The Role of the Smc5/6 Complex in the Papillomavirus Replication Cycle

The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters

Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:40050117

Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA

A dissertation presented

Peris Bentley

The Division of Medical Sciences

in partial fulfillment of the requirements

for the degree of

Doctor of Philosophy

in the subject of

Virology

Harvard University

Cambridge, Massachusetts

May 2018

Dissertation Advisor: Dr. Peter Howley Peris Bentley

The Role of the Smc5/6 Complex in the Papillomavirus Replication Cycle

Abstract

Papillomaviruses cause proliferative epithelial lesions and the high-risk subtypes are the causative agent of cervical cancer. These small DNA viruses largely rely on interactions with host cell machinery to complete their replication cycle. The papillomavirus E2 protein is the major replicative protein of papillomaviruses. It influences transcription of viral genes and is required for viral DNA replication and persistence of the viral genome in infected cells. Because E2 lacks enzymatic activity, many of its functions are mediated by interactions with host cell machinery. Proteomic experiments have identified an interaction of the host

Smc5/6 complex with the E2 proteins of various papillomavirus types. The Smc5/6 complex is a member of the cohesin and condensin, structural maintenance of chromosomes family of proteins and is conserved in all eukaryotes. It is activated by the DNA damage response and is essential for DNA double-strand break repair through homologous recombination. Here, I investigated the role of Smc5/6 in various E2 functions. The papillomavirus replication cycle is tightly linked to the differentiation state of the host cell, where viral DNA undergoes three modes of DNA replication. My studies confirm the interaction with E2 and suggest that

Smc5/6 may play different roles in the different types of viral DNA replication. Experiments utilizing a cell line derived from a cervical intraepithelial neoplasia, harboring episomal copies of high-risk HPV31b DNA, indicate that the Smc5/6 complex is required for maintenance of viral episomes in host cells. This suggests a possible mechanism by which E2 ensures long-term persistence of HPV.

iii

ACKNOWLEDGEMENTS

I would like to thank the following:

My advisor, Dr. Peter Howley, for his invaluable mentorship throughout the years of my

doctoral study. Without his guidance and support this work would not have been possible.

Past and present members of the Howley laboratory, who have created an enjoyable and

supportive lab environment. I would like to thank Elizabeth, in particular, for always being

willing to provide valuable advice on my project.

Alison McBride and the McBride laboratory for their collaboration on confocal microscopy

experiments and for being great hosts during my visit to the NIAID.

My dissertation advisory committee members: Dr. James DeCaprio, Dr. Karl Munger, and

Dr. Wade Harper, for all of their insightful comments, constructive critiques, and their

guidance throughout my graduate career.

My exam committee members: David Knipe, Ken Kaye, and Jianxin You.

Funding from the National Institute of Health, Ruth L. Kirschstein Individual Predoctoral

Fellowship.

The Harvard Virology Program.

My larger support network of family and friends, both in Boston and in California, for your

endless patience and encouragement throughout my career as a lifelong student.

TABLE OF CONTENTS

ACKNOWLEDGEMENTS ...... iv

LIST OF FIGURES ...... viii

LIST OF TABLES ...... x

FREQUENTLY USED ABBREVIATIONS ...... xi

...... 1

INTRODUCTION ...... 1

1.1 TUMOR VIRUSES ...... 2

1.2 PAPILLOMAVIRUSES ...... 3

1.3 PAPILLOMAVIRUS DNA REPLICATION ...... 12

1.4 THE PAPILLOMAVIRUS E2 PROTEIN ...... 16

1.5 THE STRUCTURAL MAINTENANCE OF CHROMOSOMES (SMC)

PROTEINS ...... 19

1.6 Smc5/6 – E2: EVIDENCE FOR AN INTERACTION ...... 27

1.7 DISSERTATION OVERVIEW ...... 30

...... 32

Validation and characterization of the Smc5/6 – E2 interaction ...... 32

ABSTRACT ...... 34

2.1 The Smc5/6-E2 interaction is conserved among PVs ...... 35

2.2 Smc6 shRNA and siRNA studies ...... 36

2.3 E2 interacts with Smc5 in the presence of Smc6 ...... 39

2.4 Smc6 interacts with full-length E2 ...... 41

2.5 Brd4 pulls-down Smc6 only in the presence of the Papillomavirus E2 protein ... 43

2.6 Brd4 and Smc6 interact with E2 independently ...... 45

2.7 The E2-Smc6 interaction may not be enhanced by the cellular DNA damage

response or keratinocyte differentiation ...... 47

2.8 Smc5/6-E2 interaction in the presence of a viral ORI containing plasmid ...... 50

2.9 Smc5/6 localizes to Papillomavirus Replication Centers ...... 52

2.10 Discussion ...... 62

2.11 Materials and Methods ...... 65

...... 72

Smc5/6 is not required for the transactivation function of E2 ...... 72

ABSTRACT ...... 74

3.1 Smc6 co-localizes with ND10 components in HPV-positive cells ...... 75

3.2 Smc5/6 is not required for E2-mediated transactivation of a reporter gene ...... 81

3.3 Smc5/6 does not influence transcription of viral genes during the maintenance or

vegetative phases of the viral life cycle ...... 84

3.4 Discussion ...... 87

3.5 Materials and Methods ...... 89

...... 93

Assessing the role of Smc5/6 in different phases of papillomavirus DNA replication...... 93

ABSTRACT ...... 95

4.1 Smc5/6 is not required for E1/E2-mediated transient DNA replication ...... 96

4.2 Smc5/6 may not be required for differentiation-dependent amplification of viral

DNA…...... 100

4.3 Smc5/6 may influence maintenance of viral episomes ...... 104

4.4 Discussion ...... 114

4.5 Materials and Methods ...... 119

...... 126

Perspectives and Future Directions ...... 126

References ...... 151

vii

LIST OF FIGURES

Figure 1.1 Classification of Human Papillomavirus types ...... 5

Figure 1.2 The papillomavirus genome ...... 8

Figure 1.3 The papillomavirus life cycle ...... 9

Figure 1.4 Papillomavirus DNA replication cycle ...... 15

Figure 1.5 The HPV16 E2 protein...... 17

Figure 1.6 Architecture of the structural maintenance of chromosome (SMC) family of proteins ...... 21

Figure 1.7 Models for Smc5/6 functions ...... 24

Figure 1.8 Identification of Smc5/6 components as HCIPs of BPV1 E2...... 29

Figure 2.1 Smc6 interacts with E2 ...... 36

Figure 2.2 Smc6 RNA interference in C33A cells ...... 38

Figure 2.3 HPV8 and HPV18 E2 interact with Smc6 and SMC5 ...... 40

Figure 2.4 Interaction of Smc6 with E2 isoforms ...... 42

Figure 2.5 Brd4 interacts with Smc6 in the presence of E2...... 44

Figure 2.6 Smc6 interacts with E2 independently of Brd4 ...... 46

Figure 2.7 DNA damage and keratinocyte differentiation do not enhance the E2 – Smc6 interaction ...... 49

Figure 2.8 Presence of the viral ori does not influence the Smc6-E2 interaction ...... 51

Figure 2.9 Smc5/6 components co-localize with RPA in HPV-positive cells ...... 54

Figure 2.10 Smc6 co-localizes with RPA foci in HPV-positive cells...... 55

Figure 2.11 Smc6 is present at PV replication foci ...... 58

Figure 2.12 Smc5 is present at PV replication foci ...... 59

viii

Figure 3.1 Co-localization of Smc6 and PML in CIN612-9E cells ...... 78

Figure 3.2 p-H2AX and Daxx co-localize in HPV-positive cells in the presence of Smc5/6 79

Figure 3.3 Smc5/6 does not influence E2-mediated transactivation of a reporter gene ...... 82

Figure 3.4 Smc5/6 does not influence transcription of viral genes...... 85

Figure 3.5 Viral gene expression is not altered after long-term knockdown of Smc6 ...... 86

Figure 4.1 E1/E2-mediated DNA replication may be enhanced in the absence of Smc6 ...... 98

Figure 4.2 Densitometric quantification of E1/E2-mediated DNA replication ...... 99

Figure 4.3 The influence of Smc5/6 knockdown on vegetative amplification of viral DNA and episome maintenance ...... 102

Figure 4.4 Smc5/6 influences the maintenance of monomeric episomes in CIN612-9E cells

...... 106

Figure 4.5 Viral DNA was reduced in a Smc6 knockdown CIN612 cell line ...... 109

Figure 4.6 Analysis of HPV31 DNA in CIN612 cells transduced with Smc6 shRNA #5. .. 112

Figure 5.1 Host factors present in HPV replication centers ...... 135

Figure 5.2 Maintenance of viral DNA in the absence of FANCD2 and TRF2 ...... 139

Figure 5.3 Model for the role of Smc5/6 in the HPV episome maintenance ...... 146

LIST OF TABLES

Table 2.1 Fraction of nuclei RPA foci positive for an Smc5/6 component ...... 56

Table 2.2 Fraction of HPV31 DNA foci positive for an Smc5/6 component ...... 61

Table 2.3 Plasmids used in Chapter 2 ...... 67

Table 2.4 Smc6 siRNA sequences used in this study ...... 68

Table 2.5 List of lentiviral shRNA constructs...... 70

Table 3.1 Plasmids used in Chapter 3 ...... 90

Table 4.1 Plasmids used in Chapter 4 ...... 119

FREQUENTLY USED ABBREVIATIONS

ALT – alternative lengthening of telomeres APB – ALT-associated PML body ATM – Ataxia telangiectasia mutated ATP – Adenosine triphosphate ATR – ataxia telangiectasia and Rad3-related serine/threonine kinase ATRX – Alpha thalassemia/mental retardation syndrome X-linked BPV – Bovine papillomavirus BPV1 – Bovine papillomavirus, type 1 BRD4 – Bromodomain-containing protein 4 CHIP – chromatin immunoprecipitation CIN1 – Cervical intraepithelial neoplasia, grade 1 DAPI – 4'-6-diamidino-2-phenylindole DAXX – Death-domain associated protein 6 DBD – DNA-binding domain DDR – DNA damage response DSB – double-strand break E2BS – E2 binding site EBV – Epstein-Barr virus EDTA – Ethylenediaminetetraacetic acid FBS – Fetal bovine serum FISH –fluorescent in situ hybridization GFP – green fluorescent protein H2AX – H2A histone family, member X HBV – Hepatitis B virus hCMV – Human cytomegalovirus HSV – Herpes simplex virus-1 HFK – Human foreskin keratinocyte HIV – Human immunodeficiency virus HPV – Human papillomavirus HR – homologous recombination ICP – Infected cell protein IF – Immunofluorescence kbp – kilobase pair KSHV – Kaposi’s sarcoma –associated herpesvirus LCR (– Long control region MAGE – melanoma-associated antigen gene MRN – MRE11/RAD50/NBS1 NCS - Neocarzinostatin NBS1 – Nijmegen breakage syndrome protein 1 ND10 – Nuclear Domain 10 NHEJ – non-homologous end-joining NSE – non-SMC element ORF – Open reading frame PBS – Phosphate buffered saline

PCR – Polymerase chain reaction PML – promyelocytic leukemia PV – Papillomavirus RB – retinoblastoma protein QPCR – quantitative PCR RAD51 – DNA repair protein RAD51 RAD52 – DNA repair protein RAD52 rDNA – ribosomal DNA RPA – Replication Protein A RNAi – RNA interference shRNA – short hairpin RNA siRNA – small interfering RNA SMC – structural maintenance of chromosomes SDS – Sodium dodecyl sulfate Sp100 – Speckled protein of 100 kilo Daltons SCC – Squamous cell carcinoma SSC – Saline-sodium citrate buffer SUMO – Small Ubiquitin-like Modifier SV40 – Simian vacuolating virus 40 TOPBP1 – DNA topoisomerase 2-binding protein 1 TRFs – Telomeric repeat binding factors URR – Upstream regulatory region UV – ultraviolet irradiation VSV – Vesicular stomatitis virus

xii

INTRODUCTION

1.1 Tumor Viruses

1.2 Papillomaviruses

1.3 Papillomavirus DNA Replication

1.4 Roles of E2

1.5 The Structural Maintenance of Chromosomes protein family

1.6 Smc5/6 – E2: Evidence for an interaction

1.7 Dissertation Overview

1.1 TUMOR VIRUSES

Studies suggest that approximately one in five cancers are caused by an infectious agent, with approximately 15% of all cancers caused by viruses(2). These tumor viruses include various classes of RNA and DNA viruses, including Kaposi’s sarcoma-associated herpesvirus (KSHV), Epstein-Barr virus (EBV), hepatitis B and C virus, human papillomavirus (HPV), human T-cell leukemia virus 1 (HTLV1), and Merkel cell polyomavirus (MCPyV). These viruses may induce cancer through a variety of mechanisms, but they commonly occur through persistent viral infection for many years. This may be either directly, through the expression of viral oncogenes or microRNAs, or indirectly through chronic tissue injury and inflammation(3). Immunosuppression by HIV is also a significant risk factor for several cancers triggered by viruses(4). In the case of the hepatitis viruses, cancer is largely caused by chronic liver inflammation, whereas in papillomavirus- induced cancers, cells harbor a non-infectious form of the virus, capable of evading immune surveillance. The absence of infectious virions in cancers suggest that tumor induction is not a required component of the viral life cycle.

Small DNA tumor viruses make up a large fraction of oncoviruses and are generally ubiquitous. Most of the world’s population is infected with EBV. KSHV prevalence ranges from 2% in northern Europe to 82% in Congo(5). Most unvaccinated, sexually-active individuals will acquire HPV at some point during their lifetime. While infection with these viruses is often asymptomatic, they can induce cancer through direct mechanisms in which the viral genome is present in cancer cells and encodes oncogenes that induce cellular transformation. Viruses that encode proteins responsible for cancer formation, termed oncoproteins, often target the same pathways and host cell proteins. These commonly

2 targeted pathways include those that regulate the cell cycle, cell death, the DNA damage response, and cell growth. There are prophylactic treatments for many tumor viruses, however there are few treatments available to combat viruses persisting within those already infected.

1.2 PAPILLOMAVIRUSES

Papillomaviruses (PV) are a family of small DNA viruses that infect a wide spectrum of vertebrate hosts. Over 140 different types of animal papillomaviruses and 200 types of human papillomaviruses (HPV) have been identified. Millions of years of coevolution with their respective hosts has resulted in PV types with preferences for specific anatomical regions of their host. Human papillomaviruses (HPV) can be categorized as cutaneous or mucosal, and consist of 5 genera: Alpha, Beta, gamma, mu, and nu. These viruses infect the basal cells of cutaneous or mucosal squamous epithelia where they generally cause benign proliferative lesions that for some specific PVs, have a risk for malignant progression. HPVs that infect cutaneous surfaces can cause benign warts on hands or feet. Of these, the Beta genus HPVs, which include types 5 and 8, have been associated with some non-melanoma skin cancers(6). These HPVs were first identified in benign lesions and skin cancers in patients with epidermodysplasia verruciformis, a rare genetic disorder, and have also been found in squamous cell cancers in immunosuppressed individuals, such as renal transplant patients(7). The HPVs that infect mucosal surfaces are classified as high- or low-risk based on their propensity to cause cancer (Figure 1.1). Both types can cause low grade abnormalities of mucosal cells and lead to genital warts. Within the Alpha genus HPVs are the 12 types associated with anal oropharyngeal cancers and virtually all cases of cervical cancer. Among these are the common HPV types -16, -18, and -31. HPV16, in particular, is

3 responsible for most (90%) of HPV-associated oropharyngeal cancers and 50% of cervical cancers, which are the third most common cancer in women(8). HPV is the most commonly sexually transmitted infection, afflicting 50-80% of the world population and with approximately 79 million Americans currently infected with the virus (WHO/ICO

Information Centre on Human Papilloma Virus and Cervical Cancer; http://www.who.int/hpvcentre/en/). Most high-risk HPV infections are asymptomatic and cleared by the immune system within one year. However, in some cases infection may persist. This persistence of the virus after initial infection is not well understood and can lead to precancerous transformation of the host cell, often associated with the integration of the viral genome into the host chromosome. Identification of virus-host protein interactions may provide insight into the mechanisms of viral DNA persistence. This may reveal potential antiviral strategies for the millions of individuals already infected with the virus, for which vaccination might have minimal benefit.

>200 HPV TYPES

Cutaneous Mucosal Types 1, 5, 8

“high-risk” “low-risk” Benign warts Types 16, 18, Types 6, 11 hands/feet 31

Benign warts Benign warts Cancer genital genital

Anogenital Oropharyngeal

Figure 1.1 Classification of Human Papillomavirus types

Human papillomaviruses infect epithelial cells of either mucosal or cutaneous surfaces. The cutaneous and low-risk types are associated with benign warts. Among the mucosal viruses, are the high-risk HPVs, which can cause high grade abnormalities and induce various anogenital cancers or oropharyngeal cancer.

Life cycle

The papillomavirus life cycle is closely linked to host cell differentiation. During the normal tissue renewal process, some basal cells remain in the basal layer as stem cells, while others migrate towards the surface and acquire various characteristics of differentiation.

These include the synthesis of important differentiation-dependent proteins such as filagrin, involucrin, and keratins(9, 10). These cells eventually go through morphological and structural changes involving degradation of organelles and nucleus until they terminally differentiate to form the cornified surface layer of the skin. This process is regulated by calcium, where extracellular calcium and the calcium receptor initiate the intracellular signaling process that promotes keratinocyte differentiation(11). The epidermis contains a calcium gradient to promote differentiation as keratinocytes migrate through different layers of the epidermis.

Papillomavirus virions are composed of an icosahedral capsid, formed by the viral L1 and L2 proteins, enclosing a circular double-stranded DNA genome of approximately 8 kilobase pairs (kbp). The viral genome contains seven early (E) open reading frames (ORFs) and two late (L) ORFs: E1, E2, E4, E5, E6, E7, E8, L1, and L2 (Figure 1.2). They enter through microdermal abrasions in the epithelium to infect the basal layer of epithelial cells

(Figure 1.3)(12). Initial infection occurs in these undifferentiated keratinocytes which are mitotically active, and begins when the major capsid protein, L1, interacts with heparin sulfate proteoglycans at the cell surface to mediate virus entry into the host cell by endocytosis(13). The virion is trafficked to the nucleus where interaction of the L2 minor capsid protein with the viral genome facilitates its release into the nucleus(12, 14). Here, the viral E1 and E2 proteins mediate extrachromosomal establishment of the genome to a low

6 copy number. E6 and E7 are the viral oncoproteins that engage host cell proteins to affect the cell cycle, contribute to genomic instability, and inhibit cellular differentiation and apoptosis(15). This early phase of the viral life cycle promotes cell proliferation, which can result in benign warts.

Papillomaviruses take advantage of the keratinocyte differentiation process by synthesizing virions when the host cell differentiates and moves toward the surface. Here, newly synthesized virions can evade immune detection and be sloughed off with dead skin cells. This process involves high levels of viral gene expression, and viral DNA undergoes differentiation-dependent amplification to a high copy number for packaging into virions(16). This process is also commonly referred to as vegetative amplification. E4 is usually expressed as the splice variant E1^E4 and is expressed at very high levels in differentiated cells, where it is believed to disrupt the cell cycle(17). Expression of the viral late capsid proteins L1 and L2 occurs at this stage where viral genomes can be packaged into

L1/L2 capsids for production of infectious virions. The late capsid proteins form the basis of the current VLP L1 preventative vaccines and L2 multimer preventive vaccine(18-21). E6 and E7 have also been suggested as targets for therapeutic vaccines to combat HPV- associated diseases(18, 19, 21-23).

Figure 1.2 The papillomavirus genome

The papillomavirus genome begins with an upstream regulatory region (URR) (yellow) and encodes three potentially oncogenic genes (red) and two late genes (black). In addition to the

E1 protein, the E1 ORF may also be joined to a short fragment within the E4 ORF, making the E1^E4 protein (green). Alternative splicing also generates an E8^E2 protein consisting of a short N-terminal fragment of E8 fused to the C-terminal domain of E2 (blue).

Figure 1.3 The papillomavirus life cycle

Virions reach the bottom layers of skin through microtraumas and infect cells of the basal epithelium. Viral DNA replication enters various phases as the host cell differentiates: initial amplification, genome maintenance, and vegetative replication. When the infected cell reaches upper layers of the epithelium late genes will be expressed to form virions. In the case of high-risk PVs, integration of viral DNA can lead to host cell transformation where viral oncoproteins E6 and E7 are overexpressed.

The mechanism of high-risk Alpha papillomavirus oncogenesis

In the case of high-risk HPVs, the viral E6 and E7 oncogenes have oncogenic activities that are responsible for precancerous alterations in the host cell(15). These proteins initiate the process that converts normal cells to precancerous cells through suppression of cell cycle control and inhibition of apoptosis. Here, E6 hijacks the host ubiquitin ligase E6AP to induce the ubiquitin-dependent degradation of p53, thereby inhibiting apoptosis(24, 25).

E6 also activates telomerase and the myc oncogene(26-28). E7 binds and degrades the cellular Rb protein to evade cell cycle checkpoints and also targets PTPN14, which may function as a tumor suppressor, for UBR4-mediated degradation(29-31). The viral E2 protein is responsible for repression of the E6 and E7 oncogenes through the regulation of viral transcription, an action which leads to growth arrest in HPV-positive cervical cancer cells(32-34). Integration of viral DNA into host chromatin and disruption of the E2 ORF leads to constitutive expression of the viral oncogenes and the development of cervical cancer(35-38). This integration does not facilitate the production of infectious virions and thus is not advantageous to the PV life cycle. A mixture of episomal and integrated viral

DNA is the most prevalent state in cervical cancer cells, where integrated genome fragments resemble multimeric concatamers generated by E1 and E2 during the vegetative amplification stage(39).

Beta papillomaviruses and tumorigenesis

An open question in the field of papillomavirus research is the role of cutaneous

HPVs in keratinocyte carcinomas. There is growing evidence that HPVs of the Beta genus can act as co-factors in the development of basal and squamous cell carcinomas (SCC) in immunosuppressed patients or patients with epidermodysplasia verruciformis (EV). These

10 cancers usually occur on sun-exposed areas of the skin, suggesting that UV exposure also plays a role in these malignancies(7). Many Beta PVs are ubiquitous, commensal viruses, and although they are found in high prevalence in the carcinomas of immunocompromised and

EV patients, they are more difficult to detect in SCCs in the general population(6). When considering the role that Beta HPVs play in skin carcinomas, it is also important to consider that in the skin cancers of immunocompetent individuals without EV, several different types of Beta HPVs have been detected and with a very low level of viral DNA, of less than a copy per cell. Beta PVs, such as types 5 and 8, are significantly more present in actinic keratoses, the precursor to SCCs(40). Unlike Alpha PVs, integration of viral DNA is extremely rare in these types of cancers, suggesting that the mechanism of Beta PV involvement in these carcinomas is different from that of Alpha genus viruses(41). Beta E6 proteins bind to the transcriptional regulator, MAML1 to inhibit the Notch pathway(42). In squamous epithelial cells, Notch plays roles in tumor suppression and keratinocyte differentiation(6, 43, 44).

Research by Pfefferle et al (2008) indicates that HPV8 E2 can induce skin tumors in transgenic mice, with 67% of homozygous mice spontaneously developing skin lesions(45).

In addition, expression of HPV8 E2 or HPV8 E6, in rodent fibroblasts or HaCaT cells may confer anchorage-independence and the ability to grow in low-serum, which are hallmarks of cellular transformation(46). These studies suggest that the mechanisms of Beta HPV-induced cellular transformation lie in the activity of the viral E2 or E6 protein. There is evidence suggesting that Beta PV is not required for maintenance of the malignant phenotype; however, observations of productive infection in premalignant cells suggest that it may be involved in initiation of the oncogenic phenotype observed in non-melanoma skin cancers(47). Studies indicate that Beta PVs, through the ability to impair DNA repair and

11 apoptosis, act in concert with UV-radiation to induce cellular transformation(48-50). Quint et al (2015) hypothesize that in immune-suppressed individuals, instead of DNA damage caused by UV-radiation leading to apoptosis, Beta PVs prevent cell death and this leads to cancer(51). This may occur in early stages of cell transformation, with the viral genome lost as the neoplastic phenotype develops in the case of immune-competent individuals.

1.3 PAPILLOMAVIRUS DNA REPLICATION

It is generally accepted that PVs undergo three phases of DNA replication during their life cycle, which amplify viral DNA to different degrees and may require different viral protein functions and host cellular proteins. These three phases are commonly referred to as initial DNA replication (genome establishment), maintenance replication, and vegetative

(differentiation-dependent) DNA amplification (Figure 1.4). While some aspects of these processes have been described, aspects of the specific mechanisms underlying these phases of PV DNA replication need to be further defined.

Initial papillomavirus DNA amplification

Soon after infection of the basal keratinocyte, the viral E1 and E2 proteins initiate PV genome establishment in the nucleus of the host cell. This mode of replication is believed to be rapid and transient and is commonly referred to as initial PV DNA amplification(52). E1, an ATP-dependent viral helicase, is the major replicative component of the virus(53). E1 is loaded onto the origin in the URR by E2, where it forms double hexamers that encircle and unwind the DNA(53, 54). This amplifies the viral genome to a low copy number of 50 to 200 copies per cell. Several studies suggest that E1 activates a cellular DNA damage response

(DDR) and blocks the progression of S-phase, where several cellular replication and DDR components are present at viral replication foci(55). Among these are RPA (replication

12 protein A), which stabilizes single-stranded viral DNA, topoisomerase I, which relieves torsional stress, replication factor C (RFC), and Proliferating Cell Nuclear Antigen

(PCNA)(56-62). The recruitment of various cellular replication factors to PV DNA replication centers is still somewhat ambiguous.

Maintenance replication

Maintenance replication is arguably the least understood of the 3 phases of PV DNA replication. While the mechanism of the initial transient replication is believed to be conserved among PVs, the method by which PVs maintain extrachromosomal episomes and whether this mechanism is conserved among PVs is unclear(63, 64). During maintenance replication, circular viral episomes are maintained at a nearly constant copy number of 50 to

200 copies per cell throughout several cell divisions. As the host cells proceed through mitosis, the genomes are partitioned between the nuclei of two daughter cells(65).

Maintenance replication has been proposed to occur in a once per S-phase manner where it is dependent on host cell replication factors(66, 67). Alternatively, maintenance replication may not be tightly regulated and occur in a random manner, where some episomes replicate once, a few times, or not at all during S-phase(68). This mode is believed to be the manner in which BPV1 episomes are maintained, where viral DNA replicates independently of the host chromosomal DNA(69-71). However, HPV16 has been published to replicate in a once per

S-phase manner in W12 cells(66). Similar to BPV, data suggest that HPV31 replicates through a random-choice mechanism in CIN612 cells, and in the NIKS keratinocyte cell line both HPV16 and HPV31 have been found to replicate in a random manner(66). The mechanism of maintenance replication may be influenced by the levels of E1, where in the presence of high levels of the E1 protein, HPV16 replicated randomly rather than once per S-

13 phase(66). E1 is not believed to be required for maintenance, and it has been suggested to be shuttled out of the nucleus by the nuclear export receptor, CRM1 (55, 72-75). Nucleoplasmic shuttling of E1 is regulated by E1 phosphorylation and complex formation with E2, and its export to the cytoplasm may be necessary for long-term episome maintenance(76).

Vegetative (differentiation-dependent) amplification

As epithelial cells differentiate and exit the cell cycle, the virus needs to adapt a new mechanism for large scale amplification of its DNA. Fully differentiated keratinocytes are no longer mitotically active and thus the cellular oncogenes E6 and E7 foster a DNA replication- competent state within differentiated keratinocytes. This may ensure that the virus will have access to the necessary DNA replication factors for large-scale amplification. Differentiation leads to a switch in transcription of E1 and E2 from the E2-regulated early promoter to the

E2-independent late promoter(77). This results in increased levels of E1 and E2 that is believed to support amplified PV DNA replication. At this stage, E1 and E2 amplify the approximately 100 copies of the viral genome present in the cell, to hundreds or thousands of copies(68). This type of replication has been postulated to occur through either a rolling circle or recombination-dependent mechanism(64, 78).

Figure 1.4 Papillomavirus DNA replication cycle

The papillomavirus replication cycle begins with a quick initial rise in PV genomes to a low copy number. These genomes may persist during the maintenance phase for several months to years before vegetative amplification, in which genome copy number rises to hundreds or thousands of copies within the host cell.

1.4 THE PAPILLOMAVIRUS E2 PROTEIN

E2 consists of an N-terminal, transactivation domain and a C-terminal, DNA-binding domain connected by a ‘hinge’ region (Figure 1.5). The transactivation domain interacts with host chromatin and the DNA-binding domain binds to sites in the viral genome(79). The papillomavirus E2 protein plays several crucial roles in the papillomavirus life cycle, most of which lie within the realm of DNA regulation. All E2 proteins bind to a consensus palindromic DNA motif, commonly referred to as an E2-binding site (E2BS):

ACCgNNNNcGGT(80). Lower case letters represent nucleotides that are preferred but not required for recognition by E2. Viral DNA contains multiple E2BSs in the long control region (LCR) upstream of viral genes. E2BSs in the LCR enable an E2 interaction with viral

DNA so that E2 may execute functions in DNA replication, maintenance, and regulation of viral gene transcription(81). The LCR also contains a promoter and enhancer that can drive

E6 and E7 expression.

