Inhibition of Adaptive Immunity by IL9 Can Be Disrupted to Achieve Rapid T-Cell Sensitization and Rejection of Progressive Tumor Challenges

Published OnlineFirst October 8, 2014; DOI: 10.1158/0008-5472.CAN-14-0836

Cancer Microenvironment and Immunology Research

Inhibition of Adaptive Immunity by IL9 Can Be Disrupted to Achieve Rapid T-cell Sensitization and Rejection of Progressive Tumor Challenges

Dominique B. Hoelzinger1, Ana Lucia Dominguez1, Peter A. Cohen1,2, and Sandra J. Gendler1,2,3

Abstract The tolerogenic cytokine IL9 promotes T regulatory cell function and allergic airway inflammation, but it has not been extensively studied in cancer. In this report, we used IL9-deficient mice to investigate the effects of IL9 in multiple models of breast and colon cancer development. Eliminating endogenous IL9 enabled sensitization of host T cells to tumors, leading to their early rejection without the requirement of vaccines or immunomodulatory therapies. Notably, IL9-deficient mice acquired immunologic memory, which actively protected from residual þ þ þ disease and tumor rechallenge, an effect linked to activation of CD8 T cells. Depletion of either CD8 or CD4 T cells abolished the benefits of IL9 loss to tumor control. Adoptive transfer experiments showed that T cells from tumor-rejecting IL9-deficient mice retained their effector competency in wild-type animals. Moreover, neutralizing IL9 antibody phenocopied the effects of IL9 gene deletion by slowing tumor progression in wild-type animals. Our results show the ability of IL9 to function as an inhibitor of adaptive immunity that prevents the formation of immunologic memory to a growing tumor, highlighting the potential for IL9 neutralization as a unique tool for cancer immunotherapy. Cancer Res; 74(23); 6845–55. 2014 AACR.

Introduction that promote opposite ends of the immune spectrum. For fl IL9 is a paradoxical cytokine, as it mediates both proin- example, proin ammatory Th17 cells can produce IL9 and flammatory events and induction of tolerance. It is secreted by exacerbate experimental autoimmune encephalitis (EAE; a host of proinflammatory immune cells including Th9 cells (1), ref. 12), whereas IL9 secreted by Tregs renders them more þ Th17 cells (2), CD8 Tc9 cells (3), eosinophils, mast cells, and suppressive and protects against EAE (8). These discrepancies innate lymphoid cells (1, 4–7). It is also associated with may be explained by the timing of IL9 secretion in a given pathologic circumstance, and by the range of cells that express tolerogenic cells such as regulatory T cells (Treg). In this þ population, IL9 enhances Treg-suppressive potency in an the IL9 receptor (IL9R). These include Tregs, CD4 T cells, B cells, and dendritic cells (expression data from the Immuno- autocrine fashion (8), while promoting T-cell tolerance via a þ þ – logical Genome Project), as well as CD3 T cells and CD11b paracrine impact upon mast cells (9 11). This wide range of þ action is followed by an equally wide range of pathologies Gr1 cells from tumor-bearing mice. involving IL9 secretion. IL9 also has seemingly contradictory roles in tumor biology. Most commonly, IL9 is linked to Th2 responses such as In many tumors, the presence of IL9 contributes to the parasite expulsion and allergic airway inflammation, but it is establishment of a tolerogenic/immunosuppressive environ- also involved in autoimmunity and graft-versus-host disease ment, or acts directly to drive tumor growth. For example, IL9 (reviewed in ref. 6). Interestingly, IL9 can be secreted by cells promotes the proliferation or survival of human lymphoid tumors such as Hodgkin lymphoma, acute lymphoblastic leukemia, myeloid leukemia, diffuse large B-cell lymphoma, – 1Department of Immunology, Mayo Clinic College of Medicine, Mayo Clinic, and NK T-cell lymphoma (13 18). It also promotes the Scottsdale, Arizona. 2Department of Hematology/Oncology, Mayo Clinic proliferation, migration, and adhesion of human lung cancer 3 College of Medicine, Mayo Clinic, Scottsdale, Arizona. Department of cells (19). However, IL9 has the opposite effect on melanoma Biochemistry and Molecular Biology, Mayo Clinic College of Medicine, Mayo Clinic, Scottsdale, Arizona. biology: it slows subcutaneous growth of B16F10 as well as reduces B16 seeding in the lungs (20, 21); both groups showed Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/). that anti-IL9 opposes this effect. Adoptively transferred IL9- þ secreting CD4 T cells (25% IL9 positivity) reduce melanoma P.A. Cohen and S.J. Gendler contributed equally to this article. growth, in a manner that is very similar to the transfer of Th2- Corresponding Author: Dominique B. Hoelzinger, Mayo Clinic College of polarized T cells (20). In addition, in vitro polarized OT-1 Medicine, Mayo Clinic, 13400 East Shea Boulevard, Scottsdale, AZ 85259. þ Phone: 480-301-6891; Fax: 480-301-9162; E-mail: CD8 T cells (Tc9), adoptively transferred to B16-OVA tumor- [email protected] bearing mice, led to tumor clearance (22). However, the doi: 10.1158/0008-5472.CAN-14-0836 authors point out that 2 weeks after transfer, Tc9 cells loose 2014 American Association for Cancer Research. IL9 expression, and instead, secrete IFNg, suggesting a

www.aacrjournals.org 6845

Hoelzinger et al.

