DOCSLIB.ORG

Genetic Markers on Chromosome 19P and Prenatal Diagnosis of HLA Class II-Deficient Combined Immunodeficiency

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Genetic Markers on Chromosome 19P and Prenatal Diagnosis of HLA Class II-Deficient Combined Immunodeficiency 0031-3998/9513805·0812$03.00/0 PEDIATRIC RESEARCH Vol. 38, No.5, 1995 Copyright © 1995 International Pediatric Research Foundation, Inc. Printed ill U.S.A. Genetic Markers on Chromosome 19p and Prenatal Diagnosis of HLA Class II-Deficient Combined Immunodeficiency HANS-HEINRICH FORSTER, RALPH WASCH, TOBIAS KRETSCHMAR, OIETMAR MISCHKE, BARBARA UCHANSKA-ZIEGLER, ANDREAS ZIEGLER, MARKUS SCHMITT, AND HANS-ULRICH WAHN lnstitut fiir Experimentelle Onkologie und Transplantationsmedizin {H-HF., R.W., T.K., D.M., B.ti.z. A.Z.] and Kinderklinik und -Poliklinik (M.S ., H-U. W.], Universitdtsklinikum Rudolf Yirchow, Freie Universitiit Berlin, D-J4050 Berlin ABST& cr HLA class II-deficient combined immunodeficiency (CID) is 01 9S177. These data may offer the possibility of a rapid and an inherited disease characterized by a total lack of HLA class II early prenatal diagnosis of a subgroup of patients with HLA class gene expression, due to a regulatory defect affecting these genes. II-deficient CID. (Pediatr Res 38: 812-816, 1995) In the family investigated the disease phenotype occurs parallel to an abnormal structural feature of the C023 antigen. We sequenced parts of the FCER2 gene coding for C023 and found Abbreviations a restriction fragment length polymorphism (RFLP) that coseg­ CID, combined immunodeficiency regates with the disease. Analysis of recombinant haplotypcs by PCR, polymerase chain reaction microsatcllites mapping to the chromosomal region 19p13.3 SSCP, single-strand conformation polymorphism suggests that the disease locus maps between FCER2 and the RFLP, restriction fragment length polymorphisms microsatellite marker 0 19S424, probably close to 01 9S216 and FACS, fluorescence-activated cell sorter In clas s II-deficient cm the HLA class II genes are not spondingly, several cis-acting elem ents have been identified in transcribed, and expression of HLA class I antigens on the cell the promoter regions of HLA class II genes (6). surface is also reduced (1). The clini cal consequences are Fusion experiments among several cell lines from patients as hypo- or aga mmaglobulinemia and impaired cell-mediated we ll as in vitro ge nerated mutant cell lines displaying the HLA immunity resulting in repe ated, severe infections and intracta­ class Il-d eficient phenotype have established four different ble diarrhea with dystrophy caused by malab sorption (2). complementation groups (7). In three of thes e complementa­ Currently, the only cur ative therap y is bone marrow transplan­ tion groups all class II promoter elements seem to be unoccu­ tation, whereas under symptomatical therapy most patients die pied in vivo although the currently known facto rs that recog­ between the age of 6 mo and 5 y (3). nize HLA class II promoter elements can be detected in vitro The disease is inherited as an auto somal recessive trait with (8). a high degree of consanguinity. Although none of the patients The fourth complementation group exhibits norm al binding expresses HLA class II mRNA, the genetic defect does not of promoter elements by their respective proteins. A trans­ segregate with the HLA complex. Hence, these observations actin g factor term ed CIITA has been isolated recently. It has suggest a defect in class II regulatory genes which are unlinked been shown that HLA class II expression can be restored in to the major histo compatibility complex (4) encoding, for cells belonging to this group (9) upon transfection with CIITA exa mple, class II promoter-binding proteins (5). cDNA, but not in a cell line established from a deceased class HLA class II antigens have a restricted tissue distribution, II-Cm pati ent of the famil y studied. their expression is under tight transcriptional control and can EBV-transformed cell lines established from the affected be induced by