Figure 1.5 The HPV16 E2 protein.

The full length E2 protein is composed of an N-terminal DNA transactivation domain and a

C-terminal DNA-binding domain which are connected by a flexible hinge region. The transactivation domain is required for the transcriptional activities of E2 and binding to E1 and Brd4. The DNA-binding domain contains sites for DNA-binding and dimerization of E2.

Roles in Transcription

Early gene transcription is modulated by E2 to regulate E6 and E7 expression. E2- mediated repression or activation of transcription can occur through the recruitment of various cellular proteins and may be partially regulated by E2 levels, where low levels activate and high levels repress transcription(82). Bromodomain protein 4 (Brd4) is a major interacting partner of E2 and is required for E2-mediated transcriptional activation and has also been implicated in transcription repression(83). The mechanisms of these processes are not well understood and research suggests that other cellular factors are involved(32, 84, 85).

Maintenance and genome partitioning

E2 binding sites in the viral genome are required for genome segregation. Brd4 is a major cellular interacting partner of E2 proteins of all PV types. However, the strengths of

Brd4-E2 binding and the functions of this interaction vary among PV species. It is required for the transactivation functions of all E2 types; however, it is only required for the tethering function of a subset of papillomaviruses: HPV1, ROPV (rabbit oral), and those of the Delta genus, including BPV(86). Here, a Brd4-E2 interaction tethers the viral genome to host chromatin for equal partitioning of viral genomes into daughter cells. For these particular

PVs, E2 associates with various parts of mitotic chromatin and Brd4 is required for this association(86, 87). In the case of Alpha PV E2s, including -16, -31, -18, and -11, the Brd4 interaction was not required for chromosome association(86). Two E2 binding sites in the

HPV18 genome are required for genome segregation and maintenance, and duplication or triplication of these site increases E2 binding and E2-dependent segregation(88). Removal of these sites disabled segregation, confirming that in the case of high-risk HPVs, E2 is required for genome maintenance, although the E2 – Brd4 interaction is not(88). ChlR1 interacts with

HPV11, -16, and BPV1 E2 and has been indicated to be required for loading of HPV11 and

BPV1 E2 on mitotic chromatin as well as maintenance of BPV1 genomes(89). TopBP1 has been proposed to be the mitotic tethering partner of HPV16 E2, where these two proteins co- localized on mitotic chromatin during late telophase(90, 91). Currently unknown, is the host cell tethering factor for Beta and Gamma papillomaviruses, which include the cutaneous wart-causing viruses, HPV8 and HPV5(92). The E2 proteins of these viruses display patterns of association on mitotic chromosomes distinct from other PV types. They preferentially bind pericentromeric regions and rDNA loci, and there is substantially less E2 associated with chromatin compared to E2 from the Delta genus(92). This suggests that these proteins interact with an unknown binding partner that preferentially binds to these regions during mitosis.

Replication

E2 loads the E1 helicase onto the viral origin to initiate viral DNA replication and also displaces nucleosomes from the origin to facilitate replication(93). E2 has been suggested to recruit host cell replication factors though interactions with host proteins such as

TOP1, RPA, PCNA, and DNA polymerase δ(60). E2 is required for the formation of viral

DNA replication foci where various cellular DNA damage response and replication proteins are present and viral DNA is synthesized. The formation of these foci and the exact roles of the numerous host proteins present in them is not well understood.

1.5 THE STRUCTURAL MAINTENANCE OF CHROMOSOMES (SMC)

PROTEINS

Structural maintenance of chromosomes (SMC) proteins are a family of proteins with several roles in chromosome structure and maintenance. The SMC family is conserved in

19 eukaryotes and consists of three major complexes: cohesin (Smc1/3), condensin (Smc2/4), and the unnamed Smc5/6 complex. Their similar ring structures and similar functions support an evolutionary connection between the three complexes. SMC complexes are characterized by a ring shape, which is believed to enable topological entrapment of DNA, where DNA strands are contained within the SMC ring (Figure 1.6). The individual SMC components are long polypeptides of 1000 to 1300 amino acids that are equidistantly folded at a ‘hinge’ domain (Figure 1.6)(94). On either side of the hinge are long coiled structures that are joined by globular, DNA-binding domains at the N and C terminus and have ATPase activity and are connected by a kleisin subunit. The other components that make up the SMC complexes are referred to as non-SMC elements (NSEs). Unlike those of cohesin and condensin, the

NSE proteins of the Smc5/6 complex have enzymatic activities, which support functions beyond maintenance of chromosome architecture(95).

The SMC complexes have distinct and overlapping roles, which they are thought to execute by functioning as inter- and intra-molecular DNA linkers(96). Condensin is required for compaction of chromosomes by forming loops within a single chromosome(97). Cohesin is largely known for its role in sister chromatid cohesion, where it holds together sister chromatids produced during S-phase(98). Smc5/6 is primarily viewed as a DNA repair complex. However, cohesin and condensin also have roles in DNA repair and cohesin also functions in chromosome condensation(97). Cohesin is also required for homologous recombination (HR) mediated double-strand break repair and can influence promoter- enhancer interactions of CCCTC-binding factor (CTCF)(99).

Condensin Cohesin Smc5/6 Hinge

Figure 1.6 Architecture of the structural maintenance of chromosome (SMC) family of proteins

The SMC protein family consists of cohesin (Smc1/3), condensin (Smc2/4), and Smc5/6.

Each complex contains an SMC heterodimer which are joined at the N and C termini by a kleisin subunit and various other non-SMC elements.

Smc5/6

In addition to the main heterodimer proteins, Smc5 and Smc6, four non-SMC elements termed NSE1, NSE2, NSE3, and NSE4 make up the Smc5/6 complex. Yeast contain two additional components termed NSE5 and NSE6(100). Human NSE1 contains a

RING-like domain that is required for the formation of the NSE1-3-4 sub-complex and has been shown to be required for the DDR in yeast(101). NSE3, also known as MAGEG1, is the founding member of the MAGE (melanoma-associated antigen) protein family, which are a class of proteins linked to cell cycle regulation and apoptosis(102). The C-terminal domain of

NSE3 interacts with the kleisin subunit, NSE4 (103). Together, the NSE1-3-4 sub-complex bridges the Smc5 and Smc6 head domains. NSE2, also referred to as MMS21, binds directly to Smc5 and is an E3 SUMO ligase that is also required for DNA damage repair but is not required for stability of the complex(104). It SUMOylates numerous proteins including members of the Shelterin complex and alternative lengthening of telomeres (ALT) pathway in humans, and can also autoregulate itself through self-SUMOylation (105, 106). Unlike many other E3 ligases, MMS21 does not have a DNA-binding domain and docking onto the intact Smc5/6 complex allows for MMS21-dependent sumoylation that is controlled by

Smc5/6 ATPase activity(107).

Role of Smc5/6 in DNA repair and genome stability

Similar to cohesin and condensin, Smc5/6 functions in chromosome dynamics and stability, and although it is a repressor of hepatitis B virus transcription, it is primarily viewed as a DNA repair factor(108, 109). Smc5/6 plays roles in the cellular DNA damage response, where it is required for homologous recombination and the rescue of collapsed replication forks. Mutations in various subunits of Smc5/6 in yeast display sister chromatid

22 homologous recombination (HR) defects and chromosomal rearrangements, suggesting that it functions in HR-mediated DNA repair and genome maintenance and stability(110-114).

Additionally, Smc5/6 was only present at double-stranded DNA breaks in G2/M phases when sister chromatids are present(115-117). Smc5/6 mutants are hypersensitive to DNA damaging agents such as methylmethanosulfate (MMS), hydroxyurea (HU), and UV radiation(101, 118, 119). HU treatment results in Smc5/6 enrichment at collapsed and stalled replication forks and HO endonuclease treatment induces localization of Smc5/6 to double- strand DNA breaks(120, 121). Several studies have identified its crucial role in homologous recombination (HR) in organisms other than yeast, where Smc5/6 deficient cells of various organisms had defects in sister chromatid HR(102, 118, 122-125). Current models suggest that Smc5/6 facilitates HR by holding sister chromatids or broken DNA ends together for double-strand break repair, and loading DSB repair factors RPA, Smc1/3, and Rad52 onto stalled replication forks (Figure 1.7)(125, 126).

Figure 1.7 Models for Smc5/6 functions

(A) Smc5/6 is also required for resolving of collapsed or stalled replication forks where it keeps the stalled fork in a recombination-competent conformation. (B) Smc5/6 mediates double-strand break repair by joining together sister chromatids for homologous recombination. It is involved in the recruitment of HR machinery such as Smc1/3, Rad52, and

RPA.

Figure 1.7 (Continued)

A Keeps stalled

replication forks

B primed for restart Double-strand break repair by homologous recombination

Chromosomal association of Smc5/6

Most research on Smc5/6 has been done in yeast as a model system. In the absence of

DNA damage, in fission yeast, Smc5/6 is localized throughout chromosomes; however, in budding yeast it is localized at intergenic regions(117, 121). It has also been found to be highly enriched at centromeres during G2/M phase in budding yeast and during S phase in fission yeast. Smc5/6 binds to telomeres and ribosomal DNA (rDNA) repeats in both types of yeast, where it facilitates segregation of these repetitive DNA elements (117, 120). These results suggest that in these organisms, Smc5/6 is enriched at sites in DNA that are prone to stalling or collapse of replication forks.

In non-DNA-damaged human cells, immunofluorescence studies indicate that Smc6 is evenly distributed throughout the nucleus but excluded from nucleoli(127). During mitosis,

Smc6 was excluded from condensed mitotic chromosomes and dispersed throughout the rest of the cell after breakdown of the nuclear envelope(127, 128). Staining with an antibody specific to the phosphorylated form of Smc6 revealed that it is enriched at nuclear speckles(127). These nuclear speckles are interchromatin granule clusters which are enriched for pre-mRNA splicing factors.

Smc5/6 transcripts are present at low levels in various human tissues including the heart, brain, skeletal muscle, ovary, prostate, and colon(127). However, the Smc6 transcript is extremely upregulated in the testis. This supports a role for Smc5/6 in cells that undergo meiosis, where Smc5/6 may prevent inappropriate recombination intermediates and coordinate proper chromosome segregation.

In addition to its enrichment on the telomeres of both budding and fission yeast, which is enhanced by DNA damage, Smc5/6 is enriched at telomeres in certain types of

26 cancer cells(129, 130). Some cancer cell lines use a telomere homologous recombination- based mechanism for elongating telomeres rather than telomerase. These are termed alternative lengthening of telomere (ALT) cancer cells. A study on human Smc5/6 found that it localizes to promyelocytic leukemia protein (PML) bodies in ALT cells which are recruited to telomeres(130). Here, the MMS21 component of the complex SUMOylates numerous telomere binding proteins for formation of ALT-associated PML bodies and telomere elongation through an HR mechanism.

1.6 Smc5/6 – E2: EVIDENCE FOR AN INTERACTION

Evidence for an interaction between the papillomavirus E2 protein and the human

Smc5/6 complex was first published in 2006 by Wu et al, where Brd4, SMC5, and Smc6 were identified by mass spectrometry as interactors of HPV11 E2(131). Additionally, proteomic experiments by the McBride laboratory suggest an interaction of Smc5 and Smc6 with the E2 proteins of BPV, HPV8, CPV2, CPV1, HPV1, SfPV1, HPV11, MmPV1,

HPV18, HPV16, and HPV31(132). These experiments suggest that the interaction is conserved among PVs. A mass spectrometry-based proteomics approach and immunoprecipitation-immunoblotting experiments by previous members of the Howley lab

(A. Tan, G. Zheng, S. Kunhle, C. Lange), suggest that Smc5/6 interacts with the E2 proteins of BPV1 and HPV16 (1). A similar proteomics pipeline was previously used to define the interaction proteome of HPV E6 and E7 proteins(133, 134). The cell line, 293T, stably expressing hemagglutinin (HA)–tagged BPV1 E2, E2TR, or E8E2C proteins were used as the starting material in immunoprecipitation (IP) experiments and HA immunoprecipitations recovered the E2 bait proteins and any associated cellular proteins. The E2-protein complexes were analyzed by liquid chromatography-tandem mass spectrometry (LC-

MS/MS) and statistical analysis using CompPASS software to identify high-confidence interacting proteins (HCIPs) as having an NWD (normalized weighted D) score greater than

1(135). This score uses abundance, detection frequency, and reproducibility to quantify enrichment of each protein compared to unrelated IP-MS datasets(135). Smc6 and Smc5 were identified as HCIPs of BPV1 E2, with scores of 3.9 and 1.84, respectively (Figure 1.8).

Other components of the complex identified in these proteomics experiments were MMS21 and NSE1; however, their NWD scores were less than 1 and did not suggest that they are E2

HCIPs (Figure 1.8)(1).

E2 HCIP NWD Score Brd4 4.54 Smc6 3.9

Smc5 1.84

MMS21 .25 NSE1 .21

Figure 1.8 Identification of Smc5/6 components as HCIPs of BPV1 E2.

Proteomics experiments identified Smc6 and Smc5 as high-confidence interacting proteins of

BPV1 E2(1). Colors represent the NWD-score of each co-immunoprecipitated component detected by mass spectrometry in 293T cells. An NWD ≥ 1 signifies a high-confidence interaction with BPV1 E2.

1.7 DISSERTATION OVERVIEW

E2 plays several roles in the viral life cycle but lacks enzymatic activity; therefore, it is plausible that host-protein interactions facilitate many of its functions. Several E2- interacting proteins have been identified among the various PV types. Among these are proteins involved in nuclear import, protein degradation, transcriptional regulation, RNA processing, apoptosis, and cell cycle control(132, 136). These studies collectively suggest that up to 100 proteins make up the E2 proteome. Many of these proteins have been identified by mass spectrometry-based proteomics or yeast two hybrid analysis but have not been thoroughly validated or characterized. Here, I confirmed and validated the interaction of

Smc6 and Smc5 with E2, an interaction which has previously been identified in multiple proteomic screens. Several of my own co-immunoprecipitation experiments confirmed the interactions of Smc6 and Smc5 with papillomavirus E2 proteins of the Alpha, Beta, and

Delta genera, suggesting that it is conserved among PVs. The Brd4 – Smc6 interaction only occurred in the presence of the E2 protein, and depletion of Brd4 did not influence the Smc6

– E2 interaction, indicating that Brd4 does not mediate the binding of E2 to Smc6. The presence of the NSE4, SMC5, and Smc6 components at PV DNA replication centers confirms the interaction and suggests the possibility that this complex may play some role in transcription or replication of viral DNA, processes that both involve the E2 protein.

Smc5/6 is a multifunctional protein complex with several established roles in the maintenance of genome stability and has been described as a viral restriction factor(108). In addressing potential roles for Smc5/6 in the PV life cycle, I considered these well-established roles for the complex in the host cell and in the context of viral infection. Smc5/6 is a core component of the cellular DNA damage and homologous recombination pathways and

30 represses transcription of hepatitis B (HBV) viral genes in concert with ND10 bodies(137,

138). I found that similar to HBV-infected cells, Smc5/6 co-localizes with ND10 components in HPV-infected cells and may influence the presence of ND10 components at viral replication foci. However, unlike the ND10 protein, Sp100, Smc6 did not significantly influence late gene expression in differentiated HPV31-positive cells. It remains to be determined whether Smc5/6 influences early gene expression of incoming PV DNA.

I also investigated the role of Smc5/6 in different types of PV DNA replication. These studies suggest that Smc5/6 is not required for initial or differentiation-dependent amplification of viral DNA replication; however, depletion of Smc6 resulted in loss of monomeric episomes in cells stably maintaining HPV31 episomes. Taken together, these data suggest that Smc5/6 may function differently in different phases of the viral life cycle or only in maintenance.

The persistence of high-risk papillomaviruses after initial infection can lead to integration and precancerous transformation of the host cell. The study of virus-host protein interactions of the viral E2 protein may provide insight into the mechanism of viral DNA maintenance. While the exact mechanism of PV DNA persistence is poorly understood, many studies have suggested that there is a requirement for particular cellular factors in the

DDR, HR, and telomere maintenance pathways, all of which require Smc5/6(139-143). Here,

I have identified Smc5/6 as an additional factor that influences the persistence of high-risk

PV episomes in infected cells. Further understanding of the mechanism of high-risk PV episome persistence may reveal potential antiviral strategies for individuals already infected with HPV.

Validation and characterization of the Smc5/6 – E2 interaction

2.1 The Smc5/6-E2 interaction is conserved among PVs

2.2 Smc6 RNA interference

2.3 E2 interacts with Smc5 in the presence of Smc6

2.4 Smc6 interacts with full-length E2

2.5 Brd4 pulls-down Smc6 only in the presence of the Papillomavirus E2 protein

2.6 Brd4 and Smc6 interact with E2 independently

2.7 The E2-Smc6 interaction may not be influenced by the cellular DDR or

differentiation-state

2.8 Smc5/6-E2 interaction in the presence of a plasmid containing the viral origin

2.9 Smc5/6 localizes to Papillomavirus replication centers

2.10 Discussion

2.11 Materials and Methods

ACKNOWLEDGEMENTS

Work described in this chapter has been submitted for publication. I performed all experiments described, however, immunofluorescence experiments were performed in collaboration with Alison McBride and her laboratory at the NIH: National Institute of

Allergy and Infectious Diseases, and some images were captured by Alison McBride. N-

Tert1 HPV18 E7 and E2 cell lines and pozn-E2 constructs were made by Elizabeth White. I also thank Alison McBride for pMEP4-E2 constructs.

ABSTRACT

Several mass spectrometry-based proteomics studies have identified an interaction of the papillomavirus E2 protein with Smc5 and Smc6, core components of the Smc5/6 complex. Here, I validated this interaction using an immunoprecipitation – western blot approach for various PV E2 types. The E2 – Smc5 interaction only occurred in the presence of Smc6. Consistent with unpublished proteomics experiments by S. Kunhle of the Howley lab, E2 was required for an interaction of Brd4 with Smc6. Brd4 knockdown, however, did not influence the E2 – Smc6 interaction and Smc6 depletion did not influence the Brd4 – E2 interaction. In addition, the DNA damage response, keratinocyte differentiation, and the presence of a plasmid containing the PV origin of replication did not influence the E2 –

Smc6 interaction. Immunofluorescence microscopy coupled with fluorescent in situ hybridization confirmed the presence of Smc5/6 components at viral DNA replication foci.

2.1 The Smc5/6-E2 interaction is conserved among PVs

I first aimed to validate the interaction of Smc6 and Smc5 with papillomavirus E2 proteins. In investigating the role of an E2 – Smc5/6 interaction, it is important to consider that the interactions of other PV proteins, such as E6 vary by PV type, where Beta PV E6s interact with MAML1 and Alpha PV E6s interact with E6AP(42, 144, 145). Thus, in characterizing an E2-host protein interaction it is worth determining whether the interaction is conserved among PVs or specific to a PV type. Prior proteomic studies suggested that the

E2 interaction with Smc5/6 may be conserved among PV genera, where Smc6 and Smc5 interacted with BPV1, HPV8, HPV11, and HPV31 E2 proteins, among several others(131,

132). To validate the interaction, C33A cells were transfected with a construct expressing an

E2 protein belonging to the Alpha, Beta, or Delta genus. Co-immunoprecipitation of E2 and western blotting showed pull-down of Smc6 with the Alpha papillomavirus HPV6b E2 and

HPV18 E2, the Beta papillomavirus HPV5 and -8 E2 proteins, as well as with the Delta

BPV1 E2 (Figure 2.1). HPV16 E1 and E6 did not pull-down Smc6, indicating an interaction specific for E2 proteins. Unlike other E2 proteins, which were expressed in a pozN vector, expression of HPV16 E2 and HPV31 E2 could only be visualized by western blotting when expressed from the cadmium-inducible pMEP4 vector. Immunoprecipitation of these proteins indicated that HPV16 and 31 could pull down both Smc6 and the previously confirmed interactor, Brd4, as a positive control (Figure 2.1C).These experiments also suggested that E2 does not influence Smc6 levels (Figure 2.1B-C).

B C

(E2)

Figure 2.1 Smc6 interacts with E2

(A) C33A cells were transfected with plasmid encoding HA-tagged HPV18, -5, or BPV1 E2, or with HPV16 E1. HA-tagged proteins were immunoprecipitated, and bound proteins were visualized by western blot. Blotting for actin was used to control for loading. (B) C33A cells were transfected with HA-tagged HPV6b, -18, -5, -8, or BPV1 E2, or with HPV16 E6. E2- protein complexes were immunoprecipitated from cell lysates overnight and visualized by western blotting. (C) C33A cells transfected with E2 inducibly expressed from a pMEP4 plasmid. Cells were treated with 2µM cadmium chloride for 5 hours to induce E2 expression before immunoprecipitation and western blotting. 36

2.2 Smc6 shRNA and siRNA studies

For subsequent experiments examining the E2 – Smc5/6 interaction and its potential roles in the PV life cycle, RNA interference was used for targeted depletion of Smc6. siRNAs targeting Smc6 were transfected into C33A cells, and their effectiveness was compared by western blotting (Figure 2.2A). Smc6 depletion at 48, 72, 96, and 120 hours post transfection with siRNA was analyzed by western blot, and optimal knockdown was achieved at 72 to 96 hours after transfection (Figure 2.2B). Smc6 shRNAs were also compared in C33A cells. Cell lines were generated by lentiviral transduction with shRNA targeting Smc6 or GFP as a negative control. Of the eleven shRNAs tested, those labeled numbers 1, 2, and 5 yielded the best knock-down of Smc6, as visualized by western blot

(Figure 2.2C,D). Densitometric analysis of multiple experiments in C33A cells indicated that shRNA #1 yields a ~90% knockdown of Smc6 and #2 and #5, a knockdown of approximately 50% (Figure 2.2D). Smc6 shRNAs #1, 2, and 5 and Smc6 siRNA #11 were used for subsequent experiments.

A B

Figure 2.2 Smc6 RNA interference in C33A cells

(A) Smc6 siRNA-mediated knock-down in C33A cells at 72 hpt. ‘Ctrl’ signifies control siRNA as a negative control and ‘Glo’ denotes siGlo, which was used to measure transfection efficiency. (B) Smc6 levels at various timepoints post transduction with either control siRNA or Smc6 siRNA #11. (C) Western blot showing shRNA-mediated knockdown of Smc6 in C33A cells. (D) Quantification of Smc6 by densitometry in C33A cell lines. Data is normalized to alpha-tubulin expression. n=3.

2.3 E2 interacts with Smc5 in the presence of Smc6

To determine whether the Smc6 component was required for the Smc5 – E2 interaction, C33A cell lines were transfected with siRNA targeting Smc6. E2 and interacting proteins were then co-immunoprecipitated from the cell lysates and subjected to western blot with antibodies to the indicated proteins (Figure 2.3). The E2 – Brd4 interaction was uninfluenced by reduction of Smc6 while the Smc5 – E2 interaction was not detected in cells containing Smc6 siRNA (Figure 2.3). It is important to note that knock-down of Smc6 also resulted in decreased levels of the Smc5 protein. Analysis of the siRNA target sequence revealed no potential target sites in SMC5, suggesting that knock-down of Smc6 destabilizes the Smc5/6 complex. This trend has been observed in several previous studies(108, 128, 130,

146, 147). Additional experiments using a proteosomal inhibitor may confirm that Smc5 is targeted for proteosomal degradation when Smc6 is not expressed. Because Smc5 levels were reduced with loss of Smc6, we cannot conclude that Smc6 is required for the E2 –

Smc5 interaction. However, pull-down of Smc5 by HPV8 and -18 E2 confirmed the E2 interaction with Smc5 (Figure 2.3).

Co-immunoprecipitation of NSE4 and MMS21 with E2 was inconsistent (data not shown). This may reflect the low NWD scores of these as E2 interactors in multiple proteomics experiments, and also the fact that components other than Smc5 and Smc6 have not been reported as interactors by other groups (Figure 1.8) (1, 131, 132).

Figure 2.3 HPV8 and HPV18 E2 interact with Smc6 and SMC5

Western blot for E2-protein complexes in the presence of Smc6 siRNA or a control siRNA. C33A cells stably expressing flag-tagged HPV E2 or GFP as a negative control were transfected with Smc6 siRNA or control siRNA. At three days post-transfection, cells were lysed and subject to immunoprecipitation of flag-tagged E2 or GFP proteins. siRNA-mediated knockdown and co-immunoprecipitation of Brd4, Smc6, and Smc5 were assessed by immunoblotting. ‘HC’ signifies the heavy chain.

2.4 Smc6 interacts with full-length E2

The full length E2 protein is between 350 and 500 amino acid residues. It consists of an N-terminal transactivation domain and a C-terminal DNA-binding domain connected by a

‘hinge’ region (Figure 2.4A). Many PVs encode a shorter isoform containing a short exon from E8, connected to a major splice acceptor in the middle of the E2 ORF, termed

E8E2(148). E8E2 represses transcription and viral DNA replication, and this activity may be important for preventing runaway replication during initial PV infection(149, 150). BPV1 encodes a second repressor protein that is initiated from an internal promoter in the E2 ORF, and referred to as E2TR(151). Depletion of this isoform has been shown to increase genome copy number, suggesting that it also functions as a repressor of viral DNA replication(149,

152). All three isoforms, E2, E2TR, and E8E2, are expressed in BPV-1 infected cells, but at a ratio of 1:10:3, respectively(151). Proteomics experiments performed by Alvin Tan of the

Howley lab identified Smc6 and Smc5 as HCIPs of BPV1 E2 but not the E2TR and E8E2 isoforms(1). To validate this result, I transfected plasmid encoding tagged versions of each isoform into C33A cells. Tagged E2 proteins were immunoprecipitated from lysed cells, and an interaction with Smc6 was visualized by western blot. Immunoblotting confirmed the interaction with BPV1 E2, but did not support an interaction with the other two isoforms

(Figure 2.4B).

kDa:

Figure 2.4 Interaction of Smc6 with E2 isoforms

(A) Diagram of BPV1 isoforms E2, E8E2, and E2TR. (B) Plasmids encoding HA-tagged

BPV1 E2, E2TR, or E8E2c constructs were transfected into C33A cells. At 48hpt, co- immunoprecipitation and western blotting were used to determine which E2 isoforms bound to Smc6.

2.5 Brd4 pulls-down Smc6 only in the presence of the Papillomavirus E2 protein

The interaction of papillomavirus E2 proteins with Brd4 has been well characterized.

Brd4 is required for the transactivation activity of E2 proteins, and this interaction mediates tethering of Delta PV genomes to mitotic chromatin for genome maintenance(83, 87). Co- immunoprecipitation-mass spectrometry experiments performed by S. Kunhle of the Howley lab indicated that HA-tagged human Brd4 protein pulls down Smc5 and Smc6 in the presence of the papillomavirus E2 protein, but does not interact with Smc5/6 in the absence of E2 or in the presence of other viral proteins including LANA1 of KSHV, EBNA1 of EBV, and large T Antigen of SV40 (unpublished). Proteomics experiments for BPV1 E2 yielded

NWD scores for Smc6 and Smc5 at 3.9 and 1.84 respectively, where a score greater than one indicates an HCIP. Similarly, proteomics for Brd4 in the presence of BPV1 E2 yielded NWD scores of 3.85 and 2.22 for Smc6 and SMC5, respectively. To validate these proteomics experiments, I transfected 293T cells stably expressing BPV E2, or BPV E7 as a negative control, with V5-tagged Brd4, or V5-tagged CNOT6 or HMG1A as negative controls. Cells were then lysed for co-immunoprecipitation for V5-associated proteins. The Brd4-Smc6 interaction was assessed by western blotting. Brd4 only pulled-down Smc6 in the presence of

BPV E2 (Figure 2.5), indicating that Brd4, E2, and Smc5/6 can exist in a single multi-protein complex, and Brd4 and Smc6 do not interact in the absence of PV E2. This indicated that

Brd4 does not mediate the binding of E2 to Smc6.

kDa:

Figure 2.5 Brd4 interacts with Smc6 in the presence of E2

The 293T cell lines stably expressing HA-tagged BPV1 proteins (E2 or E7) were cotransfected with V5-tagged Brd4 or negative controls, CNOT6 or HMG1A. This was followed by immunoprecipitation of V5-tagged proteins and subsequent immunoblotting with antibodies for Smc6 or HA.

