Article

Essential role for histone deacetylase 11 (HDAC11) in neutrophil biology † † Eva Sahakian,*, ,1,2 Jie Chen,*,1 John J. Powers,*, Xianghong Chen,* Kamira Maharaj,* Susan L. Deng,* Alex N. Achille,* Maritza Lienlaf,* Hong Wei Wang,* Fengdong Cheng,* ‡ Andressa L. Sodr´e,* Allison Distler,* Limin Xing, Patricio Perez-Villarroel,* Sheng Wei,* † { † Alejandro Villagra,* Ed Seto,§ Eduardo M. Sotomayor,*, Pedro Horna, and Javier Pinilla-Ibarz*, ,3 † { Departments of *Immunology, Malignant Hematology, §Molecular Oncology, and Hematopathology, H. Lee Moffitt Cancer ‡ Center and Research Institute, Tampa, Florida, USA; and Department of Hematology, General Hospital, Tianjin Medical University, Tianjin, People’s Republic of China RECEIVED APRIL 28, 2015; REVISED APRIL 19, 2017; ACCEPTED APRIL 21, 2017. DOI: 10.1189/jlb.1A0415-176RRR

ABSTRACT progenitors in the BM before entering the bloodstream and Epigenetic changes in chromatin structure have been account for 50–70% of the entire circulating population [1–4]. recently associated with the deregulated expression of During granulopoiesis, neutrophils are produced at the rate of critical genes in normal and malignant processes. 1 3 1011 each day, with a significant increase within hours during HDAC11, the newest member of the HDAC family of infections [5], and in patients with various cancer [6, 7] and enzymes, functions as a negative regulator of IL-10 therefore, more than one-half of the BM is devoted to the expression in APCs, as previously described by our lab. production of these cells at a steady state [8]. Neutrophils play a However, at the present time, its role in other hemato- pivotal and well-defined role in the host defense, where they poietic cells, specifically in neutrophils, has not been fully eradicate invading microorganisms [9], and although they have explored. In this report, for the first time, we present a novel physiologic role for HDAC11 as a multifaceted regulator of been labeled short lived, new in vivo deuterium labeling analysis neutrophils. Thus far, we have been able to demonstrate a has revealed that these cells may have a circulatory lifespan of up fl lineage-restricted overexpression of HDAC11 in neutrophils to 5 d [10]. Moreover, it is known that neutrophils can in uence and committed neutrophil precursors (promyelocytes). the immune response by way of communicating with DCs, Additionally, we show that HDAC11 appears to associate macrophages [11, 12], as well as B cells [13] and T cells [14]. In with the transcription machinery, possibly regulating the fact, accumulating series of evidence also suggests that neutro- expression of inflammatory and migratory genes in neu- phils have the potential to gain phenotypic as well as functional trophils. Given the prevalence of neutrophils in the periph- properties classically assigned to APCs [15, 16] and in the eral circulation and their central role in the first line of presence of cancer, appose tumor progression [1, 17] conversely, defense, our results highlight a unique and novel role for given the appropriate signals, and regulate tumor growth HDAC11. With the consideration of the emergence of new, [18–21]. These antagonistic populations of neutrophils, referred selective HDAC11 inhibitors, we believe that our findings will have significant implications in a wide range of diseases to as N1 (or tumor inhibiting) and N2 (or tumor promoting), spanning malignancies, autoimmunity, and inflammation. probably exist as a dynamic array of activation states, rather than J. Leukoc. Biol. 102: 475–486; 2017. only two distinct populations [17, 22]. Additionally, neutrophils can form structures called NETs that are involved in a process called NETosis—a contributor of innate immunity and induced Introduction or stimulated by infection, inflammation, trauma, cytokine In humans, the predominant circulating leukocytes—neutrophils— production, activated platelets, autoantibodies, and pathogens – fi are known to be produced at immense numbers through [23 27]. In recent years, NETosis has been identi ed as an sequences of increasingly differentiated precursor myeloid additional pathway of programmed cells death [28], during which nuclear chromatin relaxes and forms fibrous web-like structures composed of DNA and histone-associated granular Abbreviations: APL = acute promyelocytic leukemia, ATRA = all-trans retinoic acid, BM = bone marrow, CBA = cytometric bead array, CBC = complete blood count, ChIP = chromatin immunoprecipitation, DC = dendritic cell, 1. These authors contributed equally to this work. eGFP = enhanced GFP, HDACs = histone deacetylase, HDAC11KO = histone deacetylase 11 knockout, HL60 = human promyelocytic leukemia 2. Correspondence: Depts. of Immunology and Malignant Hematology, H. Lee Moffitt Cancer Center & Research Institute, 12902 Magnolia Dr., SRB cell, MGAL = Murine Genetic Analysis Laboratory, MPO = myeloperoxidase, 2nd Floor, Rm. 22334A2, Tampa, FL 33612, USA. E-mail: eva.sahakian@ (continued on next page) moffitt.org 3. Correspondence: Depts. of Immunology and Malignant Hematology, H. The online version of this paper, found at www.jleukbio.org, contains Lee Moffitt Cancer Center & Research Institute, 12902 Magnolia Dr., MRC supplemental information. 3rd Floor East, Tampa, FL 33612, USA. E-mail: javier.pinilla@moffitt.org

