US008110348B2

(12) United States Patent (10) Patent No.: US 8,110,348 B2 Brzustowicz et al. (45) Date of Patent: Feb. 7, 2012

(54) METHODS AND COMPOSITIONS FOR THE CI2N5/0793 (2010.01) DAGNOSIS AND TREATMENT OF GOIN33/53 (2006.01) SCHIZOPHRENA (52) U.S. Cl...... 435/4; 435/325; 435/368; 435/7.1; 435/6.1 (76) Inventors: Linda M. Brzustowicz, Madison, NJ (US); Bonnie L. Firestein-Miller, (58) Field of Classification Search ...... None Hillsborough, NJ (US) See application file for complete search history. (*) Notice: Subject to any disclaimer, the term of this (56) References Cited patent is extended or adjusted under 35 U.S.C. 154(b) by 173 days. FOREIGN PATENT DOCUMENTS WO WO 99.37768 * 7/1999 (21) Appl. No.: 12/263,939 WO WOO2098.900 * 12/2002 OTHER PUBLICATIONS (22) Filed: Nov. 3, 2008 Zaks-Makhina et al. Mol Pharm 6.5: 214-219, 2004.* Prior Publication Data (65) * cited by examiner US 2009/0215877 A1 Aug. 27, 2009 Primary Examiner — Daniel E. Kolker Related U.S. Application Data Assistant Examiner — Aditi Dutt (63) Continuation-in-part of application No. 1 1/814,906, (74) Attorney, Agent, or Firm — Dann, Dorfman, Herrell & filed as application No. PCT/US2006/002771 on Jan. Skillman; Kathleen D. Rigaut 26, 2006. ABSTRACT (60) Provisional application No. 60/647.261, filed on Jan. (57) 26, 2005, provisional application No. 61/001,684, Compositions and methods relating to the diagnosis and treat filed on Nov. 3, 2007. ment of neuropsychiatric disorders, such as Schizophrenia, schizoaffective disorders, and bipolar disorders are disclosed. (51) Int. C. Also provided are methods for screening therapeutic agents CI2O I/00 (2006.01) having efficacy for the treatment of such disorders. CI2O I/68 (2006.01) CI2N5/00 (2006.01) 5 Claims, 26 Drawing Sheets U.S. Patent Feb. 7, 2012 Sheet 1 of 26 US 8,110,348 B2

Figure 1.

A

------t s Full-length -o-o-o-o-o-o-o-o-o-o-o- Short-Form to an est

B 5' UTR '' UTR Full-Length ... Short-Form

al-r- Kb.

C Full-length

Short-Form U.S. Patent Feb. 7, 2012 Sheet 2 of 26 US 8,110,348 B2

Figure 2

U.S. Patent Feb. 7, 2012 Sheet 3 of 26 US 8,110,348 B2

Figure 3

CAPON Full-Length Expression by Diagnosis

Cert Schizophrenia Bipolar U.S. Patent Feb. 7, 2012 Sheet 4 of 26 US 8,110,348 B2

Figure 4

CAPON Short-Form Expression by Diagnosis O5

5

Control Schizophrenia Bipolar U.S. Patent Feb. 7, 2012 Sheet 5 of 26 US 8,110,348 B2

Figure 5 CAPON Short-Form Expression by Genotype

U.S. Patent Feb. 7, 2012 Sheet 6 of 26 US 8,110,348 B2

Figure 6

2.

O

18 - 16 14 12 10

GFP Capon-L. U.S. Patent Feb. 7, 2012 Sheet 7 of 26 US 8,110,348 B2

goebuenbesareº,outora (gZ:ONCIIÕIGIS)I-awTSON U.S. Patent Feb. 7, 2012 Sheet 8 of 26 US 8,110,348 B2

Figure 8A

NOSAP-L (SEQ ID NO : 1)

SEQ No. 1 >CAPO full-length TTCTCTTCGTCCCGGCGGGCTCCACTCTCTGGGGCCGGCGCCGCGCCAGCC ce CGGCCGAGCCCCGCCCCCCCCCGGGCAGGGCCGCGCCGC TCCCGCCGCCACCCCCCCCGCCGCCCTCCTAGCCGCAGGAATGCGC&ACCACA CCCGCTCCGTCCCCGAGCCAGCCCGGCCGCGCCCCGACGTC CeeCCGCCGCKecCCAccTCCCCCCCCAcrocCAGCCAC GCGTCGCCGCGCCCGCTCCGTCCCCCTCCCCGGGGCGCCAGCCCCCA (CCCCCCTCCAAGAGCGGGCCGCCGCGGGTAACGCCTSCACCAAGT CAACCTTGTGGACGATGGCCGACCCACCCCT CACAACGCCTTC AGCACGGCATTGCTTTGAGCCAAGTACGTAGGARGCCTGGACGTGCCGGCCCAA ACGGACCACCCGAAAACAAA CATCAAGAAGAAGAAAGTGRGCATTATGGTTTCAGTGGAGGAGTGAAAGGATTCTGA AAAAGAAAAAAAAAAAGACGGXGATsAGACAATCGGGC GCCCCATCTACAGGRTCTTCTATGTCTCCAGATTCCCAAACTTGAAATCTTCG CTATACGCCGGATGGTGCCAGCAATTCTTCAGGGTAACGTCTAAATCCAAGA ARAGAGCCAACTTGAAATCACGTACT's A AAGCTGAGCCGCAGCACACGCAGCAGAATGCAGATGGCCAGGAAGAGGAAGAGTA (AAACACACAGCCAGACCCAGCCGCAGCCACGGGCCGAGAGGGCC CCACGGCCWGCAGAGGGACTGACACAGCGGGACCCACTCCAGe. ArecCTGGAATCAGCCGGGGGCGATTAGATGCTGAGGGAAGGPAGGGG CTTCACAAGCTCCAGCCACCCCCAGGAGCCCATGcGACAGCCTCACCCA GGAGCTGCCCCTTCCTTCCCGAAGCCTCCAGGCCTGGGCACAAACACCCC TcCACTCACCACCAGArcCAGCOXCCAGCAGCTCCTCCAGCGCAGCGCGCGAC AAGTGSCTTGGCCCRGGCACTTGCTGAAGACCATTGGCGCTAGGCGCGG CCGGCTGGAGGCCCAGGCCGCGGCATCAGCTTTTGCTGcGAACAAGGACATGCTC CGACACTCCCCAAGGCAcACTGAAC(AACT CASACA GAACGCCATGGGCCCCGGACGCTTGCTGGGATCACGTCCGCTCCGGAGCCGC CCGTGCTCTTACCCCACACCCAGCCAAGGACCGACGCCGCCGGGGC GCGGGTTGGCTGACNGCCCAOCCTGCGGGCGCCCCTTAGGAGGCece CT AAC(AGCTCGCTCTCCGCCGAGGAACCCCGCCCCAGGCAGG GCGAGGCGCTCCGSGCGGCGGAGCTCATCAGCCGAGAGCAGGCARCGCCTCG GAGTACGAGTCCAAGGACGAGAGCGAGGGCGCGATCGGGTCCCGGGGAGCT CCGCCGTGAGCCAectice-ACCACCCCTGAeAAA CGCCGGTAGGGCCGAGGGCGAGGAGATGGAGGCGGCGGCGTGGCTGGAGGGGCCG CTCC CTCCAAGCCAAATCCGCCGGAATGCC AGCCAGGGCCGGGFGAGTGTGAGGTTTCAGGAAAGTATTGAGATTCTGcGAGGG AAGGGAAAAATCGGTTCCCAGAAAAGCCCTCTCACGTGA AGAGGGGGTGGAGGTAAGGCCTCCAGAGCCAGGCTTCAGGAGAGGGCCTCTCC AGGACTGCCAGGCTGCTGGAGGACCTGccccracCTGCTGCATCGTCAGGCTCCCAcG TTGTCCGTGATGCCCCCCTACCCCCTCACTCTCCCCGrcCCATGGTCCCGACCAGGA AGGGAAGCCATCGGTRCCTTCTCAGGTACTTGTTTCTGGATATCACGATGCT(CAG U.S. Patent Feb. 7, 2012 Sheet 9 of 26 US 8,110,348 B2

Figure 8A (Cont. )

TTGGTGTGGAGCCCGGGGGGGCACTCNCIGT Acces GArcCrgrrrrrocrgcc.criccorriccircrgicTGGCCCAGCC

U.S. Patent Feb. 7, 2012 Sheet 10 of 26 US 8,110,348 B2

Figure 8B

NOS1AP-L Protein (SEQ ID NO : 2)

it ser lys "r Lys yr Asr Ele Asp Asp gy is AP te Arg e. Pro Le. His Asr G. As A a Phe in his gy le cy. Phe S. cu Ae g Tyr was sy Sir let Asp was Fro Arg Pro Asr Ser Arg Wi it e via & As set Air Arg e Arg tyr glu rhe Lys Ala s s Lys Asn Ie ty's Lys ;: lys Wal ser Ele t We set a As gly s wall lys via e Let Lys ty's lys y’s g Lys Lys est Trip As Gu Ser Lys et let via Met Gr. As Pre. Ie tyr Arg ryr va ii. His Asp ser es. Asp. i.e. ys he seris ge e Aa s Arg 8 diy an a ser Asn e Pie Arg Oys As n va fie Lys Ser Lys 3. Lys tys ser Gin Ala Met Ari Ele was Arg Thr via Giy Gr a s t La Wa cys his : i.e. Seir et in His rtr girl gr. As Aa. As p s gly girl G. Asp Gly Gu ser is Arg, Asr ser Asr Ser ser gy. As is re Gyf Arg g let Thr gy Ala glu Arg At a ser : Ala Thr Aa SS 2 c Glu hr Asp e As As We it is Let Pro Gy As As 220 Wall Let G. Pie ser Arg cy was thr Asp E.et As A a via sy y 2. i cy (sy ser is fir gly ser Lys val is Fre g Prs s et r A a ser: Pre Arg et i.e. Let r Sr* ser ser ty's 2. 2S f re pri gy let city rer r e. Ser r is is s 28S Gr i.e. s r. gr Le e er Gr er er r" c us s s At a A gif at is let let Elys Asp 6. et A & As Ali s s s Ala Ala Arg, Le G. As Gin Aa Arg wal is Gr, i.e. e. Leli Gr s s s Ys Asp set i.e. s r. is Sier eli e We lys gir Wis s S. g e Gu Let ifs et Ser Gly As A tet g Sir Gr As p s 360 ser le Let Giti "r Pre Arg ser esy Ala s pr is f g Asp Frt The ge Pro Lys Asp leu. His ser Pro Pro e sy s s t Ala gy Leu Ala as Pie As. His Pro Aa Giy Ser Fre et Gy Arg ses A. Arg, Asp is e a ty's le Git ys Phe Arg Phe et Pro r (s s Asp thr Pres Fre Pro Aa G Gly GE A1 a let lies (sy city e g 435 4. S. Leu e Lys Phe Arg sit Ser (sy Lie A a ser Giti Tyr G st 450 ass 6. rhr Asp G se gt Gus Arg Asp ser Trp ser Sri Giti Git e ar tes af sis is Arg leu Leli Asr wall leu Ghr Arg Gin glu et gy Asp Gy te Asp 4ss is ass Aspi Gu e As a U.S. Patent Feb. 7, 2012 Sheet 11 of 26 US 8,110,348 B2

Figure 8C

NOS1AP-S (SEQ ID NO : 3)

SER D fo. 3 (A949.99) gtatgcaa. tgttgggg it. sixties ELEgotiagoag titotggerSl gge:3 categt. atcottar tottkgest tortgatatata ttittgg atti gto tittgaggot citics agact bitt C. Critt tag electil his titt tgtchet. statestigac Gaagttggest tapattggtg titrattac2-il cotetctg gractica Actg. atttgctaga gCaortgara galacticagga acacaortal att tact at tittitt ggatattata agata tascar gatggaegas 361 at at-ggg siggitttgt. ggggggt. gridggest cutgcatter begtgee sixteca.g. actictha tgttgaget. gicaggage text: ragtettitt 48l. gig tittittaa. tggaggcEtt attatgtagg catgattgat test cattg gcc.citygtgil attagettan attittagcao g-gattggg g-tact guasaakotii to totaat its got totatatgt. siggit at aggs tittgeisgart tectatt statt titat alth take tetggagat.cr2 taggett ggistt. Estagg aggata Accide. tgttittacfall tgttcaaac citigttct:ac acticag title attatatg agacaaaaaaa. atgagttga. ottcttgado aaaatatag ttittgtcott agractitt tggagga cage 9 it tattta aatticottar getttgto cgtggest taxatist to puaatsggit 96l. callege attsggest citat-ggg cragagggag gotcity testag tgaattite tgttgg ttgttggrg gg gracacic taggeragi agtracttggll &catapgtgg ccarictgttga gtag cattg catttgtt ft2. tgttgartetc.111 tittggagical t as littg gthstett tortgaggg ggestuagittle agittittg sitect ckett reg cal Excitate tests: gets caccity to test the cacaocatgg tittggit ca. 4tc. titlets agctaeattg texaggera ta. Pettes ttagttcact tatticaggg gettctgaal 3Bl it grittg gigabictatt takti etc. tttgaacaag sitesatat gbgtgaacal di bitttgo Ittatatt attette cit tgttctgyt throtto 15 titcast gagttt tatt ticacial sig tattitt 33.33. tgttgate 155 Catctggger totaa.gcatgc tgaatgcatt getgeClict gttctg.cgt. gagggttgll artist gaggotia as attgttca etcage::ct. twict tggaggaggliel U.S. Patent Feb. 7, 2012 Sheet 12 of 26 US 8,110,348 B2