2.6 Brd4 and Smc6 interact with E2 independently

I then sought to determine whether the Brd4-E2 interaction is required for an Smc5/6 interaction and vice versa. C33A cells stably expressing flag-tagged HPV18 E2, HPV8 E2, or

GFP as a negative control, underwent siRNA-mediated knockdown of Smc6 or Brd4. Co- immunoprecipitation of the flag-tagged E2 or GFP and western blotting of E2 associated proteins revealed that loss of Brd4 did not greatly influence the Smc5/6-E2 interaction, and loss of Smc6 did not influence the Brd4-E2 interaction (Figure 2.6). This argued that the

Brd4 – E2 interaction is independent of the Smc6 – E2 interaction and vice versa.

IP: Flag WB: Smc6

Figure 2.6 Smc6 interacts with E2 independently of Brd4

C33A cells stably expressing flag-tagged HPV8 E2 or HPV18 E2 were transfected with siRNA targeting Brd4 or Smc6. Pull-down of flag-tagged proteins and subsequent immunoblotting was used to assess the effect of knock-down on E2 interactions.

2.7 The E2-Smc6 interaction may not be enhanced by the cellular DNA damage response or keratinocyte differentiation

E2 may be one of the only viral proteins that is expressed throughout the viral replication cycle, and thus E2-host interactions may vary during different steps. Because the

PV life cycle is tightly linked to the differentiation-state of the host cell, with E2 performing different functions during different stages, it is conceivable that E2-host protein interactions are influenced by the host cell environment, where a state of differentiation leads to a preferential set of host interactions. To determine whether the host cell differentiation state influences the interaction of E2 with Smc6, N-Tert1 cells, a cell line of hTERT-immortalized keratinocytes, was transduced with retrovirus vectors to stably express HPV18E2 or E7 as a negative control(153). Cells were grown to confluence and induced to differentiate by 1.5 mM CaCl2 treatment for 72 hours. Immunoprecipitation of E2 and western blotting for Smc6 indicated that pull-down of Smc6 was not enhanced by keratinocyte differentiation (Figure

2.7A). This suggested that the Smc6 – E2 interaction may not be amplified during late stages of the viral life cycle when the host cell is differentiated.

E1 stimulates a DNA damage response (DDR) in cells and most studies investigating

E2-host protein interactions have not taken into account additional interactions that may occur in differentiated cells or in cells in which the DNA damage protein network is activated(55). Smc5/6 is a core member of the DDR, and although its protein levels are not altered by DNA damage, its nuclear localization is modulated by double strand breaks

(DSBs) and DDR activation (121, 129, 154, 155). Thus it is possible that the E2-Smc5/6 interaction may be influenced by the DDR. To address the possibility that E2 may interact with host cell proteins activated in the DNA damage pathway, I sought to mimic the DNA

47 damage induced by E1. N-Tert1 cells stably expressing HPV18 E2 were treated with DNA- damaging agent neocarzinostatin (NCS). NCS is a protein-small molecule complex that induces DSBs in DNA. To determine whether DNA damage might influence an interaction with Smc6, N-tert1 cells stably expressing HA-tagged 18E2 were treated with 100ng/ml of

NCS for four hours and E2-protein complexes were immunoprecipitated overnight. An increase in P53 levels in NCS treated cells indicated that the DNA damage response was activated in response to NCS treatment (Figure 2.7B). Western blotting indicated that NCS treatment did not influence the Smc6-E2 interaction (Figure 2.7B). This suggested that although a significant portion of Smc5/6 activities are modulated by the host DDR, DNA damage does not influence its interaction with E2.

A B

Figure 2.7 DNA damage and keratinocyte differentiation do not enhance the E2 – Smc6 interaction

(A) N-Tert1 cells stably expressing HA-tagged HPV18 E2 or E7 were grown to confluence in DFK medium and treated with 1.5 mM CaCl2 for 72 hours. The Smc6-E2 interaction was then assessed by immunoprecipitation and western blotting. Blotting for involucrin was used as a marker for differentiation. (B) N-Tert1 cells stably expressing HPV18 E2 or E7 were treated with 100 ng/ml NCS for 4 hours. Pull-down of HA-tagged proteins and subsequent immunoblotting were used to assess the Smc6-E2 interaction. Blotting for p53 was used as an indicator of induction of the DNA damage response.

2.8 Smc5/6-E2 interaction in the presence of a viral ORI containing plasmid

A study by Kanno et al (2015) indicates that Smc5/6 can bind to small, circular DNA, regardless of size or sequence and also directly stimulates catenation of relaxed plasmid

DNA(96). This study suggested that Smc5/6 has a similar affinity for linear and nicked plasmids irrespective of their supercoiled state. The interaction of this complex with plasmid

DNA is believed to occur through entrapment of DNA within the SMC rings. CHIP experiments from another group suggest that Smc5/6 binds directly to hepatitis B episomal

DNA to repress viral gene transcription(108). Thus, it is possible that Smc5/6 binds directly to PV episomal DNA. To address this, cells expressing HPV18 E2 were transfected with a plasmid containing the HPV18 ori. This plasmid contains E2 binding sites and thus I sought to determine whether the Smc6-E2 interaction might be enhanced in the presence of this plasmid. Immunoprecipitation-western blotting suggested that the presence of a plasmid containing the viral ori did not significantly influence the E2-Smc6 interaction (Figure 2.8).

This suggested that the E2 – Smc5/6 interaction may be independent of viral DNA. CHIP experiments assessing the interaction of Smc5/6 with HPV31 DNA are currently in progress.

Figure 2.8 Presence of the viral ori does not influence the Smc6-E2 interaction

C33A cells stably expressing flag-tagged HPV18 E2 or flag-tagged GFP as a negative control were transfected with 200 ng of a plasmid containing the HPV18 E2 ori. Cells were lysed and flag-tagged proteins were immunoprecipitated, and Smc6 was visualized by western blotting.

2.9 Smc5/6 localizes to Papillomavirus Replication Centers

E2 is required for the formation of viral DNA replication foci in differentiated cells where various cellular DNA damage response and replication proteins are present and where viral DNA is replicated(55). Replication Protein A (RPA) is among the numerous components of the DDR that have been shown previously to be recruited to viral replication foci(55, 73, 156, 157). RPA is required for the repair of double-strand breaks where it binds to single-stranded DNA and facilitates homologous recombination(158, 159). We sought to determine whether the localization of Smc5/6 is altered in HPV-positive cells, using RPA as a marker for viral replication centers. Immunofluorescence was used to examine the localization of Smc5/6 components SMC5, Smc6, and NSE4 in differentiated cells of the

HPV31-positive cell line, CIN612-9E. CIN612-9E is a cervical squamous intraepithelial neoplasia 1 (CIN1) cell line that harbors episomal copies of HPV31 genomes(160). Here,

Smc6, SMC5, and NSE4 co-localized with RPA in differentiated CIN612 cells; however, this co-localization was not observed in differentiated HPV-negative NIKS cells, a spontaneously immortalized human keratinocyte cell line(161) (Figure 2.9-2.10). This suggested that

Smc5/6 localization was altered in HPV-positive cells and may be present in viral replication compartments.

In CIN612 cells, RPA was observed to localize in numerous, small foci with a radius less than 800nm each, few foci (1-10) of 800nm to 1500nm each, or a singular large foci with a radius greater than 1500nm (Figure 2.10). In some cases, cells with a large foci contained a medium-sized satellite focus. Similar phenotypes have been reported in this cell line previously(162). These were termed small, medium, and large foci, respectively. The significance of foci size in this cell line is not well understood but it has been postulated that

52 they may represent different replication states of viral DNA, where large foci represent large replication compartments where viral DNA is being actively synthesized. Among three biological replicates with five different antibodies for various Smc5/6 components, most cells containing RPA foci were positive for Smc5/6 (Table 2.1). Among the nuclei containing small RPA foci, 11.5% were positive for an Smc5/6 component, 33.3% of nuclei with medium RPA foci were Smc5/6 positive, and 87.2% of nuclei containing large RPA foci were Smc5/6 positive. This suggested that Smc5/6 has a propensity for large HPV replication compartments.

Figure 2.9 Smc5/6 components co-localize with RPA in HPV-positive cells

HPV-negative NIKS cells and the HPV31-positive cell line CIN612-9E were grown on coverslips, fixed and permeabilized for analysis by confocal microscopy. Cells underwent 5 days of differentiation in 1.5mM calcium medium. Blue represents nuclear DAPI staining.

Samples were stained with(A) anti-Smc6 (green), and anti-RPA (red) antibodies; or (B) anti-

NSE4 (green) and anti-RPA (red).

Figure 2.10 Smc6 co-localizes with RPA foci in HPV-positive cells.

HPV-negative NIKS cells and the HPV31-positive cell line CIN612-9E were grown on coverslips, fixed and permeabilized for analysis by immunofluorescence. Both cell lines were differentiated for 5 days in high calcium medium. Blue represents nuclear DAPI staining.

Samples were stained with (A) anti-Smc6 (green), and anti-RPA (red) antibodies.

Table 2.1 Fraction of nuclei RPA foci positive for an Smc5/6 component

Co-localization of Smc5/6 components with RPA in CIN612-9E cells among multiple replicates with various antibodies. “Small” denotes cells with at least ten RPA foci with a radius less than 800 nm. “Medium” denotes cells with one to ten RPA foci with a radius greater than 800 nm. “Large” signifies cells with an RPA focus with a radius larger than 1.5

µM.

Antibody Small Medium Large Smc6 2/4 3/5 12/14 Smc5 1/20 4/11 19/20 NSE4 0/2 2/11 3/5 Total 3/26 9/27 34/39 Percentage 11.5% 33.3% 87.2%

Because Smc5/6 is required for loading of RPA onto stalled replication forks in host

DNA, it is plausible that the observed RPA-Smc5/6 co-localization is unrelated to PV infection of these cells(120). Therefore, to determine whether Smc5/6 is localized at viral

DNA, fluorescent in-situ hybridization with a probe targeting HPV31 was used to visualize viral DNA in CIN612 cells. Here, Smc5 and Smc6 both co-localized with viral DNA

(Figures 2.11-2.12). Three-dimensional rendering of z-stack images throughout the nuclei confirmed that Smc6 is present within viral DNA foci (Figures 2.11-2.12). Similar to the trend observed with RPA, most HPV replication foci observed were positive for Smc5 or

Smc6, and of these Smc5/6-positive foci, with Smc5/6 most prominently observed at large replication foci (Table 2.2). This suggested that Smc5/6 localizes to a distinct type of viral replication center that is relatively large in size.

Figure 2.11 Smc6 is present at PV replication foci

Fluorescent in situ hybridization (FISH) was used to detect HPV31 DNA (green) in calcium- differentiated CIN612-9E cells. Anti-Smc6 was used to visualize Smc6 (red) localization. Z- stack images of the nucleus were collected, deconvolved, and a 3D reconstruction was generated in IMARIS. Blue indicates nuclear DAPI staining.

Figure 2.12 Smc5 is present at PV replication foci

FISH detected HPV31 DNA (green) in calcium-differentiated CIN612-9E cells. Anti-Smc5 was used to visualize Smc5 (red) localization. Z-stack images of the nucleus were collected, deconvolved, and a 3D reconstruction was generated in IMARIS. Blue indicates nuclear

DAPI staining.

Figure 2.12 (Continued)

Table 2.2 Fraction of HPV31 DNA foci positive for an Smc5/6 component

Co-localization of Smc5/6 components with HPV DNA, visualized by FISH in CIN612-9E cells among multiple replicates with various antibodies. “Small” signifies cells with at least ten HPV replication foci with a radius less than 800 nm. “Medium” denotes cells with one to ten HPV DNA foci with a radius greater than 800 nm. “Large” signifies cells with one or two HPV DNA foci with a radius larger than 1.5 µM.

Antibody Small Medium Large Smc6 0/1 2/3 6/7 Smc5 0/2 0/3 4/4 Total 0/3 2/6 10/11 Percentage 0% 33.3% 90%

2.10 Discussion

Several proteomic studies have identified an interaction between components of the human Smc5/6 complex and the E2 proteins of various PV types. Most of these experiments have been done in the human 293T cell line, a line of human kidney cells that were immortalized by adenovirus 5 EE1A and also express SV40 large T antigen. Here, I have confirmed the Smc6 – E2 interaction through immunoprecipitation experiments in the cervical cancer cell line, C33A, and in N-tert1 cells, a line of human keratinocytes immortalized by hTERT. These experiments indicate that the Smc5/6 complex interacts with the E2 proteins of HPV6b, -18, -5, -8, -16, -31, and BPV1. Co-localization with HPV31 replication foci also supports an interaction between HPV31 E2 and Smc5/6. Taken together with previous studies, these results suggest that the E2 – Smc5/6 interaction is conserved among PVs. It is worth noting that pull-down of other Smc5/6 components, such as NSE4 was inconsistent and not observed in proteomics experiments. One possibility is that E2 interacts with Smc5 and Smc6 at their head domains and displaces the connective NSE4 component. However, IF experiments suggest that NSE4 may be present at viral replication compartments. To address this, the E2 interaction should be mapped to particular domains of

Smc6 or Smc5. In considering the domain of E2 that Smc6 binds to, the observation that

Smc6 pulls down with full-length E2 and not E2TR and E8E2, suggested that Smc5/6 is not linked to the repressor functions of the E2TR and E8E2 isoforms.

Brd4 is a well-studied interactor of E2. Unpublished proteomics studies by members of the Howley lab suggest that Brd4 interacts with Smc6 only in the presence of E2. These experiments have been confirmed in this work, where Brd4 pulled down Smc6 in the presence of E2 and not E7, suggesting that E2 may be bridging the interaction between host

62 proteins that do not normally interact. While data presented in this chapter suggests that Brd4 and Smc6 interact with E2 independently of each other, Smc6 may be required for the Smc5

– E2 interaction. Consistently higher NWD scores for Smc6 in proteomics studies suggest that the direct interaction with the Smc5/6 complex is most likely between Smc6 and E2. A significant challenge to confirming this through immunoprecipitation-western blotting experiments is the destabilization of the entire complex when Smc6 levels are reduced.

Further work should be done to map the Smc6 interaction to specific residues on the E2 protein, and gel filtration experiments can confirm the presence of other Smc5/6 components in the same complex with E2.

It is possible that PV proteins have a set of interactors that are dependent on the state of the host cell. Papillomaviruses stimulate a DNA damage response in host cells, and the PV replication cycle progresses as the host cell differentiates. Although it is a core component of the DDR and HR pathways, Smc5/6 has been found to be constitutively expressed in all human tissues studied regardless of DNA damage, although its expression is greater in rapidly proliferating cells and cells that undergo meiosis(127). Here, data suggest that the robustness of the E2 – Smc6 interaction is not influenced by activation of the cellular DNA damage response or keratinocyte differentiation. This supports a model for a static interaction that is consistent throughout the PV replication cycle whether E1 has initiated the DDR or the host keratinocyte has differentiated. This is precedent for investigating the influence of an

Smc5/6 – E2 interaction throughout the various phases of the viral life cycle.

In considering functions of the Smc5/6 – E2 interaction in the viral life cycle, it is worth noting that while Smc5/6 components were present at viral replication foci, the majority of these were large foci. Whether cells with numerous small or a single large foci

63 represent different viral replication states, in which different host factors are recruited, is unclear. It has been suggested that there are different types of PV DNA foci in CIN612 cells at different stages of the viral life cycle, where FANCD2 is present at replication foci during maintenance but not differentiation-dependent amplification, and p-Smc1 is present during differentiation-dependent amplification but not maintenance(140). One possibility is that large foci represent viral replication centers in which viral DNA is replicating through a recombination-mediated mechanism, which may require the presence of the HR complex,

Smc5/6. The formation of head-to-tail concatameric forms of viral DNA as well as integration of viral DNA into host chromatin has been proposed to occur through a recombination-mediated process(163, 164). The size of the large DNA foci, as visualized by

FISH, may be due to vegetative amplification and the resulting oligomerization of viral DNA that occurs during keratinocyte differentiation, and Smc5/6 may be required for these processes. Smc5/6 is well documented to not only interact with DNA but also function in recruiting HR factors such as RPA and Smc1 to collapsed replication forks and double-strand

DNA breaks(125, 126). An interaction with E2 may facilitate recruitment of host cell replication factors to viral genomes.

These IF-FISH experiments were performed in calcium-differentiated cells and thus are representative of later stages of the viral replication cycle. Experiments assessing Smc5/6

– E2 co-localization with E2 and viral DNA in undifferentiated and mitotic cells should be performed to confirm the interaction during other stages of the PV life cycle and determine whether the complex might influence tethering to mitotic chromatin.

2.11 Materials and Methods

Plasmids

To generate the pHAGE lentiviral expression vectors used in the proteomics studies,

BPV1 E2 and E2TR were PCR-amplified from a BPV1 genomic plasmid and E8/E2C was

PCR amplified from the pE8E2 plasmid and cloned into the lentiviral vector using Gateway cloning (Invitrogen)(149, 165). Human papillomavirus E2 ORFs were generated by PCR and cloned into pDONR223 as described(134, 166, 167). Following sequence verification, the E2 coding sequences were subcloned into the pOZ-N-HA-PURO vector using the XhoI and NotI sites. Plasmids are listed in Table 2.3. HPV16 E6 and E1 have been previously described(133, 168).

Cell lines

C33A and 293T cells were maintained according to standard protocols in Dulbecco- modified Eagle medium (DMEM) (Invitrogen) supplemented with 10% (v/v) fetal bovine serum (FBS) (HyClone) and 1% penicillin-streptomycin (Gibco/Invitrogen). To generate

C33A and 293T cells lines stably expressing E2 or negative controls, the retrovirus producer cell line 293-Phoenix, was co-transfected with the retroviral vector containing E2, and gag- pol and VSV-G expression vectors. The media was changed the next day with media for the target cells. The virus supernatant was collected 48 hours post transfection and filtered through a 0.45 µM filter. Cells were then infected using a standard protocol and began selection with 0.75 µM/mL puromycin the next day. Culture methods for the N-Tert1 cell line have been described previously(153, 169). NTert1 cells were grown in K-SFM, keratinocyte serum-free medium (GIBCO, Catalog #17005-042), and refed every two days.

For the immunofluorescence and FISH experiments, CIN612-9E and NIKS cells were cultured in F medium with 3T3-J2 fibroblast feeders, as described previously(170, 171).

Immunoprecipitation-Western blotting

pOZ-N-HA-PURO-E2 or negative control constructs were transfected into C33A cells in 10 cm plates using Fugene 6. Cells were harvested 72 hours post transfection and lysed in MCLB, and the resulting lysate was sonicated and clarified by centrifugation. Anti-

HA magnetic beads (Pierce 88836) were used to elute HA-tagged proteins and their binding partners at 4oC overnight. Bound proteins were eluted by boiling in reducing sample buffer for 5 minutes before western blotting with the indicated antibodies. The following primary antibodies were used for western blotting: actin-HRP (Abcam, 49900), Smc6 (Abgent,

AT3956a), rabbit anti-Smc6 (Bethyl A300-237-T), anti-Smc5 (Abcam 18038), Alpha-tubulin

(Sigma, T6199), Brd4 (Bethyl Laboratories, A301-985A50), anti-flag (Sigma, F3165), anti-

HA-HRP (Roche, 12013819001).

RNA Interference

For siRNA-immunoprecipitation experiments, 1.5 x 105 C33A cells were transfected with 40nM of siRNA (Dharmacon) using 5 µl of Dharmafect 2 according to the manufacturer’s instructions. siRNA sequences are listed in Table 2.4. The medium was replaced 24 hours after transfection. Cells were harvested 96 hours post transfection and lysed in MCLB. The lysate was then sonicated, clarified by centrifugation, and subject to immunoprecipitation overnight at 4oC with anti-FLAG M2 Magnetic beads (Sigma M8823) before boiling in reducing sample buffer to elute bound proteins.

Table 2.3 Plasmids used in Chapter 2 Howley lab plasmid Tag # Plasmid name Gene Promoter Tag location 7211 pHAGE-N-HA-BPV1-E2 BPV1 E2 CMVt HA N BPV1 7212 pHAGE-N-HA-BPV1-E2TR CMVt HA N E2TR BPV1 7214 pHAGE-N-HA-BPV1-E8/E2 CMVt HA N E8/E2 pOZ-N puro HA only empty 7269 none LTR n/a N vector 6976 pOZ-N puro HA-HPV6b E2 HPV6b E6 LTR HA N 6869 pOZ-N puro HA-HPV18 E2 HPV18E2 LTR HA N 6980 pOZ-N puro HA-HPV5 E2 HPV5 E2 LTR HA N 6981 pOZ-N puro HA-HPV8 E2 HPV8 E2 LTR HA N 6989 pOZ-N puro HA-BPV1 E2 BPV1 E2 LTR HA N 3X phage-CMV-N-FLAG (3X)- 7959 GFP CMV FLAG- N HA-GFP HA 3X phage-CMV-N-FLAG (3X)- 7960 HPV8 E2 CMV FLAG- N HA-HPV8 E2 HA 3X phage-CMV-N-FLAG (3X)- 7961 HPV18E2 CMV FLAG- N HA-HPV18 E2 HA 7010 MSCV-IP N-V5 CNOT6 CNOT6 LTR V5 N Brd4-V5 MSCV-P C-FlagHA 18E7- Flag, 6641 HPV18 E7 MSCV LTR C Kozak HA 6861 pE1-HA HPV16 HPV16 E1 CMV HA N 7962 pMEP4 vector Flag, 7963 pMEP4.flag.HA 16 E2 HPV16 E2 Metallothionein N HA HPV 31 Flag, 7964 pMEP4.flag.HA 31 E2 Metallothionein N E2 HA

Table 2.4 Smc6 siRNA sequences used in this study siRNA Sequence (5’3’) #9 AGAAAUAGAUAAUGCGGUU #10 GGACAAAGAAAUUAAUCGA #11 CAGCAUAGAUGGAAGUCGA #12 CUUUAAAGCCAGUGUGUAU

Lentiviral knockdowns

All shRNAs used in this study were contained within a pLKO.1-PURO vector

(Sigma, DF/HCC DNA Resource Core). Transfection of the shRNA construct (2µg) and lentivirus packaging plasmids (0.5µg each) into 293T cells produced lentivirus particles.

Twenty-four hours later the media was changed to that specific for the target cells, and the virus-producing cells were allowed to grow for another 24 hours. The virus supernatant was then collected and filtered through a 0.45 µM filter. C33A cells were lentivirally transduced with control or Smc6 shRNA. shRNAs used in this study are described in Table 2.5.

Table 2.5 List of lentiviral shRNA constructs. CDS, coding sequence. UTR, untranslated region shRNA Plasmid Target Sequence (5’3’) Control 30323 (Addgene) GFP GCAAGCTGACCCTGAAGTTCAT CCGGTATCTTGATCTGGATAGTAA TRCN000021994 Smc6 #1 Smc6 CDS ACTCGAGTTTACTATCCAGATCAA 9 GATATTTTTTG CCGGGCCATCAGAGATAATATCA TRCN000018323 Smc6 #2 Smc6 CDS AACTCGAGTTTGATATTATCTCTG 1 ATGGCTTTTTTG TRCN000011321 Smc6 #3 Smc6 CDS GCCTTTAATGACGCTGAGGTT 6 TRCN000011321 Smc6 #4 Smc6 CDS CCTACCTTGATCTGGATAATA 5 CCGGACCTCACGGCCACCGATAA TRCN000043775 Smc6 #5 Smc6 CDS TACTCGAGTATTATCGGTGGCCGT 5 GAGGTTTTTTTG CCGGCATAGAGACAGTGCTACTA TRCN000043469 Smc6 #6 Smc6 CDS ATCTCGAGATTAGTAGCACTGTCT 2 CTATGTTTTTTG CCGGGGTTGTGGCAAATAGCCTA TRCN000042741 Smc6 #7 Smc6 CDS ATCTCGAGATTAGGCTATTTGCCA 7 CAACCTTTTTTG CCGGTATCTTGATCTGGATAGTAA TRCN000041910 Smc6 #8 Smc6 CDS ACTCGAGTTTACTATCCAGATCAA 8 GATATTTTTTG CCGGAGATGGAAGTCGATCTTAT TRCN000041908 Smc6 #9 Smc6 CDS AACTCGAGTTATAAGATCGACTTC 0 CATCTTTTTTTG CCGGGCATCAATTCTGGACAAAG TRCN000018362 Smc6 #10 Smc6 CDS AACTCGAGTTCTTTGTCCAGAATT 7 GATGCTTTTTTG CCGGCCTGGATGAATTTGATGTCT TRCN000018288 Smc6 #11 Smc6 CDS ACTCGAGTAGACATCAAATTCATC 9 CAGGTTTTTTG CCGGCACCCTACCAAGAGCTTATA TRCN000021995 Smc6 #12 Smc6 3 UTR ACTCGAGTTATAAGCTCTTGGTAG 0 GGTGTTTTTG

Immunofluorescence and FISH

CIN612-9E cells were seeded on 18mm glass coverslips and grown to confluence prior to differentiation in KGM media (Lonza) with 1.5mM calcium chloride for 5 days.

Cells were fixed, blocked, and permeabilized using previously described methods(162).

Coverslips were incubated in primary antibodies at 37 degrees for 1 hour. Primary antibodies used were mouse anti-Smc6L1 (Abgent AT3955a, 1:500), rabbit anti-Smc5 (Abcam 18038,

1:100; Bethyl A300-236A-T, 1:100), rabbit anti-Smc6 (Bethyl A300-237-T, 1:100), rabbit anti-NSE4A (Abgent AP9909a, 1:100), rat anti-RPA (Cell Signaling 2208, 1:200).

Coverslips were washed and incubated in secondary antibodies (1:50), Alexa 488 and Alexa

594, at 37 degrees for 30 minutes.

FISH probe for HPV 31 was generated using the ULysis Nucleic Acid Labeling kit or

FISH-tag multicolor kit (Thermo Life Technologies). Following primary incubation, coverslips were fixed in methanol:acetic acid (3:1) for 10 minutes, followed by 2% paraformaldehyde for 1 minute. Coverslips were washed and treated with 1X RNace-It cocktail (Stratagene) and washed in phosphate-buffered saline (PBS) and ethanol as described(162). After air drying for 1 hour, each coverslip was incubated in 75ng of FISH probe with Cot-1 DNA (Invitrogen) and Hybridization Buffer (Empire Genomics) at 75 degrees for 5 minutes followed by 37 degrees overnight. Cells were washed, stained with

DAPI, and mounted using Prolong® Gold antifade reagent (Life Technologies). Images were captured with a 60x objective lens using a Leica TCS-SP5 laser scanning confocal microscope.

Smc5/6 is not required for the transactivation function of E2

3.1 Smc6 co-localizes with ND10 components in HPV-positive cells

3.2 Smc5/6 is not required for transactivation of an E2 reporter gene

3.3 Smc5/6 does not influence transcription of viral genes during the maintenance or

vegetative phases of the viral life cycle

3.4 Discussion

3.5 Materials and Methods

ACKNOWLEDGEMENTS

Work described in this chapter has been submitted for publication. I performed all experiments described.

ABSTRACT

Having validated the Smc5/6 – E2 interaction and confirmed the presence of Smc5/6 components at PV replication foci, I then sought to determine potential roles for the host complex in the PV life cycle. Based on documented roles of Smc5/6 in HBV infection, I postulated that Smc5/6 might execute a similar function in the PV replication cycle(108, 109,

138, 146, 172). Similar to HBV-infected hepatocytes, Smc5/6 co-localizes with ND10 factors in HPV-positive cells. ND10 components, Sp100 and PML have been reported to localize to

PV replication centers, and here I found that death-domain associated protein (Daxx) is also present and its localization to PV replication foci may be influenced by Smc5/6(162, 173).

To further investigate whether Smc5/6, plays a similar role in PV infection, I determined the influence of Smc6 knockdown on E2-mediated transactivation of a reporter gene and transcription of early, intermediate, and late viral genes. Smc5/6 did not significantly influence maintenance or late viral gene transcription, suggesting diverging roles of this host complex in hepatitis B virus and HPV infection.

3.1 Smc6 co-localizes with ND10 components in HPV-positive cells

Similar to papillomaviruses, hepatitis B virus (HBV) DNA persists as extrachromosomal DNA in infected cells(174-176). Analogous to the PV E2 protein, the

HBx regulatory protein, HBx promotes transcription of viral genes from circular extrachromosomal genomes(177). In the context of viral infection, Smc5/6 has been found to be an intrinsic antiviral factor of HBV, where it associates with extrachromosomal reporters and the HBV genome to inhibit transcription(108). This is counteracted by an interaction with the viral HBx protein which targets Smc6 for degradation through the DDB1-E3 ubiquitin ligase(146, 172). Smc5/6 has altered nuclear distribution in HBV-infected hepatocytes where it co-localizes with the HBV surface antigen, HBV core, and the ND10 components PML and Sp100(138). PML, Sp100, and Daxx are core components of ND10 bodies and have been implicated in several cellular pathways (Figure 3.1A). These include transcription, DNA replication and repair, cell cycle, signaling, the antiviral response, and telomere maintenance(178-180). Depletion of Smc6 was shown to increase HBV transcription, and knockdown of ND10 components results in altered localization of Smc6 and enhanced HBV transcription(108, 138, 181, 182). These studies suggest that Smc5/6 and

ND10 components act in concert to localize to HBV episomes and repress transcription.

