IDENTIFICATION AND FUNCTIONAL ANALYSIS OF INHERITED VARIATION IN THE CYP3A4 GENE REGULATORY REGION

A thesis presented for the degree of Doctor of Philosophy

By Hossein Hamzeiy

Molecular Toxicology Research Group School of Biomedical and Life Sciences University of Surrey Guildford, UK

June 2002 ProQuest Number: 27558557

All rights reserved

INFORMATION TO ALL USERS The quality of this reproduction is dependent upon the quality of the copy submitted.

In the unlikely event that the author did not send a com plete manuscript and there are missing pages, these will be noted. Also, if material had to be removed, a note will indicate the deletion. uest

ProQuest 27558557

Published by ProQuest LLO (2019). Copyright of the Dissertation is held by the Author.

All rights reserved. This work is protected against unauthorized copying under Title 17, United States C ode Microform Edition © ProQuest LLO.

ProQuest LLO. 789 East Eisenhower Parkway P.Q. Box 1346 Ann Arbor, Ml 48106- 1346 ABSTRACT

CYP3A4 is usually the major cytochrome P450 enzyme in adult human liver. It is known to metabolise a wide variety of xenobiotic and endogenous compounds. Substantial inter-individual variation in hepatic levels of CYP3A4 has been observed and although polymorphic mutations have been reported in both the 5' regulatory and coding regions of the CYP3A4 gene, those investigated so far do not appear to make a major contribution to CYP3A4 variation in the population as a whole.

To determine whether regulatory mutations might occur in more distal regions of the promoter, I have performed a new population screening on a panel of 101 human DNA samples. 1141 bp of the proximal 5' regulatory region of the CYP3A4 gene and 300 bp of the distal enhancer region at -7.9 kb, both containing numerous regulatory motifs, were amplified from genomic DNA. Screening for mutations in the resulting PCR products was carried out using non-radioactive single strand conformation polymorphism (SSCP) followed by confirmatory sequencing of both DNA strands. In addition to detection of the previously reported CYP3A4"^1B allele in nine subjects, three novel alleles were found: CYP3A4^1E (having a T-^A transversion at -369 in one subject), CYP3A4^1F (having a C ^ G transversion at -747 in 17 subjects) and CYP3A4^15B having a nine-nucleotide insertion between -845 and -844 linked to an

A-^G transition at -392 and a G->A transition in exon 6 (position 485 in the cDNA) in one subject. No mutations were found in the distal enhancer region indicating strong conservation of sequence in this region of the promoter.

Functional analysis of the regulatory region mutants was performed in vitro using reporter DNA constructs in which the whole 1141 bp proximal promoter region from each mutant allele was inserted between a single copy of the 300 bp core distal enhancer sequence and the cDNA for human secreted alkaline phosphatase (SEAR). The individual reporter constructs were co-transfected with an hPXR expression vector into human liver (HepG2, HuH7) and intestinal (Caco-2) cell lines, in the presence or absence of classical xenobiotic inducers of CYP3A4. Modulation of transcriptional activation, as indicated by SEAP expression, was measured by chemiluminescent SEAP assay of the culture medium. Significant variation in promoter strength was found between the mutant CYP3A4 promoter alleles depending on the inducer used and the recipient cell line. While there was close similarity between the xenobiotic induction patterns for wild type and mutant promoters in HepG2 and HuH7 cells, the pattern in Caco-2 cells was substantially different. Identification of novel regulatory and coding region alleles of CYP3A4 will assist detailed investigation of the mechanistic basis of CYP3A4 regulation and help elucidate the relationship between genotype, xenobiotic metabolism and toxicity in the CYP3A family of isoenzymes.

II ACKNOWLEDGEMENTS

I would like to express my gratitude to my supervisor Professor Peter S.G. Goldfarb for his advice and guidance throughout this project. I wish also thank Dr Nick Plant for his technical advice.

My special thanks go to my wife and son for their patience and support during our stay in the UK.

I particularly appreciate my Iranian friends for kindly providing almost half of the blood samples required in this work.

I am also grateful to the Iranian Ministry of Health and Medical Education for my financial support.

Ill ABBREVIATIONS

AR Androgen receptor ABCBl ATP-binding cassette B1 AF Activation function AhR Arylhydrocarbon receptor Amt AhR nuclear translocator protein BTE Basal transcription element CAR Constitutively active/ androstane receptor CBP CREB binding protein CPF CYP3A7 promoter-binding factor CREB Cyclic AMP response element binding protein CLTZ Clotrimazole COUP-TF chicken ovalbumin upstream promoter transcription factor CYP Cytochrome P450 DBD DNA-binding domain DEX Dexamethasone DHEA Dehydroepiandrosterone 3-sulfate DMGT DNA-mediated gene transfer DMSO Dimethylsulfoxide dNTP Deoxynucleotide triphosphate DR Direct repeat EDTA Ethylenediamietetraacetic acid ER Oestrogen receptor or everted repeat EST Expressed sequence tag FBS Foetal bovine serum FXR Famesoid X-activated receptor GR Glucocorticoid receptor HBS HEPES buffered saline HEPES iV-2-hydroxy-ethylpiperazine-iV -2-ethanesulfonic acid HFLa-SE Human foetal liver specific element HNF-4 Hepatic nuclear factor hPXR Human pregnane X receptor HRE Hormone responsive element

IV hsp90 Heat-shock protein 90 IP Inverted palindrome LB Luria bertaini medium LBD Ligand binding domain LCA Lithocholic acid LPS Lipopolysaccharide LXR Liver X-activated receptor MEM Minimum essential medium MIF Mifepristone MRP2 Multi-drug resistance-associated protein 2 NADH Nicotinamide adenine dinucleotide (reduced) NADPH Nicotinamide adenine dinucleotide phosphate (reduced) NcoR Nuclear receptor co-repressor proteins NFSE Nifedipine specific element NR Nuclear receptor

OCT-1 octamer 1 PAH Polycyclic aromatic hydrocarbon Pal Palindromes PB Phénobarbital PBS Phosphate buffered saline PCN Pregnenolone 16a-carbonitrile PCR Polymerase chain reaction PP Peroxisome proliferators PPAR Peroxisome proliferator activated receptor PPRE Peroxisome proliferator response element PR Progesterone receptor RXRa Retinoid X receptor a RAR Retinoid acid receptor RIF Rifampicin RXR Retinoid X receptor SEAP Secreted alkaline phosphatase SEM Standard error of mean SF-1 Steroidogenic factor 1

V SMRT Silencing mediator of retinoid and thyroid receptors SNP Nucleotide polymorphisms SPl specificity protein SPAP Secreted placental alkaline phosphatase SRC Steroid receptor co-activator SSCP Single strand conformation polymorphism SXR Steroid and xenobiotic receptor SWl/SNF Switch/sucrose non-fermentable TAD Transactivating domain TAB Tris acetate EDTA buffer TBE Tris borate EDTA buffer TCDD Tetrachlorodibenzo-p-dioxin TE Tris EDTA buffer TEMED Tetramethylethylenediamine TIE Transcription intermediary factor TR Thyroid receptor

USFl upstream stimulatory factor 1 XRE Xenobiotic response element XREM Xenobiotic responsive enhancer module

YYl ying yang 1

VI TABLE OF CONTENTS

CHAPTER ONE: INTRODUCTION...... 1 1.1 Drug metabolism ...... 1 1.2 Role and mechanism of action of cytochrome P450 enzymes in drug metabolism ...... 7 1.3 The Cytochrome P450 isoenzyme snperfamily ...... 10 1.3.1 Subcellular localisation of cytochrome P450 ...... 12 1.3.2 Nomenclature and categorisation of P450 genes or enzymes ...... 12 1.3.3 Cytochrome P450 gene families...... 13 1.3.4 Species differences in xenobiotic metabolism ...... 16 1.3.5 Regulation of cytochrome P450 gene expression ...... 17 1.3.5.1 Transcriptional regulation ...... 18 1.3.5.2 Post-transcriptional regulation ...... 22 1.3.5.3 Post-translational regulation ...... 22 1.4 The CYP3A subfamily ...... 23 1.4.1 Hepatic CYP3A enzymes ...... 23 1.4.2 Expression of CYP3A enzymes in other tissues ...... 26 1.4.3 The Human CYP3A4 enzyme ...... 27 1.4.4 CYP3A xenobiotic substrates in humans nuclear receptors ...... 29 1.4.5 CYP3A gene structure in humans ...... 32 1.5 Control of gene expression by nuclear receptors ...... 36 1.5.1 Role of the ‘hormone’ receptors ...... 36 1.5.2 Stmcture of the nuclear receptors ...... 39 1.5.3 Categories of nuclear receptors ...... 43 1.5.4 Regulation of cytochrome P450 expression by nuclear receptors ...... 43 1.5.5 Nomenclature of nuclear receptors...... 46 1.6 Co-activators and co-repressors of gene expression ...... 46 1.6.1 Role of co-activators and co-repressors ...... 46 1.6.2 Activation of co-activators and co-repressors ...... 47 1.7 Nuclear receptor activation and CYP3A regulation ...... 49 1.7.1 PXR and its role in species-specific induction of CYP3A ...... 50 1.7.2 Roles of CAR and GR in induction of CYP3A ...... 56

VII 1.8 Polymorphic cytochrome P450 genes...... 59 1.8.1 Polymorphic variations in the cytochrome P450 genes ...... 62 1.8.1.1 Human cytochrome P450 allele nomenclature ...... 62 1.8.1.2 Cytochrome P450 alleles producing inactive enzymes ...... 63 1.8.1.3 Cytochrome P450 alleles producing diminished or altered metabolism .. 65 1.8.1.4 Cytochrome P450 alleles producing ultra-rapid metabolism ...... 65

1.8.2 Polymorphism in the CYP3A locus ...... 6 6

1.8.3 Cytochrome P450 polymorphism and neoplastic disease ...... 6 8 1.9 Concluding rem arks ...... 70 1.10 Aims and objectives of this project ...... 70

CHAPTER TW O: MATERIALS AND METHODS...... 72 2.1 M aterials...... 72 2.1.1 Chemicals and reagents ...... 72 2.1.2 Enzymes and DNA M arkers ...... 72 2.1.3 K its...... 72 2.1.4 PCR prim ers...... 73 2.1.5 Human cell culture reagents ...... 73 2.1.6 Instrumentation ...... 75 2.1.7 Bacteria and Plasmids ...... 75 2.1.8 Subject recruitment ...... 75 2.1.9 Blood sample preparation ...... 75 2.2 Molecular biology ...... 81 2.2.1 DNA extractions...... 81 2.2.1.1 Genomic DNA extraction ...... 81 2.2.1.2 Miniprep plasmid DNA extraction and purification ...... 83 2.2.1.3 Endotoxin-free Maxi Prep DNA purification ...... 84

2.2.1.4 UltraClean™ 15 DNA Purification kit from gels and solutions ...... 8 6

2.2.1.5 Purification of PCR products using QIAquick PCR Purification Kit 8 6 2.2.2 Agarose gel electrophoresis of DN A...... 87

2.2.3 Restriction enzyme digestion of DN A ...... 8 8 2.2.4 Polymerase chain reaction (PCR) ...... 89 2.2.4.1 Primer design ...... 89 2.2.4.2 PCR optimisations ...... 90

VIII 2.2.43 PCR amplification of the 5' regulatory and coding regions of the CPPM4 gene...... 90 2.2.4.4 Long-range PCR...... 94 2.2.5 Single strand conformation polymorphism (SSCP) ...... 96 2.2.5.1 Polyacrylamide gel electrophoresis...... 97 2.2.52 Gel staining with SYBR® Gold ...... 100 2.2.6 DNA sequencing ...... 100 2.3 Recombinant DNA technology ...... 101 2.3.1 Sterilisation by autoclaving ...... 101 2.3.2 Preparation of bacterial stock cultures ...... 101 2.3.3 Growth of bacterial cultures ...... 101 2.3.4 Ligation of DNA inserts into pSEAP2-Basic plasmid vector ...... 102 2.3.5 Transformation of recombinant plasmid DNA into bacteria ...... 103 2.3.6 Cloning of the CYP3A4 proximal and distal promoter regions ...... 104 2.4 Human cell culture methods...... 105 2.4.1 Cell passage...... 105 2.4.2 Storage of cells in liquid nitrogen ...... 105 2.4.3 Recovery of cells from liquid nitrogen ...... 106 2.4.4 Transfection with plasmid DNA ...... 106 2.4.4.1 Calcium Phosphate method ...... 106

2.4.4.2 Transfection with FuGENE 6 reagent {Roche Biochemicals)...... 107 2.4.6 Chemiluminescence assay of secreted alkaline phosphatase activity ...... 108 2.4.7 Definition of relative light units and gain settins in sample measurements.... 109

CHAPTER THREE: MUTATION ANALYSIS OF THE HUMAN CYP3A4 GENE 5 REGULATORY REGION...... I ll 3.1 Introduction...... I ll 3.2 Human genomic DNA extraction ...... 112 3.3 PCR amplification of the CYP3A4 proximal and distal 5'regulatory regions ...... 114 3.4 Non-radioactive single strand conformation polymorphism (Cold-SSCP) analysis of the CYP3A4 5'regulatory regions ...... 119 3.5 DNA sequencing of the variant PCR products ...... 123 3.6 Linkage analysis of mutations in sample M -42 ...... 132

IX 3.7 Discussion ...... 137

CHAPTER FOUR; EFFECTS ON GENE TRANSCRIPTION OF MUTATIONS IN THE HUMAN CYP3A4 GENE PROMOTER REGION .. .141 4.1 Introduction ...... 141 4.2 Cloning of the CYP3A4 XREM region into the pSEAP2-hasic vector ...... 142 4.3 Cloning of the CYP3A4 proximal promoter region into the pX-SEAP2 vector...... 149 4.4. Functional analysis in vitro of the CYP3A4 promoter mutations ...... 162 4.4.1 Initial transfection experiments: Calcium phosphate precipitation method ... 162

4.4.2 Characterisation of the FuGENE 6 transfection method ...... 163 4.4.3 Lumicount™ (Packard) plate reader function ...... 167 4.4.4 Time from seeding the cells until transfection ...... 169 4.4.5 Concentration of CYP3A4 inducers ...... 171 4.5 In vitro responses of mutant CYP3A4 promoters to xenobiotic inducers ... 173 4.5.1 Activation of pXP-SEAP2 reporter gene constructs in HepG2 cells ...... 173 4.5.2 Activation of pXP-SEAP2 reporter gene constructs in HuH7 cells ...... 175 4.5.3 Activation of pXP-SEAP2 reporter gene constructs in Caco-2 cell lin e ...... 177 4.6 Discussion ...... 179

CHAPTER FIVE; FINAL DISCUSSION AND CONCLUSIONS...... 182 5.1 Introduction ...... 182 5.2 Mutation detection: a non-radioactive (cold) SSCP approach ...... 183 5.3 Effects of the CYP3A4 gene variation on enzyme activity ...... 184 5.4 Transcriptional regulation of CYP3A4 gene expression: basal expression versus xenobiotic modulation ...... 190 5.5 Genetic variation in the PXR gene ...... 192 5.6 Conclusions ...... 193 5.7 Future w o rk ...... 194

BIBLIOGRAPHY 196

APPENDIX I: SOLUTIONS, MEDIA AND BUFFERS...... 226

APPENDIX II: COMMUNICATIONS AND PUBLICATIONS...... 228

X CHAPTER ONE

INTRODUCTION

One of the most challenging research areas in pharmacotherapy is to understand why individuals respond differently to drugs and to what extent individual variability in drug metabolism is responsible for observed differences in therapeutic efficacy and adverse reactions. Understanding such variation at the molecular level would be very valuable because it would allow provision of more specific therapies to meet the specific needs of the individual (Lu, 1998).

Inter-individual variations in the oxidative metabolism of many drugs have been identified and are due in part to polymorphism in the cytochrome P450 enzymes. These polymorphisms invariably contain a strong genetic component and, in addition to predisposing individuals to potential drug toxicities or inefficiencies, may also contribute to the influence of host factors in carcinogenesis, since the P450s are involved in the biotransformation of a variety of environmental pollutants, pesticides, and cancer-causing agents (Guengerich et al, 1986).

1.1 Drug metabolism All organisms are exposed constantly and unavoidably to foreign chemicals (xenobiotics) which include both man-made and natural chemicals, e.g. drugs, industrial chemicals, pesticides, pollutants, chemical products in cooked food, alkaloids, secondary plant metabolites, and toxins produced by moulds, plants and animals (Correia, 1998). Pharmacologically active organic molecules including drugs tend to be lipophilic and remain non-ionised or only partially ionised at physiological pH and often bind strongly to plasma proteins. Such substances are not readily filtered in the renal glomerulus. The lipophilic nature of the renal tubular membrane also facilitates the reabsorption of hydrophobic compounds following their glomerular filtration. Consequently, most drugs would have a prolonged duration of action if termination of effects dependent solely on renal excretion. An alternative process that may lead to the termination of biological activity is metabolism (Correia, 1998). The enzymes involved in the metabolism processes are of considerable current interest in pharmaceutical discovery, development and in environmental health (Guengerich, 2000). An exception to this general rule is the elimination of volatile compounds by exhalation, in which case metabolism to non-volatile, water- soluble chemicals can retard their rate of elimination (Klaassen, 1996).

In general lipophilic xenobiotics are transformed (via metabolism) to more polar and hence more readily excretable products. Metabolic products are often less pharmacodynamically active than the parent drug and may even be inactive. However, some biotransformation products have enhanced activity or even toxic properties including mutagenicity, teratogenicity and carcinogenicity. Most metabolic biotransformations occur at some point between absorption and its renal elimination (Correia, 1998). A few transformations occur in the intestinal lumen or intestinal wall (Gibson et al, 1999). In general all of these reactions can be assigned to one of the two major categories of metabolism called phase I and phase II reactions (Correia, 1998).

Phase I reactions (Table 1.1) usually convert the parent drug to a more polar metabolite by introducing or unmasking a functional group (-OH, -NH 2 , -SH). Often these metabolites are inactive, though in some instances activity is only modified. If phase I metabolites are sufficiently polar, they may be readily excreted. However, many phase I products are not eliminated rapidly and undergo a subsequent reaction in which an endogenous substrate such as glucuronic acid, sulfuric acid, an amino acid or glutathione combines with the newly established functional group to form a highly polar conjugate. Such conjugation or synthetic reactions are hallmarks of phase II metabolism (Table 1.2). A great variety of drugs undergo these sequential biotransformation reactions, although in some instances the parent drug may already possess a functional group that may form a conjugate directly. This conjugate may be either eliminated or undergo a phase I type reaction (Correia, 1998; Gibson et al, 1999).

A further phase of metabolism, phase III, has also been proposed by some workers (Gibson and Skett, 1994) which involves the processing of glutathione conjugates. Subsequent to glutathione conjugation, a glutamyltranspeptidase can metabolise the Table 1.1 Phase I reactions of drug metabolism (adapted from Correia, 1998)

Reaction class Structural change Drug substrates Oxidations R R i) Cytochrome P450- dependent oxidations; Acetanilide, amphetamine, benzopyrene, Ô—0 17a-ethinylestradiol, naphthalene, Aromatic hydroxylations phénobarbital, phenylbutazone, phenytoin, propranolol, warfarin. Ù

RCH2 CH3 RCH2 CH2 OH Amobarbital, chlorpropamide, digitoxin, glutethimide, ibuprofen, meprobamate, Aliphatic hydroxylations RCH2 CH3 RCHCH3 pentobarbital, phenylbutazone, OH secobarbital

Epoxidation RCH=CHR-> R-C-C-R Aldrin

Oxidative dealkylation Aminopyrine, benzphetamine, caffeine, N-dealkylation RNHCH3 -^RN H 2 + CH2 O ethylmorphine, morphine, theophylline

0 -dealkylation ROCH3 -^ROH + CH2 O Codeine, p-nitroanisole

S-dealkylation RSCH3-^RSH + CH 2 0 6 -methylthiopurine, methitural

N-oxidation RNH 2 - ^ R N H 0 H Aniline, chlorphentermine Primary amines

Secondary amines ^NH pNGH 2 -acethylaminofluorene, paracetamol Ri R2 Ri Ri Tertiary amines Ri^N “> Ri—N^O Methaqualene, nicotine R3 Rs^ Ri Ri S-oxidation ^ 8 = 0 Chlorpromazine, cimetidine, thioridazine R2 R% OH Amphetamine, diazepam Deamination RCCH3 R-C-CH3 R-CCH3 +NH3

NH2 NH2 0 R. R, Désulfuration pc=s -»■ pc=o R2 R2 Thiopental, parathion \ R, / P = s P= 0 Rz ^ 2

Dechlorination CCI4 [CCI3I CHCI3 Carbon tetrachloride Table 1.1 Phase I reactions of drug metabolism (Continued)

ii) Cytochrome P450- independent oxidations: R3N R3N+O + H+ R3N+OH Amitriptyline, benzphetamine, Flavin monooxygenase chlorpromazine (Ziegler’s enzyme)

RCHzN-CHzR'-^RCHzN-CHzR' H OH Desipramine, nortriptyline

-> RCH=N^-CH2R' 0 “

Amine oxidses RCH2NH2 ^ RCHO + NH3 Adrenaline, phenylethylamine Dehydrogenations RCH2OH RCHO Ethanol Reductions Azo reductions RN=NR'-> RHN-NHR'-^RNH2+ R'NH2 Prontosil, tartrazine

Nitro reductions RNO2 - > RNO RNHOH-^ Chloramphenicol, clorazepam, RNH2 dantrolene, nitrobebzene RCR'-^RCHR' Methadone, metyropane, Carbonyl reductions II 1 0 OH naloxone Hydrolysis RCOOR' RCOOH + R'20H Aspirin, clofibrate, procaine, Esters methylphenidate, succinycholine Amides RCONHR' RCOOH + R'NH2 Indomethacin, lidocaine, procainamide Table 1.2 Phase II reactions of drug metabolism (adapted from Correia, 1998)

Type of Endogenous Transferase Types of Examples Conjugation reactant (location) substrates Diazepam, digitoxin, Glucuronidation UDP glucuronosyl Alcohols, digoxin, meproabamte, UDP glucuronic transferase carboxylic acids, morphine, acid (microsomes) hydroxylamines, N-hydroxydapsone, sulfonamides nitrophenol, paracetamol sulfathiazole N-acetyl transferase Clonazepam, dapson, Acétylation Acetyl-CoA (cytosol) Amines isoniazid, mescaline, sulfonamides Arene oxides, Glutathione Glutathione GSH-S-transferase epoxides, Bromobenzene. conjugation (cytosol, microsomes) hydroxylamines, ethacrinic acid nitro groups Acyl-CoA Benzoic acid, cholic acid, Acyl-CoA glycine Glycine Glycine derivatives of cinnamic acid, deoxy- transferase conjugation carboxylic acids cholic acid, nicotinic acid, (mitochondria) salicylic acid Alcohols, Aniline, estrone, Sulphate Phosphoadenosyl Sulphotransferase aromatic amines, 3-hydroxy-coumarine, conjugation phophosulphate (cytosol) phenols methyldopa Amines, Adrenaline, dopamine, S-Adenosyl- Transmethylases Méthylation catecholamines, histamine, pyridine, mthionine (cytosol) phenols thiouracil Arene oxides, cis- Benzopyrene 7,8-epoxide, Water Epoxide hydrolase distributed and carbamazepine epoxide, conjugation Water (microsomes) monosubstituted styrene 1 ,2 -oxide oxiranes Alkene oxides, (cytosol) fatty acid- Leukotriene A4 epoxides conjugate yielding the cysteine conjugate of the xenobiotic which can then be N-acetylated to N-acetylcysteine or mercapturic acid conjugates. Depending on the substrate and species involved the glycylcysteine, cysteine or mercapturic acid conjugates may occur as excretion products. Sulphur-containing conjugates can also be further metabolised by C-S lyase (or cysteine conjugate (3-lyase).

It should be noted that the dose and the frequency of administration of a drug required to achieve effective therapeutic blood and tissue levels in different patients will vary because of individual differences in drug distribution and rates of drug metabolism and elimination. These differences are determined by genetic factors and non-genetic variables such as age, sex, liver function, circadian rhythm, body temperature, nutrition and environmental factors such as concomitant exposure to inducers or inhibitors of drug metabolism (Correia, 1998).

The major organ of drug metabolism is the liver. In some cases extrahepaic tissues, frequently the sites of absorption or excretion (e.g. the gastrointestinal mucosa, lung or kidney), are also important in the metabolism of xenobiotics (Correia, 1998). Cytochrome P450 enzymes play the central role in xenochemical metabolism, as members of the haem-thiolate monooxygenase gene superfamily. By increasing the capability for metabolic detoxification and elimination, induction of cytochrome P450 is an integral part of the defence mechanism against xenobiotics (Sueyoshi and Negishi, 2001).

A change in pharmacokinetic behaviour is not the only consequence of xenobiotic metabolism nor, in some cases, is it the most important outcome. In many instances, chemical modification of a xenobiotic by metabolism alters its biological effects. The importance of this principle to pharmacology is that some drugs must undergo metabolism to exert their pharmacological effect. The importance of this principle to toxicology is that many xenobiotics must undergo metabolism to exert their characteristic toxic or tumorigenic effect (i.e. the metabolite is more toxic than the parent compound). In most cases, however, metabolism terminates the pharmacological effects of a drug and lessens the toxicity of xenobiotics (Paolini etal, 1999). 1.2 Role and mechanism of action of cytochrome P450 enzymes in drug metabolism

Cytochrome P450 enzymes are important in the oxidative, peroxidative and reductive metabolism of numerous and diverse endogenous compounds as well as a wide range of man-made xenobiotics including drugs, environmental chemicals and pollutants. The original name cytochrome P450 represents a hangover (related to its absorbance at 450 nm) from the time when the protein was first given its name by Omura and Sato in 1964. These proteins are not, in fact, cytochromes in the true sense of the word. The Nomenclature Conunittee of the International Union of Biochemistry and Molecular Biology (NC-IUBMB) prefers the term “ haem-thiolate protein” instead of cytochrome for these enzymes (Nelson et al, 1996).

The cytochrome P450 enzyme system consists of three essential components.

(1) Cytochrome P450 as the terminal oxidase component of the system that is classified as a haemoprotein with iron protoporphyrin DC as the prosthetic group (Gibson and Skett, 1996). The active site of cytochrome P450 contains an iron protoporphyrin IX moiety in a large, relatively open hydrophobic cleft or depression in the surface of the apoprotein. The haem is bound, apparently somewhat loosely, by a combination of hydrophobic forces, coulombic attractions, and one or two coordinate-covalent bonds to the central metal iron (White and Coon, 1980).

(2) NADPH-cytochrome P450 reductase that is a flavoprotein responsible for transferring reducing equivalents from NADPH+H^ to cytochrome P450. It exists in close association with cytochrome P450 in the endoplasmic reticulum membrane.

(3) Phospholipids, mainly phosphatidyl choline that embeds the other two components and may be required for substrate binding, facilitation of electron transfer or providing a "template" for the interaction of cytochrome P450 and NADPH-cytochrome P450 reductase molecules (Gibson and Skett, 1996). Primarily, cytochrome P450 functions as a mono-oxygenase by catalysing the cleavage of molecular dioxygen and subsequent insertion of a single oxygen atom into the substrate, with concomitant production of a water molecule. The overall catalytic process of mono-oxygenation of substrate (RH) can be represented as below, where it can be seen that the input of two reducing equivalents is required:

2H^, 2 e “ RH + O2 ------> ROH + H2O (substrate) P450 (metabolite)

The source of the reducing equivalents (2fT^, 2e~) is either NADPH or NADH and the transfer is mediated by a flavoprotein and, in some cases by an iron-sulfur redoxin (Lewis and Pratt, 1998]. Microsomal drug oxidations require cytochrome P450, cytochrome P450 reductase, NADPH and molecular oxygen. Catalytic mechanism of cytochrome P450 3A4 is presented in Figure 1.1 as an example from a general paradigm. What is not particularly clear is what steps are rate-limiting in various reactions (Guengerich, 1999 and references therein).

Step [1] is a relatively well characterised and involves drug binding to the oxidised (Fe^"^) form of cytochrome P450 to form a substrate-cytochrome P450 complex. Step [2] involves the first electron reduction of substrate-bound ferric cytochrome P450 to the ferrous form (Fe^"^) of the haemoprotein. The reducing equivalent necessary for this reduction is originally derived from NADPH-bH^ and is transferred by the flavoprotein, NADPH-cytochrome P450 reductase. Step [3] involves the binding of molecular oxygen to the binary ferrous cytochrome P450-substrate adduct. Steps [4-9] involve putative electron rearrangement, introduction of the second electron and subsequent oxygen insertion and product release. The precise oxidation states of iron and oxygen in these intermediates are not exactly known (Gibson and Skett, 1996). However, it can be briefly explained that a second electron introduced from NADPH via the same flavoprotein reductase, serves to reduce molecular oxygen and forms an “activated oxygen-cytochrome P450-substrate” complex. This complex in turn transfers “activated” oxygen to the drug substrate to form the oxidised product. The potent oxidising properties of this activated oxygen permit oxidation of a large number of substrates. Substrate specificity is very low for this enzyme complex. ROH 3+

NADPH-P450 reductase''®'^

FeROH NADPH-P450 reductase®^

Fe'^-Oi RH

Fe-OOH RH

NADPH-P450 reductase'^®'^ NADPH-P450 reductase®^

Figure 1.1 Catalytic cycle of the cytochrome P450 (adapted from Guengerich,

1999). RH: drug, e: electron, bs'. cytochrome and ROH: oxidised drug 1.3 The Cytochrome P450 isoenzyme superfamily Cytochrome P450s are classified as haem-containing enzymes (haemoprotein) with iron protoporphyrin IX as the prosthetic group present in prokaryotes and eukaryotes. These enzymes are members of a family of closely related isoenzymes. In eukaryotes they are embedded in the membrane of the endoplasmic reticulum and exist in multiple forms of monomeric molecular weight of approximately 45000-55000 Daltons. The haem is non-covalently bound to the apoprotein and the name cytochrome P450 is derived from the fact that the cytochrome (or pigment) exhibits a spectral absorbance maximum at 450 nm when reduced and complexed with carbon monoxide. The concept of cytochrome P450 multiplicity has now been firmly established and has had a profound influence on drug metabolism studies. This was initially discovered following the development of techniques enabling the cytochrome P450 isoenzymes to be solublised and purified from liver endoplasmic reticulum fragments such that structural and functional comparisons of highly purified cytochrome P450 preparations could be assessed (Gibson et al, 1999).

Over the past fifteen years gene cloning and the elucidation of P450 sequences have resulted in a dramatic increase in known P450 isoenzymes. Currently, the number of P450s known from cDNA and other sequencing procedures has been reported to be about 1200 or more (Lewis and Sheridan, 2001). The classification of P450 enzymes into families and subfamilies based on amino acid sequence comparison has proved to be useful for the construction of phylogenetic trees and for other forms of analysis that study evolutionary relationships between genes. The basis of assignment for individual P450s into families and subfamilies requires a primary amino acid sequence homology of >59% for P450s being placed within the same gene family, whereas P450s within the same subfamily should be -70% similar. Orthologous P450 genes generally exhibit similarities of between 71% and 80%, and it is found that one gene family is usually <36% similar to P450s in other families (Lewis et al, 1998).

In any one mammalian species up to 60 isoforms of cytochrome P450 may be present, representing the majority of the 18 mammalian CYP gene families (http://dmelson.utmem.edu/famcount.html). This number is rising steadily with the

10 completion of the various genome-sequencing projects (Nelson, 1999). On the basis of crystal structures of mainly bacterial P450s, molecular modelling and site directed mutagenesis, the overall structure of manunalian membrane-bound P450 has been deduced and residues required for substrate binding, electron transfer and haem binding have been identified (Honkakoski and Negishi, 2000).

There is a conserved structural fold among cytochrome P450s even though the amino acid sequence identity among proteins may be less than 20% and with only 3 absolutely conserved amino acids across the superfamily (Hasemann et al, 1995). Within the structural fold there appears to be a highly conserved core, as determined from the comparison of the structures of the six crystallised, soluble cytochrome P450s. However, while the cytochrome P450 structural fold is the same for all determined structures, they have enough diversity in the primary, secondary and tertiary sequences to accommodate specific substrates. Structural diversity also is important regarding redox partners and additionally to the cellular location of the protein (e.g. whether soluble or membrane associated, mitochondrial or microsomal) (Graham and Peterson, 1999).

All cytochrome P450s sequenced to date exhibit a so-called ‘P450 signature m otif of

1 0 amino acid residues, which includes the invariant cysteine residue that ligates the haem iron. This generally takes the form: FxxGxxxCxG where F is phenylalanine, G is glycine, C is cysteine and x is any amino acid. The occurrence of this signature sequence is indicative of haem-thiolate proteins of the cytochrome P450 superfamily and no other protein sequence have been found which display this motif, and it is probably essential for haem-binding proteins that possess cytochrome P450-like catalytic activity (Lewis et al, 1998).

An evaluation of the mechanism for the metabolic clearance of 315 different drugs revealed that 56% of them were primarily cleared through the action of the cytochrome P450 enzymes. CYP3A4 was by far the most important isoenzyme (50%) followed by CYP2D6 (20%), CYP2C9 and CYP2C19 (15%), and the remaining metabolism carried out by CYP2E1, CYP2A6, CYP1A2 and other cytochrome P450s (Bertz and Granneman, 1997). All of these enzymes are inducible except CYP2D6 (Ingelman-Sundberg et al, 1999).

11 1.3.1 Subcellular localisation of cytochrome P450s The cytochrome P450 enzyme system is found in the membranes of certain organelles in the cell. The most important and most abundant of them are embedded in the lipophilic membrane of the endoplasmic reticulum (Gibson and Skett, 1996). High solubility in lipids is the only common structural feature of the wide variety of structurally unrelated drugs and chemicals that serve as substrates in this system. All the electron transport components of the liver microsomal P450 system are localised toward the cytoplasmic side of the endoplasmic reticulum. This provides rapid recovery of the oxidised flavoproteins recruited in the metabolic reactions (Ortiz de Montellano, 1995).

This enzyme system also is present in mitochondria (Wang et al, 2000). All steroidogenic organs and some non-steroidogenic organs including liver and kidney contain cytochrome P450 in mitochondria, and mitochondrial cytochrome P450s are distinct from their microsomal counterparts in the same cell. Mitochondrial cytochrome P450s are involved in the metabolism of steroids and related physiological substrates, e.g. vitamin Dg, and in contrast with many microsomal types of cytochrome P450, they do not have significant activities towards xenobiotic compounds. These enzymes are bound to the inner membrane and receive electrons from NADPH in the matrix (Schenkman and Greim, 1993).

1.3.2 Nomenclature and categorisation of P450 genes or enzymes The system of classification is based on percentage amino acid sequence similarity between cytochrome P450s and, therefore, facilitates the construction of a phylogenetic tree for the enzyme superfamily which can be related to the development of biological species over time on the basis of the specific mutation rates for the cytochrome P450 genes (Lewis and Sheridan, 2001). This categorisation and nomenclature system results in their classification into gene families and gene subfamilies. A cytochrome P450 sequence from one gene family is defined as usually having less than 40% resemblance to that from any other family. In other words, members of different families exhibit 40% or less amino acid sequence similarity whilst members within families show more than 40% amino acid sequence similarity. Any two cytochrome P450 proteins belong to the same gene subfamily, if

12 they have approximately 70% (or greater) similarity in their sequence (Nelson et al, 1993).

The recommendation for naming a P450 gene includes the italicised root symbol CYP (Cyp for the mouse and Drosophilia), denoting cytochrome P450, an Arabic number designating the P450 family, a letter indicating the subfamily when two or more subfamilies are known to exist within that family, and an Arabic numeral representing the individual gene (e.g. CYP1A2). The same letters and numbers are recommended for the corresponding gene products (mRNA, cDNA and enzyme): non-italicised and all capital letters (e.g. CYP1A2) in all species including mouse and Drosophilia (Nelson et al, 1996).

Currently, there are about 265 families and the number is growing with time. The large number of families is beginning to make the nomenclature cumbersome. One way to alleviate some of this is to recognise that the families naturally group into higher order clusters (‘clans’). Naming these clusters would automatically reduce the need to keep abreast of all the P450 families. Nelson began the process of naming consistent clusters of P450 in 1999 (http://dmelson.utmem.edu/famcount.html).

1.3.3 Cytochrome P450 gene families Over 1200 individual cytochrome P450s have had their protein sequences defined to date (Lewis & Sheridan, 2001). Of 265 gene families so far described, 75 families belong to bacteria (CYP101-CYP174+CYP51), 72 families belong to lower eukaryotes (CYP51-CYP69 + CYP501-526), 52 families belong to plants (CYP71-99 + CYP701-726 + CYP51 minus four discontinued family names CYP91, CYP95, CYP713, and CYP717), and 69 families belong to animals [{CYP1-CYP49 minus two discontinued/not used CYP16 and CYP40) + CYP301-CYP320 + CYP51]. CYP51 is present in all four groups so it is counted four times. Full details have not been published but are available at the Nelson’s laboratory website (http.V/dmelson.utmem. edu/famcount.html).

In mammals, CYPl, CYP2 and CYP3 appear to be primarily associated with the metabolism of exogenous compounds, although they are able to metabolise some

13 endogenous chemicals such as steroids (Waxman, 1988). In contrast, members of the other cytochrome P450 families, especially those in manunalians, have been shown to possess specific metabolic functions. For example, some enzymes of the CYP4 family are responsible for the end-chain hydroxylation of long-chain fatty acids, whereas some others are associated with the co-hydroxylation of certain prostaglandins and leukotrienes (Harder et al, 1995). Cytochrome P450s belonging to gene families 5 and 8 A are involved in thromboxane and prostacyclin synthesis (Lewis and Lake, 1996). Cytochrome P450s from families 11,17,19, and 21 are required for steroid hormone biosynthesis (Nelson et al, 1996). Cytochrome P450s from families 7, 8 B, 24, 27, 46, and 51 catalyse reactions in the pathways leading to the biosynthesis of bile acid, vitamin Dg and cholesterol and CYP26 is involved in retinoid metabolism, a step that may be important during development (Nelson, 1999). These cytochrome P450s usually have selective substrate specificities and they are subject to tight tissue-specific and hormone-dependent regulation (Honkakoski and Negishi, 2000). The nomenclature of cytochrome P450 families involved in the biosynthesis of steroid hormones is derived from the various positions in the steroid nucleus where metabolism occurs (CYP7, CY Pll, CYP17, CYP19 and CYP21) (Lewis and Lake, 1996).

The involvement of individual cytochrome P450s in the metabolism of a given drug may be screened in vitro by means of selective functional makers, selective chemical inhibitors and antibodies. In vivo, such screening may be accomplished by means of relatively selective non-invasive markers, which include breath tests or urinary analyses of specific metabolites after administration of a cytochrome P450-selective substrate probe (Correia, 1998). However, most of these marker drugs are not truly non-invasive and sometimes are too complex or expensive for widespread use, and many available probes lack desired safety and/or sensitivity. For example, study of midazolam metabolism usually requires intravenous administration and preparation of several blood samples, and erythromycin breath test uses [^"^C]N-methyl- erythromycin (Streetman et al, 2000). Important human GYP isoenzymes in families 1-3 are shown in table 1.3 with substrates (drugs), inducers and drugs used for metabolic screening (non-invasive markers).

14 Table 1.3 Some important human liver drug metabolising CYPs (adapted from Correia, 1998)

Non-invasive CYP Substrates Inducers markers 1A2 Antipyrine Paracetamol Theophylline Smoking, charcoal- Caffeine Phenacetin Warfarin boded foods, Cruc­ Caffeine Clomipramine Tamoxifen iferous vegetables 2A6 Coumarin None Coumarin Hexobarbital Phenytoin Trimethadione Barbiturates 2C9 Mephenytoin Ibuprofen Tolbutamide S-Warfarin Rifampicin Diazepam Naproxen Propranolol 2C19 None Omeprazole ^'-Mephenytoin Omeprazole Amitriptyline Guanoxan Paroxetine 2D6 Clomipramine Haloperidol Phenformin None Debrisoquine Clonazepam Hydrocodone Propafenone Dextrometorphan Codeine Imipramine Propoxyphene Debrisoquine 4-methoxyam- Selegilene Desipramine phetamine Sparteine Dextrometorphan Metoprolol Thioridazine Encainide Mexiletine Timolol Flecainide Nortriptyline Fluoxetine Oxycodone 2E1 Chlorzoxazone Ethanol (minor) Paracetamol * Chlorzoxazone Enflurane Halothane Alfentanil Felodipine Quinidine 3A4 Amiodarone Gestodene Rapamycin Barbiturates Erythromycin Astemizole Lidocaine Sufentanil Glucocorticoids Midazolam Cocaine Lovastatin Sulfamethoxazole Macrolid antibiotics Cortisol Miconazole Tacrolimus Rifampicin Cyclosporine Midazolam Tamoxifen Dapsone Nifedipine Terfenadine Diazepam Niludipine Testosterone Dihydroergotamine Nitendipine Triazolam Diltiazem Paclitaxel Troleandomycin Erytheromycin Paracetamol Verapamil Ethinyl estradiol Progestrone

* 2E1 is induced by diabetes, starvation, ethanol, acetone, pyrazole, isoniazid and dimethylsulfoxide (Honkakoski and Negishi, 2000).

15 1.3.4 Species differences in xenobiotic metabolism Although a substantial number of both endogenous and exogenous P450 substrates are metabolised in a similar fashion by mammalian species, there are also examples where differences occur which may be due to either the same chemical being metabolised by different isoforms or by orthologous cytochrome P450s within the same family/subfamily (Lewis et al, 1998). For example, phénobarbital treatment increases the toxicity of paracetamol in rat and mouse, but decreases the toxicity of this chemical in the hamster (Boobis et al, 1990). Apparently, this is due to an increase in the detoxifying glucuronidation pathway in hamster as opposed to the cytochrome P450-mediated activation which is predominant in the mouse and rat. There is also a marked difference between the metabolism of coumarin in rat and mouse which results in activation in the rat {via 3-hydroxylation), but detoxification in the mouse involving the 7-hydroxylation pathway (Lewis and Lake, 1995). It is hkely that this is due to the variation between CYP2A orthologues in the rodent species.

There is, moreover, an interesting species difference between cytochrome P450 complements in New and Old World primates, which may well be explained in terms of continental drift and changing habitat. Apparently, New World monkeys possess relatively high levels of CYP1A2 but virtually no CYP2A, whereas the opposite is found for Old World primates. Homo sapiens would appear to represent a combination of each type of primate species as both CYP1A2 and CYP2A6 are constitutively expressed in human liver (Lewis and Lake, 1996).

As far as the CYP2B subfamily is concerned, there are species differences in the sterio-selectivity of steroid metabolism (Oguri et al, 1994). For example, both rat and dog CYP2B orthologues hydroxylate androgens in the 16a and 16p positions, whereas the guinea pig and monkey orthologues hydroxylate solely at the 16p position and the rabbit form exhibits 16a-hydroxylation primarily. This is likely to be due to subtle differences in amino acid residues in the enzyme active sites, as it has been demonstrated that site-directed mutagenesis at two positions can alter the stereoselectivity of CYP2B1 (Aoyama etal, 1989).

16 The CYP2C subfamily also shows marked variation in regio- and stereoselectivity of steroid metabolism between different species and also exhibits differences between CYP2C-mediated testosterone metabolism for male and female, which can be ascribed to gender-specific isoforms (reviewed in Lewis and Lake, 1996). In the CYP2D subfamily, there are also species variations in substrate metabolism. For example, unlike rat and human CYP2D enzymes, none of the mouse CYP2D orthologues is able to metabolise debrisoquine, but mouse CYP2D9 can carry out 16a-hydroxylation of testosterone, which is metabolised in the 6p position by both rat and human CYP2D isoforms (Funae and Imaoka, 1993). Furthermore, there are species differences in metabolic pathways carried out by the CYP2E subfamily enzymes (Duescher and Elfarra, 1994) which, as with other examples mentioned previously, suggest that considerable care must be exercised in using small rodents as surrogates for man in chemical safety evaluation.

Other differences between species reflect the alteration in cytochrome P450 complements together with variability of expression and regulation of the cytochrome P450 genes which can be subject to alteration depending on not only species, sex and strain differences but also variations between organs and tissues. Thus, it is found that the anticancer agent tamoxifen is carcinogenic in both rat and mouse due to cytochrome P450-dependent pathways, but is readily detoxified via CYP3A4 in human (Wiseman and Lewis, 1996). Consequently, the preferred experimental animal species for the screening of chemicals that are destined for human exposure will vary depending on the nature of the compound itself and the relevant pathways of metabolism.

1.3.5 Regulation of cytochrome P450 gene expression DNA in the nucleus of a eukaryotic cell is found in the form of chromatin where both histone and non-histone proteins are bound to the genetic material. For a gene to be available for expression, it must be in the activated state so that transcription can take place. The transcribing molecule, RNA polymerase II, is then able to synthesise a pre-mRNA copy of the gene, including both the coding (exon) and non-coding (intron) regions. The introns of this pre-mRNA are removed by splicing and mature mRNA is produced. This is then transported to the cytoplasm where it is translated

17 by ribosomes into the polypeptide apoprotein. The modification of this apoprotein yields active enzyme. Any of these stages (Figure 1.2) can be a site of regulatory control (Goldfarb, 1989; Lewis and Lake, 1996). The cytochrome P450 enzymes responsible for the metabolism of xenobiotics are generally present at low cellular levels, but are substantially induced in response to specific xenobiotics. This induction process makes biological sense because the xenobiotic inducers are generally substrates for the induced cytochrome P450. Induction of cytochrome P450 enzyme(s) then continues until the inducer is lowered to a threshold level (Dogra et al, 1998). In addition to induction, the level of catalytic activity of cytochrome P450s can be lowered (or down-regulated) by a variety of other factors such as inhibition and post-translational loss of functionality (Lewis and Lake, 1996). There is also some evidence that pre-transcriptional steps can affect the induction of some liver CYPs by phénobarbital e.g. extracellular matrix, disruption of the cytoskeleton and activation of cAMP-dependent protein kinase (Brown etal, 1997).

1.3.5.1 Transcriptional regulation Induction of cytochrome P450 enzymes occurs predominantly at the level of transcription (Dogra et al, 1998). Regulation at the level of mRNA synthesis is dependent on two factors: the presence of cis-acting regulatory DNA sequences adjacent to or within the gene and the synthesis or activation of gene-specific DNA- binding proteins. The DNA-binding proteins dock specifically with their target regulatory DNA sequences and facilitate the entry of RNA polymerase molecules into the promoter site of the gene. These DNA-binding proteins or trans-acting factors, which are present in both the nucleus and cytoplasm, can be activated by ligand binding (drugs or hormones), by phosphorylation (second messenger signalling systems) or in some instances, by metabolite-induced dimerisation/dissociation (Goldfarb, 1989).

Each ligand interacts with its cognate receptor to induce conformational changes in the tertiary protein structure, enabling productive interactions between the ligand- bound receptor and its target response element DNA sequences (Kumar and Thompson, 1999). Steroid hormones, some chemicals such as dioxin and related agents or the peroxisome proliferators bind stereospecifically to their cytoplasmic

18 Cytochrome P450 gene

Transcription and processing (Nucleus)

mRNA

Translation (Endoplasmic reticulum)

Apoprotein

Cytochrome P450 enzyme

Specific inactivation Haem pool

Cytochrome P420 (inactive)

Degradation and catabolism

Figure 1.2 Stages in cytochrome P450 gene expression (modified from Lewis and Lake, 1996).

19 xenobiotic receptors in the process of stimulating expression of some cytochrome P450 genes (Brown et al, 1997). Depending on the chemical nature of the ligand (xenobiotic), CYP isozymes belonging to a particular subfamily are predominantly induced (Figure 1.3).