Figure 8C (Cont. ) actitat atcagtcag car agttg assig gtgttgt gtsatatgttgll tastica tggtootage tgttctgc.cat get it is is get giggestigiale tggest sist t citgectrict. atter attiei gtgttcets t tgttctgggg Latgag gigaaagat eitstigati tCuttggio actgttct. it it. getata getttgttt tigtettigs tigat tags gag tgecocette tie is it tatgc tigataggtg2. tgagt tottisgical giggle agge tittgas tatgttgcaa.g.2). t-tightst statestigi tgttagut octagagggte gatggestett testgtc. tgcrets its at tgttgca tistgggot cicteggae Estagetta? qcagtgc.ca.g tgartet. attitt bettestg estigataege catatgcoc2l tgstgcc. taggott cittctgaar tittg gesttt totagger attg girta tratticatg treetct citctgtc. tette Gett, st traits its riggest tgttggestige tigagggg2 5. Eggets right toget city tgagaacaa grgaatgtc2.si cgc.cast ortgttggit ceiligraggit it is get fetal ratt gttctgaaag.21 acticests tags. agittgttg gigatacct tecgctecgg agreetge:341 its st g: title: gaggists attrigger gestggggg2G gettget setts testig attitt taggogs tigottggtg26. a getggagt. gotttegatt tetteeger sight geneage gaggggg p:gotctg grggettgga. getcatatzig traig agittee titate states s cgaggagtact gactertggit cCaggagga gettig.csgege setti.it testgags gaggist giggiggle tgaatgatga gatogcc.gtg300 taggtgrega gaggg it grg eiget gigsgr. Egtotggittgoi tgagt gate cagtgagt gcc.gee gigate siggests st taggettos ggartett statest: tittggagggit Ragtiggggas st tests tastest riggest titatgactig Eggtggtgg2l agtagger triggest lists gigs titleg stgages togetggagak cetgerect cetgetgrat agtegget eigetter testige:33.5 cocated tatt crgitotice tgtc.crgki cigatagga greategic agttctg gtttgtt. totgttg gatetics gettgcts scrotectics Bl tettitt eggitter starts tittgest gattgtags attgagtrcts trigg, it. titlett getts tggett stattoos gtggatage tittgags actgaatara attitt Grigggz stagtes etcaita garcaetgata gotttacat gttctggcc. city tigt giggestig ggaggagic ttgttgttg titcastice cittage totg attactgttt taaagttct3Bl gettigest statestset, ters statest gapstagg satgacitats te. gtgttctgtc. cigging tittgeia. settitet test) Cagagglica gag.ccg. cottalic its acctice criticityg gagggtggs ticagtttitts gas. as a aatsaggia galasiaag attgaatgcai2l stag tgart tgttitt tgttgartet titgaata tige attggal teagar a cigerattg eciettg states: tgertists attgagtails attalia agtgratgt. gattitt tet. att trett tag tact cittacggg tggggggg gatgagga. gettletttg testgag29. Gatt actgttas. gattittaka. testigia gattgettig act getting test it isitti titt at-gra aggitatsgat wasatatgcatel gtgttattgg Aggitatic gettigati tgattitt Latergart toget tagetterest testate title. aggiate tittitat getts gettettig. gif gtgaat aggatta. attcaattitt atgttagect45s tests its get sigtigest aggettingst gtgttgttg tigtgttgttettes? gttgttgttget gtic catgit getti. estigte giggaaagtt tacatatataiei gtaggattg scies. aagaat gt. gtgtttgata tenaagi atttgttgttit to tetratics atttagttgg agent ttestgttitt tttgttctg. stuttg tetti. agitatistt Categiga ggage gaggg a teetgrai eastgage te attaatgttg getgagta Cetagettil gratictatic crgygittee atter stagittag attittage ttittgaagtt 98 taggigit gart ttittctgacg tangga titggestees age giggest

U.S. Patent Feb. 7, 2012 Sheet 15 of 26 US 8,110,348 B2

Figure 9

A GFP GFP+CAPON-L GFP+CAPON-S

s

Control Capon-L Capons U.S. Patent Feb. 7, 2012 Sheet 16 of 26 US 8,110,348 B2

to ...... in &&OX-Mwscw8 d pe "t - *-

se w e (N so d r e # lauea Alepuooes O

i s c w N s pop # Ouels Kreud

U.S. Patent Feb. 7, 2012 Sheet 18 of 26 US 8,110,348 B2

Figure 12

A P B www.what with CP186 Load Cp ligG Load GST CP-S 312

3. Blot8 ope s Blot. CPE U.S. Patent Feb. 7, 2012 Sheet 19 of 26 US 8,110,348 B2

g S. se t t wr N Asued do on Sd 96 espieg Alepooes

ex e ter o wou # epued Aueug

U.S. Patent Feb. 7, 2012 Sheet 20 of 26 US 8,110,348 B2

Figure 14

A. OW DOW 5 ES OW 2-DW 5 Ba

sg* ****************************************** DIW 7-DV 10 C OW 5 DWT Da

* U.S. Patent Feb. 7, 2012 Sheet 21 of 26 US 8,110,348 B2

Figure 15

O.20

0.15

O. O.

0.05

0.00 GFP NP.L. NPS U.S. Patent Feb. 7, 2012 Sheet 22 of 26 US 8,110,348 B2

s

f : w e (s : 4 ;4. ; )& " is Aise (Einigau)speak i

(WNY. Surjos) oriuoo WNadviso U.S. Patent Feb. 7, 2012 Sheet 23 of 26 US 8,110,348 B2

Figure 17

NOS1APM

2 O was GFP O5 -- NOS 1AP-M

5

O 2 4. 6 8 O 2 distance from wentricle (arbitrary units)