In papillomavirus-infected cells, ND10 components also co-localize with HPV replication foci(162, 183, 184). Here, Sp100 represses viral transcription and replication soon after initial infection (162, 183, 185). However, these studies indicate Sp100 does not influence viral infection during the genome maintenance phase. Given that both Smc5/6 and

ND10 machinery have both been identified at viral replication centers in differentiated

CIN612-9E cells, it is plausible that the relationship between these host proteins in PV

75 infected cells is similar to that in HBV infection. Thus, I aimed to determine whether Smc5/6 and ND10 machinery co-localize in HPV-infected cells and whether Smc5/6 also acts in concert with ND10 machinery as a host restriction factor of papillomaviruses. I performed immunofluorescence microscopy experiments with U2OS cells as a positive control for PML

– Smc6 co-localization. Smc5/6 co-localizes with PML in the alternative lengthening of telomere (ALT) cell line, U2OS, to promote the formation of ALT-PML bodies (APB) for telomere elongation(130). U2OS and CIN612 cells were plated on coverslips, fixed in 4% formaldehyde and stained for Smc6 and PML. Immunofluorescence experiments suggested that Smc5/6 and PML co-localize in the nuclei of both U2OS and CIN612 cells (Figure 3.1).

Phospho-H2AX (pH2AX), containing a phosphorylation at serine position 139, has been documented to associate with 94 to 100% of HPV DNA foci in both undifferentiated and differentiated CIN612 cells, and has been used in previous studies as a marker for PV replication factories(99, 157). Using immunofluorescence confocal microscopy, I visualized co-localization of ND10 machinery with pH2AX. The most prominent and consistent trend that I observed in undifferentiated CIN612 cells, was co-localization of ND10 component,

Daxx, and pH2AX in numerous small foci in CIN612 cells (Figure 3.2A). While Sp100 and

PML have been reported at HPV31 foci in differentiated CIN612 cells, studies addressing

Daxx localization have not yet been published(162). To determine whether Smc5/6 influences localization of these proteins in HPV-positive cells, CIN612 cells were transduced to express either control shRNA (shGFP) or shRNA targeting Smc5 (Figure 3.2B). Due to difficulties with Smc5 antibody, immunoblotting for Smc6 was used to confirm the effectiveness of the shRNA. There was a consistent difference in the amount of pH2AX and

Daxx foci between these two cell lines. Daxx and pH2AX co-localized in the control cell line

76 but not in the Smc5/6 knockdown cell line (Figure 3.2B). To my knowledge, the only reported co-localization of these two proteins has been in DNA damaged ovarian cancer cells(186). It is also important to consider that ND10 proteins have been published to have different roles in PV transcription, where PML siRNA reduces, Sp100 siRNA enhances, and

Daxx has no influence on early viral gene transcription(162). Taken together, these results suggested that similar to HBV-infected cells, Smc6 co-localizes with ND10 machinery and may influence the localization of ND10 components in virus-infected cells.

Figure 3.1 Co-localization of Smc6 and PML in CIN612-9E cells

(A) Diagram showing the proteins that make up ND10 machinery. (B) Co-localization of

PML (green) with Smc6 (red) in U2OS and CIN612-9E cells. Blue represents nuclear DAPI staining.

Figure 3.2 p-H2AX and Daxx co-localize in HPV-positive cells in the presence of

Smc5/6

(A) Co-localization of Daxx (red) and pH2AX (green) in CIN612-9E cells. Nuclei are stained blue. (B) CIN612-9E cells were lentivirally transduced with either GFP shRNA or increasing amounts of Smc5 shRNA-lentivirus. (Top) Western blot showing Smc6 knockdown in the CIN612 shRNA cell lines 5dpt. The antibody used here produces an unspecific band just below Smc6. These cells were plated on coverslips for analysis by confocal immunofluorescence microscopy for Daxx (green) and pH2AX (red). Blue represents nuclear DAPI staining.

Figure 3.2 (Continued)

A Daxx pH2AX DAPI Overlay

3.2 Smc5/6 is not required for E2-mediated transactivation of a reporter gene

Given the role of E2 in transactivation of viral genes, and the role of Smc5/6 as a repressor of HBV transcription, I sought to determine whether Smc5/6 had similar repressive functions in papillomavirus infection. To examine whether Smc6 influences E2-dependent transcriptional activation, I tested the effect of Smc6 knockdown on E2-mediated transactivation of a reporter gene. C33A cells were transfected with either control, Brd4, or

Smc6 siRNA. Smc6 siRNA #11 (Figure 2.2A) was used for these experiments. At seventy- two hours after siRNA transfection, these cells were transfected with an E2 responsive firefly luciferase reporter plasmid (p2x2xE2BS-Luc), which contains four E2 binding sites, the E2 expression plasmid, and a renilla luciferase reporter gene(168). Either BPV1 E2 or HPV16

E2 alone enhanced luciferase expression from the reporter plasmid (Figure 3.3). The E2 transactivation function is mediated by Brd4, and consistent with previous results, depletion of Brd4 by siRNA inhibited the transcriptional activation function of E2(83). In contrast, depletion of Smc6 did not consistently have a significant effect on luciferase activity of the

E2-dependent reporter plasmid, suggesting that Smc6 is not required for E2-mediated transactivation of a reporter gene (Figure 3.3).

Figure 3.3 Smc5/6 does not influence E2-mediated transactivation of a reporter gene

(A) Schematic of the luciferase reporter construct with E2 binding sites. (B) (left) Western blot of lysates from C33A cells after transfection of siRNAs targeting Brd4 and Smc6. (right)

Firefly luciferase activity of an E2 reporter construct containing E2 binding sites normalized to renilla. The data represent the averages of three replicate experiments. (C) (left) Western blot showing Smc6 and Brd4 levels for the experiment shown below. (right) Relative light units from the E2 luciferase reporter plasmid normalized to renilla. The data represent the averages of three replicate experiments. Statistical significance was measured using a standard student’s t test. ***, P<0.0001. **, P<0.001. ns, not significant.

3.3 Smc5/6 does not influence transcription of viral genes during the maintenance or vegetative phases of the viral life cycle

Sp100 represses transcription of viral genes from incoming HPV DNA and late viral gene transcription(162, 183, 185). Given the previously established relationship between this

ND10 component and Smc5/6, I therefore next examined whether Smc5/6 had an effect on the transcription of papillomavirus genes in CIN612-9E cells. CIN612-9E cells differentiate in response to increased calcium levels(160). This differentiation results in the increased expression of cellular genes such as involucrin (Figure 3.4A) and of HPV late genes. These cells were transduced with pLKO.1 shSmc6 #1 or pLKO.1 shGFP. The levels of Smc6 RNA

(Figure 3.4A) and various viral gene RNAs were examined by qRT-PCR in both undifferentiated and calcium-differentiated CIN612-9E cells (Figure 3.4B). Although shRNA-mediated depletion of Smc6 RNA was achieved in the cells transduced with the shSmc6-expressing lentivirus, this depletion of Smc6 did not have a significant effect on the transcription of HPV genes in cells stably maintaining HPV genomes or on their differentiation-dependent induction (Figure 3.4). There were also no differences in the transcription of viral genes normally modulated by E2 (E2, E6, and E7) 4 weeks after shRNA transduction (Figure 3.5). These results suggested that Smc5/6 does not influence viral gene transcription during the maintenance and vegetative phases of the viral life cycle.

n.s. n.s.

n.s.

Figure 3.4 Smc5/6 does not influence transcription of viral genes.

(A) (left) Smc6 knock-down in undifferentiated and differentiated CIN612-9E cells was measured by qRT-PCR. (right) qRT-PCR for Involucrin RNA was used as a marker of differentiation in CIN612-9E cells. (B) Viral early (E2, E6, E7), intermediate (E1^E4), and late (L1) genes in undifferentiated cells (3 days post infection) and differentiated cells (7 days post infection) was measured by qRT-PCR. The data represents the averages of three experiments. All data is normalized to cyclophilin A. ‘n.s.’ = not significant.

Figure 3.5 Viral gene expression is not altered after long-term knockdown of Smc6

Fold change in viral gene expression from as measured by rt-qPCR in CIN612 cells at

Passage 4 (after shRNA transduction). All data is normalized to cyclophilin A. n = 4.

3.4 Discussion

After validation of the Smc6 – E2 interaction, I then sought to investigate a potential role for Smc6 in the papillomavirus life cycle. In the context of viral infection, Smc5/6, along with ND10 bodies, repress transcription of HBV genes(108). In addition, the ND10 components, PML and Sp100, are present at HPV replication centers in recent studies(162).

In the absence of viral infection, Smc5/6 co-localizes with PML in alternative-lengthening of telomere (ALT) cancer cells, where Smc5/6 is required for the formation of ALT-associated

PML bodies through the SUMOylation of telomere-binding proteins(130). My immunofluorescence microscopy experiments suggested that PML and Smc6 co-localize in

HPV-positive cells and Daxx-p-H2AX co-localization was influenced by Smc5/6. While these components act in concert to repress HBV replication, Smc5/6 and ND10 bodies may have diverging roles in the PV life cycle. Numerous host cell factors have been identified within PV replication foci, and some may have repressive functions while others are recruited to support PV DNA replication. Thus, I aimed to assess the influence of Smc5/6 on elements of the viral life cycle that are modulated by ND10 machinery.

In examining the influence of Smc6 on E2 transactivation using a luciferase reporter gene, Smc6 depletion did not consistently influence E2-mediated transactivation, suggesting that Smc5/6 may not repress E2-mediated transactivation. A caveat to these experiments is that optimal Smc6 knockdown by siRNA is achieved at 72 to 96 hours post siRNA transfection. E2 and the reporter construct were transfected 24 hours post siRNA transfection and cells were harvested 96 hours after siRNA transfection. Thus, it is possible that sufficient knockdown of Smc6 was not achieved at the initial timepoints in the experiment.

Experiments in knockout rather than knockdown cells may be optimal for determining the role of Smc5/6 in this E2 function.

Sp100 has antiviral functions in HBV, HCMV, and HSV infection(138, 187-191). In the context of papillomaviruses, Sp100 has been reported to restrict early and late PV gene transcription and has no influence on gene transcription during the maintenance phase of the

PV life cycle(162, 183). Its repressive role in PV gene transcription may be more robust during initial infection, where cells containing Sp100 siRNA have a 3- to 6-fold increase in early gene expression for cells transfected with re-circularized HPV18 DNA and an inconsistent 1.5- to 2-fold increase in late gene expression in differentiated CIN612-9E cells(173). Thus, it is possible that Smc5/6 may modulate expression of particular genes or during different phases of the viral life cycle. Examination of viral gene RNA levels in

CIN612-9E cells did not reveal a difference in gene expression in these cells when depleted of Smc6. The undifferentiated CIN612-9E cells are representative of the maintenance phase of HPV31 genomes, a phase in which Sp100 does not influence transcription(162, 183). If

Smc5/6 exerts repressive effects in concert with Sp100, as it does in HBV infection, then the phase of the viral life cycle in which Sp100 represses HPV transcription may be the same for

Smc5/6. Because Sp100’s repressive effects are more robust for incoming viral DNA, experiments should be performed examining the role of Smc6 on early gene transcription during the initial amplification phase, possibly by measuring gene transcription of incoming viral particles. Here, I’ve determined that Smc5/6 does not influence viral gene transcription during the maintenance and late phases of the viral life cycle, but whether it influences transcription during the early phases of the viral life cycle is unknown.

3.5 Materials and Methods

Immunofluorescence microscopy

CIN612 cells were plated on coverslips in E media with 3T3-J2 fibroblast feeders.

Twenty-four hours later, feeders were removed with versene and cells were washed with

PBS. Cells were fixed in 4% formaldehyde for 10 minutes at room temperature and then permeabilized in 0.1% Triton X-100 for 15 minutes. Coverslips were then incubated in 3% bovine serum albumin (BSA) in PBS for 30 minutes at room temperature before incubation in primary antibody for 30 minutes. The following primary antibodies were used for immunofluorescence studies: anti-Smc6 (1:1000, rabbit polyclonal, Bethyl A300-237-T), anti-PML (1:200, mouse monoclonal, Santa Cruz sc-966), anti-Daxx (1:200, mouse monoclonal, Abcam ab130198), anti-phospho-H2AX (1:500, Ser139, mouse monoclonal,

Millipore 05-636). Cells were then washed in PBS and incubated in secondary antibodies,

Alexa 488 and Alexa 594, at 37 degrees for 30 minutes. Coverslips were then washed and mounted using hard-set mounting media with DAPI (Vectashield). An Olympus

FLUOVIEW FV1000 confocal laser scanning microscope was used to analyze slides with a

60x objective lens. Western blotting in knockdown cells was performed with anti-Smc6

(1:1000, rabbit polyclonal, Bethyl A300-237-T).

Plasmids

The p2x2xE2BS, HPV16 E2, and p16ori plasmids have been described previously and are found in Table 3.1 (168, 192).

Table 3.1 Plasmids used in Chapter 3 Howley lab plasmid # Plasmid name Gene 3973 p2X2XE2BS-luc Luciferase 6989 pOZ-N puro HA-BPV1 E2 BPV1 E2 3662 pCMV4-HPV16-E2 HPV16

Reporter Assays

C33A cells were maintained, as previously mentioned, according to standard protocols in DMEM (Invitrogen) supplemented with 10% (v/v) FBS (HyClone) and 1% penicillin-streptomycin (Gibco/Invitrogen). 1.5 x 105 C33A cells were transfected with 40nM of siRNA using Dharmafect 2 (Dharmacon) according to the manufacturer’s protocol. After

24 hours, cells were transfected with 0.41 µg p2x2xE2BS-luc, 0.81 µg E2, and 200 ng

Renilla using Fugene 6 (Roche) at a 3:1 ratio (µl/µg DNA) according to the manufacturer’s protocol. Seventy-two hours later, cells were lysed and luciferase activity was measured using the Dual-Luciferase Reporter Assay System (Promega) and SpectraMax L

Luminescence Microplate Reader (Molecular Devices). Firefly luciferase readings were normalized to the respective Renilla readings. siRNAs were obtained from Dharmacon. The following primary antibodies were used for western blotting: Smc6 (Abgent, AT3956a),

Alpha-tubulin (Sigma, T6199), Brd4 (Bethyl Laboratories, A301-985A50).

Quantitative Real-Time PCR (Q-RT-PCR)

CIN612-9E cells were cultured in E medium with 3T3-J2 fibroblast feeders according to the protocol previously described by Fehrmann and Laimins (171). Feeders were removed using versene prior to protein, RNA, or DNA analysis of CIN612-9E cells. For calcium- induced differentiation of CIN612-9E cells, feeders were removed and cells were rinsed with phosphate-buffered saline (PBS), and cultured for 24 hours in Keratinocyte Basal Medium

(KBM; Lonza) containing SingleQuots for keratinocytes (Lonza). Cells were then rinsed with

PBS and cultured for 96 hours in KBM with 1.5mM CaCl2.

Total RNA was extracted using the Nucleospin RNA II Kit (Macherey-Nagel). RNA concentration was determined by NanoDropTM (ThermoFisher Scientific) and equivalent amounts were reverse-transcribed using the High-Capacity cDNA Reverse Transcription Kit

(Applied Biosystems). Gene expression levels were determined using primers specific for each gene and the Applied Biosystems ABI 7500 Fast Sequence Detection System and

SYBRTM Select Mastermix (ThermoFisher Scientific). Serial dilutions of a reference cDNA were used to generate a standard curve and determine relative amounts of cDNA in each sample. All data was normalized to cyclophilin A, which has been previously indicated to not vary during keratinocyte differentiation(193). Predesigned SYBR Green primers for Smc6

(H_Smc6_3), involucrin, H_IVL_1, and cyclophilin A (H_PPIA_1) were purchased from

Sigma. The following gene-specific primers were used to measure viral gene transcripts:

HPV31 E2 sense (5’-ATGGCTGATCCAGCAGGAC-3’) and antisense (5’-

CGTTGAGAAAGAGTCTCCATCG-3’), HPV31 E6 sense (5’-

AGATTGAATTGTGTCTACTGCAAAGGTGT-3’) and antisense (5’-

GCTATGCAACGTCCTGTCCACCT-3’), HPV31 E7 sense (5′-

TAGGAGGAAGGTGGACAGGA-3′) and antisense (5′-GCTGTCGGGTAATTGCTCAT-

3′), HPV31 E1^E4 sense (5’-CTACAATGGCTGATCCAGCAGCA-3’) and antisense (5’-

CGCCGCACACCTTCACTGG-3’), and L1 sense (5’-

ACACTTAAAAGATGTCTCTGTGGC-3’) and antisense (5’-

TCGTGTTACATATTCATCCGTGC-3’).

Assessing the role of Smc5/6 in different phases of papillomavirus DNA replication

4.1 Smc5/6 is not required for E1/E2-mediated transient DNA replication

4.2 Smc5/6 may not be required for differentiation-dependent amplification of viral DNA

4.3 Smc5/6 may influence maintenance of viral episomes

4.4 Discussion

4.5 Materials and Methods

ACKNOWLEDGEMENTS

Work described in this chapter has been submitted for publication. I performed all experiments described.

ABSTRACT

Smc5/6 is required for the maintenance of host genome stability through its essential

DNA repair and replication activities. Because E2 plays crucial roles in papillomavirus DNA replication during each phase of the viral replication cycle, I sought to determine whether an

Smc5/6 – E2 reaction might influence any of E2’s replication activities. Experiments assessing HPV16 E1 and E2 – mediated replication of a plasmid containing the HPV16 origin of replication may be representative of initial PV DNA replication, where there is a quick initial rise in viral copy number. Depletion of Smc6 in these experiments indicated that

E2-mediated transient replication did not require Smc6 and may be enhanced in the absence of Smc6. Southern blot analysis of the various forms of viral DNA maintained in CIN612-9E cells, suggested that Smc6 is required for maintenance replication of HPV31 monomeric episomes. Although extrachromosomal viral DNA was reduced in the absence of Smc6, differentiation-dependent amplification of viral DNA was not affected by depletion of Smc6, even after long-term knockdown. These experiments suggest different roles for Smc5/6 at various phases of the viral replication cycle.

4.1 Smc5/6 is not required for E1/E2-mediated transient DNA replication

The E2 protein has an auxiliary role in the initiation of viral DNA replication by loading the E1 helicase onto the replication origin. This type of replication may be representative of the initial genome amplification that occurs soon after infection(68). To determine whether Smc5/6 influences this function of E2, stable C33A cell lines harboring an

Smc6 shRNA or GFP shRNA, as a negative control, were generated by lentiviral transduction. Smc6 shRNAs #1 and #2 were used in Figures 4.1-4.2. These cells were co- transfected with plasmids encoding HPV16 E1, HPV16 E2, and a plasmid containing the

HPV16 origin of replication (ori). Knock-down of Smc6 was assessed by western blot

(Figure 4.1A). Replicated DNA was linearized by AccI digestion and transfected DNA was digested with Dpn1. Dpn1 cuts DNA only when it is methylated within the GATC sequence, thus distinguishing DNA grown in bacteria and transfected into eukaryotic cells, which contain this Gm6ATC methylation, from DNA replicated in the transfected cells. This Dpn1- digested DNA runs at a lower molecular weight in agarose gels. DNA was then visualized by

Southern blotting with a probe targeting the HPV16 ori. Transfection of the ori-containing plasmid and E1 in the absence of E2 confirmed that E2 is required for this DNA replication

(Figure 4.1B). Replicated DNA was observed in all experiments, both in the presence and absence of Smc6, suggesting that Smc6 is not required for this type of viral DNA replication.

In most experiments an increase in replicated DNA levels was observed in cells depleted of Smc6, suggesting that Smc5/6 may suppress this type of transient DNA replication. Densitometric analysis of Southern blots for three independent experiments indicates a 2.7 fold average increase in replicated DNA for the shRNA that yielded a ~50% knockdown in Smc6 expression (#2) and 5.1 fold average increase for the shRNA that

96 produced a ~90% knockdown in Smc6 expression (#1) (Figure 4.2). Some of the high variability observed may have been due to differences in the amount of input DNA, which was used for normalization. The increase in replicated DNA was only significant for the most effective shRNA, Smc6 shRNA #1 (Figure 4.2). This suggested that the degree by which E2- mediated replication is enhanced is dependent on the degree of Smc6 knockdown.

A B

Figure 4.1 E1/E2-mediated DNA replication may be enhanced in the absence of Smc6

(A) Western blot showing Smc6 knockdown in C33A shRNA cell lines established by lentiviral transduction of shRNA-containing constructs. (B) Cells were transfected with

HPV16 E1, E2, and a plasmid containing the HPV16 ori. Following HIRT extraction of low- molecular weight DNA, transfected DNA was digested with Dpn1 and Southern blotting with a probe specific to the HPV16 ori was used to identify replicated DNA linearized by

AccI digestion. As a marker (M), the AccI-digested p16ori plasmid was used without transfection.

Figure 4.2 Densitometric quantification of E1/E2-mediated DNA replication

(A) Quantification of Smc6 on western blots normalized to alpha-tubulin. (B) Quantification of linearized replicated DNA normalized to input Dpn1 digested DNA. n.s. = not significant.

** = p-value <0.01. *** = p-value <0.0001.

4.2 Smc5/6 may not be required for differentiation-dependent amplification of viral

DNA

Smc1 has been previously shown to be required for differentiation-dependent amplification of HPV31 DNA in CIN612 cells (99, 194). Because Smc5/6 has been shown to recruit Smc1 to damaged cellular replication forks for their repair, I next examined whether

Smc5/6 also had a role in PV differentiation-dependent replication. CIN612-9E cells were transduced with control (GFP) shRNA, or Smc6 shRNA #1 or #2 (Figure 4.8).

Undifferentiated cells were collected at 3 days post transduction (dpt), and a subset were grown to confluence in high-calcium media to induce differentiation. Cellular DNA was extracted and digested, transferred to nitrocellulose filters, and probed for HPV31 DNA.

DNA was either cut once with XbaI (a one cut for HPV31 DNA) to assess total viral DNA content, or with the BamHI enzyme (a no cut enzyme for HPV31 DNA). BamHI cleaves only the cellular DNA and thus allows for visualization of the various forms of viral DNA

(episomal, nicked, and multimeric/integrated).

Calcium treatment led to an increase in involucrin mRNA in these cells which is indicative of keratinocyte differentiation (Figure 4.3A). Smc6 shRNAs reduced levels of

Smc6 compared to control cells (Figure 4.3B). Southern blotting was used to assess the differentiation-dependent amplification of HPV31 DNA. Increased levels of episomal DNA were observed in all CIN612-9E cell lines after calcium-mediated differentiation (Figure

4.3C). This suggested that Smc5/6 was not required for differentiation-dependent amplification of viral DNA. However, a marked decrease in viral DNA, particularly for the monomeric episomal form, occurred in the undifferentiated cells at three days after shRNA transduction, suggesting a role for Smc6 in episome maintenance (Figure 4.3C). These

100 findings suggested that Smc5/6 may not be required for vegetative amplification of viral

DNA, but may influence maintenance.

101

Figure 4.3 The influence of Smc5/6 knockdown on vegetative amplification of viral

DNA and episome maintenance

CIN612-9E cells were transduced with lentivirus vectors expressing control or Smc6 shRNA on Day 0. Uninfected cells were collected at Day 0. At three days post infection, undifferentiated cells were harvested for analysis by rt-qPCR and Southern blotting or underwent 96 hours of differentiation in high-calcium medium.(A) qRT-PCR measured

Involucrin levels as a marker of keratinocyte differentiation. (B) Smc6 mRNA levels were measured by qRT-PCR in CIN612-9E cells lentivirally transduced with Smc6 shRNA or GFP shRNA. All qRT-PCR data is normalized to cyclophilin A. n = 4. (C) Southern blotting detected HPV31 DNA from CIN612-9E cells (left). Total DNA was digested with BamHI targeting only mammalian DNA for visualization of the various forms of viral DNA (top).

Alternatively, DNAs were digested with XbaI to linearize viral DNA (8 kbp) (middle). The bottom half of the Southern blot containing XbaI-digested DNA was probed for the human tPa gene as a loading control (1-2 kbp). (right) Densitometric analysis of the episomal form of DNA as visualized by Southern blotting. P values were calculated using the student’s t test. ***, P<0.0001. **, P<0.001. *, P<0.05.

102

Figure 4.3 (Continued)

103

4.3 Smc5/6 may influence maintenance of viral episomes

Components of the cellular DNA damage response and homologous recombination pathways have been previously suggested to influence maintenance of PV episomes(139-

141). There was a significant decrease in viral episomes in CIN612 cells under knockdown of Smc6 by different shRNAs (Figure 4.3C). To further examine the role of Smc6 in the maintenance of viral genomes, I transduced CIN612 cells to stably contain shRNA targeting

Smc6 (shSmc6 #1) or shRNA targeting GFP as a negative control (shGFP). It is important to note that loss of one component of the Smc5/6 complex destabilizes the entire complex, and studies indicate that the long term viability of most cell lines is not impacted by loss of this complex in the absence of DNA damage(128, 130, 195). In a previous study, shRNA- mediated knockdown of MMS21 and Smc6 was maintained in the colorectal carcinoma cell line, HCT116, for 120 population doublings(130). The maintenance of viral DNA in CIN612 cells was assessed by extraction of the total DNA and analyzed by qPCR and Southern blotting with a probe specific to the HPV31 URR. Unlike the experiments in Figure 4.3, these cells did not undergo puromycin selection within the first three days after shRNA transduction (Figure 4.9, page 119). These experiments revealed a reduction in HPV31 DNA in the absence of Smc6 (Figure 4.4-4.6). Quantification of total viral DNA by qPCR, normalized to the quantity of β-actin DNA, indicated a ~50% decrease in viral DNA after three days (Figure 4.4B) of Smc6 knockdown, and this was sustained up to day 14 (Figure

4.4C) where viral DNA was still present. Southern blotting was used to visualize the different forms of viral DNA across several experiments. These forms are monomeric episomes, which migrate faster in the gel, nicked/circular, linear, and multimeric/integrated (high molecular weight). Densitometric analysis indicated that the reduction was most prominent

104 for the nicked/circular and monomeric episomal forms of viral DNA (Figure 4.4E). This suggested a requirement for Smc6 in the maintenance of HPV monomeric episomes.

105

Figure 4.4 Smc5/6 influences the maintenance of monomeric episomes in CIN612-9E cells

(A) Total DNA was extracted from CIN612-9E cells at 3 and 14 days post lentiviral shRNA transduction. Cells that did not contain shSmc6 were transduced with shGFP as a control. A probe targeting the HPV31 URR was used to identify viral DNA by Southern blot. (Bottom)

Ethidium bromide staining for the Southern blot shown above. Quantification of total viral

DNA extracted from CIN612-9E cell lines 3dpt (B) and 14dpt (C). DNA was measured by qPCR and normalized to β-actin DNA. n = 4. (D) Number of cells counted by hemocytometer seven days after plating 100,000 cells per plate. (E) Densitometric quantification of the different forms of viral DNA, detected by Southern blot at day 3. n = 4.

106

Figure 4.4 (Continued)

A B 3 dpi Total viral DNA (qPCR)

shGFP shSMC6

shGFP shSMC6 D

shGFP shSMC6

E EpisomalE p i s o m a l Nicked/circularN i c k e d / c i r c u l a r Multimeric/Integrated

1 . 5 1 . 5

e g

1 . 0 g 1 . 0

l l

o 0 . 5

F F

0 . 0 0 . 0 shGFPs h G F P shSMC6s h S M C 6 shGFPs h G F P shSMC6s h S M C 6 shGFP shSMC6

107

CIN612-9E cells transduced with Smc6 shRNA #1 continued to grow for several weeks after

Smc6 knock-down and did not display any loss in cell viability, even after loss of extrachromosomal viral episomes (Figure 4.4D). This suggested that cells can tolerate depletion of Smc6 and episomal monomers of viral DNA long term. It is worth noting that, rt-qPCR for E6 and E7 indicated no difference in RNA levels for the control and Smc6 shRNA cell lines at 30 days after lentiviral transduction (Figure 3.6). Digestion of the cellular

DNA by XbaI linearizes the HPV31 DNA, concentrating the viral DNA into one band that runs at approximately 8 kbp. While this cannot be used to analyze the episomal state of the viral DNA, it can reveal whether viral DNA is still present in cells, where it may be more difficult to visualize when the DNA is not concentrated into a single band. qPCR for HPV31

DNA, normalized to β-actin DNA, revealed that there was a reduction in viral DNA at 3 and

14 days post lentivirus transduction (Figure 4.4B and C). This is visible for the fast-migrating monomeric episomal form in Southern blots analyzing BamH1-digested DNA; however, this reduction was not as apparent at day 3 for Southern blots containing linearized DNA (Figure

4.5A). These Southern blots indicate that viral DNA is still present in cells stably expressing

Smc6 shRNA #1 at 14 days post lentiviral transduction (Figure 4.5). Densitometry for the linear band, normalized to the human tPa gene, also visualized by Southern blotting, indicated a significant decrease in total viral DNA at 14 days post transduction for the shSmc6 #1 cell line (Figure 4.5B). Previous characterization of the CIN612 cell line indicated that integration of HPV31b episomes occurs after long-term passage in culture and increases with time, where it is suspected that integration confers a growth advantage(160).