repolarization to a Tc1 phenotype, which could explain the cells. Tumors were measured twice weekly and mice were efficient tumor clearance. In the B16 tumor model, IL9 acts on sacrificed when the tumors reached 1 cm2 or showed signs of mast cells, and is not T- or B-cell dependent (20), and also has external necrosis. Tumor volume was calculated from two a direct effect on the lung epithelium, which then recruits perpendicular measurements using the following formula: þ þ dendritic cells (21). [a2 b/2]. For CD4 and CD8 T-cell depletion experiments, Study of the role of IL9 in mammary carcinomas is limited to anti-CD4 and -CD8 antibodies and the corresponding isotype a longitudinal study of soluble factors present in sera of control were delivered intraperitoneally (i.p.) at 125 mg each. patients with breast cancer. Investigators found an increase Mice were pretreated 3 to 4 days before tumor inoculation, and in serum levels of IL9 over time in patients who later developed then subsequently once weekly for 4 weeks. metastatic lesions, suggesting a relationship between IL9 and For IL9 neutralization experiments, WT mice were injected tumor progression, or tumor load (23). s.c. with 2.5 104 4T1 cells and anti-IL9, isotype control Ab (100 In summary, the majority of observations about the role of mg each), or left untreated. Abs were delivered to WT and IL9ko IL9 in tumor biology suggest that it has a tolerogenic role. Here, mice through i.p. injections three times per week for 3 weeks. we show that IL9 is a key factor in establishing a permissive growth environment for CT26, a colon carcinoma cell line and ELISpot assays two murine breast cancer cells lines: TUBO cells that express Splenocytes or lymph node (LN) cells were cocultured with Her2/neu (24) and 4T1 cells (25) that resemble aggressive, tumor cells on IFNg ELISpot Kit plates from Mabtech (cat. no., triple-negative breast cancers. #3321-2HW-Plus) for 40 hours following the manufacturer's instructions. Cell numbers were as follows: 1 105 total splenocytes derived from 4T1-bearing mice with either 5 Materials and Methods 104 4T1 or TUBO cells, 5 104 total LN cells from 4T1-bearing þ þ Mice, cell line, and reagents mice with either 2.5 104 4T1 or TUBO cells. CD4 and CD8 T BALB/c mice were purchased from the NCI (Fredrick, MD). cells were enriched from the spleens of na€ve and 4T1-bearing IL9ko mice were originally generated by Townsend and col- WT and IL9ko mice using a negative isolation kit (Invitrogen). leagues (26). The IL9ko mice used in this study were in a BALB/c T cells (1 105) were cocultured with 2.5 104 4T1 cells or with background (27), and were a gift from Simon P. Hogan (Uni- BM185, a nonspecific control tumor line as above. Each versity of Cincinnati College of Medicine, Cincinnati, OH). experimental condition was executed in biologic triplicates, BALB/neuT mice were generated as previously described which, in turn, comprised triplicate wells. The plates were (24). BALB/neuT/IL9ko mice were created by breeding het- imaged and evaluated by ZellNet Consulting, Inc., and results erozygous BALB/neuT mice with IL9ko mice. F1 mice were expressed as average of triplicate spots per condition. Phorbol genotyped for Neu and IL9ko allele as well as the WT IL9 allele, 12-myristate 13-acetate (PMA) was used as a positive control of using the following primers: (IL9 genotyping F, gcgattcttcct- cell activation. gaaagcag: IL9 genotyping R, accggacacgtgatgttctt; NeomycinF, þ tgtcgatcaggatgatctgg). IL9 / /neuT mice were crossed to Immunohistochemistry IL9ko, and the resulting F2 IL9ko/neuT mice were crossed to 4T1 tumors were harvested from IL9ko and WT mice, IL9ko mice to establish the colony. All mice were housed under formalin-fixed, and paraffin-embedded. Four-micrometer sec- specific pathogen-free conditions. TUBO cells are derivatives of tions were incubated overnight with or without anti-CD8a a spontaneous mammary carcinoma in BALB/neuT mice (24) antibody (Thermo Scientific; MA5-16761) overnight, followed and were obtained from Dr. Guido Forni (Molecular Biotech- by detection using ImmPRESS Reagent Anti-rat IgG, peroxi- nology Center, University of Turin, Torino, Italy). 4T1 are a dase (Vector Labs; MP-7404) followed by DAB substrate kit mammary carcinoma line derived from 410.4 mammary (Vector Labs; SK-4100). Slides were mounted in Permount and tumors. BM 185 cells were derived from bone marrow from visualized with a Leica DMRB microscope. Images were an acute lymphoblastic leukemia model, originally provided by acquired at a magnification of 200 with a numerical aperture D. Kohn (University of Southern California, Los Angeles, CA). of 2 at room temperature with an Olympus DP71 camera using CT26 cells were purchased through the ATCC. All were main- the DPController software (Olympus). tained in complete RPMI-1640 medium supplemented with 10% FCS, 2 mmol/L glutamine, 5 10 5 mol/L 2-ME, and Winn assays 50 mg/mL gentamicin. Anti-IL9 mAb (MM9C1; ref. 28) and its Total splenocytes were harvested from 4T1-bearing WT and isotype control Ab were obtained from Dr. Jacques Van Snick from IL9ko mice that had rejected 1 106 4T1 cells 2 to 3 (Ludwig Institute, Brussels, Belgium). Depleting antibodies months prior, and that were rechallenged with 5 105 4T1 cells were obtained as follows: anti-CD4 (clone GK 1.5; BioLegend), 1 week before the start of the assay. Splenocytes were mixed anti-CD8a (clone 2.43; LifeSpan Biosciences) antibodies, or the with 2.5 104 4T1 cells and coinjected s.c. into WT mice in the þ þ corresponding rat IgG isotype control. CD4 and CD8 T cells following proportions of splenocytes to 4T1 cells: 100:1, 33:1, were enriched using negative selection kits (Invitrogen). and only 4T1. The 100:1 ratio of splenocytes contained þ the following number of T cells: WTþ4T1 ¼ 3.2 105 CD4 þ In vivo tumor studies Tcellsand1.2 105 CD8 Tcells,IL9koþ4T1 ¼ 4.4 105 þ þ Wild-type (WT) and IL9ko mice were implanted subcuta- CD4 T cells and 1.95 105 CD8 T cells. The 33:1 ratio neously (s.c.) with 1 106 TUBO, 1 106 4T1, or 1 105 CT26 of splenocytes contained the following number of T cells:

6846 Cancer Res; 74(23) December 1, 2014 Cancer Research

IL9 Inhibits Adaptive Antitumor Immunity

þ þ WTþ4T1 ¼ 1.1 105 CD4 Tcellsand4 104 CD8 T cells, initial challenge (Fig. 1C, arrow). All the mice failed to develop þ þ IL9koþ4T1 ¼ 1.5 105 CD4 Tcellsand6.5 104 CD8 tumors, suggesting that these rechallenged mice had devel- T cells. Mice were monitored twice a week for tumor growth oped a memory response to TUBO cells. and tumor growth was compared with that of 4T1 cells We repeated this experiment with 4T1 cells, and detected mixedwithsplenocytesderivedfromtumor-bearingWT. palpable tumors 5 days after injection, which grew expo- A repeat experiment was carried out using negatively nentially in WT mice (n ¼ 10; Fig. 1D). In contrast, 68% (15 of þ enriched CD8 T from tumor-bearing and na€ve WT and 22) of IL9ko mice failed to develop or rejected tumors (Fig. IL9ko mice, cells were coinjected with 4T1 cells at a con- 1E). Of the remaining 32% (7 of 22) of IL9ko mice that þ centration of 25:1 (6.25 105 CD8 Tcells:2.5 104 4T1 developed tumors, tumor growth was significantly slower cells). Each experimental cohort consisted of T cells isolated compared with WT mice, and 75% of the IL9ko mice from three individual mice, and each individual isolate survived past day 50 after tumor inoculation (P < 0.0001; Fig. was injected in duplicate, bringing the total per condition 1F). Again, IL9 did not promote 4T1 growth (Supplementary to 6. Fig. S1B), as these cells express very low levels of IL9R, and do not directly secrete IL9 (Supplementary Fig. S1C and Tumor seeding in lungs S1D). To confirm that 4T1 rejection also elicited a memory 4T1 cells (1 104) in 100 mL PBS were injected via the tail response, we rechallenged 8 of the IL9ko mice that rejected vein into WT and IL9ko mice, and mice were monitored for 18 4T1 with 4T1 (Fig. 1F, arrow). As before, all the mice failed to days. During this time 50 ng recombinant IL9 was injected i.p. develop tumors, suggestive of a memory response to 4T1 three times weekly. Mice were sacrificed and lungs inflated cells. None of the IL9ko mice in which original 4T1 tumors with 10% India ink in PBS, and fixed in Feket Solution (100 mL progressed showed any evidence of macrometastasis in the 70% ethanol, 10 mL 10% formalin, and 5 mL acetic acid). All lungs, liver, or spleen (evaluated 80–100 days after injection), tumor foci macroscopically visible through a dissecting micro- which is routinely observed in WT mice. scope were counted. To investigate whether the tumor rejection seen in IL9ko mice was confined to mammary carcinomas, we injected the Statistical analyses colon carcinoma cell line CT26 into both WT (n ¼ 15) and Statistical significance of data was determined in most IL9ko mice (n ¼ 16). CT26 tumors developed in 87% (13 of cases using the Student t test to evaluate the P value. The 15) of WT mice (Fig. 1G), whereas tumors developed in only log-rank (Mantel–Cox) test was used to evaluate significant 25% (4 of 16) of IL9ko mice injected (Fig. 1H). Once more, the differences in survival. For the comparison of differences in tumors that developed in IL9ko mice grew slower than those growth curves, the tumor size was compared over days 9, 12, in WT mice, and 75% of IL9ko mice remained tumor free 30 and 15 between groups using repeated measures ANOVA. days after the initial challenge (P ¼ 0.001). At this point, 10 IL9ko and 2 WT mice were rechallenged with CT26 (Fig. 1I, arrow). No tumor growth was observed in 10 IL9ko mice and Results 1 WT mouse (CT26 tumor developed in the second WT TUBO and 4T1 mammary carcinomas are rejected in mouse), again suggestive of a memory response in IL9ko IL9ko mice mice. We previously demonstrated that neutralization of IL9 in conjunction with intratumoral CpG-ODN administration led IL9 deficiency leads to delayed onset of autochthonous to tumor rejection in two tolerant tumor models (29). We now mammary tumors in Her2/neu transgenic mice used IL9ko mice (26) to further investigate the role of IL9 in To examine whether IL9 deficiency also had an effect on inhibiting antitumor immune activity. Injection (s.c.) of TUBO growth of autochthonous tumors, we used BALB/neuT mice cells in the flank of BALB/c (WT) mice resulted in robust tumor (24), which develop aggressive, autochthonous mammary growth within 10 days after tumor delivery (n ¼ 7; Fig. 1A). tumors in females by 16 weeks of age, and by 24 weeks in Similar s.c. tumor inoculations in IL9ko mice had a markedly males. Double transgenic mice deficient in IL9 and expressing different effect: tumors were rejected in 78% of the IL9ko mice activated Her2/neu (IL9ko/Her2/neu) were created by breed- (21 of 27 mice; Fig. 1B). In the 6 mice that developed tumors, the ing BALB/neuT with IL9ko mice, and selecting mice that were average onset of macroscopic tumor growth was delayed to 60 homozygous IL9ko and heterozygous for Her2/neu. Both days (P ¼ 0.0001; Fig. 1B). In addition to significantly delayed groups of mice were monitored from birth to track tumor tumor onset, we also observed slower growth in IL9ko mice, onset and growth as compared with that of BALB/neuT mice. resulting in 100% survival 85 days after tumor delivery, com- Mice were sacrificed when one or more mammary tumors pared with 0% survival at day 30 in the WT control group (P < reached 10 mm2, and their life span was recorded in weeks. A 0.0001; Fig. 1C). This result was not due to a direct effect of IL9 survival plot segregating males from females showed a signif- on TUBO growth (Supplementary Fig. S1A), because TUBO icant increase in survival in Her2/neu transgenic females cells do not express the IL9R or directly secrete IL9 (Supple- deficient in IL9 (P ¼ 0.001; Fig. 2). mentary Fig. S1C and S1D). To confirm that tumor rejection was based on an immune component and not due to a systemic T cells are essential for tumor rejection in IL9ko mice effect linked to IL9 deficiency, we repeated the TUBO challenge Evaluation of the immune composition of spleens and LNs of in 7 of the IL9ko mice that rejected TUBO 2 months after the 4T1-bearing WT and IL9ko mice revealed increased total

www.aacrjournals.org Cancer Res; 74(23) December 1, 2014 6847

Hoelzinger et al.

Figure 1. TUBO and 4T1 mammary carcinomas are rejected in IL9ko mice. A and B, growth of 1 106 TUBO cells implanted s.c. in the flank of WT (A) and IL9ko (B) mice. C, survival plot of TUBO-bearing mice, showing 100% of IL9ko mice surviving after day 85 of tumor injection (P < 0.0001). D and E, growth of 1 106 4T1 cells implanted s.c. in the flank of WT (D) and IL9ko (E) mice. F, survival plot of 4T1-bearing mice, showing 75% of IL9ko mice surviving after day 50 of tumor injection (P < 0.0001). G and H, growth of 1 105 CT26 cells implanted s.c. in the flank of WT (G) and IL9ko (H) mice. I, survival plot of CT26-bearing mice, showing 75% of IL9ko mice surviving after day 50 of tumor injection (P < 0.001). Arrows, the day of rechallenge with 1 106 TUBO or 4T1 cells, or 1 105 CT26 cells (7, 8, and 10 IL9ko mice, respectively). Data for each tumor model are cumulative of a minimum of two experiments.

þ þ numbers of CD4 and CD8 T cells in IL9ko mice (Supple- Tregs derived from 4T1-bearing IL9ko mice expressed ITGaE mentary Fig. S2A and S2B), and a concomitant decrease in and CTLA-4 and at a lower level of expression than Tregs from þ þ numbers of CD11b Gr1 cells (P ¼ 0.005; Supplementary Fig. WT mice (Supplementary Fig. S3C). Moreover, Tregs from S2C). However, closer scrutiny revealed that any difference in IL9ko mice were less functionally suppressive than their WT total numbers was directly related to tumor size and not to IL9 counterparts (Supplementary Fig. S3D). status (data not shown). In addition, we evaluated Treg cell Because we observed that tumor rejection occurred 10 to number, phenotypic characterization, and function (Supple- 14 days after tumor inoculation (Fig. 1E), timing that is mentary Fig. S3). We found that the percentage of splenic Tregs reminiscent of an adaptive immune response, and because was signiﬁcantly higher in 4T1-bearing mice (P < 0.001; Sup- this resulted in a memory response, we asked whether T cells plementary Fig. S3A), whereas the percentage of Tregs in were involved in tumor rejection in an IL9-deﬁcient context. tumor-draining LN was higher in TUBO-bearing IL9ko mice To test this, we inoculated IL9ko mice with 4T1 tumors, and þ þ (P ¼ 0.05; Supplementary Fig. S3B). This relative increase in depleted CD4 and CD8 T cells with mAb. Cohorts com- Tregs led us to examine Treg-related cellular markers from prised 6 to 8 mice, and were treated as follows: anti-CD4, na€ve and 4T1-bearing mice. There were no differences in Treg anti-CD8, both anti-CD4 and anti-CD8, isotype control anti- phenotype between na€ve IL9ko and WT mice. However, fewer body, or untreated. Growth was monitored over 30 days.