various stimuli, e.g. by interferon-yo Corre- children of this famil y, but not from the healthy family mem­ bers, show an abnormality in their CD23 antigen. Although it reacts normally with other antibodies directed against CD23, it is not recognized by the MAb TVI (10). If this variation Received for rapid publicati on June 2, 1995; accepted July 17, 1995. Corresponden ce: Hans-Ulrich Wahn, Kinderklinik und -Poliklinik, Universitatsklini­ reflects a genetic polymorphism in the CD23 gene (FCER2), it kum Rudolf Virchow, Freie Universitat Berlin, Heubnerweg 6, D-14050 Berlin, Germany. would suggest link age between the class II regul atory gene RUNNING TITLE CLASS II-DEFICIENT cm ON CHROMOSOME 19 813 defect and FCER2, which has been mapped to chromosome protracted diarrhea, recurrent respiratory infections, and severe 19p13.3 (11). To test this hypothesis, we have analyzed the malabsorption leading to failure to thrive. Agammaglobuline­ CD23 gene and several highly polymorphic markers mapping mia developed after 3 mo, and IgG was substituted. Parenteral to the 19p13.3 region in the disease family. nutrition was necessary. B cell as well as T cell count was inconspicious. Severe cm classified as MHC class II defi­ METHODS ciency was diagnosed by a immunorosette-forming technique and by immunohistochemical staining with anti-HLA-DR General. HLA class II antigens were determined by fluo­ mAB. He died at an age of 20 mo, after a sudden attack with rescence-activated cell cytometry. DNA and RNA were iso­ dyspnea, cyanosis, and bradycardia, despite immediate cardio­ lated by standard procedures (12) from cells of both parents, pulmonary resuscitation. Septic shock and pulmonary embo­ three healthy children, two of the affected children, and a lism were mainly discussed as the differential diagnosis. chorionic villi sample and fetal blood of an umbilical cord In the first affected girl the same clinical problems occurred. puncture from the pregnant mother. Agammaglobulinemi a and immunologic findings led, as in the cDNA was synthesized and amplified using the GENE Amp affected brother, to the diagnosis of MHC class II deficiency. RNA PCR Kit (Perkin-Elmer, Norwalk, CT) according to the Bone marrow transplantation was planned and performed. She manufacturer's protocol. PCR products were sequenced di­ died during a severe sepsis 1 wk after haploidentical bone rectly with the Cycle Sequencing Kit (Perkin-Elmer). SSCP marrow transplantation in the 5th y of life. analysis was done as described previously (13). MHC class II deficiency could be diagnosed by FACScan Analysis ofthe FCER2 locus. Oligonucleotide primers used analysis in the second affected girl immediately after birth, are listed in Table 1. The determined RFLP were tested for all before clinical symptoms occurred. The immunologic findings family members by PCR amplification using the primers showed a complete lack of HLA class II molecule expression CD23-1 up and CD23-1 down for BstNI or CD23-3 up and on B lymphocytes and activated T lymphocytes and the ab­ CD23-4 down for Hpall RFLP. Amplification reactions con­ sence of serum immunoglobulins, as well as no in vitro re­ tained 100 ng of genomic DNA and 200 nM of each oligonu­ sponses to specific antigens. Haploidentical bone marrow cleotide primer in a 50-fl,L reaction volume. The reactions transplantation was performed at the age of 5 mo. The father were run for 35 cycles, 1 min each at 94, 60, and n °c. PCR served as donor. After transplantation a chimeric pattern of products were digested overnight with BstNI or Hpall restric­ MHC class II-negative and MHC class II-positive cells was tion endonuclease, separated on a 15% polyacrylamide gel present in the peripheral blood of the child. Delayed hypersen­ (160 X 140 x 0.75 mm), and detected by silver staining. sitivity skin tests became positive for tetanus, and diphtheria Microsatellite analysis. Genomic DNA was amplified with antigen as well as tetanus antigen-induced lymphocyte prolif­ the highly polymorphic microsatellite markers D19S247 (14), eration showed normal values. Ig