Thus, cells with integrated DNA may have a growth advantage that makes viral episomes dispensable with Smc6 knockdown.

108

Figure 4.5 Viral DNA was reduced in a Smc6 knockdown CIN612 cell line

(A) Southern blotting with a probe targeting HPV31, detected the XbaI-digested linear form at approximately 8 kbp. The bottom half was probed for tissue plasminogen activator gene

(tPa) to control for loading (1-2 kbp). M = marker for linear HPV31 DNA (1ng HPV31 genome excised from pLit vector). (B) Linear viral DNA on Southern blots quantified by densitometry and normalized to tPa. n = 4. **, p <0.01.

109

CIN612 cells stably expressing Smc6 shRNA #5 also displayed a reduction in viral DNA

(Figure 4.6). This shRNA was less effective in Smc6 reduction in comparison to shRNA #1

(Figure 2.2C, D); however, a reduction in Smc6 protein levels was observed at various timepoints after shRNA transduction (Figure 4.6A). Southern blot analysis of XbaI-cleaved

DNA that linearizes HPV31b DNA from these cell lines indicated a loss of viral DNA 25 days after lentiviral transduction. At seventy days post Smc6 shRNA transduction, viral DNA was not visible from either the undifferentiated or differentiated cells when only 5ug of

BamHI-digested DNA was analyzed (Figure 4.6C). In the Smc6 knockdown cell line, viral

DNA was not visible unless the cells were differentiated and the DNA concentrated through linearization by XbaI digestion. This suggested that viral DNA was present in these cells and may have the capacity for differentiation-dependent amplification. To address this, more than three times the amount of the DNA for these same samples were run on another Southern blot (Figure 4.6C). Loading more DNA allowed for the visualization of the small amount of viral DNA left in the Smc6 shRNA cell line. Unlike the blot shown in 4.6C, XbaI-linearized viral DNA from the undifferentiated shSmc6 #5-CIN612 cell line was visible when more

DNA was loaded for Southern blotting (Figure 4.6D). This suggested that after several weeks of Smc6 depletion, viral DNA was not completely lost. However, the form of this DNA, which would be visible when the viral DNA was not cleaved and the mammalian DNA was digested with BamHI, was difficult to discern and may be integrated or multimeric high- molecular weight DNA (Figure 4.6D). Alternatively, a small amount of Smc6 protein may still be present in the shSmc6 cell line, and this may be sufficient for the cells to harbor a fewer, although markedly less, copies of the monomeric extrachromosomal viral genome.

110

These remaining copies may still have the capacity for differentiation-dependent amplification in the absence of Smc6.

111

Figure 4.6 Analysis of HPV31 DNA in CIN612 cells transduced with Smc6 shRNA #5.

CIN612 cells were transduced to stably contain shRNA targeting Smc6 (shSmc6 #5) or GFP as a negative control.(A) Western blot showing Smc6 protein levels in control and shSmc6 #5 cell lines at various days post infection (dpi). (B) Total cellular DNA was extracted and

Southern blots were probed for viral DNA using a probe specific to the HPV31 URR. 2µg of viral DNA was linearized by XbaI digestion and loaded onto an agarose gel for Southern blotting (top). The ethidium bromide gel for this Southern blot is shown below. (C) Southern blot for HPV31 DNA. The gel was loaded with 5µg of XbaI or BamHI-digested DNA from cells harvested 70 dpt. (D) 18µg of DNA of the same DNA from Part C was digested with

XbaI or BamHI. The membrane was stripped and probed for the XbaI-digested human tissue plasminogen activator (tPa) gene as a loading control.

112

Figure 4.6 (Continued) A

C D

Nicked

113

4.4 Discussion

The core functions of the human Smc5/6 complex lie within DNA repair, replication, and maintenance of eukaryotic chromosomes. Similarly, major roles of the PV E2 protein include PV genome maintenance and replication. Here, I aimed to determine whether an interaction between this human complex and viral protein might influence viral DNA replication or genome maintenance. The modes of viral DNA replication addressed in this chapter are initial (transient) PV DNA replication, maintenance replication, and vegetative amplification. These experiments suggest opposing roles for Smc5/6 in viral DNA replication, where it is not required for and in fact, represses, initial DNA replication, supports maintenance replication, and has no influence on differentiation-dependent amplification (Figure 4.7). Experiments analyzing replicated DNA after transfection of the viral replication proteins, E1 and E2, and a plasmid containing the viral ori indicate that

Smc6 is not required for this type of E1/E2-mediated DNA replication. Conversely, in multiple experiments with two shRNAs targeting Smc6, E1/E2-mediated DNA replication, which may be representative of initial replication soon after virus infection, was enhanced by

Smc6 depletion, and the degree of the increase in replication correlated with the level of

Smc6 knockdown. This suggested that Smc5/6 played an antiviral role in this phase of the viral life cycle, where it repressed the initial E1/E2-mediated replication of viral DNA.

Overexpression of Smc6 in this experiment may also confirm its repressive role in this type of viral replication. A caveat to this however, is that other components of the Smc5/6 complex may be required for Smc6 stability and its repressive activity.

Sp100 has also been documented to repress the initial amplification of viral genomes but has no influence on maintenance replication of viral DNA. These experiments, analyzing

114 initial, transient viral DNA replication were performed with re-circularized HPV18 genomes electroporated into cells(183). To determine whether Smc5/6 and Sp100 similarly function in the repression of this type of viral DNA replication, establishment and replication of HPV

DNA in cells electroporated with re-circularized genomes in the presence and absence of

Smc6 should be assessed. In addition, the influence of Sp100 knockdown on E1/E2-mediated replication in cells transfected with these viral replication proteins and an HPV origin- containing plasmid should also be determined. It is possible that Smc5/6 participates in the recruitment of the ND10 component, Sp100, to viral replication foci for repression of early viral DNA replication. For both HPV and hepatitis B virus, experiments assessing the localization of Sp100 at viral DNA foci in the presence and absence of Smc5/6 may reveal whether it plays a role in the recruitment of this antiviral host factor during certain phases of the viral life cycle.

One SMC family member, cohesin (Smc1/3), has also been reported to influence the

PV life cycle(99). The Smc1 component is required for differentiation-dependent amplification of viral DNA in CIN612-9E cells, where shRNA-mediated knockdown of this component resulted in a stagnant level of viral DNA in differentiated keratinocytes. Given the relationship between Smc1/3 and Smc5/6, where Smc5/6 influences cohesin recruitment during the DNA damage response, I sought to determine whether Smc5/6 played a similar role in the viral replication cycle. Differentiation-dependent amplification of viral DNA occurred in both the presence and absence of Smc6, suggesting that it is not required for this viral process.

Monomeric episomes were reduced in number in undifferentiated cells, suggesting that Smc5/6 may influence extrachromosomal episome maintenance replication. This trend

115 was observed in several experiments with multiple shRNAs. These data suggest that its well- documented role in eukaryotic genome stability may also extend to that of papillomaviruses.

After transduction, and during puromycin selection for shRNA-containing cells, there may have been selection for cells with integrated viral DNA that were able to grow without viral episomes, making Smc6 dispensable. Viral episomes were lost more quickly when the cells were immediately subjected to puromycin selection rather than 3dpi (Figure 4.3 vs Figure

4.4). Pressure exerted by puromycin may have led to more rapid selection for cells with

Smc6 shRNA and in these experiments, this may have led to earlier loss of viral episomes.

The CIN612 cell line is believed to contain a mixture of episomal and integrated viral DNA genomes and having one or two copies of viral DNA integrated into the host genome may allow for continued growth after depletion of Smc6 and loss of the episomal form of the viral genome. A caveat to this hypothesis is that it might not explain an increase in viral DNA that would occur after differentiation. It is possible that multimeric forms may be able to vegetatively amplify but not resolve into monomers in the absence of Smc6.

E2 is responsible for partitioning and maintenance of the viral episome in dividing cells during the genome maintenance phase, and the mode of viral DNA replication during this phase is somewhat ambiguous(86, 196, 197). A direct interaction with E2 may represent a mechanism by which DDR and HR factors are recruited to PV episomes or replication foci for the type of replication that occurs during the maintenance phase. Host DDR and HR factors have been suggested to be required for papillomavirus episome stability and activation of the DNA damage response may activate particular DNA replication factors for replication outside of S-phase; however, the specific mechanism by which particular components of the DDR response contribute to viral episome stability is not well

116 understood(139-141). Here, I identified one such factor that may have a direct interaction with the viral E2 protein. Smc5/6 largely functions in cohesion of sister chromatids and as a recruiter of DDR and HR factors, such as Smc1, RPA, and Rad52 to double-strand DNA breaks and collapsed replication forks(120, 123). Recruitment of other known maintenance factors to PV replication foci in the presence and absence of Smc6 may determine whether

Smc5/6 recruits replication machinery to viral DNA for maintenance.

117

Figure 4.7 Model for the influence of the Smc5/6 complex on different phases of papillomavirus DNA replication. Smc5/6 may repress initial, transient replication and be required for long-term maintenance of viral episomes.

118

4.5 Materials and Methods

Transient papillomavirus DNA replication

E1/E2-mediated DNA replication was assessed in C33A cells according to a previously described protocol (63, 83). C33A cells (2 x 105) were infected with 1 ml of lentivirus-media supplemented with 4 mls of media and 0.8 µg/ml Polybrene for 2 hours and selected with 0.75 µg/ml puromycin 24 hours later. Approximately seventy-two hours later 5 x 105 cells for each cell line were co-transfected with the previously described plasmids, pCMV 16E1 and pCMV 16E2 using Fugene 6 (Roche) (Table 4.1)(83). Low-molecular- weight DNA was collected using the Hirt method(198). Transfected DNA was digested with

DpnI, to distinguish replicated DNA, which was linearized by AccI digestion. DNA was detected by Southern blot with a probe targeting the HPV16 ori using the DIG DNA

Labeling and Detection Kit (Roche). The primer sequences used to generate the probe are

CAAACCGTTTTGGGTTACAC (forward) and TGCAGTTCTCTTTTGGTGCAT (reverse).

For the marker for replicated DNA on Southern blots, the HPV16 genome was excised from the pUC19 vector by BamHI digestion and has been previously described(170).

Table 4.1 Plasmids used in Chapter 4 Howley lab plasmid # Plasmid name Gene 6861 pE1-HA HPV16 HPV16 E1 3662 pCMV4-HPV16-E2 HPV16 2100 pBSII KS- 16ORI HPV16 ORI

119

Lentiviral knockdowns

All shRNAs used in this study were contained within a Mission pLKO.1-PURO vector and described in Table 2.5. 2 µg of shRNA and 0.5µg lentivirus packaging plasmids were transfected into 293T cells to produce lentivirus particles (Figure 4.8, 4.9). Twenty-four hours later the media was changed to that specific for the target cells and the virus-producing cells were allowed to grow for another 24 hours. The virus supernatant was then collected and filtered through a 0.45 µM filter. CIN612-9E cells were lentivirally transduced with control shRNA, targeting GFP, or Smc6 shRNA.

Cell culture

CIN612-9E cells were cultured in E media with mitomycin-treated 3T3-J2 fibroblast feeders according to the protocol written by Fehrmann & Laimins (2005) (171). For experiments assessing differentiation-dependent amplification of viral DNA, CIN612 cells in

15 cm plates were infected with lentivirus for Smc6 or GFP shRNA for two hours with

8ug/ml Polybrene in E media. The media was then replaced and one uninfected plate was collected and termed the ‘Day 0’ (uninfected) time point (Figure 4.8). Twenty-four hours after infection cells underwent 48 hours of selection with 0.5µg/ml of puromycin. Uninfected cells were then collected 72hpt. After 24 hours of puromycin selection, a fraction of each cell line was plated for 100% confluency in the absence of feeders in KBM (Keratinocyte Basal

Medium, Lonza) supplemented with growth factors (KGM-Gold™SingleQuots™, Lonza).

Twenty-four hours later, cells were washed with PBS and KBM media with no growth factors added and containing 1.5mM calcium chloride was added to the plates. These cells underwent 96 hours of calcium-induced differentiation prior to collection for DNA, RNA, and protein analysis.

120

For experiments analyzing maintenance in the presence of shRNA, CIN612 cells were lentivirally transduced with Smc6 or GFP shRNA through two hours of infection with

8µg/ml of Polybrene in E media. Seventy-two hours after infection the Day 3 timepoint was collected and cells began selection with 0.5 µg/ml of puromycin. CIN612 cells were infected and grown in the presence of 3T3-J2 fibroblast feeders that were replaced twice per week.

Cells were harvested at day 3 and day 14 (Figure 4.9).

121

Figure 4.8. In vitro methods for lentiviral transduction and calcium differentiation of keratinocytes

HEK293T cells were transfected with lentiviral packaging plasmids and a Mission pLKO.1 shRNA. Virus supernatant was collected 48 hours later for infection of CIN612 cells.

CIN612 cells were infected for 2 hours and cells were collected on the day of infection and designated ‘Day 0’. Cells underwent puromycin selection and a fraction was collected on

Day 3 (undifferentiated) and another fraction was plated for 100% confluency in KBM.

These cells underwent 96 hours of differentiation in 1.5mM calcium chloride.

122

Figure 4.9 Lentiviral transduction of CIN612 cells for stable knockdown cell lines

Transfection of lentiviral packaging plasmids and a Mission pLKO.1 shRNA construct into

293T cells generated infectious virions for shRNA transduction of CIN612 cells. Seventy- two hours after transduction cells began puromycin selection. Cells were harvested for DNA and protein analysis 3 and 14 days post transduction.

123

Southern blotting

Total DNA was extracted from CIN612-9E cells using previously described methods

(199). Briefly, cells were lysed in Southern lysis buffer (400 mM NaCl, 10 mM NaCl, 10 mM Tris-HCl, pH 7.4, 10 mM EDTA), treated with RNase A to a final concentration of 50

µg/ml, and incubated at room temperature for 15 minutes. Sodium dodecyl sulfate (SDS) was added to a final concentration 0.2% and Proteinase K was added to a final concentration of

50 µg/ml. The lysate was incubated at 37 degrees Celsius overnight before shearing in an 18

G needle. DNA was extracted in phenol/chloroform/isoamyl alcohol (25:24:1) and chloroform/isoamyl alcohol (24:1) before ethanol precipitation. DNA was then quantified by

NanoDropTM (ThermoScientific) and equal amounts were digested with BamHI-HF (New

England Biolabs-NEB) overnight at 37oC to cleave only mammalian DNA, or with XbaI

(NEB) to linearize viral DNA. DNA was separated in a 0.8% agarose gel, depurinated, denatured, and neutralized before transfer onto a positively-charged nylon membrane

(Amersham™ Hybond™-N+) overnight in 10X SSC (1.5M NaCl, 150 mM trisodium citrate, pH 7). After UV crosslinking at 120 mJ/cm2, the membrane was prehybridized in

ULTRAhyb™ Ultrasensitive Hybridization Buffer (ThermoFisher Scientific) at 42oC for 30 minutes prior to overnight hybridization with a probe targeting the HPV31 URR. Membrane washing and detection was done using the DIG DNA Labeling and Detection Kit (Roche) according to the manufacturer’s instruction. Viral DNA was visualized using a probe targeting the HPV31 URR. Mammalian DNA cleaved with XbaI produced a ~1.8 kbp fragment of the tissue plasminogen activator (tPa; Gene ID: 5327) which was used as a loading control for Southern blotting, where the bottom half of the blot was probed for the tPa gene and the top half was probed for the HPV31 URR (~8kbp). Probes were generated

124 using the DIG DNA Labeling and Detection Kit according to the manufacturer’s protocol

(Roche). The primer sequences used to generate the HPV31 URR probe are

CTGGCTTGTAGTTTCCTGCC (forward) and AAAGCCAGCACTGCAATCAA (reverse).

HPV31 excised from the pLIT31 vector (gift of L. Laimins) was used as a marker for the linear form on Southern blots and is previously described (150). qPCR for HPV31 DNA

DNA was extracted from CIN612-9E cells using previously described methods(199).

DNA was measured by NanoDropTM (ThermoFisher) and digested overnight at 37 degrees with BamHI-HF and XbaI (New England Biolabs). Serial dilutions of a reference CIN612

DNA, ranging from 0.5 ng to 125 ng were used to generate a standard curve for determining relative DNA amounts. Primers for HPV 31 were used to quantify viral DNA, which was normalized to qPCR data for the β-actin gene. The following gene specific primers were used: HPV31, CTGACCTCCACTGTTATGAGCAA (forward) and

CAGCTGGACTGTCTATGACATCCT (reverse), β-actin, TACGTCCACCGCAAATGC

(forward) and CGCAAGTTAGGTTTTGTCAAGAAA (reverse). qPCR was performed using

SYBRTM Select Mastermix (ThermoFisher Scientific) and the Applied Biosystems ABI 7500

Fast Sequence Detection System.

125

Perspectives and Future Directions

5.1 DNA viruses and the DNA damage response

5.2 Papillomavirus activation of the DNA damage response

5.3 Alternative lengthening of telomeres as a potential mechanism of HPV DNA

replication

5.4 Maintenance of papillomavirus episomes through tethering to host mitotic chromatin

5.5 Resolution of catenated viral episomes by Smc5/6

5.6 The Smc5/6 – E2 interaction: Implications for integration

5.7 Antiviral factors in HPV infection

5.8 Conclusions

126

Papillomaviruses have evolved many mechanisms for ensuring completion of the viral life cycle and for blocking host cell antiviral defenses. These may involve viral piracy of host proteins for execution of various replicative activities. Most papillomavirus proteins lack enzymatic activities and thus perform their functions through binding and altering the activities of cellular proteins. Elucidation of host cell interactors of papillomavirus proteins and the pathways they perturb can provide insight into key steps of the viral life cycle.

Technological advances in mass spectrometry and proteomics have allowed for systematic identification of host binding partners of papillomavirus proteins. In this dissertation, I examined the role of an interaction between an essential viral protein, E2, and a host protein complex, Smc5/6, in the viral replication cycle. Here, the Smc5/6 – E2 interaction, previously identified in several proteomics studies, was confirmed through immunoprecipitation experiments and components of Smc5/6 were observed at viral replication foci. Analysis of the role of this complex in different modes of PV DNA replication suggests that indeed Smc5/6 plays a role in an aspect of papillomavirus DNA replication. Smc5/6 depletion may lead to viral episome loss by disruption of monomeric episome tethering to host chromatin, interference of an HR mechanism of PV maintenance replication, and/or loss in the ability of viral genome concatemers to resolve to circular monomers. Here, I review the cellular pathways that influence the replication cycle of HPV and possible mechanisms by which HR and DDR machinery might contribute to replication and integration of HPV DNA, and also discuss how an interaction between the multifunctional Smc5/6 and E2 proteins might play a role in the PV replication cycle.

127

5.1 DNA viruses and DNA damage response

It is well documented that several DNA viruses influence the DNA damage response

(DDR) of the infected host cell(200, 201). There is an extremely complex relationship between DNA viruses and these pathways, where DDR machinery may possess intrinsic antiviral activities, or viral activation of the DDR response may be beneficial to certain aspects viral replication. The infection of non-dividing cells, in particular, presents a significant obstacle to the replication of certain DNA viruses, one which is largely overcome through the expression of oncogenes. While most viral oncogenes disrupt cell cycle checkpoints and prevent apoptosis, some DNA viruses also activate DDR pathways for the use of DDR machinery to replicate viral DNA outside of S-phase(202). The activation of these cellular pathways that would normally trigger apoptosis, and the prevention of adverse cell responses through the expression of viral oncogenes, can allow the virus to achieve a delicate balance within the cell, between preventing antiviral cellular events and attaining robust replication of viral DNA.

The networks of proteins that are involved in the cellular DDR are large and complex.

They are composed of sensors that respond to DNA damage, proteins that are part of signal transduction pathways and cell cycle checkpoints, and several types of repair pathways that respond to different types of DNA damage. The repair of double strand breaks (DSBs) occurs through two distinct pathways: homologous recombination (HR) or non-homologous end- joining (NHEJ). The mechanism of repair depends on the phase of the cell cycle, where HR occurs during S and G2 phase, and NHEJ occurs during G1(203). Core to activating these pathways are phospho-inositide 3-kinase (PI3K) related proteins ATM, ATR, and DNA-

PK(204). These proteins phosphorylate a large number of substrates influencing cell cycle

128 arrest, apoptosis, and the type of repair pathway activated(205-208). DNA-PK recruits the

MRE11/Rad50/NBS1 (MRN) complex for the completion of the error-prone NHEJ process, whereas ATM promotes repair through homologous recombination (HR)(208-210).

Homologous recombination uses a DNA template and the process of DNA strand invasion for high-fidelity repair. HR also assists in the recovery of collapsed replication forks and general maintenance of genome stability(211).

Of the numerous downstream targets of ATM and ATR, phosphorylation of histone

H2A variant, H2AX, is among the most prominently associated with the DNA damage response. This phosphorylated form, termed уH2AX,co-localizes with DSBs and DDR factors and is postulated to play a role in the formation of DDR factor foci, especially in the process of homologous recombination(212). Among the other DSB-activated proteins observed at HR foci are Rad51, Rad52, FANCD2, and BRCA1(210, 213-215). ATM activation leads to the phosphorylation of several of these proteins, including Rad51, p53, other protein kinases (Chk1, Chk2, cdk1, cdk2), and BRCA1, which is required for phosphorylation of Smc1(210, 215). As mentioned previously, Smc5/6 is also an integral component of this pathway where it promotes the recruitment of Smc1/3 to DSBs and holds sister chromatids together for sister chromatid HR(122, 125).

Herpes simplex virus is one of many DNA viruses that triggers the cellular DDR. It activates ATM and its downstream substrates, including several HR factors, many of which have been found to be recruited to viral replication centers(216, 217). The efficiency of virus replication is reduced in cells lacking certain DDR/HR factors, suggesting that this cellular response is beneficial for HSV(218). During polyomavirus infection, Smc1, уH2AX, p53, and ATM are phosphorylated and inhibition of the ATM pathway or of Smc1

129 phosphorylation similarly results in impaired virus replication(219-222). In addition to activation of DDR networks, SV40 recruits уH2AX, MRN, FANCD2, and Rad51 to its replication compartments(223-225). Importantly, inhibition of the ATM pathway disrupts viral replication centers and reduces the level of supercoiled SV40 DNA products at the

SV40 genome size of 5.2 kbp and results in the accumulation of high molecular weight SV40

DNA products that are head-to-tail concatemers of viral DNA(223).

Adenovirus has a linear double-stranded genome, whose ends can be recognized by the MRN complex and elicit a DDR(226). Unlike the previously mentioned viruses, adenovirus inactivates host machinery to prevent the DDR and viral genome concatamerization. The E4 open reading frame of adenovirus encodes proteins that prevent

ATM and ATR signaling by targeting the MRE11 component of MRN for degradation(226-

228). In the absence of these viral proteins, many DDR proteins including 53BP1, BRCA1,

ATR, and yH2AX are present at the viral replication centers.

5.2 Papillomavirus activation of the DNA damage response

Similar to these viruses, DDR networks may also influence various aspects of PV replication. HPV E1, E2, and the viral genome form the viral replication center. Among the numerous DDR and HR components observed at PV replication foci are pSmc1, Rad51,

FANCD2, Chk2, PCNA, RPA, BRCA1, and MRN (MRE11, RAD50, NBS1) proteins

(Figure 5.1) (73, 99, 140, 157). HPV31 E7 increases the stability of DDR proteins ATM and

Chk2(229). While ATM is an upstream activator of the DDR response, inhibition of its kinase activity is dispensable for DDR activation in HPV31-positive CIN612 cells(230).

Through its DNA-binding and ATPase activities, the viral E1 helicase also activates a DNA damage response through activation of the ATM and ATR DDR kinases(55, 231, 232). This

130 may occur through non-specific DNA melting activity of E1 that damages the host genome.

While the viral E1 helicase alone is sufficient for activation of DDR pathways, the presence of the viral E2 protein causes these activities to be localized to distinct nuclear foci, not unlike the foci of viral replication factories(55).

HPV replication foci have been documented to contain several components of the cellular HR and DDR pathways which may facilitate initial replication, differentiation- dependent amplification, and maintenance of episome stability(99, 139-141, 157) (Figure

5.1). Studies indicate that during initial, transient replication, DDR pathways are activated by

E1; however, inhibition of the ATM pathway has no influence on this type of E1/E2- mediated replication(231, 232). While the ATM pathway is activated in both undifferentiated and differentiated cells, its role is most prominent during vegetative amplification of viral

DNA where the size of viral replication foci increases and viral piracy of cellular DNA synthesis and repair proteins facilitate viral genome amplification (73, 157). Unlike the other two modes of viral DNA replication, differentiation-dependent amplification occurs in cells that should have exited the cell cycle and are in a quiescent, non-proliferative state that would not normally foster DNA synthesis. Cytoplasmic localization of Cdk1 and cyclin B indicate that HPV replicates its genome while the host cell is arrested in G2(233). When cells reach the upper layers of the stratified epithelium, ATM may arrest cells in G2 to create an environment conducive to productive replication of HPV DNA. During this process, several

DDR proteins are activated, and HPV induces the formation of foci where viral DNA is amplified to a high copy number. Here, the cellular proteins Chk2, NBS1, ATM, and BRCA1 are phosphorylated and present at viral replication foci, and Chk2 and ATM kinase activity are required for viral genome amplification in differentiated cells(73, 156, 230, 231).

131

Inhibition of HR components, MRE11, Nbs1, and Rad51 block productive replication and thus regulation of HR by ATM may promote an HR-dependent replication mechanism(234).

While ATM knock-down influences the maintenance of HPV16 genomes, inhibition of its kinase activity does not appear to influence HPV31 maintenance(73, 141). It remains to be determined whether small-molecule depletion of ATM might also influence HPV31 genome maintenance. This may reveal whether episomal maintenance occurs through distinct mechanisms for different papillomavirus types. Taken together, studies suggest that the ATM pathway does not influence initial replication and is required for vegetative amplification, and its role during maintenance is unclear.

Data suggest that HR components (MRN, BRCA1, Rad51) and pSmc1 are required for differentiation-dependent amplification of viral DNA but not maintenance, while

FANCD2 is required for maintenance and is not required for vegetative amplification(140,

235). Viral episomes were lost in undifferentiated CIN612 cells containing FANCD2 shRNAs(140). However, the Fanconi Anemia (FA) repair pathway has been implicated to restrict vegetative amplification, where FANCD2 loss stimulated HPV genome amplification in differentiating cells(236). Patients with mutations in the FA pathway have higher rates of

HPV-associated oral nasopharyngeal cancers and FANCD2 knockout mice were also more sensitive to this type of HPV-associated cancer(235, 237-242). These studies suggest that

FANCD2 has both antiviral and proviral roles in the viral life cycle.

The role of DDR and HR machinery in various aspects of the PV DNA replication cycle is still somewhat ambiguous, and Smc5/6 may be among many host cell proteins that influence an aspect of PV DNA replication, but unlike most of these host factors present in papillomavirus replication centers, Smc5/6 interacts with the viral E2 protein. The

132 mechanism of the initial transient replication is believed to be conserved among PVs and requires the viral E1 protein, however the exact mechanism of maintenance replication is unclear(63, 64). During maintenance replication, circular viral episomes are maintained at a relatively constant copy number of around 100 copies per cell throughout several cell divisions and are partitioned between the nuclei of two daughter cells(65). In addition to

ATM and FANCD2, host factor ChlR1, a helicase that interacts with Smc1/3 and plays a role in sister chromatid cohesion, has also been suggested to be required for episome maintenance. ChlR1 was required for maintenance of BPV1 episomes in C127 cells, a mouse fibroblast cell line(89). One possibility is that maintenance replication occurs through DDR signaling in a recombination-dependent manner. This unidirectional, origin independent, mechanism of recombination-dependent replication may synthesize concatameric viral DNA intermediates. Smc5/6 may help resolve head-to-tail concatemers from the multimeric, slow migrating form, into monomeric circular genomes. Future experiments should address whether the Smc5/6 interaction with E2 influences the formation of virus replication compartments and the recruitment of various DDR and HR machinery. Studies have shown that papillomavirus replication foci localize to sites of DNA damage in the host cell and integrate at fragile sites in DNA(73, 99, 157). In addition, CHIP experiments indicate that

DDR machinery such as p-H2AX and FANCD2, bind to viral DNA(140). The role of

Smc5/6 in the recruitment of DDR/HR factors to viral episomes can be assessed through IF-

FISH and CHIP experiments. However, it may be difficult to perform these experiments in the context of Smc6 knockdown, because this influences viral DNA levels.