U.S. Patent Feb. 7, 2012 Sheet 25 of 26 US 8,110,348 B2

Figure 19

Actin U.S. Patent Feb. 7, 2012 Sheet 26 of 26 US 8,110,348 B2

Figure 20

A. B

500 g 2 a 400 S 15

S 300 -S 1.0 2 2OO s 0.5 3 100 2 e CC O Oto 0.0 2. O S? US 8,110,348 B2 1. 2 METHODS AND COMPOSITIONS FOR THE tability (McGuffin et al., Br. J. Psychiatry 164:593, 1994). DAGNOSIS AND TREATMENT OF Segregation analyses have failed to clearly support a single SCHIZOPHRENA model of inheritance, with the Suggestion of at least several, possibly interacting, Susceptibility loci (Risch, Hum. Genet. PRIORITY CLAIMS 46:222, 1990). Schizophrenia and schizoaffective disorder are often observed within the same family, Suggesting that the This application is a continuation-in-part Application of two disorders may share a common genetic etiology. U.S. patent application Ser. No. 1 1/814,906, filed Sep. 9, Bipolar disorder, another type of neuropsychiatric disor 2008, which was filed under 35 U.S.C. S371 and claims der, is also known as manic-depressive illness and is also priority to PCT/US06/02771, filed Jan. 26, 2006, which in 10 described and characterized in DSM-IIIR and DSM-IV. It turn claims priority to U.S. Provisional Application 60/647, involves cycles of mania and depression. Signs and Symp 261, filed Jan. 26, 2005. This application also claims priority toms of mania include: extreme irritability and distractibility; under 35 U.S.C. S 119(e) to U.S. Provisional Patent Applica excessive euphoric feelings; a Sustained period of behavior tion 61/001,684, filed Nov. 3, 2007. Each of the foregoing that is different from the usual behavior; increased energy applications is incorporated by reference herein. 15 activity, restlessness, racing thoughts and rapid talking; decreased need for sleep; unrealistic beliefs in one’s abilities GOVERNMENT RIGHTS and powers; uncharacteristically poor judgment, increased sexual drive; abuse of drugs, particularly cocaine, alcohol and Pursuant to 35 U.S.C. S.202(c) it is acknowledged that the sleeping medications; obnoxious, provocative or intrusive U.S. Government has certain rights in the invention described behavior and denial that anything is wrong. Signs and Symp herein, which was made in part with funds from the National toms of depression include: persistent sad, anxious or empty Institutes of Health, Grant Numbers: R01 MH62440 and K25 mood; feeling of hopelessness or pessimism; feeling of guilt, AAO15346. worthlessness or helplessness; loss of interest or pleasure in ordinary activities; decreased energy, a feeling offatigue or of FIELD OF THE INVENTION 25 being “slowed down'; difficulty concentrating, remembering and making decisions; restlessness and irritability; sleep dis The present invention relates generally to the diagnosis and turbances; loss of appetite and weight, or weight gain; chronic treatment of neuropsychiatric disorders, such as Schizophre pain or other persistent bodily symptoms that are not caused nia, schizoaffective disorders and bipolar disorders. by physical disease; and thoughts of death or Suicide. Most 30 people with manic-depressive illness can be helped with BACKGROUND OF THE INVENTION treatment. However, manic-depressive illness, which is cur rently diagnosed by symptoms alone, is often not recognized Several publications and patent documents are cited by the patient, relatives, friends and even physicians. If left throughout the specification in order to describe the state of untreated, bipolar disorder tends to worsen, and the person the art to which this invention pertains. Each of these citations 35 experiences episodes of full-fledged mania and clinical is incorporated herein by reference as though set forth in full. depression. Schizophrenia is a serious neuropsychiatric illness esti Neuropsychiatric disorders, such as Schizophrenia, atten mated to affect 1.3% of the adult population in the United tion deficit disorders, schizoaffective disorders, bipolar dis States (Report of the Surgeon General on Mental Health, orders and unipolar disorders, differ from neurological disor 1999). The Diagnostic and Statistical Manual-IIIR and IV 40 ders in that anatomical or biochemical pathologies are readily (DSM-IIIR and DSM-IV) criteria used to diagnose schizo detectable for the latter but not the former. Largely as a result phrenia are well known to the skilled artisan. Age of onset is of this difference, drugs which have been used to treat indi typically between age 15 and 25 for men, and between age 25 viduals with neuropsychiatric disorders, including lithium and 35 for women. The symptoms typically develop over salts, valproic acid and carbamazepine, have not been pre weeks to months, with a prodromal period preceding the 45 dictably effective in treatment regimens across a variety of onset of acute psychotic symptoms. The disease is chronic, patients. Treatment regimens are further complicated by the characterized by episodes of worsening symptoms with fact that clinical diagnosis currently relies on clinical obser active psychosis, followed by periods of relative recovery Vation and Subjective reports. Identification of the anatomical marked by significant residual impairment. Current treatment or biochemical defects which result in neuropsychiatric dis is purely symptomatic, with no cure. 50 orders is needed in order to effectively identify these disor The lifetime risk for schizophrenia is 1.5 percent. Risk ders and to allow the design and administration of effective factors for Schizophrenia include a history of schizophrenia in therapeutics for these disorders. Indeed, there is growing first-degree relatives, birth during the late winter months, and evidence that the episodes of severe psychotic symptoms may birth trauma. Patients with schizophrenia have substantial lead to irreversible decrements in long-term functioning. Cur amounts of physical and psychological disability, as well as 55 rent clinical trials have begun to treat individuals in the pro occupational difficulties, with disability equivalent to quad dromal phase, with hopes of limiting the ultimate disability riplegia during periods of worsened symptoms (Report of the caused by these illnesses. Unfortunately, the diagnosis of Surgeon General on Mental Health, 1999). neuropsychiatric disorders, such as Schizophrenia, attention Schizoaffective disorder is a related syndrome character deficit disorders, schizoaffective disorders, bipolar disorders ized by the same disability and psychotic symptoms, but with 60 and unipolar disorders, cannot be accurately made during the the added feature of prevalent symptoms of mood distur prodromal phase. Additionally, the treatments carry a signifi bance. DSM-IIIR and DSM-IV diagnostic criteria are also cant risk of serious side effects thus currently limiting this available to assist in diagnosing this disorder. The lifetime early intervention strategy to individuals known to be at prevalence of schizoaffective disorder is 0.5 to 0.8 percent. extremely high risk for developing one of these disorders. A genetic component for Schizophrenia has long been Sug 65 Identification of genes associated neuropsychiatric disor gested. Family, twin and adoption studies have demonstrated ders would greatly facilitate the diagnosis and treatment of that Schizophrenia is predominantly genetic, with a high heri these illnesses. It is an object of the present invention to US 8,110,348 B2 3 4 provide materials, methods and kits which will aid the clini lar disorder. Exemplary antagonists which disrupt NOS1AP cian in diagnosing and treating such mental disorders. Other protein activity can include antibodies immunologically spe objects of the invention are compositions, methods, and kits cific for the NOS1AP-S protein described herein. Such agents which will facilitate the identification of pharmaceuticals can also include pharmacological compounds identified useful in treating neuropsychiatric disorders. using the screening assays disclosed herein. In yet another aspect of the invention, methods for identi SUMMARY OF THE INVENTION fying a compound which inhibits NOS1AP-NOS1AP bind ing protein complex formation are provided. Such methods In accordance with the present invention, methods for comprise incubating said NOS1AP or functional fragment assessing test compounds for Schizophrenia-related protein 10 thereof and said binding protein in the presence and absence modulating activities are provided. The Schizophrenia-re of said compound under conditions Suitable for protein com lated proteins of the present invention include NOS1AP-L of plex formation to occur, and determining whether the com SEQID NO: 2 and a short form of the same protein, herein plex formation is decreased in the presence of said compound after referred to as NOS1AP-S, having the sequence of SEQ when compared to complex formation in the absence of said ID NO: 4. Exemplary methods comprise: a) providing a host 15 compound, wherein a decrease in NOS1AP-NOS1AP bind cell expressing a nucleic acid encoding NOS1AP-L or ing protein complex formation in the presence of said com NOS1AP-S protein; b) contacting the host cell with a com pound indicates that the compound is an inhibitor of pound suspected of modulating the NOS1AP protein activity; NOS1AP-NOS1AP binding protein complex formation. and c) determining the extent of the modulation, if any. Also Another aspect of the invention optionally provides a in one embodiment of the present invention, the host cells siRNA specific to NOS1AP-L comprising SEQID NO:22, as may be neurons, and more particularly, hippocampal neu well as methods for increasing dendrite branching, compris rons. NOS1AP protein activity can include, without limita ing delivering an inhibitory construct comprising SEQ ID tion, disruption of dendrite outgrowth and branching, and NO: 22 to a cell. changes in nitric oxide production upon stimulation of the In yet another embodiment, methods of treating a neurop NMDA receptor. Agents can also be screened in such host 25 sychiatric disorder in a patient are provided comprising cells for their capacity to modulate NOS1AP mRNA and/or administering an effective amount of a compound capable of protein production levels. inhibiting the activity of carboxypeptidase E in a patient. In accordance with the present invention, it has been deter mined that patients suffering from neuropsychiatric disorders BRIEF DESCRIPTION OF THE DRAWINGS overexpress NOS1AP when compared to normal controls. 30 Thus, another screening method of the invention entails oper FIGS. 1A-1C are diagrams illustrating the gene structure, ably linking the promoter region ofNOS1AP to a nucleic acid isoforms and protein functional domains of NOS1AP. The encoding a reporter gene and identifying agents which affect terms CAPON and NOS1AP are used interchangeably herein the expression level of the reporter. In a particularly preferred as they refer the same protein. FIG. 1A shows the genomic embodiment, the promoter is shown in FIG. 7. The promoter 35 organization of NOS1AP. Exons are represented by num will be also be modified to include certain SNPs previously bered boxes; 5' and 3' UTR are represented by half-height identified to be associated with the onset of schizophrenia. boxes. FIG. 1B shows the NOS1AP transcripts. 5' and 3' UTR The modified promoters will also be assessed in such reporter are represented by shaded boxes, exons by white boxes. FIG. assayS. 1C shows the predicted NOS1AP proteins. The PTB domain In yet another aspect of the present invention, methods for 40 is shaded lightgrey, and the PDZ-binding domain is shaded assessing test compounds having binding affinity for black. NOS1AP-L and/or NOS1AP-S protein are provided. An FIG. 2 is a Western Blot of NOS1AP protein isoforms in exemplary assay comprises providing the NOS1AP-L or DLPFC (dorsolateral prefrontal cortex) from normal control NOS1AP-S protein in purified form; b) contacting the puri individuals. Tissue from Brodmann's area 46 (DLPFC) from fied NOS1AP protein with a compound suspected of binding 45 five individuals was homogenized in TEE. Proteins were the NOS1AP protein; and c) determining the extent of com resolved by SDS-PAGE and transferred to PVDF membrane. plex formation between said test compound and NOS1AP Blots were probed with rabbit polyclonal antibodies to protein, if any. NOS1AP and actin, and proteins were detected using chemi In yet another aspect of the present invention, methods for luminescence. Band intensities for NOS1AP-L (NOS1AP diagnosing Susceptibility to a neuropsychiatric disorder, e.g., 50 full-length), NOS1AP-S(NOS1AP short-form), and schizophrenia, schizoaffective disorder and/or bipolar dis NOS1AP-S--NOS1AP-S' were calculated and normalized to ease in a patient are provided. Such methods comprise deter the intensities of the corresponding actin bands. Untrans mining the expression level of NOS1AP-L (SEQID NO: 1) fected COS-7 cells expressing NOS1AP-L and NOS1AP-S and/or NOS1AP-S (SEQ ID No. 3) or the proteins encoded (CPS-7/NT) and COS-7 cells expressing recombinant thereby in a patient, wherein an elevated expression level of 55 NOS1AP-S(COS-7/NOS1AP-S) were used as controls for NOS1AP in the patient compared to that in normal healthy these proteins. NOS1AP-L appears to include multiple bands, Subjects is indicative of Susceptibility to Schizophrenia. possibly due to phosphorylation. Methods for treating neuropsychiatric disorders by admin FIG. 3 is a graph showing the beta-actin normalized istering to a patient an effective amount of an antagonist NOS1AP mRNA full-length expression by diagnosis. specific for NOS1AP protein (SEQID NO: 2 or SEQID No. 60 Expression levels are least squares means. Mean values per 4) are disclosed. Such antagonists can include, without limi category are plotted with 95% confidence intervals. The num tation, an anti-sense oligonucleotide specific for the ber of subjects per sample is indicated within each bar. Level NOS1AP-L or the NOS1AP-S gene and/or a SiRNA mol of expression does not differ significantly by diagnostic ecule effective for down-regulating production of NOS1AP. group. The mean (95% confidence interval lower bound, Representative neuropsychiatric disorders which can be 65 upper bound) for the control, Schizophrenia, and bipolar treated using the methods disclosed herein include, without groups are 1.28 (1.12, 1.45), 1.33 (1.17, 1.49), and 1.16 (0.99, limitation, Schizophrenia, Schizoaffective disorder, and bipo 1.32), respectively US 8,110,348 B2 5 6 FIG. 4 is a graph showing the beta-actin normalized FIG. 11 shows mutant forms of NOS1AP and their effects NOS1AP-S mRNA expression by diagnosis. Expression lev on dendrite branching. (A) Illustration of NOS1AP-Long els are least squares means. Mean values per category are (CP-L), NOS1AP-Short (CP-S), and five mutant forms (i.e. plotted with 95% confidence intervals. The number of sub subregions) of NOS1AP. (B), DIV 10 hippocampal neurons jects per sample is indicated within each bar. Expression is were transfected with GFP and the different forms of significantly higher in Subjects with Schizophrenia NOS1AP Cells were fixed at DIV 12 and Stained. GFP stain (p=0.0013) and bipolar (p=0.0009) as compared to controls. ing of hippocampal neurons expressing NOS1AP mutants The mean (95% confidence interval lower bound, upper were illustrated here. (C and D), Primary and secondary bound) for the control, Schizophrenia, and bipolar groups are branches were monitored. ***, significantly different from 10 GFP, p<0.001. *, significantly different from GFP, p<0.05. 