production remained nega­ D19S209 (15), D19S424 (16) D19S216 (15), D19S406 (16), tive and IgG was given further on. Despite the improved D19S413 (16), D19S221 (15), D19S226 (15), D19S177 (17), cellular immunity gastrointestinal symptoms (diarrhea, malab­ UT486 (18), and LIPE (19) under conditions given in the sorption) persisted. At last the girl died during a severe septic respective references. Products were analyzed by native or infection with different Gram-negative rods and Candida albi­ denaturing polyacrylamide gel electrophoresis or by SSCP. cans. We isolated DNA and RNA from cells of both parents, three RESULTS healthy children (C1-C3), two of the affected children (C4 and In the consanguineous family studied (parents are cousins), C5), and a chorionic villi sample and fetal blood of an umbil­ two girls and one boy were affected by MHC class II defi­ ical cord puncture from the pregnant mother (C6) (Fig. 1a). ciency. Three out of six siblings are healthy (two girls and one Cells of C6 showed normal expression of HLA class II anti­ boy). gens. The affected son was born healthy and of normal weight To analyze the nature of the aberrant Ti n epitope on CD23, without any problems. After the neonatal period he developed we amplified parts of the CD23 cDNA by PCR using primers that were deduced from the published sequence (20, 21). After Table 1. Oligonucleotide primers used fo r PCR, RNA-PCR, and restriction enzyme digestion to yield fragments smaller than direct sequencing of FCER2 300 bp, the products were examined by SSCP analysis. Frag­ Product ments showing heterozygosity in the parents were further Denotation Sequence (5' -> 3') length (bp) examined by direct sequencing. We found two transitions, the 62 CD23- 1 up CGGGAGAATCCAAGCAGGACCG first being located in exon 4 causing a Arg Trp exchange 266 and creating a new BstNI restriction site. The second point CD23-1 down TGCGCCATCTGGTCACCG mutation, located in exon 9, causes an amino acid exchange CD23-2 up GGAACGTCTC TCAAGTTTCCAAGAAC Arg188 GIn (Fig. I c) and, concurrently, the destruction of a 449 CD23-2 down GGTCAGGAAGTCCTGCTCCTCC Hpall restriction site.
Load more

Recommended publications
  • (APOCI, -C2, and -E and LDLR) and the Genes C3, PEPD, and GPI (Whole-Arm Translocation/Somatic Cell Hybrids/Genomic Clones/Gene Family/Atherosclerosis) A
    Proc. Natl. Acad. Sci. USA Vol. 83, pp. 3929-3933, June 1986 Genetics Regional mapping of human chromosome 19: Organization of genes for plasma lipid transport (APOCI, -C2, and -E and LDLR) and the genes C3, PEPD, and GPI (whole-arm translocation/somatic cell hybrids/genomic clones/gene family/atherosclerosis) A. J. LUSIS*t, C. HEINZMANN*, R. S. SPARKES*, J. SCOTTt, T. J. KNOTTt, R. GELLER§, M. C. SPARKES*, AND T. MOHANDAS§ *Departments of Medicine and Microbiology, University of California School of Medicine, Center for the Health Sciences, Los Angeles, CA 90024; tMolecular Medicine, Medical Research Council Clinical Research Centre, Harrow, Middlesex HA1 3UJ, United Kingdom; and §Department of Pediatrics, Harbor Medical Center, Torrance, CA 90509 Communicated by Richard E. Dickerson, February 6, 1986 ABSTRACT We report the regional mapping of human from defects in the expression of the low density lipoprotein chromosome 19 genes for three apolipoproteins and a lipopro- (LDL) receptor and is strongly correlated with atheroscle- tein receptor as well as genes for three other markers. The rosis (15). Another relatively common dyslipoproteinemia, regional mapping was made possible by the use of a reciprocal type III hyperlipoproteinemia, is associated with a structural whole-arm translocation between the long arm of chromosome variation of apolipoprotein E (apoE) (16). Also, a variety of 19 and the short arm of chromosome 1. Examination of three rare apolipoprotein deficiencies result in gross perturbations separate somatic cell hybrids containing the long arm but not of plasma lipid transport; for example, apoCII deficiency the short arm of chromosome 19 indicated that the genes for results in high fasting levels oftriacylglycerol (17).