The presence of viral HR proteins may facilitate viral DNA replication and oligomerization in recombination dependent manner, and also lead to accidental integration

133 of viral DNA, which is a hallmark of papillomavirus-induced cancers. Whether and how PVs switch between mechanisms of DNA replication during different phases of the replication cycle, and the role of DDR/HR machinery during these stages is not yet well understood, but it is unlikely that viral DNA replication adheres to conventional rules of chromosomal DNA replication.

134

Figure 5.1 Host factors present in HPV replication centers

Diagram of confirmed and hypothesized (TRF1/TRF2) factors present in papillomavirus replication foci. Most of these factors have been identified through studies using the HPV31- positive CIN612 cell line. Work in this dissertation indicates that Smc5/6 is also present at HPV replication compartments. Smc5/6 has been implicated in ND10, ALT, and DDR/HR functions, which may play roles in viral gene transcription and DNA replication.

135

5.3 Alternative lengthening of telomeres (ALT) as a potential mechanism of HPV

DNA replication

The maintenance and self-replicating properties of telomeres are not unlike that of viral DNA. In cancer cells, telomeres can be extended through the upregulation of telomerase, or activation of a homologous recombination-based mechanism of elongation, termed alternative lengthening of telomeres (ALT). Most ALT cells contain ALT-associated promyelocytic leukemia bodies (PML), referred to as APBs(243). Extrachromosomal telomeric DNA and the presence of numerous DDR and HR proteins are characteristic of

APBs(244, 245). These proteins include NBS1, RPA, BRCA1, Mus81, telomere repeat binding factors (TRF) 1 and 2, and FANCD2(244, 246-248). Smc5/6 component, MMS21, promotes APB assembly by inducing the localization of PML to telomeres in the ALT- positive human osteosarcoma cell line U2OS(245). Smc5/6 also localizes to ALT-PML bodies and its loss causes progressive telomere shortening and senescence in ALT cells(130).

It is also required for telomere homologous recombination, where its E3 SUMO ligase component, MMS21, SUMOylates key components of ALT machinery: Rap1, TRF1, and

TRF2(130, 245). TRF1 and TRF2 are components of shelterin and protect telomere ends, which are similar to double-stranded breaks(249). TRF1 and TRF2 were required for maintenance of HPV16 DNA; however, these experiments were performed in Saccaromyces cerevisiae(250, 251). While PML and FANCD2 have been reported at PV replication foci, the presence of these other ALT factors, which are SUMOylation targets of Smc5/6 (TRF1 and TRF2) has not yet been investigated(140, 162, 252).

Although HPV16 E6 extends cellular life span through activation of hTERT, HPV16

E7 is also capable of independently maintaining telomere length through a non-telomerase

136 mechanism(253, 254). This mechanism is believed to occur through the ALT pathway, where

HPV16 E7 induces the formation of APBs and this is correlated with a growth advantage in primary human keratinocytes (252). While, telomerase is more efficient in extending telomere length and most advanced cervical lesions have activated telomerase, its activation in early cervical neoplasms is less studied(255, 256). ALT and telomerase activity can co- exist within cultured cells, and thus it is possible that in HPV-infected cells E6 activates telomerase and E7 activates ALT.

There is precedent for DNA virus activation of the ALT pathway. Epstein-Barr virus activates ALT in B-lymphocytes where there is an increase in APBs, telomeric-sister chromatid exchange, and extrachromosomal telomeres(257). Over a dozen ALT cell lines have been generated using SV40, and the breast fibroblast ALT cell line was generated using

HPV E7(243). Thus, it is possible that HPV E7 and the SV40 large T antigen, which share similar activities including the inactivation of the pRB tumor suppressor, play roles in ALT activation. The formation of 0.7 to 56.8 kbp extrachromosomal circles containing telomeric

DNA is characteristic of the ALT pathway, and thus it is possible that an ALT-mechanism of viral extrachromosomal episome maintenance similarly results in circularized viral genomes(258). The ends of linear, double-stranded DNA genomes of viruses, which may be generated through a recombination-dependent mechanism, may appear as double-strand

DNA breaks and elicit a DNA damage response or share structural similarity to uncapped telomeres. The recruitment of APB components to HPV31 replication centers suggests that this pathway may be activated in CIN612-9E cells. E7-induced APBs contain ssDNA, and several DDR proteins including Mus81, BRCA1, and FANCD2. As mentioned previously,

FANCD2 plays a role in both ALT and maintenance of HPV31 DNA in CIN612 cells (140,

137

252). In the presence of 16-E7, approximately 72.5% of FANCD2 foci co-localized with

PML (252).

CCCTC-binding factor (CTCF1) and cohesin (Smc1/3) bind to subtelomeres to protect telomere ends and stabilize TRF1 and TRF2 binding(259-261). Moreover, CTCF has also been suggested to be required for stable maintenance of HPV genomes(99, 262, 263).

My own preliminary experiments assessing the influence of TRF2 and FANCD2 on episomal maintenance in CIN612 cells indicated a modest change in monomeric episome levels at 13 days after lentiviral transduction with FANCD2 or TRF2 shRNA (Figure 5.2). Similarly, another study showed that knockdown of PML by siRNA in CIN612 cells did not drastically reduce viral episome levels(162). Future experiments should assess maintenance of viral episomes in the absence of ALT machinery and in the absence of the Smc5/6 component,

MMS21, which SUMOylates ALT factors. While Smc6 depletion influences the stability of the other components of the Smc5/6 complex, MMS21, which binds only to SMC5, should not influence complex stability (Figure 1.8). Thus, experiments in which MMS21 is depleted from cells maintaining viral episomes may reveal whether its SUMOylation activity is required for episome maintenance. Alternatively, an Smc5/6 – E2 interaction may link viral genomes to ALT machinery for maintenance of viral genomes though a mechanism similar to recombination-based telomere maintenance.

138

Figure 5.2 Maintenance of viral DNA in the absence of FANCD2 and TRF2

CIN612-9E cells were lentivirally transduced with shGFP, shFANCD2, or shTRF2 at day 0 and cells were collected for protein and DNA analysis.(A) Western blot showing FANCD2 protein expression in CIN612-9E cells. (B) Western blot showing TRF2 expression in

CIN612-9E cell lines at Passage 4. (C) Southern blotting for HPV31 DNA after digestion of mammalian DNA with BamHI. (D) and (E) CIN612-9E cells were lentivirally transduced with the indicated shRNAs and collected for DNA analysis at P2 (13 dpi) and P4 (27 dpi).

(D) DNA from P2 samples was digested with BamHI, targeting mammalian DNA, and viral

DNA was visualized by Southern blotting with a probe targeting HPV31. (E) Viral DNA was linearized by XbaI digestion and visualized by Southern blotting. Total viral DNA was measured by qPCR and normalized to β-actin DNA. ‘M’ lanes contain a marker for the linear

HPV31 genome.

139

Figure 5.2 (Continued)

140

5.4 Maintenance of papillomavirus episomes through tethering to host mitotic chromatin

Given that the interaction of Smc5/6 with E2 is conserved across PV types, it is likely that there is also a conserved role for the interaction in the papillomavirus life cycle. Thus, the role of Smc5/6 in the maintenance of PV genomes for other PV types should also be investigated. E2 proteins of different PV species target different parts of mitotic chromosomes at different stages of mitosis(92). BPV1, HPV1, and many other animal PVs utilize the E2-Brd4 interaction to link viral genomes to various parts of chromosomes throughout mitosis (197, 264). The Alpha PV E2 proteins are not stably bound to mitotic chromatin, and the mechanism of maintenance of these viral episomes is unclear for the PVs of this genus(92). The Beta and gamma PVs, have no association with Brd4 on chromosomes, and the E2s of these genera bind to pericentromeric and rDNA loci during mitosis(86, 89, 92, 196, 265, 266). Importantly, Brd4 is displaced from HPV replication factories and cellular factors associated with DNA replication, the cellular DDR, and HR; and although it is required for transactivation, it is not required for viral DNA replication

(267). Thus, while Brd4 may promote viral genome persistence through tethering, it may not support maintenance replication, which may involve other cellular factors.

The host cell factors, ChlR1 and TopBP1 have been suggested to be required for the genome tethering of Alpha HPVs. DNA topoisomerase 2-binding protein 1 (TopBP1) is a

DNA damage response protein that is stabilized by PML and localizes to centrosomes during mitosis(268-270). TopBP1 interacts with E2 and is required for establishment of viral episomes but not for continuing E1/E2-mediated HPV16 DNA replication, suggesting that these processes may occur through different mechanisms(271). Depletion of TopBP1 alters

141 the subcellular localization of HPV16 E2 and its association with mitotic chromosomes; however, TopBP1 and E2 only co-localized on mitotic chromatin during late telophase(272).

ChlR1 is an ATP-dependent DNA helicase that associates with Smc1/3 (cohesin) and is important for sister chromatid cohesion. An interaction of ChLR1 with BPV E2 was identified in a yeast two-hybrid screen and the interaction with HPV16 and -11 was confirmed by coimmunoprecipitation experiments(89). The interaction of BPV1 E2 and

ChlR1 was required for maintenance of extrachromosomal BPV1 genomes in the mouse fibroblast cell line, C127. ChlR1 and the BPV1 and HPV11 E2 proteins co-localize during the early stages of mitosis and siRNA-mediated depletion of ChlR1 reduced localization of these E2 proteins on mitotic chromatin(89).

In the absence of the host DDR, the Smc5/6 complex is enriched on ribosomal DNA

(rDNA) in yeast (110, 273). rDNA regions are “difficult” to replicate due to their repetitive nature and the presence of replication fork barriers. This makes rDNA replication characterized by frequent stalls and collapsed replication forks, and the Smc5/6 complex is believed to regulate the stability of these regions. In yeast, Smc5/6 is also present in the centromeric regions of all chromosomes during the G2 & M phases(121). Smc5/6 is less studied in human cells in the absence of the cellular DNA damage response. Studies in the immortalized retinal pigment epithelial cell line, RPE-1, and osteosarcoma cell line, HTC75, used immunofluorescence microscopy and chromatin fractionation to determine that Smc5/6 is primarily bound to chromatin during interphase and not during mitosis(127, 128). Given that Brd4 is required for transactivation of all PVs and tethering for a subset, there is precedent for there being a conserved function for an E2-interacting protein and a tethering function for a subset(86, 87). However, given previous data on mitotic localization of Smc5/6

142 in human cells, it is unlikely that it facilitates maintenance through tethering of genomes to host mitotic chromatin.

5.5 Resolution of catenated viral episomes by Smc5/6

Various mechanisms of papillomaviruses DNA replication have been proposed. At least one study has proposed that there is a switch in replication mode from bidirectional theta replication to a rolling circle mode. Rolling circle replication can generate large amounts of viral DNA during the vegetative stage and long concatamers of viral DNA generated from this type of replication may then be cut into unit genome lengths for packaging into virions. High-molecular weight, multimeric DNAs observed on Southern blots, may represent head-to-tail concatamers of linear monomeric DNA. Another possibility is that during viral DNA replication, catenation between circular viral DNA molecules connects them together similar to chain links, which will also run at a high molecular weight.

Topoisomerase II (Top2) plays a crucial role in chromosome condensation where, in addition to supercoil relaxation, it decatenates intertwined chromosomes (274, 275). Top2 decatenation is the separation of linked DNA molecules by introduction of a double-strand break in one DNA segment followed by re-ligation. Topoisomerase II activity has also been shown to promote catenation of circular DNA molecules and this is dependent on Smc5/6

(96). Top2 interacts with the Smc5/6 complex and similar to Smc1/3 and Smc2/4, Smc5/6 influences the interconnection of DNA molecules (96). One possibility is that an interaction of Smc5/6 with the decatenating protein, Top2, and catenated PV episomes facilitates decatenation of interconnected viral DNA intermediates into independent circular monomers.

In the absence of Smc5/6, catenated viral episomes may not be resolved into low-molecular weight monomers for packaging (Figure 5.3).

143

5.6 The Smc5/6 – E2 interaction: Implications for integration

Unlike retroviruses, papillomaviruses do not encode a protein that facilitates the integration of viral genomes into the host chromosome and integration of the viral genome into the host cell chromosome is not part of the normal papillomavirus life cycle. This integration does not produce infectious virions and therefore does not increase the HPV fitness, and may be an inadvertent side-effect of viral infection. Papillomavirus replication occurs near fragile sites in host DNA, and integration is facilitated by DSBs in host

DNA(264, 276-280). The fact that integration is a precursor to cancer underlines the importance for understanding the role of DDR/HR machinery in the PV life cycle and the mechanism by which they are recruited to PV replication foci. Following a DSB, the networks of DDR proteins are activated for repair of the damaged DNA so that apoptosis can be evaded and the cell cycle can continue. However, in high-risk HPV-infected cells, unrepaired DSBs facilitate integration of viral DNA and viral oncogenes prevent the activation of the cell death pathway that should occur in response to these DSBs(35, 264,

276, 277, 279-282). Head-to-tail concatameric repeats of viral DNA within host chromatin suggest a model in which double-strand breaks in viral DNA, induced by the viral E1 protein and maintained by DDR machinery, lead to linearized viral DNA in close proximity to host

DNA fragile sites and HR machinery that facilitate ‘accidental’ viral genome integration.

Integration of PV DNA into the host chromosome may occur through a homology- mediated DNA repair pathway, such as homologous recombination. Smc5/6 has been documented to be associated with fragile sites in DNA and is required for repair of double- strand breaks by homologous recombination, where Smc5/6 recruits HR factors and holds sister chromatids together for sister chromatid homologous recombination (110, 283). An

144 interaction of E2 with Smc5/6 may foster the localization of viral DNA to breaks in host

DNA and lead to “accidental” integration. The amount of slow migrating, high molecular weight DNA, which has been termed ‘integrated’ DNA in the literature, is moderately reduced in the absence of Smc6 but not to the extent that extrachromosomal episomes are lost (Figure 4.4). A rapid loss of extrachromosomal episomes would reduce the potential for integration events to occur and lead to selection for cells that already had integrated viral

DNA prior to Smc6 knockdown (Figure 5.3). Future experiments should investigate whether

Smc5/6 is required for the localization of viral genomes to breaks in host chromatin for integration of viral DNA which can lead to the development of cancer.

145

Figure 5.3 Model for the role of Smc5/6 in the HPV episome maintenance

Smc5/6 interacts with the viral E2 protein and may exist in a complex with viral episomes where it recruits host factors for maintenance replication and/or resolution of viral DNA to circularized monomers. It may also localize viral genomes to double strand DNA breaks in host DNA for integration. In the absence of Smc5/6 multimeric viral DNA may be unresolved to the monomeric form and there may be selection for cells with already integrated viral DNA.

146

5.7 Antiviral factors in HPV infection

My studies suggest that Smc5/6 supports human papillomavirus maintenance replication but may repress initial, transient replication. This suggests distinct roles for the

Smc5/6 complex during different parts of the PV replication cycle. Similarly, host factor

FANCD2 has also been suggested to play both beneficial and antiviral roles in HPV infection. Studies indicate that FANCD2 is required for maintenance of HPV31 episomes in

CIN612 cells; however, knockdown of FANCD2 resulted in enhanced HPV vegetative genome amplification for HPV16 and HPV31 when cells were differentiated by organotypic raft culture(140, 235). These studies suggest that papillomaviruses might associate with an inimical host factor to gain access to beneficial activities at another point in the viral life cycle.

Soon after infection, many DNA viruses localize to ND10 bodies. Viral genomes of double-stranded DNA viruses are closely associated with ND10 bodies where transcription and replication of viral DNA may be regulated. ND10 bodies may act as nuclear scaffolds to which other proteins can bind and modulate DNA-related activities(284). Here, ND10 bodies influence the early replication and transcription of HSV, adenovirus, CMV, SV40, and papillomavirus during productive infection(178). While the ND10 machinery is generally thought to be antiviral, some studies suggest that they may also play positive roles in the viral life cycle. ND10 component, PML, facilitates establishment of an HSV replication domain in the nucleus while also acting as an antiviral effector of interferon-β(285, 286). In the case of human papillomaviruses, HPV18 infection of primary human keratinocytes was impaired in the absence of PML. While PML may play a positive role in HPV infection, ND10 component, Sp100 represses initial transcription and replication of incoming HPV18

147 genomes(162, 183, 185). ND10/PML bodies may function as a nuclear depot where viruses have access to DNA replication machinery despite an initial tradeoff in viral fitness due to repressive roles of other ND10 components. Smc5/6 has previously been indicated to act as an antiviral factor in concert with ND10 machinery during hepatitis B virus infection(108,

138, 146, 172). In the case of HPV, association with ND10 components limits viral genome establishment, and initial transcription and replication from incoming genomes(162, 183,

185). Given the possible increase in E1/E2-mediated DNA replication in the absence of

Smc6, future work should determine whether these antiviral activities of Sp100 also involve

Smc5/6.

The work in this dissertation and the work of others suggests that there may be different types of viral DNA foci(140, 162). Here, Smc5/6 was primarily recruited to viral

DNA in cells that had a singular large focus of over 1.5µM and was present at cells with numerous small foci at a much lower rate. Similarly, PML and Sp100 are internalized within

PV DNA replication factories only within cells that contain large viral DNA foci. Sp100 was consistently observed only within the largest replication factories, and in the case of small viral DNA foci, PML and Sp100 were arranged in a satellite configuration around viral

DNA(162). This suggests a similar configuration between Smc5/6 and ND10 components in

CIN612 cells, where these host proteins are preferentially localized within large viral replication compartments. Here, ND10 bodies may function as a nuclear scaffold for the assembly of large viral DNA replication compartments where DDR and HR machinery can be recruited. This model has been suggested for JC virus, where PML nuclear bodies provide structural support for JCV replication (287).

148

The mechanism by which viral DNA is trafficked to ND10 is unclear and it is possible that it is facilitated by Smc5/6. Thus, the association of viral DNA with ND10 machinery in the absence of Smc5/6 should be assessed. In most cases, localization of viral genomes to ND10 bodies requires the viral origin of replication and expression of the viral protein required for transcription and replication. For example, SV40 requires the origin of replication and the T antigen, and HSV requires the origin of replication and the viral proteins ICP4 (288, 289). The minimal requirements for localization of HBV and HPV genomes to ND10 bodies are currently unknown. In the case of papillomaviruses, the viral origin of replication and viral DNA regulatory protein, E2, could similarly be required for the recruitment of PV replication foci to ND10 bodies. Previous studies indicate that PV replication foci do not form in the absence of the viral E2 protein, suggesting that E2 will likely be a requirement for association of viral DNA with the ND10 nuclear scaffold. In this dissertation, Daxx and pH2AX co-localization was reduced in HPV31-positive cells the absence of Smc5/6. Smc5/6 depletion may disrupt the formation of viral replication compartments containing both advantageous and antiviral host proteins. The role of the

Smc5/6 – E2 interaction in the formation of viral replication foci at ND10 bodies and HR machinery should be investigated in future work. After establishment of the viral genome to a low copy number, viral piracy of Smc5/6 and other HR/APB components in the ND10 depot may contribute to maintenance of circularized viral extrachromosomal monomers.

5.8 Conclusions

In summary, this work confirmed the interaction of the papillomavirus E2 protein with the host complex, Smc5/6. This complex, along with numerous other components of the

DNA damage and homologous recombination pathways are present at viral replication foci,

149 and many studies suggest that these host factors play roles in the papillomavirus life cycle.

The E2 – Smc5/6 interaction may represent a mechanism by which papillomaviruses have evolved to exploit host cell pathways and interaction networks for their own replication.

Identification of Smc5/6 as a requirement for viral episome maintenance suggests a mechanism for long-term persistence of extrachromosomal episomes. Future studies should address whether the SUMOylation function of the MMS21 component of the complex or its

DNA-binding/ATPase activity are required for its functions in the papillomavirus life cycle.

Further investigation into the mechanisms of the many regulatory activities of the viral E2 protein will advance our understanding of HPV biology and generate new research strategies for antiviral therapeutics to counteract persistent infection.

150

References

1. Tan MJA. 2013. Identification of the Cellular Proteins and Pathways Engaged by the Bovine Papillomavirus Type 1 E6 and E7 Proteins. PhD in Virology. Harvard University, Dissertation.

2. Parkin DM. 2006. The global health burden of infection-associated cancers in the year 2002. Int J Cancer 118:3030-3044.

3. Chang Y, Moore PS, Weiss RA. 2017. Human oncogenic viruses: nature and discovery. Philos Trans R Soc Lond B Biol Sci 372.

4. Grulich AE, Jin F, Poynten IM, Vajdic CM. 2011. HIV, cancer, and aging. Sex Health 8:521-525.

5. Bouvard V, Baan R, Straif K, Grosse Y, Secretan B, El Ghissassi F, Benbrahim- Tallaa L, Guha N, Freeman C, Galichet L, Cogliano V, Group WHOIAfRoCMW. 2009. A review of human carcinogens--Part B: biological agents. Lancet Oncol 10:321-322.

6. Howley PM, Pfister HJ. 2015. Beta genus papillomaviruses and skin cancer. Virology 479-480:290-296.

7. Borgogna C, Landini MM, Lanfredini S, Doorbar J, Bouwes Bavinck JN, Quint KD, de Koning MN, Genders RE, Gariglio M. 2014. Characterization of skin lesions induced by skin-tropic alpha- and beta-papillomaviruses in a patient with epidermodysplasia verruciformis. Br J Dermatol 171:1550-1554.

8. Tommasino M. 2014. The human papillomavirus family and its role in carcinogenesis. Semin Cancer Biol 26:13-21.

9. Eckert RL, Rorke EA. 1989. Molecular biology of keratinocyte differentiation. Environ Health Perspect 80:109-116.

10. Eckert RL. 1989. Structure, function, and differentiation of the keratinocyte. Physiol Rev 69:1316-1346.

11. Bikle DD, Xie Z, Tu CL. 2012. Calcium regulation of keratinocyte differentiation. Expert Rev Endocrinol Metab 7:461-472.

12. Schiller JT, Day PM, Kines RC. 2010. Current understanding of the mechanism of HPV infection. Gynecol Oncol 118:S12-17.

13. Horvath CA, Boulet GA, Renoux VM, Delvenne PO, Bogers JP. 2010. Mechanisms of cell entry by human papillomaviruses: an overview. Virol J 7:11.

151

14. Richards RM, Lowy DR, Schiller JT, Day PM. 2006. Cleavage of the papillomavirus minor capsid protein, L2, at a furin consensus site is necessary for infection. Proc Natl Acad Sci U S A 103:1522-1527.

15. Munger K, Scheffner M, Huibregtse JM, Howley PM. 1992. Interactions of HPV E6 and E7 oncoproteins with tumour suppressor gene products. Cancer Surv 12:197- 217.

16. Graham SV. 2017. Keratinocyte Differentiation-Dependent Human Papillomavirus Gene Regulation. Viruses 9.

17. Brown DR, Kitchin D, Qadadri B, Neptune N, Batteiger T, Ermel A. 2006. The human papillomavirus type 11 E1--E4 protein is a transglutaminase 3 substrate and induces abnormalities of the cornified cell envelope. Virology 345:290-298.

18. Brown DR, Kjaer SK, Sigurdsson K, Iversen OE, Hernandez-Avila M, Wheeler CM, Perez G, Koutsky LA, Tay EH, Garcia P, Ault KA, Garland SM, Leodolter S, Olsson SE, Tang GW, Ferris DG, Paavonen J, Steben M, Bosch FX, Dillner J, Joura EA, Kurman RJ, Majewski S, Munoz N, Myers ER, Villa LL, Taddeo FJ, Roberts C, Tadesse A, Bryan J, Lupinacci LC, Giacoletti KE, Sings HL, James M, Hesley TM, Barr E. 2009. The impact of quadrivalent human papillomavirus (HPV; types 6, 11, 16, and 18) L1 virus-like particle vaccine on infection and disease due to oncogenic nonvaccine HPV types in generally HPV-naive women aged 16-26 years. J Infect Dis 199:926-935.

19. Jagu S, Karanam B, Gambhira R, Chivukula SV, Chaganti RJ, Lowy DR, Schiller JT, Roden RB. 2009. Concatenated multitype L2 fusion proteins as candidate prophylactic pan-human papillomavirus vaccines. J Natl Cancer Inst 101:782-792.

20. Jagu S, Kwak K, Karanam B, Huh WK, Damotharan V, Chivukula SV, Roden RB. 2013. Optimization of multimeric human papillomavirus L2 vaccines. PLoS One 8:e55538.

21. Schellenbacher C, Roden R, Kirnbauer R. 2009. Chimeric L1-L2 virus-like particles as potential broad-spectrum human papillomavirus vaccines. J Virol 83:10085-10095.

22. Haupt RM, Wheeler CM, Brown DR, Garland SM, Ferris DG, Paavonen JA, Lehtinen MO, Steben M, Joura EA, Giacoletti KE, Radley DR, James MK, Saah AJ, Sings HL, Future I, Investigators II. 2011. Impact of an HPV6/11/16/18 L1 virus-like particle vaccine on progression to cervical intraepithelial neoplasia in seropositive women with HPV16/18 infection. Int J Cancer 129:2632-2642.

23. Pedersen C, Petaja T, Strauss G, Rumke HC, Poder A, Richardus JH, Spiessens B, Descamps D, Hardt K, Lehtinen M, Dubin G, Network HPVVASI. 2007. Immunization of early adolescent females with human papillomavirus type 16 and 18

152

L1 virus-like particle vaccine containing AS04 adjuvant. J Adolesc Health 40:564- 571.

24. Scheffner M, Huibregtse JM, Vierstra RD, Howley PM. 1993. The HPV-16 E6 and E6-AP complex functions as a ubiquitin-protein ligase in the ubiquitination of p53. Cell 75:495-505.

25. Huibregtse JM, Scheffner M, Howley PM. 1993. Localization of the E6-AP regions that direct human papillomavirus E6 binding, association with p53, and ubiquitination of associated proteins. Mol Cell Biol 13:4918-4927.

26. Liu X, Dakic A, Zhang Y, Dai Y, Chen R, Schlegel R. 2009. HPV E6 protein interacts physically and functionally with the cellular telomerase complex. Proc Natl Acad Sci U S A 106:18780-18785.

27. Klingelhutz AJ, Foster SA, McDougall JK. 1996. Telomerase activation by the E6 gene product of human papillomavirus type 16. Nature 380:79-82.

28. Zhang Y, Dakic A, Chen R, Dai Y, Schlegel R, Liu X. 2017. Direct HPV E6/Myc interactions induce histone modifications, Pol II phosphorylation, and hTERT promoter activation. Oncotarget 8:96323-96339.

29. Jones DL, Thompson DA, Munger K. 1997. Destabilization of the RB tumor suppressor protein and stabilization of p53 contribute to HPV type 16 E7-induced apoptosis. Virology 239:97-107.

30. Szalmas A, Tomaic V, Basukala O, Massimi P, Mittal S, Konya J, Banks L. 2017. The PTPN14 Tumor Suppressor Is a Degradation Target of Human Papillomavirus E7. J Virol 91.

31. White EA, Munger K, Howley PM. 2016. High-Risk Human Papillomavirus E7 Proteins Target PTPN14 for Degradation. MBio 7.

32. Schweiger MR, Ottinger M, You J, Howley PM. 2007. Brd4-independent transcriptional repression function of the papillomavirus e2 proteins. J Virol 81:9612- 9622.

33. Francis DA, Schmid SI, Howley PM. 2000. Repression of the integrated papillomavirus E6/E7 promoter is required for growth suppression of cervical cancer cells. J Virol 74:2679-2686.

34. Dowhanick JJ, McBride AA, Howley PM. 1995. Suppression of cellular proliferation by the papillomavirus E2 protein. J Virol 69:7791-7799.

35. Alazawi W, Pett M, Arch B, Scott L, Freeman T, Stanley MA, Coleman N. 2002. Changes in cervical keratinocyte gene expression associated with integration of human papillomavirus 16. Cancer Res 62:6959-6965.

153

36. Pett M, Coleman N. 2007. Integration of high-risk human papillomavirus: a key event in cervical carcinogenesis? J Pathol 212:356-367.

37. Jeon S, Lambert PF. 1995. Integration of human papillomavirus type 16 DNA into the human genome leads to increased stability of E6 and E7 mRNAs: implications for cervical carcinogenesis. Proc Natl Acad Sci U S A 92:1654-1658.

38. Choo KB, Pan CC, Han SH. 1987. Integration of human papillomavirus type 16 into cellular DNA of cervical carcinoma: preferential deletion of the E2 gene and invariable retention of the long control region and the E6/E7 open reading frames. Virology 161:259-261.

39. Arias-Pulido H, Peyton CL, Joste NE, Vargas H, Wheeler CM. 2006. Human papillomavirus type 16 integration in cervical carcinoma in situ and in invasive cervical cancer. J Clin Microbiol 44:1755-1762.