Several types of agents have been found to down-regulate CYPlAl transcription by inhibiting the binding of ligand-receptor complex to DNA. For example, transcriptional regulation of CYPlAl and CYP1A2 by TCDD requires protein kinase C-dependent phosphorylation and inhibitors of protein kinase activity, such as 2-aminopurine or phorbol esters, inhibit CYPlAl mRNA induction by TCDD as well as the concomitant increase in CYPlAl enzyme activity (Berghard et al, 1993). Formation of DNA-protein complexes between the Ah receptor and its AhRE target is also inhibited by 2-aminopurine (Carrier et al, 1992; Okino et al, 1992; Berghard et al, 1993). Treatment of in vivo or in vitro ligand-activated dioxin receptor with potato acid phosphatase significantly reduced or abolished its specific binding activity. This effect was inhibited in the presence of sodium phosphate. These results suggest that phosphorylation may regulate the DNA binding activity of the ligand-occupied dioxin receptor (Pongratz et al, 1991).

20 Nucleus AhR hsp90 PAH AhR Arnt

CYP1A XRE AhR hsp90 PRARa RXRa RXRa

CYP4A PPRE PPARoc CAR O RXR RXR

CYP2B CAR PBRE

RIF PXR RXRa RXRa

CYP3A HRE PXR

Figure 1.3. A general model for the transcriptional activation of CYP genes by various chemicals (modified from Dogra et al, 1998). PAH, polycyclic aromatic hydrocarbon; PP, peroxisome proliferators; PB, phénobarbital; RIF, rifampicin; AhR, arylhydrocarbon receptor; hsp90, heat-shock protein 90; PPAR, peroxisome proliferator activated receptor; GR, glucocorticoid receptor; Arnt, AhR nuclear translocator protein; RXRa, retinoid X receptor a; XRE, xenobiotic response element; PPRE, peroxisome proliferator response element; HRE, hormone responsive element; PXR, Pregnane X receptor; CAR, constitutively active receptor.

21 1.3.5.2 Post-transcriptional regulation Post-transcriptional regulation includes the mechanisms that may affect the splicing, transport, stability (time until degradation) and translatability of mRNA. In the cytochrome P450s, post-transcriptional mechanisms have been reported to operate in the induction of CYP1A2 (and possibly CYPlAl) by 3-methylcholanthrene or TCDD, the induction of CYP3A2 by troleandomycin or dexamethasone (Goldfarb, 1989) and, the induction of CYP2E1 by triiodothyronine (Peng and Coon, 1998). In all these instances, there appears to be a stabilisation of the mRNA by some unknown mechanism e.g. alternative mRNA splicing in the 3’ UTR as has been demonstrated in the case of CYP4A1 (Goldfarb, 1989). Increased translational efficiency has been reported for CYP2E1 induction by pyridine (Kim et al, 1993). Insulin may decrease CYP2E1 mRNA stability (Peng and Coon, 1998).

1.3.5.3 Post-translational regulation Regulation of cytochrome P450 activity at the level of enzyme activity or stability has been shown to operate in a number of instances. The availability of haem is clearly an important factor and haem synthesis is readily induced following administration of TCDD or phénobarbital (Goldfarb, 1989). Some organochloride insecticides have been reported to stabilise CYP3A1 protein (Yaun et al, 1994) and ethanol has been shown to protect CYP2E1 from catalytic degeneration (Hu et al, 1995). DMSG increased CYP3A protein levels as a result of decreased protein degradation (Zangar and Novak, 1998).

Inactivation or inhibition of cytochrome P450 can also occur by formation of a chemical complex between substrate or inhibitor and enzyme protein. Inactivation of cytochrome P450 by thiono-sulfur compounds occurs during their biotransformation and results in the binding of atomic sulphur to the cytochrome P450 apoprotein (Chang etal, 1997).

The mechanism of cytochrome P450 inactivation is generally classified into two groups: one involves covalent binding of a reactive intermediate to the enzyme protein and/or haem, which leads to irreversible inhibition of catalytic function; the second involves a quasi-irreversible coordination of a reactive intermediate to the

22 cytochrome P450. The major classes of chemical entities that form cytochrome P450 complexes include methylenedioxybenzene derivatives, alkylamines, macrolide antibiotics, and hydrazines. Compounds such as piperonyl butoxide, isosafrole and alkylamine functions undergo cytochrome P450-catalysed oxidation to form intermediates that coordinate tightly to the prosthetic haem iron (Chiba et al, 1998). Also, grapefruit juice has been found to inhibit cytochrome P450 3A4 enzymatic activity and decrease the content of intestinal P450 3A4 (He et al, 1998). The mechanism of the inactivation appears to involve modification of the CYP3A4 in the active site of the enzyme. Bergamottin, a constituent of grapefruit juice appears to be responsible for this inhibition.

1.4 The CYP3A subfamily

1.4.1 Hepatic CYP3A enzymes CYP3A enzymes are found in different tissues but liver is usually considered as the major organ for drug metabolism. These enzymes are the most abundantly expressed P450s in human liver, accounting for up to 60% of total cytochrome P450 in some liver specimens (Nelson et al, 1996). In contrast, in rats, a CYP3A, designated CYP3A2 is expressed only in adult females and represents about 25% of total hepatic cytochrome P450. The enzyme is apparently absent in males (Emi and Omura, 1988). This sexual dimorphism has not been found in humans (Guengerich, 1995). Another rat hepatic cytochrome P450, CYP3A1, is not appreciably expressed in either sex but is highly inducible by certain steroids (Gonzalez, 1993).

The human CYP3A subfamily consists of four members CYP3A4, CYP3A5, CYP3A7 (Li et al, 1995) and recently identified CYP3A43 (Domanski et al, 2001). CYP3A7 is expressed only in foetal liver. Two main adult isoforms (3A4 and 3A5) display largely overlapping substrate specificity, although clear differences have also been demonstrated (Domanski et al, 2001). For example, the primary route of erythromycin metabolism appears to be by N-demethylation mediated exclusively by CYP3A4 but cortisol 6P-hydroxylation have been shown to be catalysed variably by both members of the subfamily (Watkins et al, 1989). It has been suggested that CYP3A43 might have substrate specificity different from the other human CYP3A enzymes. CYP3A43 has a valine at position 370, whereas a conserved alanine is

23 seen in the other CYP3A enzymes (Westlind et al, 2001). Alanine-370 has been shown to be important for the interaction of CYP3A4 with many of its substrates (Khan and Halpert, 2000).

Understanding the role of CYP3A isoforms in the metabolism of drugs, and the factors influencing their activity is of major clinical importance. Studies of the content of various cytochromes in large numbers of human liver specimens (Shimada et al, 1994) indicate that CYP3A isoforms on average constitute the largest component of identified cytochrome P450s (Figure 1.4).

The CYP3A isoforms are partially or entirely responsible for biotransformation of many drugs in humans including many psychotropic agents, cardiovascular drugs, antineoplastic and immunosuppressive agents, the Hi-antihistamines and various analgesics. A number of endogenous hormones are also metabolised by these isoforms. Extensive studies of drug metabolism in humans have established a number of important characteristics of CYP3A subfamily and its metabolic activity (von Moltke et al, 1995).

As indicated above, the CYP3A subfamily is variably expressed in the liver at different ages. High levels of CYP3A7 and low levels of CYP3A5 exist during foetal life. CYP3A7 ceases to be the principal hepatic CYP3A soon after birth as CYP3A4 comes on line. CYP3A4 reaches 30% to 40% of adult activity by the first postnatal month and is the predominant CYP3A during adulthood (Oesterheld, 1998).

In adults, CYP3A7 is variably expressed at low levels. CYP3A5 is more commonly expressed in children and teenagers, as compared with adults, but it is not present in all children, nor is it gender specific. The mRNA of CYP3A5 has been located in about 23% of adult livers without gender specificity. Hepatic P450 activity declines with age and it is likely that the CYP3A subfamily specific activity also declines with age but there is some disagreement on this issue (Oesterheld, 1998). CYP3A43 has been reported to be expressed in relatively low amounts in the liver where it can be induced by rifampicin (Gellner et al, 2001) but there is no strong evidence for its contribution to drug metabolism at the moment (Westlind et al, 2001).

24 28 % not identified

o 20

m 10 I

Figure 1.4 Mean relative amounts of identifiable human CYPs determined immunologically in a study of 60 human liver samples (von Moltke et al, 1995).

25 1.4.2 Expression of CYP3A enzymes in other tissues Expression of the CYP3A subfamily has been found in many tissues throughout the body with the highest levels in the liver, villus epithelium of the small intestine, kidney and to some extent in the lung (Haehner et al, 1996; Anttila et al, 1997; Paine et al, 1997).

On average, CYP3A, as mentioned above, composes 25% to 30% of total hepatic cytochrome P450s and an even larger percentage of total small intestinal cytochrome P450s. In addition, CYP3A content in both organs is highly variable among individuals (>11 fold) (Lown et al, 1994). Due to the anatomical arrangement of the small intestine and liver, drugs may encounter sequential CYP3A-mediated first pass metabolism when taken orally. Historically, the liver was considered the major site of CYP3A-dependent first pass metabolic extraction. Recent in vitro and in vivo studies, however, suggest that metabolism by the mucosal villi of the small intestine can be of equal or greater importance for some drugs such as cyclosporine and verapamil. Studies conducted on midazolam metabolism revealed large inter­ individual differences in hepatic and intestinal extraction ratios. Hepatic extraction ranged from 22% to 76%, whereas intestinal extraction ranged from -0% to 77% in healthy volunteers and 14% to 59% in anhepatics (e.g. following liver failure due to hepatitis) (Paine etal, 1997).

In the human kidney, based on immunohistochemical studies, CYP3A appears to be located in the proximal tubule, thin limb of Henle, the cortical collecting ducts and the cells lining the renal pelvis (Haehner et al, 1996). It has been well established that both human CYP3A4 and CYP3A5 catalyse the conversion of cortisol to its 6|3-hydroxy metabolite. Consequently, the pathophysiological role of renal CYP3A has been suggested to be the intrarenal conversion of excess cortisol to 6|3-hydroxycortisol. In contrast to hepatic tissue, CYP3A5 is the ubiquitously expressed member of CYP3A subfamily in renal tissue (Haehner et al, 1996).

In the lung and kidney, CYP3A5 appears to be the predominant CYP3A isoform. CYP3A4 is expressed in this tissue in only about 20% of individuals. There are considerable variations of pulmonary expression in both CYPs among individuals

26 (Anttila et al, 1997). There is also evidence that CYP3A5 is the only member of CYP3A subfamily that is expressed in human blood cells (Janarden et al, 1996).

The CYP3A7 protein appears to be expressed mainly in foetal liver but also in adult endometrium and placenta. The highest level of CYP3A43 mRNA is observed in the prostate, an organ with extensive steroid metabolism and it can be speculated that the enzyme has a physiological role in this organ (Westlind et al, 2001).

1.4.3 The Human CYP3A4 enzyme Human CYP3A4 is usually the major cytochrome P450 enzyme in the human liver and is known to metabolise a large variety of xenobiotics and endogenous biochemicals (Li et al, 1995 and references therein). Multiple metabolic pathways are catalysed by CYP3A4. The major pathways are C- and N-dealkylation and C-hydroxylation. Others include dehalogenation, dehydration and nitroreduction (Li et al, 1995). It is now known that CYP3A4 is highly inducible and this may account for a major mechanism in known cases of drug interactions. It is also plausible that CYP3A4 induction may be a key determinant of inter-individual variation in susceptibility to chemical toxicants. The abundance of CYP3A4 in the human liver, the large number of substrates of diverse chemical structures it metabolises, the multiple metabolic pathways involved and its inducibility are all reasons suggesting that CYP3A4 is one of the most interesting CYP enzymes to be studied (Li et al, 1995).

Considering the capability of CYP3A4 to metabolise structurally diverse chemicals, ranging in molecular weight of 151 for paracetamol to 1202 for cyclosporine A, the active site of the enzyme would be expected to be relatively large and open in order to accommodate very large substrates. In fact, it has been reported that the CYP3A4 active site may be large enough to allow the simultaneous binding of two similar or different molecules (Lewis et al, 1996).

The clinical significance of CYP3A4 stems from both its ability to metabolise a large number of therapeutic agents and its high expression level in the liver of most humans. Moreover, intestinal CYP3A4 expression accounts for significant first pass

27 metabolism of orally administered medication. Consequently, stmcture-function analysis of this enzyme can help to elucidate the exact mechanism of many drug interactions during drug development (Szklarz and Halpert, 1997). Thus considerable attempts have been made to construct molecular models of CYP3A4 to rationalise the binding of a broad range of substrates and possibly to predict the routs of metabolism and enzyme specificity for novel development compounds (Lewis et al, 1996; Szklarz and Halpert, 1997).

As mentioned above although CYP3A4 can metabolise a wide variety of structurally diverse substrates, it still exhibits remarkable regio- and stereoselectivity with many compounds. For example, the enzyme catalyses the 2p, 6p- and 15p-hydroxylation of testosterone, the 6p- and 16a- hydroxylation of progesterone, the 1- and 4-hydroxylation of midazolam, and Ml-, M l7- and M21-oxidation of cyclosporine A (Harlow and Halpert, 1997).

The enzyme has a very broad substrate specificity, with >100 substrate now identified. Approximately half of the therapeutic drugs currently on the market are substrates. The ability of a single protein to catalyse so many reactions has been confirmed in studies with recombinant proteins (Ueng et al, 1997).

CYP3A4, like other CYP3A subfamily enzymes, tends to lose catalytic activity during purification, and many of its reactions require special conditions for reconstitution of optimal activity. Some of the reactions are very sensitive to particular reconstitution components (e.g. cytochrome bs, Mg^^, and negatively charged phospholipids) while others are not. In addition, some reactions appear to show auto-activation or homotropic cooperativity, at least as judged by sigmoidal V versus S plots reported in studies with microsomes. Also, the effects of a-naphthoflavone and natural flavonoids vary, yielding stimulation (heterotropic cooperativity), no effect or inhibition depending on the reaction (Ueng et al, 1997; Halpert et al, 1998).

Autoactivation is observed particularly with substrates such as aflatoxin and progesterone resulting in sigmoidal kinetics. The mechanism of stimulation is not

28 well understood, but a number of hypotheses have been proposed, including the possibility that activators bind to the same site as the substrate or at a separate site, causing an allosteric effect on substrate binding (Halpert et al, 1998). Some investigators have tried to explain such properties using site directed mutagenesis in the CYP3A4 DNA to produce mutant forms of the enzyme with altered active sites. These studies have provided the first evidence for the active site location of residues that influence flavonoid stimulation of P450 3A4 (Harlow and Halpert, 1997; He etal, 1997; Szklarz and Halpert, 1998).

Although much progress has been made toward understanding the substrate specificity of CYP3A4, the detailed mechanism of activation is not clear. A broad study of multiple mutants with a range of substrates and activators is the next step toward defining this process. There is still much to be learned about the function of CYP3A4 (Harlow and Halpert, 1997; Halpert et al, 1998).

1.4.4 CYP3A xenobiotic substrates in humans CYP3A4 probably has the broadest catalytic activity of any cytochrome P450. The substrates vary in size from smaller molecules such as paracetamol (Mr 151) to cyclosporine A (Mr 1201) (Guengerich, 1999). An updated list of about 100 known human drug substrates is presented in Table 1.4. The list of substrates includes not only drugs but also synthetic steroids and carcinogens. Although an extensive list of other xenobiotic substrates such as pesticides (e.g. parathion, aldrin) has not been compiled, undoubtedly the number of substrates is larger. Studies are also in progress to determine whether the oxidation of certain peptides is catalysed by CYP3A4 (Guengerich, 1999).

CYP3A4 and CYP3A5 catalyse the 6p-hydroxylation of the steroid hormones testosterone, progesterone, hydrocortisone, and androstenedione, although CYP3A4 exhibited several fold higher expressed activity than CYP3A5 (Aoyama et al, 1989; Haehner et al, 1996). CYP3A5 shows roughly the same substrate preference pattern but the turnover rates are lower. However, exceptions appear to exist, since aflatoxin Bi and 1-nitropyrene are both activated by CYP3A4 but not by CYP3A5. However, both CYP3A4 and CYP3A5 are active in the metabolism of benzo(a)pyrene and some

29 Table 1.4 Drug substrates of CYP3A4 (modified from Guengerich, 1999)

* Acetaminophen (quinoneimine formation) Lovastatin (6'P, 6'-exo-methylene, Albendazole (S-oxide) 3",3',5'-dihydrodiol) Alfentanil (noralfentanil formation) Meloxicam Alprazolam Methadone (N-demethylation) Amiodarone (N-deethylation) Midazolam Amitryptyline (N-demethylation) Mifepristone (RU486) (N-demethylation) Astem izole A-hydroxyarginine Benzphetamine (N-demethylation) Nevaripine Bupivacaine (N-dealkylation) Nicardipine (pyridine formation) Carbamazepine (1 0 ,11-epoxidation) Nifedipine (pyridine formation) Citalopram (N-demethylation) Niludipine (pyridine formation) Claritromycin Nimodipine (pyridine formation) Clozapine Nisoldipine (pyridine formation) Codeine (N-demethylation) Nitrendipine (pyridine formation) Colchicine (2,3) Omeprazole (S, 5) Cortisol (6P) Oxodipine Cyclophosphamide Paclitaxel (taxol) (3'-phenyl para-OH) Cyclosporine A Progesterone (6p,some 16a) Cyclosporine G Propafenone Dapsone (N) Proquanil (cyclisation) Dehydroepiandroterone 3-sulfate (16a) Quinidine (3, N) Delaviridine (6',N-dealkylation) Rapamycin (0-dealkylation) Dextromethorphan (N-demethylation) Retinoic acid Diazepam (3) Ritonavir Digitoxin Sameterol (a) Diltiazem Sequenavir Disopyramide (N-dealkylation) Sertindole (N-dealkylation) Emetine (0-demethylemetine) Sulfamethoxazole (N) Ivp-Estradiol (2,4) Sulfentanil Erythromycin (0-demethylation) Tacrolimus (FK 506) (several) Ethylmorphine (N-demethylation) Tamoxifen (N-demethylation) 17 p -Ethynylestradiol (2) Tasosartan Etoposide Teniposide Felodipine (pyridine formation) Terfenadine (r-butyl, N-dealkylation) Finasteride (t-butyl) Terguride Flutamide Testosterone (6p, trace 15p, 2P) Gestoden T etrahydrocannabinol Granisterone (7, 9') Theophylline Haloperidol (alcohol oxidation) Toremifine (4, N-demethylation) Ifosphamide Triazolam Imipramine (N-demethylation) Trimethadone (N-demethylation) Indinavir Trofosfamide (4-hydroxylation, Ivermectin (several) N-dechloroethylation) Lansoprazole (5) Verapamil Lidocaine (N-deethylation) Warfarin (R-10, S-dehydro) Lisuride (N-deethylation) Zatosetron (N) Loratidine Zonisamide

Parentheses indicate the positions of oxidation, if identified.

30 other procarcinogens (Anttila et al, 1997). Several minor oxidation products of steroids (e.g. 15p-hydroxytestosterone) comprising up to ~20% of the total metabolites, are formed by CYP3A4 but not CYP3A5 (Aoyama et al, 1989). Clear differences were also detected in the catalytic activities toward the immunosuppressive drug cyclosporine, with two hydroxylated metabolites and one demethylated metabolite formed by CYP3A4 but only one hydroxylated metabolite formed by CYP3A5 (Aoyama et al, 1989). Also, CYP3A4 N-demethylates erythromycin roughly 10-fold faster than does CYP3A5 (Lown et al, 1994).

Of the large number of compounds identified as substrates of CYP3A sub-family members, CYP3A5 was found to rapidly metabolise nifedipine, testosterone, oestradiol, dehydroepiandrosterone 3-sulfate (DHEA), and cortisol, whereas it metabolised poorly or did not metabolise erythromycin, quinidine, 17a- ethinylestradiol, and aflatoxins (Wrighton et al, 1990). Shimada and Guengerich (1989) demonstrated that CYP3A4 activates a number of procarcinogens in a transformation bioassay with Salmonella typhimurium. Reconstituted CYP3A5 was found to have less than 15% of the activity of CYP3A4 in this assay with aflatoxin Bi, sterigmatocystin and (-)-benzo(a)pyrene-7,8-diol, and no activity with (+)-benzo(a)pyrene-7,8-diol and 6-aminochyrsene (Wrighton et al, 1990). However, using purified CYP3A5 and heterologously expressed CYP3A4 in reconstitution systems, Wrighton et al (1990) found that CYP3A5 contributes relatively little to the metabolism of the majority of the compounds are known to be metabolised by the CYP3A subfamily. The lower number of substrates and catalytic rates of CYP3A5, relative to CYP3A4, suggest that the substrate binding sites of the two enzymes differ, although the amino acid differences between the two proteins appear to be evenly distributed (Wrighton et al, 1990).

In vitro, CYP3A7 metabolises substrates such as testosterone, erythromycin, aldrin, triacetyloleandomycin, nifedipine, quinidine, benzo(a)pyrene, 7-ethoxycoumarin, ethylmorphine, N,N-dimethylaniline, aminopyrine, p-nitroanisole, cortisol, N- methylaniline, N,N-dimethylnitrosamine, indinavir and midazolam (Oesterheld, 1998). Foetal hepatic CYPs have high mutagen-activating abilities. CYP3A7 can also activate promutagens such as aflatoxin Bi. Benzo(a)pyrene is metabolised by

31 foetal CYP3A7 and CYPlAl enzymes. These foetal reactions could be associated with foetal carcinogenesis and dysmorphogenesis (Oesterheld, 1998).

1.4.5 CYP3A gene structure in humans The whole CYP3A locus in man has been isolated and sequenced (Gellner et al, 2001). The 231 kb locus on chromosome 7 contains the three CYP3A genes described previously (CYP3A4, CYP3A5 and CYP3A7), three pseudogenes and a novel CYP3A gene termed CYP3A43 (Figure 1.5).

The CYP3A4 gene is 27 kb long, with 13 exons and 12 introns. The promoter region of this gene contains a typical TATA box and the basal transcription element (BTE) which is reported to exist in the proximal region of several cytochrome P450 genes (Hashimoto et al, 1993; Gellner et al, 2001). In addition, the putative binding sites of transcriptional regulatory factors such as the oestrogen receptor (ER), the progesterone receptor/glucocorticoid receptor (PR/GR), hepatic nuclear factor-4 (HNF-4), hepatic nuclear factor-5 (HNF-5) and the tumour suppressor p53 exist upstream of the major transcription initiation site (Hashimoto et al, 1993). No gene has been found for the cDNA sequence reported previously as CYP3A3 which differs from CYP3A4 in 14 coding positions. It is now considered as being an artefact resulting from sequencing errors (Guengerich, 1999).

The amino acid sequence deduced from CYP3A5 cDNA contained 502 residues, with a calculated protein molecular mass of 57,115 daltons and displayed 84% amino acid similarity with CYP3A4. The CYP3A5 promoter contains a CAT A box instead of the typical TATA box and a basal transcription element (BTE). The 5'-flahking region of CYP3A5, from nucleotide -1 to -1434, is 60% similar with the corresponding region of CYP3A4 and 59% with CYP3A7, respectively. However, the similarity increases to 74% when only nucleotides -1 to -700 were compared. The similarity between CYP3A4 and CYP3A7 in the same region is 92%. The 5'-flanking sequences of CYP3A4 and CYP3A7 appear therefore to be more closely related to each other than to CYP3A5. The similarity between the 5'-flanking sequences of CYP3A5 and that of the two other CYP3A genes drop abruptly to less than 42%, upstream from nucleotide -700, while the similarity between CYP3A4 and CYP3A7 remains greater

32 .î^ (D o CO I ]■

Î: o § o CO LO CNJ I gC/Ü

S I =s u o 1 (/3 I CL 'c G a 0 o o U o K. I o Rl s § i a O CJ

o1 2 PÛ c 0 % 3 I o o U t>D k - LO CM .2 1Î U G I

I3 Æ O 0> c -B 0 Sm : O 1 o o c s — o 0 o CM CO *-G ■g

c I

1o o a I O lO I O o Î H - CD 11 l i than 89%, within the same region (Jounaidi et al, 1994). The similarity between CYP3A4 and CYP3A7 is 95% at the nucleotide level and 87% at the amino acid level. The similarity of the 5'-flanking region sequences (from -1 to 1000 bp) between CYP3A4 and CYP3A7 genes is 91% (Hashimoto et al, 1993). The CYP3A7 apoprotein has been shown to have a slightly higher molecular weight than other members of the CYP3A subfamily (Oesterheld, 1998).

When comparing the proximal promoter region of CYP3A4, CYP3A5 and CYP3A7, several motifs or deletions appear to be characteristic of each gene (Figure 1.6). A ten nucleotide-long sequence (AGGGCAAGAG, termed ‘nifedipine specific element’ [NFSE], from nucleotides -286 to -295) is present in the proximal promoter of CYP3A4 and CYP3A5 (with three mismatches, gGGGCAgGtG, from -226 to -235). This region is absent in CYP3A7. A nine nucleotide-long sequence is present in the promoter of CYP3A7 (GATGGAGTG, termed ‘human foetal liver specific element’ [HFLa-SE], from nucleotides -727 to -736) but absent in CYP3A4 and CYP3A5. A 12 nucleotide-long sequence GAGGGAATTTCG (from nucleotides -328 to -339) is present in CYP3A5 but absent in both CYP3A7 and CYP3A4. There is also a 57 bp deletion upstream of the BTE (basic transcriptional element) at -66 in CYP3A5. As shown in Figure 1.6, CYP3A5 has almost a different promoter sequence compared to CYP3A4 and CYP3A7. However, some similarities can be deduced (only up to -700 bp of the promoter region) if deletions and insertions are being put aside. After that, it is not possible to find sequence match between CYP3A5 and other two CYP3As. Whether or not these specific sequences play a part in the differential regulation of the CYP3A genes in man remains to be established (Gellner et al, 2001).

34 -741 CAAGCAACCATTAGTCTATTGCTaI' c G G - c TAATGACCTAAGAAG’ ------jTCACCAGAAAGTCAGASGGGATGACATGCAGSGGCCCAGCAATC TAATGACCTAAGAAGATGGAGTGGTCACCAGAAAGTCAGAbGAAGTGACAWcAGG'GGCCCAGCAATC H F L a-S E CCA A A C G ^ CA T C A TCAGCTAAGTCAACTCCACCAGCCTTTCTSGTpGCCCACTGTGTGTACAGCACCCTG§TAGGGACCAG TCAGCpAAGTCAACTCCACCAGCCTTTCTjsbTrqCCCACTGTGTGTACAGCACCCTGATAGGGACCAG

GTATATCG CA A AGCCATGAÎCAGGGASTAAGACTAGACTATGCCCTTGAGGAGCTCACCTCTCTTpAGGGAAACAGGCiT AGCCATGAGAGTGAWTAAGAcWAGACTATGCCCTTGAGGAGCTCACCTCTGBlWAGGGAAACAGGCCT TT A A C TG G A G G CA GGAAACACAATGGTGGTAAAGAGGAAAGAGGACAATAGGApTGCATGAAGGGGATGGAAAGTGCCCAG GGAAA^JcAATGGTGGTAAAGAGGAAAGAkGACAATAC^A^TGCATGAAGGGGATGGAAAGTGCCCAG

A T G A ATT GC WG G c GGGAGGAAATGGTTACATCTGTGTGAGGSgTiTTGGTGAGGAAAGACTCTAAGAGAAOTCTCTGTCTGT GGGAGGAAATGGTTACgTCTGTGTGAGGgGgTTGGTGAGGAAAGACTCTAAGAGAAGGCTCTGTCTGg GAGGGAATTTCG AC A A ctgggtp ^tc ^ aaggatgtgtaggagtcttctagggggcacaggcacactccaggc Àtaggtaaagatc CTGGGTATGAAAGGATGTGTAGGAGTCTTCTAGGGGGCACAGGCACACTCCAGGCATAGGTAAAGATC

GA G T C A A G G G TGTAGGTGTGGCTTGTTGGGATGAATTTCAAGTATTpjTGGAATGAGGACAGCCATAGAGACAAGGGCA’ t g t a g g c a !tggcttgttgggatgj ^ tttcaagtattptggaatgaggacagccatagagacaa ------286 [NFSE] G t | , a g g c kGAGAGAGGCGApTTAATAGATTTTATGCCAATGGCTCCACTTGAGTTT^TGATAAGAACCCAGAACC GAGG^GAbTTAATAGATTTTATGCCAATGGCTCCACTTGAGTTTfeTGATAAGAACCCAGAACC

GA C A C T C T ^ C A CTTGGACTCCCCAGTAACATTGATTGAGTTGTpTATGATACÇl^CATAGAATATGAACTCAAAGGAGGT CTTGGACTCCCCAGTAACATTGATTGAGTTGTGTATGATTCTACATAGAATATTAACTCAATGGAGGT [ER6] A CA A - GG C _ ------CAGTGAGTGGTGTGTGTGTGATTCTTTGCCAACTTCCAAGGTGGAGAAGCCTCTTCCAACTGCAGGCA cagtgagtggtgtgtgtgtgattatttgccaactgccgaggtggagaagcctcttcca Gc t g c a g g c a

------^ T AT c c TCT T GAGCACA'GGTGGCCCTGCTACTGGCTGCAGCTCCAGCCCTGCCTCCTTCTCTAGCATATAAACAATCC GAGCACriGQSGGCCCTGCTACTGGCTGCAGCTCCAGCCCTGCCTCCTTCTCCAGCATATAAACAATCC ^^-1 [BTE] [TATA box] G T GG CYP3A5 AACAGCCTCACTGAATCACTGCT CYP3A4 AACAGCCTCACTGAATCACTGCT CYP3A7

Figure 1.6 Comparison of proximal promoter regions of the CYP3A4, CYP3A5 and CYP3A7 genes (Gelner et al, 2001; GenBank GI No. 11177452). CYPS A4 (bold) and CYP3A7 are presented as matched sequences (differences are highlighted). Sequence related to CYP3A5 is shown where there is a difference with CYP3A4. Hyphens show deletions and boxes indicate insertions. TATA box, BTE, NFSE and HFLa-SE are underlined respectively. Numbering (shown by arrows) is based on CYP3A4 sequence and defines the nucleotide close to the transcription start as -1.

35 1.5 Control of gene expression by nuclear receptors

1.5.1 Role of the ‘hormone’ receptors The concept that small lipophilic hormones could regulate cellular function by interacting with specific cellular proteins called receptors, was first proposed 40 years ago from direct ligand-protein binding studies (Jensen and Jacobson, 1962). Final proof of the ‘nuclear receptor’ hypothesis was provided by the molecular cloning and in vitro expression of functional steroid hormone receptors (reviewed in Sladek and Giguere, 2000). The subsequent isolation and characterisation of receptors that were activated by non-steroidal ligands such as vitamin A and thyroid hormone suggested that nuclear hormone receptors could potentially regulate gene expression in response to a wide variety of lipophilic ligands (Evans, 1988). More than 70 such reporters have been identified so far (reviewed in Honkakoski and Negishi, 2000). Nuclear receptors with no known ligands at the time of their discovery are referred to as ‘orphan’ nuclear receptors and considerable effort has been devoted to identifying ligands and physiological functions for these gene products (Sladek and Giguere, 2000). The nuclear receptor gene family is structurally and functionally conserved across species and is represented within metazoan phylae from cnidarians to vertebrates (Escriva et al, 1997).

The discovery that certain orphan nuclear receptors are activated by non-classical hormones such as vitamin A derivatives, prostanoids, sterols, and fatty acids, combined with the observation that nuclear receptor binding response elements (REs) are present in the 5' regulatory regions of genes encoding enzymes involved in cellular metabolism, suggest that many orphan nuclear receptors may be important regulators of as yet unidentified basic endogenous cellular functions in vivo (Sladek and Giguere, 2000). This hypothesis has been corroborated by genetic linkage studies in patients with certain metabolic disorders (e.g. Chang et al, 2000; Li et al, 2000; Naville et al, 2000; Nishigori et al, 2001) as well as physiological studies of mutant mice harbouring defective nuclear receptor genes (e.g. Shinoda et al, 1995; Peet et al, 1998). Members of the nuclear receptor family may thus perform key roles in balancing the metabolic demands of the whole organism, regulated by classical endocrine hormones, with those of individual organs and cells, encoded by lipophilic paracrine and intracrine signals (Sladek and Giguere, 2000). Mutations in

36 the structural genes of certain receptors may cause certain types of cancer and hormone-resistance syndromes (Honkakoski and Negishi, 2000).

The majority of nuclear receptors bind specifically and with high affinity to their cognate hormone response elements (HREs) in DNA. Contacts between key amino acid residues in the receptor DNA-binding domain (DBD) and nucleotide bases within the cognate HRE core motif are primarily responsible for recognition of the HRE. The HRE is usually composed of two half-sites related to the nucleotide hexamer AGGTCA. However, the organisation of the HRE mirrors the nature of receptor binding (Figure 1.7):

(1) Some steroid-hormone receptors bind as homodimers to palindromic elements spaced by three nucleotides in a symmetrical way.

(2) Many other hormone and orphan receptors (e.g. PXR) form heterodimers with the retinoid X receptor (RXR) and bind to repeats with variable spacing. Heterodimers can recognise diverse HREs in which half-core motifs can be arrange as palindromes (Pal), direct repeats (DRs), or inverted palindromes (IPs). The ability of binding to these different motifs implies that the DBDs can rotate with respect to the ligand binding domains (LBDs) that held together through the dimérisation interface.

(3) Some receptors bind as monomers (e.g. steroid receptor-related receptors) to a single AGGTCA-like site (Honkakoski and Negishi, 2000). Monomeric binding requires the half-core motif preceded by a 5'-flanking A/T-rich sequence.

Also, gene regulation by some nuclear receptors can occur independently of direct DNA binding and is mediated by protein-protein interactions involving other transcription factors or adapter proteins. This has been demonstrated most clearly for the glucocorticoid receptor (Sladek and Giguere, 2000).

37 Homodimers Monomers

LBD

DBO

Pal Heterodimers

Pal DR

Figure 1.7 Binding of receptors to the hormone response elements (HREs). Receptors can bind as monomers, homodimers, or RXR heterodimers to DNA (Aranda and Pascual, 2001). Dimérisation is mediated by a strong interface (composed of hydrophobic repeats) present in the LBD, and cooperative binding of receptor dimmers is facilitated by a DNA-dependant interface that forms between the DBDs.

38 1.5.2 Structure of the nuclear receptors Members of the nuclear receptor family have a well-conserved protein domain structure that parallels the functions of the receptor protein. The ligand-binding domain (LED), which is less well conserved among family members, occupies the C-terminal region of the receptor and mediates ligand binding, dimérisation, interaction with heat shock proteins, nuclear localisation and transactivation functions. Although quite variable in primary sequence, nuclear receptor LEDs can be defined by a signature motif overlapping with helix 4. In addition, ligand- dependant transactivation is dependant on the presence of a highly conserved motif, referred to as activation function-2 (AF-2), localised at the carboxy-terminal end of the LED (Giguere, 1999 and reference therein).

The DED displays the highest protein sequence conservation among family members and consists of two zinc finger motifs encoded by 66-70 amino acid residues, each containing four cysteine molecules bound to a zinc atom, and a carboxy-terminal extension (GTE) that spans approximately 25 residues. This results in the formation of a tertiary structure containing helices that interact specifically with DNA sequences that are organized appropriately in response elements (Freedman et al,

1988a; Freedman et al, 1988b; Luisi et al, 1991). In other words, the DED may be considered as two interdependent sub-domains each consisting of a zinc ion, tetrahedrally coordinated to the sulphurs of four cysteine residues, and an amphipathic helix. They differ both structurally and functionally. The helix of the first sub-domain is mainly involved in site-specific recognition based on its interaction with DNA response element hexamer (Luisi et al, 1991; Lee et al, 1993a). A loop formed in the second sub-domain provides the DED homodimerisation interface and less specific DNA interactions (Figure 1.8).

The hinge domain of nuclear receptors has a connecting function between the DED and LED. High variability in both length and primary sequence of the hinge region allows the DED to rotate by up to 180° in some receptors enabling them to bind as dimers on direct and inverted hormone response elements. However, some studies have reported that the hinge region also contains a functional feature called the CoR-box may serve as a binding site for co-repressors (Giguere, 1999).

39 A/B

DBDModulator LBDHinge

N < |> C

AF-1 Zn++ CTE CoR-box AF-2 DNA binding Ligand and coactivator binding pockets

Figure 1.8 Functional domains in nuclear receptors and typical NR gene structure (adapted from Giguere, 1999). A) General structure of nuclear receptors indicating the conserved zinc finger-based DNA binding domain (DBD) and the C-terminal ligand binding domain (LBD) which mediates ligand binding and dimérisation. In addition, constitutive (AF-1) and ligand dependent (AF-2) activation functions have been identified. Amino acid sequence conservation is the basis for defining the A to F domains of the same receptor in different species. B) Representative organisation of a nuclear receptor gene indicating alternative promoter usage (arrows) and splicing (linked exons). The zinc finger modules are encoded by distinct exons while the hinge and LBD are encoded by between 6 and 10 exons. Nuclear receptors with modified LBDs may also be generated via further alternative splicing events.

40 The modulator domain, also referred to as the A/B domain, displays the most variability both in terms of length and primary sequence. This region usually contains a transcriptional activation function, referred to as AF-1. Studies of the oestrogen and progesterone receptors have clearly demonstrated that the modulator domains possess promoter- and cell context-dependant activities, suggesting that the amino-terminal region of nuclear receptors may interact with cell-specific cofactors. The modulator domain can also interact directly with steroid receptor co-activators (SRCs) to enhance the activity of the receptor complex (Giguere, 1999 and reference therein).

The three dimentional structure of the recombinant LBDs of the retinoic acid receptor y (RAR-y), thyroid receptor (TR) and oestrogen receptor (ER) have been characterised by x-ray diffraction, as has that of the unliganded retinoid X receptor a (RXR-a) (Bourguet et al, 1995; Renaud et al, 1995; Wagner et al, 1995; Brzozoeski et al, 1997). Ail are composed of a series of 11-12 a-helices (HI-H 12) closely folded in a similar manner (Figure 1.9). The C-terminal part of the LBDs of these receptors has been shown to have a ligand-inducible trans-aetivation function, termed AF-2 (Green and Chambon, 1988; Nagpal et al, 1993). Both deletion and mutation studies have shown that the AF-2 activation helix is essential for ligand-induced transcriptional activation (Kumar and Thompson, 1999). It appears that the activation of AF-2 upon ligand binding corresponds to major eonformational changes, which create the surface required for efficient interaction with transcription factors, the putative mediators of AF-2 function (Danielian et al, 1992; Mcinemey et al, 1996). The LBD not only serves to provide a class-specific ligand-binding site, but also as a homodimerisation domain. It also interacts with other proteins in transactivating genes and still others in regulating receptor activation (Kumar and Thompson, 1999). Thus, a ligand interacts with its cognate receptor to induce conformational changes in the tertiary protein structure, enabling productive interactions between the hormone-bound reeeptor and its target response element on DNA sequences (Heery et al, 1997; Masuyama et al, 1997).

41 Y

AF -2

Figure 1.9 Schematic representations of the RXR-a LBD (left) and RAR-y LBD (right) (Kumar & Thompson, 1999). H2 is found in RXR but not in RAR. The LBDs of TR and ER have a similar overall topology.

42 1.5.3 Categories of nuclear receptors The nuclear hormone receptor super family is divided into three well-known major categories based on functional studies, ligand specificity, and DNA- and ligand- binding regions: (1) Steroid hormone receptors (2) Thyroid/retinoid/vitamin D and peroxisome proliferator activated receptors (3) The largest category, receptors for which no ligand is known, or orphan receptors (Kumar and Thompson, 1999).

Although these proteins are called the nuclear receptor family, some members such as glucocorticoid and mineralocorticoid receptors are transported to the nucleus only after ligand binding (Savory et al, 1999; Lombes et al, 1994). The first decade of orphan nuclear receptor research has yielded a large number of new family members and many tantalising clues to their biological functions (Kliewer et al, 1999). However, ligands have been identified for only a handful of these receptors. Given the large number of remaining orphan nuclear receptors and the recent advances in combinatorial chemistry, high-throughput screening, and funetional genomics, the next decade promises an explosion in our understanding of nuclear hormone signalling pathways.

1.5.4 Regulation of cytochrome P450 expression by nuclear receptors After activation by ligand binding, the nuclear receptors ean modify expression of cytochrome P450 and other genes through a complex control network (Figure 1.10). Also, nuclear receptor ligands can be metabolised by cytochrome P450s creating a feedback loop. The cytochrome P450s involved in metabolism of vitamin D (CYP24) and retinoids (CYP26, CYP2C7) are examples (Honkakoski and Negishi, 2000). Other examples of similar relationships are shown in Table 1.5.

In early attempts to investigate the mechanisms by which the drug metabolising cytochrome P450 genes are controlled, a phénobarbital response element (PBRE) was identified upstream (-2318 to -2155 bp) of the rat CYP2B2 gene (Trottier et al, 1995) and two nuclear reeeptor binding sites of type AGGTCA known as direct repeat 4 (DR-4) were identified as important in the induction of CYP2B genes by

43 CYP-dependent metabolism of xenobiotics and endobiotics

CYP genes XO, EO

NRs

Other genes

Figure 1.10 Relationship between nuclear receptors, their ligands and cytochrome P450 enzymes (after Honkakoski and Negishi, 2000). Nuclear receptors are ligand-activated transcription factors regulating the activity of cytochrome P450s and other genes to generate specific cellular responses to activating ligands. These ligands are formed and degraded via specific cytochrome P450 enzymes. The ligands may be xenobiotics (X), endobiotics (E) or their oxidation products (XO, EO).

44 Table 1.5 Examples of interactions between genes and nuclear receptors (modified from Honkakoski and Negishi, 2000)

CYP gene CYP substrates/products NRs affected by the CYP NRs known to regulate that can serve as NR ligands substrate/product CYP genes*

CYPIA Oestrogens, retinoids ERs, RARs, RXRs ER, GR, RAR CYPIB Oestrogens ERs ER,GR CYP2A Androgens AR HNF-4 CYP2B Xenobiotics^ Many CAR (PXR) Androgens^ oestrogens, AR, ER, PPAR, PXRs GR retinoids CYP2C Xenobiotics^ M any HNF-4, orphan N SA ID s RAR Androgens, retinoids, AR, ER, RARs, RXRs fatty acids derivatives PPARs CYP2D Xenobiotics^ Many ER Androgens, oestrogens. AR,ER VDR

vitamine D 3 HNF-4 CYP3A Xenobiotics^ Many PXR (CAR) Methoxychlor HNF-4, orphan Androgens, corticoids. AR, ER, GR GR oestrogens, pregnanes^ CYP4A Fatty acid derivatives PPARs PPAR, (orphan) CYP26 Retinoic acid RARs, RXRs RAR CYP27B1 Vitamin D VDR CYP24 Vitamin D VDR VDR (RXR, orphan) Steroidogenic CYPs Androgens, oestrogens, AR, ER, GR, MR SF-1, orphan corticoids, pregnanes^ CYP74 Precursors of steroids CPF, LXR, FXR Bile acid- Oxysterols LXR, FXR LXR?, FXR? forming CYPs CYP51 Sterols LXR

* Nuclear receptors in parentheses have a tentative role. ^ Many compounds in this class are activators of PXR, CAR or PPAR. Abbreviations: NSAIDS, nonsteroidal anti-inflammatory drugs; MR, mineralocorticoid receptor; VDR, vitamin D receptor.

45 phénobarbital (Park et al, 1996). A similar sequence in the mouse CyplblO gene was shown to be activated by several compounds in reporter gene assays in mouse primary hepatocytes (Honkakoski et al, 1998). It has now been revealed that the orphan nuclear receptor CAR (constitutive androstane receptor) binds to DR-4 elements a heterodimer with the retinoid X receptor a (RXRa) and transactivates the CYP2B genes (Sueyoshi et al, 1999). Sequence analysis of the CYP3A gene regulatory regions established an array of response elements that interact with another orphan nuclear receptor PXR (pregnane X receptor) as a direct (DR-3) repeat in rodent CYP3A genes (Kliewer et al, 1998) and everted (ER- 6 ) repeats in the rabbit, and human CYP3A promoters (Lehmann et al, 1998). It has also become evident that HNF-4 (hepatocyte nuclerar factor 4) or related orphan nuclear receptors control basal expression of certain cytochrome P450 enzymes, e.g. CYP2D (Yoshioka et al, 1990), CYP2C (Ibeanu and Goldstein, 1995), CYP2A (Yokomori et al, 1997) and CYP3A (Ogino et al, 1999). Since the cytochrome P45ÜS are responsible for the metabolism of a wide range of endogenous compounds as well as xenobiotics, the complexity of the control loops is evident.

1.5.5 Nomenclature of nuclear receptors The unified nomenclature system for nuclear receptors (Laudet et al, 1999) is based on amino acid sequence similarity and follows the rules applied for the cytochrome P450 super-family. Briefly, it recommends the capital letters NR (for nuclear receptors) followed by an Arabic number indicating gene family, a capital letter for subfamily members, an Arabic number for defining the individual gene and a lower case letter for receptor isoforms generated from the same gene by alternative promoter usage or differential splicing.

1.6 Co-activators and co-repressors of gene expression

1.6.1 Role of co-activators and co-repressors The regulation of transcription by members of the nuclear receptor family occurs by a mixture of mechanisms, involving direct interaction of each receptor with specific DNA sequences and a variety of other proteins. These include other sequence- specific DNA-binding transcription factors, the basal transcription factors, various

46 co-activators, co-repressors, and ‘integrators’ of transcription (Kumar and Thompson, 1999).

The interplay between distinct nuclear receptor responsive transcription pathways has been recognised for some time (Bocquel et al, 1989; Meyer et al, 1989). The capacity for the activation of transcription by one nuclear receptor to compromise a transcriptional response, which depends on a second receptor, implies that shared components of transcriptional machinery were involved. An explanation for this transcriptional interference became apparent with the discovery of shared co-activator proteins that facilitated communication between nuclear receptors, the basal transcriptional machinery and the chromatin environment (reviewed by Torchia et al, 1998).

1.6.2 Activation of co-activators and co-repressors Control of gene expression by nuclear receptors requires the recruitment of functionally distinct co-regulatory complexes which appear to operate through different mechanisms (Figure 1.11). A structural feature of the common co-activators and co-integrators such as p300/CBP, SRC-1 and TIF-2 is an a-helical LXXLL (leucine zipper) motif, or NR box present from a single to several copies and implicated in ligand-dependent recruitment by the LBD-embedded activation function 2 (AF-2) of nuclear receptors (Darimont et al, 1998). As a result, several functional properties are common across different groups of co-activators. Acetyltransferase activity, for instance, with which co-activators are thought to target histones and other proteins can cause disruption of chromatin packing and activation of transcription (Grant and Burger, 1999). This process usually starts with the initial binding of a nuclear receptor ligand and dissociation of co-repressor proteins such as nuclear hormone receptor co-repressor (NcoR) and silencing mediator of retinoid and thyroid receptors (SMRT) (Chen and Evans, 1995; Horlein et al, 1995; Kurokawa et al, 1995; Zamir et al, 1997; Ordentlich et al, 1999; Xu et al, 1999). Subsequently, recruitment of e.g. switch/sucrose non-fermentable (SWl/SNF) family members of chromatin remodelling enzymes facilitates transcription indirectly by alleviating the repressive effects of histone-DNA contacts. These two classes of co-activators may act in concert to regulate transcription initiation (Collingwood et al, 1999).

47 Histone Histone acetyl deacetylases transferases Ligand binding Protein kinases Co-integrators Co-repressors Dimérisation Co-activators T ranslocation

NR NR NR NR No ligand Antagonist Gene Gene Repression Activation

Figure 1.11 Model for gene activation and gene repression by nuclear receptors

(after Honkakoski and Negishi, 2000). Ligand binding or other activating processes induce the binding of the nuclear receptor (NR) to the DNA element. The ligand-bound nuclear receptor then recruits a complex of common and/or NR-specific co-activators and co-integrators, and turns on acétylation of histones to activate transcription. In the absence of ligands or upon antagonist binding, some but not all, nuclear receptors bind co-repressors to trigger deacetylation of histones and maintenance of chromatin structure.