0741-5400/17/0102-475 © Society for Leukocyte Biology Volume 102, August 2017 Journal of Leukocyte Biology 475 Downloaded from www.jleukbio.org to IP 216.185.5.2. Journal of Leukocyte Biology Vol.102, No.2 , pp:475-486, August, 2017 proteins [25, 29]. Therefore, it is of no surprise that these cells Research Building, Moffitt Cancer Center, Tampa, FL, USA), kept in a can also damage cells and tissues of self (host), highlighting the pathogen-free condition, and handled in accordance with the requirements of importance of regulating genes functionally responsible for these the U.S. Guidelines for Animal Experiments. The HL60 APL cell line was purchased from American Type Culture Collection (Manassas, VA, USA) and pathologic occurrences [30, 31]. Regulation of neutrophil cultured and maintained in RPMI (HyClone RPMI-1640) with 10% FBS at 5% function and differentiation, in particular, genes involved in the CO2 and 37°C. Aging HDAC11KO and C57BL/6 WT mice were housed in the inflammatory responses and chronic diseases, is mostly regulated same room under identical conditions (mentioned above) for 18 mo (n =5/ at the transcriptional levels [32], and subsequently, an identifi- group and strain). cation of factors involved in these processes would offer significant insight into the molecular mechanisms governing qRT-PCR functional outcome. For a number of years, regulation of normal Total RNA was prepared from centrifugally pelleted and presorted cells and malignant hematopoiesis by epigenetic factors has shown to (RNeasy mini columns and RNAse-free DNAse; Qiagen, Germantown, MD, be an area of significant interest [33, 34]. Epigenetic changes in USA). cDNA was prepared using the iScript cDNA Synthesis Kit (Bio-Rad chromatin structure have been associated with the deregulation Laboratories, Hercules, CA, USA), and qRT-PCR reactions were con- of critical genes in normal as well as malignant hematopoiesis ducted using the SYBR Green Two-Step qRT-PCR (Bio-Rad Laboratories) with transcript-specific primers (supplied upon request) and cDNA from [35, 36]. HDACs alter chromatin by deacetylation of histone tails, samplesastemplates.qRT-PCRamplification reactions were resolved on resulting in transcriptionally inactive chromatin [37]. HDAC CFX iCycler (Bio-Rad Laboratories), and fold changes were quantified 2DD inhibitors have also been identified to alter the cytokine (2 Ct) [46]. Primers used HDAC11: forward: ACACGAGGCGCTATCT- production profile [38], ultimately influencing the fate and CAAC, reverse: ACGCGTTCAAACAGGAACTT; TNF-a forward (59-CCGATGGG- expansion of hematopoietic cells [35, 39]. However, presently, TTGTACCTTGTC-39), reverse (39-AGATAGCAAATCGGCTGACG-59); 9 9 9 the exact role of specific HDACs in regulation of hematopoietic IL-6 forward (5 -CCGGAGAGGAGACTTCACAG-3 ), reverse (3 -TCCAC- 9 9 9 processes is yet to be elucidated. Moreover, it has been GTTTCCCAGAGAAC-5 ); 18s forward (5 -GTAACCCGTTGAACCCCATT-3 ), reverse (39-CCGTCCAATCGGTAGTAGCG-59); CXCL2 forward (59-TCCA- demonstrated that cytokine production by myeloid cells is GAGCTTGAGCGTGACG-39), reverse (39-TTCAGGGTCAAGGCAAACTT- fi regulated by changes in the acetylation status of speci c gene 59); and CXCR2 forward (59-TCTGCTACGGGTTCACACTG-39), reverse promoters [40, 41]. HDAC11 has been described as a negative (39-ACAAGGACGACAGCGAAGAT-59). regulator of IL-10 expression in myeloid cells [42]. Furthermore, it has been shown that lack of HDAC11 increases the suppressive Flow cytometry capacity of myeloid-derived suppressor cells [43]. HDAC11, the Flow cytometric analysis of BM aspirates was performed using fluorochrome- fi most recently identi ed HDAC, is the sole member of the class IV labeled mAb (anti-CD3, -CD4, -CD8, -CD19, -NK1.1, -CD11b, -Ly6G, -CD45, HDAC subfamily [44]. The functional role of HDAC11 remains -CD117, -CD127, -CD11C, and -Ly6G; BD Biosciences, San Jose, CA, USA, and poorly characterized. Initially, it was believed that HDAC11 had a eBioscience, San Diego, CA, USA) and the vitality dye DAPI (Sigma-Aldrich, limited tissue expression restricted to kidney, heart, brain, St. Louis, MO, USA). Data were acquired on an LSR II cytometer (BD skeletal muscle, and testis [44], but it has recently been Biosciences, San Jose, CA, USA) at least 10,000 events of the smallest population of interest were analyzed using Kaluza (BD Biosciences) and documented also to be expressed in hematopoietic cells, where it FlowJo software 10.0.07r2 (TreeStar, Ashland, OR, USA). Annexin V flow plays an integral role in the regulation of immune tolerance cytometry was performed using BD Bioscience’s LSR II flow cytometer using through its action in APCs. However, at the present time, its purified PNs from WT C57BL/6 and HDAC11KO mice. An FITC-conjugated regulatory role in myeloid differentiation and specifically, Annexin V antibody and the DNA dye propidium iodide were used in neutrophil function is yet to be characterized. In this manuscript, conjunction with FACS buffer. Gates were created for the analysis of we reveal a previously unknown role of HDAC11, which may apoptotic, viable, and dead cells from total cells. Data were collected to a limit involve the regulation of neutrophil function. Here, we of 10,000 events of the population of interest. demonstrate that expression of HDAC11 correlates with neutro- phil maturation, migration, and phagocytic function. We also Immunoblotting show that HDAC11 may be involved in the transcriptional The cells were lysed in a lysis buffer containing 50 mM Tris, 280 mM NaCl, 3 machinery of IL-6, TNF-a, and CXCR2/CXCL2. HCl, pH 8.0, 0.5% Igepal, 5 mM MgCl2,10%glycerol,and10 protease inhibitor (Roche, Basel, Switzerland) and phosphatase inhibitor (Santa Cruz Biotechnology, Dallas, TX, USA). Next, lysates were sonicated for 8min(onice,for2cyclesof30son/30srest)andthenmixedwith43 gel MATERIALS AND METHODS loading buffer and boiled for 10 min. Samples were then resolved on 10% gels and transferred to nitrocellulose membranes, which were blocked with Mice and cell lines 5% milk-PBS-Tween. Bands were detected by scanning blots with an LI-COR Odyssey imaging system. Anti-GAPDH (68795) was purchased from Sigma- C57BL/6 WT mice were purchased from Charles River Laboratories Aldrich. Anti-b-actin (sc-47778) was purchased from Santa Cruz Bio- (Wilmington, MA, USA), Tg-HDAC11-eGFP reporter mice [45] were provided technology. Anti-HDAC11 (3611P-100) was purchased from BioVision by the Nathaniel Heintz Institute through the Mutant Mouse Resource & (Milpitas, CA, USA). Research Centers, and HDAC11KO, kindly supplied by Merck (Kenilworth, NJ, USA) and obtained from the E.S. lab, respectively. All strains of mice were housed in the same designated room at the animal facility (Vincent A. Stabile Harvesting and in vitro culturing of mouse PNs C57BL/6 WT or HDAC11KO mice (8 wk old, female) were injected i.p. (continued from previous page) with 1 ml sterile 5% thioglycollate solution (BD Biosciences). Mice were fl NET = neutrophil extracellular trap, PN = peritoneal neutrophil, qRT-PCR = euthanized, and the peritoneal cavity was ushed immediately. The cavity quantitative RT-PCR, RFP = red fluorescent protein, Tg = transgenic, TV = tail was flushed with 10 ml ice-cold RPMI-1640 medium (HyClone Laborato- vein, WT = wild-type ries, Logan, UT, USA). Cells from the initial wash were pelleted, and

476 Journal of Leukocyte Biology Volume 102, August 2017 www.jleukbio.org Downloaded from www.jleukbio.org to IP 216.185.5.2. Journal of Leukocyte Biology Vol.102, No.2 , pp:475-486, August, 2017 Sahakian et al. Role of HDAC11 in neutrophils neutrophils were positively selected using biotin anti-mouse Ly-6G antibody to a single tube of lyophilized pHrodo Red E. coli BioParticles (Thermo (127604; BioLegend, San Diego, CA, USA) and Mouse Biotin Positive Fisher Scientific). The BioParticles were vortexed and then incubated for Selection Kit (EasySep; Stemcell Technologies, Vancouver, BC, Canada). 30 min in a 37°C water bath for optimal opsonization. BioParticles were The PNs were cultured in 6-well (5 3 106 cell/ml) plates in complete RPMI- centrifuged at 2000 rpm for 2 min and washed twice with PBS (pH 7.4, 1640 medium in the presence of 10% FBS (HyClone Laboratories) and 1% without Ca and Mg), and resuspended in 2 ml RPMI-1640 with 10% FBS. penicillin–streptomycin (Corning, Corning, NY, USA), stimulated with Purified neutrophils were resuspended at 1 3 106 cells/ml and plated at 2.5 mg/ml LPS (L2880; Sigma-Aldrich). The purity of the PNs was ;90% 100 ml/well in quadruplicate in a 96-well, flat-bottom, tissue culture-treated after selection. plate per mouse. BioParticles were added to the plate immediately before being placed into IncuCyte high-throughput live cell microscope system Migration assay analysis (Essen BioScience, Ann Arbor, MI, USA) for detection of RFP expression. Medium (25 ml; control medium) containing serum-free medium or chemo- kine MIP-2 (10 mg/ml) was loaded into the lower chambers of the Transwell IncuCyte real-time microscopy analysis system. Cell suspension (50 ml; 1 3 106/ml or 2 3 106/ml) in 10% FBS RPMI- Cells in a 96-well plate were imaged through a 103 objective lens at 5 min 1640 medium was added to the upper compartment of the chemotaxis intervals for 3 h using the IncuCyte Zoom HD live cell imaging system (Essen m chamber. The two compartments were separated by a 5 M pore-size BioScience). The system is located in a 37°C/5% CO2 cell culture incubator to polycarbonate filter. Spontaneous migration was determined as the movement maintain proper incubation conditions. Analysis was performed using the of cells toward the control medium. default red fluorescence processing definition within the IncuCyte Zoom 2014B software. The number of red cells and confluency of measured red ChIP fluorescence were translated from the images and exported using the Excel format. Mouse PNs (3 3 107) were cross-linked with 1% formaldehyde (F8775; 25 ml; Sigma-Aldrich) for 10 min at room temperature. Then, the cross-linking was stopped by 0.125 M glycine for 10 min at room temperature. The cells were CBA washed twice with PBS and proceeded with sample preparation. The cell This assay involves measurement of secreted cytokines in the media by flow pellet was lysed by 1 ml lyse buffer (50 mM HEPES, pH 7.8, 3 mM MgCl2, cytometry. In brief, 100 ml supernatant, from cells stimulated with or without 20 mM KCl, 0.25% Triton X-100, 0.5% Nonidet P-40) on ice for 10 min. The LPS, was collected as specific time points, and IL-6 and TNF-a levels were cell lysate was transferred to a “dounce homogenizer,” and 25 strokes were measured following the manufacturer’s recommended protocol for the CBA applied using the loose pestle A. The cell pellet was washed once with 1 ml kit; (BD Biosciences). wash buffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA, 200 mM NaCl). The pellet was resuspended in 600 ml sonication buffer (50 mM HEPES, pH 7.8, 140 mM Sepsis model NaCl, 1 mM EDTA, 0.5% SDS, 1% Triton X-100). The samples were sonicated and centrifuged for 10 min. The lysate was diluted at 1:10 to dilution buffer I C57BL/6 WT and HDAC11KO mice were injected with 15 mg/kg LPS (L4391- m (50 mM HEPES, pH 7.8, 140 mM NaCl, 1 mM EDTA, 1% Triton X-100), 1MG; Sigma-Aldrich) via TV in 100 l vol and observed for signs of sepsis precleared using Protein A agarose beads (16-156; Millipore, Billerica, MA, (abnormal posture/positioning; partial paralysis; failure to respond to stimuli; USA), and incubated with rabbit anti-HDAC11 antibody cocktail (3611P, head tilt; circling; impaired locomotion; nonpurposeful movement; hypo- BioVision; and H4539-200UL, Sigma-Aldrich) on a rotator at 4°C overnight. activity; hyperactivity; restlessness; self-trauma; aggressiveness; isolation from Biotin-conjugated normal rabbit IgG-B (SC-2763; Santa Cruz Biotechnology) cage mates; shallow, rapid, and/or labored breathing; cyanosis; piloerection; was added at the same amount of rabbit anti-HDAC11 antibody cocktail in matted hair coat; lack of inquisitiveness; hunched posture; and/or vocaliza- parallel of each sample and incubated on a rotator at 4°C overnight. Then, tions), 3 times daily. 50 ml protein A agarose beads were applied to each sample and incubated at 4°C for 4 h. The beads were then washed twice each with dilution buffer I, RACE analysis dilution buffer II (50 mM HEPES, pH 7.8, 500 mM NaCl, 1 mM EDTA, 1% This experiment was out sourced to the MGAL, Mouse Biology Program, at Triton X-100), LiCl buffer (20 mM Tris-HCl, pH 8.0, 250 mM LiCl, 1 mM University of California, Davis (Davis, CA, USA). Detailed protocol will be EDTA, 0.5% Triton X-100), and TE buffer (10 mM Tris-HCl, pH 8.0, 1 mM provided upon request. EDTA). Then, the beads were eluted in 100 ml elution buffer (50 mM Tris-HCl, pH 8.0, 1 mM EDTA, 1% SDS) and incubated at 65°C for 15 min, and the Statistical analysis immunocomplexes were collected in the soluble fraction. NaCl was added to a fi fi final concentration of 200 mM, and the cross-linking was reverted by incubating Unless otherwise speci ed, the statistical signi cance between values was ’ 6 at 65°C overnight. Then, RNAse A (158922; Qiagen) was added to 20 mg/ml to determined by Student s t test. Data were expressed as the means SD. # fi each sample and incubated at 37°C for 30 min. Proteinase K (EO0491; Thermo Probability values of P 0.05 were considered signi cant. Fisher Scientific, Waltham, MA, USA) was then added to 100 mg/ml and incubated at 42°C for 2 h. DNA was purified by using the QIAquick PCR Purification Kit (28104; Qiagen), and purified DNA was eluted in 100 mlTE RESULTS buffer for analysis by qRT-PCR. DNA (2 ml) was used for each qRT-PCR reaction. The following PCR primers were used: TNF-a forward (59-CTCGG- HDAC11 is differentially expressed in various stages of AAAACTTCCTTGGTG-39), reverse (39-CGATGGAGAAGAAACCGAGA-59); myeloid differentiation 9 9 9 IL-6 forward (5 -TCTGCAGAGTGAAGAAGCTGA-3 ), reverse (3 -GATTCC- It has previously been reported that HDAC11 is a negative AGGCTGAAAGTAGGC-59); CXCL2 (MIP-2) forward (59-GGCTAGAACTG- regulator of IL-10 production in myeloid cells. Here, we AGGGCTAC-39), reverse (39-ACATCCATTCTTGTCCCACTG-59); and CXCR2 forward (59-CCTCTGACTCCCACACATCT-39), reverse (39-GCTTGCTGTGC- examined the expression of HDAC11 in myelopoiesis. To follow TTTTGGTTT-59). the dynamic changes in HDAC11 transcriptional activation, we used HDAC11 promoter-driven eGFP reporter mice (Tg- Phagocytosis assay HDAC11-eGFP) [45], where eGFP expression is indicative of fl Upon euthanasia, 1 ml blood was obtained from an experimental mouse via HDAC11 transcription. With the use of multiparameter ow cardiac puncture with a heparinized syringe. Blood was centrifuged at 2000 cytometric analysis, as seen in Fig. 1A, in the BM compartment, rpm for 2 min in a microcentrifuge tube, and sera was aspirated and added we were able to determine that expression of HDAC11 is