6848 Cancer Res; 74(23) December 1, 2014 Cancer Research

IL9 Inhibits Adaptive Antitumor Immunity

These results suggest that the presence of IL9 negatively regulates T-cell function within 10 to 14 days of tumor challenge. The precise source of IL9 in the tumor microenvironment is yet to be determined. However, both 4T1 and TUBO cells do not transcribe either IL9 or IL9R mRNA, nor do they secrete IL9 in vitro, as measured by ELISA using supernatants of tumors generated in IL9ko mice and cultured for 3 days (Supplementary Fig. S1C and S1D). To test whether the absence of recurrent tumors in IL9ko mice challenged with 4T1 reflected active T-cell immuno- þ surveillance, we depleted CD8 T cells in IL9ko mice (n ¼ 8) that had rejected 4T1 cells 21 days prior (Fig. 3C, arrows). Tumors grew in 3 of 8 mice, and no tumor growth was evident in 5 of 8 mice. These data confirmed that active Figure 2. IL9 deficiency leads to delayed onset of autochthonous mammary tumors in Her2/neu transgenic mice. Survival plot of T-cell surveillance was operative in at least a portion of non- WT/Her2-neu (WT) and IL9ko/Her2-neu mice (IL9ko) showing that recurrences, and raised the possibility that mice without þ IL9 deficiency leads to increased survival of female Her2/neu tumor growth following CD8 T-cell depletion might harbor þ transgenic mice (P ¼ 0.001). sufficient CD4 T-cell immunologic memory to compensate þ for the CD8 T-cell depletion, or that the tumor was IL9ko mice untreated and treated with isotype control completely eradicated. antibody gave evidence of tumor rejection between days 10 and 14 after tumor injection, with rejection completed 1 T cells from IL9ko mice are activated and tumor specific þ þ week later. In contrast, CD8 T-cell depletion or joint CD4 To confirm that tumor rejection was due to the sensiti- þ and CD8 T-cell depletion resulted in 4T1 tumor growth zation of a tumor-specificimmunecomponent,wehar- (Fig. 3A) comparable with that observed in WT mice (Fig. vested total splenocytes and lymphocytes (from tumor- þ 1A). Finally, depletion of only CD4 T cells also prevented draining LNs) from 4T1-bearing WT and IL9ko mice 14 days þ 4T1 rejection, but with slower tumor outgrowth than CD8 after tumor injection. These cells were cocultured with depletion. These results demonstrate that in an IL9-deficient either 4T1 (target tumor) or TUBO (negative control tumor) þ þ milieu, both CD8 and CD4 T cells were involved in tumor cells to measure the number of cells that were activated in a þ eradication, and that neither subset alone was sufficient for tumor-specific manner, using the number of IFNg spots as þ cure. Interestingly, we found that T cells from tumor-bearing areporterofactivation(Fig.4A).ThenumberofIFNg spots mice express high levels of IL9R mRNA (Supplementary Fig. present in WT splenocytes or lymphocytes cocultured with S1C). Tumor sizes were tabulated 21 days after tumor 4T1 cells was near the levels of negative control (TUBO) þ injection, and confirmed that CD8 depletion resulted in tumor. In contrast, IL9ko-derived splenocytes and lympho- large tumors (averaging 700 mm3), whereas untreated or cytes were activated in a tumor-specific manner. Moreover, isotype treated mice harbored very small tumors (averaging IL9ko-derived splenocytes (6.5-fold increase) and lympho- 14 mm3) or no tumors at all (Fig. 3B). cytes (9.7-fold increase) showed a significantly higher degree

þ Figure 3. CD8 T cells are essential for tumor rejection in IL9ko mice. A, growth of 1 106 4T1 cells implanted s.c. in the ﬂank of IL9ko mice treated with neutralizing þ þ antibodies against CD4 , CD8 , þ þ CD4 , and CD8 T cells or isotype control. There were 6 to 8 mice per cohort and data shown are cumulative of two separate experiments. B, average tumor sizes in each treatment cohort 21 days after tumor injection. C, þ depletion of CD8 T cells with anti- CD8 antibody in the IL9ko mice that rejected 4T1 tumors from A. Arrows, dosage times once weekly for 3 weeks.

www.aacrjournals.org Cancer Res; 74(23) December 1, 2014 6849

Hoelzinger et al.

ABSpleen LN 4T1 TUBO 4T1 TUBO IL9KO + TUBO IL9ko + 4T1 WT WT + TUBO Spleen WT + 4T1 IL9ko IL9KO + TUBO IL9ko + 4T1 LN WT + TUBO WT + 4T1

M PMA M PMA 0 50 100 150 200 Spots per well CD CD8T cells from CD8T cells from IL9ko TB3 4T1-naÏve mice 4T1-bearing mice IL9ko TB2 IL9ko TB1 Balb/C IL9ko N3 IL9ko N2 +4T1 IL9ko N1 IL9ko WT TB3 WT TB2 Balb/C WT TB1 +BM185 WT N3 IL9ko WT N2 WT N1

050100 150 200 250 300 350 Spots per well M PMA

E H&E Anti-CD8 No primary

IL9ko

þ þ Figure 4. CD8 T cells are activated in a tumor-speciﬁc manner and are tumor tropic. A, ELISpot analysis measuring IFNg spots derived from total þ splenocytes (spleen) and lymphocytes (LN) from 4T1-bearing WT and IL9ko mice. B, graph showing the average number of IFNg spots from triplicate þ wells. , P ¼ 0.001. C, CD8 T cells derived from naïve or tumor-bearing WT and IL9ko mice cocultured with either 4T1 or BM185 cells. Wells shown þ are representative of triplicate determinations from three biologic replicates. M, media. D, graph showing the average numbers of IFNg spots in each well. Biologic replicates are denoted as follows: WT naïve (WT N1-3), WT bearing 4T1 (WT TB1-3), IL9ko naïve (IL9ko N1-3), and IL9ko bearing 4T1 þ (IL9ko TB1-3). ,thesigniﬁcance of the difference in number of spots when comparing CD8 T cells from tumor-bearing WT versus IL9ko mice (P ¼ þ 0.007). Representative data of duplicate experiments with three mice in each condition. E, immunohistochemical evaluation of CD8 T cells present in 4T1 tumor derived from WT (bottom) and IL9ko (top) mice. Each series is composed of sequential slides to show morphology (hematoxylin and eosin, H&E), anti-CD8 staining, and a negative control. Images are representative of three tumors from three individual mice in each strain. Scale bar, 100 mm.