    [Show full text]
  • Human Chromosome‐Specific Aneuploidy Is Influenced by DNA
    Article Human chromosome-specific aneuploidy is influenced by DNA-dependent centromeric features Marie Dumont1,†, Riccardo Gamba1,†, Pierre Gestraud1,2,3, Sjoerd Klaasen4, Joseph T Worrall5, Sippe G De Vries6, Vincent Boudreau7, Catalina Salinas-Luypaert1, Paul S Maddox7, Susanne MA Lens6, Geert JPL Kops4 , Sarah E McClelland5, Karen H Miga8 & Daniele Fachinetti1,* Abstract Introduction Intrinsic genomic features of individual chromosomes can contri- Defects during cell division can lead to loss or gain of chromosomes bute to chromosome-specific aneuploidy. Centromeres are key in the daughter cells, a phenomenon called aneuploidy. This alters elements for the maintenance of chromosome segregation fidelity gene copy number and cell homeostasis, leading to genomic instabil- via a specialized chromatin marked by CENP-A wrapped by repeti- ity and pathological conditions including genetic diseases and various tive DNA. These long stretches of repetitive DNA vary in length types of cancers (Gordon et al, 2012; Santaguida & Amon, 2015). among human chromosomes. Using CENP-A genetic inactivation in While it is known that selection is a key process in maintaining aneu- human cells, we directly interrogate if differences in the centro- ploidy in cancer, a preceding mis-segregation event is required. It was mere length reflect the heterogeneity of centromeric DNA-depen- shown that chromosome-specific aneuploidy occurs under conditions dent features and whether this, in turn, affects the genesis of that compromise genome stability, such as treatments with micro- chromosome-specific aneuploidy. Using three distinct approaches, tubule poisons (Caria et al, 1996; Worrall et al, 2018), heterochro- we show that mis-segregation rates vary among different chromo- matin hypomethylation (Fauth & Scherthan, 1998), or following somes under conditions that compromise centromere function.
    [Show full text]
  • Alzheimer's Disease Genetics Fact Sheet
    Alzheimer’s Disease Genetics FACT SHEET cientists don’t yet fully In other diseases, a genetic variant understand what causes may occur. This change in a gene can SAlzheimer’s disease. How- sometimes cause a disease directly. ever, the more they learn about More often, it acts to increase or this devastating disease, the more decrease a person’s risk of develop- they realize that genes* play an ing a disease or condition. When a important role in its development. genetic variant increases disease risk Research conducted and funded but does not directly cause a disease, by the National Institute on Aging it is called a genetic risk factor. (NIA) at the National Institutes of Health and others is advancing Alzheimer’s Disease Genetics the field of Alzheimer’s disease genetics. Alzheimer’s disease is an irreversible, progressive brain disease. It is charac- terized by the development of amyloid The Genetics of Disease plaques and neurofibrillary tangles, the loss of connections between nerve Some diseases are caused by a cells, or neurons, in the brain, and genetic mutation, or permanent the death of these nerve cells. There change in one or more specific are two types of Alzheimer’s—early- genes. If a person inherits from onset and late-onset. Both types have a parent a genetic mutation that a genetic component. causes a certain disease, then he or she will usually get the disease. Early-Onset Alzheimer’s Disease Sickle cell anemia, cystic fibrosis, and early-onset familial Alzheimer’s Early-onset Alzheimer’s disease disease are examples of inherited occurs in people age 30 to 60.