www.jleukbio.org Volume 102, August 2017 Journal of Leukocyte Biology 477 Downloaded from www.jleukbio.org to IP 216.185.5.2. Journal of Leukocyte Biology Vol.102, No.2 , pp:475-486, August, 2017 Figure 1. The HDAC11 message is differentially expressed in various stages of myelopoiesis. (A) Dynamic visualization of the HDAC11 message using a Tg-HDAC11-eGFP mouse in myeloid compartments. BM was extracted from Tg-HDAC11-eGFP (as well as C57BL/6 mice as control, non- eGFP-expressing cells; gray), and cells were labeled (as indicated above) with specific cell surface markers for identification of each population. HDAC11 expression was determined by flow cytometry analysis of eGFP reporter gene expression, where the expression of the eGFP protein corresponds to the activation of HDAC11 transcriptional machinery (representative presentation from 2 individual experiments). SSC-H, Side- scatter-height. (B) Monocytes, promyelocytes, and neutrophils from Tg-HDAC11-eGFP mouse BM cells were sorted using the FACSAria (BD Biosciences) device with 99% purity. Cells were lysed using TRIzol reagent (Thermo Fisher Scientific), as well as radioimmunoprecipitation assay buffer (Cell Signaling Technology, Danvers, MA, USA), and RNA as well as protein was extracted, respectively. Immunoblotting [Western blot (WB)] was performed using 10% SDS gel, the image was resolved using the Dura ECL reagent (Pierce; Thermo Fisher Scientific; inset), and qRT-PCR analysis was performed using HDAC11 primers (graph). Sorted cell populations were also morphologically confirmed (lower). (C) Coexpression of the HDAC11 message and eGFP message was confirmed by qRT-PCR using eGFP primers (error bars = SEM; data representative of 3 individual experiments; n = 3). (D) Monocytes, promyelocytes, neutrophils, B cells, and T cells were sorted from C57BL/6 WT mouse BM cells using the FACSAria (BD Biosciences) device with 98% purity. Cells were lysed using TRIzol reagent (Thermo Fisher Scientific), and RNA was extracted. qRT-PCR analysis was performed using HDAC11 primer. This was done to confirm the HDAC11 expression profile in a non-Tg setting (error bars = SEM; data representative of 3 individual experiments; n = 3). (E) Four normal human donor peripheral blood source leukocyte samples (purchased from OneBlood, Florida Blood Bank) were sorted for monocytic and neutrophylic populations using the FACSAria (BD Biosciences) device with a 96% purity and then examined for the expression of the HDAC11 message using qRT-PCR analysis, and the fold change between neutrophils and monocytes was normalized to the lowest expressing monocytic population (error bars = SEM; n = 4). (B–E) Note: subpopulations were compared and normalized to monocytes (as they have the lowest expression of HDAC11). markedly increased in promyelocytes when compared with compared with promyelocytes and neutrophils (Fig. 1A). earlier progenitors and further amplified in the neutrophils The lymphocytes also show a moderate expression of the when compared with myeloblasts. Interestingly, expression eGFP HDAC11 transcript. Expression of the HDAC11 protein was and consequently of HDAC11 in monocytes was negligible when confirmed by immunoblotting analysis in flow-sorted monocytes,

478 Journal of Leukocyte Biology Volume 102, August 2017 www.jleukbio.org Downloaded from www.jleukbio.org to IP 216.185.5.2. Journal of Leukocyte Biology Vol.102, No.2 , pp:475-486, August, 2017 Sahakian et al. Role of HDAC11 in neutrophils promyelocytes, and neutrophils (Fig. 1B, inset). Quantitative Expression of HDAC11 is significantly increased in mRNA analysis confirmed our findings by demonstrating an leukemic cells upon differentiation increase in the expression of the HDAC11 message (fold changes With the use of the HL60 APL cell line model and upon in vitro are normalized to the 18 s housekeeping gene for each maturation and differentiation of these cells using ATRA sample) and further validated the Tg-HDAC11-eGFP reporter stimulation, we observed an increase in the expression of the mouse model (Fig. 1B; graph) used in our experiments. HDAC11 message (Fig. 2A, lower) and protein (Fig. 2A, inset), as Additionally, we further validated these results by quantifying demonstrated. These differentiated HL60 cells also exhibited the mRNA expression of eGFP in the same samples and were neutrophil-like segmentation and overexpression of maturation able to demonstrate that expression of HDAC11 is concom- markers, such as CD11b and MPO (Fig. 2B). itant with the expression of the eGFP message (Fig. 1C). To ensure that our data were not an artifact of the eGFP reporter Lack of HDAC11 markedly increases the expression of mouse model, we flow sorted monocytes, promyelocytes, proinflammatory cytokines neutrophils, and lymphocytes from a C57BL/6 WT mouse and HDAC11 is restricted mainly to the nucleus, and its expression examined the expression of the HDAC11 message (Fig. 1D). appears to be tissue specific with higher expression in brain, fi fi The results con rmed our previous ndings in the Tg- heart, testis, and skeletal muscle [44]; however, its precise HDAC11-eGFP reporter mouse, and consequently, the neu- function in the myeloid compartment and specifically, in the trophil population expressed significantly higher levels of neutrophils is yet to be elucidated. In the proceeding exper- HDAC11 when compared with the restofthesubpopulations. iments, we used germline HDAC11KO (Merck; C57BL/6 Next, we purchased source leukocytes (OneBlood, Florida background) mice that were developed using Lox/Cre technol- Blood Bank, St. Petersburg, FL, USA), collected from ogy to remove a floxed exon 3, a portion of the HDAC catalytic volunteer, normal donors, and isolated (flow-sorted cell region. In our Supplemental Fig. 1A, we demonstrate our populations) monocytes and neutrophils. Quantification of method of positively genotyping HDAC11KO mice. As these mice HDAC11 expression observed inthisFig.1showsparallel will still transcribe a truncated mRNA sequence (excluding exon results, mirroring what we had previously seen in our murine 3), to validate this mouse model further, we designed a special models, where neutrophils had higher expression of the HDAC11 primer set that was within the excised exon 3 region of HDAC11 message (Fig. 1E, graph). Immunoblotting analysis the HDAC11 gene. As seen in Supplemental Fig. 1, HDAC11KO confirmed the expression of HDAC11 in the neutrophils when mice have no amplified HDAC11 amplicons demonstrated by compared with the monocyte population (Fig. 1E, inset). qRT-PCR analysis when compared with C57BL/6 WT