þ of activation in the presence of 4T1 as compared with WT IFNg spots in cells from IL9ko mice, versus 67 spots in WT þ cells (P ¼ 0.001; Fig. 4B). cells (P ¼ 0.007; Fig. 4D). Furthermore, activation of CD8 T Because we observed that T-cell depletion resulted in cells was 4T1 specific, because there were no measurable þ þ tumor growth in IL9ko mice, we repeated the ELISpot assay IFNg spots when CD8 T cells were cocultured with BM185 þ þ with isolated CD4 T cells and CD8 T cells. Total numbers cells. PMA was used as a positive control to confirm that the þ þ þ of CD4 TcellsandCD8 T cells in spleens of na€ve and 4T1 WT CD8 T cells were capable of activation. A similar þ tumor-bearing mice are shown in Supplementary Fig. S2. experiment using CD8 T cells from TUBO-bearing mice þ These cells were cocultured with 4T1 or BM185 cells, a yielded similar results (data not shown). CD4 T cells tested þ BALB/c background murine leukemia cell line used here as under identical conditions produced IFNg spots only if þ a negative control (Fig. 4C). Again using the number of exposed to PMA. The lack of CD4 T-cell activation is þ IFNg spots as a reporter of T-cell activation, we found a consistent with the absence of MHC class II–expressing þ 3.6-fold increase in the number of activated CD8 Tcellsin cells: T cells were cultured with MHC II–negative tumor the population derived from tumor-bearing IL9ko mice as cell lines (verifiedbyFACS;datanotshown),intheabsence compared with their WT counterparts: an average of 239 of of syngeneic antigen-presenting cells.

6850 Cancer Res; 74(23) December 1, 2014 Cancer Research

IL9 Inhibits Adaptive Antitumor Immunity

þ CD8 T cells are found in 4T1 tumors growing in IL9ko three cohorts, which received increasing numbers of spleno- mice, but not in tumors growing in WT mice cytes, holding the number of tumor cells constant: (i) no þ Having observed that CD8 T cells were key effectors in splenocytes added, (ii) 33:1, and (iii) 100:1. Splenocytes from tumor eradication, and that they were activated in a tumor- 4T1-bearing WT mice were used in the same proportions as a þ specific manner, we sought to verify the presence of CD8 T control. Tumor growth was monitored twice weekly, revealing cells in 4T1 tumors that were in the process of being tumor growth in WT mice that received only 4T1, and complete rejected. WT and IL9ko mice were injected with 4T1 cells, abrogation of tumor growth in all the mice that received IL9ko- and tumor growth monitored. After 7 days, the tumors in activated splenocytes (Fig. 5A). Coinjection of 4T1 and sple- WT mice were robustly growing (an average of 5 mm2;Fig. nocytes derived from 4T1-bearing WT mice grew similarly to 1D), whereas tumors growing in IL9ko mice were decreasing the mice that received only 4T1. These results show that in size (2–3mm2;Fig.1E).Tumorswereharvestedatthis splenocytes derived from mice that had rejected 4T1 included point, formalin-fixed, and paraffin-embedded. Staining with cells that were capable of eradicating 4T1 tumor cells in a WT þ anti-CD8 revealed a population of CD8 cells arranged context. þ mostly in groups at the margins of shrinking 4T1 tumors We repeated the experiment with negatively isolated CD8 þ þ in the IL9ko mice (Fig. 4E). No CD8 cells were observed in T cells to verify our finding that depletion of CD8 T cells þ tumors growing in WT mice, even though our ELISpot enables tumor growth in IL9ko mice (Fig. 3A). CD8 T cells þ analyses revealed 4T1-specificCD8 Tcellsinthespleens were harvested from spleens of the following groups of mice: (i) of WT 4T1-bearing mice (Fig. 4D). WT bearing 4T1 tumors, (ii) na€ve WT, (iii) IL9ko bearing 4T1 þ tumors, and (iv) na€ve IL9ko. CD8 T cells were mixed with 4T1 þ Splenocytes, or CD8 T cells from IL9ko mice that cells in a ratio of 25:1 injected into WT mice, and tumor growth rejected 4T1 tumors, also abrogate 4T1 growth in WT was monitored. As observed before (Fig. 5A), cells derived from mice tumor-bearing IL9ko mice prevented 4T1 growth in 6 of 6 mice We used Winn assays to test whether activated splenocytes (Fig. 5B). Cells isolated from both IL9ko and WT na€ve mice from IL9ko mice that had rejected 4T1 tumors were capable of permitted 4T1 growth. Surprisingly, half of the mice treated þ inducing tumor rejection in WT mice. IL9ko mice that rejected with CD8 T cells from tumor-bearing WT mice prevented 4T1 tumors were rechallenged with 4T1 cells to boost the levels tumor growth, and half enabled tumor growth. These findings of memory cells. Total splenocytes were then harvested from echo our observations from the ELISpot assays (Fig. 3C), which þ the rechallenged mice, and mixed with 4T1 cells before injec- show that CD8 T cells derived from IL9ko mice have 3.6-fold tion in the flanks of WT mice. WT mice were segregated into more tumor-reactive cells than their WT equivalents.

þ Figure 5. Splenocytes, or CD8 T cells from IL9ko mice that rejected 4T1 tumors also impede 4T1 growth in WT mice. A, splenocytes derived from tumor-bearingWT(WTþ4T1) or IL9ko (IL9koþ4T1) mice were mixed with 4T1 cells and implanted s.c. in the ﬂank of WT mice in the given ratios (100:1 and 33:1), holding the number of 4T1 cells constant at 2.5 104. Each line represents tumor growth in one mouse, and the cohorts are colored as follows: (i) 4T1 only, blue; (ii) IL9koþ4T1 100:1, dark green; (iii) IL9koþ4T1 33:1, light green; (iv) WTþ4T1 100:1 purple; and (v) WTþ4T1 33:1, þ red. Shown is one of two determinations. B, enriched CD8 T cells derived from either naïve or 4T1 tumor-bearing WT or IL9ko mice were coinjected s.c. into WT mice in a ratio of 25:1. Each cohort contains duplicate mice injected with 4T1 and cells from three individual donor mice. Each line represents þ tumor growth in one mouse, and the cohort colors deﬁne the CD8 T-cell donor subsets as follows: (i) WTþ4T1, dark blue; (ii) WT naïve, light blue; (iii) IL9koþ4T1, dark green; and (iv) IL9ko naïve, light green.

www.aacrjournals.org Cancer Res; 74(23) December 1, 2014 6851

Hoelzinger et al.

Figure 6. Anti-IL9 treatment results in slowed tumor growth in WT mice, whereas addition of recombinant IL9 increases experimental metastases in IL9ko mice. A, representation of the treatment schedule to measure the effect of IL9 depletion on tumor growth. Symbols mark the days of anti-IL9 injections, twice a week for 3 weeks (3). 4T1 cells (2.5 104) were injected on day 0. B, box-whisker plot of tumor growth in three cohorts of mice: untreated (white boxes, n ¼ 7), isotype control antibody (dotted boxes, n ¼ 8), and anti-IL9 antibody (checkered boxes, n ¼ 11). Each box contains a line representing the median and is bounded by the upper and lower quartiles. Minimum and maximum values are shown as whiskers. The bar frames the period of time (days 0–15) during which there is a signiﬁcant difference in growth between the isotype control and anti-IL9–treated cohorts (, P ¼ 0.03). Data are cumulative of two independent experiments. C, experimental 4T1 lung metastases in WT and IL9ko mice. Number of lung metastases per mouse are shown; cross bar indicates the median number of metastases and bounding bars represent upper and lower quartiles. D, representative images of 4T1 foci in lungs from each treatment group.