48 Acétylation of the core histones also destabilises chromatin folding and a major consequence of this is facilitated transcription factor access to DNA and (Lee et al,

1993b; Ura et al, 1997; Tse et al, 1998). One effect of acetylating the basic N-terminal domains of the core histones is to reduce the stability of electrostatic interactions between the tail domains, the acidic phosphodiesterase backbone of DNA, the acidic domains of other proteins associated with nucleosomes and on other chromatin fibres (Hong et al, 1993; Tse et al, 1998). There may also be consequences for histone secondary structure and shape-related interactions with non­ histone proteins following acétylation (Hansen et al, 1998). Also, histone acétylation coupled with the action of SWl/SNF chromatin remodelling complexes can facilitate the processivity of RNA polymerase through chromatin (Brown et al, 1996; Ura et al,

1997).

Repression of transcription in many ways is similar to transcriptional activation. Analogus to co-activators, the nuclear receptor co-repressors NcoR and SMRT are recruited in the absence of ligand or in the presence of antagonists to deacetylate histones, stabilise chromatin structure and repress transcription (Johnson and Turner, 1999). The transcription intermediary factor 1 (TlF-1) is another repressor protein with co-repressor activity via deacetylation of histones (Le Dourain et al, 1995; vom Baur et al, 1996). Also, it has been shown that nuclear receptor activity can be repressed directly by binding of other transcription factors such as STATSb (Zhou and Waxman, 19990.

1.7 Nuclear receptor activation and CYP3A regulation CYP3A genes are characterised by expression in liver and intestine (main tissues), catalysis of steroid hormone and bile acid 6 p-hydroxylation reactions, selective inhibition by the mechanism based inactivator troleandomycin, and induction by a broad range of steroids and antibiotics (Waxman, 1999). There are, however, important species-specific differences in the induction response. Most notably, while the rat, rabbit and human CYP3A genes are all inducible by dexamethasone, the anti­ glucocorticoid pregnenolone 16a-carbonitrile (PCN) is an efficacious CYP3A inducer in rat but not in human or rabbit. By contrast, the antibiotic rifampicin is an excellent CYP3A inducer in human and rabbit, but not in the rat (Kocarek et al, 1995).

49 Transfection studies carried out in rat and rabbit hepatocytes utilising CYP3A constructs containing dexamethasone-respsonsive regulatory elements derived from rat CYP3A23, rabbit CYP3A6, and human CYP3A4 genes demonstrated that the species-specific induction responses are not due to speeies differences in the individual CYP3A genes, but rather are a function of factor(s), most likely a receptor, provided by the host species liver cell (Waxman, 1999 and references therein). The first indication that the complex regulation of CYP3A might reflect a conunon mechanism involving a nuclear hormone receptor (NHR) came from cw-acting control elements in the proximal promoter region of CYP3A genes (Savas et al, 1999). Using deletion analysis and DNA foot-printing, these responses were mapped to each of two sites that conform closely to NHR binding sequences and that are distinct from glucocorticoid receptor (GR) binding sequences (Table 1.6). One of these sites corresponds to a direct repeat of the hexameric, consensus binding site for NHRs, (A/G)(A/G)(G/T)TCA, separated by three nucleotides (DR3), that is also found in the promoter of the rat CYP3A2 gene. The other NHR binding site constitutes an imperfect everted repeat separated by six nucleotides (ER 6 ) with an overlaying DR-4 motif. This element is found in rat CYP3A23 and CYP3A2 promoters as well as in the promoters of the human CYP3A7 and CYP3A4, and rabbit CYP3A6 genes (Savas et al, 1999). The NHR, which binds to these elements, has been cloned and termed the pregnane-X-receptor (PXR) (Kliewer et al, 1998).

1.7.1 PXR and its role in species-specific induction of CYP3A Identification of the dexamethasone/pregnenolone 16a-carbonitrile (PCN) response element of the CYP3A genes provided the initial firm evidence for involvement of a nuclear receptor in CYP3A induction. Cloning of PXR (NR 112), a PCN-activated nuclear receptor in mouse liver, by Kliewer’s group at Glaxo Welcome (Kliewer et al, 1998) confirmed this conclusion. Kliewer’s group demonstrated that PXR, named the pregnane-X-receptor because of its strong activation by pregnane compounds, seemed to mediate CYP3A induction not only in mice, but through its homologous counterparts in rat, rabbit, and humans, as well (Bertilsson et al, 1998; Blumberg et al, 1998; Lehmann et al, 1998; Zhang et al, 1999; Savas et al, 2000). The human PXR receptor is also referred to as steroid and xenobiotic-sensing receptor (SXR) (Blumberg et al, 1998). It soon become apparent that PXR was an

50 Table 1.6 Nuclear receptor response elements in the 5'regulatory regions of CYP genes (adapted from Savas et al, 1999).

Receptor Motif Sequence Gene

PPAR/RXR DR-1 aactAGGGTA a AGTTC Agtg CYP4A1 aactAGGGTA a AGTTGAggg CYP4A6 aagtAGGACA a AGGCCAggg CYP4A6

PXR/RXR DR-3 AGTTCAtgaAGTTCA CYP3A23

ER- 6 agaataXGA ACT caaagg AGGTC Agtgagt CYP3A4 agcacaTGA ACT cagaggAGGTC Accacgg CYP3A6 agaatgTTAACT caaagg AGGTC Aaaaata

CAR/PXR DR-4 gtgccaAGGTC Aggaa AGT AC Agattct Cyp2bl0 DR-4 gGTGTCAggcaAGTTGAggtgg Cyp2bl0 DR-4 caAGGTCAggaaAGTACAgt CYP2B6

51 unusual receptor in that it was activated by a remarkably diverse collection of compounds, including both xenobiotics and natural steroids (Bertilsson et al, 1998; Blumberg et al, 1998; Lehmann et al, 1998; Zhang et al, 1999; Jones et al, 2000; Savas et al, 2000). Among the chemicals that activated PXR were the macrocyclic antibiotic rifampicin, the glucocorticoid dexamethasone, the anti glucocorticoids PCN and mifepristone, which provided the first hint that PXR regulated CYP3A. Over the past 4 years, a large body of evidence has accumulated linking PXR to the regulation of CYP3A gene expression. The evidence includes the following:

(1) High expression of PXR has been shown in the liver and intestine of humans, rabbit, rats and mice (Bertilsson et al, 1998; Blumberg et al, 1998; Lehmann et al, 1998; Zhang et al, 1999; Jones et al, 2000; Savas et al, 2000). CYP3A genes are expressed and induced in response to xenobiotics in these tissues. Similar to other nuclear receptors, PXR contains an N-terminal transactivating domain (TAD), followed by a DNA binding domain (DBD), and a C-terminal ligand-binding domain (LBD) (Figure 1.12A).

(2) Mutation analysis of the previously identified CYP3A response elements established the PXR binding site of the rodent CYP3A promoter/enhancer as a direct repeat, DR-3 (TGAACT3nTGAACT) (Kliewer et al, 1998), and the

rabbit and human CYP3A response elements as everted repeats ER - 6

(TGAACT6 nAGGTCA) (Lehmann et al, 1998) or inverted repeats, IR - 6 (Blumberg et al, 1998). The PXR forms a heterodimer with RXR (NR2B1), a requirement for binding and activation. PXR/RXR heterodimer can interact with

either the DR-3 or ER-6 /IR- 6 elements in CYP3A promoters and through these response elements activates transcription efficiently (Figure 1.12B). This heterodimer can also bind to and activate the regulatory response through DR-4

and ER - 8 elements located in the regulatory region of CYP2B genes (Xie et al,

2000a; Goodwin et al, 2001) and the multi-drug resistance-associated protein 2

(MRP2) gene (kast et al, 2002). Thus, the PXR/RXR heterodimer is capable of activating transcription through a variety of response elements with distinct

architectures. The human CYP3A4 gene appears to have not only the ER 6 response element, located in the proximal promoter (Barwick et al, 1996) but also a second, distal xenobiotic responsive element module (XREM), located

52 1 41 107 141 434 Hum an PXR DBD LBD

1 17 85 118 411 R a b b i t PXR 94% 82%

1 38 104 138 431 M o u se PXR 96% 77%

1 38 104 138 431 R a t PXR 96% 76%

B

DR-3 AGTTCA AGTTCA

DR-4 AGTTCA N a AGTTCA

ER-6 TGAACT Ng AGTTCA

ER-8 TGAACT N« AGTTCA

Figure 1.12 Comparison of PXR sequence homology among species (A) and interaction of PXR-RXR heterodimer to different xenobiotic response elements (B) (adapted from LeCluyse, 2001; Kliewer and Wilson, 2002).

53 -7.8 kb upstream of the transcriptional starts site (Goodwin et al, 1999). XREM

contains PXR binding sites DR-3 and ER- 6 . In transient transfection studies in HepG2 cells, XREM was required for induction of CYP3A4 constructs by numerous dmgs (Goodwin et at, 1999).

(3) It has become evident that almost all the chemicals that activate PXR in reporter

gene assays are in vivo CYP3A inducers. They belong to a wide range of pharmacologically and structurally diverse endogenous, and xenobiotic chemicals such as steroid hormones and therapeutic agents (Blumberg et at,

1998; Moore et at, 2000a) as well as dietary compounds such as coumestrol and

carotenoids (Blumberg et al, 1998). The most potent PXR ligand is hyperforin, a

constituent of St. John’s wort, a herbal remedy for depression with an EC 5 0 of

23 nM (Moore et al, 2000b). The best-known pharmaceutical agents that activate

PXR include rifampicin, phénobarbital, nifedipine, clotrimazole, RU 486

(mifepristone), and metyrapone (Goodwin et al, 1999; Moore et al, 2000a).

PXR activation profiles have shown to vary considerably between species. For example, while PCN effectively activates mouse and rat PXR, its activity towards human and rabbit PXR is low (Lehmann et al, 1998; Savas et al, 2000). Rifampicin, in contrast, produces an opposite effect and strongly activates human and rabbit PXR with almost no effect on rat or mouse PXR. The PXR activation profiles produced by rifampicin and PCN closely correlate with their induction profile of CYP3A enzymes in hepatocytes derived from these species (Kocarek et al, 1995; Jones et al, 2000). These results provided strong pharmacological evidence that PXR regulates CYP3A expression in vivo. Cloning and characterization of PXR from human, rabbit, rat and mouse have shown that there is >95% sequence identity in DBD regions. However, the LBDs of the PXRs are much less similar and share only 75-80% amino acid identity (Figure 1.12A) and display markedly different activation profiles in response to xenobiotics (Zhang et al, 1999; Jones et al, 2000). As the DBD is highly conserved among the PXRs in several species the difference in CYP3A regulation by xenobiotics is likely due to the differences in the LBDs of the receptors.

Zhang et al (1999) reported that specific amino acid substitutions found in the LBD regions of PXR may be responsible for the species differences in CYP3A induction

54 by xenobiotics. Their data reveal that rat PXR has nine amino acid substitutions compared with the mouse PXR in the LBD, and are likely to be responsible for the lower responsiveness of rats to rifampicin. Compared with the human PXR, five of the nine amino acids in mouse PXR are conserved in human PXR, and the remaining four residues, Phei 8 4 , Arg2 0 3 , Lyss3 4 , and Ser 4 i4 , are substituted by Serig?, Leuzos,

GIU3 3 4 , and He 4 i4 respectively. The five amino acids conserved between mouse and human PXRs likely support the interaction between PXR and rifampicin. In contrast, the remaining four substitutions could cause drastic changes in the hydrophobicity or the net charge of the ligand-binding domain. Thus, these substitutions likely contribute to the lower responsiveness of mice to rifampicin compared with that of humans.

Given their high degree of sequence identity, it is not surprising that the rat and mouse PXR have very similar activation profiles, although there are subtle differences in their response profiles. Overall, these data support the important role of PXR in the regulation of CYP3A expression in multiple species, and, although the human, rabbit, rat and mouse PXR are activated by several of the same compounds, each is pharmacologically distinct (LeCluyse, 2001).

(4) Transgenic mice have been developed to establish the role of the PXR in vivo

(Xie et al, 2000b; Staudinger et al, 2001). Targeted disruption of the mouse PXR gene eliminated the induction of Cyp3Al 1 by PCN. PXR-null transgenic mice harbouring the human PXR gene, when challenged with drugs known to induce human CYP3A such as rifampicin and clotrimazole, displayed induced CYP3A mRNA in the liver. Transgenic mice expressing a constitutively active human PXR were shown to develop sustained CYP3A expression, resulting in enhanced

protection against challenges of xenobiotic toxicants (Xie et al, 2000b).

PXR is now known to play a key role in the regulation of both drug metabolism and efflux by inducing a net work of genes, including those that encode cytochrome P450s (particularly CYP3A4) (Kliewer et al, 1998) and the multidrug resistance gene ABCBl (previously known as MDRl) which encodes P-glycoprotein (Synold et al, 2001) (Figure 1.13). It is also shown that PXR is activated by LCA (lithocholic acid, a toxic hydrophobic secondary bile acid that is primarily formed in the intestine

55 ('7 'v C V . ■ ■ CYP 3A 4 Drug metabolism

Drugs

A B C B l Drug excretion

Figure 1.13 PXR activation by xenobiotics results in a defensive mechanism involving more than one gene (adapted from Ekins and Schuetz, 2002). P X R has a very large (>1100 A), spherical ligand-binding cavity, which accounts for its promiscuous ligand-binding properties (Watkins et al, 2001). Drugs can bind and activate the nuclear hormone receptor, pregnane X receptor (PXR) leading to induction of cytochrome P450 isoform 3A4 (CYP3A4)-mediated drug metabolism and ABCBl-P-glycoprotein-mediated drug efflux (Ekins and Schuetz, 2002).

56 by the bacterial 7a-dehydroxylation of chenodeoxycholic acid) and its 3-keto metabolite, and coordinately regulates genes involved in the biosynthesis, transport, and metabolism of LCA. PXR thus joins FXR as nuclear receptors that are activated by bile acids and plays a fundamental role in protecting the liver against pathophysiological levels of LCA (Staudinger et al, 2001).

Moreover, it is recently revealed that under a variety of dietary conditions, the control of lipid homeostasis is dependent upon cross-talk between PXR, LXR (Liver X activated receptor) and FXR (famesoid X activated receptor). For example excess uptake of cholesterol from the diet results in the hepatic production of oxysterols, activation of LXR, increased expression of CYP7A1, and enhanced production of primary bile acids. In turn, bile acid-activated FXR enhances the expression of genes involved in bile acid excretion and reabsorption, while inhibiting the expression of additional CYP7A1. At the same time, hepatic PXR, activated by LCA generated in the intestine, represses CYP7A1 and activates genes involved in bile acid metabolism (CYP3A) (Edwards et al, 2002).

1.7.2 Roles of CAR and GR in induction of CYP3A The constitutively active receptor (CAR, also called constitutive androstane receptor) is a novel orphan nuclear receptor, which was originally characterised as a constitutive activator of retinoid acid response elements (RARE). It is called “constitutive” because of its apparent ability to transactivate RAREs and other response elements without being bound to ligand (Baes et al, 1994, Tzameli et al,

2000). CAR is predominantly expressed in liver (Baes et al, 1994). It mediates the induction of CYP2B6 and, to a lesser extent, CYP3A4 (Sueyoshi et al, 1999, Tzameli et al, 2000). Recent results indicate that CYP2C8 and CYP2C9 are also regulated by CAR (Pascussi et al, 2000). CAR is down regulated by the inflammatory cytokine interleukin-6, which could explain the repression of CYPs by inflammatory mediators (Abdel-Razzak et al, 1995). Biochemical and genetic studies had previously established the CAR/RXR heterodimer as the main CYP2B regulator. Xie et al

(2000b) found that PXR could also regulate CYP2B both in cultured cells and CAR- null transgenic mice via ‘adaptive recognition’ of the phénobarbital response element (PBRE). In similar experiments on CAR activation, it was found that CAR can bind

57 to PXR response elements and activate CYP3A expression in PXR null mice (Xie et al, 2000a). These findings again demonstrate the existence of different nuclear receptor activation mechanisms and ‘cross-talk’ between several known and unknown regulatory proteins which control multiple cytochrome P450 genes.

Moore et al (2000a) demonstrated that PXR and CAR have the potential to cross- regulate CYP3A gene expression by sharing certain ligands and binding of PXR and CAR to each other’s DNA response elements (Sueyoshi et al, 1999). Studies in primary cultures of rat hepatocytes, using natural CYP3A and CYP2B promoters, demonstrated that CAR could regulate CYP3A reporter gene activity, but only in response to its own ligands (e.g. the human PXR activator rifampicin had little effect on CAR activity). Likewise, co-transfection with human PXR resulted in induction of CYP2B reporter gene activity in response to rifampicin and mifeprisrone (Xie et al, 2000a). The most convincing evidence was obtained when it was demonstrated that even in PXR-null mice, the PXR ligands clotrimazole and phénobarbital were efficacious inducers of CYP3A (Xie et al, 2000b). However, these studies led to the conclusion that in humans PXR is the dominant regulator of CYP3A4 gene expression.

Close inspection of other reports regarding the role of hPXR and CAR in CYP3A gene induction suggests that these receptors may not totally account for drug and steroid induction of CYP3A. Some lines of evidence suggest that induction of CYP3A by glucocorticoids can also occur through a pathway distinct from PXR. Dexamethasone which is an efficacious inducer of rat (Wrighton et al, 1985), mouse (Yanagimoto et al, 1997) and human (Watkins et al, 1989) CYP3A expression, was only a weak ligand for mouse and human PXRs (Kliewer et al, 1998; Bertilson et al, 1998). Indeed, Bertilsson et al (1998) found no activation of human PXR by dexamethasone, concluding that there must be additional mechanisms for induction of CYP3A4 by glucocorticoids. None of the four reports on PXR activation has used the authentic CYP3A4 5'-flanking sequence which also contains putative GR binding elements (Ogget al, 1999). Instead, only reporter constructs with multiple copies of the PXR binding motif were used. Moreover, rifampicin which is a good inducer of mouse CYP3A (Wrighton et al, 1985; Yanagimoto et al, 1997) is reported to be a

58 weak activator of mouse PXR, suggesting there may also be an alternative mechanism for rifampicin induction of CYP3 A in the mouse.

Recent studies in human primary hepatocytes (Pascussi et al, 2000; Pascussi et al, 2001) suggest that in maintaining the GR in a fully activated state, physiological levels of circulating glucocorticoids control the transcriptional expression of nuclear receptors including PXR and CAR. Also, in the absence of added xenobiotics both PXR and CAR appear to be able to transactivate the CYP3A4 gene (albeit at a low rate). This process of transactivation is strongly increased in the presence of appropriate activators resulting in the induction of CYP3A4 above basal levels. Thus in contrast to other xenobiotics, glucocorticoids appears to play a dual role in CYP3A4 expression, first by controlling the expression of PXR and CAR mRNA (under low dose physiological conditions), and second in perhaps being able to bind to the CAR/PXR receptors under high dose bolus or stress conditions.

1.8 Polymorphic cytochrome P450 genes Pharmacogenetics has evolved from its beginning in the 1950’s when genetic polymorphisms were defined at the phenotypic level, to the modem era of molecular studies to elucidate the genetic basis of these inherited traits. While new polymorphisms in constitutive expression and regulatory mechanisms continue to be discovered for drug metabolising enzymes, there is also increasing focus on genetic polymorphisms of dmg targets (e.g. receptors). Theoretically, polymorphisms in drug metabolism and disposition (e.g. transporters) will be important in selecting the optimal dosage and schedule of medications for individual patient, while polymorphisms in dmg targets will influence the choice of medications for a specific genetic subtype of the disease or receptor (Krynetski and Evans, 1999).

Today it is known that each human being is different from most other human beings at about one nucleotide in a thousand, or about 3 million sites in the genome. Only 3-5% of the genome is protein coding sequence and the frequency of polymorphism is about 1 in 1159 bases in the coding region of genes (Wang et al, 1998), so about 78,000 polymorphisms will occur in protein coding regions. Many will be silent, but theoretically 68% of all possible mutations will result in an amino acid substitution.

59 Therefore, we all harbour about 50,000 inherited amino acid differences in our proteome compared with our neighbour’s. With 30,000 to 40,000 genes in humans, about two-thirds of our proteins will have an amino acid difference between unrelated individuals. Since there are about 50 different cytochrome P450 genes in humans, we can expect about 30 of these will bear polymorphic sites that affect the protein sequence. Some of these are already known and have been associated with an altered ability to metabolise drugs (Yamano et al, 1990; de Morals et al, 1994; Haining et al, 1996). Other polymorphic sites that lie outside the coding region may also influence gene expression (Rebbeck et al, 1998; Kuehl et al, 2001; Hamzeiy et al, 2002). The need to name these inherited differences (polymorphisms) in a consistent manner has prompted the formation of a human cytochrome P450 allele nomenclature committee, http:// www.imm.ki.se/CYPalleles (Nelson, 1999).

In the discussion of natural variations in a population, it is important to distinguish between rare disease-causing mutations and polymorphisms that are present in greater than 1 % of a population. Many mutations are known in the cytochrome P450s that are associated with specific diseases, e.g. CYPIB 1 related congenital glaucoma (Martin et al, 2000), CYP17 related 17a-hydroxylase deficiency (Fardella et al, 1993), CYP19 related pseudo-hermaphrodism (Conte et al, 1994), CYP21 related congenital adrenal hyperplasia (Delague et al, 2000) and CYP27B1 related pseudo vitamin D deficiency rickets (Kitanaka et al, 1999) but these clear-cut effects are different from polymorphisms that may affect drug metabolism or influence susceptibility to disease without causing disease directly. However, it must be remembered that cytochrome P450 mutations are recessive in their effects. Thus, any adverse effects may only be expressed in homozygotes and any change in drug metabolism in heterozygotes will perhaps have little or no effect on therapeutic responses. Also, for many CYP substrates, metabolism by multiple CYPs is possible. Again, this relates to the fail-safe aspects of xenobiotic metabolism and the evolution of compensatory capacity to detoxify most foreign compounds even if an individual CYP isoenzyme is lacking.

Polymorphisms may be heterogeneous, having several alleles, as in nucleotide repeats, or they may be single nucleotide polymorphisms (SNPs) with only two

60 different alleles and heterozygosity near 50% (Nelson, 1999). Automated searches of the human expressed sequence tag (EST) database for conunon sequence variations have already been performed and more than 3000 candidate coding region SNPs have been discovered (Buetow et al, 1999). Some rare polymorphisms near the 1% frequency level may however be difficult to find unless hundreds of chromosomes are examined. However, these small differences are important. Mutagenesis experiments on CYP2C2 (lauric acid hydroxylase) have shown that a single amino acid substitution, S473V, allows CYP2C2 to accept progesterone as a substrate (Ramarao and Kemper, 1995). The change in substrate specificity from fatty acid to steroid is significant. This characterisation is being extended to all the P450 genes in humans. Such knowledge could characterise a person’s risk of adverse drug reactions and possible predisposition to disease (Nelson, 1999).

Owing to the rapid development of efficient and inexpensive methods for genotyping, plus the need to genotype a patient only once in a lifetime, it would be possible to include the genotype in the patient’s medical record. This would provide medical practitioners with valuable information in order to individualise the drug treatment (Ingelman-Sundberg 6[/, 1999).

To assist genetic analysis, the activity of a cytochrome P450 can be measured in vivo using a prototypic probe substrate (e.g. debrisoquine or dextrometorphan for CYP2D6). The amounts of unchanged drug and metabolite are measured in urine or plasma and expressed as a ratio. Those who have two null alleles and show no activity are termed poor metabolisers. The remainder of the population, who perform this reaction to varying degrees, are called extensive metabolisers (Sellers and Tyndale, 2000). The relative activity of the enzyme expressed in this way is constant over time since it is genetically differed (Eichelbaum et al, 1986; Vincent-Viry et al, 1991). All polymorphic enzymes demonstrate large inter-racial differences in the frequency of allele variants (Kalow, 1991). In addition to the null or deletion alleles described above, other variants resulting in lowered activity and gene duplications with increased activity have also been identified (reviewed in Ingelman-Sundberg et a/, 1999). Approximately 40% of human P450-dependent drug metabolism is carried out by polymorphic enzymes, which can cause abolished, quantitatively/qualitatively

61 altered, or enhanced drug metabolism. The main causes for the variation in drug metabolism are:

(1) Genetic polymorphisms

(2) Induction or inhibition due to concomitant drug therapies or environmental factors (3) Physiological status (4) Disease states (Ingelman-Sundberg et al, 1999).

Of these, the first two appear to be of most importance for the occurrence of adverse effects or lack of therapeutic efficacy in many cases.

1.8.1 Polymorphic variations in the cytochrome P450 genes In general, alleles that cause defective, qualitatively altered, diminished or enhanced rates of drug metabolism have been identified for many of the P450 enzymes and the underlying molecular mechanisms elucidated (Figure 1.14). Polymorphisms resulting in amino acid substitutions can give rise to an unstable enzyme or an enzyme with an altered active site, causing a change in substrate specificity. Furthermore, duplication/multiplication of active genes can result in higher levels of mRNA and enzyme, and therefore increased metabolic activity. The genes encoding CYP2A6, CYP2C9, CYP2C19 CYP2D6 and CYP3A4 are functionally polymorphic, thus at least 40% of P450-dependent drug metabolism is performed by polymorphic enzymes. The relative distribution of variant alleles for these P450s differs markedly between ethnic groups, making the extent and characteristics of genetically- determined differences in drug response quite specific for the global region in question (Ingelman-Sundberg etal, 1999).

1.8.1.1 Human cytochrome P450 allele nomenclature The most accepted nomenclature system has been described in the Human Cytochrome P450 (CYP) Allele Nomenclature Committee web site (http ://www.imm.ki.se/CYPallele). Briefly, a cytochrome P450 gene is usually considered as the sequence from the transcription start site to 500 bp down stream of

62 the last exon. However, if a regulatory region has been described at a more distant part of the gene it would be considered in the gene. The wild type gene is designated by the name of the gene followed by an asterisk, the Arabic number 1 and the capital letter A (e.g. CYP3A4^1A). Any new alleles should contain nucleotide changes that have been shown to affect transcription, splicing, translation, post translation, post transcriptional and post translational modifications or result in at least one amino acid change and will be assigned by an Arabic number of higher order (CYP3A4^2, CYP3A4^3). Any mutation in regulatory region or introns with unclear function will be assigned by a capital letter closest to the previously assigned gene (e.g. CYP3A4HB, CYP3A4nC, CYP3A4H5B).

1.8.1.2 Cytochrome P450 alleles producing inactive enzymes Completely inactive alleles have been found for CYP2D6, CYP2C19 and CYP2A6. Defective alleles can be the result of gene deletions, gene conversion with related pseudogenes and single base mutations causing frame shift, missense, nonsense or splice-site mutations. The homozygous presence of such alleles leads to a total absence of active enzyme and an impaired ability to metabolise probe drugs specific for the enzyme, hence the poor metaboliser (PM) phenotype (Ingelman-Sundberg et al, 1999). The number of known defective alleles is growing and at least 30 different defective CYP2D6 alleles resulting in about 55 CYP2D6 variant genotypes have been identified (Marez et al, 1997). It appears, however, that genotyping for only the six most common defective alleles will predict CYP2D6 phenotype with about 95-99% certainty (Sachse et al, 1997; Griese et al, 1998). Individuals that lack functional CYP2D6 genes have been shown to metabolise selective CYP2D6 substrates, particularly antidepressants (Carrillo et al, 1996; Hamelin et al, 1996; Spina et al, 1997) and neuroleptics (Jerling et al, 1996), at a substantially lower rate than normal. A lack of CYP2D6 enzyme would also be expected to result in reduced therapeutic effectiveness where prodrugs requiring CYP2D6 activation are used. For example, following administration of the prodrug codeine, no trace of morphine in plasma or any analgesic effect could be observed in CYP2D6 PMs (Poulssen et al, 1996).

63 Duplicated or Deleted gene Single gene multiduplicated genes

mRNA-AAAA

mRNA-AAAA mRNA-AAAA

mRNA-AAAA

No Unstable Normal Altered substrate Higher enzyme enzyme enzyme specificity enzyme levels

Vf Vf Vf

No Reduced Normal Other metabolites metabolism metabolism metabolism possibly formed Increased CYP2D6*4,*5 CYP2D6*10 CYP2D6*1 CYP2D6*17 metabolism CYP2C19*2/3 CYP2C9*1 CyP2 0 6 *2xN

Figure 1.14 Overview of the major molecular mechanisms that can result in altered human drug metabolism (Ingelman-Sundberg et al, 1999).

Examples of common human cytochrome P450 variant alleles that have been found to cause the corresponding changes in drug metabolism are shown at the bottom of the diagram. The transcription-translation pathway resulting in normal enzyme and metabolism is shown by the thick arrows and the thin arrows represent genetically altered pathways. AAA indicates the poly (A) tail.

64 The polymorphism of CYP2C19, which causes impaired drug metabolism, affects as many as 20% of Asians but only 3% of Caucasians (Ingelman-Sundberg et al, 1999), causing impaired metabolism of S-mephenytoin and certain other drugs (Goldstein et al, 1994; de Moris et al, 1994). Today, at least six different defective CYP2C19 alleles have been identified (Ibeanu et al, 1998). Of these, CYP2C19*2 and CYP2C19*3 contain mutations that create an aberrant splice site and a premature stop codon, respectively and are the most common defective alleles. Three different defective CYP2A6 alleles have been described so far, of which CYP2A6^2 encodes an inactive enzyme resulting from a Leul60His substitution (Yamano et al, 1990). CYP2A6*3 is proposed to have been generated through a gene conversion between CYP2A6 and CYP2A7 (Femandez-Salguero et al, 1995). There are also alleles in which the CYP2A6 gene is deleted (Nunoya et al, 1999; Oscarson et al, 1999).

1.8.1.3 Cytochrome P450 alleles producing diminished or altered metabolism There are also variant alleles that cause diminished or altered drug metabolism. The most common CYP2D6 allele in the Chinese population is CYP2D6'^10, which has a Pro34Ser substitution in the proline-rich region near the NHi-terminal. This results in an enzyme that exhibits impaired folding and the expression of functional enzyme is therefore severely diminished (Johansson et al, 1994). CYP2D6'^17 (Masimirembwa et al, 1996), CYP2C9^2 (Crespi and Miller, 1997) and CYP2C9'^3 (Haining et al, 1996) are other alleles that result in cytochrome P450 enzymes with diminished capacity for drug metabolism. Regarding the CYP2C9 polymorphism for example, reports have clarified the importance of the CYP2C9*2 and CYP2C9'^3 alleles to CYP2C9-catalysed 6- and 7-hydroxylation of the anticoagulant S-warfarin. The enzyme variants, in particular CYP2C9'^3, are much less effective at warfarin hydroxylation in vitro (Crespi and Miller, 1997; Haining et al, 1996) and the clearance of S-warfarin among subjects homozygous for the CYP2C9^3 allele has been shown to be reduced by 90% compared with subjects homozygous for the wild- type allele (Carrillo et al, 1996).

1.8.1.4 Cytochrome P450 alleles producing ultra-rapid metabolism Ultra-rapid metabolism as seen in some individuals for metabolism via CYP2D6 is caused by the presence of duplicated, multi-duplicated, or tandem gene copies in the

65 genome (Johansson et al, 1993). At present, CYP2D6 alleles with two, three, four, five and 13 gene copies in tandem have been reported and the number of individuals carrying multiple CYP2D6 gene copies is highest in Ethiopia and Saudi Arabia, where up to the third of the population displays this genotype (Ingelman-Sundberg, 1999). Interestingly, the number of defective CYP2D6 gene is very low in this region. Alleles with two-to-five gene copies in tandem have likely been formed by unequal recombination between two homologous but non-allelic sequences flanking the gene. The outcome is one locus that contains two genes in tandem and a deleted gene on the other locus. By contrast, the allele containing 13 copies of the gene has probably occurred by unequal segregation and extra-chromosomal replication of acentric DNA (Lundquist et al, 1999). Subjects with 13 CYP2D6 gene copies on one allele formed a substantially higher amount of metabolite(s) from substrates specific to this enzyme. For example, extensive formation of morphine occurs if these subjects take the prodrug codeine (Hedenmalm et al, 1997) and severe abdominal pain, a typical adverse effect of morphine, was observed in an ultra-rapid metaboliser treated with codeine. Duplication of the genes encoding drug-metabolising enzymes is not restricted to CYP2D6 since duplicated glutathione-S-transferase, e.g. GSTMl genes have been identified in the GSTji locus, although this allele appears to be quite rare (McLellan et al, 1997). Another type of ultra high metaboliser genotype is not related to gene amplification, but to mutation in the promoter region of the gene.

1.8.2 Polymorphism in the CYP3A locus The CYP3A enzymes are the most abundant CYPs in human liver and small intestine. Substantial inter-individual differences in CYP3A expression, exceeding 30-fold in some populations (Watkins, 1995), contribute greatly to variation in oral bioavailability and systemic clearance of CYP3A substrates, including HIV protease inhibitors, several calcium channel blockers and some cholesterol-lowering drugs. Variation in CYP3A expression is particularly important for substrates with narrow therapeutic indices, such as cancer chemotherapeuties and the immunosuppressive eyelosporine A and tacrolimus. Such variation in CYP3A can result in clinically significant differences in drug toxicities (e.g. nephrotoxicity) and response (e.g. graft survival) (Kivisto et al, 1995). Moreover, because CYP3A metabolises oestrogens to 2-hydroxyestrone, 4-hydroxyestrone and 16a-hydroxylated oestrogens, all of which

66 have been implicated in oestrogen-mediated carcinogenicity (Huang et al, 1998), variation in CYP3A may influence the circulating levels of these oestrogens and the risk of breast eancer.

Human CYP3A activities reflect the heterogenous expression of its four members: CYP3A4, CYP3A5, CYP3A7 and CYP3A43 (Gellner et al, 2001). CYP3A5, a polymorphic form, is present to a variable extent in adult livers. CYP3A5 is believed to be present in the livers of approximately 20% of Caucasians, but a recent study suggests that CYP3A5 is expressed and may predominate in more than 50% of African-Americans (Kuehl et al, 2001). There is evidence of polymorphism in the coding (Jounaidi et al, 1996) and promoter regions (Kuehl et al, 2001) which may contribute to variation in the overall hepatic metabolism of CYP3A substrates. However, two mutations which were believed to be related to CYP3A5 promoter and an association with polymorphic CYP3A5 expression (Paulussen et al, 2000) were revealed to be actually in the promoter of the pseudogene CYP3AP1 (Finta and Zaphiropoulos, 2000). CYP3A7 is found in intestine, reproductive system and infant liver but also present in some adult livers (Schuetz et al, 1994). CYP3A43 has recently been suggested to be a non-fimctional isoform (Westlind et al, 2001).

CYP3A4, the adult-specific isoform, is considered the most important and is the most extensively studied member of the CYP3A subfamily. Although there had been no indication of genetic polymorphism in the CYP3A4 gene until 1997 (Linder et al, 1997; Lewis and Pratt, 1998; Lewis et al, 1998), investigations since then have reported inherited variation in both the promoter (Rebbeck et al, 1998; Kuehl et al, 2001; Hamzeiy et al, 2002) and coding region of the gene (Sata et al, 2000; Hsieh et al, 2001; Fiselt, et al, 2001; Dai et al, 2001; Lamba et al, in press). However, the impact of these mutations on mRNA expression or enzyme activity has not been extensively investigated. Also the proposed relationship between the CYP3A4"^1B allele (-392 A ^G ) and an increased incidence of prostate cancer was not confirmed in later studies (Westlind et al, 1999; Ball et al, 1999). Sata et al (2000) showed that the CYP3A4^2 allele (Ser222Pro) produces a lower in vivo intrinsic clearance of nifedipine, but no significant difference from the wild type enzyme activity for testosterone 6p-hydroxylation. In addition, Hsieh et al (2001) have recently reported

67 three further mutations in the coding region of the CYP3A4 gene and related them to a decreased urinary 6p-hydroxycortisol/cortisol ratio in heterozygotes. In a further study of 213 subjects, Eiselt et al (2001) have identified 18 new CYP3A4 variants of which several showed altered enzyme activity. All the recognised CYP3A alleles are now listed on in the Human Cytochrome P450 {CYP) Allele Nomenclature Conunittee Home Page (http:// www.imm.ki.se/CYPalleles).

In a more recent genetic analysis on white individuals for some of CYP3A4 variant alleles, including CYP3A4^1B, CYP3A4^2, CYP3A4H, CYP3A4^5, CYP3A4^6, CYP3A4^8, CYP3A4^11, CYP3A4^12 and C7P3A4*73, none of these alleles (except CYP3A4'^1B) were present in 30 genes from persons with extremely low enzyme activity. CYP3A4'^1B was present with an allele frequency of 5.5% but no relationship to the low enzyme activity established (Garcia-Martin et al, 2002).

1.8.3 Cytochrome P450 polymorphism and neoplastic disease Many carcinogenic compounds require metabolic activation before being capable of reacting with cellular macromolecules. Thus, individual features of carcinogen metabolism must play an essential role in the development of cancer (Raunio et al, 1995). A complicating factor is the multistage aetiology of carcinogenesis implying the involvement of many distinct events. However, it has become evident that the enzyme activating and inactivating exogenous carcinogens are involved in the aetiology of eancer (Hietanen, 1999).

Many compounds are converted to reactive electrophilic metabolites by the oxidative (mainly cytochrome P450-related) enzymes (e.g. Bartsch et al, 2000; Dehal and Kupfer, 1996). Secondary metabolism mainly involving epoxide hydrolase (Miyata, 1999), sulfotransferases (Seth et al, 2000) and aeetyltransferases (e.g. Hett et al, 1991) can also lead to the formation of the highly reactive metabolites that bind to genomic DNA. Thus, the concerted action of these enzymes may be crucial in determining the final biological effect of a carcinogen. The activity of these enzymes is modulated by many host and environmental factors. Host factors include both life­ style factors, diseases, and genetic factors while environmental factors include exposures to various chemicals as well as dietary habits (Hietanen, 1999).

68 CYP 1 Al has been implicated in the conversion of numerous polycyclic aromatic hydrocarbons into electrophilic species capable of binding covalently to DNA and has therefore been postulated to be involved in the initiation of carcinogenesis (Geneste et al, 1991; Petruzzelli et al, 1998). In addition, a restriction fragment length polymorphism located in the 3'-noncoding region of this gene {MspI) identified in the Japanese population has been associated with an increase in CYPlAl activity and an elevated risk of lung cancer (Hayashi et al, 1991; Kawajiri et al, 1993). Another polymorphism of the CYPlAl gene, linked to the Mspl polymorphism, has been identified in exon 7 and results in a substitution of valine to isoleucine in the haem-binding region (Hayashi et al, 1991) and higher enzyme activity (1.5-fold) (Kawajiri et al, 1993). It is associated with an elevated risk of developing lung and endometrial cancers (Esteller et al, 1997; Spivack et al, 1997), although opposing results have been shown as well (reviewed by Drahushuk et al, 1998).

Numerous studies have demonstrated an association of certain CYP2D6 genotypes with lung cancer risk and poor metabolisers (defined by either genotyping or phenotyping) have a lower risk than other genotypes (Bouchardy et al, 1996; Stacker et al, 1995). The risk was dose-dependent with smoking and in persons with low or medium CYP2D6 activity no such an increase was found even at very high smoking levels. CYP2D6 gene mutations may also be involved in an increased risk of liver cancer since extensive metabolisers appear to have 6.4-fold greater risk of primary liver eancer in comparison with poor metabolisers (Agundez et al, 1995).

CYP3A4 and CYP3A7 also mediate the metabolism of hepatocareinogens, including mycotoxins, aflatoxin Bi and 2,4-dichlorophenol. Over expression of these cytochrome P450s in cultured human hepatoma cells is associated with an inerease in afiatoxin-induced mutations, particularly in the P53 tumour suppressor gene (Kondoh et al, 1999). Similarly, the presence of CYP3A5 in normal proximal tubular epithelium has been suggested as a eausative factor in renal tumour development (Murray et al, 1999).

69 1.9 Concluding remarks Presently, some of the significant polymorphisms causing genetic differences in phase I drug metabolism are known and therapeutic failures or adverse drug reactions caused by these polymorphism genes can, to a great extent, be foreseen. This information is currently being used by the pharmaceutical industry during drug development. The majority of eompanies regularly genotype the patients involved in their clinical trials in order to obtain more information regarding pharmacokinetics properties and observed side effects. Furthermore, eandidate drugs that are selectively metabolised by polymorphic enzymes are often eliminated early in drug screening. Therefore, fewer problems with polymorphic variation during drug therapy will oecur in the future. However, owing to the rapid development of efficient and inexpensive methods for genotyping, plus the need to genotype a patient only onee a lifetime, it might be advisable to include drug metabolism genotype in the patient’s medical record. In the future, this could also include the genotypes of transport proteins and drug reeeptors whieh taken together would provide the physician with highly predictive genetic information concerning the likelihood of successful drug therapy (Ingelman-Sandberg et al, 1999).

1.10 Aims and objectives of this project It is clear that inter-individual variation in the level or activity of the cytochrome P450 enzymes may play an important role in the development of both adverse drug reactions and diseases such as cancer. Sinee CYP3A4 represents a significant proportion of the hepatie cytochrome P450 content, identification of the genetic polymorphisms and analysis of their effeets on enzyme expression will be of great value in elucidating the genetic basis of inter-individual variation. Although polymorphic variations have been reported in both 5' regulatory and eoding regions of the CYP3A4 gene, those investigated so far do not appear to make a major contribution to CYP3A4 variation as a whole.

In this projeet, in order to identify novel genetie variations in the proximal and distal 5'regulatory regions of the CYP3A4, a new population screening will be performed. Functional analysis of the novel CYP3A4 alleles, using a reporter gene assay, will also be performed.

70 (1) 100 blood samples will be collected from suitable volunteers for the purpose of genomic DNA extraction.

(2) Proximal (1141 bp) and distal (300 bp) 5'regulatory regions of the CYP3A4 gene will be isolated from genomie DNAs using PCR amplifieation.

(3) Screening for mutations in the resulting PCR produets will be carried out using a non-radioaetive single strand conformation polymorphism (so called ‘cold SSCP’) and confirmatory sequencing.

(4) A reporter gene expression system will be developed by cloning the wild type and mutant 5' regulatory regions of the CYP3A4 gene into a vector containing the human secreted alkaline phosphatase (SEAP) eDNA.

(5) The individual reporter eonstructs will be transfeeted into human liver (HepG2, HuH7) and intestinal (Caeo-2) cell lines. Xenobiotic modulation of CYP3A4 promoter activity will be measured by ehemiluminescent SEAP assay.

71 CHAPTER TWO

MATERIALS AND METHODS

2.1 Materials

2.1.1 Chemicals and reagents All chemicals and reagents used in the experimental work were purchased from Sigma-Aldrich Ltd (Dorset, England) unless speeified below.

Acrylamide 40% and Bis-acrylamide 2% stock solutions were purchased from Promega Corporation (Madison, WI, USA).

Bactriologie agar. Phosphate Buffered Saline tablets, Tryptone and Yeast extraet were supplied by OXOID LTD, (Hampshire, England).

FuGENE 6 transfection reagent was purchased from Roche Molecular Biochemicals (Indianapolis, USA).

Multipurpose agarose was provided from FMCproducts (Rockland, Maine, USA).

SYBR® Gold nueleic acid stain (lOOOOx concentration in DMSG) and SYBR® gel stain photographic filter were supplied by Molecular Probes (Oregon, USA).

2.1.2 Enzymes and DNA Markers All restriction enzymes, T4 DNA ligase, 1 kb DNA ladder. Lambda DNAJHindiW DNA marker were supplied by Promega Corporation (Madison, WI, USA).

2.1.3 Kits Advantage®-HF 2 (high fidelity) PCR kit was purehased from Clontech Laboratories Inc (Palo Alto, CA, USA).

72 TripleMaster PCR system was supplied by Eppendorf AG (Hamburg, Germany).

Aurora’^"' AP Chemiluminescent Reporter Gene assay system for measuring alkaline phosphatase was purchased from ICNBiomedicals Inc (Costa Mesa, CA, USA).

Wizard® genomic DNA purification and Wizard® Plus SV Minipreps DNA purification kits were purehased from Promega Corporation (Madison, WI, USA).

Endofree Plasmid Maxiprep, QIAquick PCR purification and QIAquick gel extraetion kits were supplied by QIAGEN (Hilden, Germany).

Ultra Clean™ 15 DNA purification kit was purchased from MO BIO Laboratories Inc (Carlsbad, CA, USA).

2.1.4 PCR primers The primers were purehased from MWG Biotech AG (Ebersberg, Germany). On arrival the primer tubes were centrifuged for a few seeonds to collect the dry DNA at the bottom of the tube. An appropriate volume of TE buffer or nuclease-free water was added to the tubes and, after rehydration for 2 minutes, the solution was vortexed for 15 seconds and stored at -20 ”C.

2.1.5 Human cell culture reagents HepG2 (a human hepatocyte carcinoma cell line originally established from a 15 years old Caucasian male) and Caco-2 (a human colon adenocarcinoma cell line isolated from a primary colon tumour in a 72-year old Caucasian male) were supplied by European Collection of Animal Cell Cultures (ECACC) (Salisbury, Wiltshire UK) as frozen cultures. On receipt of the frozen cultures the cells were grown up in bulk and aliquots were frozen to be used as a bank for subsequent work. HuH7 (a human hepatoeellular careinoma cell line originally established from a 57 years old Japanese male) was a gift in a 75 cm^ flask from a colleague in our laboratory.

73 Minimum essential medium (MEM with Earle's salts), L-glutamine 200 mM (lOOx), foetal bovine serum, gentamicin (10 mg/ml) and trypsin-EDTA solutions were purchased from Gibco BRL Life Technologies Inc (Paisley, Seotland).

2.1.6 Instrumentation PCR amplifications were performed using either the DNA ENGINE PTC-200 (MJ Research Inc, Watertown, MC, USA) or GeneAmp® PCR system 9700 {PE Applied Biosystems, Foster City, CA, USA).

A RunOne™ Electrophoresis cell, Embi Tec (San Diego, CA, USA) was used for agarose gel electrophoresis of DNA preprations.

Chemiluminescent assays were carried out on a Lumicount Microplate Lumometer Packard Instrument Company (Meriden, CT, USA).

Polyacrylamide gel electrophoresis was performed using a Bio-Rad mini Protean II™ set, Bio-Rad Laboratories (Hercules, USA).

2.1.7 Bacteria and Plasmids Competent TOPI OF' E. coli cells were purchased from Invitrogen (Carlsbad, CA, USA).

The pSEAP2-Basic vector was supplied by Clontech Laboratories Inc (Palo Alto, CA, USA). This plasmid was used to develop pX-SEAP2 (eontaining xenobiotic responsive enhaneer module, XREM, of the cytochrome P450 3A4 gene) and pXP-SEAP2 (eontaining XREM and 1141 bp of proximal promoter of the same gene) plasmids.

The human pregnane X reeeptor plasmid (pSG5-hPXRAATG) was a gift from Dr. Steven Kliewer {GlaxoSmithkline Ltd). This expression vector was generated by PCR amplifieation and subcloning of 1.3 kb of the hPXR cDNA, modified at the first amino aeid (CTG —> ATG), into the pSG5 expression vector (Lehman et al, 1998).

74 Positive control, alkaline phosphatase reporter vector (pCMV-cSPAP) was supplied by Glaxo Smithkline Ltd (Dr. S. Hood).

Restriction maps of the plasmids are given in Figures 2.1 to 2.5.

2.1.8 Subject recruitment Study subjects were ehosen from among healthy male and female volunteers working at the University of Surrey. After obtaining phlebotomy authorisation aecording to the University of Surrey regulations, an advertisement was prepared. In the first stage only 40 subjects participated in the study. For recruitment of additional volunteers via payment of an honorarium, approval from the University of Surrey Advisory Committee on Ethics was obtained.

Following this, recruitment of subjects (finally 41 females and 59 males) was completed. They were mainly from 2 populations; 32 Iranians (including myself) and 58 Caucasians (mostly British). The other 11 subjeets were from Arab or South East Asian countries. Each subject read and signed the University of Surrey consent form for donation of blood and urine for research purposes.