    [Show full text]
  • The Cytogenetics of Hematologic Neoplasms 1 5
    The Cytogenetics of Hematologic Neoplasms 1 5 Aurelia Meloni-Ehrig that errors during cell division were the basis for neoplastic Introduction growth was most likely the determining factor that inspired early researchers to take a better look at the genetics of the The knowledge that cancer is a malignant form of uncon- cell itself. Thus, the need to have cell preparations good trolled growth has existed for over a century. Several biologi- enough to be able to understand the mechanism of cell cal, chemical, and physical agents have been implicated in division became of critical importance. cancer causation. However, the mechanisms responsible for About 50 years after Boveri’s chromosome theory, the this uninhibited proliferation, following the initial insult(s), fi rst manuscripts on the chromosome makeup in normal are still object of intense investigation. human cells and in genetic disorders started to appear, fol- The fi rst documented studies of cancer were performed lowed by those describing chromosome changes in neoplas- over a century ago on domestic animals. At that time, the tic cells. A milestone of this investigation occurred in 1960 lack of both theoretical and technological knowledge with the publication of the fi rst article by Nowell and impaired the formulations of conclusions about cancer, other Hungerford on the association of chronic myelogenous leu- than the visible presence of new growth, thus the term neo- kemia with a small size chromosome, known today as the plasm (from the Greek neo = new and plasma = growth). In Philadelphia (Ph) chromosome, to honor the city where it the early 1900s, the fundamental role of chromosomes in was discovered (see also Chap.
    [Show full text]
  • Stem Cells® Original Article
    ® Stem Cells Original Article Properties of Pluripotent Human Embryonic Stem Cells BG01 and BG02 XIANMIN ZENG,a TAKUMI MIURA,b YONGQUAN LUO,b BHASKAR BHATTACHARYA,c BRIAN CONDIE,d JIA CHEN,a IRENE GINIS,b IAN LYONS,d JOSEF MEJIDO,c RAJ K. PURI,c MAHENDRA S. RAO,b WILLIAM J. FREEDa aCellular Neurobiology Research Branch, National Institute on Drug Abuse, Department of Health and Human Services (DHHS), Baltimore, Maryland, USA; bLaboratory of Neuroscience, National Institute of Aging, DHHS, Baltimore, Maryland, USA; cLaboratory of Molecular Tumor Biology, Division of Cellular and Gene Therapies, Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, Maryland, USA; dBresaGen Inc., Athens, Georgia, USA Key Words. Embryonic stem cells · Differentiation · Microarray ABSTRACT Human ES (hES) cell lines have only recently been compared with pooled human RNA. Ninety-two of these generated, and differences between human and mouse genes were also highly expressed in four other hES lines ES cells have been identified. In this manuscript we (TE05, GE01, GE09, and pooled samples derived from describe the properties of two human ES cell lines, GE01, GE09, and GE07). Included in the list are genes BG01 and BG02. By immunocytochemistry and reverse involved in cell signaling and development, metabolism, transcription polymerase chain reaction, undifferenti- transcription regulation, and many hypothetical pro- ated cells expressed markers that are characteristic of teins. Two focused arrays designed to examine tran- ES cells, including SSEA-3, SSEA-4, TRA-1-60, TRA-1- scripts associated with stem cells and with the 81, and OCT-3/4. Both cell lines were readily main- transforming growth factor-β superfamily were tained in an undifferentiated state and could employed to examine differentially expressed genes.