Anti-IL9 treatment results in slowed tumor growth in WT verify whether IL9 plays a role in 4T1 seeding in the lung. Tail mice vein injections of 1 105 4T1 cells led to metastatic lesions If IL9 is an important factor in tumor development, then in WT mice (an average of 87 foci per lung), whereas the neutralizing IL9 in WT mice with nascent 4T1 should lead to majority of IL9ko mice did not develop visible metastases slowed tumor growth or tumor rejection. We inoculated (an average of 3 foci per lung; P ¼ 0.0001; Fig. 6B and C). WT mice with 4T1 cells and separated them into three cohorts: Interestingly, addition of recombinant IL9 led to enhanced (i) untreated, (ii) treated with neutralizing anti-IL9, and 4T1 seeding in the lungs of IL9ko mice (an average of 13 foci (iii) treated with isotype control (Fig. 6A) and tumor growth per lung; P ¼ 0.043; Fig. 6B and C). was monitored. Mice treated with anti-IL9 antibody showed significant delay in tumor growth (days 0–15) as compared with untreated mice (P < 0.0001), and also when compared with Discussion isotype control antibody (P ¼ 0.03; Fig. 6B). The difference Perhaps the role of IL9 in tumor biology can be inferred by in growth between anti-IL9 and untreated remains highly what is known about its role in Th2-type diseases such as significant throughout the 3 weeks (P < 0.0001). However, due parasitic infections, allergy, and asthma. In such cases, IL9 is þ to the high degree of variation in the isotype control cohort, rapidly, and transiently, expressed by CD4 T cells (30), þ there was no measurable significance in 4T1 growth in latter CD8 T cells (3), dendritic cells (31), and innate lymphoid time points. cells (32) in response to activating stimuli. It can therefore be considered a marker of early T-cell activation. We hypoth- IL9 deficiency prevents the establishment of 4T1 tumor esize that upon tumor inoculation, the host immune system foci in the lung is activated and responds by producing IL9. Although several Because we observed that the few IL9ko mice that devel- IL9-secreting cells have been identified in the tumor micro- oped 4T1 tumors never had evidence of macro metastases in environment, at present, it is unclear which are the first the lungs, we used an experimental metastasis model to responders. We have observed that in IL9-deficient mice

6852 Cancer Res; 74(23) December 1, 2014 Cancer Research

IL9 Inhibits Adaptive Antitumor Immunity

TUBO, 4T1 and CT26 cells grow and are then resorbed partially reversed by anti-IL9 antibody. This antitumor activity around day 7 to 10. This leads us to suggest that IL9 is was exclusively found in tumor models with strong antigen involved in an immediate, early establishment of a tolero- specificity (B16-OVA and MC38-gp100). One explanation was genic milieu, which hampers the development of an adaptive suggested by the authors, who observed that in vivo Tc9 cells immune response against a tumor challenge. This is rem- repolarized to a more classical IFNg-expressing CTL profile; iniscent of CTLA-4 and PD1, receptors that are expressed on these cells were also long-lived explaining their enhanced activated T cells, and that, when engaged, act as checkpoints antitumor activity (22). Therefore, their antitumor activity that lead to a dampening of an antitumor immune response in vivo may not be IL9 dependent. Most recently, Vegran and þ (33). We hypothesize that the early secretion of IL9 in the colleagues (36) found that TH9-polarized CD4 T cells, coad- tumor microenvironment may prevent the activation of ministered with IL1b, led to slowed tumor growth, reduced adaptive immunity, whereas the role of CTLA-4 and PD1 is tumor foci in the lungs, and increased survival in C57BL/6- to curtail an adaptive immune reaction. based tumor models. However, in this case also, IL9 was not the The presence of IL9 does not completely inhibit the forma- driving factor in tumor rejection, because only IL21 neutral- tion of tumor-specific T cells in WT mice. In our ELISpot ization reversed the combined antitumor effect of TH9 cells þ assays, we observed a modest tumor-specific activation of IL1b. Taken together, the discrepancy between our findings: þ CD8 T cells derived from tumor-bearing WT mice. In addi- who see IL9 as a tolerizing agent, and those who conclude that tion, we observed that when total splenocytes derived from IL9 leads to tumor rejection, may be partly mouse strain tumor-bearing WT mice are coinjected with 4T1 cells, all the dependent. C57BL/6 mice are intrinsically Th1 polarized, þ mice developed tumors, whereas when CD8 T cells were whereas BALB/c mice are Th2 polarized (37). Because IL9 enriched and coinjected with 4T1, there was a heightened belongs to the overarching Th2 phenotype, its removal may chance of tumor rejection. Therefore, the lack of effector lead to a shift to Th1 profile in BALB/c mice, which could lead þ function is not due to lack of tumor-specific CD8 T cells in to an enhancement of tumor rejection. We are in the process of tumor-bearing WT mice. Indeed, administration of a higher confirming whether IL9ko mice in a C57BL/6 also reject tumor þ number of enriched CD8 T cells leads to tumor rejection even challenges. in WT mice. On the other hand, the large proportion of The first step in exploring whether anti-IL9 treatment can be myeloid-derived suppressor cells (MDSC) present in the used as an adjuvant to immunotherapy regimens, is to dem- spleens of WT 4T1-bearing mice (averaging 40% of MDSCs in onstrate an effect in a WT host. We show here that the a spleen from a 5-mm2 tumor; ref. 34) could be the causative administration of anti-IL9 indeed led to a significant delay in factor. MDSCs impede the activation of splenic T cells unless tumor growth of a very aggressive mammary carcinoma. the latter are isolated experimentally. Because IL9ko mice However, we observed that the effect of IL9 diminished as the reject tumors approximately 10 days after tumor injection, tumors increased in size. It is possible that neutralization of IL9 they do not develop the same immunosuppressive milieu, and becomes progressively more difficult as the tumor size therefore tumors are rejected even when total splenocytes are increases because there is an increase in IL9-secreting sup- transferred. pressor cells, as well as poor penetration of the Ab into the As mentioned above, IL9 and the IL9R are expressed by both tumor. We are actively exploring the pharmacokinetics of anti- innate and adaptive immune cells. We are in the process of IL9 neutralization as well as other strategies for blocking the identifying the timing and cellular source of IL9 during a IL9–IL9R signaling axis more efficiently. Interestingly, IL9 nascent antitumor immune reaction, using an IL9Cre reporter deficiency also plays a role in the development and growth system previously used in the study of airway inflammation of autochthonous Her2/neu tumors. Although the increase in (32, 35). However, our work shows that in an IL9-deficient host, survival is modest, it is significant, especially because this þ tumor specific CD8 T cells are generated, and that these are tumor model is extremely aggressive, where female Her2/ sufficiently activated to be capable of eliminating a tumor neu–positive mice develop multiple mammary carcinomas by challenge in WT mice. Others have shown that in WT hosts, 4 months. Nevertheless, we do not know whether this effect is þ CD8 T cells can be polarized to secrete IL9 (3) and that these due to the effect of IL9 on the immune component (for example cells are less cytotoxic in vitro than conventional cytotoxic T by reducing the efficiency of immunosurveillance) or the cells (CTL; refs. 3, 21), expressing lower levels of IFNg, gran- neoplasm itself. zyme B, and perforin. These findings support our observations To summarize, we have discovered that IL9 is involved in the þ that more IL9ko CD8 T cells express IFNg and are more promotion of a tolerogenic environment during the time cytotoxic than their WT counterparts. However, three discre- period that an adaptive immune response against a tumor is pancies between our findings and those of others who report primed. IL9 deficiency leads to a robust tumor rejection, that IL9 promotes antitumor activity remain to be explained. involving a strong sensitization of tumor-specific T cells, which First, addition of recombinant IL9 increases experimental 4T1 remain operative as effectors rather than tolerized or other- metastasis, whereas Lu and colleagues show that anti-IL9 wise subverted. Activated antitumor cells can be transferred to increases B16 experimental metastases. Second, in our WT mice and lead to tumor rejection. Finally, treatment with BALB/c-based tumor models, tumors are rejected in IL9- IL9-neutralizing Abs significantly slowed the growth of breast deficient mice; however, Lu and colleagues found that coad- cancer cell lines in WT mice. Conversely, addition of recom- ministration of tumor-antigen primed DCs with in vitro polar- binant IL9 increased the number of 4T1 foci in the lungs of ized Tc9 cells led to tumor shrinkage and cure, which was IL9ko mice.