Figure 2. Expression of HDAC11 in APL samples and functional consequences of its manipulation in this model. (A) HL60 cells were treated with ATRA for 72 h, the expression of the HDAC11 message was measured by qRT-PCR, and the differentiation of HL60 cells to granulocytic-like cells was examined by morphologic analysis (Below bar graph; error bars = SEM;datarepresen- tative of 3 individual experiments). NT, Nontreated control. (B) The differentiation of HL60 cells to granulocytic-like cells was examined using MPO (a marker for cell’s gain of granularity; upper), as well as CD11b expression (lower; representative figure from 3 individual experiments).

www.jleukbio.org Volume 102, August 2017 Journal of Leukocyte Biology 479 Downloaded from www.jleukbio.org to IP 216.185.5.2. Journal of Leukocyte Biology Vol.102, No.2 , pp:475-486, August, 2017 counterparts (Supplemental Fig. 1B). Furthermore, immuno- performed a migration assay. In brief, in this assay, isolated blotting analysis suggested that the expression of HDAC11 is neutrophils were loaded in the upper compartment of the absent in cells isolated from HDAC11KO mice (Supplemental chemotaxis chamber, the serum-free media or chemokine Fig. 1C). Taking it a step further, we sent samples from 2 C57BL/ CXCL2 (MIP-2–IL-8 homolog; 10 mg/ml) were loaded into the 6 WT and 2 HDACK11KO mice to MGAL, Mouse Biology lower chambers of a Transwell system, and the assay was Program, at University of California, Davis, for RACE-sequencing. concluded by detection and calculation of migratory neutrophils. The data confirmed that HDAC11KO mice are devoid of exon 3 The data suggest that neutrophils isolated from HDAC11KO on the HDAC11 gene sequence (data will be provided upon mice have a significantly higher migratory capacity toward a bait request). Recently, it has been demonstrated that epigenetic chemokine MIP-2 when compared with the WT counterpart (Fig. factors, such as HDACs, have been known to affect regulation of 4A). Next, we compared the expression of migratory receptor/ genes involved in inflammatory responses [47]. Subsequently, we chemokines, such as CXCR2 (homolog of IL-8Rb)/CXCL2, in decided to investigate whether lack of HDAC11 had any HDAC11KO and C57BL/6 WT mice. In Fig. 4B, we demonstrate functional consequences in the neutrophil population. To do a higher endogenous expression of mRNA for these molecules in this, we isolated PNs from both HDAC11KO as well as C57BL/6 neutrophils lacking HDAC11. Flow cytometry analysis confirmed WT mice, 18 h, 5% post-thioglycollate injection. In vitro, cells a significant increase in the protein level of CXCR2 on were treated with 2.5 mg/ml LPS for 2 and 4 h, and the samples HDAC11KO neutrophils compared with C57BL/6 WT mice (Fig. were analyzed for the TNF-a and IL-6 message and protein 4C); however, the changes in the CXCL2 protein levels were not expression. Results revealed that in the absence of HDAC11, significant (data not shown). Furthermore, we assessed the neutrophils became more inflammatory, as seen by the mRNA phagocytic ability of C57BL/6 WT versus HDAC11KO mouse expression level of TNF-a and IL-6 at every time point (Fig. 3A). PNs. In brief, an equal number of PNs from C57BL/6 WT and These findings were confirmed further by CBA protein analysis, HDAC11KO mice were cocultured with pHrodo Red E. coli where both cytokines showed a higher level of expression when BioParticles loaded with a pH-sensitive fluorescent dye. With the compared with the C57BL/6 WT counterparts (Fig. 3B). We use of live microscopy, we were able (in real-time) to monitor the were also interested in considering whether the lack of functional phagocytic capacity of PNs from each mouse. Data ascertained HDAC11 changed the normal distribution of hematologic cells in from these experiments demonstrated that PNs from the peripheral blood. In brief, we collected peripheral blood HDAC11KO mice were functionally more potent (Fig. 4D). from HDAC11KO as well as their normal counterparts, C57BL/6 Given our findings discussed in the above experiments, it was WT mice (submandibular blood collection), and performed a deemed necessary to determine if HDAC11 was being recruited CBC analysis. Surprisingly, both cohorts—HDAC11KO as well as to the promoters of CXCR2 and CXCL2. Given our presented C57BL/6 WT control mice—had a relatively similar monocytic data so far, we predict that HDAC11 may be a negative regulator and granulocytic blood count profile (Fig. 3C). To our of genes involved in migratory response. To examine this knowledge, thus far, there has been no report of HDAC11 hypothesis, in our concluding experiments, we performed a ChIP binding directly to DNA, and consequently, there are no direct analysis. In brief, PNs from C57BL/6 WT mice were treated with downstream genes that can be signature indicators of this 2.5 mg/ml LPS for 3.5 h, and then the cells were processed for a interaction. In experiments for this section, we also interrogated ChIP assay. The data indicate that there is recruitment of the possibility of HDAC11 being involved in transcriptional HDAC11 to the promoter regions of CXCR2 and CXCL2 (Fig. regulation of these molecules. In brief, PNs isolated from 4E). Additionally, ChIP assay using PNs from HDAC11KO mice C57BL/6 WT mice were treated with 2.5 mg/ml LPS for 3.5 h demonstrates no enrichment suggesting an absence of HDAC11 (the concentration and the time point for these experiments recruitment to the same promoter regions (Fig. 4F). To were determined by dose titration and time course analysis in demonstrate that this observation was specific to HDAC11, we preceding experiments), and then the cells were processed for a performed a similar ChIP analysis using HDAC11KO PNs that ChIP assay. In Fig. 3D, ChIP data suggest that HDAC11 may be showed no change in the enrichment ratio when comparing LPS- recruited to the TNF-a and IL-6 transcriptional complex. To stimulated samples with nonstimulated controls. The observed demonstrate that this observation was specific to HDAC11 being recruitment of HDAC11 to the promoter regions is not possibly recruited to the promoter region of TNF-a and IL-6, we discriminated to a direct biding of HDAC11 to the promoter performed a similar ChIP analysis in mice using HDAC11KO PNs regions; however, the interrogation of this possibility requires that showed no recruitment of HDAC11 to the promoter regions additional and in-depth promoter-binding analysis, which was not of TNF-a and IL-6, interpreted by no change in the enrichment the focus of our manuscript. ratio when comparing LPS-stimulated samples with nonstimu- lated controls (Fig. 3E). HDAC11KO mice are more susceptible to LPS-induced sepsis when compared with the C57BL/6 Neutrophils isolated from mice lacking HDAC11 WT counterpart demonstrate much higher migratory and Sepsis in humans, defined as severe inflammation in the phagocytic capacity presences of infection, is a common syndrome that kills The hallmark of neutrophils in the innate immune system is their thousands of patients each year [48]. To study this physiologic capacity to migrate to the site of tissue injury and/or infection. response, murine models have been established and validated. To interrogate the migratory capacity of neutrophils lacking For instance, in intoxication models, mice are inoculated with HDAC11, we isolated PNs (as mentioned in Fig. 3) and proinflammatory compounds (noninfections), such as LPS [49].