2.1.9 Blood sample preparation 20 ml of blood was taken, via phlebotomy, from each volunteer. Blood samples were collected into 2 separate 10 ml EDTA eontaining tubes. One of them was stored at -70 °C and the other was kept at -20 °C for a short period and used for genomic DNA extraction.

75 Xhol 33 Mlul 16 EcoRI H indlll 54 CS NotI4511 TB

fl ori

780 SEAP A m p’^ pSEAP2-Basic 4677 bp

3117 1559,

X bal 1602

2338 SV40 Poly A

Sail 1870 BamHI 1864 pUC ori

Figure 2.1 Functional map of pSEAP2-Basic {Clontech Laboratories Inc, CA, USA), a plasmid that has been used for constructing pX-SEAP2 and pXP- SEAP2 plasmids. Amp^: ampicillin resistance gene fl ori: origin of replication of the filamentous phage fl MCS: multiple cloning site showing the restriction enzymes that were used for cloning of the XREM and proximal promoter region of cytochrome P450 3A4 gene pUC ori: origin of replication SEAP: cDNA for human secreted alkaline phosphatase SV40 Poly A: simian virus 40 late mRNA polyadenylation signal TB: transcription blocker (composed of a synthetic polyadenylation site and a transcription pause site from the human a2 globin gene)

76 M C Sl XREM MCS2 fl ori TB 1

4465 497

3969 993 SEAP pX-SEAP2 Amp^ 4966 bp

3473 1489

2977 1985

2481

pUC on SV40 poly A

Figure 2.2 Functional map of pX-SEAP2, a plasmid containing the XREM region of the cytochrome P450 3A4 gene.

Amp^: ampicillin resistance gene

fl ori: origin of replication of the filamentous phage fl

MCS: multiple cloning site

pUC ori: origin of replication

SEAP: cDNA for human secreted alkaline phosphatase

SV40 Poly A: simian virus 40 late mRNA polyadenylation signal

TB: transcription blocker (composed of a synthetic polyadenylation site and a

transcription pause site from the human a2 globin gene)

XREM: CYP3A4 distal xenobiotic responsive enhancer module

77 M CSl XREM fl ori

TB 1

Amp 5482 610 3A4 Prom.

Ampr 4873 1219 pXP-SEAP2 6099 bp

4264 1828

2437 pUC ori 3046 SEAP

SV4G ployA

Figure 2.3 Functional map of pXP-SEAP2, a plasmid containing the XREM and 1141 bp of proximal promoter regions of the cytochrome P450 3A4 gene.

Amp*^: ampicillin resistance gene

fl ori: origin of replication of the filamentous phage fl

MCS: multiple cloning site

pUC ori: origin of replication

SEAP: cDNA for human secreted alkaline phosphatase

SV40 Poly A: simian virus 40 late mRNA polyadenylation signal

TB: transcription blocker (composed of a synthetic polyadenylation site and a

transcription pause site from the human a l globin gene)

3A4 Prom: 1141 bp proximal promoter region of cytochrome P450 3A4

XREM: CYP3A4 distal xenobiotic responsive enhancer module

78 San 2

SV40

I eta-globin intron 4843 539

,T7

t— EcoRI 1044

pSGS-hPXR 5383 bp

hPXR cDNA Amp'

2691

Poly A BamHI 2358

Xbal 2517 Sail 2511

Figure 2.4 Map of pSG5-hPXR (a gift from Dr. Steven Kliewer, Glaxo Smithkline Ltd) a plasmid encoding the human pregnane-X- receptor.

Amp^: ampicillin resistance gene

fl ori: origin of replication of the filamentous phage fl

hPXR cDNA: hPXRAATG, the human pregnane X receptor cDNA with a

modified codon 1 (CTG —> ATG)

ori: origin of replication

SV40: simian virus 40 promoter

T7: T7 RNA polymerase promoter

79 Sal I (5934)

on CMV Promoter

5374 598 EcoRI (978)

4777 1195 Amp pC M V -cSPA P SPAP cDNA 5976 bp

4180 1792 Sea I (4379) EcoRI (1652)

3583 2389

2986 Xba I (2254) SV40 t-intron & poly (A) sites

Figure 2.5 Functional map of pCMV-cSPAP control alkaline phosphatase expressing plasmid (was supplied by Glaxo Smithkline Ltd, Dr. S. Hood). Amp^: ampicillin resistance gene CMV: eukaryotic cytomegalovirus strong promoter ori: origin of replication SPAP cDNA: cDNA for human secreted placental alkaline phosphatase SV40: simian virus 40 2.2 Molecular biology

2.2.1 DNA extractions Genomic and plasmid DNA can be isolated from cells by disrupting the tissue and then exploiting the difference in properties between DNA, protein and other constituents. The techniques require the use of partition and precipitation to purify the DNA sample. All reagents should be the best available and made up in high- quality water (Towner, 1991).

The isolation and purification of DNA is a key step for most protocols in molecular biology. Methods to purify DNA generally fall into two broad categories. The first category covers the isolation of recombinant DNA constructs such as plasmids or bacteriophage after propagation by the host organism. These techniques form the basis of molecular cloning experiments and constitute the most frequently used protocols in molecular biology laboratories. The second type of DNA purification involves the isolation of chromosomal or genomic DNA from prokaryotic or eukaryotic organisms. These purification techniques have greatly facilitated studies of complex genomes, particularly by enabling the construction of genomic DNA libraries representative of many different species. In both types of DNA isolation, further purification and fractionation of DNA is often necessary; for example, following a restriction enzyme digestion or amplification of specific sequences. This may be conveniently accomplished by gel electrophoresis and purification of the fragment of interest (Towner, 1991).

2.2.1.1 Genomic DNA extraction Genomic DNA can be obtained from any microorganism, plant or animal at any time during development and provides DNA which contains a copy of every gene from the organism. Genomic DNA is easy to isolate and characterise but will be of little use unless it is of high molecular weight, readily cleaved by a variety of restriction enzymes and clonable.

2x400 |xl of each blood sample were used to DNA extraction using Wizard® genomic DNA purification kit from Promega. For 400 pi sample volume, 1.2 ml Cell Lysis Solution was added to a sterile 2 ml microcentrifuge tube. The tube of blood was

81 gently rocked until thoroughly mixed before transferring to the tube containing Cell Lysis Solution. The tube was then invert 5 to 6 times to mix. The mixture was incubated for 10 minutes at room temperature (the tube was inverted 2 to 3 times once during the incubation) to lyse the red blood cells. The resulting lysate was centrifuged at 14000xg for 20 seconds at room temperature. The supernatant was removed as much as possible without disturbing the visible white pellet.

If blood samples had been frozen, the above steps were repeated until pellet was white. There may be some loss of DNA in frozen samples. The tube was then vortexed vigorously until the white blood cells were re-suspended (10-15 seconds). 400 pi Nuclei Lysis Solution was added and the solution was pipetted 5 to 6 times to lyse the white blood cells. The solution then became very viscous. If clumps of cells were visible after mixing, the solution was incubated at 37 °C until the clumps were broken up. If the clumps were still visible after 1 hour, additional Nuclei Lysis Solution (about 130 pi) was add and the incubation was repeated.

RNase Solution (2 pi) was added to the nuclear lysate and the sample was mixed by inverting (25 times). The mixture was incubated at 37 °C for 15 minutes and then was cooled to room temperature.

Protein Precipitation Solution (130 pi) was added to the nuclear lysate and vortexed vigorously for 10-20 seconds. Small protein clumps may be visible after vortexing. Note: If it was necessary to use additional Nuclei Lysis Solution, a total of 170 pi of Protein Precipitation Solution was added. The tube was centrifuged at 14000xg for 3 minutes at room temperature. A dark brown protein pellet should be visible. The supernatant was transferred to a clean 2 ml microcentrifuge tube containing 400 pi of room temperature isopropanol.

The solution was gently mixed by inversion until the white thread-like strands of DNA formed a visible mass. The tube was centrifuged at 14000xg for 1 minute at room temperature. The DNA was visible as a small white pellet. The supernatant was removed and 400 pi of room temperature 70% ethanol was added. The tube was gently inverted several times to wash the DNA pellet and the inside of the

82 microcentrifuge tube. The tube was centrifuged again at 14000xg for 1 minute at room temperature. The ethanol was then carefully aspirated using a pipette tip. The DNA pellet was very loose at this point and care was required to avoid aspirating the pellet into the pipette. The tube was inverted on a clean absorbent paper and the pellet was air-dried for 10-15 minutes.

Finally, DNA Rehydration Solution (150 pi TE) was added to the tube and the DNA was re-hydrated by incubating at 65 °C for 1 hour. The solution was periodically mixed by gently tapping the tube. Alternatively, the DNA could be re-hydrated by incubating the solution overnight on the bench at room temperature or in the cold room. DNA quality was checked by agarose gel electrophoresis and the quantity was estimated by spectrophotometry.

2.2.1.2 Miniprep plasmid DNA extraction and purification It is quite straightforward to isolate plasmid DNA from E. coli and this can be performed on either small or ‘mini-prep’ scale to obtain sufficient material for cursory analysis, or on a large, ‘maxi-prep’ scale to provide stock of plasmid for longer-term use. The isolation of plasmids is performed in essentially three stages. The bacterial cell wall is first weakened by the action of lysozyme, and the cells then lysed by EDTA and detergent at high pH. Finally, the insoluble cell debris consisting of genomic DNA and protein is precipitated at high salt concentration and centrifuged down, leaving the plasmid DNA in solution (Towner, 1991).

Wizard® Plus SV Minipreps DNA purification kit takes advantage of the benefits of alkaline lysis but eliminates the need for organic extraction and differential precipitation by employing a proprietary silica-based resin to bind the plasmid DNA in the cleared alkaline lysates. The principle of the method is based on selective adsorption of plasmid DNA to the resin in the presence of high concentrations of chaotropic salts and allows for elution of the DNA, after efficient removal of contaminants, with low ionic strength solutions such as TE buffer or water.

1 to 5 ml of bacterial culture was centrifuged for 5 minutes at lOOOOxg in a bench centrifuge. The supernatant was poured off and the tube blotted upside down on a

83 paper towel to remove the residual liquid. The pellet was suspended in 250 pi of Wizard® Plus SV Cell Resuspension Solution by pipetting. The resuspended cells were transferred into a 1.5 ml micro-centrifuge tube(s). 250 pi of Wizard® Plus SV Cell Lysis Solution was added and after mixing (by inverting 4 times), the tube was incubated for 1 to 5 minutes at room temperature until the cell suspension became clear. 10 pi of Alkaline Protease Solution was added into the tube and incubated for 5 minutes after mixing (by inverting 4 times). Then 350 pi of Wizard® Plus SV Neutralization Solution was added and immediately mixed by inverting the tube 4 times. The resulting bacterial lysate was centrifuged at 14000xg for 10 minutes at room temperature.

Plasmid DNA purification units were prepared by inserting one Wizard® Plus SV Miniprep Spin Column into one 2 ml Collection Tube for each sample. The cleared lysate was transferred to the prepared Wizard® Plus SV Miniprep Spin Column, by decanting, and centrifuged at 14000xg for 1 minutes at room temperature. Wizard® Plus SV Miniprep Spin Column was removed from the tube and the flow through was discarded from the Collection tube. After reinserting the Spin Column into the Collection Tube, 750 pi of Wizard® Plus SV Miniprep Spin Column Wash Solution (previously diluted with 95% ethanol) was added to the Spin Column. Centrifugation at 14000xg for 1 minute at room temperature and removal of the flow through was performed again. 250 pi of Wizard® Plus SV Miniprep Spin Column Wash Solution was then added and centrifuged at 14000xg for 2 minutes at room temperature. Finally, the Wizard® Plus SV Miniprep Spin Column was transferred to a new, sterile 1.5 ml micro-centrifuge tube. The plasmid DNA was eluted by adding 100 pi of Nuclease-Free Water and centrifuged at 14000xg for 1 minute at room temperature.

2.2.1.3 Endotoxin-free Maxi Prep DNA purification Endotoxins are lipopolysaccharide (EPS) components of the lipid portion of the outer layer of the cell membranes of gram-negative bacteria such as E. coli (Rietschel and Brade, 1992). Endotoxins are released during the lysis step of plasmid purification and significantly reduce transfection efficiency in sensitive cultured cells (Weber et al, 1995). Plasmid DNA purified with the Endo Free Plasmid Maxi Kit contains

84 negligible amounts of LPS (less than 0.1 endotoxin units/pg plasmid DNA) due to the use of a special ‘endotoxin removal’ buffer that prevents LPS molecules from binding to the resin in the purification tips (QIAGEN kit protocol). DNA purified by this method can be used directly for transfection of mammalian cells in culture without the need for ethanol precipitation.

The Maxiprep plasmid purification technique is more time consuming and uses relatively large volumes of media, but results in large quantities of very pure plasmid DNA. The rationale of the method is similar to that described for the miniprep preparation, but the crucial purification step entails more complex resin binding methods (Towner, 1991).

The bacterial suspension from the maxi-culture was centrifuged at 6000xg for 15 minutes at 4 ”C and the resultant pellet was suspended in 10 ml of buffer PI (see Appendix 1 for the kit components). 10 ml of buffer P2 was added and mixed with the suspension by gentle inversion 4 to 6 times and then incubated for 5 minutes. Then 10 ml chilled buffer P3 was added to the lysate, and mixed immediately by inversion (4 to 6 times). The lysate was poured into a QIAFilter Maxi Cartridge and incubated at room temperature for 10 minutes after which it was gently filtered using the piston supplied and the filtrate was collected in a 50 ml tube. After adding 2.5 ml of buffer ER and mixing by inversion (10 times), the solution was incubated on ice for 30 minutes, during which a QIAGEN-tip 500 was equilibrated by applying 10 ml of buffer QBT. The cleared lysate was then applied to the tip, allowed to enter the resin by gravity flow, and was washed twice with 30 ml of QC buffer. The DNA was eluted with 15 ml of buffer QN. 10.5 ml of room temperature isopropanol was added to the eluted DNA, mixed and centrifuged immediately at 15000xg for 30 minutes at 4^C. After discarding the supernatant, the DNA pellet was washed with 2.5 to 5 ml of endotoxin-free, room temperature 70% ethanol and centrifuged at 15000xg for 10 minutes. The supernatant was carefully discarded; the pellet was air-dried for 5 minutes and suspended in suitable volume (200 to 500 pi) of endotoxin-free TE buffer.

85 2.2.1.4 ültraCIean 15 DNA Purification kit from gels and solutions Applications such as cloning, labeling and sequencing of DNA frequently require the purification of DNA fragments from agarose gels or amplification reactions. The gel extraction kit was provided by MO BIO Laboratories Inc (Carlsbad, CA, USA). It includes ULTRA SALT, ULTRA WASH solutions and ULTRA BIND silica-based suspension.

After weighing the gel slice into a 1.5 ml microcentrifuge tube, 3 volumes of ULTRA SALT was added (e.g. 0.3 ml for 0.1 g of gel) and mixed well. The mixture was incubated at 55 ”C while mixed occasionally by inverting until the gel melted (approximately 5 minutes). The ULTRA BIND suspension was vortexed until homogeneous (about 30 seconds). 7 pi was added to the melted gel mixture and incubated at room temperature for 5 minutes. At this stage binding of DNA to silica occurs. The mixture was mixed several times during this binding step by inversion. The mixture then was centrifuged for 5 seconds and the supernatant removed into a new microcentrifuge tube (if the DNA does not bind, it can be recovered from this supernatant). The pellet was resuspended in 1 ml of ULTRA WASH and centrifuged for 5 seconds. The supernatant was discarded and the pellet was washed and centrifuged again for 5 seconds. All traces of ULTRA WASH were removed by aspirating with a narrow pipette tip. The pellet was resuspended in water or TE and mixed by pipetting until homogeneous. The suspension was incubated for 5 minutes at room temperature to ensure that elution was complete. After centrifuging for 1 minute, the clear DNA containing supernatant was collected and stored at 4 °C.

2.2.1.5 Purification of PCR products using QIAquick PCR Purification Kit PCR products used for subsequent applications, such as sequencing and cloning, should be purified to remove primers, nucleotides and polymerases. Silica gel based membranes have selective binding properties and give efficient recovery of DNA. DNA adsorbs to the silica-membrane in the presence of high salt concentrations while contaminants pass through the column (Manufacturer’s manual).

Five volumes of Buffer PB were added to one volume of the PCR reaction and mixed. A QIAquick spin column was placed in a provided 2 ml collection tube.

86 To bind DNA, the sample was applied to the QIAquick column and centrifuged for 30 to 60 seconds. The flow-through was discarded and the QIAquick column was placed back into the same tube. To wash, 0.75 ml Buffer PE was added to the QIAquick column and centrifuged for 30-60 seconds. The flow-through was discarded and the QIAquick column was placed back. The column was centrifuged for an additional one minute at maximum speed. The QIAquick column was placed in a clean 1.5 ml microcentrifuge tube. To elute DNA, 50 |il of Buffer EB (10 mM Tris.Cl, pH 8.5) was added to the centre of the QIAquick membrane and the column was centrifuged for one minute.

2.2.2 Agarose gel electrophoresis of DNA Due to its negative charge, DNA will migrate toward the positive pole (anode) of an electric field. This property is used to separate and size the fragments of DNA by electrophoresing them through an agarose gel in a running buffer. The smaller molecules travel more easily through the gel matrix, whilst the larger molecules are retarded, thus they separate according to size. Agarose gels are the most popular medium for the electrophoresis of medium and large-sized nucleic acids. In these gels typical agarose concentrations fall within the range 0.3-2.5%. The concentration used depending upon the sizes of nucleic acid molecules to be separated (Andrews, 1991).

1% Electrophoresis gels were made by dissolution of Ig of agarose in 100 ml Ix TAE buffer (0.04 M Tris-acetate and 0.001 M EDTA) electrophoresis buffer using a microwave oven. After cooling the solution to about 60 °C, ethidium bromide was added (from a stock solution of 10 mg/ml) to a final concentration of 0.5 |Lig/ml and was mixed thoroughly. Enough of the solution was used, together with a slot-making comb, to make a gel of 3 to 5 mm thickness. Usually 30 to 45 minutes at room temperature was enough for an agarose gel to set. The comb was then carefully removed and the gel was mounted in the electrophoresis tank (mini gel, RunOne'^'^ electrophoresis cell from Embiotec, Sandiego, California). Enough electrophoresis buffer (Ix TAE) was added to the tank to cover the gel to a depth of about 1 mm.

87 5 |xl DNA samples (approximately 50 to 200 ng) were mixed with 1 pi of loading dye (bromophenol blue 0.35%, Xylene cyanol FF 0.25% and 50% glycerol in water) and loaded into the slots. The same amount of a 1 kb DNA ladder from Promega was also added into one of slots in order to estimate the size of the DNA in the samples. The gel was run at 2.5 to 5 V/cm until the bromophenol blue and xylene cyanole FF had migrated the appropriate distance through the gel (based on the expected DNA sample size). After electrophoresis was completed the gel was photographed under UV light.

2.2.3 Restriction enzyme digestion of DNA The first step in processing DNA for a genetic engineering experiment is the generation of smaller and more manageable fragments. Almost without exception, this is now achieved by use of sequence-specific bacterial endonucleases called restriction enzymes. The palindromic substrate nucleotide sequence at which each of several hundred restriction enzymes digests double stranded DNA is known. The manner in which the enzymes digest the DNA (leaving a 5' protruding sequence, a 3' protruding sequence, or a blunt end) is also known. Appropriate complimentary termini can also be generated by two different enzymes (Gannon and Powell, 1991).

The restriction digest reaction mixture consisting of the following ingredients was incubated at 37 ”C for 1 to 4 hours:

Restriction enzyme lOx buffer 2 pi Bovine serum albumin, acetylated (1 mg/ml) 0.5 pi DNA sample (0.2 pg/pl) 1 pi Restriction enzyme (10 unit/pl) 1 pi Nuclease-free water up to 20

To stop further effects of the restriction enzyme or carry out digestion with another enzyme the reaction mixture was heated at 65 °C for ten minutes {Xhol, EcoRI and Hindlll) or was purified (Mlul) using QIAquick PCR Purification Kit (section

2.2.6.1). 2.2.4 Polymerase chain reaction (PCR) Molecular biology relies on techniques that enable the detection or capture of minute quantities of nucleic acids. The use of radioisotopes and later non-radioisotope alternatives provides methods to detect and track nucleic acids. The cloning of nucleic acids into high copy number vectors allows amplification of DNA sequences in living cells, providing a nearly unlimited source of these DNA molecules for further manipulation. With the introduction of the polymerase chain reaction (PCR), more sensitive levels of detection and higher levels of amplification of specific sequences are achieved, and in less time compared to previously used methods (Kosher and Wilson, 1991).

PCR is a relatively simple technique by which a DNA or cDNA template is amplified many thousand or million-fold quickly and reliably. By amplifying just a small portion of a target nucleic acid, a researcher effectively isolates that portion from the rest of the nucleic acid in the sample, as with the traditional cloning methods. The PCR process generates sufficient material for subsequent experimental analysis. The entire amplification can now been performed in vitro as opposed to standard cloning procedures. While most biochemical analyses, including nucleic acid detection with radioisotopes, require the input of significant amounts of biological material, the PCR process requires very little. These features make the technique extremely useful, not only in basic research, but also in commercial uses including genetic identity testing, forensics, industrial quality control, and in vitro diagnosis. In order to analyse plasmid DNAs or gene promoter in genomic DNA, PCR reactions were performed using the appropriate primers (Kosher and Wilson, 1991).

2.2.4.1 Primer design Selecting the correct primers is one of the most important steps in designing a PCR experiment. The primer set should efficiently hybridise to the target sequence with as little hybridisation as possible to other sequences that are also present in the sample. In general, oligonucleotides between 18 and 30 bases are extremely sequence- specific, provided that the annealing temperature is optimal and they have a G+C content of 45-60%. The 3'-ends of the primers should not be complementary to avoid the production of primer-dimers in the reaction and care should be taken to

89 exclude structures that would produce internal secondary structure. The annealing temperature for the primer pair is generally calculated as 2 to 5 °C lower than the estimated melting temperature (Tm) and during optimisation the suitable annealing temperature will be achieved based on practical results. Differences of 4-6 °C between forward and reverse primers do not seem to affect the yield of PCR, however, ideally the annealing temperature of each primer should match and be within the 55 °C to 72 °C range. The inclusion of a G or C residue at the 3'-end of each primer helps to ensure correct binding at the 3'-end due to the stronger hydrogen binding of G and C residues (‘GC clamping’). 100% complimentarity between primer and template is not necessaiy for polymerase-catalysed extension to occur. However, to ensure stable annealing, the primers should be as complimentary to the desired DNA sequence as possible (Kidd and Ruano, 1995).

2.2.4.2 PCR optimisations Polymerase chain reactions should be optimised to yield one amplified product band. In an optimisation experiment, important factors such as annealing temperature, or polymerisation temperature, reaction buffer components (especially Mg^'^ concentration), deoxynucleotide concentration, type of thermo-stable DNA polymerase, DNA template quality and primer/template concentrations are examined. However, conunercially available PCR kits have reduced the need for most of this time consuming effort. But even with the kits, template concentration, DNA polymerase concentration and polymerisation temperature are important factors that should still be optimised. In the case of multiple band appearances in the electrophoresis gel, decreasing template and polymerase concentration and increasing the annealing temperature will often prevent the non-specific amplifications (Kidd and Ruano, 1995).

2.2.4.3 PCR amplification of the 5' regulatory and coding regions of the CYP3A4 gene Specific primers were designed to amplify the proximal regulatory (Figure 2.6) and distal enhancer XREM (Figure 2.7) regions of the CYP3A4 gene and their relative positions are shown in Table 2.1. The proximal 1141 bp 5' regulatory region was amplified as 3 short overlapping segments to aid the SSCP analysis (Figure 2.6).

90 Table 2.1 Primer pairs used for PCR amplification of the CYP3A4 5' regulatory and XREM regions.

Region Sequence Position* Size (bp)

5'proximal regulatory PI: 5 -GACCACTGCCCCATCATTGC-3' 424 P2: 5'-GCTGGTGGAGTTGACTTAGC-3' -1201/-778

P3: 5 -GCACAGCCAAGAGCTCTGGC-3' -884/-391 494 P4: 5'-CTTGCCCTTGTCTCTATGGC-3'

P5: 5-GGCACAGGCACACTCCAGGC-3' -493/-61 433 P6: 5'-TGCTGGGCTATGTGCATGGAGC-3'

Distal XREM P7: 5-ACTTCATGCAAAAATGCTGG-3' -79727-7673 300 P8: 5 -GTTCTTGTCAGAAGTTCAGC-3'

Numbering system defines the first coding AT G as position +1.

P3 PS -1201 -4 9 3 Coding Region 6177 8 -3 9 1 -6 1-7 P4 P6

Figure 2.6 The CYP3A4 proximal promoter region and position of the PCR primer sets.

P7 - 7 9 7 2----- > -7939 1------XREM region (230 bp) ------1 -7710 <------7673 PS

Figure 2.7 The CYP3A4 distal XRFM region and position of the PCR primer set.

91 All PCR amplifications were carried out in a 50 |il reaction volume, using the Advantage-HF 2 (high fidelity) PCR kit (Clontech, Palo alto, California, USA). This kit is an AdvanTaq™-based system designed to amplify cDNA or genomic DNA templates with exceptionally high fidelity. The Advantage-HF 2 Polymerase Mix is a high-performance PCR system that combines AdvanTaq DNA polymerase (a 5'-exonuclease-deficient genetically modified variant of Taq polymerase) with a minor amount of proof-reading polymerase (such as Pfu DNA polymerase) and TaqStart™ Antibody. The dual-polymerase system provides both high sensitivity and flexibility in amplifying a wide range of DNA templates, and TaqStart provides automatic hot-start PCR (User manual).

Each reaction contained:

lOxHF 2 PCR buffer 5 pi lOx HE 2 dNTP mixture 5 pi Relevant primer mixture (15 pmol each) 6 pi 50x Advantage-HF 2 polymerase mixture 1 pi Genomic DNA template 100-200 ng (1 pi) Nuclease-free water up to 50 pi

The reaction conditions for the CYP3A4 proximal 5' regulatory region segments were: 94 °C for 90 seconds (initial dénaturation) 1 cycle 94 °C for 30 seconds (dénaturation) 65 °C for 30 seconds (annealing) > 30 cycles 72 ®C for 1 minute (extension) 72 °C for 7 minute (final extension) 1 cycle

The same conditions (except for the annealing temperatures) were used to amplify the distal XREM region and the coding exons. The annealing temperature used for amplification of the distal XREM region was 60 °C. PCR primers and annealing temperatures used for amplification of the individual CYP3A4 exons are shown in Table 2.2.

92 Table 2.2 Primers used for PCR amplification of the CYP3A4 exons.^

Primer pairs Sequence Size cDNA PCR annealing position^ temp. °C

Exon 1-A* 5'-GTGGAGAAGCCTCTTCCAACTG-3' 357 -216/71 62 Exon 1-B* 5'-GGGAAAGAGAGGCCTGATTAGC-3'

Exon 2-A 5'-CATTGCCGTCAGAGTTACTG-3' 439 72/165 60 Exon 2-B 5-CTGAGGCAAACCTGAGGTTC-3'

Exon 3-A 5'-GCTTCCTCTAACTGCCAGCAAG-3' 365 166/218 62 Exon 3-B* 5-GGCATGCAGATTCCCATTGC-3'

Exon 4-A* 5'-GTGTCAGACTCTTGCTGTGTG-3' 387 219/318 60 Exon 4-B 5'-GAAGTGGACGTGGAACCTTC-3'

Exon 5-A 5'-CATCACCCAGTAGACAGTCAC-3' 351 319/432 60 Exon 5-B 5-GGCAGCTCAAATTCAGTGGAC-3'

Exon 6-A* 5'-TGTCCTTCTGGGACTAGAGTC-3' 351 433/521 60 Exon 6-B* 5-GGGAGAAGATCCTTTTCCTCC-3'

Exon 7-A 5-CCTGTTGCATGCATAGAGG-3' 366 522/670 58 Exon 7-B 5-GATGATGGTCACACATATC-3'

Exon 8-A 5'-GCTTCCAGTTGAGAACCTTG-3' 393 671/798 60 Exon 8-B* 5'-CTCTTGCTCTAAACATGAGCAG-3'

Exon 9-A* 5-ACATCCTGCTTTCCAAGGA-3' 419 799/865 60 Exon 9-B 5'-CCTGCATGCCTCTAGAAAGTG-3'

Exon 10-A 5-CCAGTGTACCTCTGAATTGC-3' 430 866/1027 60 Exon 10-B 5'-CAGAGCCTTCCTACATAGAG-3'

Exon 11-A* 5'-CCAGTATGAGTTAGTCTCTGGA-3' 416 1028/1253 60 Exon 11-B* 5-TGTCCTGTAGATTAAGAGAGGC-3

Exon 12-A* 5-AGGGGTGGCCCTAAGTAAG-3' 396 1254/1416 62 Exon 12-B 5'-GATCACAGATGGGCCTAATTG-3'

Exon 13-A* 5'-TGAAGGAGTGTCTCACTCAC-3' 735 1417/2065 60 Exon 13-B* 5'-ACGCCAACAGTGATTACAATG-3'

1. * Indicates primers modified from (Sata et al, 2000). 2. Numbering system defines the first coding ATG as position +1.

93 2.2.4.4 Long-range PCR Long range PCR allows the amplification of PCR products, which are much larger than those achieved with conventional Taq polymerases (100 to 2000 bp). Up to 27 kb amplimers are achievable from good quality genomic DNA and up to 40 kb from plasmid DNA, although 10 to 20 kb fragments are routinely achievable, given the appropriate conditions. The method relies on a mixture of thermostable DNA polymerases, usually Taq DNA polymerase for high processivity (i.e. 5'-3' polymerase activity) and another DNA polymerase with 3'-5' proofreading abilities (usually Pwo or Pfu). This combination of features allows longer primer extension than can be achieved with Taq polymerase alone. In addition, specific buffer formulation is needed to improve pH maintenance at high temperatures thus reducing pH-driven template degradation to minimum.

Long-range PCR became a necessity when three heterozygous mutations were found in genomic DNA amplifications of sample M-42 (two mutations in the promoter region and another in the exon 6 with a distance of 15.5 kb). PCR products of long- range amplification were needed to carry out linkage analysis on these mutations.

A few attempts to perform long-range PCR using different kits and polymerases such as Advantage 2 polymerase Mix (Clontech), Termoprime Plus DNA Polymerase (Abgene, Surrey UK) and TaqPlus Long PCR system (Stratagene, The Netherlands) were unsuccessful and the result of each amplification reaction was a smear without any specific band. Another trial using TripleMaster® PCR system (Eppendorf AG, Germany) was successful and sufficient PCR products of desired amplification were produced which were then extracted from the gel. However, background non­ specific amplification also occurred (see Figure 3.18).

The TripleMaster® PCR system combines a powerful polymerase blend with a Tuning Buffer® system for efficient amplification of genomic targets up to 20 kb and episomal targets up to 40 kb. The TripleMaster® Enzyme Mix is a blend of thermostable DNA polymerases with a ‘processivity-enhancing factor’ providing both an extremely high extension rate and maximal proof-reading assisted fidelity (Manufacturer’s manual).

94 15.5 kb products from -858 bp of the 5' proximal regulatory region to the end of exon 6, were amplified from volunteer M-42 genomic DNA using a long- range PCR kit (TripleMaster PCR system, Eppendorf AG, Germany) and allele- specific forward primers 5^-AATGACCTAAGAAGTCACCAGAA-3^ (wild type) or 5 AAT GACCT A AG A AG AT GGAGT AG -3 ' (insertion-mutant) with a common exon 6 reverse primer 5'-TGGATATGTAAACCCTGGCCC-3'.

For each reaction two mixtures were prepared in separate sterile microcentrifuges tubes.

Tube 1 contained:

Template DNA 100-200 ng (1 pi) Primer mixture (15 pmol each) 6 pi Nuclease-free water up to 10 pi

It was mixed well, centrifuged and placed on ice.

Tube 2 contained:

lOx reaction buffer 5 pi lOx dNTP mixture 5 pi TripleMaster® Enzyme Mix 0.4 pi (2 units) Nuclease-free water up to 40 pi

The tube was mixed well, centrifuged and placed on ice.

Just before cycling, the contents of the tubes were mixed gently by pipetting 3-4 times in a 0.2 ml tube and placed immediately into a thermal cycler which was pre­ heated at 94 °C.

95 The reaction conditions were:

94 °C for 2 minutes (initial dénaturation) 1 cycle 94 °C for 25 seconds (dénaturation) 62 °C for 30 seconds (annealing) >• 28 cycles 68 °C for 12 minutes (extension) 68 °C for 10 minute (final extension) 1 cycle

Following electrophoresis, the wild type or mutant 15.5 kb bands (-858/+14536) were extracted from the gel, purified using the Ultra Clean 15 DNA purification kit (MO BIO, Solana beach, California, USA) and then used as templates to amplify exon 6 from each corresponding allele. The exon 6 PCR products were then sequenced to identify on which allele the exon 6 mutation was present.

2.2.5 Single strand conformation polymorphism (SSCP) SSCP is a widely used method for mutation detection because of its simplicity and versatility. In the original SSCP protocol (Orita et al, 1989), the region of interest in the genome or cDNA is amplified by PCR, using radio labelled PCR primers or nueleotides, to generate a 200-350 bp radioactive product which is then denatured and electrophoresed in a large-format (40x20 cm) 8-10% non-denaturing gel. The mobility of single-stranded nucleic acid molecules electrophoresed under non-denaturing conditions is determined by both their fragment length and their secondary structure which is sequence dependent. A DNA strand may adopt several conformations for any given set of electrophoresis conditions and these are visualised as separate bands in the gel (Figure 2.8). The test sample will take up a different conformation if there is a sequence change and will migrate differently during electrophoresis. Mutations are thus detected as differences of mobility of the DNA bands between control and test. Some or all of the bands may show a shift, a single base change being sufficient to alter secondary structure and hence mobility. Because of a lack of theoretical background to predict conformation, and therefore the mobility of single-stranded DNA in gel electrophoresis, optimal conditions for separation of conformers has to be determined by empirical observation (Hayashi etal, 1998).

96 This method has several drawbacks. It requires the use of radioisotopes and electrophoresis on large denaturing gels to effect separation and detection of the single-strand conformers. Also, auto radiography (usually with multiple exposure) requires substantial time to produce a clear image of the resulting SSCP pattern.

There are now several reports describing non-radioactive (or ‘cold’) protocols for SSCP analysis. However, some require the purchase of expensive additional equipment or use of silver staining techniques. In ‘cold’ SSCP as used in this project, there is no need to use radioactivity and the gel is made of high percentage polyaerylamide (14-20%) in a mini format. The bands are visualised by staining the gel with conventional DNA stains (Hongyo et al, 1993).

In this project I have further developed this simple, ‘cold’ SSCP analysis method so that it can reliably detect single nucleotide changes in PCR products of up to 500 bp in length. I have utilised this system to identify novel mutations in the 5'-promoter region of the human CYP3A4 gene.

2.2.5.1 Polyacrylamide gel electrophoresis Polyacrylamide gels are formed by the polymerisation of acrylamide monomers

(CH2 =CH-C 0 -NH 2 ) into long random chains of polyacrylamide which are cross-linked by the inclusion into the mixture of small amounts of an appropriate bi-functional co-monomer, usually A,A'-methylene-bis-acrylamide (CH2=CH-C0-NH-CH2-NH-C0-CH=CH2) commonly known as ‘Bis’. The resulting cross-linked chains form a gel structure, the pore size of which is determined by the initial concentrations of acrylamide and cross-linker.

97 Wild-type DNA Mutant DNA

Dénaturation to produce single stranded DNA F ir

Each single strand can produce one or more secondary structure and the result of a polyacrylamide gel electrophoresis is demonstrated in the following picture.

Figure 2.8 Simplified steps of the single strand conformation (SSCP) analysis. PCR products of wild type and likely mutant samples denatured, using a denaturising buffer and heat, and the resulting single stranded DNAs were run in a high percentage non-denaturising polyacrylamide gel. Structural differences between the wild type and mutant strands cause mobility shift and therefore different SSCP pattern (adapted from Hayashi et al, 1998). Lane 1: wild-type DNA sample Lanes 2-4: mutant DNA samples showing different SSCP patterns

98 A stock solution of 20% acrylamide mixture (39:1 acrylamide to bis-acrylamide) was prepared with following components and stored at cold room;

For 100 ml of 20% solution

40% Acrylamide solution (from Promega) 48.75 ml 2% Bis-acrylamide solution (from Promega) 25 ml 5xTBE Buffer 10 ml 50% Glycerol 10 ml Water to 100 ml

After extensive optimisation trials (e.g. using gels of different strength, running the gels in the cold room or at room temperature and for different times) the best separation of SSCP bands for CYP3A4 PCR products up to 5()0 bp in length was obtained with 14.5 to 15.5% gels that had been run in the cold room at 15 V/cm for 65 to 70 hours.

To prepare a 10 ml 15% acrylamide gel the following components were mixed;

20% Acrylamide mixture (see above) 7.5 ml TEMED (tetramethylethylenediamine) 10 Pl 10% Ammonium persulphate (freshly prepared) 10 pi Water to 10 ml

Each gel (8 cmx7.3 cmxl mm) was cast using the Bio-Rad mini Protean II™ set. The gels were ready after about 1.5 hour. Before sample loading the gels were pre-run in Ix TBE (diluted from 5x TBE as described above) for about 1 hour.

After the pre-run, 5 pi of PCR product was mixed with 10 pi of denaturing-loading dye (95% formamide, 4 M urea, 0.1% bromophenol blue, 0.1% Xylene cyanol FF and 0.5 pi 15% Ficoll) and the mixture was heated to 94 °C for 10 min (Ainsworth and Rodenhise, 1994). All of the 15 pi of the mixture was loaded into the well without

99 quenching (Hayashi et al, 1998). A 1 kb DNA ladder (from Promega) was also added to one of the wells. The electrophoresis was carried out as indicated above.

After electrophoresis the gels were stained with SYBR® Gold nucleic acid stain (Molecular probes, Oregon, USA) for 30-40 minutes and photographed under UV light using a SYBR® gel stain photographic filter (Tuma et al, 1999).

2.2.S.2 Gel staining with SYBR® Gold SYBR® Gold is one of a series of proprietary unsymmetrical cyanine dyes that have been recently developed. As a group, these dyes are characterised as having low intrinsic fluorescence, large fluorescence enhancement upon binding to nucleic acids, and high fluorescence quantum yields when complexed with nucleic acids. SYBR® Gold has a major excitation peak centred around 300 nm, penetrates thick and high-percentage gels efficiently, and is exceptionally photo-stable. It is > 10-fold more sensitive than ethidium bromide for detecting DNA and RNA in denaturing urea, glyoxal and formaldehyde gels, even with 300 nm transillumination. The presence of the dye in stained gels at standard staining concentrations does not interfere with restriction enzymes, T4 DNA ligase, Taq polymerase, or with Southern or Northern blotting. The dye is readily removed from nucleic acids by ethanol precipitation, leaving pure templates available for subsequent manipulation or analysis (manufacturer’s manual).

The stock SYBR® Gold stain was diluted 10000-fold to make a Ix staining solution e.g. in TE (10 mM Tris-Cl, 1 mM EDTA, pH 7.5-8.0). The gel was incubated in Ix staining solution for 10 to 40 minutes after adding enough staining solution to completely cover the gel. During staining the gel was proteeted from light by covering it with aluminium foil or by placing it in the dark. The gel was agitated gently at room temperature. No de-staining was required.

2.2.6 DNA sequencing PCR products showing altered SSCP patterns were re-amplified from genomic DNA then purified with the Ultra Clean™ 15 DNA purification kit (MO BIO, Solana beach, California, USA). The purified samples were used directly for DNA sequencing of

100 both strands without any further treatment. Where a variation in DNA sequence from the wild type was found, the original PCR product was also sequenced for confirmation. In the case of novel mutations, additional repeat amplification and sequencing was performed for final confirmation. In all samples where novel 5' regulatory region mutations were found, direct sequencing of PCR products from the 13 CYP3A4 exons was also performed to identify any linked coding region mutations. Numbering of nucleotides was carried out by assigning the figure +1 to the base A in the translation initiation ATG codon and -1 to the base before the A (http:// www.imm.ki.se/CYPalleles).

Dye-termination sequencing, using a capillary sequencer (ABI PRISM® 3700 DNA analyser), was performed by MWG Biotech AG (Ebersberg, Germany) throughout this project.

2.3 Recombinant DNA technology

2.3.1 Sterilisation by autoclaving Plastic ware and solutions prepared for use in procedures involving the handling of nucleic acids, bacteria or mammalian cell culture were sterilised in an RSI series 32 automatic autoclave. Items were sterilised for 20 minutes at 120 °C at a pressure of 15 Ib/inl

2.3.2 Preparation of bacterial stock cultures Bacterial cultures containing recombinant plasmids with DNA inserts of interest were stored in glycerol at -70 ”C. Overnight cultures of E. colt in LB medium containing 100 jig/ml ampicillin (for plasmids coding for ampicillin resistance) were prepared. 150 pi of sterile glycerol was added to 850 pi of bacterial culture in a sterile 1.5 ml centrifuge tube. The tube was vortexed briefly to ensure complete mixing of the contents before freezing the stocks at -80 °C.

2.3.3 Growth of bacterial cultures Most plasmids carry a marker gene for a specific antibiotic resistance. By supplementing the growth medium with the appropriate antibiotic, only cells

101 containing the plasmid of interest will grow. Addition of antibiotic to the optimal concentration will also help to maximise plasmid yields.

For growing plasmid-containing bacteria from a glycerol stock, a sterile inoculation loop was scraped across the surface of a frozen stock and then streaked on an LB agar plate containing 100 pg/ml ampicillin and incubated overnight at 37 °C. An isolated colony from a freshly streaked plate (less than 5 days old) was then picked using a sterile loop and inoculated into 5 ml LB medium containing 100 pg/ml ampicillin. This mini-culture was incubated in a rotary incubator at 225 rpm at 37 ”C for 8 hours. For subsequent maxi-culture, 500 pi of the miniculture was added to 250 ml of LB medium containing 100 pg/ml ampicillin and incubated overnight (12-16 hours) in a rotary incubator at 225 rpm at 37 (reconunendations of the manufacturer, QIAGEN Endo Free Plasmid Maxi Kit).

2.3.4 Ligation of DNA inserts into pSEAP2-Basic plasmid vector pSEAP2-Basic enables expression of the reporter gene, human secreted alkaline phosphatase (SEAP). This vector lacks eukaryotic promoter and enhancer sequences and has a multiple cloning site (MGS) that allows putative promoter DNA fragments to be inserted upstream of the SEAP gene. The SEAP coding sequence is followed by the SV40 late polyadenylation signal to insure proper, efficient processing of the SEAP transcript in eukaryotic cells. A synthetic transcription blocker (TB), composed of adjacent polyadenylation and transcription pause sites, located upstream of the MGS reduces background transcription. The vector backbone also contains an fl origin for single-stranded DNA production, pUG origin of replication, and an ampicillin resistance gene for propagation and selection in E. coli (Figure 2.1). Following transfection of mammalian cells in culture the SEAP reporter gene product is secreted into the media. Samples of the medium can then be assayed for alkaline phosphatase activity by a simple chemiluminescence assay. Also because of lack of requirement for cell lysis multiple readings can be taken during the course of the experiment. SEAP activity can be distinguished from intracellular alkaline phosphatase by its resistance to heat dénaturation and insensitivity to certain alkaline phosphatase inhibitors.

102 T4 DNA ligase catalyses the joining of two strands of DNA between the 5'-phosphate and the 3'-hydroxyl groups of adjacent nucleotides in either a cohesive-ended or blunt-ended configuration. The enzyme has also been shown to catalyse the joining of duplex RNA to either a DNA or RNA strands, but will not join single-stranded nucleic acids (Manufacturer’s manual, Promega).

Restriction digested, purified PCR products and plasmids were used to set up ligation reactions based on the manufacturer’s (Promega) recommended ratios. The following formula can be used to calculate the amounts of the vector and the insert DNA.

ng of vector x kb size of insert ------X molar ratio of insert/vector = ng of insert kb size of vector

Appropriate amounts of vector and PCR product were incubated together with ligation buffer and T4 DNA ligase at room temperature for three hours or overnight at 4 ®C. Negative control (without insert DNA) reactions were also set up to assess the self-ligation and non-digestion of the vector.

2.3.5 Transformation of recombinant plasmid DNA into bacteria Competent TOPI OF' E. coli cells were used in transformation reactions. For each transformation reaction one 50 |il vial of the cells were thawed on ice. 5 |il of the ligation reaction was added directly to the vial containing competent cells and mixed by tapping gently. The mixture was incubated in a 42 ”C water bath for exactly 30 seconds. The vial was removed from the bath and was quickly placed on ice. 250 \il of pre-warmed SOC medium was added to the vial and incubated at 37 °C for exactly one hour at 225 rpm in a rotary shaker-incubator. 50 \i\ from transformation vial was spread onto an LB agar plate containing 100 pg/ml ampicillin and incubated at 37 ”C overnight. Positive (using pUC18 super coiled plasmid) and negative (bacteria itself) control transformations were also carried out.

103 2.3.6 Cloning of the CYP3A4 proximal and distal promoter regions pSEAP2-Basic plasmid (Clontech, Palo alto, California, USA) was used to create the constmcts containing these regions.

(1) PCR reactions were carried out as described in section 2.2.3 to amplify 300 bp of distal XREM region and 1141 bp of proximal promoter of the CYP3A4 gene.

Modified primers:

P7; 5'-cggacgcgtACTTCATGCAAAAATGCTGG-3' (Forward) P 8: 5'-ccgctcgagGTTCTTGTCAGAAGTTCAGC-3' (Reverse)

were used to create Mlul and Xhol restriction sites at the 5'- and 3'-ends of the amplified XREM region PCR products.

Modified primers:

PI : 5-cccaagcttGACCACTGCCCC ATCATTGC-3' (Forward) P6: 5'-ccggaattcTGCTGGGCTATGTGCATGGAGC-3' (Reverse)

were also used to create Hindlll and EcoRl restriction sites at the 5'- and 3'-ends of the amplified proximal promoter region PCR products.

(2) PCR products then were purified using QIAquick PCR purification kit.

(3) The purified PCR products of the XREM region and pSEAP2-Basic plasmid were digested with Mlul and Xhol as described earlier (section 2.2.3). The digested products re-purified and re-used in ligation reactions (section 2.2.4) to construct pX-SEAP2 plasmid (Figure 2.2). The authenticity of the plasmid was confirmed by re-digestion with relevant restriction enzymes, PCR of the insert region and sequencing of the PCR product using the constructed plasmid as template.

(4) The same procedure was carried out using Hindlll/EcoRl digested proximal promoter region PCR products (from four different mutant samples) and

104 pX-SEAP plasmid to construct pXP-SEAP2 plasmids (Figure 2.3) containing wild-type and mutant promoters.

2.4 Human cell culture methods Human hepatoma HepG2 (ECCAC No. 85011430) and HuH7 (Japanese collection No. JCRB0403) cells, and the human Caucasian colon carcinoma Caco-2 (ECCAC

No. 86010202) cells were grown in 75 cm^ flasks in 5% CO 2 in air at 37 °C. Cells were cultured in minimum essential medium (MEM) with Earle's salts supplemented with 10% (v/v) foetal bovine serum (FBS), 2 mM L-glutamine, 10% (w/v) gentamicin and 1% (v/v) non-essential amino acids. Cells were seeded at 2 to 3x10"^ cells/cm^ and passaged using trypsin/EDTA.

2.4.1 Cell passage Cells were split every 3 to 5 days when 90% confluent. The medium was aspirated and the cells were washed with phosphate buffered saline pH 7.4 (PBS) or trypsin- EDTA (Appendix I) to remove dead cells and any remaining medium. The washing solution was removed by aspiration. 2 ml trypsin-EDTA solution were added and left for 2 to 3 minutes to detach the cells from the flask. The flask was shaken to detach the cells completely. 8 ml of medium were added to inactivate the trypsin. The required amount of cell suspension (usually 1/3 of the suspension) was added to a new flask containing 20 ml of pre-warmed medium.