www.aacrjournals.org Cancer Res; 74(23) December 1, 2014 6853

Hoelzinger et al.

These data demonstrate that among its many other actions, Acquisition of data (provided animals, acquired and managed patients, provided facilities, etc.): D.B. Hoelzinger, A.L. Dominguez, S.J. Gendler IL9 inhibits the activation of adaptive antitumor immunity. IL9 Analysis and interpretation of data (e.g., statistical analysis, biostatistics, þ þ ablation enables CD8 and CD4 T cells to become promptly computational analysis): D.B. Hoelzinger, P.A. Cohen, S.J. Gendler sensitized to tumor Ag within the formidable microenviron- Writing, review, and/or revision of the manuscript: D.B. Hoelzinger, P.A. Cohen, S.J. Gendler ment of a growing tumor, where only IL9 is missing, Remark- Administrative, technical, or material support (i.e., reporting or orga- ably, it was unnecessary to perform vaccine or adjunct cytokine nizing data, constructing databases): A.L. Dominguez Study supervision: P.A. Cohen maneuvers to achieve this end. Blockade of the IL9–IL9R axis is clearly a promising target for potentiation of immunotherapy. Even regional blockade may prove effective for T-cell sensiti- Acknowledgments The authors thank Cheryl Myers and Noweeda Mirza for constructive zation. Serendipitously, a phase II clinical trial evaluating discussions and insight. This work benefited from the technical support provided humanized IL9 neutralizing Ab (MEDI-528) for asthma relief by Kevin Pollock, the Flow Cytometry Core, the Immunohistochemistry Core, and by Tammy Brehm-Gibson from the Immunology Core. The authors also has recently ended, revealing no improvement over conven- thank Amylou Dueck for statistical analyses. In addition, they thank the Mayo tional therapy, but also (and most importantly) no significant Clinic Natalie Schafer Animal Care attendants for excellent animal care. side effects (38). We are currently examining the usage of anti- IL9 as an adjuvant in combinatorial regimens such as anti-IL9 Grant Support with chemo- or immunotherapeutic agents. This work was supported by the NCI: CA155295-01-03A (S.J. Gendler), RO1 A108984 (P.A. Cohen), and 5P50 CA102701 (P.A. Cohen and S.J. Gendler), and the fl Mayo Foundation. Disclosure of Potential Con icts of Interest The costs of publication of this article were defrayed in part by the payment fl No potential con icts of interest were disclosed. of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Authors' Contributions Conception and design: D.B. Hoelzinger, P.A. Cohen, S.J. Gendler Received March 21, 2014; revised September 16, 2014; accepted September 18, Development of methodology: D.B. Hoelzinger, P.A. Cohen, S.J. Gendler 2014; published OnlineFirst October 8, 2014.