1.34 (1.05, 1.62), 2.02 (1.73, 2.30), and 2.05 (1.77, 2.34), FIG. 12 shows that binding of CPE to NOS1AP was con respectively. firmed with immunoprecipitation and GST pull-down stud FIG. 5 is a graph showing the beta-actin normalized ies. (A), rat brain lysate was incubated with NOS1AP (CP) NOS1AP-S expression by genotype. Expression levels are antibody and protein-A Sepharose. The eluate was separated least squares means. Individuals from all three diagnostic 15 using polyacrylamide gel electrophoresis, transferred to classifications are included, grouped only by genotype. Mean PVDF membrane, and blotted with CPE antibody. (B), rat values per genotype for each SNP are plotted with 95% con brain lysate was screened with GST or GST-fusion proteins. fidence intervals. The number of Subjects per genotype is The eluted proteins were separated using polyacrylamide gel indicated within each bar. SNP alleles are given for forward electrophoresis, transferred to PVDF membrane, and blotted strand sequence. All three SNPs exhibit significantly with CPE antibody. (p<0.05) different levels of NOS1AP expression by geno FIG. 13 shows knockdown of CPE reduced NOS1AP type, with a dominant effect. Higher levels of NOS1AP are Long (CP-L) effects. DIV 10 hippocampal neurons were seen in Subjects with one or two copies of alleles previously transfected with pSuper-GFP-Negative-Control (pS-NC) or identified as associated with schizophrenia (T for rs1415263, pSuper-GFP-CPE-Knock-Down (pS-CPE) along with a con C for rs4145621, and C for rs266.1818). The mean (95% 25 struct for NOS1AP-Long. Cells were fixed and stained on confidence interval lower bound, upper bound) for the three DIV 12. (A), Illustration of double-staining of GFP (Green) genotypes for each SNP are for rs1415263, 1.54 (1.29, 1.80) and CPE (Red). (B), CPE intensity in cells transfected with for CC, 2.07 (1.81, 2.34) for CT, and 1.83 (1.36, 2.29) for TT; pS-NC or pS-CPE was monitored and compared. (C), Illus for rs4145621, 1.51 (1.25, 1.78) for TT, 2.01 (1.74, 2.27) for tration of GFP staining of transfected neurons. (D and E). TC, and 2.01 (1.61, 2.41) for CC; and for rs266.1818, 1.49 30 Number of primary and secondary dendrites was monitored. (1.21, 1.76) for GG, 1.96 (1.70, 2.23) for CG, and 2.04 (1.68, ***, significantly different from GFP, p<0.001. *, signifi 2.41) for CC. cantly different, p<0.05. FIGS. 6A and 6B are graphs showing that the overexpres FIG. 14 shows that overexpression of NOS1AP alters den sion of NOS1AP full-length (SEQ ID NO: 1, indicated by drite number in young hippocampal neuron cultures. Cells “NOS1AP-L) results in decreased number of primary and 35 were transfected with cDNA encoding GFP, GFP secondary dendrites in hippocampal neurons. *p-0.05 and NOS1AP-L (G-NPL), GFP-NOS1AP-S (G-NPS), or GFP **p<0.01 by nonparametric ANOVA (Kruskal-Wallis) fol NOS1AP-M (“M”, mutant form of NOS1AP-L, amino acids lowed by Dunn's Multiple Comparison Test. 181-307); (G-CPM) at the indicated dates (A, DIV 0; B, DIV FIG.7 shows the promoter sequence of NOS1AP-L. (SEQ 2: C, DIV 5, D, DIV 7). Neurons were fixed and immun ID NO:25) 40 ostained for dendrite counting at DIV5 (A), DIV5 (B), DIV FIGS. 8A-D shows the nucleic acid and amino acid 7 (C) or DIV 10 (D). (Aa, Ba, Ca, Da), GFP images of sequences of NOS1AP-L, SEQID NOS: 1 and 2 (FIGS. 8A representative neurons. (Ab. Bb, Cb, Db, Ac, Bc, Cc, Dc), and 8B respectively). The Figures also shows the nucleic acid Average number of primary and secondary dendrites in trans and amino acid sequences of NOS1AP-S, SEQ ID NOS: 3 fected neurons. Scale bar, 10 mm.*, p<0.05, *, p<0.01, ***, and 4 (FIGS. 8C and 8D respectively). 45 p<0.001, by nonparametric ANOVA followed by Dunn's FIG.9 shows that NOS1AP-Long reduces dendrite branch analysis comparing G-NPL, G-NPS, and G-NPM groups ing. DIV 10 hippocampal neurons were transfected with with GFP. DNA constructs encoding GFP, or GFP with NOS1AP-Long FIG. 15 shows that overexpression of NOS1AP-L reduces (NOS1AP-L) or GFP with NOS1AP-Short (NOS1AP-S). protrusion formation in mature hippocampal neurons. Hip Cells were fixed on DIV 12 and Stained with GFP and 50 pocampal neurons were transfected on DIV 10 with cDNA NOS1AP antibodies. The numbers of primary and secondary constructs encoding GFP, GFP and NOS1AP-L (NP-L), or branches of the transfected neurons were analyzed. (A), GFP and NOS1AP-S(NP-S). Neurons were fixed and immu sample pictures illustrating GFP-positive neurons. (B and C), nostained for analysis of protrusion number at DIV 21. (A, B, statistical analysis demonstrating the numbers of primary and C), GFP images of representative neurons. Scale bar, 5 mm. secondary branches in the three groups. NOS1AP-Long was 55 (D), The average number of protrusions per um dendrite much more effective at reducing dendritic branching than length for each condition. ***, p<0.001, by nonparametric NOS1AP-Short. * Significantly different from control, ANOVA followed by Dunn's analysis comparing co-trans p<0.01. fected groups with GFP. FIG. 10 shows that treatment of neurons with L-NAME FIG. 16 shows that expression of an shRNA against (LNM) to inhibit nNOS activity reduced NOS1AP-Long 60 NOS1AP-L results in a 40% decrease in NOS1AP expression (CP-L) activity. DIV 10 hippocampal neurons were trans and a 67% increase in primary dendrite number over 48 hours. fected with GFP or GFP with NOS1AP-Long. Right after A) Hippocampal neurons were transfected with either pSU transfection, L-NAME was added to 500 nM. Cells were PER-scramble shRNA or pSUPER-NOS1AP shRNA at fixed on DIV 12 and stained. (A), Illustration of GFP stained DIV10 and fixed at DIV12. B) Quantification of primary neurons. (B and C), Number of primary and secondary den 65 dendrites shown. C) Hippocampal neurons transfected with drites were monitored. ***, significantly different from GFP. the same vectors as in A at DIV10 and fixed and immun p<0.001. *, significantly different, p<0.05. ostained for NOS1AP at DIV12. Zoomed inset indicates a US 8,110,348 B2 7 8 representative region of primary dendrite showing corre NM 014697), while NOS1AP-S (SEQ ID No. 3) of the sponding fluorescence intensities of anti-NOS1APD) Quan present invention contains the last two exons of the previously tification of NOS1AP levels in primary dendrite regions, as disclosed NOS1AP (GenBank Accession No. NM 014697) represented by normalized (total intensity/area) fluorescence and parts of the intron preceding the penultimate exon, and intensity levels. *p-0.05 by Student's t-test. additional 3' UTR sequences. The present inventors have FIG. 17 shows overexpression of NOS1AP-M results in discovered that the expression of NOS1AP-S (SEQID No. 3) neuronal migration defect in vivo. A, plasmids encoding is significantly increased (p<0.05) in both schizophrenia and GFP-NOS1AP-M or GFP were electroporated into cells lin bipolar disorder. Furthermore, this increased expression is ing the lateral ventricular wall at E16 and analyzed at E18. In significantly associated (p<0.005) with genotype at the three control. Some positive cells are migrating to the cortical plate. 10 single-nucleotide polymorphisms (SNPs) previously identi However, NOS1AP-M overexpression resulted in very few fied as being in linkage disequilibrium with Schizophrenia. neurons positioned in the cortical plate. V-ventricle, Pipial Expression of NOS1AP full-length (SEQ ID No. 1) appears surface. B, bin distribution of migration distance from V to p. to be sensitive to treatment with antipsychotic medication, but The cortical mantle was divided into twelve equally spaced is significantly (p<0.005) elevated in individuals with bipolar bins, and percentage of cells in each bin was represented. In 15 disorder and no history of antipsychotic exposure. These control, approximately 17% of cells were positioned in the results provide support for the role of NOS1AP-L and upper four bins, whereas NOS1AP-M overexpression NOS1AP-S in the etiology of schizophrenia, and provide new resulted in few than 6% in upper bins. n=4 for GFP and n=5 evidence implicating this gene in the etiology of bipolar dis for NOS1AP M, more than 900 cells per condition. Graph order as well. In addition, the outgrowth and branching of plot meaniSEM. p=0.0276 for NOS1AP-M vs. GFP data dendrites is inhibited when hippocampal neurons are trans shown in B by Kolmogorov-Smirnov (chi-squared+8.563). fected with cDNA encoding either NOS1AP full-length FIG. 18 shows eEF2 and hippocalcin-like 1 co-immuno (SEQID No. 1) or NOS1AP-S (SEQID No.3). This provides precipitate (co-IP) with NOS1AP NOS1AP was immunopre an exemplary model system for screening agents which cipitated from rat brain extract, and precipitates were Sub impact NOS1AP activity, thereby identifying pharmaceuti jected to SDS-PAGE and Western blotting. The top panel 25 cals useful in the prevention and treatment of neuropsychiat shows that eEF2 co-IPS with NOS1AP and that this interac ric disorders. tion is enhanced by the absence of a phosphatase inhibitor cocktail. The middle panel shows that NOS1AP is immuno I. DEFINITIONS precitated by the NOS1AP antibody. The bottom panel shows that hippocalcin-like 1 co-IPs with NOS1AP. 30 The following definitions are provided to facilitate an FIG. 19 shows that actin is found in a complex with understanding of the present invention: NOS1AP. Rat brain extract was incubated with a polyclonal "Linkage” describes the tendency of genes, alleles, loci or antibody to NOS1AP (CP) or rabbit IgG (negative control). genetic markers to be inherited together as a result of their Immunoprecipitates were run on SDS-PAGE, transferred to location on the same chromosome, and is measured by per PDVF, and the blot was probed for actin. 35 cent recombination (also called recombination fraction, or 0) FIG. 20 shows expression of NOS1AP is increased in between the two genes, alleles, loci or genetic markers. The BA46 of Schizophrenic patients in panel A. The graph repre closer two loci physically are on the chromosome, the lower sents the results of a Western blot of lysates from postmortem the recombination fraction will be. Normally, when a poly brains from control and Schizophrenic patients. Dark bars morphic site from within a disease-causing gene is tested for represent the amount of NOS1AP in controls, and the light 40 linkage with the disease, the recombination fraction will be bars represent the amount of NOS1AP in schizophrenic Zero, indicating that the disease and the disease-causing gene patients. Panel B is a negative control from the olfactory lobe are always co-inherited. In rare cases, when a gene spans a of the brain which is not involved in schizophrenia, and very large segment of the genome, it may be possible to NOS1AP is not increased. observe recombination between polymorphic sites on one 45 end of the gene and causative mutations on the other. How DETAILED DESCRIPTION OF THE INVENTION ever, if the causative mutation is the polymorphism being tested for linkage with the disease, no recombination will be Several prior independent studies have reported the linkage observed. of markers from chromosome 1 q22 to schizophrenia. Within “Centimorgan” is a unit of genetic distance signifying link this linkage region, the present inventors identified significant 50 age between two genetic markers, alleles, genes or loci, cor linkage disequilibrium (LD) between Schizophrenia and responding to a probability of recombination between the two markers within the gene for carboxyl-terminal PDZ ligand of markers or loci of 1% for any meiotic event. neuronal nitric oxide synthase (NOS1AP, GenBank Acces “Linkage disequilibrium' or “allelic association” means sion No. NM 014697, also known in the art as CAPON). the preferential association of a particular allele, locus, gene Prior sequencing of the 10 exons of NOS1AP, however, failed 55 or genetic marker with a specificallele, locus, gene or genetic to reveal a coding mutation associated with illness. The marker at a nearby chromosomal location more frequently present invention is related to the discovery of two NOS1AP than expected by chance for any particular allele frequency in isoforms, “NOS1AP full-length” (SEQ ID No. 1) which the population. encodes a full-length NOS1AP Protein (SEQID No. 2) and An "oligonucleotide' can be DNA or RNA, and single- or “NOS1AP short-form (NOS1AP-S)” (SEQID No. 3) which 60 double-stranded. Oligonucleotides can be naturally occurring encodes a short-form NOS1AP protein (NOS1AP-S) (SEQ or synthetic, but are typically prepared by synthetic means. ID No. 4). Compared to the previously disclosed NOS1AP The term “primer' refers to an oligonucleotide capable of gene (GenBankAccession No. NM 014697), NOS1AP full acting as a point of initiation of DNA synthesis under condi length (SEQ ID NO. 1) of the present invention contains an tions in which synthesis of a primer extension product additional 60 bp of 5' untranslated region (UTR) and lacks the 65 complementary to a nucleic acid strand is induced, i.e., in the first 15 bp of sequence present in the fourth exon of the presence of four different nucleoside triphosphates and an previously disclosed NOS1AP (GenBank Accession No. agent for polymerization (i.e., DNA polymerase or reverse US 8,110,348 B2 10 transcriptase) in an appropriate buffer and at a suitable tem sequences without the restriction enzyme site will only show perature. A primer is preferably a single-stranded oligonucle one fragment, of the length of the amplified sequence. Simi otide. The appropriate length of a primer depends on the larly, the RFLP can be detected by probing an EcoRI digest of intended use of the primer but typically ranges from 15 to 30 Southern blotted DNA with a probe from a nearby region such nucleotides. Short primer molecules generally require cooler 5 that the presence or absence of the appropriately sized EcoRI temperatures to form sufficiently stable hybrid complexes fragment may be observed. RFLP's may be caused by point with the template. A primer need not reflect the exact mutations which create or destroy a restriction enzyme site, sequence of the template but must be sufficiently complemen VNTR’s, dinucleotide repeats, deletions, duplications, or any tary to hybridize with a template. The term “primer' may other sequence-based variation that creates or deletes a refer to more than one primer, particularly in the case where 10 restriction enzyme site, or alters the size of a restriction frag there is some ambiguity in the information regarding one or ment. both ends of the target region to be amplified. For instance, if “Variable number of tandem repeats” (VNTR's) are short a region shows significant levels of polymorphism or muta sequences of nucleic acids arranged in a head to tail fashion in tion in a population, mixtures of primers can be prepared that a tandem array, and found in each individual, as described in will amplify alternate sequences. A primer can be labeled, if 15 Wyman et al., Proc. Nat. Acad. Sci. 77:6754-6758 (1980). desired, by incorporating a label detectable by spectroscopic, Generally, the VNTR sequences are comprised of a core photochemical, biochemical, immunochemical, or chemical sequence of at least 16 base pairs, with a variable number of means. For example, useful labels include P. fluorescent repeats of that sequence. Additionally, there may be variation dyes, electron-dense reagents, enzymes (as commonly used within the core sequence, Jefferys et al., Nature 314:67-72 in an ELISA), biotin, or haptens and proteins for which anti (1985). These sequences are highly individual, and perhaps sera or monoclonal antibodies are available. A label can also unique to each individual. Thus, VNTR’s may generate be used to “capture' the primer, so as to facilitate the immo restriction fragment length polymorphisms, and may addi bilization of either the primer or a primer extension product, tionally serve as size-based amplification product differentia Such as amplified DNA, on a solid Support. tion markers. “Chromosome 1 set’ means the two copies of chromosome 25 “Microsatellite sequences’ comprise segments of at least 1 found in Somatic cells or the one copy in germ line cells of about 10 base pairs of DNA consisting of a variable number of a patient or family member. The two copies of chromosome 1 tandem repeats of short (1-6 base pairs) sequences of DNA may be the same or different at any particular allele, including (Clemenset al., Am. J. Hum. Genet. 