2.4.2 Storage of cells in liquid nitrogen A flask of actively growing cells was trypsinised and resuspended in 20 ml medium. The cells were pelleted by centrifugation at 1200xg for 5 minutes and then resuspended at 10^ cell/ml in medium containing 10% DMSO. This suspension was dispensed into cryovials (Nunc International) in 1 ml aliquots, packed in cotton wool and put into a polystyrene box. The cryovials were transferred to the -80 °C freezer overnight to freeze slowly (1 °C/min). They were then transferred to liquid nitrogen for storage.

105 2.4.3 Recovery of cells from liquid nitrogen A cryovial of cells was incubated in the water bath at 37 °C for 2 minutes to thaw completely, wiped with 70% ethanol, and the contents transferred into a sterile 50 ml centrifuge tube containing 20 ml pre-warmed medium. The cells were pelleted by centrifugation at 5000xg for 5 minutes after which the pellet was re-suspended in 20 ml pre-warmed medium and transferred to a 75 cm^-cell culture flask.

2.4.4 Transfection with plasmid DNA The ability to introduce nucleic acids into mammalian cells (DNA-mediated gene transfer, DMGT) has advanced our knowledge of gene regulation and protein function. The process of introducing nucleic acids into cells by non-viral methods is known as “transfection”. This process is distinct from “infection”, which is a virus- based method. Many transfection techniques have now been developed. Desirable features include high efficiency transfer of DNA into the nucleus, minimal intrusion or interference with normal cell physiology, low chemical toxicity, ease of use, reproducibility, successful generation of stable transfectants (if required).

2.4.4.1 Calcium Phosphate method The calcium phosphate precipitation transfection technique is widely used because the components are easily available and cheap. The protocol is easy to use and many different types of cultured cells can be transfected. The method is routinely used for both transient and stable transfection of a variety of cell types. The protocol involves mixing DNA with calcium chloride, adding this in a controlled manner to a buffered saline/phosphate solution and allowing the mixture to incubate for a period. This step generates a fine DNA precipitate that is dispersed onto the cultured cells. The precipitate is taken up by the cells via endocytosis. The calcium phosphate also appears to provide protection against intracellular nuclease digestion of the DNA. However, the method gives relatively poor levels of transfection efficiency and the high Ca^"^ concentration is toxic to some cell types. The transfection protocol was that used previously in our laboratory (Ogg et al, 1999).

Day 1: Seeding of HepG2 cells. Following trypsinisation, cells were diluted to a concentration of 6x10^ cells/ml with medium for seeding into 96-well plates (Nunc

106 International). 80 jil of pre-warmed medium was dispensed per well, and then 40 |xl of cell suspension was added. The plates were placed in a humidified container in the cell culture incubator at 37 ”C for 24 hours.

Day 2: Transfection. One hour prior to transfection, the growth medium was removed, replaced with fresh medium and the plates returned to the incubator. The transfection mix was then prepared on ice for optimum precipitate formation. In a sterile tube 100 pi of 2 M CaCli was added to 25 pg plasmid DNA and the required volume of O.lx TE (1 mM Tris.Cl pH 8.0, 0.1 mM EDTA pH 8.0) was added to a final volume of 1 ml. Then 1 ml of 2x HBS (280 mM NaCl, 10 m M KCl, 1.5 mM

Na2 HP0 4 .2 H2 0 , 12 mM dextrose and 50 mM HEPES) was added and incubated on ice for 1 minute after which 4.6 ml medium was added to terminate the precipitation reaction. After removal of medium, 80 pi of transfection mix were added per well of the 96-well plate followed by 40 pi of medium to a final volume of 120 pl/well. The plates were replaced in the humidified container and transferred to the cell culture incubator.

Day 3: Dosing. A sample of growth medium was removed for alkaline phosphatase assay and then drug solutions or control solvent were added to the cell cultures in a small volume. The maximum final solvent concentration was 0.1%. All solutions were freshly prepared in the day of dosing. Incubation was then continued for a further 48 hours.

Day 5: Reporter assay. A further sample of the growth medium was removed for chemiluminescent assay of alkaline phosphatase activity.

2.4.4.2 Transfection with FuGENE 6 reagent (Roche Biochemicals) FuGENE 6 transfection reagent is a proprietary, multi-component lipid-based transfection reagent that forms complexes with and transports DNA into cells during transfection. The FuGENE 6 transfection reagent provides very high transfection efficiency in many common cell types, demonstrates virtually no cytotoxicity even in many primary cell types and requires minimal optimisation. This reagent is unique as compared to other liposomal transfection reagents and requires special handling.

107 Undiluted FuGENE 6 must not be allowed to come in contact with plastic surfaces other than the pipette tip and should always be stored in the original tubes. It has been shown that chemical residues in new plastic vials can significantly decrease the biological activity of the reagent. It is supplied in 80% ethanol, sterile-filtered, and packaged in polypropylene tubes.

Following trypsinisation, cells were diluted to a concentration of 2x10^ cell/ml with medium for seeding into 96-well plates (Nunc International) and 120 pi of cell suspension was added to each well. The plates were placed in a humidified container in the cell culture incubator at 37 °C for 48 hours.

On the day of transfection, serum-free medium was added to a micro-centrifuge tube (to a final volume of 100 pi) as diluent for the FuGENE 6 transfection reagent. Suitable amounts of FuGENE 6 reagent and DNA at a ratio of 3:1 (pi of FuGENE 6 reagent:pg of DNA) was added to the medium. FuGENE 6 reagent was added first (directly into the medium without contact with the plastic surface) and, after mixing by gently tapping the tube, the DNA (3 to 4 pg) was added. The order of addition was critical (based on the manufacturer’s instructions). The tube was mixed as before and stood for at least 15 minutes at room temperature. The mixture was then diluted in suitable amount of serum-free medium and, after removing the old medium, 120 pi of the transfection solution was added to each well. Transfection was allowed to proceed for 5 hours in the serum-free medium. Subsequently the serum-free medium was removed and the cells were cultured for an additional 60 to 65 hours in fresh serum-containing medium in the presence or absence of the various CYP3A4 inducers. 15 pi samples from each well were then removed for alkaline phosphatase assay.

2.4.6 Chemiluminescence assay of secreted alkaline phosphatase activity Secreted Placental Alkaline Phosphatase (SPAP or SEAP) can be assayed using a chemiluminescent alkaline phosphatase substrate. Alkaline phosphatase-catalysed dephosphorylation of the chemiluminescent substrate produces a destabilised dioxetane anion. This decomposes rapidly with the concomitant production of light. Unique chemiluminescence-enhancing reagents consisting of a water-soluble

108 macromolecule, e.g. poly (benzylmethylvinylbenzyl) amonium chloride, and a fluorescent dye are key to the rapid production of an intense stable signal from the excited state generated in these alkaline phosphatase-catalysed reactions. The polymer sequesters the dephosphorylated dioxetane anion into hydrophobic domains of the polymer chain, thereby eliminating the aqueous quenching reactions, which profoundly lower the intensity of the chemiluminescent signal. In the presence of this type of enhancer approximately 2.5 to 3 orders of magnitude signal enhancement is achieved (Manufacturer’s manual).

Dilution buffer, assay buffer (a mixture of intra-cellular alkaline phosphatase inhibitors) and reaction buffer (containing a luminescence enhancer) were allowed to equilibrate to room temperature (Appendix 1). 15 pi samples from each well were placed in the wells of fresh 96-well Optiplate polystyrene microplates {Packard UK). 45 pi of Ix dilution buffer was added to each well and the plates were incubated at 65 for 1 hour to inactivate any background intracellular alkaline phosphatase activity presents. The plates were removed, incubated on ice for 2 minutes and then left to reach room temperature (about 15 minutes). 60 pi of assay buffer was then added and the samples were incubated for 5 minutes at room temperature. 60 pi of the reaction buffer was added and left for 20 minutes after which time the plates were analysed for chemiluminescence using the Lumicount™ (Packard) plate reader.

2.4.7 Definition of relative light units and gain settings in sample measurements The luminometer uses a photomultipher tube (PMT) to measure the photons of light emitted by the samples. The PMT converts the photons striking it into a voltage which can be processed by the LumiCount into relative light units (RLUs). RLUs allow data to be analysed relative to a reference sample (e.g. in a 96 well plate the light emission from each well is set to be measured relative to the well with the strongest emission). The measurements are performed at different gain settings (or levels) to allow for different overall intensities of light from different experiments, the range (of gain level) being from 1.0 to 32.0. The lower the gain level, the stronger the light emission or response. The LumiCount has a range of 0.0-70,000 RLUs per 0.5 second read length at each gain level. Thus, the amount of relative

109 light units produced at any one gain level can not be directly related to the relative light units measured at a different gain level.

110 CHAPTER THREE

MUTATION ANALYSIS OF THE HUMAN CYP3A4 GENE 5' REGULATORY REGION

3.1 Introduction CYP3A isoenzymes are the most abundantly expressed cytochrome P450s in human liver, accounting for up to 60% of the total hepatic cytochrome P450 activity in some individuals (Gonzalez, 1993). However the expression and activity of the CYP3A isoenzymes show wide inter-individual variation, influencing both drug responses and disease susceptibility (Guengerich, 1999). Four human CYP3A genes have been identified, CYP3A4, CYP3A5, CYP3A7 (Nelson et al, 1996) and most recently CYP3A43 (Domanski et al, 2001).

CYP3A4 is the major cytochrome P450 isoenzyme in adult human liver and is known to metabolise a large variety of xenobiotic and endogenous substrates (Li et al, 1995). Inter-individual variation in hepatic CYP3A4 levels of up to 40 fold (based on the metabolism of specific substrates such as triazolam, midazolam or cyclosporine) has been observed (Daly et al, 1993). The basis of this variation is not yet understood but may be due to genetic, environmental, pathological, hormonal or dietary factors (Guengerich, 1995).

The CYP3A4 gene and its 5'-fianking region has been isolated and sequenced (Hashimoto et al, 1993). The gene is approximately 27 kb long with a coding region composed of 13 exons located on chromosome 7q22.1 (Hashimoto et al, 1993; Goodwin et al, 1999). Although there had been no indication of genetic polymorphism in the CYP3A4 gene until 1997 (Linder et al, 1997; Lewis et al, 1998), investigations since then have reported inherited variation in both the promoter (Rebbeck et al, 1998; Kuehl et al, 2001) and coding region of the gene (Westlind et al, 1999; Sata et al, 2000; Hsieh et al, 2001). However, the impact of these mutations on mRNA expression or enzyme activity has not been extensively investigated. Also the proposed relationship between the CYP3A4'^1B allele (-392 A^G) and an increased incidence of prostate cancer was not confirmed in later

111 studies (Ball et al, 1999; Westlind et al, 1999). However, Sata et al (2000) showed that the CYP3A4^2 allele (Ser222Pro) produces a lower in vivo intrinsic clearance of nifedipine, but no significant difference from the wild type enzyme activity for testosterone 6p-hydroxylation. In addition Hsieh et al (2001) have recently reported three further mutations in the coding region of the CYP3A4 gene and related them to a decreased urinary 6p-hydroxycortisol/cortisol ratio in heterozygotes.

In the case of CYP3A5, there is also evidence of polymorphism in the coding (Jounaidi et al, 1996) and promoter regions (Kuehl et al, 2001) which may contribute to variation in the overall hepatic metabolism of CYP3A substrates. All the recognised CYP3A alleles are now listed on in the Human Cytochrome P450 (CYP) Allele Nomenclature Committee Home Page (http:// www.imm.ki.se/CYPalleles).

3.2 Human genomic DNA extraction 101 human genomic DNAs were isolated from whole blood using the Wizard® genomic DNA purification kit (Promega, UK) and used directly for PCR amplification of the proximal regulatory (1141 bp) and distal enhancer (300 bp) regions of the CYP3A4 gene. As mentioned in Materials and Methods (section 2.2.1.1) all extracted genomic DNAs were quantified by spectrophotometry. Samples were in the range of 100-200 ng/pl with an A 260 /A280 nm ratio of more than 1.7 indicating the absence of protein contamination. Subsequent use of the genomic DNA samples (e.g. in PCR) produced good results indicating reliability of the extraction method.

To determine the quality of extracted genomic DNA and the reliability of the purification kit, all DNA samples were analysed on 1% agarose gels. A photograph of the agarose gel electrophoresis of 16 samples is shown in figure 3.1 as an example. As this shows, all samples were of good quality with a high molecular weight compared to the DNA size marker.

112 M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16

lOkb^

Figure 3.1 1% agarose gel electrophoresis of extracted genomic DNAs (2.5 pi of each sample) from blood samples. M: 1 kb DNA marker Lanes 1-16: different high molecular weight genomic DNAs from individual blood samples

113 3.3 PCR amplifîcâtion of the CYP3A4 proximal and distal 5' regulatory regions

Polymerase chain reactions were optimised to yield one product band under the conditions described in Materials and Methods (section 2.2.4.2). The proximal 1141 bp 5' regulatory region was amplified as 3 short overlapping segments to aid the SSCP analysis (see diagram in section 2.2.4.3). The sizes of the PCR products were expected to be 433 (-493/-61), 493 (-884/-391), 423 (-1201/-778) and 1141 (-1201/-61) bp respectively for proximal regulatory region and, 300 bp (-79727-7671) for distal xenobiotic responsive enhancer module (XREM) region (Table 2.1). Negative control reactions (without template DNA) were also included in the optimisations to ensure no contamination has occurred.

Figures 3.2 and 3.3 show 1% agarose gel electrophoresis (section 2.2.2) of the PCR products from optimised reactions. 5 p.1 of each PCR product was mixed with 1 |il of a loading dye and loaded into each well. As the photographs clearly indicate, all products have correct size and good yield indicating the efficiency of the reaction under optimised conditions.

The optimised conditions were then used for amplifications from 101 genomic DNA samples. PCR reactions for XREM region have been carried out in cooperation with Helen J. Edwards as an undergraduate project.

As exemplified in figures 3.4, 3.5, 3.6 and 3.7, all PCR reactions were successful and yielded high quality product. 5 |il of each PCR product was mixed with 1 p.1 of a loading dye and loaded into each well. There was no failure in the amplification of any sample and as the photograph shows all products had similar quality and yield. PCR products then were directly used for SSCP (section 2.2.4) analysis without any further treatment.

All PCR primers were checked initially for specificity by sequencing of the PCR products. No evidence was found to indicate non-specific cross-amplification of the CYP3A5 or CYP3A7 5' regulatory regions.

114 1000 750 500

250

Figure 3.2 1% agarose gel electrophoresis of optimised PCR amplifications of the CYP3A4 proximal regulatory region. M: 1 kb DNA ladder Lane 1: negative control

Lane 2: PCR of the whole 1141 bp promoter region (-1201/-61)

Lane 3: PCR of the 433 bp first segment (-4937-61) Lane 4: PCR of the 493 bp second segment (-8 847-391) Lane 5: PCR of the 423 bp third segment (-12017-778)

115 750 ^ 500 ^ <-300 250

Figure 3.3 1 % agarose gel electrophoresis of optimised PCR amplification of the CYP3A4 distal XREM region. M: 1 kb DNA ladder Lane 1: negative control Lane 2: PCR of the distal 300 bp xenobiotic responsive enhancer module (XREM) region (-79727-7671)

116 750 500 <-433 250

Figure 3.4 An example of 1% agarose gel electrophoresis of the PCR products for the -493/-61 segment Of the CYP3A4 promoter from different genomic DNA samples. M: 1 kb DNA marker Lanes 1-12: PCR products of different samples

10 11

750 —> 500 <-493 250 -4»

Figure 3.5 An example of 1 % agarose gel electrophoresis of the PCR products for the -884/-391 segment of the CYP3A4 promoter from different genomic DNA samples. M: 1 kb DNA marker Lanes 1-12: PCR products of different samples.

117 10 11

750 -> 500 -4 <-423 250 -4

Figure 3.6 An example of 1% agarose gel electrophoresis of the PCR products for the -1201/—778 segment of the CYP3A4 promoter from different genomic DNA samples. M: 1 kb DNA marker Lanes 1-12: PCR products of different samples

bp M 1 8 9 10 11 12

750 - 4 500 - 4 <-300 250 - 4

Figure 3.7 An example of 1% agarose gel electrophoresis of the PCR products for the distal XREM (—7972/-7671) of the CYP3A4 promoter from different genomic DNA samples. M: 1 kb DNA marker Lanes 1-12: PCR products of different samples

118 3.4 Non-radioactive single strand conformation polymorphism (Cold-SSCP) analysis of the CYP3A4 5' regulatory regions

As described in materials and methods (section 2.2.4), the SSCP technique is based on the appearance of new “refolding” conformations during electrophoresis due to mutation. In screening of unknown samples appearance of an extra band(s) or band shifts in the SSCP pattern of a sample in comparison to the normal samples indicates likely mutation in that DNA sample. SSCP analysis has a limited capacity for genetic mutation screening because it does not indicate the nature or position of the polymorphism. Mutations detected via SSCP must be confirmed by sequencing of the PCR product. In addition a fresh PCR amplification of that genomic DNA must be analysed to eliminate any possible changes that may be introduced by the polymerase itself into the first PCR product. The SSCP results obtained clearly showed that the Cold SSCP method for mutation detection was reliable and reproducible. Also, the staining dye SYBR Gold was found to be sufficiently sensitive to detect changes in mobility due to alteration in single strand conformation.

SSCP analysis for the -493/-61 segment of the CYP3A4 promoter showed altered SSCP patterns for ten out of the 101 PCR products indicating likely mutations. The photograph in figure 3.8 is an example showing the SSCP patterns produced. In this example, all samples have either two or three bands except one (lane 6 ) which has 4 bands indicating the possible presence of mutations in the DNA. The occasional presence of the uppermost band does not appear in this case to be related to changes in DNA sequence in the PCR product but is due to either the concentration of the PCR product or the extent of single strand formation during dénaturation. The SSCP pattern of the sample with the new mutation was not distinguishable from that of the other 9 variant samples. In segment -884/-391, eighteen out of the 101 PCR products showed an altered SSCP band pattern indicating possible mutations (Figure 3.9). In this example, all samples have three bands except one (lane 3) which has 4-5 bands indicating the possible presence of mutation. SSCP analysis of the PCR products from -1201/-778 segment showed only one sample with an altered band pattern (Figure 3.10). All samples have three bands except one (lane 2) which has a split pattern in the uppermost band indicating possible mutation.

119 SSCP analysis was also performed on the PCR products (Figure 3.7) of the distal XREM region (-7972/-7671) of the CYP3A4 promoter from 101 genomic DNA samples by Helen J. Edwards as an undergraduate project under my supervision. No differences in the SSCP patterns were identified. An example of the SSCP analysis band patterns from the XREM region is shown in Figure 3.11. Subsequent sequencing of 5 randomly selected PCR products revealed no mutation in this region indicating high sequence conservation in this essential regulatory element (see Figure 4.5). Similar conservation of the XREM region of CYP3A7 has been reported recently (Bertilsson et al, 2001).

120 Figure 3.8 An example of 15% polyacrylamide gel electrophoresis and SSCP analysis of PCR products from the -493/-61 segment of the CYP3A4 promoter. M: DNA marker Lanes 1-8: SSCP analysis of PCR products from different genomic DNA samples Arrow indicates a PCR product producing an extra lower SSCP band.

Figure 3.9 An example of 15% polyacrylamide gel electrophoresis and SSCP analysis of PCR products from the -884/-391 segment of the CYP3A4 promoter. M: DNA marker Lanes 1-8: SSCP analysis of PCR products from different genomic DNA samples Arrow indicates a PCR product producing an extra lower SSCP band.

121 I -% ###

Figure 3.10 An example of 15% polyacrylamide gel electrophoresis and SSCP analysis of PCR products from the —1201/-778 segment of the CYP3A4 promoter. M: DNA marker Lanes 1-8: SSCP analysis of PCR products from different genomic DNA samples Arrow indicates a PCR product producing an extra upper SSCP band.

Figure 3.11 An example of 15% polyacrylamide gel electrophoresis and SSCP pattern for PCR products of the CYP3A4 XREM region (-7972/-7671). M: DNA marker Lanes 1-8: SSCP analysis of PCR products from different genomic DNA samples

122 3.5 DNA sequencing of the variant PCR products PCR products producing altered SSCP patterns were re-amplified from the corresponding genomic DNA samples and purified with the Ultra Clean'^^ 15 DNA purification kit (MO BIO, Solana beach, California, USA). The purified samples were then used directly for DNA sequencing of both strands. Where a variation in DNA sequence compared to wild type (Figure 3.12) was found, the initial PCR product was also sequenced for confirmation. In the case of novel mutations, additional repeat amplification and sequencing was performed. In all samples where novel 5' regulatory region mutations were found, direct sequencing of PCR products from the 13 CYP3A4 exons was also performed to identify any linked coding region mutations. Numbering of nucleotides was carried out by assigning the figure +lto the base A in the ATG translation initiation codon and -1 to the base before this A, (http:// www.imm.ki.se/CYPalleles).

In sequencing the -493/-61 section, the previously described CYP3A4"^1B allele -392 A ^G (Rebbeck et al, 1998) was found to be heterozygous in 9 of the 10 variant samples (Figure 3.13 A). A new allele (designated CYP3A4"^1E) containing a -369 T->A transversion was found in sample F-14 (Figure 3.13 B). As it is shown, all detected mutations were heterozygous. It should be mentioned here that to confirm the new T->A mutation, 4 different PCR products were prepared from the relevant genomic DNA (F-14) and sequenced using 2 different DNA sequencing machines. The results were the same in all cases. The -884/-391 sequencing revealed 17 samples with a novel allele (designated CYP3A4^1F) containing a -747 C^G transversion (Figure 3.14 A). The remaining sample (M-42) showed a 9-nucleotide heterozygous insertion (ATGGAGTGA) after -845 G (Figure 3.14 B). The double sequence read out due to the insertion and its normal interpretation are demonstrated. The insertion was also detected in the SSCP and sequencing analysis of the overlapping -1201/-778 segment of the M-42 promoter and was the only sample from this segment with an altered SSCP pattern (Figure 3.10). It should be noted that in addition to the insertion at -845 this sample also contained heterozygously a -392 A-4G transition. All DNA samples containing novel mutations were subject to confirmatory PCR and sequencing to eliminate the possibility of PCR artefacts.

123 10 20 30 « 50 60 70 80 91 C T 0.«3GT G GTT GGGGTCOVTCTGGC TATC T OGGCAGC T GTTCTCTTCTCTCCTTTCTCTCCTGT TTCCAQ ACAT GCAGTAT TTCCA G AO #

90 100 110 120 130 140 150 160 170 AGAAGGGGCCAC TC T T TG GCAAAG AAC C T GTC TAAC TTGC TATC TAT GGCA GGAC C T T T GAA G G GT TCAC A G G AA GC A GC AC A A A

190 200 210 220 230 240 250 T T GAT AC TAT TCC AC C A AGC CATCAGCTCCATCTCATCCATGCCCTGTCTCTCCTTTAGGGGTCCCCTTGCCAACAGAATC

260 270 280 290 300 310 320 330 CAC AG AG G AC CAGC C TGAAAG TGC A GAG AC AGC AGC T GAG GC AC A GC C A AG AGC T C T G GC T GTAT TA AT GAC C TAAG AAG

340 350 360 370 380 390 400 410 TCACCAGAAAGTCAGAAGGGATGACATGCAGAGGCCCAGCAATCTCAGC TAAGTCA AC TC CAC CAGC C TT TC TAG T TGC

420 430 440 450 460 470 480 490 C CA.C T GTG TGTACAGC AC CC TG GTAGGGAC CA G AG C C A T G AC A G GG A AT A A G AC TA G AC TAT GC C C TTG AG G AG C TCAC C 'ïïmmm 500 510 520 530 540 550 T C T G T T C A G G G A A A C A G G C G T G G A A A C A C A A T G G T G G T A A A G A G G A A A G A O G .AC A A T A

end of first part

40 50 60 70 80 90 100 110 120 AAAG.AGG.AA.AG.A3G.AC.AATAGG.ATTGCAT GAAG GO O.AT G G.AAAGT GC C C AG GG G AG G.AA AT G GT TAC A T C T GTGT G A G G A G T T T GOT

130 140 150 160 170 180 190 200 GAGGAAAGAC TC T A A G A G A A G G C TC T GTC T GTC T GG G T T T G GAA G GAT GT G T A G G AG T C T TC TA G G G G GC AC A G GC AC ACCTC

continued on next page

124 210 220 230 250 270 CAGGCATA GGTAAAGATC T GTAO GT GTGOC T TGTT 0 GG A I GAA TT TCA A G TAT TTT GGAAT GAG GAG A GC CAT AO AG AC

290 300 310 320 330 340 AAGGGC AAG AG AG AG GC GAT TTAATA GATTTTAT GC CAATOGC TCCACCT TGAGTTTCT GATA AG AAC C CAG AAC CC TT C

- 3 6 9-392 ^ -369-392

370 390 420 440 GGAC TC C CCAGTAACAT TGA T T GAGT T GTT TAT OATAC C TCATAGAA TAT GAAC TCAAAGGAGGTCA GT GAG TG GT GT G

450 460 470 480 490 500 510 TG TG T GAT TCT T TGC CAAC TTC CAAG GTG GAG AAGC C TC T TC CAAC TGC AG GC A G AGC AC AG GT G GC C C T GC TAC T GGC

530 540 550 560 570 520 590 600 TGC AGC T C CAGC CC TGC C TCC TTC TC TAGCAT A TA A AC A AT CCAAC AGC C T CAC TGAAT CAC TGC T GT OCA G GGC AG GAA fi -103

610 GC TCC ATOCACAT

Figure 3.12 Wild type sequence of 1141 bp of the proximal promoter region of the CYP3A4 gene. The sequencing reactions have been performed on the PCR product of the whole promoter region using PI (Table 2.1) and 5 -T AG ACT AT GCCCTT G AGG AGC-3 ' (underlined) as primers. Arrows indicate the position of the various mutations found by SSCP and confirmatory sequencing. It should be noted that this picture was assembled from two

successive sequencing reactions from the same sample. T 5 5 0 in the first part of

the picture is T 5 7 in the second part. * Indicates the transcription start site.

125 (A) -392

Sense strand Antisense strand

(B) -369 T TAAT AG A T T AT GCCA A G C C^JTGGCAT AN^^TCTATT AA^g

Sense strand Antisense strand

Figure 3.13 Panels (A) and (B) and demonstrate the sequence confirmation (both strands) of the previously reported heterozygous -392 A ^G transition (Rebbeck et al, 1998) and the novel heterozygous -369 T ^A transversion, identified by SSCP of the^93/-61 section. Sense strands as per figure 3.12. The -392 A ^ G transition was found in 9 samples (F-05, 12, 27 and M-06, 10, 14, 29, 32, 42). The -369 T ^ A trans version was found in sample F-14.

126 (A) -747 100 i 110 320 330 }T GTACA GCAC gC T GGTA GGC C C C TAC CAG g G T GC T G TAC AC

II Sense strand Anti sense strand

(B) -845

310 320 330 340 350 360 370 T T A A T G AC C T A A G AA G A -

Sense strand T CAC CAGAAAGT CAGAAGGGATGACATGCAGAGGC CCAGCAAT CT CAGC ATGGAGTAGTCACCAGAAAGTCAGAAGGGATGACATGCAGAGGCCCAGC

CT G ÆTTTCT GOT GAC TAC T - -AT CTAT T - A-ACA-T -A - T - CAGTC GG - T GTOG- - G G AT GT GC T

Antisense strand CTTCTTAGGTCATTAATACAGCCAGAGCTCTTGGCTGTGCCTCAGCTGG CTACTCCATCTTCTTAGGTCATTAATACAGCCAGAGCTCTTGGCTGTCC

Figure 3.14 Panels (A) and (B) and demonstrate sequence confirmation (both strands) of the novel heterozygous -747 C^G transversion and a nine- nucleotide insertion between -845 and -844, identified by SSCP, respectively. Sense strands as per figure 3.12. The -747 C ^ G transversion was found in 17 samples (F-08, 11, 17, 18, 24, 26, 31, 33, 34, 39 and M-02, 18, 31, 38, 44, 48, 53). The -845 9 bp insertion was detected in sample M-42.

127 As noted earlier sample M-42 showed a 9-nucleotide heterozygous insertion (ATGGAGTGA) after -845 G (Figure 3.14 B). This inserted sequence has close similarity to the ‘HFL-a’ motif in the CYP3A7 promoter region (in 8 out of 9 nucleotides, Hashimoto et al, 1993) and may have arisen by recombination between CYP3A4 and CYP3A7 genes in this region. To investigate any reciprocal recombination between CYP3A4 and CYP3A7 promoters in subject M-42 PCR amplification was carried out to examine the CYP3A7 promoter sequence in this region. No reciprocal insertion of CYP3A4 DNA was found in the CYP3A7 promoter of M-42 as shown in Figure 3.15.

In all genomic DNA samples where novel CYP3A4 5' regulatory region mutations were found, direct sequencing of PCR products from the thirteen CYP3A4 exons (Figure 3.16) was also performed using primers and conditions as listed in table 2.2 to identify any linked coding region mutations. For amplification of the CYP3A4 exons the PCR primers and reaction conditions in Sata et al (2000) were used initially. In some instances, however the primers and annealing temperatures had to be modified to optimise the amplifications (Table 2.2). In the case of exons 1 and 2 the relevant primers did not distinguished between the CYP3A4 and CYP3A7 sequences, causing double sequence readings in places for the PCR products. However, the two sequences could be read easily from the sequencer printout and analysed for mutations by inspection.

The results from direct sequencing of the CYP3A4 exons, from samples with new mutations in the 5' regulatory region, showed no mutations in the coding region except in the case of sample M-42 where a heterozygous G ^A transition in exon 6 (cDNA position 485, creating R162Q in the protein structure) was found (Figure 3.17). This exon 6 mutation (designated CYP3A4"^15) has recently been described by J. Lamba (http:// www.imm.ki.se/CYPalleles/cyp3a4.htm).

It should be noted that in addition to the heterozygous 9 bp insertion at -845 and the heterozygous G ^ A transition in exon 6, sample M-42 also contained heterozygously a -392 A ^ G transition mutation. So it was crucial to identify the linkage between these mutations.

128 AAG.V*GCACAAAT TG A T GC TAT T C C Æ TA AGC CAT CAGC T CCAT C T CAT C CAT GC CAT GT C T C T T T T T T A G G G G T C C TC T TGC CAACAGAA

100 110 120 130 140 IJO 160 170 TCACAGAGGACAAATC T GAAAOTGCA GAG AC AGC A GC T GA G GCAC A GC CAA GAGC TC TGGC T GTATTAA T GAC C TAA G AAG ATG

180 190 200 210 GA G T G G T C A C C A G A A AG T C A G A G G A A G T GAC AC A C A G G G GC

Figure 3.15 Sequence of the CYP3A7 promoter from sample M-42 DNA. The HFLa-SE sequence is underlined. To amplify this region 5 -CAGGACTTTTGAAGCTACAG-3' forward and 5'-GCCCCTGTGTGTCACTTCC-3' reverse primers were used. PCR amplifications were performed using M-42 and a wild type control genomic DNA.

129 bp M 1 2 3 4 6 7 8 9 10 11 12 13 14 M

1000 7S0

500 - >

250 ^ 357 439 365 387 351 351 366 393 419 430 416 396 735<

Figure 3.16 1% agarose gel electrophoresis of the PCR products for the CYP3A4 exons. M: 1 kb DNA marker Lanes 1: negative control Lanes 2-14: PCR products of the CYP3A4 exons (1-13 respectively) * Numbers under the lanes indicate the sizes of the PCR products.

130 (A) 485 (cDNA)

60 70 SO 4 ' 90 100 : C C A G T A T G G AG AT GT GT T GGT GAGA^A^ATC T GAG GC G G GAA GC A G A O Æ A GGC A A GC C

(B) 485 (cDNA) 60 70 SO 90 100 110 C AG T AT G G AG AT GT GT T GGT GA G AA AT C T GAG GC a G GAA GC A G AG AC A G GC A A GC C T GT C AC r i\l

I I -1 ï m II i[ \ m V n 11A V 1 Sense strand

485 (cDNA)

190 200 210 4^i 220 230 240 T GAC A GGC T T GCC T GTC TC TGC TTC C t GC C TCA G AT TTC TCAC CAACAC AT C TCC

Anti sense strand

Figure 3.17 Identification by sequencing of a mutation in CYP3A4 exon 6. Panel (A) indicates the wild type sequence of CYP3A4 exon 6. Panel (B) demonstrates the heterozygous G ^ A transition in exon 6 (creating R162Q) in sample M-42.

131 3.6 Linkage analysis of mutations in sample M-42 In order to determine whether the three heterozygous CYP3A4 mutations found in genomic DNA from subject M-42 were in the same allele, linkage analysis was performed. An initial amplification and cloning (section 2.2.6) of the 5'-proximal promoter region was used to separate the alleles and determine if the 9 bp insertion at -845 was linked to the -392 A—>G mutation. Using the recombinant plasmid DNAs as template, PCR amplification of 592 bp (to cover both mutations) of the CYP3A4 promoter (-9297-337) was performed and sent directly for sequencing. The following primers were used for these PCR reactions.

5'-AGAATCACAGAGGACCAGCC-3' 5'-CTTATC AGAAACTCAAGTGG -3'

The results of the sequencing reactions revealed that both mutations are in the same allele in M-42 (Figure 3.18).

Following this, long-range (-858/4-14536) allele-specific PCR products (Figure 3.19), as described in section 2.2.4.4, were used as templates after gel extraction and purification to amplify each corresponding exon 6. The exon 6 PCR products (Figure 3.20) were then sequenced to identify on which allele the exon 6 mutation was present. The results (Figure 3.21) again showed that all three mutations of M-42 are present on the same allele.

132 -845

10 2) 30 40 1 "^50 ÔO 70 80 90 AGC TGAOQCACAGC CAAGAGC TCT GGC T GTAT TAAT GAC CTAAG .AA.G AT G G AGTA GTCAC CAGAAAGTCA GAAGGGAT GAC AT OC A GAG

100 110 120 130 140 uo 160 170 GCCCAGCAATC TCAGC TAAGTCAAC TCCAC CAGC CT TTC TA G T T GC CCACCT GT GT GTACA GCAC CC T G GTA G G GAC CAG AGC CA

180 190 200 210 220 230 240 250 T GAC AGGG AAT AA GAC TA G AC TAT GC CC TTG AG G AG C TCAC C T C T GT T CA G G G AA AC A G GC GT GGA AAC AC AA T G GT GG T

260 270 280 300 310 330320 A A A G A G G A A A G AG GAC A A T A G G A T T GC A T G A A G G G G AT G G A A A G TGC C C A G G G G A G G A A A T G GT TAC A TC T GT G T G A G G

340 350 360 370 380 390 400 410 AGTTTGGT GAGGAAAGAC TC TAAG AGAAGGC TC TGTCTGTCTGGGTTTGGAAGGATGTGTAGGAGTCTTCTAGGGGGCAC

420 430 450 460440 470 490 C AGGCACAC TCC AGGCAT A GGTAAAGATC T GTAGG TGT GGC T T G T T G G GAT GA A T T T C A A G TA T T T T G G A A T G A G G A C A G C

510 530 C C A T A G A G A C A A G G G C A G G A G A G A G G C G A T T T A A T AG A T T T T A T OC C A A T O G C TCCAC TTGAGT

-392

Figure 3.18 Sequence analysis of the cloned PCR fragment from the CYP3A4 promoter of M-42. The sense strand sequence from the M-42 pXP-SEAP2 plasmid (Figure 2.3) is shown.

133 23.1 k b ^ 9.4 kb ^15.5 kb 6.6 kb —>

4.3 kb

2.3 kb

Figure 3.19 Allele-specific long-range-PCR of the wild type and 9 bp insert- containing alleles of sample M-42 genomic DNA. M: lambda DNAJHindlll DNA marker Lane 1: negative PCR control Lane 2: M-42 mutant allele PCR product Lane 3: M-42 wild type allele PCR product Arrow indicates the 15.5 kb PCR products.

134 500 4— 351 bp 250

Figure 3.20 PCR amplification of the CYP3A4 exon 6 using gel extracted long- range PCR products from the M-42 wild type and 9 bp insertion-containing alleles. M: 1 kb DNA marker Lane 1: negative control Lane 2: PCR product of CYP3A4 exon 6 from the mutant allele Lane 3: PCR product of CYP3A4 exon 6 from the wild type allele

135 485 (cDNA)

70 80 >Uo 100 110 r GT T G GT GA G A 4 AT C T GAG GC A G G AA GC A G A G AC A G GC A A GC C T GT C.

Sense strand

485 (cD N A ) 200 210 >l 220 230 GCT T GC C T GTC TC T GC T TC C T GC C TCA G AT T TC TCAC CAAC

Anti sense strand

Figure 3.21 Sequencing results of CYP3A4 exon 6 DNA amplified from the 9 bp insertion-containing allele of sample M-42. The arrows indicate the CYF3A4'^15 mutation.

136 3.7 Discussion To provide suitable templates for PCR amplifications, genomic DNA extraction was performed on the collected blood samples. Although this was straightforward for fresh blood, some problems arose with frozen samples. It was found necessary to repeat the white cell pellet wash several times to remove haemoglobin contamination. However during these decontamination steps some loss of DNA always resulted. The most difficult issue, however, was genomic DNA rehydration. Complete removal of ethanol after washing the precipitated DNA pellet was critical for this step; otherwise DNA rehydration became difficult and was time consuming. Apart from these initial problems, the Promega DNA extraction and purification method proved to be fast and reliable in comparison to the other methods examined in this study (e.g. DNA Zol BD solution ‘Molecular Research Centre Inc., Ohio, USA’ and conventional laboratory non-kit methods). In general, the amount of extracted DNA in the samples was in the range of 100-200 ng/pl of final solution which was more than adequate for the purposes of this investigation.

Initially Pfu DNA polymerase was examined in PCR amplifications because of the high copying fidelity requirement of mutation analysis. But many attempts using different Mg^"*" concentrations, touchdown PCR and varying concentrations of the reaction components failed to give the expected PCR products with good yield. Subsequently, a ‘high fidelity’ kit (Advantage-HF 2, see section 2.2.4.3) was examined. This had seemed to be very reliable and efficient when it was used previously in our laboratory. However, considerable effort and time was still needed to optimise the conditions for the PCR amplifications of the CYP3A4 promoter region. The most critical factors were annealing temperature and primer/template concentrations. After optimisation, the PCR results were very satisfactory indicating robustness and reliability of the method.

Optimisation of ‘Cold’ SSCP also took a relatively long time due to the larger than usual (> 300 bp) PCR products being examined. There is in fact only one publication suggesting the possibility of performing SSCP on PCR products of around 500 bp (Kukita et al, 1997). In my study different techniques from the literature (Hongyo et al, 1993; Ainsworth and Rodenhise, 1994; Hayashi et al, 1998; Tuma et al, 1999;

137 Yip et al, 1999) were combined, particularly using different polyacrylamide gel concentrations and loading dye with high concentrations of dénaturants, to develop a reliable method. Moreover, it was found to be difficult to perform the high percentage (e.g. 15%) polyacrylamide gel electrophoresis of PCR products of more than 400 bp in a reasonable time scale. PCR products of this size, as single strands, move very slowly in high percentage gels. As a consequence the application of high voltages was necessary to perform efficient separation, however such voltages could cause melting of the gel and jeopardise the electrophoresis process. Due to the lack of suitable instrumentation (e.g. refrigerated buffer circulation) to perform ‘cold’ SSCP at high voltages and reduce the electrophoresis time to a matter of a few hours, SSCP electrophoresis had to be performed in the cold room at lower voltage and took almost three days to complete. However, the final results were very satisfactory and the optimised method was able to reliably reveal new mutations in amplified DNA from blood samples. In fact the ‘Cold’ SSCP method developed here seems to be robust enough to analyse PCR products up to 500 bp long.

DNA sequencing of samples that appear from SSCP analysis to contain a mutation is the only reliable method of confirmation. The in-house ABI Prism 373 DNA sequencer which was used initially for sequencing of the samples detected as mutants, had a reduced accuracy after 350 bp of sequence. To overcome this problem as well as possible ‘operator errors’ or the presence of PCR ‘artefacts’, several samples of each relevant DNA and PCR product were prepared for sequencing to obtain confirmation. Satisfactory DNA sequencing results were obtained for all samples analysed especially for the -493/-61 section of the CYP3A4 promoter. PCR products of the sample with the new mutation were also sequenced and confirmed using a different DNA sequencing machine (OpenGene system. Visible Genetic Inc., Canada). However, in order to reduce the time loss and cost of failed sequencing runs the commercial sequencing service of MWG Biotech AG (Ebersberg, Germany) was used subsequently.

The frequency of the -392 A ^ G transition polymorphism varies considerably among different racial populations; for example, the allele is present in only 4% to 9% of European Americans: but it is the predominant (55%) allele in African Americans

138 (Wendel et al, 2000). The frequency of this mutation (all of them heterozygous) in our study was 9.6% among a white European population and is consistent with the previous studies. In the Iranian samples the frequency was lower at 6%. There has been a substantial debate regarding the association of the -392 A—>G transition with a higher clinical stage and grade of prostate cancer (Rebbeck et al, 1998) but this issue was not confirmed in later studies (Ball et al, 1999; Westlind et al, 1999).

The novel -369 T ^ A transversion which was found here in one Caucasian subject may have some effect on enzyme expression because of its proximity to the CAAT box and other regulatory motifs.

The -747 C-^G transversion identified in this study is a mutation with a relatively high frequency of 20% in Caucasians and 18% in the Iranian populations. This mutation is not located in or near a known transcriptional element and might thus have little or no effect on gene expression.

Perhaps the most surprising result in mutation detection experiments was the genotype of subject M-42. This Caucasian male has inherited an allele containing a nine-nucleotide insertion after -845 G, a -392 A—>G transition, and a G-^A transition in exon 6 (resulting in (R162Q). Insertion of nine nucleotides at position -845 (which is identical in 8 out of 9 nucleotides to the ‘HFL-a’ response element in the CYP3A7 promoter) makes this region of the CYP3A4 gene in this allele similar to CYP3A7. Since CYP3A7 expression is repressed in adult liver and ‘HFL-a’ is one of the few substantial differences between the CYP3A4 and CYP3A7 promoter regions, this insertion may cause down-regulation of CYP3A4 expression from this allele. The linked mutation in exon 6 of the M-42 subject and conservative substitution of arginine for glutamine may not have a substantial effect on enzyme activity (Lewis et al, 1996; Szklarz and Halpert, 1997).

In summary, we have further developed a simple, non-radioactive SSCP analysis method so that it can reliably detect single nucleotide changes in PCR products up to 500 bp in length. We have utilised this system and confirmatory sequencing to identify three novel mutations in the 5' regulatory region of the human CYP3A4 gene.

139 The investigation in vitro of the possible impact of these novel mutations on hepatic CYP3A4 gene expression, using an alkaline phosphatase reporter gene system, is the subject of the next chapter.

140 CHAPTER FOUR

EFFECTS ON GENE TRANSCRIPTION OF MUTATIONS IN THE HUMAN CYP3A4 GENE PROMOTER REGION

4.1 Introduction It has been proposed that much of the substantial inter-individual variability in CYP3A4 activity can be attributed to genetic factors (Ozdemir et al, 2000), but extensive efforts to investigate a genetic role for inter-individual variation in enzyme activity have been inconclusive. Although a growing number of rare CYP3A4 mutant alleles (mostly in the coding region) have been recently discovered (http://www.imm.ki.se/CYPalleles/cyp3a4.htm) their contribution to overall CYP3A4 activity is limited. This finding and the fact that CYP3A4 activity is strongly correlated with CYP3A4 mRNA abundance, indicates that transcriptional control is the primary mechanism for regulating expression of CYP3A4 (Kuehl et al, 2001) and underlines the importance of investigating the role of regulatory region polymorphisms in modulating CYP3A4 levels.

Wild type and mutant proximal promoter region DNAs, as described in chapter three (section 3.3.), were inserted into alkaline phosphatase reporter vectors. The potent upstream XREM region (Goodwin et al, 1999) was also included in the constructs. The reporter plasmids were named according to the blood DNA samples from which the proximal promoter region had been amplified:

M-01: containing a wild type proximal promoter region.

F-14: containing the CYP3A4"^1E proximal promoter region (-369 T->A trans version).

F-27: containing the CYP3A4"^1B proximal promoter region (-392 A ^ G transition).

141 M-18: containing the CYP3A4^1F) proximal promoter region (-747 C-^G transversion.

M-42: containing the CYP3A4^15B proximal promoter region (nine-nucleotide insertion after -845 G and -392 A ^ G transition).

To evaluate the activity of these promoters a number of transfection studies were performed using three different cell lines and several classical CYP3A4 inducers.

4.2 Cloning of the CYP3A4 XREM region into the pSEAP2-hasic vector In a detailed report, Goodwin et al (1999) characterised a distal XREM region that, in conjunction with elements in the proximal promoter region, directs hPXR-mediated transactivation of CYP3A4. This region, located ~ 7.9 kp upstream of the CYP3A4 translation initiation site, is a complex array of transcriptional-binding sites that includes at least two elements (designated dNRl and dNR2) that are capable of binding the hPXR-RXRa heterodimer (see Figure 4.5). Disruption of the proximal hPXR binding site and dNRl destroys 80 to 90% of the CYP3A4 promoter xenobiotic responsiveness, demonstrating that these two elements are central to transactivation by ligand-activated hPXR.

The pSEAP2-basic expression vector (Figure 2.1) was digested with the restriction enzymes Mlui and Xhol to create sticky ends as described in Materials and Methods (section 2.2.3). The vector DNA was re-purified after each digestion reaction (section 2.2.6.1).

300 bp of the XREM region (-79727-7673) was amplified from genomic DNA (section 2.3.6) using modified P7 and P8 primers creating Mlu\ and Xhol restriction sites respectively. The purified and digested PCR products were then ligated into the digested and purified pSEAP2-Basic plasmid DNA (section 2.3.4). The recombinant plasmid DNA (designated pX-SEAP2, Figure 2.2) was transformed into E. coli TOPI OF' (Invitrogen, CA, USA) cells and transformed colonies were isolated.

142 Miniprep plasmid DNA extraction and purification was performed (section 2.2.1.2). The authenticity of the plasmid was confirmed by the following.

(1) The sizes of intact recombinant plasmid DNA were examined. As shown in Figure 4.1, pX-SEAP2 plasmid DNA was larger compared to pSEAP2-Basic plasmid DNA indicating insertion of the XREM region.

(2) The pSEAP2-Basic and pX-SEAP2 plasmids were digested with Mlu\ to check the sizes of the linear forms. Figure 4.2 clearly shows that linear pX-SEAP2 plasmids DNA had the correct size as compared with the DNA marker and linear pSEAP2-Basic DNA.

(3) The Mlul digestion products were re-digested with Xhol to confirm the presence of the XREM region insert. Figure 4.3 indicates the results of the double digestions and confirms the identity of the selected pX-SEAP2 plasmid.

(4) Diagnostic PCR of the XREM region was performed using constructed pX- SEAP2 plasmid DNA as template. Figure 4.4 shows the XREM region can be amplified from the recombinant plasmids.

(5) DNA sequencing of the PCR product provided final confirmation of the presence of the unchanged XREM region in the pX-SEAP2 plasmid (Figure 4.5).

One of the authenticated XREM containing plasmid constructs was taken as the reference pX-SEAP2 plasmid and used as the parent in all further manipulations.

143 bp

8000 ^ 6000 ^ 4000 3000

Figure 4.1 Size control of the pX-SEAP2 plasmids in comparison to pSEAP2- Basic. M: 1 kb DNA marker Lane 1: pSEAP2-Basic DNA (4677 bp) Lanes 2-4: different pX-SEAP2 plasmid DNAs (4966 bp) prepared from bacteria transformed by DNA from three different ligation reactions. Lane 2 is plasmid DNA prepared from transformation of a ligation reaction performed at room temperature for three hours. Lanes 3 and 4 are from reactions that were carried out overnight at 4 ”C.