480 Journal of Leukocyte Biology Volume 102, August 2017 www.jleukbio.org Downloaded from www.jleukbio.org to IP 216.185.5.2. Journal of Leukocyte Biology Vol.102, No.2 , pp:475-486, August, 2017 Sahakian et al. Role of HDAC11 in neutrophils

Figure 3. Phenotypic consequences of HDAC11-deficient PNs. (A) PNs from C57BL/6 WT and HDAC11KO mice were collected post-thyoglycolate injection (5% at 18 h). The cells were treated with 2.5 mg/ml LPS for 2 and 4 h. Expression of inflammatory genes TNF-a and IL-6 were measured by qRT-PCR. NT, nontreated control. (B) Protein concentrations for TNF-a and IL-6 were measured by CBA analysis. (C) CBC from C57BL/6 WT and HDAC11KO (n = 6/group). LYM, lymphocyte; MONO, monocyte; GRAN, granulocyte. (D) The recruitment of HDAC11 protein to chromatin fragments of TNF-a and IL-6 promoters was analyzed using the Pfaffl method [46] and is presented relative to input before immunoprecipitation, and the enrichment ratio was normalized to the IgG control (PNs isolated from C57BL/6 WT). (E) PNs isolated from HDAC11KO mice were used in another ChIP assay as negative control (error bars = SEM; data presented for each graph are representative of 2 individual experiments).

Of note, mice are extremely resilient to most types of eventual sepsis and death (post-LPS inoculation) when compar- inflammation when compared with humans, but at high doses of ing HDAC11KO with C57BL/6 WT mice. In brief, a cohort of LPS, within the range of 1–25 mg/kg (1000–10,000 times the HDAC11KO and age-matched C57BL/6 WT mice (n = 8 in each dose that will cause septic shock in humans), mice experience group) was injected with LPS at 15 mg/kg via TV. Mice were severe inflammatory response and eventually succumb to sepsis monitored 3 times in 24 h. As seen in Fig. 5, although all mice [50, 51]. Given our observations thus far, it appears that post-LPS inoculation showed signs of fatigue and sluggish HDAC11KO PNs, at steady state, have a higher innate in- movements, HDAC11KO mice expired within the first 48 h of the flammatory nature when compared with C57BL/6 WT mice. experiment, whereas the remaining C57BL/6 WT mice fully Therefore, we sought to investigate whether there was a recovered and were ultimately euthanized at the 72 h time point difference between the time of inflammatory onset leading to to mark the termination of the experiment.

www.jleukbio.org Volume 102, August 2017 Journal of Leukocyte Biology 481 Downloaded from www.jleukbio.org to IP 216.185.5.2. Journal of Leukocyte Biology Vol.102, No.2 , pp:475-486, August, 2017 Figure 4. Enhanced migratory and phagocytic capacity of HDAC11KO neutrophils. (A) Migration assay analysis between C57BL/6 WT and HDAC11KO PNs using the Transwell system and 2 3 106/sample. Expression of migratory genes was analyzed in PNs isolated from WT and HDAC11KO mice using qRT-PCR analysis (data generated from 4 individual experiments); **P , 0.01. (B) mRNA expression of CXCL2 and CXCR2 was analyzed in C57BL/6 WT and HDAC11KO mice at steady state (data generated from 2 individual experiments). (C) Expression of surface CXCR2 protein on neutrophils from HDAC11KO versus C47BL/6 WT mice. gMFI, geometric mean fluorescence intensity; *P , 0.05. (D) Phagocytic ability of PNs isolated from C57BL/6 WT and HDAC11KO mice was analyzed in the presence of pHrodo Red E. coli BioParticles loaded with a pH-sensitive fluorescent dye and analyzed as a measure of cell engulfment and lysis in real time (RFP measurement by microscopy; error bars = SEM; statistical analysis was done using 2-way ANOVA; data presented are representative of 2 individual experiments). (E) The recruitmentofHDAC11protein-to-chromatin fragments of CXCL2 and CXCR2 promoters was analyzed in the presence and absence of LPS stimulation. (F)PNsfromHDAC11KOmicewereusedinanotherChIPassayasanegative control. The values obtained for these ChIP experiments were analyzed using the Pfaffl method [46] and are presented relative to input before immunoprecipitation; the enrichment ratio was normalized to the IgG control (error bars = SEM;representativefigure from 2 individual experiments).

482 Journal of Leukocyte Biology Volume 102, August 2017 www.jleukbio.org Downloaded from www.jleukbio.org to IP 216.185.5.2. Journal of Leukocyte Biology Vol.102, No.2 , pp:475-486, August, 2017 Sahakian et al. Role of HDAC11 in neutrophils

consequently lead to manifestation of diseases, such as cancer and autoimmunity [57, 58]. More specifically, epigenetic modulations have been reported in a number of cellular processes involved in neutrophil development and functions (reviewed in Ostuni et al. [34]), including NETosis [59]. In this report, the interrogation of the transcriptional activity of HDAC11 in myeloid and lymphoid cells, using an HDAC11 promoter-driven eGFP reporter mouse model, combined with use of lineage-specific markers with multiparametric flow cytometry analysis, demonstrated a significant overexpression of HDAC11 in neutrophils when compared with monocytes (Fig. 1A). Moreover, analysis of hematopoietic cells isolated from the Figure 5. Septic shock experiment comparing HDAC11KO with BM of Tg-HDAC11-eGFP mice revealed an overexpression of C56BL/6 mice. A cohort (n = 8) of HDAC11KO and C57BL/6 mice HDAC11 at the promyelocyte stage of neutrophil differentiation was injected with 15 mg/kg LPS via TV. Survival graph representing fi both groups in timeline up to 72 h (data presented are representative and with a signi cant increase in the neutrophils. Monocytes of 2 individual experiments). showed low-to-undetectable expression of HDAC11 (Fig. 1B and C). Additionally, our results using flow-sorted leukocyte subpop- ulations from C57BL/6 WT mouse BM further confirmed and HDAC11KO mice show BM hypercellularity with demonstrated a higher level of HDAC11 expression in promye- locytes and neutrophils compared with monocytes and lymphoid granulocytic expansion and splenomegaly as a result fl of increased extramedullary hematopoiesis subsets (Fig. 1D). Equally, ow-sorted monocytes and neutrophils from source leukocytes of normal human donors showed higher Emergency granulopoiesis is defined as a well-coordinated de levels of HDAC11 expression in neutrophils compared with the novo production of neutrophils as a result of increased myeloid monocyte population (Fig. 1E). These findings are of interest, as progenitor cells proliferating in the BM, signaled by and during they suggest that HDAC11 may be a factor during myelopoiesis severe infection. The ultimate goal of this physiologic occurrence and consequently, play a role in the fate of neutrophils. is to increase the neutrophil output during an innate immune Epigenetic mechanisms, such as histone modifications, play a key response. To examine whether HDAC11KO mice had a more role in the control of multiple normal biologic processes, robust production of neutrophils, we injected (i.p.) a cohort of including hematopoiesis, as well as alterations leading to many HDAC11KO and C57BL/6 WT mice with CFA (Thermo Fisher diseases, such as autoimmunity and cancer [60, 61]. The Scientific) and assessed the expression of granular cells by flow understanding of the role of each specific HDAC in the context cytometry. Flow cytometery analysis revealed a moderate increase of the immune system in different malignancies will facilitate of granular cells in the spleen of HDAC11KO mice when selective cancer immunotherapeutic modalities. Therefore, we compared with C57BL/6 WT mice; however, this difference was further examined HDAC11 in a cancer model to determine not significant. Immunohistochemistry and H&E staining of BM whether this lineage-specific overexpression also applied to cells from the same mice demonstrated extensive hypercelullar- malignancies using the HL60 APL human cell line. Our findings ity, which did not allow decisive identification and quantification supported what we had seen in normal processes. Upon in vitro of granular cells (data not shown). However, when we compared ATRA-induced differentiation and maturation of APL cells, spleen sections from aging (18 mo old) HDAC11KO and expression of HDAC11 is increased exponentially (Fig. 2A). C57BL/6 WT mice, we observed that the HDAC11KO spleens Concurrently, the expression of MPO and CD11b (markers of had increased extramedullary hematopoiesis, resulting in an granularization) was increased (Fig. 2B) during maturation of expanded red pulp (Fig. 5). In addition, sections from femoral APL cells. The exploration into the physiologic role of HDAC11 bones revealed a marked BM hypercellularity on aging overexpression in neutrophils, using a model of germline HDAC11KO mice, mostly as a result of an expansion of maturing HDAC11KO mice, demonstrated that purified neutrophils neutrophils (Fig. 5). lacking HDAC11 displayed an apparent overproduction of TNF-a and IL-6 upon stimulation with LPS at message and protein levels DISCUSSION compared with their C57BL/6 WT counterparts (Fig. 3A and B). Our assessment of these collective data suggests that HDAC11 In myelopoiesis, lineage-specific transcription factors C/EBPa, may be playing the role of a check-point molecule, where it C/EBPe, PU.1, and acute myeloid leukemia 1 cooperatively possibly controls the activation of neutrophils. Moreover, sub- interact with specific DNA sequence response elements to initiate sequent data suggest that HDAC11 may be associated with the transcription of genes involved in differentiation [8, 52–54]. transcriptional machinery of inflammatory molecules, TNF-a and More recently, epigenetic mechanisms, such as chromatin IL-6, as seen by HDAC11 chromatin binding, which was modification by acetylation/deacetylation of histone tails, have demonstrated by ChIP analysis (Fig. 3D and E). Recently, been shown to contribute to the regulation of gene expression Stammler et al. [62] reported that HDAC11 inhibition increases and determination of cell population specificity [55, 56]. IL-1b in DCs and macrophages, through promoting a non- Conversely, it has been demonstrated that the deregulation of canonical caspase-8-dependent pathway. In our experiments, epigenetic mechanisms causes genetic alterations that ChIP analysis revealed that HDAC11 chromatin binding is