    [Show full text]
  • Definition of the Landscape of Promoter DNA Hypomethylation in Liver Cancer
    Published OnlineFirst July 11, 2011; DOI: 10.1158/0008-5472.CAN-10-3823 Cancer Therapeutics, Targets, and Chemical Biology Research Definition of the Landscape of Promoter DNA Hypomethylation in Liver Cancer Barbara Stefanska1, Jian Huang4, Bishnu Bhattacharyya1, Matthew Suderman1,2, Michael Hallett3, Ze-Guang Han4, and Moshe Szyf1,2 Abstract We use hepatic cellular carcinoma (HCC), one of the most common human cancers, as a model to delineate the landscape of promoter hypomethylation in cancer. Using a combination of methylated DNA immunopre- cipitation and hybridization with comprehensive promoter arrays, we have identified approximately 3,700 promoters that are hypomethylated in tumor samples. The hypomethylated promoters appeared in clusters across the genome suggesting that a high-level organization underlies the epigenomic changes in cancer. In normal liver, most hypomethylated promoters showed an intermediate level of methylation and expression, however, high-CpG dense promoters showed the most profound increase in gene expression. The demethylated genes are mainly involved in cell growth, cell adhesion and communication, signal transduction, mobility, and invasion; functions that are essential for cancer progression and metastasis. The DNA methylation inhibitor, 5- aza-20-deoxycytidine, activated several of the genes that are demethylated and induced in tumors, supporting a causal role for demethylation in activation of these genes. Previous studies suggested that MBD2 was involved in demethylation of specific human breast and prostate cancer genes. Whereas MBD2 depletion in normal liver cells had little or no effect, we found that its depletion in human HCC and adenocarcinoma cells resulted in suppression of cell growth, anchorage-independent growth and invasiveness as well as an increase in promoter methylation and silencing of several of the genes that are hypomethylated in tumors.
    [Show full text]
  • Variation in Chromosome 19
    J Med Genet: first published as 10.1136/jmg.16.1.79 on 1 February 1979. Downloaded from Case reports 79 This research was supported in part by the UCLA Requests for reprints to Dr S. J. Funderburk, Mental Retardation/Child Psychiatry Program, and Neuropsychiatric Institute, 760 Westwood Plaza, NIH grants MCH-927, HD-04612, HD-05615, and Los Angeles, California 90024, USA. HD-06576. STEvE J. FUNDERBURK,' ROBERT S. SPARKES,2 AND IVANA KLISAK2 Variation in chromosome 19 'Department ofPsychiatry, Mental Retardation Research Program, and 2Departments ofPsychiatry, Pediatrics, and SUMMARY Variations in centromeric staining of Medicine, UCLA School ofMedicine, chromosome 19 appear to be an uncommon Los Angeles, California, USA polymorphism inherited in a Mendelian manner and easily seen in G-banded cells. It should not References be misinterpreted as a structural cytogenetic abnormality. 1Alfi, O., Donnell, G. N., Crandall, B. F., Derencsenyi, A., and Menon, R. (1973). Deletion of the short arm of chromosome 9 (46,9p-): a new deletion syndrome. Although Craig-Holmes et al. (1973) were the first Annales de Gene'tique, 16, 11-22. to draw attention to additional centromeric banding 2Alfi, O., Sanger, R. G., Sweeny, A. E., and Donnell, G. N. (1974). 46, del (9) (22:). A new deletion syndrome. Clinical in the F group of chromosomes, it was Crossen Cytogenetics and Genetics. Birth Defects: Original Article (1975) who specifically implicated chromosome 19. Series, 10, 27-34. The National Foundation-March of However, there has been very little documentation Dimes, New York. of this variant. McKenzie and Lubs (1975) and 3Alfi, O., Donnell, G.