144 bp

8000 ^ 5000 3000 ^ 2000 —>

Figure 4.2 Agarose gel (1%) electrophoresis of recombinant plasmids digested with Mlul. M: 1 kb DNA marker Lane 1: pSEAP2-Basic DNA (4677 bp) Lanes 2-3: different pX-SEAP2 DNAs prepared from two ligation reactions (4966 bp). Lane 2 is plasmid DNA prepared from transformation of a ligation reaction performed overnight at 4 °C. Lanes 3 is from a reaction that was carried out at room temperature for three hours. Lane 4: uncut pX-SEAP2 DNA

145 8000 ^ 5000 ^ <— 4666 bp

2 0 0 0 ^

500-> <— 300 bp 2 5 0 ^

Figure 4.3 Restriction digests of recombinant pX-SEAP2 plasmids to check for the presence of the XREM region (300 bp). M: 1 kb DNA marker Lane 1: uncut pSEAP2-Basic DNA (4677 bp) Lane 2: uncut pX-SEAP2 DNA (4966 bp) Lane 3: pSEAP2-Basic DNA digested with Mlul (4677) Lanes 4-5: pX-SEAP2 DNAs digested with Mlul and Xhol

146 500 i— 300 bp 250

Figure 4.4 PCR amplification of the XREM region using the reference pX- SEAP2 plasmid as template. M: 1 kb DNA marker Lane 1: negative control (pSEAP2-Basic DNA) Lane 2: PCR product of the XREM amplified from human genomic DNA Lane 3: PCR product of the XREM amplified from reference pX-SEAP2 DNA.

147 -7938

4- 10 20 30 40 50 60 70 80 90 TA G AG AG ATG GT TCAT T C C T T TCAT T T G AT TAT CAAAG M AC T CAT GT CC CAAT TAAAG GTCATAA AGC CCAGT TT GTAAAC T GAG AT GA

100 120 130 140 150 d N R 2 jgQ 170 TCTCAGC TGA a T g a a c t t o c t gag CC TCTOCTTTCCTCCAGCCTCTCGGTGCCCT T G A A A T C A T GTC G G T TC A A GCA GC G T C A T

180 190 200 210 220 230 240 250 GAGGC ATTAC AAAGTTTAATTATTTCAGTGATTATTAAACCTTGTCCTGTGTT G AC C CCAGGT GAATCACAA GC T GAAC T

-7682

Figure 4.5 Sequencing of the XREM region PCR product amplified from the reference pX-SEAP2 plasmid DNA. The putative hPXR responsive elements (dNRl and dNR2) are boxed (adapted from Goodwin et al, 1999).

148 4.3 Cloning of the CYP3A4 proximal promoter region into the pX-SEAP2 vector

Reference pX-SEAP2 plasmid DNA (Figure 2.2) was digested with EcoRl and Hindlll to create sticky ends (section 2.2.3). The vector was purified after each digestion reaction (section 2.2.6.1). As described in section 2.3.6, a 1141 bp of the proximal promoter region (-1201/-61) was re-amplified from the genomic DNA of wild type and mutant subjects, using modified P1/P6 primers (Table 2.1), creating EcoRl and Hindlll restriction sites. The purified and digested PCR products were then ligated into the cut pX-SEAP2 plasmid DNA. The recombinant plasmid DNAs (designated pXP-SEAP2, Figure 2.3) were transformed into E. coli TOPI OF' (Invitrogen, CA, USA) cells and transformed colonies were isolated. Five colonies of M-01 (wild type) and 10 colonies of each mutant were randomly selected and cultured in 5 ml LB. Miniprep plasmid DNA extraction and purifications were performed as in section 2.2.1.2. The authenticity of the plasmids was confirmed by performing the procedures described in section 4.2.

As Figure 4.6 shows all plasmid DNAs extracted from the minipreps were electrophoresed to check the size correctness in comparison to pSFAP2-Basic and pX-SFAP2 plasmid DNAs. Plasmid DNAs of the wrong size (e.g. lanes 14-16) or related to mixed colonies (lanes 9-11) were omitted from further experiments. Further size evaluation was performed by digesting with EcoRl of the plasmid DNAs. Figure 4.7 is an example of this procedure. The plasmid DNAs of the correct size were also re-digested with Hindlll. Figure 4.8 indicates the results of the double digestions and confirms the authenticity of the pXP-SFAP2 plasmids.

PCR amplifications of the CYP3A4 proximal promoter region using the constructed plasmids as template were also performed for further confirmation of the authenticity of the pXP-SFAP2 plasmid DNAs. Figure 4.9 is an example of PCR amplifications for each of the five pXP-SFAP2 plasmids related to the wild type and mutant CYP3A4 promoters.

149 M 9 10 11 12 13 14 15 16

5000 3000^ 2000

1000^

Figure 4.6 An example of size analysis of the constructed pXP-SEAP2 plasmids. M: 1 kb DNA marker Lane 1: pSEAP2-Basic Lane 2: pX-SEAP2 Lanes 3-16: different newly constructed pXP-SEAP2 plasmids

Lanes 3 and 14-16 are plasmids that are similar in size to pX-SEAP2. These are probably derived from uncut original plasmid DNA. Lanes 9-11 are mixtures of pX-SEAP2 and pXP-SEAP2. Plasmids in lanes 4-8 and 11-12 are pure plasmid clones of the correct size.

150 M 1 2 3 4 5 6 7 9 10 11 12 13 14 15 16 17

<- 6099 bp 5000^ <- 4966 bp 3000^

2000 — >

1000^

Figure 4.7 Restriction digest (EcoRl) of recombinant pXP-SEAP2 plasmids. M: 1 kb DNA marker Lane 1: pSEAP2-Basic plasmid DNA (4677 bp) Lanes 2 and 17: pX-SEAP2 plasmid DNA (4966 bp) Lanes 3-16: different newly constructed pXP-SEAP2 plasmids

Plasmids in lanes 3, 5-7, 9, 12 and 14-16 are new recombinant pXP-SEAP2 plasmid clones of the correct size.

151 bp M

<- 4958 bp 5 0 0 0 ^ 3 0 0 0 ^

1 5 0 0 ^ 1141 bp 1000-^ 750

Figure 4.8 Restriction digest (EcoRl and Hindlll) of selected recombinant pXP-SEAP2 plasmids to cbeck for tbe presence of tbe CYP3A4 proximal promoter region. M: 1 kb DNA marker Lanes 1-5: pXP-SEAP2 plasmids M-01, F-14, F-27, M-18 and M-42 (section 4.1)

152 bp

1500 e - 1141 bp 1000 ^ 750 ^

500

Figure 4.9 An example of PCR amplification of tbe CYP3A4 proximal promoter region using pXP-SEAP2 plasmids as template. M: 1 kb DNA marker Lane 1: negative control (pSEAP2-Basic DNA) Lane 2: PCR product of the CYP3A4 proximal promoter amplified from genomic DNA Lanes 3-7: PCR products of CYP3A4 proximal promoter insert from plasmids M-01, F-14, F-27, M-18 and M-42 respectively

153 Due to the heterozygous nature of the mutations in the genomic DNA samples, sequencing of the PCR products amplified from several plasmid clones was the only way of selecting and confirming the final authenticity of the desired pXP-SEAP2 plasmids containing the mutant alleles. Sequencing results (Figures 4.10, 4.11, 12) confirmed the identity and authenticity of five different pXP-SEAP2 vectors containing the wild type and mutant CYP3A4 promoters. The mutant alleles are seen as a homozygous readout with the mutation in each sequence marked by arrow. Sequencing information regarding the recombinant plasmid M-42 containing the CYP3A4"^15B allele has already been shown in Figure 3.17.

154 AATTTCA a GTAT TT T GGAAT G AG G Æ AOC CAT A G AG A C A A G G GC AA G AG AG AGGC GAT T TA A TA GAT TT TAT G C C A A T GGC TCCAC :

Wild type forward sequence

40 30 60 70 80 90 100 110 120 AATTTCAAGTATTT T GG AAT GAGGACAGC CAT AG AG ACAAG G GC AGG AG AG AG GC GAT TTAATA GAT TT TAT GCCAAT GGC TCCAC TT

AATC TAT TAA AT C GC CTC TC TC CT GC CC TT GT C T CT AT GGC T GTC C TCAT TCCAAAATAC T T GAAAT TCATC CCAACAAGCCAC AC C TAC

Mutant forward and reverse sequences

Figure 4.10 Authentication by DNA sequencing of plasmid F-27 containing the CYP3A4'^1B promoter (A—>G transition at -392). The wild type sequence was amplified from plasmid MO-1. The arrows indicate the site of the mutation.

155 3D 40 50 60 70 80 90 100 110 CCATAGAGACAAGGGCAAGAOAGAGGC GA.T TTAATA GATTTTAT GCCAAT GGC TCCAC TTGAGTTTC T GATAA GAAC CCA GAAC CC T1

Wild type forward sequence

30 40 50 60 70 80 90 100 GAG GAG AGC CATA G AG ACAAGG GCAA G AG AG AGGC GA T T TAA TA G AT TA TA T GC CA A T G GC TCC.AC T T G A G T T T C T GA TAA G AAC CC

230 240 250 260 270 290 30C C T TA TC A G AA AC T C A A G T G G AGC C A T T G GC A T A T A A T C TAT TAA AT C GC C TC TC TC T T G C C C T T G T C TC TA T G GC T

Mutant forward and reverse sequences

Figure 4.11 Authentication by DNA sequencing of plasmid F-14 containing the CYP3A4^1E promoter (T—>A transversion at -369). The wild type sequence was amplified from plasmid MO-1. The arrows indicate the site of the mutation.

156 70 SO 90 100 110 120 140 150 CAAC TCCAC CAGC C T TTCTA 0 T T GGC CA.C T GT GT G TAC A GCACCC TGGTA GGGACCA GAGCCAT GACA GGGAATAA GAC TA G AC TA

Wild type forward sequence

70 80 90 100 120 140 150130 C TAAGTCA.AC TCCAC CAGC CT TTC TAG TTQ CCCAC T GT GT GTACA GCAC GC TG G TA G G GAC CA G AGC CAT GACA G G G A A T A A GAC T,

i i i l m

300 310 320 330 340 350 370 TAGTCTTATTCCCTOTCATGOC TC TGGTCCC TAC CAGC GTGC T GTAC ACAC AGT GGGC AAC TAGAAAGGCTOGTGG

Mutant forward and reverse sequences

Figure 4.12 Authentication by DNA sequencing of plasmid M-18 containing the CYP3A4^1F promoter (C ^G tranversion at -747). The wild type sequence was amplified from plasmid MO-1. The arrows indicate the site of the mutation.

157 After designation of the mini-cultures of the desired recombinant plasmids containing mutant alleles, endotoxin-free maxiprep plasmid DNA preparations were performed. Diagnostic size and restriction digest control reactions were then performed for final confirmations.

As shown in Figure 4.13 all maxiprep plasmid DNAs were of correct size in comparison to pX-SEAP2 plasmid DNA. Further analysis was performed by digestion of the plasmid DNAs with EcoRl. Figure 4.14 is the result of this digestion and again indicates the correct size of the linear plasmids (6099 bp) compared to a DNA marker. The plasmid DNAs were then re-digested with HindMl. Figure 4.15 indicates the result of the double digestions and confirms the authenticity of the maxiprep plasmid DNAs. The concentration of the authenticated maxiprep DNAs was then measured at 260 nm (section 2.2.1.3).

158 8000 ^ 6000 ^

4000 ->

3000

Figure 4.13 Size control of the maxiprep DNA extracts of pXP-SEAP2 plasmids in comparison to pX-SEAP2. M: 1 kb DNA marker Lane 1: pX-SEAP2 (4966 bp) Lanes 2-6: pXP-SEAP2 plasmids (6099 bp) containing wild type (M-01) and mutant alleles (F-14, F-27, M-18 and M-42 respectively)

159 bp

6000 <— 6099 bp 3000

1000

Figure 4.14 Restriction digest {EcoRY) of the maxiprep DNA extracts of pXP- SEAP2 plasmids to check the size correctness. M: 1 kb DNA marker Lanes 1-5: pXP-SEAP2 plasmids (6099 bp) containing wild type (M-01) and mutant alleles (F-14, F-27, M-18 and M-42 respectively)

160 bp

5000 —^ <- 4958 bp 3000

1500 <— 1141 bp 1000

Figure 4.15 Restriction digest {EcoRl and Hindlll) of the maxiprep DNA extracts of plasmids pXP-SEAP2 to check for the presence of the CYP3A4 proximal promoter region insert (1141 bp). M; 1 kb DNA marker Lanes 1-5: pXP-SEAP2 plasmids containing wild type (M-01) and mutant alleles (F-14, F-27, M-18 and M-42 respectively)

161 4.4. Functional analysis in vitro of the CYP3A4 promoter mutations Studies of transcription control elements have been greatly facilitated by linking them to reporter genes, which are readily assayed and expression of the reporter gene is used as an indication of transcriptional activity. The key features of a useful reporter gene are that its activity be easily assayed and that its endogenous activity in the target cells be low (Yanget al, 1997).

Secreted alkaline phosphates (SEAP) based reporter gene system obviously fulfils the above criteria as described in chapter two (section 2.3.4). pSEAP2-Basic (Figure 2.1) vector that allows for expression of SEAP under control of putative promoters and/ or enhancers of interest, was used to construct the recombinant plasmids containing the CYP3A4 wild type and mutant promoter regions. Using three different cell lines described in section 2.4, transient transfection experiments were performed to evaluate the effects of the mutations found on the CYP3A4 regulation.

Considering the central rate of hPXR in CYP3A expression and its possible ‘cross­ talk’ and even interaction with other receptors such as CAR and GR, it was decided to use a representative panel of previously identified CYP3 A4 inducers which belong to different chemical and pharmacological groups (Lehmann et al, 1998; Goodwin et al, 1999). All drugs were dissolved in DMSO producing maximum 0.1% of the solvent in cell culture medium.

4.4.1 Initial transfection experiments: Calcium phosphate precipitation method Preliminary transfection experiments were performed using calcium phosphate method (section 2.4.4.1) by Raman Dhir as an MSc project under my supervision. This method has been used previously in our laboratory for the study of CYP3A enzymes regulation in cell cultures such as HepG2 cells (Ogg et al, 1999 and El-Sankary et al, 2000).

The five pXP-SEAP2 reporter gene constructs described in section 4.1 were examined with known inducers of CYP3A4 dexamethasone (10 pM), phénobarbital (1 mM) and rifampicin (10 pM) in HepG2 cell line. All experiments included pSEAP2-Basic (Figure 2.1) and pCMV-cSPAP (Figure 2.5) vectors as negative and

162 positive controls respectively. Although the cells transfected by the pCMV-cSPAP vector produced high levels of alkaline phosphatase (demonstrated by emitted relative light units “RLU”), no obvious differences \vere observed between pSEAP2-Basic (SEAP) and constructed reporter gene vectors (Figure 4.16). This could be due to transfection inefficiency (as seen by relatively high well to well variation shown by large standard error values for pCMV-SPAP), insufficient activation of the CYP3A4 promoter region in this system or the toxicity induced by high concentration of calcium ions in this method.

Considering the report by Goodwin et al (1999) regarding the importance of co-transfection with hPXR expression plasmid in the study of CYP8A4 transcriptional activation, the same experiments were performed in the presence of the hPXR expression vector pSG5-hPXR. Again the results of the transfection experiments generally failed to demonstrate significant induction of the co-transfected plasmids by dexamethasone, phenobabital and rifampicin, the classical inducers of CYP3A4 in vivo (similar to the results illustrated in Figure 4.16).

As shown in Figure 4.16 there is only base line production of alkaline phosphatase for all vectors except pCMV-cSPAP which contains a potent cytomegalovirus promoter. None of the vectors was activated by known inducers of CYP3A4. Apparently the pCMV-cSPAP vector is capable of expression of alkaline phosphatase in high levels even at low transfection efficiency or in the presence of cytotoxicity due to high calcium concentration.

In view of the poor results using calcium phosphate as transfection reagent, it was decided to examine the FuGENE 6 transfection reagent (Roche Molecular Biochemicals) used by Goodwin et al (1999) in the HepG2 cell line and shown by them to produce high transfection efficiencies.

4.4.2 Characterisation of the FuGENE 6 transfection method Experiments with FuGENE 6 were performed initially to examine the activation of the CYP3A4 promoter constructs without co-transfection with hPXR expression vector pSG5-hPXR. As Figure 4.17 shows no activation of constmcted reporter

163 vectors was observed in comparison to the negative control plasmid pSEAPI-Basic (SEAP). The relative light units (RLU) produced are actually related to base line endogenous alkaline phosphatase activity which is not inactivated by heat treatment.

Subsequently the effects of co-transfection with pSG5-hPXR were examined. Dramatic activation of pXP-SEAP2 constructs (wild type and M-42) was observed in the presence of hPXR. As shown in Figure 4.18 both wild type and M-42 plasmids were able to express high levels of alkaline phosphatase. Small standard error values obtained clearly show that the cells in multiple wells were transfected almost equally. This obviated the need for further transfection efficiency evaluation or optimisation. Transfection of HepG2 cells in this experiment was performed 24 hours after seeding them into a 96 well plate. Although significant induction of both wild type and M-42 promoters was took place by 10 |iiM rifampicin no obvious difference was observed between DMSO and 10 |iM dexamethasone (CYP3A4 inducers were applied 5 hours after transfection as described in section 2.4.4.2). This was thought to be due to the relatively short time from seeding until transfection of the cells (described below).

164 45000 40000 35000 3 30000 B 25000

< D 20000 iÇ 15000 10000 5000 0 nm fvn nrfi mu SEAP CMV WT -42 M-18 F-27 F-14 SPAR

Figure 4.16 Transfection of HepG2 cells using the calcium phosphate precipitation method. □ DMSO 0.1%;0 dexamethasone (10 pM) ; □ phénobarbital (ImM); □rifampicin (lOpM). Data are shown as mean ±SEM, n=6 and were taken from day 5 of alkaline phosphatase measurement (gain level 12) (section 2.4.4.1).

165 4500 4000 ■ti 3500 ^ 3000 D) 2500 2000

SEAP WT M-42 M-18 F-27 F-14

Figure 4.17 Transfection of HepG2 cells with different pXP-SEAP2 plasmids using FuGENE 6 reagent. Effects of different CYP3A4 inducers in the absence of co-transfected hPXR. □ DMSO 0.1%; ■ dexamethasone (10 pM); □ Phénobarbital (1 mM); □ rifampicin (10 pM). Data represent the mean+SEM, n=6 (gain level 32).

50000 45000 T 40000 c 35000 Z) 2 30000 O) —I 25000 20000 .>4—» CO 15000 ----: ocCD 10000 5000 0 1— 1— B B SEAP WT M-42

Figure 4.18 Transfection of HepG2 cells performed using FuGENE 6 reagent. Effects of CYP3A4 inducers in the presence of eo-transfected hPXR.D DMSO 0.1%; El dexamethasone (10 pM); □ rifampicin(10 pM). Data represent the mean+SEM, n=6 (gain level 1).

166 In view of the high transfection efficiency using FuGENE 6 reagent, it was decided to perform further control experiments to ensure that any variation in alkaline phosphatase detection related only to differences between the mutant promoters, recipient cells, or xenobiotic inducers.

4.4.3 Lumicount™ {Packard) plate reader function To be certain that the location of the columns in the Optiplate (when relative light units were being measured) did not affect the supposed biological responses, the

Lumicount™ (Packard) plate reader was checked using HepG2 cells co-transfected with wild type pXP-SEAP2 (M-01) and the pSG5-hPXR plasmid, to define any possible instrument-related chemiluminescence reading errors. The contents of a column of 6 wells, from a 96 well plate containing HepG2 cells transfected with wild type pXP-SEAP2 plasmid and treated with 10 pM rifampicin, were re-distributed (illustrated below) into 9 replicate columns in an Optiplate polystyrene microplates

(Packard UK). Alkaline phophatase activity was then measured using the chemiluminescence procedure (section 2.4.6).

12 3 4567 89 e Contents of one column of e 6 transfected wells re-distributed into 9 columns of the Optiplate in 10 pi A •w aliqouts •

Figure 4.19 shows the results of this experiment. Statistical analysis of data, with single factor ANOVA, confirmed there was no significant difference between measurements. It can be seen that a very small variance ratio (F) corresponding to a

P value of 0.999 in fact indicates negligible variation. Therefore the Lumicount''

(Packard) plate reader was not subject to instrument or 96-well pi ate-derived variation of measurement.

167 15000 I

10000

CO Q) è 5000 CO CD OC

1 2 3 4 5 6 7 8 9 Cdunms

Figure 4.19 Lumicount™ (Packard) 96-well plate reader; examination for possible instrumental varation. Data are shown as mean+SEM (gain level 1), where each column (1-9) is a replicate of 6 wells derived from one experiment. Single factor ANOVA analysis of the data is shown below (a= 0.05).

ANOVA Source of Variation SS df MS F P-value F crit Between Groups 4.24x10^ 8 5.30x10® 0.052 0.999 2.15 Within Groups 4.53x10® 45 1.00x10®

Total 4.57x10® 53

SS: sum of squares, df: degree of freedom, MS: mean sum of squares

F: variance ratio= MS (between groups)/ MS (within goups)

F critical: indicates the variance ratio where the differences are significant

168 4.4.4 Time from seeding the cells until transfection It has been shown that primary human adult hepatoeytes at low cell density are relatively insensitive to typical CYP3A4 inducers such as rifampicin (Greuet et al, 1997). Based on this finding, the effects of the time after seeding of the HepG2 cells on the expression of transfected plasmids were examined. The rationale was that during the initial period of rapid cell division the cells would be less differentiated and thus less able to express transgenes containing liver-specific promoters (perhaps due to low levels of endogenous transcription factors). The inducer used in this experiment was dexamethasone since it was found in the previous experiments to be the weakest inducer of SEAP expression from the transgenes. Also the mechanism of action of dexamethasone is thought to be mediated by a complex interaction of endogenous transcription factors (Pascussi et al, 2001) and might thus be a better test for differentiation state.

As shown in Figure 4.20 it was found that the expression of transfected pXP-SEAP2 plasmids was considerably increased when transfection was performed 48 hours after seeding of the HepG2 cells into 96 well plate instead of as previously at 24 hours. This finding indicates the importance of the rate of cell growth and extent of confluency in transfection experiments (Hoen et al, 2000). Figure 4.20 also shows that all the mutant promoters were more responsive to 10 |iM dexamethasone than the wild type promoter (P<0.05 for M-42 and F-14; P<0.01 for M-18 and F-27).

169 (A) 900 800 1 700 2 600 CT 500

CD' 400

CO 300 CD OC 200 100

WT M-42 M-18 F-27 F-14

(B) 9000 8000 7000 2 6000 o)5000 m 4000 I 3000 (T 2000 1000 0 WT M-42 IVH8 F-27 F-14

Figure 4.20 The effect of the time after seeding of HepG2 cells on expression of transfected plasmids. Cells were eo-transfected with pXP-SEAP2 and hPXR using FuGENE 6. Data represent as mean +SEM, n=6 (gain level 1). □ DMSO 0.1%; ■ dexamethasone (10 pM). A. Cells transfected 24 hours after seeding B. Cells transfected 48 hours after seeding

170 4.4.5 Concentration of CYP3A4 inducers Although detailed dose-response measurements were beyond the main scope of this project some experiments were performed to cheek pXP-SEAP2 reporter construct activity and confirm the effective range of drug concentrations.

As shown in Figure 4.21 using the M-42 promoter as an example, significant induction of the mutant and wild type promoters commenced at 5 pM rifampiein and mifepristone, and a maximum effect was achieved at 40 pM. However, mifepristone produced a dose response curve in the HepG2 cells demonstrating almost equal aetivation of both promoters at 40 pM. For this strong hPXR ligand (Lehmann et al, 1998) at high doses its ability to maximally activate hPXR may result in swamping of the CYP3A4 promoters and loss of distinction between mutant and wild type promoters. Statistical analysis (t-test) was performed to evaluate the signifieanee of the different pattern of activation between wild type and M-42 mutant promoters. It can be seen that M-42 reporter construet is significantly more active than wild type in both cell lines. It was also clearly demonstrated that at 10 pM rifampicin could distinguish wild type and mutant promoter activities. This is the same concentration as used by Goodwin et al (1999).

171 6000 HepG2 c 5000 ** 1-42 2O) 4000 - I 3000 WT 2000 i CD 1000

2.5 20 Rifampicin (pM)

Caco-2

Qj 3000 scO 2000 0 1000

Rifampicin (pM)

HepG2 w 2 5 0 0 M-42 3 2000 I WT "o) 1 5 0 0 ' ** _ i m 1000 1

2 .5 20 Mifepristone (pM)

Figure 4.21 Dose response curves for rifampicin and mifepristone as inducers of pXP-SEAP2 expression follovying co-transfection with hPXR into HepG2 or Caco-2 cells.

Statistical analysis was performed using a t-test. Data represent the mean±SEM, n=6 (gain level 1). (* P<0.05; ** P<0.01; *** P<0.001)

172 4.5 In vitro responses of mutant CYP3A4 promoters to xenobiotic inducers

Transfection experiments were performed in HepG2, HuH7 and Caco-2 cell lines using previously defined optimal conditions. As indicated in sections 4.4.4 and 4.4.5 a concentration of 10 |iM for rifampicin, mifepristone and dexamethasone would give significant distinction between wild type and mutant promoters. For clotrimazole and phénobarbital the concentrations used by Goodwin et al (1999), 10 pM and 1 mM respectively, were used.

4.5.1 Activation of pXP-SEAP2 reporter gene constructs in HepG2 cells HepG2 liver hepatoma cells have been extensively used in cytochrome P450 expression and induction experiments due to their close similarity to normal liver cells (Goodwin et at, 1999; Pascussi et al, 1999; El-Sankary et al, 2001; Pascussi et al, 2001). The cells are easily passaged and retain their growth characteristics for about 20 passages from ECACC stock.

As shown in Figure 4.22 the activation profile of pXP-SEAP2 reporter constructs containing the CYP3A4 wild type and mutant promoters in HepG2 cells were compared. Statistical analysis of the data is shown in Table 4.1. It can be seen that except for F-14 (only more active than the wild type in response to dexamethasone, p<0.05) the mutant promoters are all more active with CYP3A4 inducers than the wild type promoter with F-27 the strongest. However M-18 was the only reporter construct that showed significantly increased activation with all the drugs tested (Table 4.1). Although the M-42 reporter construct also contained the A ^ G transition (the same as in F-27) it demonstrates less induction than F-27 and indeed with phénobarbital, a response that was not significantly different from the wild type (p>0.05).

173 50000

(/) r 40000 Z)

o ) 30000

(D "fri 20000 ~ ô OC 10000

WT M-42 M-18 F-27 F-14

Figure 4.22 Induction profile of reporter construct containing the CYP3A4 wild type and mutant promoters in the HepG2 cell line. Cells were co-transfected with pSG5-hPXR plasmid. Data represent the mean+SEM (gain level 1). DMSO and rifampicin, n=24 (four experiments); dexamethasone, phénobarbital, clotrimazole and mifepristone n=12 (two experiments); rifampicin without hPXR, n=6 (one experiment). □ DMSO; B1 dexamethasone (10 pM); □ phénobarbital (1 mM); □ clotrimazole (10 pM); ■ mifepristone (10 pM); □ rifampicin (10 pM); B rifampicin (10 pM) without hPXR.

Table 4.1 Statistical analysis (t-test) of the data in Figure 4.22 represented as relative inductions compared to the CYP3A4 wild type promoter.

Drug DEX PB CLTZ MIF RIF

Promo te r ^ ^ M-42 136** 1.04 E23* 132* 132*

M-18 1.62 *** E23* 127** 189*** 137*** CYP3A4^1F E-27 E47*** E20* 1.16 2.15 *** 139***

F-14 E22* 0.95 1.00 1.12 1.10

* P<0.05, ** P<0.01, *** P<0.001. p values relate to the wild type promoter.

174 4.5.2 Activation of pXP-SEAP2 reporter gene constructs in HuH7 cells The HuH7 cell line (Pascussi et al, 1999) was chosen as a second hepatoma cell line having similar characteristics to HepG2 cells (in handking requirements and growth rate) to examine the activation profile of the reporter constructs. Observation could be made regarding the effects of cell environment and availability of different transcription factors.

There is no extensive information published regarding the HuH7 cell line and expression of cytochrome P450 enzymes except a report by Pascussi et al (1999) indicating the expression of CYP3A7 by typical PXR activators rifampicin, clotrimazole and mifepristone. Also the cell line is not available commercially. However, study of CYP3A4 wild type and mutant promoters- dependant reporter gene construct expression in another hepatoma cell line was felt to be important.

The activation pattern of pXP-SEAP2 reporter constructs containing the CYP3A4 wild type and mutant promoters was different in the HuH7 cell line compared to HepG2 cells. As shown in Figure 4.23 and also the statistical analysis in Table 4.2, it can be seen that although M-18 and F-27 were the most active promoters (as in HepG2 cells), all the mutant promoters showed significantly increased activity in comparison to the wild type (P<0.001 in most of the cases). Another difference was that with all the reporter constructs phénobarbital produced a greater effect than mifepristone or clotrimazole (p<0.05 and p<0.01 respectively). This could be explained by higher expression of the nuclear receptor CAR in HuH7 cells. However, as with HepG2 cells rifampicin was the most powerful inducer (p<0.01 in all cases). The different drug induction patterns in the different hepatoma cell lines again indicates that drug metabolism and interaction studies using liver cancer cells may not be a good reflection of the events in normal hepatoeytes in vivo (Hamilton et al, 2001).

175 60000 —

50000 g c 3 40000 D) _J 30000 I i J !§ 20000 r 0 j ce 10000 r. 0 k 1 WT IW42 M-18 F-27 F-14

Figure 4.23 Induction profile of reporter construct containing the CYP3A4 wild type and mutant promoters in the HuH7 cell line. Cells were co-transfected with pSG5-hPXR plasmid. Data represent the mean±SEM (gain level 1). DMSO and rifampicin, n=24 (four experiments); phénobarbital, clotrimazole and mifepristone n=l 2 (two experiments). □ DMSO; □ phénobarbital (1 mM); □ clotrimazole (10 pM); ■ mifepristone (10 pM); □ rifampicin (10 pM).

Table 4.2 Statistical analysis (t-test) of the data related in 4.23 represented as relative induction compared to the CYP3A4 wild type promoter.

Drug PB CLTZ MIF RIF

P rom oter\^ M-42 1.18 0 3 6 * 1.60 *** 172***

M-18 170*** 0.66 ** 2.22 *** 1.97*** CyP3A4*7F F-27 E75*** 2 21 *** 2.47 *** 1.96 *** CyP3A4*7R F-14 E26* 0.75 ** 158*** 1.70 *** CyP3A4*7F * P<0.05, ** P<0.01, *** P<0.001. p values relate to the wild type promoter.

176 4.5.3 Activation of pXP-SEAP2 reporter gene constructs in Caco-2 cell line Since CYP3A enzymes are extensively expressed in gastrointestinal tract tissue (Schmiedlin-Ren et al, 1997 and references therein) it was decide to perform similar experiments to those in hepatic cell lines using a colon-derived cell line. The colon adenocarcinoma cell line Caco-2 has been used extensively to examine both intestinal drug uptake and xenobiotic metabolism. Under certain conditions it has been shown to express some members of CYP3A enzymes (Schmiedlin-Ren et al, 1997; Hara et al, 2002; Tran et al, 2002). Its use in here was designed to examine the possibility of tissue specific variation in transcription factor availability and induction profile.

Figure 4.24 shows the results obtained from the experiments using Caco-2 cell. As it can be seen the M-42 construct is the only promoter that shows substantially increased activation for all of the inducers compared to the wild type (p>0.01) (Table 4.3). Also of note was that in Caco-2 cells phénobarbital produced higher activation of some promoters (M-42 p>0.01 and M-18 >0.05) than rifampicin. This again indicates the important role of endogenous factors in manifesting drug effects in this in vitro system.

177 40000

35000

^ 30000 c 2 25000 O) □ 20000 CD 15000 _co (g 10000

5000 0 1 mm 1 l i WT M-42 M-18 F-27 F-14

Figure 4.24 Induction profile of reporter constructs containing the CYP3A4 wild type and mutant promoters in Caco-2 cell line. Cells were co-transfected with pSG5-hPXR plasmid. Data represent the mean+SEM (gain level 1). DMSO and rifampicin, n=24 (four experiments); phénobarbital, clotrimazole and mifepristone n=12 (two experiments). □ DMSO; □ phénobarbital; □ clotrimazole(10 pM); ■ mifepristone(10 pM); □ rifampicin(10 pM).

Table 4.3 Statistical analysis (t-test) of the data in Figure 4.24 represented as relative induction compared to the CYP3A4 wild type promoter.

Drug PB CLTZ MIF RIF

Promoter^^ M-42 1.87 ** 2.78 *** 1.78 ** 1.64 **

M-18 1.14 1.08 1.06 1.00

F-27 1.04 1.45* 1.19 1.06 CyP3A4+7B F-14 1.18 1.13 1.28 * 1.34* CyPjA4+7F * P<0.05, ** P<0.01, *** P<0.001. p values relate to the wild type promoter.

178 4.6 Discussion A carefully designed and constructed reporter gene system can be a very valuable tool in functional analysis of mutant regulatory regions in vitro. Cloning of the CYP3A4 XREM region into the pSEAP2-Basie vector was performed first. Due to the commercial availability of high quality cloning reagents and kits this step of the work was performed without difficulty. Amplification of the PCR product from this region with different restriction digest sites at each end provided the possibility of insertion of the XREM in the correct orientation in the pX-SEAP2 vector. This vector was authenticated by several electrophoresis and restriction digest examinations as well as final sequencing of the insert using the pXP-SEAP2 plasmid DNA as template (Figures 4.1 to 4.5).

A similar approach was applied to construct the five different pXP-SEAP2 reporter genes containing the CYP3A4 wild type and four mutant proximal promoter regions. The only problem encountered was the heterozygous nature of the mutations. In cloning experiments a 1:1 mixture of pXP-SEAP2 plasmids containing wild type and mutant promoters was produced as expected. Sequencing of the PCR products of the promoter region, using the cloned plasmid DNAs as template, was the only way of identifying these plasmids containing mutant promoters. However, using several authentication procedures (Figures 4.6 to 4.12), all five pXP-SFAP2 vectors were demonstrated to contain the required CYP3A4 proximal promoter.

The maxiprep pXP-SEAP2 plasmids DNAs were used directly in transfection experiments. The initial transfection experiments using the calcium phosphate precipitation method failed to demonstrate any activation of the reporter constructs in HepG2 cell line. Later co-transfection attempts with pSG5-hPXR also failed. Based on these findings and other unsuccessful transfection results reported in our lab (Vahdati-Mashhadian PhD thesis, 2001) it was decided to use an alternative transfection reagent. It seemed that relatively high levels of calcium ions produced during DNA-calcium precipitation caused cellular toxicity and hence interfered with proper reporter gene expression. Apparently this kind of toxicity is more obvious in the case of the reporter genes that contained an endogenous promoter rather than virus derived strong promoters such as pCMV-cSPAP. This plasmid expressed

179 moderate levels alkaline phosphatase in transfections using calcium phosphate method (section 4.4.1).

Experiments using FuGENE 6 reagent produced satisfactory and reproducible results when the pXP-SEAP2 reporter constructs were co-transfeeted with pSG5-hPXR plasmid (section 4.4.2). These results were in agreement with Goodwin et al (1999) and once again indicated the crucial role of hPXR in CYP3A4 regulation. Functional analysis of the novel mutations in the CYP3A4 regulatory region as well as CYP3A4^1B allele (Rebbeck et al, 1998) in human liver (HepG2, HuH7) and a colon adenocarcinoma (Caco-2) cell lines became possible by use of this reagent.

Significant variation in promoter strength was found among the mutant CYP3A4 alleles depending on the inducer used and the recipient cell line (section 4.5). Also different induction patterns were observed in different cell lines with different CYP3A4 inducers (most notably by phénobarbital and mifepristone). This indicates the role of endogenous transcription factors (such as CAR and PXR) and their concentration relative to each other.

Transfection of wild type and mutant containing reporter constructs in HepG2, HuH7 and Caeo-2 cells, in general, produced similar pattern of induction by the same drugs. The only exception was phénobarbital which produced more induction with all CYP3A4 alleles in HuH7 and Caco-2 cells compared to HepG2 cells. However, the induction pattern of the CYP3A4 alleles was substantially different in Caeo-2 cells. Only the M-42 reporter construct showed a significantly different (increased) activity for all of the inducers examined in comparison to the wild type promoter in this cell line. This may suggest the possibility of binding of a specific transcription factor to the nine-nucleotide insertion site in the M-42 promoter in these cells. Further studies are required to evaluate this assumption.

The most notable finding in the transfection experiments was the high promoter activity in hepatic cell lines of the F-27 reporter construet (containing the CYP3A4'^1B allele). This allele which is common in the African-American population, has been the subject of several investigations and a connection with some abnormalities such as prostate cancer has been proposed (Rebbeck et al, 1998; Ball

180 et al, 1999; Westlind et al, 1999). Most of these studies reported no difference in promoter activity of CYP3A4*1B in comparison to the wild type allele as judged by measurement of hepatic microsomal CYP3A4 levels in biopsy samples and gel shift analysis (Westlind et al, 1999) or the erythromycin breath test (Ball et al, 1999). However, none of these reports used an in vitro reporter gene analysis approach. It seems that direct in vivo analysis of steroid and drug metabolism in populations that express this allele homozygously could clarify the situation.

In summary, I have shown that polymorphisms in the human CYP3A4 gene regulatory region can significantly affect transcriptional responses to xenobiotic inducers in vitro. However, due to their heterozygous nature, these mutations may have only a limited overall effect on hepatic CYP3A4 expression in vivo.

181 CHAPTER FIVE

FINAL DISCUSSION AND CONCLUSIONS

5.1 Introduction Understanding the genetie basis of inter-individual variability in drug disposition and response is a fundamental foeus for pharmaeogenetic research, and for rational and individualised drug treatment. Pharmacogenetics is the study of the linkage between an individual’s genotype and that individual’s ability to metabolise a foreign compound. Pharmaeogenetic studies are often related to the genotyping of polymorphic alleles that encoding drug-metaboHsing enzymes in order to identify an individual’s drug metabolism phenotype. Genetic polymorphism has been linked to three classes of phenotypes based on the extent of drug metabolism. Extensive metabolism (EM) of a drug is characteristic of the normal population; poor metabolism (PM) is associated with accumulation of specific drug and is typically an autosomal recessive trait due to mutation and (or) deletion of both alleles for phenotypic expression; and ultra extensive metabolism (UEM) results in increased drug metabolism and is an autosomal dominant trait often arising from gene amplification (Linder et al, 1997).

CYP3A4 is usually the most abundant GYP isoform in the adult human liver, displays large inter-individual variability in its expression and hence, has considerable relevance for personalised medicine, carcinogenesis risk associated with exposure to procarcinogens and other xenobiotics. It also plays the main role in metabolic fate of endogenous steroids (Ozdemir et al, 2000). CYP3A4 is considered the most important and is the most extensively studied member of the CYP3A subfamily. CYP3A4 activities in liver biopsies vary up to 40-fold in the population (Daly et al, 1993; Shimada et al, 1994; Westlind et al, 1999). However, the variability measured in vivo is usually much smaller (five fold) (Thummel and Wilkinson, 1998). This variation is generally assumed to contribute to harmful drug interactions frequently encountered in development and application of drugs that are CYP3A4 substrates. In addition to modulation of bioavailability of drugs, the inter-individual variation in CYP3A4 activity may contribute to the individual predisposition to several common

182 cancers caused by environmental carcinogens. For example, CYP3A4 metabolises aflatoxin Bi (Wang et al, 1998), a mycotoxin strongly implicated in the aetiology of liver cancer, which is a major cause of premature death in many areas of Africa and Asia (Henry et al, 1999). It has also been proposed that high levels of CYP3A in humans could predispose an individual to cancer risk from bio-aetivated tobacco- smoke proearcinogens (Paolini et al, 1999). Taken together, the elucidation of factors controlling a patient’s CYP3A4 expression level could permit individual dose adjustments in therapies with its substrates and also lead to the identification of sub­ populations at increase risk for several common cancers.

It has been proposed that much of the variability in CYP3A4 activity can be attributed to genetic factors (Ozdemir et al, 2000) but, until recently (Rebbeck et al, 1998; Sata et al, 2000; Hsieh et al, 2001; Eiselt et al, 2001; Dai et al, 2001; Lamba et al, in press) no reports of screens for CYP3A4 variants were available. However, the protein variants described so far may contribute to, but obviously do not fully explain, the variability of CYP3A4 expression. Therefore, it could be postulated that functionally relevant genetic variance may be located in the regulatory rather than in coding region of the CYP3A4 gene. In this project a new population screening for CYP3A4 regulatory region polymorphism has been performed and novel alleles with relatively increased enzyme activity are introduced.

5.2 Mutation detection: a non-radioactive (Cold) SSCP approach In order to analyse a relatively large number of PCR samples (more than 400) with a cost effective and efficient mutation detection method several approaches were considered. For example, direct sequencing of the PCR products was considered as the easiest and the most accurate mutation detection method. However, the high cost of the of primary sequencing of the samples and further confirmation sequencing reactions as well as unavailability of a robust in house DNA sequencing instrumentation made it almost non practical. Single-strand conformation polymorphism (SSCP) facilitates rapid identification of genetie polymorphisms within segments of DNA up to 300 bp. This method has many advantages compared to other mutation detection methods such as simplicity and inexpensiveness (Hayashi et al, 1998). Use of a non-radioaetive SSCP method for analysis of known mutations of

183 p53 coding region PCR products from human gastric carcinoma had already been reported and compared to conventional SSCP (in which radio-labelled PCR primers or nucleotides are used to generate radioactive PCR products) (Hongyo et al, 1993). In this report a mutation detection efficiency of 100% using ‘cold’ SSCP, compared to 57-94% (in different exons) for radioactive SSCP, was achieved. It was also mentioned that the use of methylmereury hydroxide as a strong dénaturant (to produce and maintain high amounts of single strand DNA) was necessary to the success of this method. Considering all options it was decided to use a similar approach for mutation detection in this project.

During initial cold SSCP trials I could not acquire methylmereury hydroxide from any known commercial company. However, as described in section 2.2.4.1 using a mixture of different dénaturants it was possible to produce sufficient amounts of single-strand DNA required to be easily visualised using SYBR® Gold stain. Cold SSCP analysis of PCR products from the CYP3A4 proximal 5' regulatory region (amplified as three overlapping segments) revealed several samples with altered electrophoretic patterns (described in detail in section 3.4). The presence of proximal 5' regulatory region mutations was confirmed by sequencing of both DNA strands in the original and freshly amplified PCR products. In all samples where novel CYP3A4 regulatory region mutations were found, direct sequencing of PCR products from all 13 exons was performed to identify any linked coding region mutations. Some PCR samples with wild type SSCP pattern were also selected randomly and sequenced to be assured that no mutation remains undetected. No mutation was detected in these sequencings.

Briefly, in addition to detection of the previously reported CYP3A4'^1B allele in nine subjects, three novel alleles were found: CYP3A4*1E (having a T ^A transversion at -369 in one subject), CYP3A4^1F (having a C^G transversion at -747 in 17 subjects) and CYP3A4'^15B having a nine-nueleotide insertion between -845 and -844 linked to an A—>G transition at -392 and a G—>A transition in exon 6 (position 485 in the cDNA) in one subject (M-42). Linkage of the three mutations in subject M42 was confirmed using cloning and long-range allele-speeifie PCR to separate the alleles. No variant electrophoretic SSCP patterns were found in PCR products from

184 the distal enhancer (XREM) region indicating extensive conservation of sequence in this essential regulatory region. Out of three novel CYP3A4 alleles identified in this project, each of the two alleles {CYP3A4^1E and CYP3A4^15B) was only found in one Caucasian subject and can be categorised as rare alleles. However, CYP3A4^1F was found in both Iranian and European populations with a high frequencies, i.e. 18 and 20% respectively.

The strategy designed to screen for novel mutations in the CYP3A4 5' regulatory region worked very well and is easily applicable to further large-scale population screening studies. Indeed the relatively high number (28 in total) of the mutations found clearly demonstrated the robustness and reliability of the cold SSCP protocol that was developed and used in this project. The only modification which seems to be necessary for large-scale applications is to provide suitable conditions to reduce the electrophoresis time by applying higher voltages. This could be achieved by using a thermostatically controlled refrigerated circulator to maintain a constant preset temperature of the buffer during electrophoresis in order to prevent melting of the gel due to high voltages.

5.3 Effects of the CYP3A4 gene variation on enzyme activity Since 1998 considerable effort has been made to elucidate the genetic basis of the inter-individual variability of hepatic CYP3A4 activity but the results obtained so far suggest a limited genetic contribution. Most of CYP3A4 alleles are either rare or specific to a given population. Indeed, Chinese and Europeans share only one out of eight protein variants (CFP3A4*3) found in these ethnic groups (Sata et al, 2000; Eiselt et al, 2001). Likewise, the CYP3A4'^2 allele has only been identified in the Finnish population which is in agreement with their distinct genetie heritage. The population-specific character of CYP3A4 protein variation is likely to affect further efforts to identify alleles underlying the variable activity of the gene. However, the utilisation of ethnically matched sample sets will improve the odds of finding a correlation with a clinical or biochemical phenotype (Eiselt et al, 2001).

As described in sections 4.4 and 4.5, functional analysis of the regulatory region mutants was performed in vitro using reporter gene constructs in which the whole

185 1141 bp proximal promoter region from each mutant allele was inserted between a single copy of the 300 bp core distal enhancer sequence and the cDNA for human secreted alkaline phosphatase (SEAP). The individual reporter constructs were eo- transfected with an hPXR expression vector into human liver (HepG2, HuH7) and intestinal (Caeo-2) cancer cell lines. Xenobiotic modulation of CYP3A4 promoter activity was measured by chemiluminescent SEAP assay.

Novel mutations in CYP3A4 proximal promoter discovered in this project were not located in/or near any of the known transcriptional regulatory elements. Only the mutation in the CYP3A4"^1E allele (-369 T-^A transversion) is located near a regulatory element, the CAAT box (Figure 5.1). Therefore it might have been predicted that the novel alleles might not show altered promoter activity compared to the wild type allele. However, significant increased promoter activity of the reporter constructs containing the novel alleles CYP3A4"^1F and CYP3A4^15B as well as the previously described CYP3A4^1B allele (Rebbeck et al, 1998) was observed in human hepatoma cell lines (HepG2 and HuH7) when different CYP3A4 inducers were applied. In Caco-2 (colon carcinoma) cells only the CYP3A4^15B allele showed significantly increased activity. The promoter activity of the CFP3A4 *7 £ allele was not significantly different from the wild type allele in HepG2 and Caeo-2eell lines. In HuH7 cell line, however, it showed increased activity. Another notable feature was the different induction effects produced by drugs when the three cell lines were compared. While there was some similarity between the xenobiotic induction patterns for wild type and mutant promoters in HepG2 and HuH7 cells the pattern in Caeo-2 cells was substantially different (section 4.6).

To further identify possible transcriptional binding sites related to the various mutations, the proximal wild type and mutant promoter sequences were analysed for putative transcriptional factor binding using the most up-to-date versions of the AliBaba 2.1 and Matlnspector online promoter analysing programmes (http:// www.imm.ki.se/CYPalleles/eyp3a4.htm and http://genomatix.gsf.de/mat_fam respectively). Similar overall pictures emerged from both programs. The AliBaba analysis for the CYP3A4 wild type proximal promoter, neighbouring the mutation sites, and the corresponding mutant sequences are presented in Figures 5.1 and 5.2.

186 When the mutant promoters are compared to the wild type sequence, changes in putative transcription factor binding are only seen in the cases of the T—>A {CYP3A4^1E) and C— {CYP3A4^1F) mutations. As shown in Figure 5.2 (A) the T ^ A transversion would result in NF-1 (nuclear factor 1) and Oct-1 (oetamer 1) binding preferentiality and position being changed. In the case of the C ^ G transversion a potential Sp-1 (specificity protein 1) binding site would be deleted. Whether these alterations actually lead to increased or decreased binding activities remains the subject of future detailed studies. Further analysis of these findings by carefully directed gel mobility shift assays and site-directed mutagenesis might clarify the situation.