www.jleukbio.org Volume 102, August 2017 Journal of Leukocyte Biology 483 Downloaded from www.jleukbio.org to IP 216.185.5.2. Journal of Leukocyte Biology Vol.102, No.2 , pp:475-486, August, 2017 distinctive to TNF-a and IL-6, and no binding was observed for selective HDAC inhibitors to narrow the target of interest. In IL-1b (IL-1b, data not shown). Markedly, migration assay analysis regards to HDAC11, our observations suggest that this HDAC also demonstrated that neutrophils isolated from HDAC11KO may be a gatekeeper of inflammatory response in neutrophils. In mice exhibit a significantly higher migratory rate, as well as fact, in a murine sepsis model, we were able to show that increased phagocytic activity, compared with C57BL/6 WT mice HDAC11KO mice succumb to sepsis much faster than the (Fig. 4A). This observation is highlighted by qRT-PCR analysis C57BL/6 WT counterparts (Fig. 5), suggesting the possible that showed that HDAC11KO mice demonstrate an endogenous presence of preprimed neutrophils in HDAC11KO mice. overexpression of CXCR2 and CXCL2 genes (Fig. 4B and C). Additionally, the CellTiter-Blue viability assay demonstrated a Moreover, ChIP analysis results suggest that HDAC11 may also be modest decrease in the number of neutrophils (isolated from the recruited to the transcription complex, regulating the transcrip- BM) extracted from HDAC11KO mice in the absence of tion machinery of CXCR2 and CXCL2 (Fig. 4E and F). Recently stimulation when compared with the C57BL/6 WT counterpart; published data [63] suggest that HDAC11 has functional network however, a significant decrease in the viability of neutrophils protein association with a number of biologic processes, in- isolated from HDAC11KO mice was observed when these cells cluding gene expression, therefore, highlighting the possibility of were stimulated with GM-CSF compared with C57BL/6 WT its involvement in regulating transcription, which is yet to be counterparts (Supplemental Fig. 2). Moreover, in an aging determined. HDAC11KO mouse experiment, we observed a noticeable Typically, occurrence of severe sepsis, also known as septic increase in the BM cellularity when compared with age-matched shock, is a fatal complication of infection, usually caused by C57BL/6 WT control mice, which is mostly a result of an dysregulated inflammatory and immune responses. The onset of expansion of maturing neutrophils (Fig. 6). This is indicative of sepsis is generally a result of a robust innate immune response what we have demonstrated so far in this manuscript: signifying through enhanced granulopoiesis in the BM and generation of the likelihood of an essential role for HDAC11 in neutrophil an exuberant number of neutrophils and consequently, a massive biology. production of proinflammatory cytokines [64]. Sepsis remains to In recent years, the role of neutrophils has expanded be a serious health issue, and therefore, identification of factors significantly from frontline combatants of infection to endow- contributing to it is of great interest. Thus far, numerous studies ment of anti-tumor immunity [67, 68]. In contrast, recent have labeled pan-HDAC inhibitors fundamentally as negative evidence suggests a novel protumor function for these cells [11, regulators of gene expression for acute immune receptors and 69], suggesting complex and opposing roles of neutrophils in a pathways in innate immune cells [65, 66]. However, the tumor setting. Such observations continue to highlight the oversimplification of this statement cannot be generally correct, importance of identifying factors that may play essential roles in as HDAC inhibitors, depending on tissue type and time of neutrophil activation and function. In conclusion, our data treatment, can have alternative effects on gene expression. suggest that HDAC11 appears to have a dual function in Consequently, numerous investigators are now focusing on neutrophils biology: 1) HDAC11 is increased as neutrophils

Figure 6. Observation of splenomegaly as well as hypercellularity with granulocytic expansion in BM of HDAC11KO mice. (A) Representative sections of spleens (H&E stain) harvested from aged C57BL/6 WT (upper) and HDAC11 KO (lower) mice showing a marked expansion of the red pulp (left; original magnification, 340), as a result of replacement of the mostly lymphocytic red pulp cellularity observed on C57BL/6 WT mice with mostly trilineage extramedullary hematopoiesis on HDAC11KO mice (right; original magnification, 3400). (B) Representative sections of femurs (H&E stain) harvested from aged C57BL/6 WT (upper) and HDAC11 KO (lower) mice showing a marked increase in the BM cellularity on HDAC11KO mice compared with WT mice (left; original magnification, 320), mostly as a result of an expansion on maturing neutrophils (right; original magnification, 3200; n = 5/group).