49:951-960 1991). “Mic alleles at or near the schizophrenia locus. The chromosome 1 rosatellite sequences are generally spread throughout the set may include portions of chromosome 1 collected in chro 30 chromosomal DNA of an individual. The number of repeats mosome 1 libraries, such as plasmid, yeast, orphage libraries, in any particular tandem array varies greatly from individual as described in Sambrook et al., Molecular Cloning, 2nd to individual, and thus, microsatellite sequences may serve to Edition, and in Mandel et al., Science 258:103-108 (1992). generate restriction fragment length polymorphisms, and “Penetrance' is the percentage of individuals with a defec may additionally serve as size-based amplification product tive gene who show some symptoms of a trait resulting from 35 differentiation markers. that defect. Expressivity refers to the degree of expression of A “marker' is referred to as fully “informative” for a par the trait (e.g., mild, moderate or severe). ticular individual if the configuration of alleles observed in “Polymorphism' refers to the occurrence of two or more the family allow for the unambiguous determination of paren genetically determined alternative sequences or alleles in a tal origin of the alleles of a child. For example, if the mother population. A polymorphic marker is the locus at which diver 40 has a “1” and “2' allele, while the father has a “3 and “4” gence occurs. Preferred markers have at least two alleles, each allele, then it is possible to unambiguously assign the parental occurring at frequency of greater than 1%. A polymorphic origin of alleles in each of the four possible combinations in locus may be as Small as one base pair. Polymorphic markers the children (1-3, 1-4, 2-3, 2-4). A marker is partially infor suitable for use in the invention include restriction fragment mative when unambiguous determination of parental origin is length polymorphisms, variable number of tandem repeats 45 possible for only certain children. For example, if both par (VNTRs), hypervariable regions, minisatellites, dinucle ents have a “1” and '2' allele, then the parental origins of the otide repeats, trinucleotide repeats, tetranucleotide repeats, alleles may be unambiguously determined for children with and other microsatellite sequences. the genotypes 1-1 and 2-2, but not for the children with the “Restriction fragment length polymorphism’ (RFLP) genotype 1-2. If one parent is homozygous for a marker, the means a variation in DNA sequence that alters the length of a 50 marker will be only partially informative, and the inheritance restriction fragment as described in Botstein et al., Am. J. from that parent cannot be traced. If the marker is homozy Hum. Genet. 32:314-331 (1980). The restriction fragment gous in both parents, the marker is fully uninformative for the length polymorphism may create or delete a restriction site, transmission from them to their children, even though their thus changing the length of the restriction fragment. For children may be heterozygous and thus informative for the example, GAATTC is the DNA sequence, together with its 55 transmission of that marker to the next generation. complementary strand, CTTAAG which comprises the rec A “binding complex’ used herein refers to the complex ognition and cleavage site of the restriction enzyme EcoRI. formed between NOS1AP protein and a test compound. The Replacement of any of the six nucleotides on either strand of test compound may be an antibody, a protein peptide, or any DNA with a different nucleotide destroys the EcoRI site. This other molecule which exhibits binding affinity for RFLP can be detected by, for example, amplification of a 60 NOS1AP-S or NOS1AP-L. target sequence including the polymorphism, digestion of the As used herein, “shRNA or short hairpin RNA, or small amplified sequence with EcoRI, and size fractionation of the hairpin RNA is an RNA molecule that contains a sense strand, reaction products on an agarose or acrylamide gel. If the only antisense Strand, and a short loop sequence between the sense EcoRI restriction enzyme site within the amplified sequence and antisense fragments. shRNA can be cloned into a vector, is the polymorphic site, the target sequences comprising the 65 allowing for expression by a pol III type promoter. The restriction site will show two fragments of predetermined expressed shRNA is then exported into the cytoplasm where size, based on the length of the amplified sequence. Target it is processed by dicer into siRNA which then get incorpo US 8,110,348 B2 11 12 rated into the siRNA induced silencing complex (RISC). of NOS1AP protein that compete with the NOS1AP protein Typically, shRNA molecules consist of short complementary for binding, and synthetic peptides or analogs thereof selected sequences separated by a small loop sequence wherein one of from random combinatorial libraries. See, e.g., Ladner et al., the sequences is complimentary to the gene target as provided U.S. Pat. No. 5,223,409 (1993) (incorporated by reference in in U.S. Application Publication No. 20050032733. its entirety herein). Therapeutic agents can also include tran An “siRNA refers to a molecule involved in the RNA Scription factors, and the like, which regulate expression of interference process for a sequence-specific post-transcrip the NOS1AP gene as described hereinbelow. tional gene silencing or gene knockdown by providing Small Additionally, inhibitors of protein interactions or protein interfering RNAs (siRNAs) that has homology with the function could be utilized to treat patients, for example, sequence of the targeted gene. Small interfering RNAs (siR 10 patients with schizophrenia, schizoaffective disorder and NAs) can be synthesized in vitro or generated by ribonuclease bipolar disorder. Thus, an optional feature of the invention is III cleavage from longer dsRNA and are the mediators of the use of compounds or agents with the ability to inhibit the sequence-specific mRNA degradation. Preferably, the siRNA function of a protein. For example, the invention may option of the invention are chemically synthesized using appropri ally include the feature of administering known inhibitors of ately protected ribonucleoside phosphoramidites and a con 15 CPE, Such as, e-aminocaproic acid and Guanidinoethylmer ventional DNA/RNA synthesizer. The siRNA can be synthe captosuccinic Acid (GEMSA), both described in U.S. Pat. sized as two separate, complementary RNA molecules, or as No. 7,176,008, bromoacetyl-D-arginine as described in (J. a single RNA molecule with two complementary regions. Cell. Biochem. (1988) 38(4):279-289), DL-2-mercaptom Commercial suppliers of synthetic RNA molecules or syn ethyl-3-guanidinoethyldiopropanoic acid (MGTA) and thesis reagents include Applied BioSystems (Foster City, p-chloromercuriphenylsulfonate as described in (Immunol. Calif., USA), Proligo (Hamburg, Germany), Dharmacon Reviews (1998) 161:129-141), and carboxypeptidase inhibi Research (Lafayette, Colo., USA), Pierce Chemical (part of tors described in U.S. Pat. No. 6,489,319. Perbio Science, Rockford, Ill., USA), Glen Research (Ster ling, Va., USA), ChemGenes (Ashland, Mass., USA) and III. METHODS OF DIAGNOSIS AND Cruachem (Glasgow, UK). Specific siRNA constructs for 25 DIAGNOSTIC KITS inhibiting NOS1AP or CPE mRNA may be between 10-35 nucleotides in length. The present discovery that NOS1AP-L (SEQ ID NO: 1) The terms 'agent” and "compound are used interchange and NOS1AP-S (SEQID No. 3) are overexpressed in patients ably herein and denote a chemical compound, a mixture of having Schizophrenia or bipolar disease, provides additional chemical compounds, a biological macromolecule, or an 30 means for diagnosing such patients. Such diagnosis may be extract made from biological materials such as bacteria, accomplished by providing one or more oligonucleotides that plants, fungi, or animal (particularly mammalian) cells or bind specifically to a segment of NOS1AP-L or NOS1AP-S tissues. Biological macromolecules include siRNA, shRNA, mRNA, thereby assessing the expression levels of NOS1AP antisense oligonucleotides, Small molecules, antibodies, pep gene. The diagnosis may also be accomplished by providing tides, peptide/DNA complexes, and any nucleic acid based 35 one or more agents, such as an antibody (monoclonal or molecule, for example an oligo, which exhibits the capacity to polyclonal), that bind specifically to NOS1AP protein, modulate the activity of the SNP containing nucleic acids thereby assessing the production levels of NOS1AP protein. described herein or their encoded proteins. Agents are evalu In a preferred embodiment, antibodies immunologically spe ated for potential biological activity by inclusion in Screening cific for the NOS1AP-S protein are provided. Suchantibodies assays described herein. 40 have utility for detection and subcellular localization of the The term “modulate” as used herein refers increasing/pro NOS1AP-S protein described herein. moting or decreasing/inhibiting. For example, the term The present invention also includes kits for the practice of modulate refers to the ability of a compound or test agent to the methods of the invention. The kits comprise a vial, tube, or interfere with or inhibit signaling orbinding activity of a gene any other container which contains one or more oligonucle or protein of the present invention. Preferably the modulation 45 otides, which hybridizes to a segment of NOS1AP-S mRNA. is an inhibition of protein binding, for example, between The kits may include positive or negative control reactions or NOS1AP and CPE. markers, molecular weight size markers for gel electrophore sis, and the like. The kits usually include labeling or instruc II. METHODS OF TREATMENT AND tions indicating the Suitability of the kits for diagnosing neu IDENTIFYING NEW DRUGS 50 ropsychiatric disorders and indicating how the oligonucleotides are to be used for that purpose. The term The discovery of novel NOS1AP isoforms, i.e., "label' is used generically to encompass any written or NOS1AP-L and NOS1AP-S genes (SEQ ID NOS: 1 and 3 recorded material that is attached to, or otherwise accompa respectively), facilitates the development of new therapeutic nies the diagnostic at any time during its manufacture, trans agents and methods of treatment for neuropsychiatric disor 55 port, sale or use. ders, such as Schizophrenia, Schizoaffective disorders and It has been proposed that altered regulation of NOS1AP bipolar disorders. gene in utero may be associated with the later development of The provision of NOS1AP-L and NOS1AP-S proteins Schizophrenia. Accordingly, methods are provided herein for encoded by the newly discovered NOS1AP variants facili isolating fetal cells present in maternal circulation, perform tates the development of Screening assays to identify 60 ing PCR, and assessing such cells for altered levels of NOS1AP binding or interacting molecules and/or other NOS1AP nucleic acid production, an elevation in NOS1AP agents or test compounds that interact with the same and gene expression relative to normal control fetal cells being design of agents that agonize or antagonize this interaction. indicative of a predisposition to the development of neurop These methods allow for the identification of compounds or sychiatric disorders. Thus, a kit of the invention may include agents which modulate (i.e., inhibit or promote) NOS1AP 65 the necessary reagents for isolating fetal cells from the mater binding with NOS1AP binding proteins. Such agents include nal circulation (See WO/2002/077604) and primers for monoclonal antibodies against NOS1AP protein, fragments amplifying NOS1AP-L and/or NOS1AP-S. US 8,110,348 B2 13 14 It is also possible to determine NOS1AP-L or NOS1AP-S fragments of the protein may be used to advantage to generate levels in olfactory neurons isolated from adult patients. See an array of monoclonal antibodies specific for various Feronet al. (1998) “New Techniques for Biopsy and Culture epitopes of NOS1AP-L and NOS1AP-S proteins, for of Human Olfactory Epithelial Neurons' in Arch. Otolaryn example, thereby providing even greater sensitivity for detec gol. Head Neck Surg. 124:861. A demonstrable elevation in tion of other variants in cells. NOS1AP-S or NOS1AP-L in such neurons would provide a Polyclonal or monoclonal antibodies immunologically positive indicator of an increased risk of developing schizo specific for the NOS1AP protein of the invention may be used phrenia. in a variety of assays designed to detect and quantitate the Additionally, Segalat et al. report that NOS1AP expression protein. Such assays include, but are not limited to: (1) flow can also be assessed using muscle tissue. See "Segalat et al. 10 cytometric analysis; (2) immunochemical detection/localiza (2004) NOS1AP expression in skeletal muscle is regulated by tion of NOS1AP protein in cells derived from the brain, position, repair, NOS activity and dystrophy. Accordingly, muscle cells, fetal neuronal cells in maternal circulation and/ muscle biopsies may be obtained from patients at risk and or olfactory neuronal cells in various stages of neuronal dif NOS1AP expression levels assessed. ferentiation; and (3) immunoblot analysis (e.g., dot blot, 15 Western blot) of extracts from various cells. Additionally, as IV. USES OF NOS1AP NUCLEICACID described above, antibodies specific for the NOS1AP-S pro tein can be used for purification of Such proteins and any The nucleic acids encoding the NOS1AP-L and associated subunits (e.g., affinity column purification, immu NOS1AP-S genes may be used as research tools to identify noprecipitation). other genes or proteins that are involved in the maintenance In accordance with the present invention, the NOS1AP and promotion of neuropsychiatric disorders. For example, gene has been localized to a specified region on chromosome the sequence information in the NOS1AP gene may be used 1 and encodes an alternatively spliced variant of the NOS1AP to advantage to identify and characterize other genes of vary gene. It appears likely that mutations in the promoter or 5' ing degrees of relation to the genes of the invention thereby UTR region or the coding sequence of the NOS1AP-L or enabling further characterization of the aberrant neural cel 25 NOS1AP-S genes are associated with the neuropsychiatric lular processes associated with neuropsychiatric disorders. phenotype. In one aspect of the invention, the promoter and Additionally, the nucleic acids encoding NOS1AP gene(s) coding sequence of the NOS1AP-L gene isolated from brain may be used to identify genes encoding proteins that interact cells will be screened for mutations. See FIG. 7. Such screen with NOS1AP protein e.g., by the “interaction trap' tech ing should effectively identify genetic changes associated nique), which should further accelerate identification of the 30 with altered expression levels of the NOS1AP gene. The components involved in the progression of neuropsychiatric promoter fragment or 5' UTR of the NOS1AP gene, disorders. employed in drug screening assays may either be free in Nucleic acid molecules, or fragments thereof, encoding solution, affixed to a solid support or within a cell. One NOS1AP genes, for example, may also be utilized to control method of drug screening utilizes eukaryotic or prokaryotic the production of NOS1AP protein, thereby regulating the 35 host cells which are stably transformed with recombinant amount of protein available to participate in the maintenance polynucleotides expressing the polypeptide, a fragment and progression of the neuropsychiatric state. Antisense oli thereof, or a NOS1AP gene promoter/reporter gene construct, gonucleotides corresponding to essential processing sites in preferably in competitive binding assays. Such cells, either in NOS1AP mRNA molecules may be utilized to inhibit protein viable or fixed form, can be used for standard binding assays. production in targeted cells. Alternatively, SiRNA molecules 40 One may determine, for example, formation of complexes based on the coding sequences can be prepared and assessed between a NOS1AP polypeptide or promoter and the agent for the ability to down regulate NOS1AP production. Such