It is also worth remembering that the findings in this project and indeed most of the published information regarding CYP3A genotype to phenotype come from in vitro and/or ex vivo experiments, and may not provide an accurate picture of the in vivo events. Large groups of subjects and/or patients will need to be examined using kinetic data to determine whether the mutant alleles discovered here, or possibly other genetie variations, affect phenotypic enzyme activity. Initial reports from trials of this type have not established a link between the CYP3A4^1B mutation and CYP3A activity in vivo (Ball et al, 1999). For this reason studies that pre-select individuals with unusually high or low CYP3A-mediated drug metabolising activity may be particularly important in determining whether genetie variation underlies the in vivo phenotypes exhibiting clinically significant variation in hepatic drug metabolism.

187 (A) -392 -369 GGACAGCCATAGAGACAAGGGCAAGAGAGAGGCGATTTAATAGATTTTATGCCAATGGCT NFSE CAAT box = = = = S p l = =^= = = = = S p l ======NF-1 ======Oct-l===

(B) -747 TTTCTAGTTGCCCACTGTGTGTACAGCACCCTGGTAGGGACCAGAGCCATGACAGGGAAT =: = = =Spl ======NF-1 ======AP-1==

(C) -845 ACAGCAGCTGAGGCACAGCCAAGAGCTCTGGCTGTATTAATGACCTAAGAAGTCACCAGA ===AP-4=== ==C/EBPg== ===HNF-1== = = C/EBPg= = = = C/EB Pg= = ===AP-1===

Figure 5.1 Analysis of CYP3A4 wild type proximal promoter for potential transcriptional factor binding sites using AliBaba 2.1 online program. The sequences neighbouring the mutation sites are shown compared the mutant sequences in Figure 5.2, (A-C) Indicate the sites for wild type sequences of the corresponding mutation sites.

188 (A) -392 -359 GGACAGCCATAGAGACAAGGGCAGGAGAGAGGCGATTTAATAGATTATATGCCAATGGCT NFSE CAATbox ====Spl======Spl======Oct-l======NF-1 = = =

(B) -747 TTTCTAGTTGCCCACTGTGTGTACAGCACGCTGGTAGGGACCAGAGCCATGACAGGGAAT ===NF-1======AP-1==

(C) -854 ACAGCAGCTGAGGCACAGCCAAGAGCTCTGGCTGTATTAATGACCTAAGAAGATGGAGTGATCACCAGA = =z=AP-4 = = = = = C/EBPg== = = =HNF-1 = = ==C/EBPg== ==C/EBPg== ===AP-1===

Figure 5.2 Analysis of CYP3A4 mutant proximal promoters for potential transcriptional factor binding sites. (A) Indicates the sites for -369 A ^ T transversion and -392 A ^ G transition. (B) Indicates the site for -747 C ^ G transversion. (C) Shows the site for nine nucleotide insertion (underlined) after -845 G.

189 5.4 Transcriptional regulation of CYP3A4 gene expression: basal expression versus xenobiotic modulation

The role of PXR as a xenobiotic-responsive mediated transcriptional modulator of CYP3A4 gene expression has been established (Bertilsson et al, 1998; Blumberg et al,

1998; Kliewer et al, 1998; Lehman et al, 1998). Moreover, in studies earned out in vitro, without co-transfection with hPXR expressing vectors, no induction of CYP3A4

reporter constructs was observed (Goodwin et al, 1999). The same results were also

observed during this project (section 4.4.2). However, it has been shown that the loss of the expression of PXR protein inereases the constitutive expression of the murine

CYP3A proteins (Xie et al, 2000b). Therefore, a transcription factor(s) other than PXR is assumed to contribute to the constitutive expression of the CYP3A gene in mammals (Saito et al, 2001).

A general model (Figure 5.3) for the constitutive transcriptional regulation of the CYP3A7 and CYP3A4 genes in HepG2 cells has been proposed (Saito et al, 2001). Using gel mobility shift assays, site-directed mutagenesis and transfection of HepG2 cells with reporter constructs in which 5' flanking regions of the CYP3A7 or the CYP3A4 gene were fused to the luciferase gene, they have identified the binding sites for transcription factors such as Spl/Sp3, USFl (upstream stimulatory factor 1), YYl (ying yang 1), NFl and/or HNF-3p in the proximal promoters between nucleotides -140 and -35 of the CYP3A7 and CYP3A4 genes (Figure 5.4). In this report a novel NF-KB-like enhancer has also proposed in ~ 2300 bp of the promoters. There is only one bp mismateh between the sequences of this element in both genes. However, binding of Spl/Sp3 to the CYP3A7 (but not CYP3A4) NF-tcB-like element could be documented. It is proposed that an unknown factor(s), so called complex D, also acts as a transcriptional activator of the CYP3A4 gene (Figure 5.3).

Other interesting result reported by these investigators is that the deletion of PXR- responsive elements (PXR-RE) of the two genes increased lueiferase activity by -1.5 fold in HepG2 cells. Thus, it was assumed that PXR-RE may function as a negative regulatory element in constitutive transcription. Although a constitutive factor(s) that interacts with the PXR-RE remains to be identified, an orphan receptor COUP-TF

190 NKI

5

ON U 2 6 FATAS CVPM? GürAAGTCCÏ'

E or 0

+ 1 OFF 2 J 3 I IJ4J2 NO S¥‘K ihm t T A X IS CYPJA4 GK’UfiTCCC

Figure 5.3 Proposed model for constitutive transcriptional regulation of the

CYP3A7 and CYP3A4 genes (Saito et al, 2001). Transcriptional factors D and E have not yet been identified.

■192 TGTTTATGATACCTCATAGAATATGAACTCAAAGGAGGTCAGTGAGTGGTGTGTGTGTGA ER6/PXR-RE ==C/EBa== ===Oct-l== =COUP-TF==

-132 TTCTTTGCCAACTTCCAAGGTGGAGAAGCCTCTTCCAACTGCAGGCAGAGCACAGGTGGC =C/EBPg== YYl E box

-72 CCTGCTACTGGCTGCAGCTCCAGCCCTGCCTCCTTCTCTAGCATATAAACAATCCAACAG BTE ' ' TATA box ==-NF-K======Spl======TBP===

■12 I transcriptional start CCTCACTGAATCACTGCTG

Figure 5.4 Proposed binding sites of Spl/Sp3 (BTE), USFl (E-box), YYl, NFland/or HNF-3p in the CYP3A4 proximal promoter (Saito et al, 2001).

Some putative binding sites identified by the AliBaba programme are also shown.

191 (chicken ovalbumin upstream promoter transeription factor) known to be a transcriptional repressor, is one of the candidates that constitutively bind to the PXR- RE (Figure 5.4). In fact, COUP-TF is reported to interact with the PXR-RE of the rat CYP3A genes, which contain the direct repeat of an AGGTCA motif separated by three nucleotides. Because COUP-TF is capable of recognising the divergent types of the AGGTCA repeat, it may also interact with the ER6-type motif seen in the human CYP3A genes (Saito et al, 2001 and references therein).

5.5. Genetic variation in the PXR gene Variant CYP3A4 allelic frequencies and /or the available funetional data indicate a limited role of these variants in the inter-individual variability of CYP3A4 expression and activity (Rebbeck et al, 1998; Ball et al, 1999; Westlind et al, 1999; Sata et al, 1999, Eiselt et al, 2001; Hsieh et al, 2001). The good correlation between hepatic CYP3A4 protein and mRNA expression suggests variation in CYP3A expression may be under transcriptional control. Because no SNPs in either the proximal or distal PXR cognate binding sequences in CYP3A4 5' flanking region were so far reported, it can be hypothesised that sequenee variations in PXR exist and could contribute to variation in expression of a target gene, CYP3A4 (Kuehl et al, 2001). Although hepatic CYP3A activity is the sum activity of the CYP3A4 and CYP3A5 gene products in most individuals, only CYP3A4 is significantly induced by PXR ligands. The CYP3A5 gene has a consensus proximal PXR-RE identieal to that in CYP3A4 but lacks the distal PXR-RE cluster found in CYP3A4. This may be why CYP3A5 is not significantly up regulated by PXR ligands (Zhang et al, 2001).

Two independent groups (Hustret et al, 2001; Zhang et al, 2001) have reported PXR protein variants (R122Q, V140M, D163G and A370T) with altered regulatory activity toward CYP3A4. However, in both studies no conclusive results have been obtained in relation to the CYP3A4 expression. For example, the variant protein R122Q had significantly decreased affinity for the PXR binding sequenee in electromobility shift assays and attenuated ligand activation of the CYP3A4 reporter plasmids in transient transfection assays. However, the individual heterozygous for this variant had a normal CYP3A4 metabolism phenotype. Therefore it has been suggested that further

192 studies are needed to elucidate whether these PXR variants may represent reliable predictors of in vivo CYP3A metabolism.

5.6 Conclusions In this project a population screening for novel mutations in CYP3A4 5' regulatory region produced interesting results. As described before, in addition to the CYP3A4^1B allele (discovered in 1998) three new CYP3A4 alleles designated CYP3A4'^1E, CYP3A4^1F and CYP3A4"^15B were identified. Although the CYP3A4^1E and CYP3A4*15B alleles could be considered as rare alleles, CYP3A4^1F has a high frequency in both Iranian and British populations, and homozygotes could be more common. Therefore, its impact on CYP3A4 regulation could be more important. In fact this is the first time that mutation detection experiments have been extended to -1100 bp of the proximal and also the distal XREM sections of CYP3A4 promoter. However, regarding reeent reports on the role of regulatory elements beyond these sections it seems that upstream sequences up to 10 kb should also be considered in the study of regulatory elements and mechanisms.

Based on previous experiments and published literature I was able to design and construct an in vitro reporter gene system to evaluate the functional impact of these mutations. The evidenee presented in this report suggests that inherited mutations in the CYP3A4 gene 5' regulatory region can significantly affect in vitro transcriptional responses to different xenobiotic inducers. The relative increased activation of all mutant promoters by several CYP3A4 inducers which was observed in two hepatoma cell lines (except F-27 in HepG2) as well as increased aetivation of only one mutant (M-42) in Caco-2 cell, suggests that these effects could be as a result of possible occurrence of mutations at some yet unknown cell-specific repressor binding sites. Indeed, it has been recently reported that a single nueleotide polymorphism (-308 A ^G ) in the promoter of the tumour necrosis factor a gene inereased its transcription 6 to 7 fold (Fernandes et al, 2002). Also, it has been shown (Saito et al, 2001) that basal expression in both CYP3A4 and CYP3A7 of genes is inhibited by sequence motifs present between -140 and -1000 bp, presumably due to binding of repressor proteins. Conversely, it is possible that a mutation in an activator protein binding site may increase the binding affinity for the activator and hence lead to higher levels of

193 expression. Therefore, considering the different activation profiles of the mutant alleles in different cell types, it can be deduced that these responses are dependent on the cellular environment, the availability of the transcription factors governing the expression of a specific gene in a specific tissue and the presenee of endogenous or xenobiotic ligands and their coneentrations.

Finally, in spite of a great deal of effort to search for genetic factors governing the inter-individual variability in CYP3A enzyme expression during last four years and the identification of a long list of mutations in both coding and regulatory regions of the CYP3A4 gene (http://ww.imm.ki.se/CYPalleles/cyp3a4.htm), a genetic polymorphism with a conclusive and clear functional effect on CYP3A4 activity in vivo has yet to be identified. Very recent studies have also focused on the possible impaets of the polymorphisms in CYP3A5 and genes encoding the transeriptional faetors responsible for CYP3A regulation such as PXR. To date these studies have been inconclusive.

5.7 Future work (1) Screening of additional populations should be done to determine the allele frequencies and search for homozygous subjects who can be analysed with in vivo probes of CYP3A activity.

(2) Electrophoretic mobility shift assays could be performed to elucidate any difference in protein binding properties of the mutant alleles compared to the wild type sequenee and the nature of the elements that interaet with them.

(3) It would be interesting to expand mutation deteetion experiments to the whole 10 kb upstream region of the CYP3A4 gene.

(4) Use of primary cultures of human hepatocytes instead of cancer cell lines for transfection studies may also be useful in evaluating the impact of the CYP3A4 novel alleles.

194 (5) Further expansion of mutation analysis to other nuclear receptors which have a role in CYP3A4 regulation such as CAR, GR and other possible elements.

195 BIBLIOGRAPHY

Abdel-Razzak, Z., Cocos, L., Fautrel, A. and Guillouzo, A. (1995). Interleukin-1 beta antagonizes Phénobarbital induction of several major cytochromes P450 in adult rat hepatocytes in primary culture. FEBS Lett. 366: 159-164

Agundez, J.A., Ledesma, M.C., Benitez, J., Ladero, J.M., Rodriguez-Lescure, A., Diaz-Rubio, E. and Diaz-Rubio, M. (1995). CYP2D6 genes and risk of liver cancer. Lancet MS: 830-831

Ainsworth, P.J. and Rodenhise, D.I. (1994). A non-radioactive method for the deteetion of single-strand conformational polymorphism (SSCP). In: Methods in Moleeular Biology, Vol. 31: Protocols for Gene Analysis. (A.J. Hawood, ed.) Humana Press Inc., Totowa, NJ, USA. pp. 205-210

Andrews, A T. (1991). Electrophoresis of nucleie acids. In: Essential Molecular Biology, vol. 1. (T.A. Brown, ed.) IRE Press, Oxford, pp. 89-126

Anttila, S., Hukkanen, J., Hakkola, J., Stjemvall, T., Beaune, P., Edwards, R.J., Boobis, A.R., Pelkonen, O. and Raunio, H. (1997). Expression and localization of CYP3A4 and CYP3A5 in human lung. Am. J. Respir. Cell Mol. Biol. 16: 242-249

Aoyama, T., Yamano, S., Waxman, D.J., Lapenson, D.P., Meyer, U.A., Fischer, V., Tyndale, R., Inaba, T., Kalow, W., Gelboin, H.V. and Gonzalez, F.J. (1989). Cytochrome P-450 hPCN3, a novel cytochrome P-450 IIIA gene product that is differentially expressed in adult human liver. cDNA and deduced amino acid sequence and distinct specificities of cDNA-expressed hPCNl and hPCN3 for the metabolism of steroid hormones and cyclosporine. J. Biol. Chem. 264: 10388-10395

Aranda, A. and Pascual, A. (2001). Nuelear hormone receptors and gene expression. Physiol. Rev. 81: 1269-1304

Baes, M., Guliek, T., Choi, H.S., Martinoli, M.G., Simha, D. and Moore, D.D. (1994). A new orphan member of the nuclear hormone receptor superfamily that interacts with a subset of retinoic acid response elements. Mol. Cell. Biol. 14: 1544- 1551

196 Ball, S.E., Scanda, J., Kado, J., Perron, G.M., Fruncillo, R., Mayer, P., Weinryb, L, Guido, M., Hopkins, PJ., Warner, N. and Hall, J. (1999). Population distribution and effects on drug metabolism of a genetie variant in the 5' promoter region of CYP3A4, Clin. Pharmacol. Ther. 66: 288-294

Bartsch, H., Nair, U., Risch, A., Rojas, M., Wikman, H. and Alexandrov, K. (2000). Genetic polymorphism of GYP genes, alone or in combination, as a risk modifier of tobacco-related cancers. Cancer Epidemiol. Biomarkers Prev. 9: 3-28

Barwick, J.L., Quattrochi, L.C., Mills, A.S., Potenza, C., Tukey, R.H. and Guzelian, P S. (1996). Trans-species gene transfer for analysis of glueocorticoid-inducible transcriptional activation of transiently expressed human CYP3A4 and rabbit CYP3A6 in primary cultures of adult rat and rabbit hepatocytes. Mol. Pharmacol. 50: 10-16

Berghard, A., Gradin, K., Pongratz, I., Whitelaw, M. and Poellinger, L. (1993). Cross-eoupling of signal transduction pathways: the dioxin receptor mediates induction of cytochrome P-450IA1 expression via a protein kinase C-dependent metabolism. Mol. Cell. Biol. 13: 677-689

Bertilsson, G., Heidrieh, J., Svensson, K., Asman, M., Jendeberg, L., Sydow- Backman, M., Ohlsson, R., Postlind, H., Blomquist, P. and Berkenstam, A. (1998). Identification of a human nuclear receptor defines a new signaling pathway for CYP3A induction. Proc. Natl. Acad. Sci. USA 95: 12208-12213

Bertilsson, G., Berkenstam, A. and Blomquist, P. (2001). Functionally conserved xenobiotic response enhancer in cytochrome P450 3A7. Biochem. Biophys. Res. Commun. 280: 139-144

Bertz, R.J. and Granneman, G.R. (1997). Use of in vitro and in vivo data to estimate the likelihood of metabolic pharmacokinetic interactions. Clin. Pharmacokinet. 32: 210-285

Blumberg, B., Sabbagh, W. Jr., Juguilon, H., Bolado, J. Jr., van Meter, C M., Ong, E.S. and Evans, R.M. (1998). SXR, a novel steroid and xenobiotic-sensing nuclear receptor. Genes Dev. 12: 3195-3205

197 Bocquel, M.T., Kumar, V., Strieker, C., Chambon, P. and Gronemeyer, H. (1989). The contribution of the N- and C-terminal regions of steroid reeeptors to activation of transcription is both receptor and cell-specific. Nucleic Acids Res. 17: 2581-2595

Boobis, A.R., Sesardic, D., Murray, B.P., Edwards, R.J., Singleton, A.M., Rich, K.J., Murray, S., de la Torre, R., Segura, J., Pelkonen, O., Pasanen, M., Kobayashi, S., Zi- Guang, T. and Davies, D.S. (1990). Species variation in the response of the cytochrome P-450-dependent monooxygenase system to inducers and inhibitors. Xenobiotica 20: 1139-1161

Bornheim, L., Myles, K. and Cole, T.J. (2000). The glucocorticoid receptor is essential for induction of cytochrome P-4502B by steroids but not for drug or steroid induction of CYP3A or P-450 reductase in mouse liver. Drug Metab. Dispos. 28: 268- 278

Bouchardy, C., Benhamou, S. and Dayer, P. (1996). The effect of tobacco on lung cancer risk depends on CYP2D6 activity. Cancer Res. 56: 251-253

Bourguet, W., Ruff, M., Chambon, P., Gronemeyer, H. and Moras, D. (1995). Crystal strueture of the ligand-binding domain of the human nuclear receptor RXR- alpha. Nature 375: 377-382

Brown, S.A., Imbalzano, A.N. and Kingston, R.E. (1996). Activator-dependent regulation of transcriptional pausing on nucleosomal templates. Genes Dev. 10: 1479- 1490

Brown, S.E.S., Quattroehi, L.C. and Guzelian, P.S. (1997). Charaeterization of a pretranscriptional pathway for induction by phénobarbital of cytochrome P450 3A23 in primary cultures of adult rat hepatocytes. Arch. Biochem. Biophys. 342: 134-142

Brzozowski, A.M., Pike, A C., Dauter, Z.,Hubbard, R.E., Bonn, T., Engstrom, O., Ohman, L., Greene, G.E., Gustafsson, J.A. and Carlquist, M. (1997). Molecular basis of agonism and antagonism in the oestrogen receptor. Nature 389: 753-758

Buetow, K.H., Edmonson, M.N. and Cassidy, A.B. (1999). Reliable identification of large numbers of candidate SNPs from public EST data. Nat. Genet. 21: 323-325

198 Carrier, F., Owens, R.A., Nebert, D.W. and Puga, A. (1992). Dioxin-dependent activation of murine CYPla-1 gene transcription requires protein kinase C-dependent phosphorylation. Mo/. Cell Biol 12: 1856-1863

Carrillo, J.A , Dahl, M.L., Svensson, J.O., Aim, C., Rodriguez, I. and Bertilsson, L. (1996). Disposition of fluvoxamine in humans is determined by the polymorphie CYP2D6 and also by the CYP1A2 activity. Clin. Pharmacol. Ther. 60: 183-190

Chang, T.K., Maurel, P. and Waxman, D.J. (1997). Enhanced cyclophosphamide and ifosfamide activation in primary human hepatocyte cultures: response to cytochrome P450 inducers and autoinduction by oxazaphosphorines. Cancer Res. 57: 1946-1954

Chang, T.J., Lei, H.H., Yeh, J.I., Chiu, K.C., Lee, K.C., Chen, M.C., Tai, T.Y. and Chuang, L.M. (2000). Vitamin D receptor gene polymorphisms influence susceptibility to type 1 diabetes mellitus in the Taiwanese population. Clin. Endocrinol. (O^f) 52: 575-580

Chen, J.D. and Evans, R.M. (1995). A transcriptional co-repressor that interacts with nuclear hormone reeeptors. Nature 377: 454-457

Chiba, M., Nishime, J.A., Chen, I.W., Vastag, K.J., Sahly, Y.S., Kim, B.W., Dorsey, B.D., Vacca, J.P. and Lin, J.H. (1998). Metabolite-P450 complex formation by methylenedioxy-phenyl HIV protease inhibitors in rat and human liver microsomes. Biochem Pharmacol 56: 223-230

Collingwood, T.N., Dmov, F.D. and Wolffe, A. (1999). Nuclear receptors: coactivators, corepressors and chromatin remodeling in the control of transcription. J. Mol Endocrinol. 23: 255-275

Conte, F.A., Grumbach, M.M., Ito, Y., Fisher, G.R. and Simpson, E.R. (1994). A syndrome of female pseudohermaphrodism, hypergonadotropic hypogonadism, and multicystic ovaries associated with missense mutations in the gene encoding aromatase (P450arom). J. Clin. Endocrinol Metab. 78: 1287-1292

Correia, M.A. (1998). Drug biotransformation. In: Basic & Clinical Pharmacology (B.G. Katzung, ed.) Appleton & Lange, Stamford, USA. pp: 50-61

199 Crespi, C L. and Miller, V.P. (1997). The R144C change in the CYP2C9*2 allele alters interaction of the cytochrome P450 with NADPHrcytoehrome P450 oxidoreductase. Pharmacogenetics 7: 203-210

Dai, D., Tang, J., Rose, R.L., Hodgson, E., Bienstock, R.J., Mohrenweiser, H.W. and Goldstein, J.A. (2001). Identification of variants of CYP3A4 and characterization of their abilities to metabolize testosterone and chlorpyrifos. J. Pharmacol. Exp. Ther. 299: 825-831

Daly, A.K., Cholerton, S., Gregory, W. and Idle, JR. (1993). Metabolic polymorphisms, Pharmacol. Ther. 57: 129-160

Danielian, P.S., White, R., Lees, J.A. and Parker, M.G. (1992). Identification of a conserved region required for hormone dependent transcriptional activation by steroid receptors. EMBO J. 11:1025-1033

Darimont, B.D., Wagner, R.L., Apriletti, J.W., Stalleup, M R., Kushner, P.J., Baxter, J.D., Hetterick, R.J. and Yamamoto, K.R. (1998). Structure and speeificity of nuclear receptor-coaetivator interaetions. Genes Dev. 12: 3343-3356

Dehal, S.S. and Kupfer, D. (1996). Evidence that the catechol 3,4- Dihydroxytamoxifen is a proximate intermediate to the reactive species binding covalently to proteins. Cancer Res. 56: 1283-1290

Delague, V., Souraty, N., Khallouf, E., Tardy, V., Chouery, E., Halaby, G., Loiselet, J., Morel, Y. and Megarbane, A. (2000). Mutational analysis in Lebanese patients with congenital adrenal hyperplasia due to a deficit in 21-hydroxylase. Horm. Res. 53: 77-82 de Morals, S.M., Wilkinson, G.R., Blaisdell, J., Meyer, U.A., Nakamura, K. and Goldstein, J.A. (1994). Identification of a new genetie defect responsible for the polymorphism of (S)-mephenytoin metabolism in Japanese. Mol. Pharmacol. 46: 594- 598

200 Dogra, S.C., Whitelaw, M.L. and May, B.K. (1998). Transcriptional activation of cytochrome P450 genes by different classes of chemical inducers. Clin Exp Pharmacol and Physiol 25: 1-9

Domanski, T.L., Finta, C., Halpert, J.R. and Zaphiropoulos, P.G. (2001). cDNA cloning and initial characterization of CYP3A43, a novel human P450. Mol Pharmacol 59: 386-392

Drahushuk, A T., McGarrigle, B.P., Larsen, K.E., Stegeman, J.J. and Olson, J.R. (1998). Detection of CYPlAl protein in human liver and induetion by TCDD in precision-cut liver slices incubated in dynamic organ culture. Carcinogenesis 19: 1361-1368

Duescher, R.J. and Elfarra, A.A. (1994). Human liver microsomes are efficient catalysts of 1,3-butadiene oxidation: evidence for major roles by cytochromes P450 2A6 and 2E\.Arch. Biochem. Biophys. 311: 342-349

Edwards, P.A., Kast, H R. and Ainsfeld, A.M. (2002). BAREing it all: the adoptation of LXR and FXR and their role in lipid homeostasis. J. Lipid Res. 43: 2-12

Eichelbaum, M., Mineshita, S., Ohnhaus, E.E. and Zekom, C. (1986). The influenee of enzyme induetion on polymorphic sparteine oxidation. Br. J. Clin. Pharmacol. 22: 49-53

Eiselt, R., Domanski, T.L., Zibat, A., Muller, R, Presecan-Siedel, E., Hustert, E., Zanger, U.M., Brockmoller, J., Klenk, HP., Meyer, U.A., Khan, K.K., He, Y.A., Halpert, J.R. and Wojnowski. L. (2001). Identification and functional characterization of eight CYP3A4 protein variants. Pharmacogenetics 11: 447-458

Ekins, S. and Schuetz, E. (2002). The PXR crystal structure: the end of the beginning. Trends Pharmacol. Scl 23: 49-50

El-Sankary, W., Plant, N.J., Gibson, G.G. and Moore, D.J. (2000). Regulation of the CYP3A4 gene by hydrocortisone and xenobiotics: role of the glucocorticoid and pregnane X receptors. Drug Metab. Dispos. 28: 493-496

201 Emi, Y. and Omura, T. (1988). Synthesis of sex-specific forms of cytochrome P-450 in rat liver is transiently suppressed by hepatic monooxygenase inducers. /. Biochem. 104: 40-43

Escriva, H., Safi, R., Hanni, C., Langlois, M.C., Saumito-Laparade, P., Stehelin, D., Capron, A., Pierce, R. and Laudet, V. (1997). Ligand binding was acquired during evolution of nuclear receptors. Proc. Nat.lAcad. Sci. USA 94: 6803-6808

Esteller, M., Garcia, A., Martinez-Palones, J.M., Xercavins, J. and Reventes J. (1997). Susceptibility to endometrial caneer: influence of allelism at p53, glutathione S-transferase (GSTMl and GSTTl) and cytochrome P-450 (CYPlAl) loci. Br. J. Cancer 15: 1385-1388

Evans, R.M. (1988). The steroid and thyroid hormone receptor superfamily. Science 240: 889-895

Fardella, C.E., Zhang, L.H., Mahachoklertwattana, P., Lin, D. and Miller, W.L. (1993). Deletion of amino acids Asp487-Ser488-Phe489 in human cytochrome P450cl7 causes severe 17 alpha-hydroxylase deficiency. J. Clin. Endocrinol. Metab. 77:489-493

Fernandes, H., Koneru, B., Fernandes, N., Hameed, M., Cohen, M.C., Raveche, E. and Cohen, S. (2002). Investigation of promoter polymorphisms in the tumor necrosis factor-alpha and interleukin-10 genes in liver transplant patients. Transplantation 73: 1886-1891

Fernandez-Salguero, P., Hoffman, S.M., Cholerton, S., Mohrenweiser, H., Raunio, H., Rautio, A., Pelkonen, O., Huang, J.D., Evans, W.E., Idle, J.R. and Gonzalez, F.J. (1995). A genetic polymorphism in coumarin 7-hydroxylation: sequence of the human CYP2A genes and identification of variant CYP2A6 alleles. Am. J. Hum. Genet. 57: 651-660

Finta, C. and Zaphiropoulos, P.G. (2000). The human cytochrome P4503A locus. Gene evolution by capture of downstream exons. Gene 260:13-23

202 Freedman, L.P., Luisi, B.F., Korszun, Z.R., Basavappa, R., Sigler, P.B. and

Yamamoto, K.R. (1988a). The function and structure of the metal coordination sites within the glucocorticoid receptor DNA binding domain. Nature 334: 543-546

Freedman, L.P., Yamamoto, K.R., Luisi, B.F. and Sigler, P.B. (1988b). More fingers in hand. Cell 54: 444-445

Funae, Y. and Imaoka, S. (1993). Cytochrome P450 in rodents. In: cytochrome P450. (J.B. Schenkman and H. Greim, eds.) Springer-Verlag, Berlin, pp 221-238

Garcia-Martin, E., Martinez, C., Pizarro, R.M., Garcia-Gamito, F.J., Gullsten, H., Raunio, H. and Agundez J.A. (2002). CYP3A4 variant alleles in white individuals with low CYP3A4 enzyme activity. Clin. Pharmacol. Ther. 71: 196-204

Gellner, K., Eiselt, R., Hustert, E., Arnold, H., Koeh, I., Haberl, M., Deglmann, C.J., Burk, O., Buntefuss, D., Escher, S., Bishop, C., Koebe, H.G., Brinkmann, U., Klenk, H.P., Kleine, K., Meyer, U.A. and Wojnowski, L. (2001). Genomic organization of the human CYP3A locus: identification of a new, indueible CYP3A gene. Pharmacogenetics 11:111-121

Geneste, O., Camus, A.M., Castegnaro, M., Petruzzelli, S., Macchiarini, P., Angeletti, C.A., Giuntini, C. and Bartsch, H. (1991). Comparison of pulmonary DNA adduct levels, measured by ^^P-postlabelling and aryl hydrocarbon hydroxylase activity in lung parenchyma of smokers and ex-smokers. Carcinogenesis 12:1301- 1305

Gibson, G.G. and Skett, P. (1996). Introduction to Drug Metabolism, 2nd edition, Blaekie Academic & Professional, London, pp. 1-52

Gibson, G.G., Goldfarb, P.S., King, L.J., Kitehen. I., Plant, N., Scholfield, C. and Harries, H. (1999). Cell engineering of the rat and human cysteine conjugate beta lyase genes and applications to nephrotoxicity assessment. In: Molecular and Applied Aspects of Oxidative Drug Metabolizing Enzymes. (Arinc et al, eds) Kluwer Aeademic/ Plenum Press, New York. pp. 283-291

203 Giguere, V. (1999). Orphan nuclear receptors: From gene to function. Endocrine Rev. 20: 689-725

Glass, C.K., Rose, D.W. and Rosenfeld, M.G. (1997). Nuclear receptor coaetivators. Curr. Opin. Cell Biol. 9: 222-232

Goldfarb, P. (1989). Molecular mechanisms of cytochrome P450 gene regulation. Biochem. Soc. Trans. 18: 30-32

Goldstein, J.A., Faletto, M.B., Romkes-Sparks, M., Sullivan, T., Kitareewan, S., Rauey, J.L., Lasker, J.M. and Ghanayem, B.I. (1994). Evidence that CYP2C19 is the major (S)-mephenytoin 4’-hydroxylase in humans. Biochemistry 33: 1743-1752

Gomez-Lechon, M.J., Donato, T., Jover, R., Rodriguez, C., Ponsoda, X., Glaise, D., Castell, J.V. and Guguen-Guillouzo, C. (2001). Expression and induction of a large set of drug-metabolizing enzymes by the highly differentiated human hepatoma cell line BC2. Eur. J. Biochem. 268: 1448-1459

Gonzalez, F.J. (1993). Cytoehrome P450 in humans, in: Cytochrome P450, edited by Schenkman JB and Greim H, Springer-Verlag, Berlin, pp: 239-249

Goodwin, B., Hodgson, E. and Liddle, C. (1999). The orphan human pregnane X receptor mediates the transcriptional activation of CYP3A4 by rifampicin through a distal enhancer module. Mol. Pharmacol. 56: 1229-1239

Goodwin, B., More, L.B., Stoltz, CM., MeKee, D.D. and Kliewer, S.A. (2001). Regulation of the human CYP2B6 gene by the nuclear pregnane-X-receptor. Mol. Pharmacol. 60: 427-431

Graham, S.E. and Peterson, J.A. (1999). How similar are P450s and what can their differences teach \is7 Arch. Biochem. Biophys. 369: 24-29

Grant, P.A., and Burger, S.L. (1999). Histone acetyltransferase complexes. Semin. Cell Dev. Biol. 10: 169-177

Green, S. and Chambon, P. (1988). Nuclear reeeptors enhance our understanding of transcription regulation. Trends Genet. 4: 309-314

204 Greuet, J., Richard, L., Ourlin, J.C., Bonfils, C., Domergue, J., Le, T.P. and Maurel, P. (1997). Effects of cell deneity and epidermal growth factor on the inducible expression of CYP3A and CYPIA genes in human hepatocytes in primary culture. Hepatology 25: 1166-1175

Griese, E.U., Zanger, U.M., Brudermanns, U., Gaedigk, A., Mikus, G., Morike, K., Stuven, T. and Eichelbaum, M. (1998). Assessment of the predictive power of genotypes for the in-vivo catalytic function of CYP2D6 in a German population. Pharmacogenetics 8: 15-26

Guengerich, F.P., Martin, M.V., Beaune, P.H., Kremers, P. and Wolff, T. (1986). Characterization of rat and human liver microsomal cytochrome P-450 forms involved in nifedipine oxidation, a prototype for genetic polymorphism in oxidative drug metabolism. J. Biol. Chem. 261: 5051-5060

Guengerich, F.P. (1995). Human cytochrome P450 enzymes. In: Cytochrome P450. (P.R. Ortize de Montellano, ed.) Plenum Press, New York. pp. 473-535

Guengerich, F.P. (1999). Cytochrome P-450 3A4: regulation and role in drug metabolism. Annw. Rev. Pharmacol. Toxicol. 39: 1-17

Guengerich, F.P. (2000). Pharmaeogenomics of cytochrome P450 and other enzymes involved in biotransformation of xenobiotics. Drug Develop. Res. 49: 4-16

Haehner, B.D., Gorski, J.C., Vandenbranden, M., Wrighton, S.A., Janardan, S.K., Watkins, P.B. and Hall, S.D. (1996). Bimodal distribution of renal cytochrome P450 3A activity in humans. Mol. Pharmacol. 50: 52-59

Haining, R.L., Hunter, A.P., Veronese, M.E., Trager, W.F. and Rettie, A.E. (1996). Allelic variants of human cytochrome P450 2C9: baculovirus-mediated expression, purification, structural characterization, substrate stereoselectivity, and prochiral selectivity of the wild-type and I359L mutant forms. Arch. Biochem. Biophys. 333: 447-458

Halpert, J R., Domanski, T.L, Adali, O., Biagini, C.P., Cosme, J., Dierks, E.A., Johnson, E.F., Jones, J.P., Ortize de Montellano, P., Philpot, R.M., Sibbensen, O.,

205 Wyatt, W.K. and Zheng, Z. (1998). Structure-function of cytochrome P450 and flavin-containing monooxygenases, Drug Metahol Dispos. 26: 1223-1231

Hamelin, B.A., Turgeon, J., Vallee, P., Belanger, P.M., Paquet, F. and LeBel, M. (1996). The disposition of fluoxetine but not sertraline is altered in poor metabolizers of debrisoquin. Clin. Pharmacol. Ther. 60: 512-521

Hamilton, G.A., Coon, D.J., Barros, S., Jolley, S.L. and LeCluyse, E.L. (2001). Regulation of cell morphology and gene expression in human hepatocytes by extracellular matrix and cell-cell interactions. Cell Tissue Res. 306: 85-99

Hamzeiy, H., Vahdati-Mashhadian, N., Edwards, H.J. and Goldfarb, P.S. (2002). Mutation analysis of the human CYP3A4 gene 5 ' regulatory region: population screening using non-radioactive SSCP. Mutat. Res. 500: 103-110

Hansen, J.C., Tse, C. and Wolffe, A.P. (1998). Structure and function of the core histone N-termini: more than meets the eye. Biochemistry 37: 17637-17641

Hara, H., Yasunami, Y. and Adachi, T. (2002). Alteration of cellular phosphorylation state affeets vitamin D receptor-mediated CYP3A4 mRNA induetion in Caco-2 cells. Biochem. Biophys. Res. Commun. 296: 182-188

Harder, D R., Campbell, W.B. and Roman, R.G. (1995). Role of cytochrome P450 enzymes and metabolites of arachidonic acid synthesis in the control of vascular tone. J. Vase. Res. 32: 79-82

Harlow, G.R. and Halpert, J.R. (1997). Alanine-scanning mutagenesis of a putative substrate recognition site in human cytochrome P450 3A4, J. Biol. Chem. 272: 5396- 5402

Hasemann, C.A., Kurumbail, R.G., Boddupalli, S.S., Peterson, J.A. and Deisenhofer, J. (1995). Structure and function of cytochromes P450: a comparative analysis of three crystal structures. Structure 3: 41-62

Hashimoto, H., Toide, K., Kitamura, R., Fujita, M., Tagawa, S., Itoh, S. and Kamataki, T. (1993). Gene structure of CYP3A4, an adult-specific form of

206 cytochrome P450 in human livers, and its transcriptional control. Eur. J. Biochem. 218: 585-595

Hayashi, S., Watanabe, J., Nakachi, K. and Kawajiri, K. (1991). Genetic linkage of lung cancer-associated MspI polymorphisms with amino acid replacement in the heme binding region of the human cytochrome P450IA1 gene. J. Biochem. 110: 407- 411

Hayashi, K., Kukita, Y., Inazuka, M. and Tahira, T. (1998). Single-strand conformation polymorphism. In: Mutation Detection, A Practical Approach (R.G.H. Cotton, E. Edkins, and S. Forrest, eds.) IRE Press, Oxford, pp. 7-24

He, Y.A., He, Y.Q., Szklarz, G.D. and Halpert, J.R. (1997). Identification of three key residues in substrate recognition site of human cytochrome P450 3A4 by cassette and site-directed mutagenesis, Biochem. 36: 8831-8839

He, K., Iyer, K.R., Hayes, R.N., Sinz, M.W., Woolf, T.F. and Hollenberg, P.F. (1998). Inactivation of cytochrome P450 3A4 by bergamottin, a component of grapefruit juice. Chem. Res. Toxicol. 11: 252-259

Hedenmalm, K., Sundgren, M., Granberg, K., Spigset, O. and Dahlqvist, R. (1997). Urinary excretion of codeine, ethylmorphine, and their metabolites: relation to the CYP2D6 activity. Ther. Drug Monit. 19: 643-649

Heery, D M., Kalkhoven, E., Hoare, S. and Parker, M.G. (1997). A signature motif in transcriptional co-activators mediates binding to nuclear receptors. Nature 387: 733- 736

Henry, S.H., Bosch, F.X., Troxell, T.C. and Bolger, P.M. (1999). Policy forum: public health. Reducing liver cancer-global eontrol of aflatoxin. Science 286: 2453- 2454

Hietanen, E., (1999). Significance of genetic polymorphism in cancer susceptibility. Adv. Exp. Med. Biol. 472: 241-251

207 Hoen, P.A., Commandeur, J.N.M., Vermeulen, N.P.E., Van Berkel, TJ.C. and Bijstrbosch, K. (2000). Selective induction of Cytochrome P450 3A1 by dexamethasone in cultured rat hepatocytes. Biochem. Pharmacol. 60:1509-1518

Hong, L., Sehroth, G.P., Matthews, H.R., Yau, P. and Bradbury, E M. (1993). Studies of the DNA binding properties of histone H4 amino terminus. Thermal dénaturation studies reveal that acétylation markedly reduces the binding constant of the H4 "tail" to DNA. J. Biol. Chem. 268: 305-314

Hongyo, T., Buzzard, G.S., Calvert, R.J. and Weghorst, C M. (1993). ‘Cold SSCP’: a simple, rapid and non-radioactive method for optimized single-strand conformation polymorphism, Nucl. Acid Res. IV. 3637-3642

Honkakoski, P., Moore, R., Washburn, K.A. and Negishi, M. (1998). Activation by diverse xenochemicals of the 51-bp phénobarbital- responsive enhancer module in the CYP2B10 gene. Mol. Pharmocol. 53: 597-407

Honkakoski, P. and Negishi, M. (2000). Regulation of cytochrome P450 (GYP) genes by nuclear receptors. Biochem. J. 347: 321-337

Horlein, A.J., Naar, A.M., Heinzel, T., Torchia, J., Gloss, B., Kurokawa, R., Ryan, A., Kamei, Y., Soderstrom, M., Glass, C.K. And Rosenfeld, M.G. (1995). Ligand- independent repression by the thyroid hormone receptor mediated by a nuelear receptor co-repressor. Nature 377: 397-404

Hsieh, K.P., Lin, Y.Y., Cheng, C.L., Lai, M L., Lin, M.S., Siest, J.P. and Huang, J.D. (2001). Novel mutations of CYP3A4 in Chinese. Drug Metab. Dispos. 29: 268-273

Hu, ¥., Ingelman-Sundberg, M. and Lindros, K.O. (1995). Induction mechanisms of cytochrome P450 2E1 in liver: interplay between ethanol treatment and starvation. Biochem. Pharmacol. 50: 155-161

Hustert, E., Zibat, A., Presecan-Siedel, E., Eiselt, R., Muller, R., FuB, C., Brehm, I., Brinkmann, U., Eichelbaum, M., Wojnowski, L. and Burk, O. (2001). Natural protein variants of pregnane X receptor with altered transactivation activity toward CYP3A4. Drug Metab. Dispos. 29: 1454-1459

208 Huang, Z., Fasco, M. J., Figge, H. L., Keyomarsi, K., Kaminsky, L. S. (1996). Expression of cytochromes P450 in human breast tissue and tumors. Drug. Metab. Dispos. 24: 899-905

Ibeanu, G.C. and Goldstein, J.A. (1995). Transcriptional regulation of human CYP2C genes: functional comparison of CYP2C9 and CYP2C18 promoter regions. Biochemistry 34: 8028-8036

Ibeanu, G.C., Goldstein, J.A., Meyer, U., Benhamou, S., Bouchardy, C., Dayer, P., Ghanayem, B.I. and Blaisdell, J. (1998). Identification of new human CYP2C19 alleles (CYP2C19*6 and CYP2C19*2B) in a Caucasian poor metabolizer of mephenytoin. J. Pharmacol. Exp. Ther. 286: 1490-1495

Ilett, K.F., Reeves, P.T., Minchin, R.F., Kinnear, B.F., Watson, H E. and Kadlubar, F.F. (1991). Distribution of acetyltransferase activities in the intestines of rapid and slow acetylator rabbits. Carcinogenesis 12:1465-1469

Ingelman-Sundberg, M., Oscarson, M. and MeLellan, R.A. (1999). Polymorphic human cytochrome P450 enzymes: an opportunity for individualized drug treatment. Trends Pharmacol. Sci. 20: 342-349

Janarden, S.K., Lown, K.S., Schmiedlin-Ren, P., Thummel, K.E. and Watkins, P.B. (1996). Selective expression of CYP3A5 and not CYP3A4 in human blood. Pharmacogenetics 6: 379-385

Jensen, E.V. and Jacobson, H.I (1962). Basic guides to the mechanism of estrogen action. Recent Prog. Horm. Res. 18: 387-414 Jerling, M., Dahl, M L., Aberg-Wistedt, A., Liljenberg, B., Landell, N.E., Bertilsson, L. and Sjoqvist, F. (1996). The CYP2D6 genotype predicts the oral clearanee of the neuroleptic agents perphenazine and zuclopenthixol. Clin. Pharmacol. Ther. 59: 423- 428

Johansson, I., Lundqvist, E., Bertilsson, L., Dahl, M.L., Sjoqvist, F. and Ingelman- Sundberg, M. (1993). Inherited amplification of an active gene in the cytochrome P450 CYP2D locus as a cause of ultrarapid metabolism of debrisoquine. Proc. Natl. Acad. Sci. USA 90: 11825-11829

209 Johansson, I., Oscarson, M., Yue, Q.Y., Bertilsson, L., Sjoqvist, F. and Ingelman- Sundberg, M. (1994). Genetic analysis of the Chinese cytochrome P4502D loeus: characterization of variant CYP2D6 genes present in subjects with diminished capacity for debrisoquine hydroxylation. Mol Pharmacol 46: 452-459

Johnson, C.A. and Turner, B.M. (1999). Histone deacetylases : complex transducers of nuclear signals. Semin. Cell Dev. Biol 10: 179-188

Jones, S.A., Moore, L.B., Shenk, J.L., Wisely, G.B., Hamilton, G.A., McKee, D.D., Tomkinson, N.C., LeCluyse, E.L., Lambert, M.H., Willson, T.M., Kliewer, S.A. and Moore, I T. (2000). The pregnane X receptor: a promiscuous xenobiotic receptor that has diverged during evolution. Mol Endocrinol 14: 27-39

Jounaidi, ¥., Guzelian, P.S., Maurel, P. and Vilarem, M.J. (1994). Sequence of the 5’-flanking region of CYP3A5: comparative analysis with CYP3A4 and CYP3A7. Biochem. Biophys. Res. Commun. 205: 1741-1747

Jounaidi, ¥., Hyrailles, V., Gervot, L. and Maurel, P. (1996). Detection of CYP3A5 allelic variant: a candidate for the polymorphie expression of the protein? Biochem. Biophys. Res. Commun. 221: 466-470

Kalow, W. (1991). Interethnic variation of drug metabolism. Trends Pharmacol Scl 12: 102-107

Kast, H R ., Goodwin, B., Tarr, P.T., Jones, S.A., Anisfeld, A.M., Stoltz, C M., Tontonoz, P., Kliewer, S.A., Willson, T.M. and Edwareds, P.A. (2002). Regulation of mulidrug resistance-associated protein 2 (ABCC2) by the nuclear receptors pregnane- X-receptor, famesoid X-activated receptor and constitutive androstane receptor. J. Biol Chem. 277: 2908-2915

Kawajiri, K., Nakaehi, K., Imai, K., Watanabe, J. and Hayashi, S. (1993). The CYPlAl gene and caneer susceptibility. Crit. Rev. Oncol. Hematol 14: 77-87

Khan, K.K. and Halpert J.R. (2000). Structure-function analysis of human cytochrome P450 3A4 using 7-alkoxycoumarins as active-site probes. Arch. Biochem. Biophys. 373: 335-345

210 Kidd, K.K. and Ruano, G. (1995). Optimizing PGR, in: PCR2, edited by Mcpherson, M.J., Hames, B.D. and Taylor G.R., IRL Press, Oxford, pp. 1-22

Kim, H., Putt, D., Reddy, S.,Hollenberg, P.F. and N ov^, R.F. (1993). Enhanced expression of rat hepatic CYP2B1/2B2 and 2E1 by pyridine: differential induction kinetics and molecular basis of expression. J. Pharmacol Exp. Ther. 267: 927-936

Kitanaka, S., Murayama, A., Sakaki, T., Inouye, K., Seino, Y., Fukumoto, S., Shima, M., Yukizane, S., Takayanagi, M., Niimi, H., Takeyama, K. and Kato, S. (1999). No enzyme activity of 25-hydroxyvitamin D3 1 alpha-hydroxylase (CYP27B1) gene product in pseudovitamin D deficiency rickets, including that with mild clinical manifestation. J. Clin. Endocrinol. Metab. 84: 4111-4117

Kivisto, K.T., Koremer, H.K. and Eichelbaum, M. (1995). The role of human cytochrome P450 enzymes in the metabolism of anticancer agents: implications for drug interactions. Br. J. Clin. Pharmacol. 40: 523-530

Klaassen, C D. (1996). Principles of toxicology, in: Cassarett and Doull’s Toxicology; The basic Science of Poisons, fifth edition, edited by Klaassen, C.D., Amdur, M.O. and Doull, J., McGraw Hill, New York. pp. 13-33

Kliewer, S.A., Moore, J.T., Wade, L., Staudinger, J.L., Watson, M.A., Jones, S.A., McKee, D.D., Oliver, B.B., Willson, T.M., Zetterstrom, R.H., Perlmann, T. and Lehmann, J.M. (1998). An orphan nuclear reeeptor aetivated by pregnanes defines a novel steroid signaling pathway. Cell 92: 73-82

Kliewer, S.A., Lehman, J.M. and Wilson, T.M. (1999). Orphan nuclear receptors: shifting endocrinology into reverse. Science 284: 757-760

Kliewer, S.A. and Wilson, T.M. (2002). Regulation of xenobiotic and bile acid metabolism by the nuclear pregnane X reeeptor. J. Lipid Res. 43: 359-364

Kocarek, T.A., Schuetz, E.G., Strom, S.C., Fisher, R.A. and Guzelian, P.S. (1995). Comparative analysis of cytoehrome P4503A induction in primary cultures of rat, rabbit, and human hepatocytes. Drug Metab. Dispos. 23: 415-421

211 Kondoh, N., Wakatsuki, T., Ryo, A., Hada, A., Aihara, T., Horiuchi, S., Goseki, N., Matsubara, O., Takenaka, K., Shichita, M., Tanaka, K., Shuda, M. and Yamamoto M. (1999). Identification and characterization of genes assoeiated with human hepatocellular carcinogenesis. Cancer Res. 59:4990-4996

Kosher, T.D. and Wilson, A C. (1991). DNA amplification by the polymerase chain reaction. In: Essential Molecular Biology, vol. 2 (T.A. Brown, ed.) IRL Press, Oxford, pp. 185-208

Krynetski, E.Y. and Evans, W.E. (1999). Pharmaeogeneties as a moleeular basis for individualized drug therapy: the thiopurine S-methyltransferase paradigm. Pharmaceut. Res. 16: 342-349

Kuehl, P., Zhang, J., Lin, Y., Lamba, J., Assem, M., Schuetz, J., Watkins, P.B., Daly, A., Wrighton, S.A., Hall, S.D., Maurel, P., Relling, M., Brimer, C., Yasuda, K., Venkataramanan, R., Strom, S., Thummel, K., Boguski, M.S. and Schuetz, E. (2001). Sequenee diversity in CYP3A promoters and characterization of the genetic basis of polymorphic CYP3A5 expression. Nat. Genet. 27: 383-3891

Kukita, ¥., Tahira, T., Sommer, S.S. and Hayashi, K. (1997). SSCP analysis of long DNA fragments in low pH gel. Hum. Mutat. 10: 400-407

Kumar, R. and Thompson, E.B. (1999). The structure of the nuclear receptors. Steroids 64: 310-319

Kurokawa, R., Soderstrom, M., Horlein, A., Halachmi, S., Brown, M., Rosenfeld, M.G. and Glass, C.K. (1995). Polarity-specific activities of retinoic acid receptors determined by a co-repressor. Nature 377: 451-454

Lamba et al, in press.