    [Show full text]
  • Rapid Molecular Assays to Study Human Centromere Genomics
    Downloaded from genome.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press Method Rapid molecular assays to study human centromere genomics Rafael Contreras-Galindo,1 Sabrina Fischer,1,2 Anjan K. Saha,1,3,4 John D. Lundy,1 Patrick W. Cervantes,1 Mohamad Mourad,1 Claire Wang,1 Brian Qian,1 Manhong Dai,5 Fan Meng,5,6 Arul Chinnaiyan,7,8 Gilbert S. Omenn,1,9,10 Mark H. Kaplan,1 and David M. Markovitz1,4,11,12 1Department of Internal Medicine, University of Michigan, Ann Arbor, Michigan 48109, USA; 2Laboratory of Molecular Virology, Centro de Investigaciones Nucleares, Facultad de Ciencias, Universidad de la República, Montevideo, Uruguay 11400; 3Medical Scientist Training Program, University of Michigan, Ann Arbor, Michigan 48109, USA; 4Program in Cancer Biology, University of Michigan, Ann Arbor, Michigan 48109, USA; 5Molecular and Behavioral Neuroscience Institute, University of Michigan, Ann Arbor, Michigan 48109, USA; 6Department of Psychiatry, University of Michigan, Ann Arbor, Michigan 48109, USA; 7Michigan Center for Translational Pathology and Comprehensive Cancer Center, University of Michigan Medical School, Ann Arbor, Michigan 48109, USA; 8Howard Hughes Medical Institute, Chevy Chase, Maryland 20815, USA; 9Department of Human Genetics, 10Departments of Computational Medicine and Bioinformatics, University of Michigan, Ann Arbor, Michigan 48109, USA; 11Program in Immunology, University of Michigan, Ann Arbor, Michigan 48109, USA; 12Program in Cellular and Molecular Biology, University of Michigan, Ann Arbor, Michigan 48109, USA The centromere is the structural unit responsible for the faithful segregation of chromosomes. Although regulation of cen- tromeric function by epigenetic factors has been well-studied, the contributions of the underlying DNA sequences have been much less well defined, and existing methodologies for studying centromere genomics in biology are laborious.
    [Show full text]
  • Mitochondrial DNA and Genetic Disease
    Arch Dis Child: first published as 10.1136/adc.63.8.883 on 1 August 1988. Downloaded from Archives of Disease in Childhood, 1988, 63, 883-885 Mitochondrial DNA and genetic disease Mitochondrial DNA (mtDNA) became news a few expression of a maternally transmitted antigen months ago when a publication in Nature announced (MTA), is dependent on a variant mtDNA although that we may all be descended from a single African the mechanism by which it interacts with this nuclear woman who lived 200 000 years ago.' The gene encoding the protein antigen is obscure.8) 'mitochondrial African Eve' hypothesis is based on Likely human diseases include the mitochondrial the fact that mitochondria are strictly maternally myopathies, Leber's optic neuropathy, congenital inherited, and the accumulation of mutations can be myotonic dystrophy, and chloramphenicol induced used as a genetic clock.2 aplastic anaemia. These criteria exclude a large But mtDNA should not just remain the province number of conditions where nuclear encoded of evolutionary biologists, feminists, and religious mitochondrial enzymes may be affected such as fundamentalists. To paediatricians it offers an ex- Leigh's encephalopathy, where inheritance is prob- planation for maternal inheritance patterns in ably recessive. human disease, as an individual's mitochondria are A familiar alternative explanation for maternal inherited exclusively from the mother. For example, inheritance is a transplacental biochemical factor, as mitochondrial mutations could cause some types of occurs in transient neonatal myaesthenia gravis. mitochondrial myopathy,3 Leber's optic neuro- Although this could explain the initial improvement pathy,4 and could influence the clinical manifesta- in congenital myotonic dystrophy it does not explain tions of congenital myotonic dystrophy5 and the persistent developmental delay nor why non- neurofibromatosis.6 myotonic offspring are unaffected, nor the progres- sive degeneration in Leber's and mitochondrial The mitochondrial genome: 'small is beautiful' myopathy.