being tested, or examine the degree to which the formation of siRNA molecules can be obtained from Dharmacon. Alter a complex between a NOS1AP polypeptide or fragment and ations in the physiological amount of NOS1AP protein may a known ligand is interfered with by the agent being tested. dramatically affect the activity of other protein factors 45 Another technique for drug screening provides high involved in the maintenance and progression of neuropsychi throughput screening for compounds having Suitable binding atric disorders. affinity to the NOS1AP-L or NOS1AP-S promoter or the The nucleic acids encoding the NOS1AP genes disclosed encoded NOS1AP polypeptides and is described in detail in herein may be cloned into expression systems which may be Geysen, PCT published application Wo 84/03564, published used as screening tools to identify compounds that modulate 50 on Sep. 13, 1984. Briefly stated, large numbers of different, protein activity. Modulation of such activity, for example, Small peptide test compounds are synthesized on a solid Sub may be assessed by measuring alterations in NOS1AP activi strate, such as plastic pins or some other Surface. The peptide ties in the presence of the test compound. Test compounds can test compounds are reacted with NOS1AP gene promoter also be assessed for the induction and/or Suppression of disclosed herein or NOS1AP polypeptide and washed. Bound expression of other nucleic acids and proteins that are 55 NOS1AP gene promoter or polypeptide is then detected by involved in the maintenance and promotion of neuropsychi methods well known in the art. atric disorders. The goal of rational drug design is to produce structural analogs of biologically active polypeptides of interest or of V. NOS1AP PROTEINS AND ANTIBODIES Small molecules with which they interact (e.g., agonists, 60 antagonists, inhibitors) in order to fashion drugs which are, Purified NOS1AP proteins, or fragments thereof, may be for example, more active or stable forms of the polypeptide, used to produce polyclonal or monoclonal antibodies which or which, e.g., enhance or interfere with the function of a also may serve as sensitive detection reagents for the presence polypeptide in vivo. See, e.g., Hodgson, (1991) Bio/Technol and accumulation of such proteins (or complexes containing ogy 9:19-21. In one approach, one first determines the three Such protein) in mammalian cells. Recombinant techniques 65 dimensional structure of a protein of interest (e.g., enable expression of fusion proteins containing part or all of NOS1AP-L or NOS1AP-S protein) or, for example, of NOS1AP proteins of the invention. The full length protein or NOS1AP protein-substrate complex, by X-ray crystallogra US 8,110,348 B2 15 16 phy, by nuclear magnetic resonance, by computer modeling the efficacy of the active ingredient. The precise nature of the or most typically, by a combination of approaches. Less often, carrier or other material may depend on the route of admin useful information regarding the structure of a polypeptide istration, e.g. oral, intravenous, cutaneous or subcutaneous, may begained by modeling based on the structure of homolo nasal, intramuscular, intraperitoneal routes. gous proteins. An example of rational drug design is the Whether it is a polypeptide, antibody, peptide, nucleic acid development of HIV protease inhibitors (Erickson et al., molecule, Small molecule or other pharmaceutically useful (1990) Science 249:527-533). In addition, peptides (e.g., compound according to the present invention that is to be NOS1AP-L or NOS1AP-S protein) may be analyzed by an given to an individual, administration is preferably in a “pro alanine scan (Wells, 1991) Meth. Enzym. 202:390-411. In phylactically effective amount’ or a “therapeutically effec this technique, an amino acid residue is replaced by Ala, and 10 tive amount' (as the case may be, although prophylaxis may its effect on the peptide's activity is determined. Each of the be considered therapy), this being sufficient to show benefit to amino acid residues of the peptide is analyzed in this manner the individual. to determine the important regions of the peptide. From the foregoing discussion, it can be seen that nucleic It is also possible to isolate a target-specific antibody, acids encoding the NOS1AP proteins described herein, selected by a functional assay, and then to solve its crystal 15 expression vectors for producing the same, and antibodies structure. In principle, this approach yields a pharmacore immunologically specific for the protein of the invention can upon which Subsequent drug design can be based. It is pos be used to detect the expression the NOS1AP gene and alter sible to bypass protein crystallography altogether by gener NOS1AP protein accumulation for purposes of assessing the ating anti-idiotypic antibodies (anti-ids) to a functional, phar genetic and protein interactions involved in the development macologically active antibody. As a mirror image of a mirror and progression of neuropsychiatric disorders. image, the binding site of the anti-ids would be expected to be The detection of immunocomplex formation is well known an analog of the original molecule. The anti-id could then be in the art and may be achieved through the application of used to identify and isolate peptides from chemically or bio numerous approaches. These methods are generally based logically produced banks of peptides. Selected peptides upon the detection of a label or marker, Such as any radioac would then act as the pharmacore. 25 tive, fluorescent, biological or enzymatic tags or labels of Thus, one may design drugs which have, e.g., improved standard use in the art. U.S. patents concerning the use of Such NOS1AP polypeptide activity or stability or which act as labels include U.S. Pat. Nos. 3,817,837; 3,850,752; 3,939, inhibitors, agonists, antagonists, etc. of the NOS1AP 350; 3,996,345; 4,277,437; 4,275,149 and 4,366,241, each polypeptide activity. By virtue of the availability of cloned the incorporated herein by reference. Of course, one may find NOS1AP sequences described herein, sufficient amounts of 30 additional advantages through the use of a secondary binding NOS1AP polypeptide may be made available to perform such ligand Such as a second antibody or a biotin/avidin ligand analytical studies as X-ray crystallography. In addition, the binding arrangement, as is known in the art. The immunode knowledge of NOS1AP protein sequence provided herein tection methods of the present invention have evident utility will guide those employing computer modeling techniques in in the diagnosis of neuropsychiatric disorders. Here, a bio place of, or in addition to X-ray crystallography. 35 logical or clinical sample Suspected of containing either the In a particularly preferred embodiment of the invention, the encoded protein orpeptide or corresponding antibody is used. promoter region of the NOS1AP gene is cloned upstream of However, these embodiments also have applications to non a reporter gene. See FIG. 7. Reporter genes suitable for this clinical samples, such as in the titering of antigen orantibody purpose include, without limitation, beta galactosidase, samples, in the selection of hybridomas, and the like. In the luciferase, chloramphenicol acetyltransferase, and green 40 clinical diagnosis or monitoring of patients with neuropsy fluorescent protein. Methods for operably linking the coding chiatric disorders, the detection of NOS1AP antigens, or an regions for the reporter genes to NOS1AP promoter sequence increase in the levels of Such antigens, in comparison to the or 5' UTRs are well known to those of ordinary skill in the art. levels in a corresponding biological sample from a normal In an alternative embodiment, SNPs previously associated Subject may be indicative of a patient with neuropsychiatric with schizophrenia can be introduced into the promoter 45 disorders. The basis for Such a diagnostic methods lies, in sequence provided herein and their effects on NOS1AP part, with the finding that presence of the NOS1AP nucleic expression level and protein activity assessed. acid is associated with the neuropsychiatric disorder pheno Following introduction of such DNA constructs into type. By extension, it may be possible that this nucleic acid recipient host cells, the cells may be contacted with agents produces elevated levels of encoded NOS1AP protein for suspected of affecting NOS1AP activity. Agents capable of example, which may prove useful as a neuropsychiatric altering expression levels of the reporter gene may prove marker. Cell lines expressing the nucleic acids encoding efficacious in regulating the expression of the NOS1AP gene, NOS1AP protein or variants thereofmay be used in screening thereby having therapeutic advantage in the treatment of neu methods to identify agents, which modulate their function. ropsychiatric disorders or other disorders where altered In one broad aspect, the present invention encompasses kits expression of the NOS1AP gene plays a role. 55 for use in detecting expression of NOS1AP proteins in brain tissues, most preferably in neuronal tissue. Such a kit may VI. PHARMACEUTICALS AND PEPTIDE comprise one or more pairs of primers for amplifying nucleic THERAPIES acids corresponding to the NOS1AP genes described herein. The kit may further comprise samples of total mRNA derived The discovery of the NOS1AP gene facilitates the devel 60 from tissue of various physiological States, for example, to be opment of pharmaceutical compositions useful for treatment used as controls. The kit may also comprise buffers, nucle and diagnosis of those syndromes and conditions associated otide bases, and other compositions to be used in hybridiza with neuropsychiatric disorders. These compositions may tion and/or amplification reactions. Each solution or compo comprise, in addition to one of the above Substances, a phar sition may be contained in a vial or bottle and all vials held in maceutically acceptable excipient, carrier, buffer, stabilizer 65 close confinement in a box for commercial sale. Another or other materials well known to those skilled in the art. Such embodiment of the present invention encompasses a kit for materials should be non-toxic and should not interfere with use in detecting cells in a biological sample comprising oli US 8,110,348 B2 17 18 gonucleotide probes effective to bind with high affinity to GAGGGTGGTGC (SEQID No. 9)/5RACESn: TTGAGTC NOS1AP mRNA in a Northern blot assay and containers for CAAGGAGAGGGTAGTGG (SEQ ID No. 10)) and 3'UTR each of these probes. In a further embodiment, the invention sequence (3RACE 1: AATGAATGCAAGCTGATAGCT encompasses a kit for use in detecting NOS1AP-S proteins in GAGACTG (SEQID No. 11)/3RACE1n: TGAATCACTGC cells comprising antibodies specific for NOS1AP-S proteins. 5 CACTTGGGTCAGG (SEQID No. 12),3RACE2: AGAAG The following examples are provided to illustrate various GAAGAACCAGGAAAGTGAGATCC (SEQ ID No. 13)/ embodiments of the present invention. They are not intended 3RACE2n: ATCCAGTGTGGCTGAGCCTACCTAGC to limit the invention in any way. (SEQ ID No. 14), and 3RACE3: ATGTGGATG GAGAGGGCTTGT (SEQID No. 15)/3RACE3n: GTGAG Example I 10 GAAGGCCGCTTCTAAAT (SEQ ID No. 16)) and were used in conjunction with a set of universal nested primers The NOS1AP gene (GenBank Accession No. (supplied). Products were cloned into TOPOTA cloning vec NM 014697) has been previously identified as an attractive tor (Invitrogen) and sequenced using a CEQ 8000 (Beckman candidate for schizophrenia susceptibility. NOS1AP was first Coulter). identified in the rat as a neuronal nitric oxide synthase 15 II. Human Postmortem Samples: (nNOS) binding protein, capable of disrupting the association RNA and DNA samples from the Stanley Array Collection of nNOS with the postsynaptic density scaffolding proteins of the Stanley Brain Collection (Torrey et al. 2000) were PSD93 and PSD95 through the binding of the C-terminus of analyzed. This is a collection of biomaterials derived from NOS1AP to nNOS (Jaffrey et al. 1998). The interaction post-mortem brain specimens from 35 individuals with between nNOS and PSD93 and PSD95 is important in target schizophrenia, 35 individuals with bipolar disorder, and 35 ing nNOS to the postsynaptic N-methyl-D-aspartate psychiatrically normal controls. Diagnoses were made by (NMDA) receptor complex, and facilitates the tight coupling two senior psychiatrists, using DSM-IV criteria, based on between activation of the NMDA receptor and nNOS, allow medical records, and when necessary, telephone interviews ing nNOS activation by Ca" influx through the NMDA with family members. Diagnoses of unaffected controls were receptor, producing NMDA receptor-mediated nNO release 25 based on structured interviews by a senior psychiatrist with into the synaptic structures (Brenman et al. 1996a; Brenman family member(s) to rule out Axis I diagnoses. et al. 1996b). This places NOS1AP at the site of NMDA Specimens were collected, with informed consent from glutamate neurotransmission, long proposed to be involved in next-of-kin, by participating medical examiners between schizophrenia (reviewed in Coyle et al. 2003). NOS1AP can January 1995 and June 2002. The specimens were all col also serve as an nNOS adaptor protein, with the N-terminus 30 lected, processed, and stored in a standardized way. Exclu either binding to a direct target of NO-mediated activation by sion criteria for all specimens included: 1) significant struc S-nitrosylation (Fang et al. 2000) or to Synapsin (Jaffrey et al. tural brain pathology on post-mortem examination by a 2002), resulting in the localization of nNOS to the presynap qualified neuropathologist, or by pre-mortem imaging; 2) tic terminals. History of significant focal neurological signs pre-mortem; 3) Sequencing of the coding region of NOS1AP in individuals 35 History of central nervous system disease that could be from the Canadian linkage sample has failed to identify any expected to alter gene expression in a persistent way; 4) coding mutations associated with illness (Brzustowicz et al. Documented IQ<70; or 5) Poor RNA quality. RNA integrity 2004), consistent with current results for other candidate and purity were determined with an Agilent 2100 Bioana genes for schizophrenia (Harrison and Owen 2003). lyzer. Degradation was defined as a shift in the RNA size NOS1AP has a large, approximately 300 kb, genomic extent, 40 distribution towards Smaller fragments and a decrease in fluo only 1.5 kb of which represents coding sequence. Therefore rescence signal of ribosomal peaks. Additional exclusion cri there are many potential sites for regulatory sequences that teria for unaffected controls included age less than 30 (thus, could be disrupted and lead to altered gene expression. In the still in the period of maximum risk) and Substance abuse present invention, a human cloNA library was screened to within one year of death or evidence of significant alcohol identify possible alternative splice forms of NOS1AP. The 45 related changes in the liver. expression of NOS1AP by quantitative RT-PCR was investi DNA and RNA from Brodmann's area 46 (DLPFC) was gated in the Stanley Array Collection (Torrey et al. 2000), available for all Subjects. Genotyping and expression analy derived from post-mortem tissue from the dorsolateral pre ses were conducted with the samples coded to keep investi frontal cortex (DLPFC) of individuals with schizophrenia, gators blind to diagnostic status. After the blind was broken, bipolar disorder, and psychiatrically normal controls. 