484 Journal of Leukocyte Biology Volume 102, August 2017 www.jleukbio.org Downloaded from www.jleukbio.org to IP 216.185.5.2. Journal of Leukocyte Biology Vol.102, No.2 , pp:475-486, August, 2017 Sahakian et al. Role of HDAC11 in neutrophils differentiate and mature, and 2) a decrease in HDAC11 11. Mantovani, A., Cassatella, M. A., Costantini, C., Jaillon, S. (2011) Neutrophils in the activation and regulation of innate and adaptive correlates with functional activity of neutrophils. In this report, immunity. Nat. Rev. Immunol. 11, 519–531. our studies reveal that HDAC11 plays a role in neutrophil 12. Kolaczkowska, E., Kubes, P. (2013) Neutrophil recruitment and function fl – chemokine and cytokine biology and function. Given the in health and in ammation. Nat. Rev. Immunol. 13, 159 175. 13. Cerutti, A., Puga, I., Magri, G. (2013) The B cell helper side of multifaceted function of neutrophils, the key findings described neutrophils. J. Leukoc. Biol. 94, 677–682. in this report will potentially lead to targeted epigenetic therapies 14. Kalyan, S., Kabelitz, D. (2014) When neutrophils meet T cells: beginnings fl of a tumultuous relationship with underappreciated potential. Eur. J. to in uence diseases involving neutrophils. Immunol. 44, 627–633. 15. Takashima, A., Yao, Y. (2015) Neutrophil plasticity: acquisition of phenotype and functionality of antigen-presenting cell. J. Leukoc. Biol. 98, 489–496. AUTHORSHIP 16. Ruffell, B., Affara, N. I., Coussens, L. M. (2012) Differential macrophage programming in the tumor microenvironment. Trends Immunol. 33, P.H. and J.P.-I. are co-principal investigators on this manuscript. 119–126. E.S. and J.C. planned, organized, and performed the research 17. Coffelt, S. B., Wellenstein, M. D., de Visser, K. E. (2016) Neutrophils in cancer: neutral no more. Nat. Rev. Cancer 16, 431–446. and wrote the manuscript. J.J.P., X.C., K.M., S.L.D., A.D., M.L., 18. Galdiero, M. R., Bonavita, E., Barajon, I., Garlanda, C., Mantovani, A., H.W.W., L.X., F.C., A.L.S., and P.P.-V. performed experiments. Jaillon, S. (2013) Tumor associated macrophages and neutrophils in cancer. Immunobiology 218, 1402–1410. S.W., A.V., E.S., E.M.S., P.H., and J.P.-I. supervised the projects 19. Galli, S. J., Borregaard, N., Wynn, T. A. (2011) Phenotypic and functional for this research, reviewed the manuscript, and provided plasticity of cells of innate immunity: macrophages, mast cells and neutrophils. Nat. Immunol. 12, 1035–1044. funding. 20. Fridlender, Z. G., Sun, J., Kim, S., Kapoor, V., Cheng, G., Ling, L., Worthen, G. S., Albelda, S. M. (2009) Polarization of tumor-associated neutrophil phenotype by TGF-beta: “N1” versus “N2” TAN. Cancer Cell 16, ACKNOWLEDGMENTS 183–194. 21. Nozawa, H., Chiu, C., Hanahan, D. (2006) Infiltrating neutrophils mediate the initial angiogenic switch in a mouse model of multistage E.S. and J.C. share senior authorship. The authors gratefully carcinogenesis. Proc. Natl. Acad. Sci. USA 103, 12493–12498. acknowledge the flow cytometry core facilities at H. Lee Moffitt 22. Murray, P. J., Allen, J. E., Biswas, S. K., Fisher, E. A., Gilroy, D. W., Goerdt, S., Gordon, S., Hamilton, J. A., Ivashkiv, L. B., Lawrence, T., Locati, M., Cancer Center and their extended technical support for our Mantovani, A., Martinez, F. O., Mege, J. L., Mosser, D. M., Natoli, G., project. This work has also been supported, in part, by the Analytic Saeij, J. P., Schultze, J. L., Shirey, K. A., Sica, A., Suttles, J., Udalova, I., van fi Ginderachter, J. A., Vogel, S. N., Wynn, T. A. (2014) Macrophage Microscopy Core Facility at the H. Lee Mof tt Cancer Center and activation and polarization: nomenclature and experimental guidelines. Research Institute, a U.S. National Institutes of Health National Immunity 41, 14–20. Cancer Institute (NCI)-designated Comprehensive Cancer Center 23. Brinkmann, V., Zychlinsky, A. (2012) Neutrophil extracellular traps: is immunity the second function of chromatin? J. Cell Biol. 198, 773–783. (P30-CA076292). This work was supported by NCI Grant CA 24. Branzk, N., Lubojemska, A., Hardison, S. E., Wang, Q., Gutierrez, M. G., 134807-05. Brown, G. D., Papayannopoulos, V. (2014) Neutrophils sense microbe size and selectively release neutrophil extracellular traps in response to large pathogens. Nat. Immunol. 15, 1017–1025. 25. Brinkmann, V., Reichard, U., Goosmann, C., Fauler, B., Uhlemann, Y., DISCLOSURES Weiss, D. S., Weinrauch, Y., Zychlinsky, A. (2004) Neutrophil – fl extracellular traps kill bacteria. Science 303, 1532 1535. The authors declare no con icts of interest. 26. Caudrillier, A., Kessenbrock, K., Gilliss, B. M., Nguyen, J. X., Marques, M. B., Monestier, M., Toy, P., Werb, Z., Looney, M. R. (2012) Platelets induce neutrophil extracellular traps in transfusion-related acute lung injury. J. Clin. Invest. 122, 2661–2671. REFERENCES 27. Carestia, A., Kaufman, T., Rivadeneyra, L., Landoni, V. I., Pozner, R. G., 1. Nicolas-´ Avila,´ J. A., Adrover, J. M., Hidalgo, A. (2017) Neutrophils in Negrotto, S., D’Atri, L. P., G´omez,R. M., Schattner, M. (2016) Mediators homeostasis, immunity, and cancer. Immunity 46, 15–28. and molecular pathways involved in the regulation of neutrophil 2. Phillipson, M., Kubes, P. (2011) The neutrophil in vascular extracellular trap formation mediated by activated platelets. J. Leukoc. inflammation. Nat. Med. 17, 1381–1390. Biol. 99, 153–162. 3. Kruger, P., Saffarzadeh, M., Weber, A. N., Rieber, N., Radsak, M., von 28. Fuchs, T. A., Abed, U., Goosmann, C., Hurwitz, R., Schulze, I., Wahn, V., Bernuth, H., Benarafa, C., Roos, D., Skokowa, J., Hartl, D. (2015) Weinrauch, Y., Brinkmann, V., Zychlinsky, A. (2007) Novel cell death Neutrophils: between host defence, immune modulation, and tissue program leads to neutrophil extracellular traps. J. Cell Biol. 176, 231–241. injury. PLoS Pathog. 11, e1004651. 29. Radic, M. (2014) Clearance of apoptotic bodies, NETs, and biofilm DNA: 4. Summers, C., Rankin, S. M., Condliffe, A. M., Singh, N., Peters, A. M., implications for autoimmunity. Front. Immunol. 5, 365. Chilvers, E. R. (2010) Neutrophil kinetics in health and disease. Trends 30. Wright, H. L., Moots, R. J., Bucknall, R. C., Edwards, S. W. (2010) Immunol. 31, 318–324. Neutrophil function in inflammation and inflammatory diseases. 5. Furze, R. C., Rankin, S. M. (2008) Neutrophil mobilization and clearance Rheumatology (Oxford) 49, 1618–1631. in the bone marrow. Immunology 125, 281–288. 31. Mantovani, A., Allavena, P., Sica, A., Balkwill, F. (2008) Cancer-related 6. Templeton, A. J., McNamara, M. G., Seruga,ˇ B., Vera-Badillo, F. E., Aneja, inflammation. Nature 454, 436–444. P., Ocaña, A., Leibowitz-Amit, R., Sonpavde, G., Knox, J. J., Tran, B., 32. Fiedler, K., Brunner, C. (2012) The role of transcription factors in the Tannock, I. F., Amir, E. (2014) Prognostic role of neutrophil-to- guidance of granulopoiesis. Am. J. Blood Res. 2, 57–65. lymphocyte ratio in solid tumors: a systematic review and meta-analysis. J. 33. Goyama, S., Kitamura, T. (2017) Epigenetics in normal and malignant Natl. Cancer Inst. 106, dju124. hematopoiesis: an overview and update 2017. Cancer Sci. 108, 553–562. 7. Gentles, A. J., Newman, A. M., Liu, C. L., Bratman, S. V., Feng, W., Kim, 34. Ostuni, R., Natoli, G., Cassatella, M. A., Tamassia, N. (2016) Epigenetic D., Nair, V. S., Xu, Y., Khuong, A., Hoang, C. D., Diehn, M., West, R. B., regulation of neutrophil development and function. Semin. Immunol. 28, Plevritis, S. K., Alizadeh, A. A. (2015) The prognostic landscape of genes 83–93. and infiltrating immune cells across human cancers. Nat. Med. 21, 35. Rice, K. L., Hormaeche, I., Licht, J. D. (2007) Epigenetic 938–945. regulation of normal and malignant hematopoiesis. Oncogene 26, 8. Borregaard, N. (2010) Neutrophils, from marrow to microbes. Immunity 6697–6714. 33, 657–670. 36. Prasad, P., R¨onnerblad,M., Arner, E., Itoh, M., Kawaji, H., Lassmann, T., 9. Mayadas, T. N., Cullere, X., Lowell, C. A. (2014) The multifaceted Daub, C. O., Forrest, A. R., Lennartsson, A., Ekwall, K.; FANTOM functions of neutrophils. Annu. Rev. Pathol. 9, 181–218. Consortium. (2014) High-throughput transcription profiling identifies 10. Pillay, J., den Braber, I., Vrisekoop, N., Kwast, L. M., de Boer, R. J., putative epigenetic regulators of hematopoiesis. Blood 123, e46–e57. Borghans, J. A., Tesselaar, K., Koenderman, L. (2010) In vivo labeling 37. Rosmarin, A. G., Yang, Z., Resendes, K. K. (2005) Transcriptional with 2H2O reveals a human neutrophil lifespan of 5.4 days. Blood 116, regulation in myelopoiesis: hematopoietic fate choice, myeloid 625–627. differentiation, and leukemogenesis. Exp. Hematol. 33, 131–143.