40. Weissenborn SJ, Nindl I, Purdie K, Harwood C, Proby C, Breuer J, Majewski S, Pfister H, Wieland U. 2005. Human papillomavirus-DNA loads in actinic keratoses exceed those in non-melanoma skin cancers. J Invest Dermatol 125:93-97.

41. Yabe Y, Tanimura Y, Sakai A, Hitsumoto T, Nohara N. 1989. Molecular characteristics and physical state of human papillomavirus DNA change with progressing malignancy: studies in a patient with epidermodysplasia verruciformis. Int J Cancer 43:1022-1028.

42. Tan MJ, White EA, Sowa ME, Harper JW, Aster JC, Howley PM. 2012. Cutaneous beta-human papillomavirus E6 proteins bind Mastermind-like coactivators and repress Notch signaling. Proc Natl Acad Sci U S A 109:E1473-1480.

43. Rangarajan A, Talora C, Okuyama R, Nicolas M, Mammucari C, Oh H, Aster JC, Krishna S, Metzger D, Chambon P, Miele L, Aguet M, Radtke F, Dotto GP. 2001. Notch signaling is a direct determinant of keratinocyte growth arrest and entry into differentiation. EMBO J 20:3427-3436.

44. Shen H, McElhinny AS, Cao Y, Gao P, Liu J, Bronson R, Griffin JD, Wu L. 2006. The Notch coactivator, MAML1, functions as a novel coactivator for MEF2C- mediated transcription and is required for normal myogenesis. Genes Dev 20:675- 688.

45. Pfefferle R, Marcuzzi GP, Akgul B, Kasper HU, Schulze F, Haase I, Wickenhauser C, Pfister H. 2008. The human papillomavirus type 8 E2 protein induces skin tumors in transgenic mice. J Invest Dermatol 128:2310-2315.

46. Iftner T, Fuchs PG, Pfister H. 1989. Two independently transforming functions of human papillomavirus 8. Curr Top Microbiol Immunol 144:167-173.

154

47. Arron ST, Ruby JG, Dybbro E, Ganem D, Derisi JL. 2011. Transcriptome sequencing demonstrates that human papillomavirus is not active in cutaneous squamous cell carcinoma. J Invest Dermatol 131:1745-1753.

48. Jackson S, Storey A. 2000. E6 proteins from diverse cutaneous HPV types inhibit apoptosis in response to UV damage. Oncogene 19:592-598.

49. Giampieri S, Storey A. 2004. Repair of UV-induced thymine dimers is compromised in cells expressing the E6 protein from human papillomaviruses types 5 and 18. Br J Cancer 90:2203-2209.

50. Underbrink MP, Howie HL, Bedard KM, Koop JI, Galloway DA. 2008. E6 proteins from multiple human betapapillomavirus types degrade Bak and protect keratinocytes from apoptosis after UVB irradiation. J Virol 82:10408-10417.

51. Quint KD, Genders RE, de Koning MN, Borgogna C, Gariglio M, Bouwes Bavinck JN, Doorbar J, Feltkamp MC. 2015. Human Beta-papillomavirus infection and keratinocyte carcinomas. J Pathol 235:342-354.

52. McBride AA. 2008. Replication and partitioning of papillomavirus genomes. Adv Virus Res 72:155-205.

53. Yang L, Mohr I, Fouts E, Lim DA, Nohaile M, Botchan M. 1993. The E1 protein of bovine papilloma virus 1 is an ATP-dependent DNA helicase. Proc Natl Acad Sci U S A 90:5086-5090.

54. Mohr IJ, Clark R, Sun S, Androphy EJ, MacPherson P, Botchan MR. 1990. Targeting the E1 replication protein to the papillomavirus origin of replication by complex formation with the E2 transactivator. Science 250:1694-1699.

55. Sakakibara N, Mitra R, McBride AA. 2011. The papillomavirus E1 helicase activates a cellular DNA damage response in viral replication foci. J Virol 85:8981- 8995.

56. Clower RV, Fisk JC, Melendy T. 2006. Papillomavirus E1 protein binds to and stimulates human topoisomerase I. J Virol 80:1584-1587.

57. Clower RV, Hu Y, Melendy T. 2006. Papillomavirus E2 protein interacts with and stimulates human topoisomerase I. Virology 348:13-18.

58. Hu Y, Clower RV, Melendy T. 2006. Cellular topoisomerase I modulates origin binding by bovine papillomavirus type 1 E1. J Virol 80:4363-4371.

59. Conger KL, Liu JS, Kuo SR, Chow LT, Wang TS. 1999. Human papillomavirus DNA replication. Interactions between the viral E1 protein and two subunits of human dna polymerase alpha/primase. J Biol Chem 274:2696-2705.

155

60. Kuo SR, Liu JS, Broker TR, Chow LT. 1994. Cell-free replication of the human papillomavirus DNA with homologous viral E1 and E2 proteins and human cell extracts. J Biol Chem 269:24058-24065.

61. Loo YM, Melendy T. 2004. Recruitment of replication protein A by the papillomavirus E1 protein and modulation by single-stranded DNA. J Virol 78:1605- 1615.

62. Melendy T, Sedman J, Stenlund A. 1995. Cellular factors required for papillomavirus DNA replication. J Virol 69:7857-7867.

63. Del Vecchio AM, Romanczuk H, Howley PM, Baker CC. 1992. Transient replication of human papillomavirus DNAs. J Virol 66:5949-5958.

64. Flores ER, Lambert PF. 1997. Evidence for a switch in the mode of human papillomavirus type 16 DNA replication during the viral life cycle. J Virol 71:7167- 7179.

65. Maglennon GA, McIntosh P, Doorbar J. 2011. Persistence of viral DNA in the epithelial basal layer suggests a model for papillomavirus latency following immune regression. Virology 414:153-163.

66. Hoffmann R, Hirt B, Bechtold V, Beard P, Raj K. 2006. Different modes of human papillomavirus DNA replication during maintenance. J Virol 80:4431-4439.

67. Roberts JM, Weintraub H. 1988. Cis-acting negative control of DNA replication in eukaryotic cells. Cell 52:397-404.

68. Kadaja M, Silla T, Ustav E, Ustav M. 2009. Papillomavirus DNA replication - from initiation to genomic instability. Virology 384:360-368.

69. Piirsoo M, Ustav E, Mandel T, Stenlund A, Ustav M. 1996. Cis and trans requirements for stable episomal maintenance of the BPV-1 replicator. EMBO J 15:1- 11.

70. Gilbert DM, Cohen SN. 1987. Bovine papilloma virus plasmids replicate randomly in mouse fibroblasts throughout S phase of the cell cycle. Cell 50:59-68.

71. Ravnan JB, Gilbert DM, Ten Hagen KG, Cohen SN. 1992. Random-choice replication of extrachromosomal bovine papillomavirus (BPV) molecules in heterogeneous, clonally derived BPV-infected cell lines. J Virol 66:6946-6952.

72. Kim K, Lambert PF. 2002. E1 protein of bovine papillomavirus 1 is not required for the maintenance of viral plasmid DNA replication. Virology 293:10-14.

73. Moody CA, Laimins LA. 2009. Human papillomaviruses activate the ATM DNA damage pathway for viral genome amplification upon differentiation. PLoS Pathog 5:e1000605.

156

74. Deng W, Lin BY, Jin G, Wheeler CG, Ma T, Harper JW, Broker TR, Chow LT. 2004. Cyclin/CDK regulates the nucleocytoplasmic localization of the human papillomavirus E1 DNA helicase. J Virol 78:13954-13965.

75. Hubert WG, Lambert PF. 1993. The 23-kilodalton E1 phosphoprotein of bovine papillomavirus type 1 is nonessential for stable plasmid replication in murine C127 cells. J Virol 67:2932-2937.

76. Fradet-Turcotte A, Moody C, Laimins LA, Archambault J. 2010. Nuclear export of human papillomavirus type 31 E1 is regulated by Cdk2 phosphorylation and required for viral genome maintenance. J Virol 84:11747-11760.

77. Spink KM, Laimins LA. 2005. Induction of the human papillomavirus type 31 late promoter requires differentiation but not DNA amplification. J Virol 79:4918-4926.

78. Dasgupta S, Zabielski J, Simonsson M, Burnett S. 1992. Rolling-circle replication of a high-copy BPV-1 plasmid. J Mol Biol 228:1-6.

79. Bastien N, McBride AA. 2000. Interaction of the papillomavirus E2 protein with mitotic chromosomes. Virology 270:124-134.

80. Hegde RS. 2002. The papillomavirus E2 proteins: structure, function, and biology. Annu Rev Biophys Biomol Struct 31:343-360.

81. Lu JZ, Sun YN, Rose RC, Bonnez W, McCance DJ. 1993. Two E2 binding sites (E2BS) alone or one E2BS plus an A/T-rich region are minimal requirements for the replication of the human papillomavirus type 11 origin. J Virol 67:7131-7139.

82. Bouvard V, Storey A, Pim D, Banks L. 1994. Characterization of the human papillomavirus E2 protein: evidence of trans-activation and trans-repression in cervical keratinocytes. EMBO J 13:5451-5459.

83. Schweiger MR, You J, Howley PM. 2006. Bromodomain protein 4 mediates the papillomavirus E2 transcriptional activation function. J Virol 80:4276-4285.

84. Smith JA, Haberstroh FS, White EA, Livingston DM, DeCaprio JA, Howley PM. 2014. SMCX and components of the TIP60 complex contribute to E2 regulation of the HPV E6/E7 promoter. Virology 468-470:311-321.

85. Smith JA, White EA, Sowa ME, Powell ML, Ottinger M, Harper JW, Howley PM. 2010. Genome-wide siRNA screen identifies SMCX, EP400, and Brd4 as E2- dependent regulators of human papillomavirus oncogene expression. Proc Natl Acad Sci U S A 107:3752-3757.

86. McPhillips MG, Oliveira JG, Spindler JE, Mitra R, McBride AA. 2006. Brd4 is required for e2-mediated transcriptional activation but not genome partitioning of all papillomaviruses. J Virol 80:9530-9543.

157

87. You J, Croyle JL, Nishimura A, Ozato K, Howley PM. 2004. Interaction of the bovine papillomavirus E2 protein with Brd4 tethers the viral DNA to host mitotic chromosomes. Cell 117:349-360.

88. Ustav M, Jr., Castaneda FR, Reinson T, Mannik A, Ustav M. 2015. Human Papillomavirus Type 18 cis-Elements Crucial for Segregation and Latency. PLoS One 10:e0135770.

89. Parish JL, Bean AM, Park RB, Androphy EJ. 2006. ChlR1 is required for loading papillomavirus E2 onto mitotic chromosomes and viral genome maintenance. Mol Cell 24:867-876.

90. Kanginakudru S, DeSmet M, Thomas Y, Morgan IM, Androphy EJ. 2015. Levels of the E2 interacting protein TopBP1 modulate papillomavirus maintenance stage replication. Virology 478:129-135.

91. Donaldson MM, Mackintosh LJ, Bodily JM, Dornan ES, Laimins LA, Morgan IM. 2012. An interaction between human papillomavirus 16 E2 and TopBP1 is required for optimum viral DNA replication and episomal genome establishment. J Virol 86:12806-12815.

92. Oliveira JG, Colf LA, McBride AA. 2006. Variations in the association of papillomavirus E2 proteins with mitotic chromosomes. Proc Natl Acad Sci U S A 103:1047-1052.

93. Li R, Botchan MR. 1994. Acidic transcription factors alleviate nucleosome-mediated repression of DNA replication of bovine papillomavirus type 1. Proc Natl Acad Sci U S A 91:7051-7055.

94. Gligoris T, Lowe J. 2016. Structural Insights into Ring Formation of Cohesin and Related Smc Complexes. Trends Cell Biol 26:680-693.

95. Palecek J, Vidot S, Feng M, Doherty AJ, Lehmann AR. 2006. The Smc5-Smc6 DNA repair complex. bridging of the Smc5-Smc6 heads by the KLEISIN, Nse4, and non-Kleisin subunits. J Biol Chem 281:36952-36959.

96. Kanno T, Berta DG, Sjogren C. 2015. The Smc5/6 Complex Is an ATP-Dependent Intermolecular DNA Linker. Cell Rep 12:1471-1482.

97. Thadani R, Uhlmann F, Heeger S. 2012. Condensin, chromatin crossbarring and chromosome condensation. Curr Biol 22:R1012-1021.

98. Mehta GD, Rizvi SM, Ghosh SK. 2012. Cohesin: a guardian of genome integrity. Biochim Biophys Acta 1823:1324-1342.

99. Mehta K, Gunasekharan V, Satsuka A, Laimins LA. 2015. Human papillomaviruses activate and recruit Smc1 cohesin proteins for the differentiation-

158

dependent life cycle through association with CTCF insulators. PLoS Pathog 11:e1004763.

100. Pebernard S, Wohlschlegel J, McDonald WH, Yates JR, 3rd, Boddy MN. 2006. The Nse5-Nse6 dimer mediates DNA repair roles of the Smc5-Smc6 complex. Mol Cell Biol 26:1617-1630.

101. Santa Maria SR, Gangavarapu V, Johnson RE, Prakash L, Prakash S. 2007. Requirement of Nse1, a subunit of the Smc5-Smc6 complex, for Rad52-dependent postreplication repair of UV-damaged DNA in Saccharomyces cerevisiae. Mol Cell Biol 27:8409-8418.

102. Wani S, Maharshi N, Kothiwal D, Mahendrawada L, Kalaivani R, Laloraya S. 2017. Interaction of the Saccharomyces cerevisiae RING-domain protein Nse1 with Nse3 and the Smc5/6 complex is required for chromosome replication and stability. Curr Genet doi:10.1007/s00294-017-0776-6.

103. Hudson JJ, Bednarova K, Kozakova L, Liao C, Guerineau M, Colnaghi R, Vidot S, Marek J, Bathula SR, Lehmann AR, Palecek J. 2011. Interactions between the Nse3 and Nse4 components of the SMC5-6 complex identify evolutionarily conserved interactions between MAGE and EID Families. PLoS One 6:e17270.

104. Duan X, Sarangi P, Liu X, Rangi GK, Zhao X, Ye H. 2009. Structural and functional insights into the roles of the Mms21 subunit of the Smc5/6 complex. Mol Cell 35:657-668.

105. Stephan AK, Kliszczak M, Morrison CG. 2011. The Nse2/Mms21 SUMO ligase of the Smc5/6 complex in the maintenance of genome stability. FEBS Lett 585:2907- 2913.

106. Mahendrawada L, Rai R, Kothiwal D, Laloraya S. 2017. Interplay between Top1 and Mms21/Nse2 mediated sumoylation in stable maintenance of long chromosomes. Curr Genet 63:627-645.

107. Bermudez-Lopez M, Pocino-Merino I, Sanchez H, Bueno A, Guasch C, Almedawar S, Bru-Virgili S, Gari E, Wyman C, Reverter D, Colomina N, Torres-Rosell J. 2015. ATPase-dependent control of the Mms21 SUMO ligase during DNA repair. PLoS Biol 13:e1002089.

108. Decorsiere A, Mueller H, van Breugel PC, Abdul F, Gerossier L, Beran RK, Livingston CM, Niu C, Fletcher SP, Hantz O, Strubin M. 2016. Hepatitis B virus X protein identifies the Smc5/6 complex as a host restriction factor. Nature 531:386- 389.

109. Gerossier L, Decorsiere A, Abdul F, Hantz O. 2016. A new restriction factor against HBV infection: the SMC5/6 complex. Med Sci (Paris) 32:808-812.

159

110. Peng XP, Lim S, Li S, Marjavaara L, Chabes A, Zhao X. 2018. Acute Smc5/6 depletion reveals its primary role in rDNA replication by restraining recombination at fork pausing sites. PLoS Genet 14:e1007129.

111. Lehmann AR, Walicka M, Griffiths DJ, Murray JM, Watts FZ, McCready S, Carr AM. 1995. The rad18 gene of Schizosaccharomyces pombe defines a new subgroup of the SMC superfamily involved in DNA repair. Mol Cell Biol 15:7067- 7080.

112. Cost GJ, Cozzarelli NR. 2006. Smc5p promotes faithful chromosome transmission and DNA repair in Saccharomyces cerevisiae. Genetics 172:2185-2200.

113. McDonald WH, Pavlova Y, Yates JR, 3rd, Boddy MN. 2003. Novel essential DNA repair proteins Nse1 and Nse2 are subunits of the fission yeast Smc5-Smc6 complex. J Biol Chem 278:45460-45467.

114. Hu B, Liao C, Millson SH, Mollapour M, Prodromou C, Pearl LH, Piper PW, Panaretou B. 2005. Qri2/Nse4, a component of the essential Smc5/6 DNA repair complex. Mol Microbiol 55:1735-1750.

115. Almedawar S, Colomina N, Bermudez-Lopez M, Pocino-Merino I, Torres-Rosell J. 2012. A SUMO-dependent step during establishment of sister chromatid cohesion. Curr Biol 22:1576-1581.

116. Bermudez-Lopez M, Ceschia A, de Piccoli G, Colomina N, Pasero P, Aragon L, Torres-Rosell J. 2010. The Smc5/6 complex is required for dissolution of DNA- mediated sister chromatid linkages. Nucleic Acids Res 38:6502-6512.

117. Torres-Rosell J, Machin F, Farmer S, Jarmuz A, Eydmann T, Dalgaard JZ, Aragon L. 2005. SMC5 and SMC6 genes are required for the segregation of repetitive chromosome regions. Nat Cell Biol 7:412-419.

118. Bustard DE, Menolfi D, Jeppsson K, Ball LG, Dewey SC, Shirahige K, Sjogren C, Branzei D, Cobb JA. 2012. During replication stress, non-SMC element 5 (NSE5) is required for Smc5/6 protein complex functionality at stalled forks. J Biol Chem 287:11374-11383.

119. Branzei D, Sollier J, Liberi G, Zhao X, Maeda D, Seki M, Enomoto T, Ohta K, Foiani M. 2006. Ubc9- and mms21-mediated sumoylation counteracts recombinogenic events at damaged replication forks. Cell 127:509-522.

120. Ampatzidou E, Irmisch A, O'Connell MJ, Murray JM. 2006. Smc5/6 is required for repair at collapsed replication forks. Mol Cell Biol 26:9387-9401.

121. Lindroos HB, Strom L, Itoh T, Katou Y, Shirahige K, Sjogren C. 2006. Chromosomal association of the Smc5/6 complex reveals that it functions in differently regulated pathways. Mol Cell 22:755-767.

160

122. Potts PR. 2009. The Yin and Yang of the MMS21-SMC5/6 SUMO ligase complex in homologous recombination. DNA Repair (Amst) 8:499-506.

123. De Piccoli G, Cortes-Ledesma F, Ira G, Torres-Rosell J, Uhle S, Farmer S, Hwang JY, Machin F, Ceschia A, McAleenan A, Cordon-Preciado V, Clemente- Blanco A, Vilella-Mitjana F, Ullal P, Jarmuz A, Leitao B, Bressan D, Dotiwala F, Papusha A, Zhao X, Myung K, Haber JE, Aguilera A, Aragon L. 2006. Smc5- Smc6 mediate DNA double-strand-break repair by promoting sister-chromatid recombination. Nat Cell Biol 8:1032-1034.

124. Bermudez-Lopez M, Aragon L. 2017. Smc5/6 complex regulates Sgs1 recombination functions. Curr Genet 63:381-388.

125. Potts PR, Porteus MH, Yu H. 2006. Human SMC5/6 complex promotes sister chromatid homologous recombination by recruiting the Smc1/3 cohesin complex to double-strand breaks. EMBO J 25:3377-3388.

126. Irmisch A, Ampatzidou E, Mizuno K, O'Connell MJ, Murray JM. 2009. Smc5/6 maintains stalled replication forks in a recombination-competent conformation. EMBO J 28:144-155.

127. Taylor EM, Moghraby JS, Lees JH, Smit B, Moens PB, Lehmann AR. 2001. Characterization of a novel human SMC heterodimer homologous to the Schizosaccharomyces pombe Rad18/Spr18 complex. Mol Biol Cell 12:1583-1594.

128. Gallego-Paez LM, Tanaka H, Bando M, Takahashi M, Nozaki N, Nakato R, Shirahige K, Hirota T. 2014. Smc5/6-mediated regulation of replication progression contributes to chromosome assembly during mitosis in human cells. Mol Biol Cell 25:302-317.

129. Pebernard S, Schaffer L, Campbell D, Head SR, Boddy MN. 2008. Localization of Smc5/6 to centromeres and telomeres requires heterochromatin and SUMO, respectively. EMBO J 27:3011-3023.

130. Potts PR, Yu H. 2007. The SMC5/6 complex maintains telomere length in ALT cancer cells through SUMOylation of telomere-binding proteins. Nat Struct Mol Biol 14:581-590.

131. Wu SY, Lee AY, Hou SY, Kemper JK, Erdjument-Bromage H, Tempst P, Chiang CM. 2006. Brd4 links chromatin targeting to HPV transcriptional silencing. Genes Dev 20:2383-2396.

132. Jang MK, Anderson DE, van Doorslaer K, McBride AA. 2015. A proteomic approach to discover and compare interacting partners of papillomavirus E2 proteins from diverse phylogenetic groups. Proteomics 15:2038-2050.

133. White EA, Kramer RE, Tan MJ, Hayes SD, Harper JW, Howley PM. 2012. Comprehensive analysis of host cellular interactions with human papillomavirus E6

161

proteins identifies new E6 binding partners and reflects viral diversity. J Virol 86:13174-13186.

134. White EA, Sowa ME, Tan MJ, Jeudy S, Hayes SD, Santha S, Munger K, Harper JW, Howley PM. 2012. Systematic identification of interactions between host cell proteins and E7 oncoproteins from diverse human papillomaviruses. Proc Natl Acad Sci U S A 109:E260-267.

135. Huttlin EL, Ting L, Bruckner RJ, Gebreab F, Gygi MP, Szpyt J, Tam S, Zarraga G, Colby G, Baltier K, Dong R, Guarani V, Vaites LP, Ordureau A, Rad R, Erickson BK, Wuhr M, Chick J, Zhai B, Kolippakkam D, Mintseris J, Obar RA, Harris T, Artavanis-Tsakonas S, Sowa ME, De Camilli P, Paulo JA, Harper JW, Gygi SP. 2015. The BioPlex Network: A Systematic Exploration of the Human Interactome. Cell 162:425-440.

136. Muller M, Demeret C. 2012. The HPV E2-Host Protein-Protein Interactions: A Complex Hijacking of the Cellular Network. Open Virol J 6:173-189.

137. De Piccoli G, Torres-Rosell J, Aragon L. 2009. The unnamed complex: what do we know about Smc5-Smc6? Chromosome Res 17:251-263.

138. Niu C, Livingston CM, Li L, Beran RK, Daffis S, Ramakrishnan D, Burdette D, Peiser L, Salas E, Ramos H, Yu M, Cheng G, Strubin M, Delaney WI, Fletcher SP. 2017. The Smc5/6 Complex Restricts HBV when Localized to ND10 without Inducing an Innate Immune Response and Is Counteracted by the HBV X Protein Shortly after Infection. PLoS One 12:e0169648.

139. Edwards TG, Vidmar TJ, Koeller K, Bashkin JK, Fisher C. 2013. DNA damage repair genes controlling human papillomavirus (HPV) episome levels under conditions of stability and extreme instability. PLoS One 8:e75406.

140. Spriggs CC, Laimins LA. 2017. FANCD2 Binds Human Papillomavirus Genomes and Associates with a Distinct Set of DNA Repair Proteins to Regulate Viral Replication. MBio 8.

141. Edwards TG, Helmus MJ, Koeller K, Bashkin JK, Fisher C. 2013. Human papillomavirus episome stability is reduced by aphidicolin and controlled by DNA damage response pathways. J Virol 87:3979-3989.

142. Pittayakhajonwut D. 2010. DNA Replication and Genome Maintenance of Human Papillomavirus Type 16 in Mammalian CellsUniversity of Nebraska - Lincoln, School of at DigitalCommons@University of Nebraska - Lincoln.

143. Rogers A. 2013. Telomere-Related Factors and Human Papillomavirus Genome MaintenanceUniversity of Nebraska - Lincoln, DigitalCommons@University of Nebraska - Lincoln.

162

144. Scheffner M, Werness BA, Huibregtse JM, Levine AJ, Howley PM. 1990. The E6 oncoprotein encoded by human papillomavirus types 16 and 18 promotes the degradation of p53. Cell 63:1129-1136.

145. White EA, Walther J, Javanbakht H, Howley PM. 2014. Genus beta human papillomavirus E6 proteins vary in their effects on the transactivation of p53 target genes. J Virol 88:8201-8212.

146. Murphy CM, Xu Y, Li F, Nio K, Reszka-Blanco N, Li X, Wu Y, Yu Y, Xiong Y, Su L. 2016. Hepatitis B Virus X Protein Promotes Degradation of SMC5/6 to Enhance HBV Replication. Cell Rep 16:2846-2854.

147. Vignard J, Charbonnel C, Masson JY. 2011. Partners apart: Smc6-independent DNA binding activity of Smc5 on single-strand DNA. Cell Cycle 10:1025-1026.

148. McBride AA. 2013. The papillomavirus E2 proteins. Virology 445:57-79.

149. Lambert PF, Monk BC, Howley PM. 1990. Phenotypic analysis of bovine papillomavirus type 1 E2 repressor mutants. J Virol 64:950-956.

150. Powell ML, Smith JA, Sowa ME, Harper JW, Iftner T, Stubenrauch F, Howley PM. 2010. NCoR1 mediates papillomavirus E8;E2C transcriptional repression. J Virol 84:4451-4460.

151. Hubbert NL, Schiller JT, Lowy DR, Androphy EJ. 1988. Bovine papilloma virus- transformed cells contain multiple E2 proteins. Proc Natl Acad Sci U S A 85:5864- 5868.

152. Riese DJ, 2nd, Settleman J, Neary K, DiMaio D. 1990. Bovine papillomavirus E2 repressor mutant displays a high-copy-number phenotype and enhanced transforming activity. J Virol 64:944-949.

153. Dickson MA, Hahn WC, Ino Y, Ronfard V, Wu JY, Weinberg RA, Louis DN, Li FP, Rheinwald JG. 2000. Human keratinocytes that express hTERT and also bypass a p16(INK4a)-enforced mechanism that limits life span become immortal yet retain normal growth and differentiation characteristics. Mol Cell Biol 20:1436-1447.

154. Tsuyama T, Inou K, Seki M, Seki T, Kumata Y, Kobayashi T, Kimura K, Hanaoka F, Enomoto T, Tada S. 2006. Chromatin loading of Smc5/6 is induced by DNA replication but not by DNA double-strand breaks. Biochem Biophys Res Commun 351:935-939.

155. Jeppsson K, Carlborg KK, Nakato R, Berta DG, Lilienthal I, Kanno T, Lindqvist A, Brink MC, Dantuma NP, Katou Y, Shirahige K, Sjogren C. 2014. The chromosomal association of the Smc5/6 complex depends on cohesion and predicts the level of sister chromatid entanglement. PLoS Genet 10:e1004680.

163

156. Anacker DC, Moody CA. 2017. Modulation of the DNA damage response during the life cycle of human papillomaviruses. Virus Res 231:41-49.

157. Gillespie KA, Mehta KP, Laimins LA, Moody CA. 2012. Human papillomaviruses recruit cellular DNA repair and homologous recombination factors to viral replication centers. J Virol 86:9520-9526.

158. Binz SK, Sheehan AM, Wold MS. 2004. Replication protein A phosphorylation and the cellular response to DNA damage. DNA Repair (Amst) 3:1015-1024.

159. Ruff P, Donnianni RA, Glancy E, Oh J, Symington LS. 2016. RPA Stabilization of Single-Stranded DNA Is Critical for Break-Induced Replication. Cell Rep 17:3359- 3368.

160. Bedell MA, Hudson JB, Golub TR, Turyk ME, Hosken M, Wilbanks GD, Laimins LA. 1991. Amplification of human papillomavirus genomes in vitro is dependent on epithelial differentiation. J Virol 65:2254-2260.

161. Allen-Hoffmann BL, Schlosser SJ, Ivarie CA, Sattler CA, Meisner LF, O'Connor SL. 2000. Normal growth and differentiation in a spontaneously immortalized near-diploid human keratinocyte cell line, NIKS. J Invest Dermatol 114:444-455.

162. Stepp WH, Stamos JD, Khurana S, Warburton A, McBride AA. 2017. Sp100 colocalizes with HPV replication foci and restricts the productive stage of the infectious cycle. PLoS Pathog 13:e1006660.

163. Orav M, Henno L, Isok-Paas H, Geimanen J, Ustav M, Ustav E. 2013. Recombination-dependent oligomerization of human papillomavirus genomes upon transient DNA replication. J Virol 87:12051-12068.