50 diagnostic status and a range of clinical variables were pro Materials and Methods vided for analysis. These included gender, race, age at time of I. Identification and Characterization of NOS1AP Tran death, age of onset, post-mortem interval (PMI), brain pH, Scripts: total brain weight, hemisphere used for RNA extraction, A human fetal brain arrayed cDNA library (Origene Tech Smoking status at time of death (coded as non-Smoking for nologies, Catalog Number LLFB-1001) was screened using 55 individuals who Smoked previously but had quit), antipsy the supplier's protocol by PCR amplification using primers chotic status at time of death, and lifetime antipsychotic expo from NOS1AP exon 10 (Ex10-F: AAATCAACAACCT Sure in fluphenazine milligram equivalents. In addition, life TGCCTAACG (SEQID No. 5), Ex10-R: GAAAGCACTC time alcohol and Substance use were each rated on a scale of CAGCTTCACC(SEQID No. 6)). Individual positive clones 0 to 5 using the categories “little or none”, “social”, “moder were sequenced using a CEQ 8000 (Beckman Coulter). Tran 60 ate past”, “moderate present”, “heavy past, and “heavy scripts were further characterized by 3' and 5 RACE, per present. Overall, the sample was 66% male, with an average formed with RACE-ready cDNA from human brain (Am age at death of 44 years (S.D. 8.9, range of 19 to 64), and was bion). For each reaction a pair of nested PCR primers were predominantly Caucasian (97%), with one African American designed from full-length and short-form 5' UTR sequences subject with bipolar disorder, one Native American subject (5RACEL: GAAGGCGTCCTCGTTGTGCAAGG (SEQID 65 with bipolar disorder, and one Hispanic individual with No. 7)/5RACELn: TTGTGCAAGGGGATCCGCAGGTCG Schizophrenia. Smoking status at time of death was available (SEQ ID No. 8), 5RACES: TTAGAGGTTCCTG for 67 subjects, with 72% of the sample smokers. Lifetime US 8,110,348 B2 19 20 alcohol use estimates were available on all but one subject, V. Statistical Analyses: with 57% of the sample reporting no, little, or social use, 17% RNA amounts were quantified by the ABI Relative Quan reporting past or present moderate use, and 26% reporting titation of Gene Expression protocol (Applied Biosystems). past or present heavy use. Lifetime Substance use estimates The results from three repeat assays were averaged to produce were available on all but two subjects, with 65% of the sample a single mean quantity value for each mRNA for each Subject. reporting no, little, or Social use, 16% reporting past or The quantity values of the target gene were then normalized present moderate use, and 19% reporting past or present over the quantity values of the reference gene (beta-actin) to heavy use. The average age of onset for the schizophrenia produce normalized expression quantities. These are unitless group was 21.3 years (S.D. 6.1, range of 9 to 34) and for the measures of the relative amount of transcript that is present in bipolar group was 25.1 years (S.D. 9.1, range of 14 to 48). 10 each individual. Further information about the Stanley Array Collection is Normalized expression quantities and Subject variables available from the Stanley Medical Research Institute. were analyzed with SAS v8.2 for UNIX software (SAS Insti III. RNA Quantification: tute Inc.). Most potentially confounding variables were tested Total RNA (5ug) was treated with the DNA-free Kit (Am 15 for correlation with NOS1AP expression using all subjects, bion) in accordance with the manufacturer's procotol to although exposure to antipsychotics (either as a dichotomous eliminate DNA contamination. The resulting DNase-treated trait or a quantitative estimate of total lifetime exposure) was RNA was used in a 40 ul reverse transcriptase reaction to examined only in subjects with bipolar disorder or schizo synthesize cDNA following the SuperScript II First-Strand phrenia. Normally distributed variables (age at death, post cDNA Synthesis protocol (Invitrogen), including optional mortem interval, brain pH, and brain weight) were tested with RNaseGUT treatment. Samples were then quantified using Pearson’s product moment correlation, dichotomous vari real-time PCR. The previously described primer pair ables (gender, brain hemisphere analyzed, Smoking status at NN05224/NN05225 (HUGE database clone KIAA0464) time of death, and history of exposure to antipsychotic medi was used for quantification of full-length NOS1AP (Ohara et cation) with point biserial correlation, and ranked variables al. 1997: Kikuno et al. 2004). This primer pair produces a 338 25 (lifetime alcohol use and lifetime substance abuse) with bp product that spans the boundary of exons 7 and 8. The Spearman's correlation. Quantitative lifetime antipsychotic primers specific for NOS1AP-S were designed using Primer exposure was tested with Pearson’s product moment correla Express Software Version 2.0 (Applied Biosystems). The tion after log transformation to normalize the distribution of forward primer (Short-F: CATTCATGTCCCTCTCT the data. The relationship between gene expression levels and 30 diagnostic group was analyzed by point biserial correlation, TCTCTC (SEQ ID No. 17)) is located in the 5' UTR that is and the relationship between gene expression levels and age unique to the short form transcript, the reverse primer (Short of onset within the bipolar and schizophrenia groups was R: AATGCAGGTCCTCTGGCTTAG (SEQ ID No. 18)) is tested with Pearson’s product moment correlation. The rela located within exon 10, and the pair produces a 321 bp prod tionship between genotype and NOS1AP expression was uct that spans the boundary of exons 9 and 10. The house 35 analyzed by Spearman's rank correlation, with the heterozy keeping gene beta-actin was used as reference gene to nor gotes ranked between the homozygotes. malize the total RNA input. The forward (beta-actin-F: SNPs were analyzed for association to schizophrenia and CATCCTCACCCTGAAGTACCC (SEQ ID No. 19)) and bipolar disorder using Fisher's exact test. Two by two tables reverse (beta-actin-R: GAGAAGATGACCCAGATCAT were constructed comparing the frequency of the two alleles GTTT (SEQ ID No. 20)) primers produce a 184 bp product 40 for each SNP in cases from a single diagnostic category that spans the boundary of exons 3 and 4. Real time PCR versus controls. Since three SNPs that had demonstrated sig analysis was conducted using 1 ul of a 1:5 dilution of cDNA, nificant association to Schizophrenia in a prior study (Brzus 0.1 M of each primer, and 5 ul Sybr Green Master Mix towicz et al. 2004) were tested, one-sided p-values reflecting (Applied Biosystems) in a total reaction volume of 10 ul in a association of the alleles previously found to be associated 384 well plate on an ABI Prism 7900HT sequence detector 45 with schizophrenia are reported. system (Applied Biosystems). Samples were initially Results warmed to 50° C. for 2 minutes followed by activation of the I. Identification and Characterization of Two Human AmpliTaq Gold DNA polymerase by heating to 95°C. for 10 NOS1APIsoforms: minutes. PCR amplification was performed with 40-50 cycles Screening of a human fetal brain cDNA library resulted in of 95°C. for 30s, 58° C. (full-length experiments) or 61° C. 50 the isolation of four distinct clones. Three clones (“NOS1AP (short-form experiments) for 40s, and 72° C. for 1 minute. full-length', having the sequence of SEQID No. 1) contain Each real-time PCR assay was repeated three times. The inserts of approximately 2.5 kb, corresponding to exons 1-10, standard curve used for determining the relative quantity of as previously described in the NCBI reference sequence for each isoform in each sample was constructed by the amplifi NOS1AP (GenBank Accession No. NM 014697), except cation of serial dilutions of pooled brain cDNA. In each 55 that exon 4 from these clones was missing the first 15bp listed experiment, the R value of the standard curve was greater in the reference sequence. These transcripts are predicted to than 0.98 and the no-template control produced no detectable produce a 501 amino acid full-length NOS1AP protein (SEQ signal. Dissociation curve analysis was conducted on all PCR ID No. 2) which contains an in-frame deletion of the 5 amino products to assure that only a single product was present in the acids sequence Glu-Leu-Leu-Leu-Leu (SEQ ID No. 21), reaction. Real-time PCR data acquisition and analysis were 60 when compared to the NOS1AP protein previously disclosed performed using SDS v2.0 software (Applied Biosystems). (GenBank Accession No. NP 055512). The fourth clone IV. SNP Genotyping: (“NOS1AP short-form', having the sequence of SEQID No. DNA samples from the Stanley Array Collection were 3) contains an insert of 4 kb with a unique 5' UTR correspond genotyped for rs1415263, rS4145621, and rs2661818 by a ing to genomic sequence from intron 8, followed by exons 9 primer extension strategy (Pyrosequencing) using the auto 65 and 10, and a 3' UTR longer than that contained by the other mated PSQ HS.96A platform as described in Brzustowicz, et clones or in the reference sequence. This transcript is pre al. 2004. dicted to produce a 211 amino acid protein (SEQID No. 4), US 8,110,348 B2 21 22 including 18 novel amino acids at the amino terminus, and relative expression levels were used for all Subsequent analy will contain the NOS1AP PDZ-binding domain. ses. No significant correlations were detected between The previously undescribed transcript of NOS1AP-S was mRNA levels of either NOS1AP isoform and the potentially further characterized by 5' and 3' RACE. The 5' UTR was confounding variables of age at death, PMI, brain pH, brain 2,367 bp, while the longest 3' RACE product ended 2,556 bp weight, gender, hemisphere, Smoking status at time of death, downstream of the stop codon. From these results, the total lifetime alcohol use, or lifetime substance abuse (Table 3). length of the short-form mRNA was calculated to be 5.559 NOS1AP expression levels were found to be significantly bp. Due to the much longer 5' and 3' UTRs, the NOS1AP (p<0.001) correlated with length of sample storage for both transcript encoding NOS1AP-S protein (SEQ ID No. 4) is isoforms (Table 3). Therefore, for all subsequent analyses actually significantly longer than the transcript that encodes 10 the full-length protein (SEQID No. 2). The gene, transcripts, storage time was used as covariate. and predicted proteinstructures of the two forms are shown in FIG 1. TABLE 3 Protein and total RNA were extracted from Brodmann's Correlations Between NOS1APIsoform Expression area 46 (DLPFC) of postmortem samples from five normal 15 and Possible Confounding Variables controls, COS-7 cells that had been transfected with cDNA encoding NOS1AP-S protein (SEQID No. 4), and untrans Full-Length Short-Form fected COS-7 cells that normally express the full-length NOS1AP protein (SEQ ID No. 2). Western blots of these Variable Correlation p-value' Correlation p-value samples were probed with a rabbit polyclonal antibody raised Age” -0.05 O.63 -0.03 0.75 against the carboxyl terminus of NOS1AP. This antibody is Post-Mortem Interval O.O8 0.44 O.09 O.38 predicted to interact with both the full-length and short-form Brain pH O16 O.11 O.O7 O.49 ofNOS1AP, since the antigen used to generate the antibody is Brain Weight O.O3 O.74 O.04 O.68 Storage Time' O.SO Chromosomes (2004) Pathology of layer V pyramidal neurons in the 1q32.2, 5q33.2, and 8p21-22 and Provides Support for prefrontal cortex of patients with schizophrenia. Am J Psy 55 chiatry 161:742-744. Linkage to Schizophrenia, on Chromosomes 11q23.3-24 Bassett AS, Chow E W, Waterworth D M, Brzustowicz, L and 20d 12.1-11.23. Am J Hum Genet 68:661-673. (2001) Genetic insights into schizophrenia. Can J Psychia Harrison PJ, Owen M. J. (2003) Genes for schizophrenia? try 46:131-137. Recent findings and their pathophysiological implications. Brenman J. E. Chao DS, Gee SH, McGee AW, Craven SE, 60 Lancet 361:417-419. Santillano DR, Wu Z, Huang F, Xia H. Peters M. F. Froe Hwu HG, Liu CM, Fann CS, Ou-Yang WC, Lee SF (2003) hner SC, Bredt D S (1996a) Interaction of nitric oxide Linkage of Schizophrenia with chromosome 1 q loci in synthase with the postsynaptic density protein PSD-95 and Taiwanese families. Mol Psychiatry 8:445-452. alpha1-syntrophin mediated by PDZ domains. Cell Jaffrey SR, Benfenati F. Snowman AM, Czernik A.J. Snyder 84:757-767. 65 S H (2002) Neuronal nitric-oxide synthase localization Brenman J. E. Christopherson KS, Craven SE, McGee AW. mediated by a ternary complex with synapsin and CAPON. Bredt D S (1996b) Cloning and characterization of Proc Natl Acad Sci USA99:3199-3204. US 8,110,348 B2 35 36 Jaffrey SR, Snowman AM, Eliasson M.J. Cohen NA. Snyder Schaefer A T, Larkum M. E. Sakmann B, Roth A (2003) S H (1998) CAPON: a protein associated with neuronal Coincidence detection in pyramidal neurons is tuned by nitric oxide synthase that regulates its interactions with their dendritic branching pattern. J Neurophysiol 89:3143 PSD95. Neuron 20:115-124. 3154. Kikuno R, Nagase T, Nakayama M. Koga H, Okazaki N. 5 Seki N, Ohira M, Nagase T. Ishikawa K. Miyajima N, Naka Nakajima D, Ohara O (2004) HUGE: a database for human jima D. Nomura N. Ohara O (1997) Characterization of KIAA proteins, a 2004 update integrating HUGEppi and cDNA clones in size-fractionated cDNA libraries from ROUGE. Nucleic Acids Res 32: D502-504. human brain. DNA Res 4:345-349. Lewis CM, Levinson DF, Wise LH, DeLisi LE, Straub RE, Shaw S H. Kelly M, Smith A B, Shields G, Hopkins P J, Hovatta I, Williams NM, et al. (2003) Genome Scan Meta Loftus J, Laval SH, Vita A, De Hert M, Cardon L. R. Crow Analysis of Schizophrenia and Bipolar Disorder, Part II: 10 T. J. Sherrington R, DeLisi L E (1998) A genome-wide Schizophrenia. Am J Hum Genet 73:34-48. search for schizophrenia Susceptibility genes. Am J Med McGuffin P. Asherson P. Owen M, Farmer A (1994) The Genet 81:364-376. strength of the genetic effect. Is there room for an environ- Stefansson H. Sigurdsson E. Steinthorsdottir V. Bjornsdottir mental influence in the etiology of schizophrenia? Br J S, Sigmundsson T. Ghosh S. Brynjolfsson J, et al. (2002) Psychiatry 164:593-599. 15 Neuregulin 1 and susceptibility to schizophrenia. Am J Miyoshi K, Honda A, Baba K, Taniguchi M., Oono K, Fujita Hum Genet 71:877-892. T. Kuroda S. Katayama T, Tohyama M (2003) Disrupted- Straub RE, Jiang Y. MacLean CJ, MaY. Webb BT, Myaki In-Schizophrenia 1, a candidate gene for Schizophrenia, shev M.V. Harris-Kerr C. Wormley B, Sadek H. Kadambi participates in neurite outgrowth. Mol Psychiatry 8:685- B, Cesare AJ, Gibberman A, Wang X, O'Neill FA, Walsh 694. 20 D. Kendler KS (2002) Genetic variation in the 6p22.3 gene Naggert J K, Fricker L. D. Varlamov O, Nishina PM, Rouille DTNBP1, the human ortholog of the mouse dysbindin Y. Steiner D F, Carroll RJ, Paigen BJ, Leiter E H (1995) gene, is associated with Schizophrenia. Am J Hum Genet Hyperproinsulinaemia in obese fat/fat mice associated 71:337-348. with a carboxypeptidase E mutation which reduces Tochio H, Hung F, Li M. Bredt DS, Zhang M (2000) Solution enzyme activity. Nat Genet 10:135-142. as structure and backbone dynamics of the second PDZ Ohara O, Nagase T. Ishikawa K, Nakajima D, Ohira M. Seki domain of postsynaptic density-95. J Mol Biol 295:225 N. Nomura N (1997) Construction and characterization of 237. human brain cDNA libraries suitable for analysis of cDNA Torrey E. F. Webster MJ, Knable M B, Johnston N, Yolken R clones encoding relatively large proteins. DNA Res 4:53- H (2000) The Stanley Foundation Brain Collection and 59. 30 Neuropathology Consortium. Schizophrenia Research Ozeki Y. Tomoda T. Kleiderlein J. Kamiya A, Bord L., Fujii K, 44:151-155. Okawa M. Yamada N, Hatten ME, Snyder SH, Ross CA, Vetter P. Roth A. Hausser M. (2001) Propagation of action Sawa A (2003) Disrupted-in-Schizophrenia-1 (DISC-1): potentials in dendrites depends on dendritic morphology. J mutant truncation prevents binding to NudE-like (NU- Neurophysiol 85:926-937. DEL) and inhibits neurite outgrowth. Proc Natl Acad Sci Xu B, Wratten N. Charych E I, Buyske S, Firestein B L, USA 100:289-294. 35 Brzustowicz, LM (2005) Increased expression in dorsolat Rosa A, Fafianás L., Cuesta MJ, Peralta V. Sham P (2002) eral prefrontal cortex of CAPON in schizophrenia and 1q21-q22 locus is associated with Susceptibility to the real- bipolar disorder. PLOS Med2(10): e263. ity-distortion syndrome of Schizophrenia spectrum disor- Zoghbi HY (2003) Postnatal neurodevelopmental disorders: ders. American Journal of Medical Genetics 114:516-518. meeting at the synapse?, Science 302:826-830.