www.jleukbio.org Volume 102, August 2017 Journal of Leukocyte Biology 485 Downloaded from www.jleukbio.org to IP 216.185.5.2. Journal of Leukocyte Biology Vol.102, No.2 , pp:475-486, August, 2017 38. De Felice, L., Tatarelli, C., Mascolo, M. G., Gregorj, C., Agostini, F., 55. Villagra, A., Sotomayor, E. M., Seto, E. (2010) Histone deacetylases and Fiorini, R., Gelmetti, V., Pascale, S., Padula, F., Petrucci, M. T., Arcese, the immunological network: implications in cancer and inflammation. W., Nervi, C. (2005) Histone deacetylase inhibitor valproic acid enhances Oncogene 29, 157–173. the cytokine-induced expansion of human hematopoietic stem cells. 56. Zeng, L., Xiao, Q., Margariti, A., Zhang, Z., Zampetaki, A., Patel, S., Cancer Res. 65, 1505–1513. Capogrossi, M. C., Hu, Y., Xu, Q. (2006) HDAC3 is crucial in shear- and 39. Bartels, M., Geest, C. R., Bierings, M., Buitenhuis, M., Coffer, P. J. (2010) VEGF-induced stem cell differentiation toward endothelial cells. J. Cell Histone deacetylase inhibition modulates cell fate decisions during Biol. 174, 1059–1069. myeloid differentiation. Haematologica 95, 1052–1060. 57. Woan, K. V., Sahakian, E., Sotomayor, E. M., Seto, E., Villagra, A. (2012) 40. Zhang, X., Edwards, J. P., Mosser, D. M. (2006) Dynamic and transient Modulation of antigen-presenting cells by HDAC inhibitors: implications remodeling of the macrophage IL-10 promoter during transcription. J. in autoimmunity and cancer. Immunol. Cell Biol. 90, 55–65. Immunol. 177, 1282–1288. 58. Baylin, S. B., Ohm, J. E. (2006) Epigenetic gene silencing in cancer - a 41. Yao, Y., Li, W., Kaplan, M. H., Chang, C. H. (2005) Interleukin (IL)-4 mechanism for early oncogenic pathway addiction? Nat. Rev. Cancer 6, inhibits IL-10 to promote IL-12 production by dendritic cells. J. Exp. Med. 107–116. 201, 1899–1903. 59. Wang, Y., Li, M., Stadler, S., Correll, S., Li, P., Wang, D., Hayama, R., 42. Villagra, A., Cheng, F., Wang, H. W., Suarez, I., Glozak, M., Maurin, M., Leonelli, L., Han, H., Grigoryev, S. A., Allis, C. D., Coonrod, S. A. (2009) Nguyen,D.,Wright,K.L.,Atadja,P.W.,Bhalla,K.,Pinilla-Ibarz,J.,Seto,E., Histone hypercitrullination mediates chromatin decondensation and Sotomayor, E. M. (2009) The histone deacetylase HDAC11 regulates the neutrophil extracellular trap formation. J. Cell Biol. 184, 205–213. expression of interleukin 10 and immune tolerance. Nat. Immunol. 10, 92–100. 60. Dear, A. E. (2016) Epigenetic modulators and the new immunotherapies. 43. Sahakian, E., Powers, J. J., Chen, J., Deng, S. L., Cheng, F., Distler, A., N. Engl. J. Med. 374, 684–686. Woods, D. M., Rock-Klotz, J., Sodre, A. L., Youn, J. I., Woan, K. V., 61. Shen, L., Orillion, A., Pili, R. (2016) Histone deacetylase inhibitors as Villagra, A., Gabrilovich, D., Sotomayor, E. M., Pinilla-Ibarz, J. (2015) immunomodulators in cancer therapeutics. Epigenomics 8, 415–428. Histone deacetylase 11: a novel epigenetic regulator of myeloid derived 62. Stammler, D., Eigenbrod, T., Menz, S., Frick, J. S., Sweet, M. J., suppressor cell expansion and function. Mol. Immunol. 63, 579–585. Shakespear, M. R., Jantsch, J., Siegert, I., Wol¨ fle, S., Langer, J. D., Oehme, 44. Gao, L., Cueto, M. A., Asselbergs, F., Atadja, P. (2002) Cloning and I., Schaefer, L., Fischer, A., Knievel, J., Heeg, K., Dalpke, A. H., Bode, functional characterization of HDAC11, a novel member of the human K. A. (2015) Inhibition of histone deacetylases permits histone deacetylase family. J. Biol. Chem. 277, 25748–25755. lipopolysaccharide-mediated secretion of bioactive IL-1b via a caspase-1- 45. Heintz, N. (2001) BAC to the future: the use of bac transgenic mice for independent mechanism. J. Immunol. 195, 5421–5431. neuroscience research. Nat. Rev. Neurosci. 2, 861–870. 63. Joshi, P., Greco, T. M., Guise, A. J., Luo, Y., Yu, F., Nesvizhskii, A. I., 46. Pfaffl, M. W. (2001) A new mathematical model for relative Cristea, I. M. (2013) The functional interactome landscape of the human quantification in real-time RT-PCR. Nucleic Acids Res. 29, e45. histone deacetylase family. Mol. Syst. Biol. 9, 672. 47. Shakespear, M. R., Halili, M. A., Irvine, K. M., Fairlie, D. P., Sweet, M. J. 64. Nemzek, J. A., Hugunin, K. M., Opp, M. R. (2008) Modeling sepsis in the (2011) Histone deacetylases as regulators of inflammation and immunity. laboratory: merging sound science with animal well-being. Comp. Med. 58, Trends Immunol. 32, 335–343. 120–128. 48. Angus, D. C., Linde-Zwirble, W. T., Lidicker, J., Clermont, G., Carcillo, J., 65. Ciarlo, E., Savva, A., Roger, T. (2013) Epigenetics in sepsis: targeting Pinsky, M. R. (2001) Epidemiology of severe sepsis in the United States: histone deacetylases. Int. J. Antimicrob. Agents 42 (Suppl), S8–S12. analysis of incidence, outcome, and associated costs of care. Crit. Care 66. Adcock, I. M. (2007) HDAC inhibitors as anti-inflammatory agents. Br. J. Med. 29, 1303–1310. Pharmacol. 150, 829–831. 49. Warren, H. S. (2009) Editorial: mouse models to study sepsis syndrome in 67. Hicks, A. M., Riedlinger, G., Willingham, M. C., Alexander-Miller, M. A., humans. J. Leukoc. Biol. 86, 199–201. Von Kap-Herr, C., Pettenati, M. J., Sanders, A. M., Weir, H. M., Du, W., 50. McCuskey, R. S., McCuskey, P. A., Urbaschek, R., Urbaschek, B. (1984) Kim, J., Simpson, A. J., Old, L. J., Cui, Z. (2006) Transferable anticancer Species differences in Kupffer cells and endotoxin sensitivity. Infect. innate immunity in spontaneous regression/complete resistance mice. Immun. 45, 278–280. Proc. Natl. Acad. Sci. USA 103, 7753–7758. 51. Maestre, Z., Martinez-Madrid, M., Rodriguez, P., Reynoldson, T. (2007) 68. Di Carlo, E., Forni, G., Lollini, P., Colombo, M. P., Modesti, A., Musiani, Ecotoxicity assessment of river sediments and a critical evaluation of P. (2001) The intriguing role of polymorphonuclear neutrophils in some of the procedures used in the aquatic oligochaete Tubifex tubifex antitumor reactions. Blood 97, 339–345. chronic bioassay. Arch. Environ. Contam. Toxicol. 53, 559–570. 69. Sagiv, J. Y., Michaeli, J., Assi, S., Mishalian, I., Kisos, H., Levy, L., Damti, 52. Avellino, R., Delwel, R. (2017) Expression and regulation of C/EBPa in P.,Lumbroso,D.,Polyansky,L.,Sionov,R.V.,Ariel,A.,Hovav,A.H., normal myelopoiesis and in malignant transformation. Blood 129, 2083–2091. Henke, E., Fridlender, Z. G., Granot, Z. (2015) Phenotypic diversity 53. Sadeghi, K., Wisgrill, L., Wessely, I., Diesner, S. C., Sch¨uller,S., D¨urr,C., and plasticity in circulating neutrophil subpopulations in cancer. Cell Heinle, A., Sachet, M., Pollak, A., Forster-Waldl,¨ E., Spittler, A. (2016) Reports 10, 562–573. GM-CSF down-regulates TLR expression via the transcription factor PU.1 in human monocytes. PLoS One 11, e0162667. 54. Rogers, J. H., Owens, K. S., Kurkewich, J., Klopfenstein, N., Iyer, S. R., Simon, M. C., Dahl, R. (2016) E2A antagonizes PU.1 activity through KEY WORDS: inhibition of DNA binding. BioMed Res. Int. 2016, 3983686. epigenetics • innate immunity • gene regulation

486 Journal of Leukocyte Biology Volume 102, August 2017 www.jleukbio.org Downloaded from www.jleukbio.org to IP 216.185.5.2. Journal of Leukocyte Biology Vol.102, No.2 , pp:475-486, August, 2017 Essential role for histone deacetylase 11 (HDAC11) in neutrophil biology

Eva Sahakian, Jie Chen, John J. Powers, et al.

J Leukoc Biol 2017 102: 475-486 originally published online May 26, 2017 Access the most recent version at doi:10.1189/jlb.1A0415-176RRR

Supplemental http://www.jleukbio.org/content/suppl/2017/05/26/jlb.1A0415-176RRR.DC1 Material

References This article cites 69 articles, 23 of which can be accessed free at: http://www.jleukbio.org/content/102/2/475.full.html#ref-list-1

Subscriptions Information about subscribing to Journal of Leukocyte Biology is online at http://www.jleukbio.org/site/misc/Librarians_Resource.xhtml

Permissions Submit copyright permission requests at: http://www.jleukbio.org/site/misc/Librarians_Resource.xhtml

Email Alerts Receive free email alerts when new an article cites this article - sign up at http://www.jleukbio.org/cgi/alerts

© Society for Leukocyte Biology

Downloaded from www.jleukbio.org to IP 216.185.5.2. Journal of Leukocyte Biology Vol.102, No.2 , pp:475-486, August, 2017 Supplemental figure legends:

Figure 1 Legend: (A) Schematic representation of HDAC11KO mouse development and genotyping methods for proper identification of mouse colony. (B) qRT-PCR analysis of HDAC11 expression (using exon3-designed primers) in brain and spleen of

C57BL/6 wild-type and HDAC 11KO mice (n=3). (C) Expression of HDAC11 protein in brain and testes of C57BL/6 wild-type and HDAC 11KO mouse.

Figure 2 Legend: BM cells from the femurs of age-matched WT (C57BL/6) and/or

HDAC11KO (C57BL/6) mice (n=4/ mouse strain) were extracted and neutrophils from these samples were isolated using the StemCell™ EasySep magnetic selection kit.

Each sample was plated at equal numbers in triplicates in a 96-well plate. Cells were then treated (or not in the control groups) with 50ng/ml of mouse GM-CSF for 9 hours.

Next CellTiter-Blue® reagent was added to each well and incubated at 37C for 1 hour following by the measurement of fluorescent signal at 560(20)Ex/590(10)Em using a

BioTek Cytation 3 plate reader. (Data is a representative graph from 2 independent experiments).