164. McKinney CC, Hussmann KL, McBride AA. 2015. The Role of the DNA Damage Response throughout the Papillomavirus Life Cycle. Viruses 7:2450-2469.

165. Heilman CA, Engel L, Lowy DR, Howley PM. 1982. Virus-specific transcription in bovine papillomavirus-transformed mouse cells. Virology 119:22-34.

166. Bennett EJ, Rush J, Gygi SP, Harper JW. 2010. Dynamics of cullin-RING ubiquitin ligase network revealed by systematic quantitative proteomics. Cell 143:951-965.

167. Sowa ME, Bennett EJ, Gygi SP, Harper JW. 2009. Defining the human deubiquitinating enzyme interaction landscape. Cell 138:389-403.

168. Sakai H, Yasugi T, Benson JD, Dowhanick JJ, Howley PM. 1996. Targeted mutagenesis of the human papillomavirus type 16 E2 transactivation domain reveals separable transcriptional activation and DNA replication functions. J Virol 70:1602- 1611.

164

169. Smits JPH, Niehues H, Rikken G, van Vlijmen-Willems I, van de Zande G, Zeeuwen P, Schalkwijk J, van den Bogaard EH. 2017. Immortalized N/TERT keratinocytes as an alternative cell source in 3D human epidermal models. Sci Rep 7:11838.

170. Flores ER, Allen-Hoffmann BL, Lee D, Sattler CA, Lambert PF. 1999. Establishment of the human papillomavirus type 16 (HPV-16) life cycle in an immortalized human foreskin keratinocyte cell line. Virology 262:344-354.

171. Fehrmann F, Laimins LA. 2005. Human papillomavirus type 31 life cycle: methods for study using tissue culture models. Methods Mol Biol 292:317-330.

172. Mitra B, Guo H. 2016. Hepatitis B virus X protein crosses out Smc5/6 complex to maintain covalently closed circular DNA transcription. Hepatology 64:2246-2249.

173. Stepp WH. 2015. The role of nuclear domain 10 proteins in the human papillomavirus lifecycle. Doctor of Philosophy. Georgetown University.

174. Nozaki C, Miyanohara A, Fujiyama A, Hamada F, Ohtomo N, Matsubara K. 1985. Two mammalian cell systems for propagation of the hepatitis B virus genome in extrachromosomal and chromosomally integrated states: production of the surface and e antigens. Gene 38:39-44.

175. Elfassi E, Romet-Lemonne JL, Essex M, Frances-McLane M, Haseltine WA. 1984. Evidence of extrachromosomal forms of hepatitis B viral DNA in a bone marrow culture obtained from a patient recently infected with hepatitis B virus. Proc Natl Acad Sci U S A 81:3526-3528.

176. Pittayakhajonwut D, Angeletti PC. 2008. Analysis of cis-elements that facilitate extrachromosomal persistence of human papillomavirus genomes. Virology 374:304- 314.

177. Keasler VV, Hodgson AJ, Madden CR, Slagle BL. 2007. Enhancement of hepatitis B virus replication by the regulatory X protein in vitro and in vivo. J Virol 81:2656- 2662.

178. Everett RD. 2006. Interactions between DNA viruses, ND10 and the DNA damage response. Cell Microbiol 8:365-374.

179. Lindsay CR, Morozov VM, Ishov AM. 2008. PML NBs (ND10) and Daxx: from nuclear structure to protein function. Front Biosci 13:7132-7142.

180. Maul GG, Negorev D, Bell P, Ishov AM. 2000. Review: properties and assembly mechanisms of ND10, PML bodies, or PODs. J Struct Biol 129:278-287.

181. Livingston CM, Ramakrishnan D, Strubin M, Fletcher SP, Beran RK. 2017. Identifying and Characterizing Interplay between Hepatitis B Virus X Protein and Smc5/6. Viruses 9.

165

182. Schreiner S, Nassal M. 2017. A Role for the Host DNA Damage Response in Hepatitis B Virus cccDNA Formation-and Beyond? Viruses 9.

183. Stepp WH, Meyers JM, McBride AA. 2013. Sp100 provides intrinsic immunity against human papillomavirus infection. MBio 4:e00845-00813.

184. Porter SS, Stepp WH, Stamos JD, McBride AA. 2017. Host cell restriction factors that limit transcription and replication of human papillomavirus. Virus Res 231:10- 20.

185. Habiger C, Jager G, Walter M, Iftner T, Stubenrauch F. 2016. Interferon Kappa Inhibits Human Papillomavirus 31 Transcription by Inducing Sp100 Proteins. J Virol 90:694-704.

186. Pan W-W, Fan H-Y, Zhou J-J, Liu X-M, Xu Y, Guo L-J, Yu C, Shi Q-H. 2013. Death Domain-associated Protein DAXX Promotes Ovarian Cancer Development and Chemoresistance. THE JOURNAL OF BIOLOGICAL CHEMISTRY 288:13620- 13630.

187. Everett RD, Parada C, Gripon P, Sirma H, Orr A. 2008. Replication of ICP0-null mutant herpes simplex virus type 1 is restricted by both PML and Sp100. J Virol 82:2661-2672.

188. Negorev DG, Vladimirova OV, Maul GG. 2009. Differential functions of interferon-upregulated Sp100 isoforms: herpes simplex virus type 1 promoter-based immediate-early gene suppression and PML protection from ICP0-mediated degradation. J Virol 83:5168-5180.

189. Kim YE, Lee JH, Kim ET, Shin HJ, Gu SY, Seol HS, Ling PD, Lee CH, Ahn JH. 2011. Human cytomegalovirus infection causes degradation of Sp100 proteins that suppress viral gene expression. J Virol 85:11928-11937.

190. Adler M, Tavalai N, Muller R, Stamminger T. 2011. Human cytomegalovirus immediate-early gene expression is restricted by the nuclear domain 10 component Sp100. J Gen Virol 92:1532-1538.

191. Tavalai N, Adler M, Scherer M, Riedl Y, Stamminger T. 2011. Evidence for a dual antiviral role of the major nuclear domain 10 component Sp100 during the immediate-early and late phases of the human cytomegalovirus replication cycle. J Virol 85:9447-9458.

192. Kovelman R, Bilter GK, Glezer E, Tsou AY, Barbosa MS. 1996. Enhanced transcriptional activation by E2 proteins from the oncogenic human papillomaviruses. J Virol 70:7549-7560.

193. Steele BK, Meyers C, Ozbun MA. 2002. Variable expression of some "housekeeping" genes during human keratinocyte differentiation. Anal Biochem 307:341-347.

166

194. Potts PR, Porteus MH, Yu H. 2006. Human SMC5/6 complex promotes sister chromatid homologous recombination by recruiting the Smc1/3 cohesin complex to double-strand breaks. The EMBO Journal 25:3377-3388.

195. Taylor EM, Copsey AC, Hudson JJ, Vidot S, Lehmann AR. 2008. Identification of the proteins, including MAGEG1, that make up the human SMC5-6 protein complex. Mol Cell Biol 28:1197-1206.

196. Sekhar V, Reed SC, McBride AA. 2010. Interaction of the betapapillomavirus E2 tethering protein with mitotic chromosomes. J Virol 84:543-557.

197. McBride AA, Sakakibara N, Stepp WH, Jang MK. 2012. Hitchhiking on host chromatin: how papillomaviruses persist. Biochim Biophys Acta 1819:820-825.

198. Hirt B. 1967. Selective extraction of polyoma DNA from infected mouse cell cultures. J Mol Biol 26:365-369.

199. Fehrmann F, Klumpp DJ, Laimins LA. 2003. Human papillomavirus type 31 E5 protein supports cell cycle progression and activates late viral functions upon epithelial differentiation. J Virol 77:2819-2831.

200. Kgatle MM, Spearman CW, Kalla AA, Hairwadzi HN. 2017. DNA Oncogenic Virus-Induced Oxidative Stress, Genomic Damage, and Aberrant Epigenetic Alterations. Oxid Med Cell Longev 2017:3179421.

201. Weitzman MD, Carson CT, Schwartz RA, Lilley CE. 2004. Interactions of viruses with the cellular DNA repair machinery. DNA Repair (Amst) 3:1165-1173.

202. Deng X, Yan Z, Cheng F, Engelhardt JF, Qiu J. 2016. Replication of an Autonomous Human Parvovirus in Non-dividing Human Airway Epithelium Is Facilitated through the DNA Damage and Repair Pathways. PLoS Pathog 12:e1005399.

203. Wyman C, Ristic D, Kanaar R. 2004. Homologous recombination-mediated double-strand break repair. DNA Repair (Amst) 3:827-833.

204. Blackford AN, Jackson SP. 2017. ATM, ATR, and DNA-PK: The Trinity at the Heart of the DNA Damage Response. Mol Cell 66:801-817.

205. Abraham RT. 2004. PI 3-kinase related kinases: 'big' players in stress-induced signaling pathways. DNA Repair (Amst) 3:883-887.

206. Clouaire T, Marnef A, Legube G. 2017. Taming Tricky DSBs: ATM on duty. DNA Repair (Amst) 56:84-91.

207. Hammond EM, Giaccia AJ. 2004. The role of ATM and ATR in the cellular response to hypoxia and re-oxygenation. DNA Repair (Amst) 3:1117-1122.

167

208. Zhou Y, Lee JH, Jiang W, Crowe JL, Zha S, Paull TT. 2017. Regulation of the DNA Damage Response by DNA-PKcs Inhibitory Phosphorylation of ATM. Mol Cell 65:91-104.

209. Chun HH, Gatti RA. 2004. Ataxia-telangiectasia, an evolving phenotype. DNA Repair (Amst) 3:1187-1196.

210. Kurz EU, Lees-Miller SP. 2004. DNA damage-induced activation of ATM and ATM-dependent signaling pathways. DNA Repair (Amst) 3:889-900.

211. Wright WD, Shah SS, Heyer WD. 2018. Homologous recombination and the repair of DNA Double-Strand Breaks. J Biol Chem doi:10.1074/jbc.TM118.000372.

212. Fernandez-Capetillo O, Lee A, Nussenzweig M, Nussenzweig A. 2004. H2AX: the histone guardian of the genome. DNA Repair (Amst) 3:959-967.

213. Mochan TA, Venere M, DiTullio RA, Jr., Halazonetis TD. 2004. 53BP1, an activator of ATM in response to DNA damage. DNA Repair (Amst) 3:945-952.

214. Giglia-Mari G, Zotter A, Vermeulen W. 2011. DNA damage response. Cold Spring Harb Perspect Biol 3:a000745.

215. Ting NS, Lee WH. 2004. The DNA double-strand break response pathway: becoming more BRCAish than ever. DNA Repair (Amst) 3:935-944.

216. Li R, Zhu J, Xie Z, Liao G, Liu J, Chen MR, Hu S, Woodard C, Lin J, Taverna SD, Desai P, Ambinder RF, Hayward GS, Qian J, Zhu H, Hayward SD. 2011. Conserved herpesvirus kinases target the DNA damage response pathway and TIP60 histone acetyltransferase to promote virus replication. Cell Host Microbe 10:390-400.

217. Taylor TJ, Knipe DM. 2004. Proteomics of herpes simplex virus replication compartments: association of cellular DNA replication, repair, recombination, and chromatin remodeling proteins with ICP8. J Virol 78:5856-5866.

218. Lilley CE, Carson CT, Muotri AR, Gage FH, Weitzman MD. 2005. DNA repair proteins affect the lifecycle of herpes simplex virus 1. Proc Natl Acad Sci U S A 102:5844-5849.

219. Heiser K, Nicholas C, Garcea RL. 2016. Activation of DNA damage repair pathways by murine polyomavirus. Virology 497:346-356.

220. Tsang SH, Wang X, Li J, Buck CB, You J. 2014. Host DNA damage response factors localize to merkel cell polyomavirus DNA replication sites to support efficient viral DNA replication. J Virol 88:3285-3297.

221. Justice JL, Verhalen B, Jiang M. 2015. Polyomavirus interaction with the DNA damage response. Virol Sin 30:122-129.

168

222. Verhalen B, Justice JL, Imperiale MJ, Jiang M. 2015. Viral DNA replication- dependent DNA damage response activation during BK polyomavirus infection. J Virol 89:5032-5039.

223. Sowd GA, Li NY, Fanning E. 2013. ATM and ATR activities maintain replication fork integrity during SV40 chromatin replication. PLoS Pathog 9:e1003283.

224. Boichuk S, Hu L, Hein J, Gjoerup OV. 2010. Multiple DNA damage signaling and repair pathways deregulated by simian virus 40 large T antigen. J Virol 84:8007- 8020.

225. Hein J, Boichuk S, Wu J, Cheng Y, Freire R, Jat PS, Roberts TM, Gjoerup OV. 2009. Simian virus 40 large T antigen disrupts genome integrity and activates a DNA damage response via Bub1 binding. J Virol 83:117-127.

226. Evans JD, Hearing P. 2005. Relocalization of the Mre11-Rad50-Nbs1 complex by the adenovirus E4 ORF3 protein is required for viral replication. J Virol 79:6207- 6215.

227. Mathew SS, Bridge E. 2008. Nbs1-dependent binding of Mre11 to adenovirus E4 mutant viral DNA is important for inhibiting DNA replication. Virology 374:11-22.

228. Mathew SS, Bridge E. 2007. The cellular Mre11 protein interferes with adenovirus E4 mutant DNA replication. Virology 365:346-355.

229. Johnson BA, Aloor HL, Moody CA. 2017. The Rb binding domain of HPV31 E7 is required to maintain high levels of DNA repair factors in infected cells. Virology 500:22-34.

230. Anacker DC, Aloor HL, Shepard CN, Lenzi GM, Johnson BA, Kim B, Moody CA. 2016. HPV31 utilizes the ATR-Chk1 pathway to maintain elevated RRM2 levels and a replication-competent environment in differentiating Keratinocytes. Virology 499:383-396.

231. Fradet-Turcotte A, Bergeron-Labrecque F, Moody CA, Lehoux M, Laimins LA, Archambault J. 2011. Nuclear accumulation of the papillomavirus E1 helicase blocks S-phase progression and triggers an ATM-dependent DNA damage response. J Virol 85:8996-9012.

232. Reinson T, Toots M, Kadaja M, Pipitch R, Allik M, Ustav E, Ustav M. 2013. Engagement of the ATR-dependent DNA damage response at the human papillomavirus 18 replication centers during the initial amplification. J Virol 87:951- 964.

233. Banerjee NS, Wang HK, Broker TR, Chow LT. 2011. Human papillomavirus (HPV) E7 induces prolonged G2 following S phase reentry in differentiated human keratinocytes. J Biol Chem 286:15473-15482.

169

234. Anacker DC, Gautam D, Gillespie KA, Chappell WH, Moody CA. 2014. Productive replication of human papillomavirus 31 requires DNA repair factor Nbs1. J Virol 88:8528-8544.

235. Hoskins EE, Morris TA, Higginbotham JM, Spardy N, Cha E, Kelly P, Williams DA, Wikenheiser-Brokamp KA, Duensing S, Wells SI. 2009. Fanconi anemia deficiency stimulates HPV-associated hyperplastic growth in organotypic epithelial raft culture. Oncogene 28:674-685.

236. Hoskins EE, Morreale RJ, Werner SP, Higginbotham JM, Laimins LA, Lambert PF, Brown DR, Gillison ML, Nuovo GJ, Witte DP, Kim MO, Davies SM, Mehta PA, Butsch Kovacic M, Wikenheiser-Brokamp KA, Wells SI. 2012. The fanconi anemia pathway limits human papillomavirus replication. J Virol 86:8131-8138.

237. Sauter SL, Wells SI, Zhang X, Hoskins EE, Davies SM, Myers KC, Mueller R, Panicker G, Unger ER, Sivaprasad U, Brown DR, Mehta PA, Butsch Kovacic M. 2015. Oral human papillomavirus is common in individuals with Fanconi anemia. Cancer Epidemiol Biomarkers Prev 24:864-872.

238. Park S, Park JW, Pitot HC, Lambert PF. 2016. Loss of Dependence on Continued Expression of the Human Papillomavirus 16 E7 Oncogene in Cervical Cancers and Precancerous Lesions Arising in Fanconi Anemia Pathway-Deficient Mice. MBio 7.

239. Kutler DI, Wreesmann VB, Goberdhan A, Ben-Porat L, Satagopan J, Ngai I, Huvos AG, Giampietro P, Levran O, Pujara K, Diotti R, Carlson D, Huryn LA, Auerbach AD, Singh B. 2003. Human papillomavirus DNA and p53 polymorphisms in squamous cell carcinomas from Fanconi anemia patients. J Natl Cancer Inst 95:1718-1721.

240. Kutler DI, Auerbach AD, Satagopan J, Giampietro PF, Batish SD, Huvos AG, Goberdhan A, Shah JP, Singh B. 2003. High incidence of head and neck squamous cell carcinoma in patients with Fanconi anemia. Arch Otolaryngol Head Neck Surg 129:106-112.

241. Park JW, Pitot HC, Strati K, Spardy N, Duensing S, Grompe M, Lambert PF. 2010. Deficiencies in the Fanconi anemia DNA damage response pathway increase sensitivity to HPV-associated head and neck cancer. Cancer Res 70:9959-9968.

242. Romick-Rosendale LE, Hoskins EE, Privette Vinnedge LM, Foglesong GD, Brusadelli MG, Potter SS, Komurov K, Brugmann SA, Lambert PF, Kimple RJ, Virts EL, Hanenberg H, Gillison ML, Wells SI. 2016. Defects in the Fanconi Anemia Pathway in Head and Neck Cancer Cells Stimulate Tumor Cell Invasion through DNA-PK and Rac1 Signaling. Clin Cancer Res 22:2062-2073.

243. Henson JD, Neumann AA, Yeager TR, Reddel RR. 2002. Alternative lengthening of telomeres in mammalian cells. Oncogene 21:598-610.

170

244. Wu G, Jiang X, Lee WH, Chen PL. 2003. Assembly of functional ALT-associated promyelocytic leukemia bodies requires Nijmegen Breakage Syndrome 1. Cancer Res 63:2589-2595.

245. Chung I, Leonhardt H, Rippe K. 2011. De novo assembly of a PML nuclear subcompartment occurs through multiple pathways and induces telomere elongation. J Cell Sci 124:3603-3618.

246. Zeng S, Xiang T, Pandita TK, Gonzalez-Suarez I, Gonzalo S, Harris CC, Yang Q. 2009. Telomere recombination requires the MUS81 endonuclease. Nat Cell Biol 11:616-623.

247. Fan Q, Zhang F, Barrett B, Ren K, Andreassen PR. 2009. A role for monoubiquitinated FANCD2 at telomeres in ALT cells. Nucleic Acids Res 37:1740- 1754.

248. Pan X, Drosopoulos WC, Sethi L, Madireddy A, Schildkraut CL, Zhang D. 2017. FANCM, BRCA1, and BLM cooperatively resolve the replication stress at the ALT telomeres. Proc Natl Acad Sci U S A 114:E5940-E5949.

249. Smogorzewska A, van Steensel B, Bianchi A, Oelmann S, Schaefer MR, Schnapp G, de Lange T. 2000. Control of human telomere length by TRF1 and TRF2. Mol Cell Biol 20:1659-1668.

250. Pittayakhajonwut D. 2010. DNA Replication and Genome Maintenance of Human Papillomavirus Type 16 in Mammalian Cells. University of Nebraska Lincoln, Dissertations and Theses in Biological Sciences.

251. Rogers A. 2013. Telomere-Related Factors and Human Papillomavirus Genome Maintenance. University of Nebraska Lincoln, Dissertations and Theses in Biological Sciences.

252. Spardy N, Duensing A, Hoskins EE, Wells SI, Duensing S. 2008. HPV-16 E7 reveals a link between DNA replication stress, fanconi anemia D2 protein, and alternative lengthening of telomere-associated promyelocytic leukemia bodies. Cancer Res 68:9954-9963.

253. Yamamoto A, Kumakura Si, Uchida M, Barrett JC, Tsutsui T. 2003. Immortalization of normal human embryonic fibroblasts by introduction of either the human papillomavirus type 16 E6 or E7 gene alone. International journal of cancer 106:301-309.

254. Stöppler H, Hartmann D-P, Sherman L, Schlegel R. 1997. The human papillomavirus type 16 E6 and E7 oncoproteins dissociate cellular telomerase activity from the maintenance of telomere length. Journal of Biological Chemistry 272:13332-13337.

171

255. Anderson S, Shera K, Ihle J, Billman L, Goff B, Greer B, Tamimi H, McDougall J, Klingelhutz A. 1997. Telomerase activation in cervical cancer. Am J Pathol 151:25-31.

256. Kyo S, Takakura M, Tanaka M, Kanaya T, Inoue M. 1998. Telomerase activity in cervical cancer is quantitatively distinct from that in its precursor lesions. Int J Cancer 79:66-70.

257. Kamranvar SA, Chen X, Masucci MG. 2013. Telomere dysfunction and activation of alternative lengthening of telomeres in B-lymphocytes infected by Epstein-Barr virus. Oncogene 32:5522-5530.

258. Cesare AJ, Griffith JD. 2004. Telomeric DNA in ALT cells is characterized by free telomeric circles and heterogeneous t-loops. Mol Cell Biol 24:9948-9957.

259. Deng Z, Norseen J, Wiedmer A, Riethman H, Lieberman PM. 2009. TERRA RNA binding to TRF2 facilitates heterochromatin formation and ORC recruitment at telomeres. Mol Cell 35:403-413.

260. Deng Z, Wang Z, Stong N, Plasschaert R, Moczan A, Chen HS, Hu S, Wikramasinghe P, Davuluri RV, Bartolomei MS, Riethman H, Lieberman PM. 2012. A role for CTCF and cohesin in subtelomere chromatin organization, TERRA transcription, and telomere end protection. EMBO J 31:4165-4178.

261. Beishline K, Vladimirova O, Tutton S, Wang Z, Deng Z, Lieberman PM. 2017. CTCF driven TERRA transcription facilitates completion of telomere DNA replication. Nat Commun 8:2114.

262. Paris C, Pentland I, Groves I, Roberts DC, Powis SJ, Coleman N, Roberts S, Parish JL. 2015. CCCTC-binding factor recruitment to the early region of the human papillomavirus 18 genome regulates viral oncogene expression. J Virol 89:4770- 4785.

263. Pentland I, Parish JL. 2015. Targeting CTCF to Control Virus Gene Expression: A Common Theme amongst Diverse DNA Viruses. Viruses 7:3574-3585.

264. Jang MK, Shen K, McBride AA. 2014. Papillomavirus genomes associate with BRD4 to replicate at fragile sites in the host genome. PLoS Pathog 10:e1004117.

265. Poddar A, Reed SC, McPhillips MG, Spindler JE, McBride AA. 2009. The human papillomavirus type 8 E2 tethering protein targets the ribosomal DNA loci of host mitotic chromosomes. J Virol 83:640-650.

266. Sekhar V, McBride AA. 2012. Phosphorylation regulates binding of the human papillomavirus type 8 E2 protein to host chromosomes. J Virol 86:10047-10058.

172

267. Sakakibara N, Chen D, Jang MK, Kang DW, Luecke HF, Wu SY, Chiang CM, McBride AA. 2013. Brd4 is displaced from HPV replication factories as they expand and amplify viral DNA. PLoS Pathog 9:e1003777.

268. Bang SW, Kim GS, Hwang DS. 2013. Oligomerization of TopBP1 is necessary for the localization of TopBP1 to mitotic centrosomes. Biochem Biophys Res Commun 436:31-34.

269. Reini K, Uitto L, Perera D, Moens PB, Freire R, Syvaoja JE. 2004. TopBP1 localises to centrosomes in mitosis and to chromosome cores in meiosis. Chromosoma 112:323-330.

270. Xu ZX, Timanova-Atanasova A, Zhao RX, Chang KS. 2003. PML colocalizes with and stabilizes the DNA damage response protein TopBP1. Mol Cell Biol 23:4247-4256.

271. Gauson EJ, Donaldson MM, Dornan ES, Wang X, Bristol M, Bodily JM, Morgan IM. 2015. Evidence supporting a role for TopBP1 and Brd4 in the initiation but not continuation of human papillomavirus 16 E1/E2-mediated DNA replication. J Virol 89:4980-4991.

272. Donaldson MM, Boner W, Morgan IM. 2007. TopBP1 regulates human papillomavirus type 16 E2 interaction with chromatin. J Virol 81:4338-4342.

273. Torres-Rosell J, Sunjevaric I, De Piccoli G, Sacher M, Eckert-Boulet N, Reid R, Jentsch S, Rothstein R, Aragon L, Lisby M. 2007. The Smc5-Smc6 complex and SUMO modification of Rad52 regulates recombinational repair at the ribosomal gene locus. Nat Cell Biol 9:923-931.

274. Baxter J, Aragon L. 2012. A model for chromosome condensation based on the interplay between condensin and topoisomerase II. Trends Genet 28:110-117.

275. Baxter J, Sen N, Martinez VL, De Carandini ME, Schvartzman JB, Diffley JF, Aragon L. 2011. Positive supercoiling of mitotic DNA drives decatenation by topoisomerase II in eukaryotes. Science 331:1328-1332.

276. Smith PP, Friedman CL, Bryant EM, McDougall JK. 1992. Viral integration and fragile sites in human papillomavirus-immortalized human keratinocyte cell lines. Genes Chromosomes Cancer 5:150-157.

277. Cannizzaro LA, Durst M, Mendez MJ, Hecht BK, Hecht F. 1988. Regional chromosome localization of human papillomavirus integration sites near fragile sites, oncogenes, and cancer chromosome breakpoints. Cancer Genet Cytogenet 33:93-98.

278. McBride AA. 2017. Playing with fire: consequences of human papillomavirus DNA replication adjacent to genetically unstable regions of host chromatin. Curr Opin Virol 26:63-68.

173

279. Thorland EC, Myers SL, Persing DH, Sarkar G, McGovern RM, Gostout BS, Smith DI. 2000. Human papillomavirus type 16 integrations in cervical tumors frequently occur in common fragile sites. Cancer Res 60:5916-5921.

280. Gao G, Johnson SH, Vasmatzis G, Pauley CE, Tombers NM, Kasperbauer JL, Smith DI. 2017. Common fragile sites (CFS) and extremely large CFS genes are targets for human papillomavirus integrations and chromosome rearrangements in oropharyngeal squamous cell carcinoma. Genes Chromosomes Cancer 56:59-74.

281. Hu Z, Zhu D, Wang W, Li W, Jia W, Zeng X, Ding W, Yu L, Wang X, Wang L, Shen H, Zhang C, Liu H, Liu X, Zhao Y, Fang X, Li S, Chen W, Tang T, Fu A, Wang Z, Chen G, Gao Q, Li S, Xi L, Wang C, Liao S, Ma X, Wu P, Li K, Wang S, Zhou J, Wang J, Xu X, Wang H, Ma D. 2015. Genome-wide profiling of HPV integration in cervical cancer identifies clustered genomic hot spots and a potential microhomology-mediated integration mechanism. Nat Genet 47:158-163.

282. Wang L, Shen H, Feng B, Zhu D, Yu L, Tian X, Ren C, Gao C, Li X, Ma D, Hu Z, Wang H. 2017. Reduction in the copy number and expression level of the recurrent human papillomavirus integration gene fragile histidine triad (FHIT) predicts the transition of cervical lesions. PLoS One 12:e0175520.

283. Menolfi D, Delamarre A, Lengronne A, Pasero P, Branzei D. 2015. Essential Roles of the Smc5/6 Complex in Replication through Natural Pausing Sites and Endogenous DNA Damage Tolerance. Mol Cell 60:835-846.

284. Ching RW, Dellaire G, Eskiw CH, Bazett-Jones DP. 2005. PML bodies: a meeting place for genomic loci? J Cell Sci 118:847-854.

285. Xu P, Mallon S, Roizman B. 2016. PML plays both inimical and beneficial roles in HSV-1 replication. Proc Natl Acad Sci U S A 113:E3022-3028.

286. Merkl PE, Orzalli MH, Knipe DM. 2018. Mechanisms of Host IFI16, PML, and Daxx Protein Restriction of Herpes Simplex Virus 1 Replication. J Virol 92.

287. Shishido-Hara Y, Higuchi K, Ohara S, Duyckaerts C, Hauw JJ, Uchihara T. 2008. Promyelocytic leukemia nuclear bodies provide a scaffold for human polyomavirus JC replication and are disrupted after development of viral inclusions in progressive multifocal leukoencephalopathy. J Neuropathol Exp Neurol 67:299-308.

288. Tang Q, Bell P, Tegtmeyer P, Maul GG. 2000. Replication but not transcription of simian virus 40 DNA is dependent on nuclear domain 10. J Virol 74:9694-9700.

289. Tang Q, Li L, Ishov AM, Revol V, Epstein AL, Maul GG. 2003. Determination of minimum herpes simplex virus type 1 components necessary to localize transcriptionally active DNA to ND10. J Virol 77:5821-5828.

174