References 1. Stassen M, Schmitt E, Bopp T. From interleukin-9 to T helper 9 cells. 14. Lemoli RM, Fortuna A, Tafuri A, Fogli M, Amabile M, Grande A, et al. Ann N Y Acad Sci 2012;1247:56–68. Interleukin-9 stimulates the proliferation of human myeloid leukemic 2. Nowak EC, Noelle RJ. Interleukin-9 as a T helper type 17 cytokine. cells. Blood 1996;87:3852–9. Immunology 2010;131:169–73. 15. Lemoli RM, Fortuna A, Tafuri A, Grande A, Amabile M, Martinelli G, et al. 3. VisekrunaA,RitterJ,ScholzT, Campos L, Guralnik A, Poncette Interleukin-9 in human myeloid leukemia cells. Leuk Lymphoma L, et al. Tc9 cells, a new subset of CD8(þ) T cells, support 1997;26:563–73. Th2-mediated airway inflammation. Eur J Immunol 2013;43: 16. Lv X, Feng L, Fang X, Jiang Y, Wang X. Overexpression of IL-9 receptor 606–18. in diffuse large B-cell lymphoma. Int J Clin Exp Pathol 2013;6:911–6. 4. Goswami R, Kaplan MH. A brief history of IL-9. J Immunol 2011; 17. Lv X, Wang X. The role of interleukin-9 in lymphoma. Leuk Lymphoma 186:3283–8. 2013;54:1367–72. 5. Jabeen R, Kaplan MH. The symphony of the ninth: the deve- 18. Nagato T, Kobayashi H, Kishibe K, Takahara M, Ogino T, Ishii H, et al. lopment and function of Th9 cells. Curr Opin Immunol 2012;24: Expression of interleukin-9 in nasal natural killer/T-cell lymphoma cell 303–7. lines and patients. Clin Cancer Res 2005;11:8250–7. 6. Noelle RJ, Nowak EC. Cellular sources and immune functions of 19. Matsushita K, Arima N, Ohtsubo H, Fujiwara H, Hidaka S, Fukumori J, interleukin-9. Nat Rev Immunol 2010;10:683–7. et al. Frequent expression of interleukin-9 mRNA and infrequent 7. Schmitt E, Bopp T. Amazing IL-9: revealing a new function for an "old" involvement of interleukin-9 in proliferation of primary adult T-cell cytokine. J Clin Invest 2012;122:3857–9. leukemia cells and HTLV-I infected T-cell lines. Leuk Res 1997;21: 8. Elyaman W, Bradshaw EM, Uyttenhove C, Dardalhon V, Awasthi A, 211–6. Imitola J, et al. IL-9 induces differentiation of TH17 cells and enhances 20. Purwar R, Schlapbach C, Xiao S, Kang HS, Elyaman W, Jiang X, et al. function of FoxP3þ natural regulatory T cells. Proc Natl Acad Sci U S A Robust tumor immunity to melanoma mediated by interleukin-9–pro- 2009;106:12885–90. ducing T cells. Nat Med 2012;18:1248–53. 9. Eller K, Wolf D, Huber JM, Metz M, Mayer G, McKenzie AN, et al. IL-9 21. Lu Y, Hong S, Li H, Park J, Hong B, Wang L, et al. Th9 cells promote production by regulatory T cells recruits mast cells that are essential for antitumor immune responses in vivo. J Clin Invest 2012;122:4160–71. regulatory T cell-induced immune suppression. J Immunol 2011; 22. Lu Y, Hong B, Li H, Zheng Y, Zhang M, Wang S, et al. Tumor-specific IL- 186:83–91. 9–producing CD8þ Tc9 cells are superior effector than type-I cytotoxic 10. Lu LF, Lind EF, Gondek DC, Bennett KA, Gleeson MW, Pino-Lagos K, Tc1 cells for adoptive immunotherapy of cancers. Proc Natl Acad Sci et al. Mast cells are essential intermediaries in regulatory T-cell toler- U S A 2014;111:2265–70. ance. Nature 2006;442:997–1002. 23. Carlsson A, Wingren C, Kristensson M, Rose C, Ferno M, Olsson H, 11. Yang Z, Zhang B, Li D, Lv M, Huang C, Shen GX, et al. Mast cells et al. Molecular serum portraits in patients with primary breast cancer mobilize myeloid-derived suppressor cells and Treg cells in tumor predict the development of distant metastases. Proc Natl Acad Sci U S microenvironment via IL-17 pathway in murine hepatocarcinoma A 2011;108:14252–7. model. PLoS ONE 2010;5:e8922. 24. Rovero S, Amici A, Di Carlo E, Bei R, Nanni P, Quaglino E, et al. DNA 12. Nowak EC, Weaver CT, Turner H, Begum-Haque S, Becher B, Schrei- vaccination against rat her-2/Neu p185 more effectively inhibits car- ner B, et al. IL-9 as a mediator of Th17-driven inflammatory disease. cinogenesis than transplantable carcinomas in transgenic BALB/c J Exp Med 2009;206:1653–60. mice. J Immunol 2000;165:5133–42. 13. Merz H, Houssiau FA, Orscheschek K, Renauld JC, Fliedner A, Herin M, 25. Pulaski BA, Ostrand-Rosenberg S. Mouse 4T1 breast tumor model. et al. Interleukin-9 expression in human malignant lymphomas: unique Curr Protoc Immunol 2001;Chapter 20:Unit 20 2. association with Hodgkin's disease and large cell anaplastic lympho- 26. Townsend JM, Fallon GP, Matthews JD, Smith P, Jolin EH, McKenzie ma. Blood 1991;78:1311–7. NA. IL-9–deficient mice establish fundamental roles for IL-9 in

6854 Cancer Res; 74(23) December 1, 2014 Cancer Research

IL9 Inhibits Adaptive Antitumor Immunity

pulmonary mastocytosis and goblet cell hyperplasia but not T cell 32. Turner JE, Morrison PJ, Wilhelm C, Wilson M, Ahlfors H, Renauld JC, development. Immunity 2000;13:573–83. et al. IL-9–mediated survival of type 2 innate lymphoid cells promotes 27. Forbes EE, Groschwitz K, Abonia JP, Brandt EB, Cohen E, Blan- damage control in helminth-induced lung inflammation. J Exp Med chard C, et al. IL-9- and mast cell-mediated intestinal permeability 2013;210:2951–65. predisposes to oral antigen hypersensitivity. J Exp Med 2008; 33. Pardoll DM. The blockade of immune checkpoints in cancer immu- 205:897–913. notherapy. Nat Rev Cancer 2012;12:252–64. 28. Khan WI, Richard M, Akiho H, Blennerhasset PA, Humphreys NE, 34. Ko JS, Rayman P, Ireland J, Swaidani S, Li G, Bunting KD, et al. Direct Grencis RK, et al. Modulation of intestinal muscle contraction by and differential suppression of myeloid-derived suppressor cell sub- interleukin-9 (IL-9) or IL-9 neutralization: correlation with worm sets by sunitinib is compartmentally constrained. Cancer Res expulsion in murine nematode infections. Infect Immun 2003;71: 2010;70:3526–36. 2430–8. 35. Wilhelm C, Hirota K, Stieglitz B, Van Snick J, Tolaini M, Lahl K, et al. An 29. Smith SE, Hoelzinger DB, Dominguez AL, Van Snick J, Lustgarten J. IL-9 fate reporter demonstrates the induction of an innate IL-9 Signals through 4-1BB inhibit T regulatory cells by blocking IL-9 response in lung inflammation. Nat Immunol 2011;12:1071–7. production enhancing antitumor responses. Cancer Immunol Immun- 36. Vegran F, Berger H, Boidot R, Mignot G, Bruchard M, Dosset M, et al. other 2011;60:1775–87. The transcription factor IRF1 dictates the IL-21–dependent anticancer 30. Tan C, Aziz MK, Lovaas JD, Vistica BP, Shi G, Wawrousek EF, et al. functions of TH9 cells. Nat Immunol 2014;15:758–66. Antigen-specific Th9 cells exhibit uniqueness in their kinetics of cyto- 37. Watanabe H, Numata K, Ito T, Takagi K, Matsukawa A. Innate immune kine production and short retention at the inflammatory site. J Immunol response in Th1- and Th2-dominant mouse strains. Shock 2004;22:460–6. 2010;185:6795–801. 38. Oh CK, Leigh R, McLaurin KK, Kim K, Hultquist M, Molfino NA. A 31. Leech MD, Grencis RK. Induction of enhanced immunity to intestinal randomized, controlled trial to evaluate the effect of an anti-interleukin- nematodes using IL-9-producing dendritic cells. J Immunol 2006; 9 monoclonal antibody in adults with uncontrolled asthma. Respir Res 176:2505–11. 2013;14:93.

www.aacrjournals.org Cancer Res; 74(23) December 1, 2014 6855

Inhibition of Adaptive Immunity by IL9 Can Be Disrupted to Achieve Rapid T-cell Sensitization and Rejection of Progressive Tumor Challenges

Dominique B. Hoelzinger, Ana Lucia Dominguez, Peter A. Cohen, et al.

Cancer Res 2014;74:6845-6855. Published OnlineFirst October 8, 2014.

Updated version Access the most recent version of this article at: doi:10.1158/0008-5472.CAN-14-0836

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2014/10/09/0008-5472.CAN-14-0836.DC1

Cited articles This article cites 37 articles, 16 of which you can access for free at: http://cancerres.aacrjournals.org/content/74/23/6845.full#ref-list-1

Citing articles This article has been cited by 2 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/74/23/6845.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at Subscriptions [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/74/23/6845. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.