SEQUENCE LISTING

<16 Os NUMBER OF SEO ID NOS: 25

<21 Os SEQ ID NO 1 &211s LENGTH: 2870 &212s. TYPE: DNA <213> ORGANISM: Homo Sapiens <4 OOs SEQUENCE: 1 ttctt Cttcg toccgggcgg tecgttccac totctgggg ccggcgc.cgc gcc.cagtic cc 60 gct tcgggcc gcaa.gc.ccca cc.gct cocct coccgggcag gggcgc.cgcg cagoccgctic 12O

cc.gc.cgc.cac ct cotcc cct gcc.gc.cct cc tagc.cggcag gaattgcgcg accacagcgc 18O

cgctcgc.gtC goccgcatca gcticagoccg Ctgcc.gctcg gC cct cqgca cc.gctc.cggg 24 O

to cigcc.gcc gcgcggc.cag ggctic cc cct gcc.ca.gc.gct CocaggccCC gocacgcgtc 3 OO

gcc.gc.gc.cca gct coagt ct cocct coccg gggit ct cqcc agcc cct tcc ticago.cgc.c 360

gcctic Caag gagcgggtcc gcc.gcgggta accatgcct a gcaaaaccala gtacaiaccitt 42O

gtggacgatg ggcacgacct gcggat.ccc.c ttgcacaacg aggacgc.ctt Ccagcacggc 48O

atctgctttg aggccaagta C9taggaagc ctggacgtgc caaggcc.cala cagcagggtg 54 O

US 8,110,348 B2 39 40 - Continued

&211s LENGTH: 5O1 212. TYPE: PRT <213> ORGANISM: Homo Sapiens <4 OOs, SEQUENCE: 2 Met Pro Ser Lys Thr Llys Tyr Asn Lieu Val Asp Asp Gly His Asp Lieu. 1. 5 1O 15 Arg Ile Pro Lieu. His Asn. Glu Asp Ala Phe Glin His Gly Ile Cys Phe 2O 25 3O Glu Ala Lys Tyr Val Gly Ser Lieu. Asp Val Pro Arg Pro Asn. Ser Arg 35 4 O 45 Val Glu Ile Val Ala Ala Met Arg Arg Ile Arg Tyr Glu Phe Lys Ala SO 55 6 O Lys Asn. Ile Llys Llys Llys Llys Val Ser Ile Met Val Ser Val Asp Gly 65 70 7s 8O Val Llys Val Ile Lieu Lys Llys Llys Llys Llys Llys Lys Glu Trp Thir Trip 85 90 95 Asp Glu Ser Lys Met Lieu Val Met Glin Asp Pro Ile Tyr Arg Ile Phe 1OO 105 11 O Tyr Val Ser His Asp Ser Glin Asp Lieu Lys Ile Phe Ser Tyr Ile Ala 115 12 O 125 Arg Asp Gly Ala Ser Asn. Ile Phe Arg Cys Asn Val Phe Llys Ser Lys 13 O 135 14 O Llys Llys Ser Glin Ala Met Arg Ile Val Arg Thr Val Gly Glin Ala Phe 145 150 155 160 Glu Val Cys His Llys Lieu. Ser Lieu Gln His Thr Glin Gln Asn Ala Asp 1.65 17O 17s Gly Glin Glu Asp Gly Glu Ser Glu Arg Asn. Ser Asn. Ser Ser Gly Asp 18O 185 19 O Pro Gly Arg Glin Lieu. Thr Gly Ala Glu Arg Ala Ser Thr Ala Thr Ala 195 2OO 2O5 Glu Glu Thir Asp Ile Asp Ala Val Glu Val Pro Lieu Pro Gly Asn Asp 21 O 215 22O Val Lieu. Glu Phe Ser Arg Gly Val Thir Asp Lieu. Asp Ala Val Gly Lys 225 23 O 235 24 O Glu Gly Gly Ser His Thr Gly Ser Llys Val Ser His Pro Glin Glu Pro 245 250 255 Met Lieu. Thir Ala Ser Pro Arg Met Lieu. Leu Pro Ser Ser Ser Ser Lys 26 O 265 27 O Pro Pro Gly Lieu. Gly Thr Glu Thr Pro Leu Ser Thr His His Gln Met 27s 28O 285

Gln Lieu. Lieu. Glin Glin Lieu. Lieu. Glin Glin Glin Glin Glin Glin Thr Glin Wall 29 O 295 3 OO Ala Val Ala Glin Val His Lieu. Lieu Lys Asp Glin Lieu Ala Ala Glu Ala 3. OS 310 315 32O Ala Ala Arg Lieu. Glu Ala Glin Ala Arg Val His Glin Lieu. Lieu. Lieu. Glin 3.25 330 335 Asn Lys Asp Met Lieu Gln His Ile Ser Lieu. Lieu Val Lys Glin Val Glin 34 O 345 35. O Glu Lieu. Glu Lieu Lys Lieu. Ser Gly Glin Asn Ala Met Gly Ser Glin Asp 355 360 365 Ser Lieu. Lieu. Glu Ile Thr Phe Arg Ser Gly Ala Lieu Pro Val Lieu. Cys 37 O 375 38O Asp Pro Thir Thr Pro Llys Pro Glu Asp Lieu. His Ser Pro Pro Leu Gly 385 390 395 4 OO US 8,110,348 B2 41 42 - Continued

Ala Gly Luell Ala Asp Phe Ala His Pro Ala Gly Ser Pro Luell Gly Arg 4 OS 41O 415

Arg Asp Lieu Val Llys Lieu. Glu Cys Phe Arg Phe Lell Pro Pro Glu 425 43 O

Asp Thir Pro Pro Pro Ala Glin Gly Glu Ala Lieu. Lell Gly Gly Lieu. Glu 435 44 O 445

Lell Ile Phe Arg Glu Ser Gly Ile Ala Ser Glu Glu Ser Asn 450 45.5 460

Thir Asp Glu Ser Glu Glu Arg Asp Ser Trp Ser Glin Glu Glu Leul Pro 465 470

Arg Luell Luell Asn Val Lieu. Glin Arg Glin Glu Lieu. Gly Asp Gly Lieu. Asp 485 490 495

Asp Glu Ile Ala Wall SOO

<210s, SEQ ID NO 3 &211s LENGTH: 5559 &212s. TYPE: DNA <213> ORGANISM: Homo Sapiens

<4 OOs, SEQUENCE: 3

Ctatgaccala atgitatgggg ct t t t t coca cacaccaagc alagcaa.gcag ttctgcagag 6 O ggcacacagt gtc.ctictaac t cagtttgat tctgatacta tctacctgga aac agcatca 12 O gatccCacag tittgagggct CaatcCCaCa agactitt coc c catttcaga Caccalat CaC 18O aagtaatagt ttgtcaccita cacctctgac Caagtggcta taa attggtg titcCCaCtac 24 O cctcitccttg gacticaactg atttgctaga gcaactgaca gaact cagga aalacaccitac 3OO atttactggit ttattittaala ggatattata agggatacca atgaacacca gatggalaga.g 360 atgcat aggg Cagggtctgt gggaagggtg gcagagcticc catgc cct c c Caacgtgcac caccct coag gaacct ctaa atgttcagct gcc.cggcagc to CCCaCaCC cagtic cttitt gagtttittaa tggaggctitt attatgtagg catgattgat tacat cattg gcc actggtg 54 O attagtttaa cittittagc cc cit catctic ct ggaggttggg gcgtgggact gaaaaatcct atcCtectaat cataccttgg tctgtc.ctgt gag cago Ccc catc.ccgaag Ctt coagggg 660 titcCCCalacc actaat catc. taataagcat a Caaaaaa.ca CtecttacCaC tctggagat C 72 O t caagggittt ggggagct at atgtcaggaa acagggatga agaccaaaca tgt attt cac tgitat cacac ctgttct cac c cct c cccag a tott ct citc. aattaatatg agacaaaaaa 84 O atgagt ctga cittcttgacc aaaatat cag ttctgtcctt agcagctitta tggagga cag 9 OO atttagttta aatticcittag gcattatgcc Cctgtggctic CactCaatca gaaat agggit 96.O

Caacggcaag gtcagggc ct c caatctggg Caagagggag gcago Cacgg tat coacaag tgtaattctic tgagtgctgg ttgctgggag ggg cacaccc tgggc.ca.gca agt cacttgg cCaagggtgg c caactgtga ggtag cactg c cott tactic CCtaaaaaaa. tgttgaat ct c 14 O tittggagcaa. act cost cit to agalaatttga gcacttgttt tctgagcaa.g ggaat cagct 2OO aatgcttittg act CCC catc. catct tcc td catcct cqtc ccacct citcc. tgcc.cccact 26 O cacctggctic tgtc.tttacc Cacac catgg ttittggtaca agaac accct titt coccata 32O agctacattg gtcCaggc.ca taaaaatt Ca ttagttc cct ttctt Caggg gcc ttctgaa atgctic cctd gagaact citt tatt cact to tittgcacaag aat Cacatat gtgttgaacac 44 O tgg tattggc cit total actic agtttctt.ca alaccagggtc Ctggtctggit tgc.ccctgtc SOO

US 8,110,348 B2 47 48 - Continued

85 90 95

Thir Thr Pro Llys Pro Glu Asp Lieu. His Ser Pro Pro Lell Gly Ala Gly 1OO 105 11 O

Lieu Ala Asp Phe Ala His Pro Ala Gly Ser Pro Lell Gly Arg Arg Asp 115 12 O 125

Cys Lieu Val Lys Lieu. Glu. Cys Phe Arg Phe Luell Pro Pro Glu Asp Thir 13 O 135 14 O

Pro Pro Pro Ala Glin Gly Glu Ala Leu Luell Gly Gly Lell Glu Luell Ile 145 150 155 160

Llys Phe Arg Glu Ser Gly Ile Ala Ser Glu Tyr Glu Ser Asn Thir Asp 1.65 17O 17s

Glu Ser Glu Glu Arg Asp Ser Trp Ser Glin Glu Glu Lell Pro Arg Luell 18O 185 19 O

Lieu. Asn Val Lieu. Glin Arg Glin Glu Lieu. Gly Asp Gly Lell Asp Asp Glu 195 2OO 2O5

Ile Ala Wall 21 O

SEO ID NO 5 LENGTH: 22 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: primer SEQUENCE: 5 aaatcaacaa ccttgcctaa cq 22

SEQ ID NO 6 LENGTH: 2O TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: primer SEQUENCE: 6 gaaag.c actic cagctt cacc

SEO ID NO 7 LENGTH: 23 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: primer SEQUENCE: 7 gaaggcgt.cc ticgttgttgca agg 23

SEQ ID NO 8 LENGTH: 24 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: primer SEQUENCE: 8 ttgttgcaagg ggat.ccgcag gtcg 24

SEO ID NO 9 LENGTH: 24 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: US 8,110,348 B2 49 50 - Continued <223> OTHER INFORMATION: primer <4 OOs, SEQUENCE: 9 ttagaggttc Ctggagggtg gtgc 24

<210s, SEQ ID NO 10 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: primer <4 OOs, SEQUENCE: 10 ttgagt cc aa ggagagggta gtgg 24

<210s, SEQ ID NO 11 &211s LENGTH: 28 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: primer <4 OOs, SEQUENCE: 11 aatgaatgca agctgatagc tigagactg 28

<210s, SEQ ID NO 12 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: primer <4 OOs, SEQUENCE: 12 tgaat cactg. C Cacttgggt cagg 24

<210s, SEQ ID NO 13 &211s LENGTH: 28 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: primer <4 OOs, SEQUENCE: 13 agaaggaaga accaggaaag tagatcc 28

<210s, SEQ ID NO 14 &211s LENGTH: 26 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: primer <4 OOs, SEQUENCE: 14 atcCagtgtg gctgagccta cct agc 26

<210s, SEQ ID NO 15 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: primer <4 OOs, SEQUENCE: 15 atgtggatgg agagggcttg t 21

<210s, SEQ ID NO 16 US 8,110,348 B2 51 52 - Continued

&211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: primer <4 OOs, SEQUENCE: 16 gtgaggaagg cc.gcttctaa at 22

<210s, SEQ ID NO 17 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: primer <4 OOs, SEQUENCE: 17 catt catgtc. cct citcttct citc 23

<210s, SEQ ID NO 18 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: primer <4 OOs, SEQUENCE: 18 aatgcagg to Ctctggctta g 21

<210s, SEQ ID NO 19 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: primer <4 OOs, SEQUENCE: 19 catcct cacc ctdaagtacc c 21

<210s, SEQ ID NO 2 O &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: primer <4 OOs, SEQUENCE: 2O gagalagatga CCC agatcat gtt 23

<210s, SEQ ID NO 21 &211s LENGTH: 5 212. TYPE: PRT <213> ORGANISM: Homo Sapiens <4 OOs, SEQUENCE: 21

Glu Lieu. Lieu. Lieu. Lieu 1. 5

<210s, SEQ ID NO 22 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: primer <4 OOs, SEQUENCE: 22 gcaatat citt cagatgcaa. 19

US 8,110,348 B2 55 56 What is claimed is: wherein said nitric oxide synthetase 1 adaptor protein 1. A method for identifying a compound which inhibits (NOS1AP) binding protein is selected from the group complex formation between nitric oxide synthetase 1 adaptor consisting of carboxypeptidase E (CPE), eEF2, and hip protein (NOS1AP) and NOS1AP binding protein(s), com- pocalcin-like-1, and prising: 5 wherein a decrease in NOS1AP-NOS1AP binding protein a) incubating said NOS1AP or functional fragment thereof complex formation in the presence of said compound and said NOS1AP binding protein in the presence and indicates that the compound is an inhibitor of NOS1AP absence of said compound under conditions suitable for 2 NSEig Ety ple st d i protein complex formation to occur, wherein said . The method of claim 1 wherein said compound 1s a NOS1AP or functional fragment thereof is SEQID NO: 10 siRNA which down-modulates nitric oxide synthetase 1 adaptor protein (NOS1AP). 2, a fragment consisting of amino acids 181-307 of SEQ y EF ES claim . wherein said siRNA comprises ID NO: 2, or a fragment consisting of amino acids 186- SEQID NO: 22 312 of SEQ ID NO: 2, and 4. The method of claim 1, performed in a neuronal cell. b) determining whether the complex formation is is 5. The method of claim 4, wherein said compound decreased in the presence of said compound when com- increases dendritic branching in said neuronal cell. pared to complex formation in the absence of said com pound, k . . . .