    [Show full text]
  • 1 SUPPLEMENTARY RESULTS Hypomethylated Promoters Are
    SUPPLEMENTARY RESULTS Hypomethylated promoters are neither mutated nor deleted in HCC samples To rule out the possibility that the demethylation observed in gene promoters in our pyrosequencing assays (conversion of a C to T following bisulfite conversion) indicates a mutation of C to T rather than demethylation, we sequenced the unconverted DNA of AKR1B10, CENPH, MMP2, MMP9, MMP12, NUPR1, PAGE4, PLAU, and S100A5 promoter regions using the pyrosequencing SNP assay (Supplementary Fig. S2). We show that in all cases the fraction of cytosines in the unconverted sequence is similar in normal liver and in HCC. Therefore, the increase in the fraction of cytosines that were converted to thymidine in the tumor samples occurred only after bisulfite treatment and it was not due to mutations of Cs to Ts. Loss of signal for methylated DNA in hypomethylated promoters in HCC did not result from loss of DNA by deletions since our method internally controls for loss of DNA. Our MeDIP arrays are hybridized with both DNA immunoprecipitated with anti-5-methylcytosine antibody as well as total DNA. Thus, our assays measure both DNA methylation and DNA integrity. The DNA methylation signal reflects the ratio of signal for methylated DNA immunoprecipitation with the anti-5-methylcytosine antibody over total DNA in the sample at the indicated genome position. Loss of DNA by deletion would have increased the ratio of methylated DNA to total DNA to infinity and would have presented itself as hypermethylation rather than hypomethylation. Careful examination of the promoters that were demethylated in HCC provides evidence for the absence of deletions/amplifications in the genes that are hypomethylated in HCC patients.
    [Show full text]
  • 19P13.13 Microdeletions
    19p13.13 microdeletions rarechromo.org Sources 19p13.13 microdeletion The information in this A 19p13.13 microdeletion is a very rare genetic guide is drawn from four condition, in which there is a tiny piece of one of sources: the medical the 46 chromosomes missing. In this case, it is literature, the chromosome from the region known as p13.13, on database Decipher www. chromosome 19 (see diagram on page 3). The decipher.sanger.ac.uk, the missing piece of chromosome is very small Unique members’ database (less than 5Mb) and is called a microdeletion. and a survey of Unique The information in this guide is new as this is an members. For the emerging syndrome. There is likely to be a published medical range of effects from mild to more severe. literature, the first-named author and publication date Genes and chromosomes are given to allow you to The human body is made up of trillions of cells. look for the abstracts or Most of the cells contain a set of around 20,000 original articles on the different genes; this genetic information tells internet in PubMed the body how to develop, grow and function. (www.ncbi.nlm.nih.giv/ Genes are carried on structures called pubmed/). If you wish, you chromosomes, which carry the genetic material, can obtain most articles or DNA, that makes up our genes. from Unique. Chromosomes usually come in pairs: one This guide draws on chromosome from each parent. Of the 46 information from a survey chromosomes, two are a pair of sex of three members of chromosomes: XX (a pair of X chromosomes) in Unique in 2013, referenced females and XY (one X chromosome and one Y Unique, and the medical chromosome) in males.
    [Show full text]
  • Receptor Signaling Through Osteoclast-Associated Monocyte
    Downloaded from http://www.jimmunol.org/ by guest on September 29, 2021 is online at: average * The Journal of Immunology The Journal of Immunology , 20 of which you can access for free at: 2015; 194:3169-3179; Prepublished online 27 from submission to initial decision 4 weeks from acceptance to publication February 2015; doi: 10.4049/jimmunol.1402800 http://www.jimmunol.org/content/194/7/3169 Collagen Induces Maturation of Human Monocyte-Derived Dendritic Cells by Signaling through Osteoclast-Associated Receptor Heidi S. Schultz, Louise M. Nitze, Louise H. Zeuthen, Pernille Keller, Albrecht Gruhler, Jesper Pass, Jianhe Chen, Li Guo, Andrew J. Fleetwood, John A. Hamilton, Martin W. Berchtold and Svetlana Panina J Immunol cites 43 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Author Choice option Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Freely available online through http://www.jimmunol.org/content/suppl/2015/02/27/jimmunol.140280 0.DCSupplemental This article http://www.jimmunol.org/content/194/7/3169.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Author Choice Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2015 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606.
    [Show full text]