Laudet, V., Auwerx, J., Gustafsson, J. and Wahli, W. [Nuelear Receptor Committee] (1999). A unified nomenclature system for the nuelear receptor subfamily. Cell 97: 1- 20

LeCluyse, E.L. (2001). Pregnane X receptor: molecular basis for species differences in CYP3A induction by xenobiotics. Chemico-Biol. Interact. 134: 283-289

212 LeDouarin, B., Zechel, C., Gamier, J.M., Lutz, Y., Tora, L., Pierrat, P., Heery, D., Gronemeyer, H., Chambon, P. and Losson, R. (1995). The N-terminal part of TIFl, a putative mediator of the ligand-dependent activation function (AF-2) of nuclear receptors, is fused to B-raf in the oncogenic protein T18. EMBO J. 14: 2020-2033

Lee, D.Y., Hayes, J.J., Pmss, D. and Wolffe, A.P. (1993b). A positive role for histone acétylation in transcription factor access to nucleosomal DNA. Cell 72: 73-84

Lee, M. S., Kliewer S. A., Provencal, J., Wright, P. E. and Evans, R. M. (1993a). Stmcture of the retinoid X receptor-a DNA binding domain: a helix required for homodimeric DNA binding. Science 260: 1117-1121

Lehmann, J.M., McKee, D.D., Watson, M.A., Willson, T.M., Moore, J.T., Kliewer, S.A. (1998). The human orphan nuclear receptor PXR is activated by compounds that regulate CYP3A4 gene expression and cause dmg interactions. J. Clin. Invest. 102: 1016-1023

Lewis, D.F.V. and Lake, B.G. (1995). Molecular modeling of members of the P4502A subfamily: application to studies of enzyme specificity. Xenobiotica 25: 585- 598

Lewis, D.F.V., Eddershaw, P.J., Goldfarb, P.S. and Tarbit, M.H. (1996). Molecular modelling of CYP3A4 from an alignment with CYP102: Identification of key interactions between active site residues and CYP3A-specific chemicals, Xenobiotica 26:1067- 1086

Lewis, D.F.V. and Lake, B.G. (1996). Molecular modelling of CYPIA subfamily members based on an alignment with CYP102: rationalization of CYPIA substrate specificity in terms of active site amino acid residues. Xenobiotica 26: 723-753

Lewis, D.F.V. and Pratt, J.M. (1998). The catalytic cycle and oxygenation mechanism. Drug Metabol. Rev. 30: 739-786

Lewis, D.F.V., Watson, E. and Lake, B.G. (1998). Evolution of the cytochrome P450 superfamily: sequence alignment and pharmacogenetics. Mutat. Res. 410: 245-270

213 Lewis, D.F.V. and Sheridan, G. (2001). Cytochrome P450, oxygen and evolution. The Scientific World 1: 151-167

Li, H.C., Dehal, S.S. and Kupfer, D. (1995). Induction of the hepatic CYP2B and CYP3A enzymes by the proestrogenic pesticide methoxychlor and by DDT in the rat. Effects on methoxychlor metabolism. J. Biochem. Toxicol 10: 51-61

Li, W.D., Lee, J.H. and Price, R.A. (2000). The peroxisome proliferator-activated receptor gamma 2 Pro 12Ala mutation is associated with early onset extreme obesity and reduced fasting glucose. M ol Genet Metab. 70: 159-161

Linder, M.W., Prough, R.A. and Valdes, R. (1997). Pharmacogenetics : a laboratory tool for optimising therapeutic efficiency, Clin. Chem. 43: 254-266

Lown, K.S., Kolars, J. C., Thummel, K.E., Barnett, J.L., Kunze, K.L., Wrighton, S.A. and Watkins, P.B. (1994). Interpatient heterogeneity in expression of CYP3A4 and CYP3A5 in small bowel. Lack of prediction by the erythromycin breath test. Drug Metab. Dispos. 22: 947-955

Lu, A.Y.H. (1998). Drug individual variability in dmg therapy and drug safety. Drug Met. Disp. 26: 1217-1222

Luisi, B.F., Xu, W.X., Otwinowski, Z., Freedman, L.P., Yamamoto, K.R. and Sigler, P.B. (1991). Crystallographic analysis of the interaction of the glucocorticoid receptor with DNA. Nature 352: 497-505

Lundquist, E., Johansson, I. and Ingelman-Sundberg, M. (1999). Genetic mechanisms for duplication and multiduplication of the human CYP2D6 gene and methods for detection of duplicated CYP2D6 genes. Gene 226: 327-338

Maenpaa, J., Hall, S.D., Ring, B. J., Strom, S.C. and Wrighton, S.A. (1998). Human cytochrome P450 3A (CYP3A) mediated midazolam metabolism: the effect of assay conditions and regioselective stimulation by alpha-naphthoflavone, terfenadine and testosterone. Pharmacogenetics 8 : 137-155

Marez, D., Legrand, M., Sabbagh, N., Guidice, J.M., Spire, C., Lafitte, J.J., Meyer, U.A. and Broly, F. (1997). Polymorphism of the cytochrome P450 CYP2D6 gene in a

214 European population: characterization of 48 mutations and 53 alleles, their frequencies and evolution. Pharmacogenetics 7: 193-202

M artin, S.N., Sutherland, J., Levin, A.V., Klose, R., Priston, M. and Heon, E. (2000). Molecular characterisation of congenital glaucoma in a consanguineous Canadian community: a step towards preventing glaucoma related blindness. J. Med. Genet. 37: 422-427

Masimirembwa, C., Persson, I., Bertilsson, L., Hasler, J. and Ingelman-Sundberg, M. (1996). A novel mutant variant of the CYP2D6 gene (CYP2D6*17) conunon in a black African population: association with diminished debrisoquine hydroxylase activity. Br. J. Clin. Pharmacol. 42: 713-719

Masuyama, H., Brownfield, C M., St-Arnaud, R., MacDonald, P.N. (1997). Evidence for ligand-dependent intramolecular folding of the AF-2 domain in vitamin D receptor-activated transcription and coactivator interaction. Mol. Endocrinol. 11: 1507-1517

Mclnerney, E.M., Tsai, M L, O'Malley, B.W. and Katzenellenbogen B.S. (1996). Analysis of estrogen receptor transcriptional enhancement by a nuclear hormone receptor coactivator. Proc. Natl. Acad. Sci. USA 93: 10069-10073

McLellan, R.A., Oscarson, M., Alexandrie, A.K., Seidegard, L, Evans, D.A., Rannug, A. and Ingelman-Sundberg, M. (1997). Characterization of a human glutathione S-transferase mu cluster containing a duplicated GSTMl gene that causes ultrarapid enzyme activity. Mol. Pharmacol. 52: 958-965

Meyer, M E., Gronemeyer, H., Turcotte, B., Bocquel, M.T., Tasset, D. and Chambon, P. (1989). Steroid hormone receptors compete for factors that mediate their enhancer function. Cell 57: 433-442

Miyata, M., Kudo, G., Lee, Y.H., Yang, T.J., Gelboin, H.V., Femandez-Salguero, P., Kimura, S. and Gonzalez, F.J. (1999). Targeted disruption of the microsomal epoxide hydrolase gene. Microsomal epoxide hydrolase is required for the carcinogenic activity of 7,12-dimethylbenz[a]anthracene. J. Biol. Chem. 274: 23963-23968

215 Moore, L.B., Park, DJ., Jones, S.A., Bledsoe, R.K., Consler, T.G., Stimmel, J.B., Goodwin, B., Liddle, C., Blanchard, S.G., Willson, T.M., Collins J.M. and Kliewer,

S.A. (2000a). Orphan nuclear receptors constitutive androstane receptor and pregnane X receptor share xenobiotic and steroid ligands. J. Biol Chem. 275: 15122-15127

Moore, L.B., Jones, S.A., Wisely, C.J., Serabjitsingh, T.M., Willson, T.M., Collins

J.M. and Kliewer, S.A. (2000b). St. John’s wort induces hepatic drug metabolism through activation of the pregnane X receptor. Proc. Natl Aca. Sci. USA 97: 7500-

7502

M urray, G.I., McFadyen, M.C., Mitchell, R.T., Cheung, Y.L., Kerr, A C. and Melvin, W.T. (1999). Cytochrome P450 CYP3A in human renal cell cancer. Br. J. Cancer 19'. 1836-1842

Nagpal, S., Friant, S., Nakshatri, H. and Chambon, P. (1993). RARs and RXRs: evidence for two autonomous transactivation functions (AF-1 and AF-2) and heterodimerization in vivo. EMBO J. 12: 2349-2360

Naville, D., Penhoat, A., Begeot, M. (2000). ACTH resistance syndromes. Ann. Endocrinol. 61: 428-439

Nelson, D R., Kamataki, T., Waxman, D.J., Guengerich, F.P., Estabrook, R.W., Feyereisen, R., Gonzalez, F.J., Coon, M.J., Gunsalus, I.C., Gotoh, O., Okuda, K., and Nebert, D.W. (1993). The P450 superfamily: update on new sequences, gene mapping, accession numbers, early trivial names of enzymes and nomenclature. DNA and Cell Biol 12: 1-51

Nelson, R.D., Koymans, L., Kamataki, T., Stegeman, J.J., Feyereisen, R., Waxman, D.J., Waterman, M R., Gotoh, O., Coon, M.J., Estabrook, R.W., Gunsalus, I.C. and Nebert, D.W. (1996). P450 superfamily: update on new sequence, gene mapping, accession numbers and nomenclature. Pharmacogenetics 6 : 1-42

Nelson, D R. (1998). Metazoan cytochrome P450 evolution. Comp. Biochem. Physiol C. Pharmacol. Toxicol Endocrinol 121: 15-22

216 Nelson, D R. (1999). Cytochrome P450 and the individuality of species. Arch. Biochem. Biophys. 369:1-10

Nishigori, H., Tomura, H., Tonooka, N., Kanamori, M., Yamada, S., Sho, K., Inoue, I., Kikuchi, N., Onigata, K., Kojima, I., Kohama, T., Yamagata, K., Yang, Q., Matsuzawa, Y., Miki, T., Seino, S., Kim, M.Y., Choi, H.S., Lee, Y.K., Moore, D.D. and Takeda, J. (2001). Mutations in the small heterodimer partner gene are associated vyith mild obesity in Japanese subjects. Proc. Natl. Acad. Sci. USA 98: 575-580

Nunoya, K.I., Yokoi, T., Kimura, K., Kainuma, T., Satoh, K., Kinoshita, M. and Kamataki, T. (1999). A new CYP2A6 gene deletion responsible for the in vivo polymorphic metabolism of (4-)-cis-3,5-dimethyl-2-(3-pyridyl)thiazolidin-4-one hydrochloride in humans. /. Pharmacol. Exp. Ther. 289: 437-442

Oesterheld, J R. (1998). A review of developmental aspects of cytochrome P450. J

Child Adolecs. Psychopharmacol. 8 : 161-174

Ogg, M.S., Williams, J.M., Tarbit, M., Goldfarb, P.S., Gray, T.J. and Gibson, G.G. (1999). A reporter gene assay to assess the molecular mechanisms of xenobiotic- dependent induction of the human CYP3A4 gene in vitro. Xenohiotica 29: 269-279

Ogino, M., Nagata, K., Miyata, M. and Yamazoe, Y. (1999). Hepatocyte nuclear factor 4-mediated activation of rat CYP3A1 gene and its modes of modulation by apolipoprotein AI regulatory protein I and v-ErbA-related protein 3. Arch. Biochem. Biophys. 362: 32-37

Oguri, K., Yamada, H. and Yoshimura, H. (1994). Regiochemistry of cytochrome P450 isozymes. Annu. Rev. Pharmacol. Toxicol. 34: 251-279

Okino, S.T., Pendurthi, U.R. and Tukey, R.H. (1992). Phorbol esters inhibit the dioxin receptor-mediated transcriptional activation of the mouse CYPla-1 and CYPla-2 genes by 2,3,7,8-tetrachlorodibenzo-p-dioxin. J. Biol. Chem. 267: 6991- 6998

Omura, T. and Sato, R. (1964). The carbon monoxide-binding pigment of liver microsomes. J. Biol. Chem. 239: 2370-2378

217 Ordentlich, P., Downes, M., Xie, W., Genin, A., Spinner, N.B., Evans, R.M. (1999). Unique forms of human and mouse nuclear receptor corepressor SMRT. Proc. Natl. Acad. Sci. USA 96: 2639-2644

Orita, M., Iwahana, H., Kazanawa, H., Hyashi, K. And Sekiya, T. (1989) Detection of polymorphisms of human DNA by gel electrophoresis as single-strand conformation polymorphisms. Proc. Natl. Acad. Sci. USA 86:2766-2770

Ortiz de Montellano, P R. (1995). Oxygen activation and transfer. In: Cytochrome P450. (P.R. Ortiz de Montellano, ed.) Plenum Press, New York. pp. 245-303

Oscarson, M., McLellan, R.A., Gullsten, H., Yue, Q.Y., Lang, M.A., Bernal, M.L., Sinues, B., Hirvonen, A., Raunio, H., Pelkonen, O. and Ingelman-Sundberg, M. (1999). Characterisation and PCR-based detection of a CYP2A6 gene deletion found at a high frequency in a Chinese population. FEES Lett. 448: 105-110

Ozdemir, V., Kalow, W., Tang, B., Paterson, A.D., Walker, S.E., Endrenyi, L. and Kashuba, A.D.M. (2000). Evaluation of the genetic compound of variability in CYP3A4 activity: a repeated drug administration method. Pharmacogenetics 10: 373- 388

Paine, M.F., Khalighi, M., Fisher, J.M., Shen, D.D., Kunze, K.L., Marsh, C.L., Perkins, J.D. and Thummel, K.E. (1997). Characterization of interintestinal and intraintestinal variations in human CYP3A-dependent metabolism. J. Pharmacol. Exp. Ther. 283: 1552-1562

Paolini, M., Cantelli-Forti G., Perocco, P., Pedulli, G.F., Abdel-Rahman S.Z. and Legator, M.S. (1999). Co-carcinigenic effect of beta-carotene. Nature 398: 760-761

Park, ¥., Li, H. and Kemper, B. (1996). Phénobarbital induction mediated by a distal CYP2B2 sequence in rat liver transiently transfected in situ. J. Biol. Chem. 271: 23725-23728

Pascussi, J.M., Jounaidi, Y., Drocourt, L., Domergue, J., Balabaud, CMaurel, P. and Vilarem, M.J. (1999). Evidence for the presence of a functional pregnane X receptor

218 response element in the CYP3A7 promoter gene. Biochem. Biophys. Res. Commun. 260: 377-381

Pascussi, J.M., Drocourt, L., Fabre, J. M., Maurel, P. and Vilarem, M.J. (2000). Dexamethasone induces pregnane X receptor and retinoid X receptor-alpha expression in human hepatocytes: synergistic increase of CYP3A4 induction by pregnane X receptor activators. Mol. Pharmacol. 58: 361-72

Pascussi, J.M., Drocourt, L., Gerbal-Chaloin, S., Fabre, J.M., Maurel, P. and Vilarem, M.J. (2001). Dual effects of dexamethasone on CYP3A4 gene expression in human hepatocytes: sequential role of glucocorticoid receptor and pregnane X receptor. Eur. J. Biochem. 268: 6346-6357

Paulussen, A., Lavrijsen, K., Bohets, H., Hendrickx, J., Verhasselt, P., Luyten, W., Konings, F. and Armstrong, M. (2000). Two linked mutations in transcriptional regulatory elements of the CYP3A5 gene constitute the major genetic determinant of polymorphic activity in humans. Pharmacogenetics 10: 415-424

Peet, D.J., Turley, S.D., Ma, W., Janowski, B.A., Lobaccaro, J.M., Hanuner, R E. and Mangelsdorf, D.J. (1998). Cholesterol and bile acid metabolism are impaired in mice lacking the nuclear oxysterol receptor LXR alpha. Cell 93: 693-704

Peng, H. and Coon, M.J. (1998). Regulation of rabbit cytochrome P450 2E1 expression in HepG2 cells by insulin and thyroid hormone. Mol. Pharmacol. 54: 740- 747

Petruzzelli, S., Camus, A. M., Carrozzi, L., Ghelarducci, L., Rindi, M., Menconi, G., Angeletti, C.A., Ahotupa, M., Hietanen, E., Aitio A, Saracci, R., Bartsch, H. and Giuntini, C. (1988). Long-lasting effects of tobacco smoking on pulmonary drug- metabolizing enzymes: a case-control study on lung cancer patients. Cancer Res. 48: 4695-700

Pongratz, I., Stromstedt, P., Mason, G.G.F. and Poellinger, L. (1991). Inhibition of the specific DNA binding activity of the dioxin receptor by phosphatase treatment. J. Biol. Chem. 266: 16813-16817

219 Poulsen, L., Arendt-Nielsen, L., Brosen, K. and Sindrup, S.H. (1996). The hypoalgesic effect of tramadol in relation to CYP2D6. Clin. Pharmacol. Ther. 60: 636-644

Ramarao, M. and Kemper, B. (1995). Substitution at residue 473 confers progesterone 21-hydroxylase activity to cytochrome P450 2C2. Mol. Pharmacol. 48: 417-424

Raunio, H., Husgafvel-Pursiainen, K., Anttila, S., Hietanen, E., Hirvonen, A. and Pelkonen, O. (1995). Diagnosis of polymorphisms in carcinogen-activating and inactivating enzymes and cancer susceptibility. Gene 159: 113-121

Rebbeck, T.R., Jaffe, J.M., Walker, A.H., Wein, A.J., Malkowicz, S.B. (1998). Modification of clinical presentation of prostate tumors by a novel genetic variant in CYP3A4. J. Natl. Cancer Inst. 90: 1225-1229

Renaud, J.P., Rochel, N., Ruff, M., Vivat, V., Chambon, P., Gronemeyer, H. and Moras, D. (1995). Crystal structure of the RAR-gamma ligand-binding domain bound to all-trans retinoic acid. Nature 378: 681-689

Rietschel, E.T. and Brade, H. (1992). Bacterial endotoxins. Sci. Am. 267: 54-61

Roman, L.J., Palmer, C.N., Clark, J.E., Muerhoff, A.S., Griffin, K.J., Johnson, E.F. and Masters, B.S. (1993). Expression of rabbit cytochromes P4504A which catalyze the omega-hydroxylation of arachidonic acid, fatty acids, and prostaglandins. Arch. Biochem. Biophys. 307: 57-65

Sachse, C., Brockmoller, J., Bauer, S. and Roots, !.. (1997). Cytochrome P450 2D6 variants in a Caucasian population: allele frequencies and phenotypic consequences. Am. J. Hum. Genet. 60: 284-295

Sata, F., Sapone, A., Elizondo, G., Stocker, P., Miller, V.P., Zheng, W., Raunio, H., Crespi, C.L. and Gonzalez, F.J. (2000). CYP3A4 allelic variants with amino acid substitutions in exons 7 and 12: evidence for an allelic variant with altered catalytic activity. Clin. Pharmacol. Ther. 67: 48-56

220 Saito, T., Takahashi, Y., Hashimoto, H. and Kamataki, T. (2001). Novel transcriptional regulation of the human CYP3A7 gene by Spl and Sp3 through nuclear factor KB-like elements. J. Biol Chem. 276: 38010-38022

Savas, U., Griffin, K.J. and Johnson, E.F. (1999). Molecular mechanisms of cytochrome P-450 induction by xenobiotics: An expanded role for nuclear hormone receptors. Mol Pharmacol 56: 851-857

Savas, U., Wester, M.R., Griffin, K.J. and Johnson, E.F. (2000). Rabbit pregnane X receptor is activated by rifampicin. Drug Metab. Dispos. 28: 529-537

Schenkman, J. B. and Greim, H. (1993). Cytochrome P450. Springer-Verlag, Berlin, pp. 61-109

Schmiedlin-Ren, P., Thummel, K.E., Fisher, J.M., Paine, M.F., Lown, K.S. and Watkins, P.B. (1997). Expression of enzymatically active CYP3A4 by Caco-2 cells grown on extracellular matrix-coated permeable supports in the presence of la-25- dihydroxyvitamin Dg. Mol. Pharmacol 51: 741-754

Schuetz, J.D., Beach, D.L. and Guzelian, P.S. (1994). Selective expression of cytochrome P450 CYP3A mRNAs in embryonic and adult human liver. Pharmacogenetics 4: 11-20

Sellers, E.M. and Tyndale, R.F. (2000). Mimicking gene defects to treat drug dependence. Ann. N. Y. Acad. Sci 909: 233-246

Seth, P., Lunetta, K.L., Bell, D.W., Gray, H., Nasser, S.M., Rhei, E., Kaelin, C M., Iglehart, D.J., Marks, J.R., Garber, J.E., Haber, D.A. and Polyak, K. (2000). Phenol sulfotransferases : hormonal regulation, polymorphism, and age of onset of breast cancer. Cancer Res. 60: 6859-6863

Shimada, T., and Guengerich, F.P. (1989). Evidence for cytochrome P450NF, the nifedipine oxidase, being the principal enzyme involved in the bioactivation of afiatoxins in human liver. Proc. Natl Acad. Sci USA 8 6 : 462-465

221 Shimada, T., Yamazaki, H., Mimura, M. Inui, Y., and Guengerich, F.P. (1994). Interindividual variations in human liver cytochrome P-450 enzymes involved in the oxidation of drugs, carcinogens and toxic chemicals: studies with liver microsomes of 30 Japanese and 30 Caucasians. J. Pharmacol. Exp. Ther. 270: 414-423

Shinoda, K., Lei, H., Yoshii, H., Nomura, M., Nagano, M., Shiba, H., Sasaki, H., Osawa, Y., Ninomiya, Y., Niwa, O., Morohashi, K. and Li, E. (1995). Developmental defects of the ventromedial hypothalamic nucleus and pituitary gonadotroph in the Ftz-Fl disrupted mice. Dev. Dyn. 204: 22-29

Sladek, R. and Giguere, V. (2000). Orphan nuclear receptors: an emerging family of metabolic regulators. Adv. Pharmacol. 47: 23-87

Spina, E., Gitto, C., Avenoso, A., Campo, G. M., Caputi, A. P. and Perucca, E. (1997). Relationship between plasma desipramine levels, CYP2D6 phenotype and clinical response to desipramine: a prospective study. Eur. J. Clin. Pharmacol. 51: 395-398

Spivack, S.D., Fasco, M.J., Walker, V.E. and Kaminsky, L.S. (1997). The molecular epidemiology of lung cancer. Crit. Rev. Toxicol. 27: 319-365

Staudinger, J.L., Goodwin, B., Jones, S.A., Hawkins-Brown, D., Mackenzie, K.I., Latour, A., Liu, Y., Klassen, C.D., Brown, K.K., Reinhard, J., Willson, T.M. and Kliewer, S.A (2001). The nuclear receptor PXR is a lithicholic acid sensor that protects against liver toxicity. Proc. Natl. Acad. Sci. USA 98: 3369-3374

Streetman, D.S., Bertino, J.S Jr. and Nafziger A.N. (2000). Phenotyping of drug- metabolizing enzymes in adults: a review of in vivo cytochrome P450 phenotyping probes. Pharmacogenetics 10: 187-216

Stacker, I., Cosme, J., Laurent, P., Cenee, S., Beaune, P., Bignon, J., Depierre, A., Milleron, B. and Hemon, D. (1995). CYP2D6 genotype and lung cancer risk according to histologic type and tobacco exposure. Carcinogenesis 16: 2759-2764

222 Sueyoshi, T., Kawamoto, T., Zelko, L, Honkakoski, P. and Negishi, M. (1999). The repressed nuclear receptor CAR responds to phénobarbital in activating the human CYP2B6 gene. J. Biol Chem. 274: 6043-6046

Sueyoshi, T. and Negishi, M. (2001). Phénobarbital response elements of cytochrome P450 genes and nuclear receptors. Annu. Rev. Pharmacol Toxicol 41: 123-143

Synold ,T.W., Dussault, I. and Formam, B.M. (2001). The orphan nuclear receptor SXR coordinantly regulates drug metabolism and efflux. Nat Med. 7: 584-590

Szklarz, G.D. and Halpert, J R. (1997). Molecular modelling of cytochrome P450 3A4. J. Computer-Aided M ol Des. 11: 265-272

Szklarz, G.D. and Halpert, J R. (1998). Molecular basis of P450 inhibition and activation. Drug Metabol Dispos. 26: 1179-1184

Thummel, K.E. and Wilkinson, G.R. (1998). In vitro and in vivo drug interactions involving human CYP3A. Annu. Rev. Pharmacol. Toxicol. 38: 389-430

Torchia, J., Glass, C. and Rosenfeld, M.G. (1998). Co-activators and co-repressors in the integration of transcriptional responses. Curr. Opin. Cell Biol 10: 373-383

Towner, P. (1991). Purification of DNA. In: Essential Molecular Biology, vol. 1 (T.A. Brown, ed.) IRL Press, Oxford, pp 47-68

Tran, C D., Timmens, P., Conway, B.R. and Irwin, W.J. (2002). Investigation of the coordinated functional activities of cytochrome P450 3A4 and P-glycoprotein in limiting the absorption of xenobiotics in Caco-2 cells. J. Pharm. Sci 91: 117-128

Trottier, E., Belzil, A., Stoltz, C. and Anderson, A. (1995). Localization of a phénobarbital -response element (PBRE) in the 5'-flanking region of the rat CYP2B2 gene. Gene 158: 263-268

Tse, C., Sera, T., Wolffe, A. P. and Hansen, J.C. (1998). Disruption of higher-order folding by core histone acétylation dramatically enhances transcription of nucleosomal arrays by RNA polymerase III. Mol Cell Biol 18: 4629-4638

223 Tuma, R.S., Beaudet, M.P., Jin, X., Jones, L.J., Chueng, C.Y., Yue, S and Singer, V.L. (1999). Characterisation of SYBR Gold nucleic acid gel stain: a dye optimised for use with 300-nm ultraviolet transilluminators. Anal Biochem. 268: 278-288

Tzameli, I., Pissios, P., Schütz, E.G. and Moore, D.D. (2000). The xenobiotic compound 1,4-bis [2-(3,5 -dichloropyridyloxy)] benzene is an agonist ligand for the nuclear receptor CAR. Mol Cell Biol 20: 2951-2958

Ueng, Y.F., Kuwabara, T., Chun, Y.J. and Guengerich, F.P. (1997). Cooperativity in oxidations catalyzed by cytochrome P450 3A4. Biochemistry 36: 370-381

Ura, K., Kurumizaka, H., Dimitrov, S., Almouzni, G. and Wolffe, A.P. (1997). Histone acétylation: influence on transcription, nucleosome mobility and positioning, and linker histone-dependent transcriptional repression. EMBO J. 16: 2096-2107

Vahdati-Mashhadian, N. (2001). PhD thesis.

Vincent-Viry, M., Muller, J., Fournier, B., Galteau, M.M. and Siest, G. (1991). Relation between debrisoquine oxidation phenotype and morphological, biological, and pathological variables in a large population. Clin. Chem. 37: 327-332 vom Baur, E., Zechel, C., Heery, D., Heine, M.J., Gamier, J.M , Vivat, V., Le Douarin, B., Gronemeyer, H., Chambon, P. and Losson, R. (1996). Differential ligand-dependent interactions between the AF-2 activating domain of nuclear receptors and the putative transcriptional intermediary factors mSUGl and TIFl. EMBOJ. 15: 110-124 von Moltke, L.L., Greenblatt, D.J., Schmider, J., Harmatz, J.S. and Shader, R.I. (1995). Metabolism of dmgs by cytochrome P450 3A isoforms. Implications for dmg interactions in psychopharmacology. Clin. Pharmacokinet. 29 suppl 1: 33-43

Wagner, R.L., Apriletti, J.W., McGrath, ME., West, B.L., Baxter, J.D. and Fletterick, R.J. (1995). A stmctural role for hormone in the thyroid hormone receptor. Nature 378: 690-697

Wang, D.G., Fan, J.B., Siao, C.J., Bemo, A., Young, P., Sapolsky, R., Ghandour, G., Perkins, N., Winchester, E., Spencer, J., Kmglyak, L., Stein, L., Hsie, L., Topaloglou,

224 T., Hubbell, E. Robinson, E., Mittmann, M., Morris, M.S., Shen, N., Kilbum, D., Rioux, J., Nusbaum, C., Rozen, S., Hudson, T.J., Lipshutz, R., Chee, M. and Lander, E.S. (1998). Large-scale identification, mapping, and genotyping of single-nucleotide polymorphisms in the human genome. Science 280: 1077-1082

Wang, X.L., Bassett, M., Zhang, Y., Yin, S., Clyne, C., White, P.C. and Rainey, W.E. (2000). Transcriptional regulation of human 1 Ibeta-hydroxylase (hCYPllBl). Endocrinology 141: 3587-3594

Watkins, P.B., Murray, S.A., Winkelman, L.G., Heuman, D M., Wrighton, S.A. and Guzelian, P.S. (1989). Erythromycin breath test as an assay of glucocorticoid- inducible liver cytochromes P-450. Studies in rats and patients. J. Clin. Invest. 83: 688-697

Watkins, P.B. (1995). Cyclosporine and liver transplantation: will the midazolam test make blood level monitoring obsolete? Hepatology 22: 994-996

Waxman, D.J. (1988). Interactions of hepatic cytochrome P450 with steroid hormones. Biochem Pharmacol. 37: 71-84

Waxman, D.J. (1999). P450 gene induction by structurally diverse xenochemicals: central role of nuclear receptors CAR, PXR and PPAR. Arch. Biochem. Biophys. 369: 11-23

Weber, M., Moller, K., Welzeck, M. and Schorr, J. (1995). Short technical reports. Effects of lipopolysaccharide on transfection efficiency in eukaryotic cells. Biotechniques 19: 930-940

Wendel, C., Witte, J.S., hall, J.M., Stein, C M., Wood, A.J.J. and Wilkinson, G.R. (2000). CYP3A activity in African American and European American men: population differences and functional effects of the CYPSAd'^IB 5'-promoter region polymorphism, Ciln. Pharmacol. Ther. 6 8 : 82-91

Westlind, A., Lofberg, L., Tindberg, N., Andersson, T.B. and Ingelman-Sundberg, M. (1999). Interindividual differences in hepatic expression of CYP3A4: relationship to

225 genetic polymorphism in the 5'-upstream regulatory region. Biochem. Biophys. Res. Commun. 259: 201-205

Westlind, A., Malmebo, S., Johansson, 1.0., Otter, C., Andesson, T.B., Ingelman- Sundberg M. and Oscarson, M. (2001). Cloning and tissue distribution of a novel human cytochrome P450 of the CYP3A subfamily, CYP3A43. Biochem. Biophys. Res. Commun. 281: 1349-1355

Williams, J.A., Chenery, R.J., Berkhout, T.A. and Hawksworth, G.M. (1997). Induction of cytochrome P450 3A by the antiglucocorticoid mifepristone and a novel hypocholesterolaemic drug. Drug Metab. Dispos. 25: 757-761

Wiseman, H. and Lewis, D.F. (1996). The metabolism of tamoxifen by human cytochromes P450 is rationalized by molecular modelling of the enzyme-substrate interactions: potential importance to its proposed anti-carcinogenic/carcinogenic actions. Carcinogenesis 17: 1357-1360

Wrighton, S.A., Schuetz, E.G., Watkins, P.B., Maurel, P., Barwick, J., Bailey, B.S., Hartle, H.T., Young, B. and Guzelian, P. (1985). Demonstration in multiple species of inducible hepatic cytochromes P-450 and their mRNAs related to the glucocorticoid- inducible cytochrome P-450 of the rat. Mol. Pharmacol. 28: 312-321

Wrighton, S.A., Brian, W.R., Sari, M., Iwasaki, M., Guengerich, F.P., Raucy, J.L., Molowa, D.T. and VandenBranden, M. (1990). Studies on the expression and metabolic capabilities of human hver cytochrome P450 3A5 (HLP-3). Mol. Pharmacol. 38: 207-213

Xie, W., Barwick, J.L., Simon, C M., Pierce, A.M., Safe, S., Blumberg, B., Guzelian,

P.S. and Evans, R.M. (2000a). Reciprocal activation of xenobiotic response genes by nuclear receptors SXR/PXR and CAR. Genes Dev. 14: 3014-3023

Xie, W., Barwick, J.L., Downes, M., Simon, Blumberg, B., Simon, C M., Nelson,

M.C., Neuschwander-Tetri, Brunt E.M., Guzelian, P.S. and Evans, R.M. (2000b). Humanized xenobiotic response in mice expressing nuclear receptor SXR. Nature 406: 435-439

226 Xu, L., Glass, C.K. and Rosenfeld, M.G. (1999). Coactivator and corepressor complexes in nuclear receptor function. Curr. Opin. Genet. Dev. 9: 140-147

Yamano, S., Tatsuno, J. and Gonzalez, F.J. (1990). The CYP2A3 gene product catalyzes coumarin 7-hydroxylation in human liver microsomes. Biochemistry 29: 1322-1329

Yanagimoto, T., Itoh, S., Sawada, M. and Kamataki, T. (1997). Mouse cytochrome P450 (CYP3A11): predominant expression in liver and capacity to activate aflatoxin Bl.Arch. Biochem. Biophys. 340: 215-218

Yang, T. Sinai, P., Kitts, P.A. and Kain S.R. (1997). Quzntification of gene expression with a secreted alkaline phosphatase reporter system. BioTechniques 23: 1110-1114

Yaun, W., Cawley, G.F., Eyer, C.S. and Backes, W.L. (1994). Induction of P450 3A by ethylbenzen without altering RNA levels. Biochem. Biophys. Res. Commun. 202: 1259-1265

Yeowell, H.N., Waxman, D.J., Wadhera, A., and Goldstein, J.A. (1987). Suppression of the constitutive, male-specific rat hepatic cytochrome P-450 2c and its mRNA by 3,4,5,3',4',5'-hexachlorobiphenyl and 3-methylcholanthrene. Mol. Pharmacol. 32: 340-734

Yip, S.P., Hopkinson, D.A. and Whitehouse, D.B. (1999). Improvement of SSCP analysis by use of dénaturants. Biotechniques 27: 20-24

Yokomori, N., Nishio, K., Aida, K. and Negishi, M. (1997). Transcriptional regulation by HNF-4 of the steroid 15alpha-hydroxylase P450 (Cyp2a-4) gene in mouse liver. J. Steroid. Biochem. Mol. Biol. 62: 307-314

Yoshioka, H., Lang, M., Wong, G. and Negishi, M. (1990). A specific cis-acting element regulates in vitro transcription of sex-dependent mouse steroid 16 alpha- hydroxylase (C-P450 (16 alpha)) gene. J. Biol. Chem. 265: 14612-14617

Zamir, L, Dawson, J., Lavinsky, R.M., Glass, C.K., Rosenfeld, M.G. and Lazar, M.A. (1997). Cloning and characterization of a corepressor and potential component

227 of the nuclear hormone receptor repression complex. Proc. Natl. Acad. Sci. USA 94: 14400-14405

Zangar, R.C. and Novak, R.F. (1998). Posttranslational elevation of cytochrome P450 3A levels and activity by dimethyl sulfoxide. Arch. Biochem. Biophys. 353: 1-9

Zhang, H., LeCulyse, E., Liu, L., Hu, M., Matoney, L., Zhu, W. and Yan, B. (1999). Rat pregnane X receptor: molecular cloning, tissue distribution, and xenobiotic regulation. Arc/î. Biochem. Biophys. 368: 14-22

Zhang, J., Kuehl, P., Green, E., Touchman, J.W., Watkins, P.B., Daly, A., Hall, S.D., Maurel, P., Relling, M., Brimer, C., Yasuda, K., Wrighton, S.A., Hancock, M., Kim, R., Strom, S., Thummel, K., Russel, C.G., Hudson, J.R Jr., Schuetz, E.G. and Boguski, M.S. (2001). The human pregnane X receptor: genomic structure and identification and functional characterization of natural allelic variants. Pharmacogenetics 11: 555-572

Zhou, Y. and Waxman D.J. (1999). STATb down-regulates peroxisome proliferator- activate receptor a transcription by inhibition of ligand-independent activation function region-1 tran^-activation domain. J. Biol. Chem. 274: 29874-29882

228 APPENDIX I SOLUTIONS, MEDIA AND BUFFERS

Ammonium persulphate stock solution (10% w/v)

0 . 1 g ammonium persulphate

1 ml distilled water Prepare fresh and mix well.

Ampicillin stock solution

1 0 0 mg/ml ampicillin in dissolved in distilled water. The solution is filter sterilised. Store at -20°C. Use at 100 pg /ml in growth media for selection of ampicillin resistant bacteria.

Calcium chloride stock solution (2M) for transfection experiments

Dissolve 10.8 g of CaCU.6 H2 O in 20 ml distilled water. Sterilise by filtration; store in 1ml aliquots at -20°C.

EDTA stock solution (0.5 M) 186.1 g EDTA 20 g NaOH pellets Add 800 ml distilled water, adjust the pH to 8.0 Make up to 1 L with distilled water.

Ethidium Bromide Stock solution of 10 mg/ml in TAB buffer.

HBS (2x) (HEPES-buffered saline) for transfection experiments 1.6 g NaCl (280 mM) 0.074 g KCl (10 mM)

0.027 g Na2 HPO4 .2 H2 0 (1.5 mM) 0.2 g dextrose (12 mM) 1 g HEPES (50 mM) pH to 7.05 with NaOH; make up to 100 ml with distilled water. Sterilise by filtration; store in 5 ml aliquots at -20°C.

229 LB medium 10 g trypton 5 g yeast extraction 10 g NaCl Add distilled water to 1 L. Sterilise by autoclaving.

LB agar 15 g agar/L of LB medium Sterilise by autoclaving. Cool to 50°C before addition of ampicillin (if required). Poor into petri dishes.

Phosphate buffered saline (PBS pH 7.5) 1 tablet (Dulbecco ‘A’ Oxoid) dissolved in 100 ml distilled water. Sterilised by autoclaving.

TAE electrophoresis buffer (lOx) 48.4 g Tris base 40 ml 0.5 M EDTA pH 8.0 11.42 ml glacial acetic acid Add distilled water to 1 L

TBE electrophoresis buffer (lOx) for SSCP 108gTris.Cl 55 g boric acid 20 ml 1 M EDTA Make up to 1 L by distilled water.

TE buffer (Tris-EDTA) 10 mM Tris.Cl, pH 7.5 1 mM EDTA Sterilise by filtration.

230 APPENDIX II

COMMUNICATIONS AND PUBLICATIONS FROM THIS WORK

1. Hamzeiy, H. and Goldfarb, P.S. (2001) Novel alleles of the human CYP3A4 gene CYP3A4nE, CYP3A4^1F and CYP3A4^15B; Submission in the Human Cytochrome P450 (CYP) Allele Nomenclature Committee Home Page (http:// www.imm.ki.se/CYPalleles).

2. Hamzeiy, H., Vahdati-Mashhadian, N., Edwards, H.J. and Goldfarb, P.S. (2002). Mutation analysis of the human CYP3A4 gene 5 ^regulatory region: population screening using non-radioactive SSCP. Mutat. Res. 500: 103-110

3. Hamzeiy, H., Vahdati-Mashhadian, N., Edwards, H.J. and Goldfarb, P.S. (2002). Polymorphic Variation in the Human CYP3A4 Gene 5' Regulatory Region: Effect of Inherited Mutation on Xenobiotic Transcriptional Modulation. A poster presentation in British Toxicology Society Annual Meeting, University of Kent.

4. Hamzeiy, H., Vahdati-Mashhadian, N., Edwards, H.J. and Goldfarb, P.S. (2002). Polymorphic Variation in the CYP3A4 Gene 5' Regulatory Region: Effects of Xenobiotic Transcriptional Induction. A poster presentation in the 14* International Symposium on Microsomes and Drug Oxidation, Sapporo, Japan

231 Fundamental and Molecular Mechanisms of Mutagenesis ELSEVIER Mutation Research 500 (2002) 103-110 www.clscvicr.com/locatc/molmut Community address: www.elsevier.com/locate/mutres

Mutation analysis of the human CYP3A4 gene 5' regulatory region: population screening using non-radioactive SSCP Hossein Hamzeiy, Nasser Vahdati-Mashhadian, Helen J. Edwards, Peter S. Goldfarb* Molecular Toxicology Group, School of Biomedical and Life Sciences, University of Surrey, Guildford, Surrey GUI 7XH, UK

Received 14 September 2001 ; received in revised form 3 December 2001 ; accepted 10 December 2001

Abstract

Human CYP3A4 is the major cytochrome P450 isoenzyme in adult human liver and is known to metabolise many xenobiotic and endogenous compounds. There is substantial inter-individual variation in the hepatic levels of CYP3A4. Although, polymorphic mutations have been reported in the 5' regulatory region of the CYP3A4 gene, those that have been investigated so far do not appear to have any effect on gene expression. To determine whether other mutations exist in this region of the gene, we have performed a new population screen on a panel of 101 human DNA samples. A 1140 bp section of the 5' proximal regulatory region of the CYP3A4 gene, containing numerous regulatory motifs, was amplified from genomic DNA as three overlapping segments. The 300 bp distal enhancer region at —7.9 kb containing additional regulatory motifs was also amplified. Mutation analysis of the resulting PCR products was carried out using non-radioactive single strand conformation polymorphism (SSCP) and confirmatory sequencing of both DNA strands in those samples showing extra SSCP bands. In addition to detection of the previously reported CYP3A4* IB allele in nine subjects, three novel alleles were found; CYP3A4* IE (having a T A transversion at —369 in one subject), CYP3A4*1F (having a C -» G tranversion at —747 in 17 subjects) and CYP3A4* 15B containing a nine-nucleotide insertion between —845 and —844 linked to an A ^ G transition at —392 and a G ^ A transition in exon 6 (position 485 in the cDNA) in one subject. All the novel alleles were heterozygous. No mutations were found in the upstream distal enhancer region. Our results clearly indicate that this rapid and simple SSCP approach can reveal mutant alleles in drug metabolising enzyme genes. Detection and determination of the frequency of novel alleles in CYP3A4 will assist investigation of the relationship between genotype, xenobiotic metabolism and toxicity in the CYP3A family of isoenzymes. © 2002 Elsevier Science B.V. All rights reserved.

Keywords: Cytochrome p450; CYP3A; CYP3A4 gene; CYP3A4 mutations; Single strand conformation polymorphism

1. Introduction show wide inter-individual variation, influencing both drug responses and disease susceptibility [2]. Four CYP3A isoenzymes are the most abundantly human CYP3A genes have been identified, CYP3A4, expressed cytochrome P450s in human liver, account­ CYP3A5, CYP3A7[2>] and most recently CYP3A43 [4]. ing for up to 60% of the total hepatic cytochrome CYP3A4 is the major cytochrome P450 isoenzyme P450 activity in some individuals [1]. However, the in adult human liver and is known to metabolise a large expression and activity of the CYP3A isoenzymes variety of xenobiotic and endogenous substrates [5]. Inter-individual variation in hepatic CYP3A4 levels of up to 40-fold (based on the metabolism of specific sub­ * Corresponding author. Tel.: +44-1483-876456; fax: +44-1483-300374. strates such as triazolam, midazolam or cyclosporine) E-mail address: [email protected] (P.S. Goldfarb). has been observed [6]. The basis of this variation is

0027-5107/02/$ - see front matter © 2002 Elsevier Science B.V. All rights reserved. FIX: 80027-5107(01)00305-0 104 H. Hamzeiy et al./Mutation Research 500 (2002) 103-110

not yet understood but may be due to genetic, environ­ the recognised CYP3A alleles are now listed on in the mental, pathological, hormonal or dietary factors [7]. Human Cytochrome P450 (CYP) Allele Nomenclature The CYP3A4 gene and its 5' flanking region has Committee home page [18]. been isolated and sequenced [8]. The gene is approx­ In order to identify novel mutations in the 5' prox­ imately 27 kb long with a coding region composed imal and distal regulatory regions of the CYP3A4 of 13 exons located on chromosome 7q22.1 [8,9]. gene we have performed a new population screening Although there had been no indication o f genetic poly­ study. Linkage of new regulatory region mutations to morphism in the CYP3A4 gene until 1997 [10-12], mutations in the coding region was also examined by investigations since then have reported inherited vari­ sequencing all 13 exons of the CYP3A4 gene in those ation in both the promoter [13,14] and coding region individuals carrying the new mutations. We report of the gene [15-18]. However, the impact of these here the discovery of three new CYP3A4 alleles des­ mutations on mRNA expression or enzyme activity ignated CYP3A4*1E, CYP3A4*1F and CYP3A4*15B. has not been extensively investigated. Also the pro­ posed relationship between the CYP3A4* IB allele (—392 A -A- G) and an increased incidence of prostate 2. Materials and methods cancer was not confirmed in later studies [19,20]. However, Sata et al. [15] showed that the CYP3A4*2 2.1. Subject recruitment and genomic allele (Ser222Pro) produces a lower in vivo intrinsic DNA isolation clearance of nifedipine, but no significant difference from the wild-type enzyme activity for testosterone Blood samples were obtained by phlebotomy from 6-3-hydroxylation. In addition Hsieh et al. [16] have healthy subjects (41 females and 60 males) of mainly Caucasian or Iranian origin. Genomic DNA was iso­ recently reported three further mutations in the coding region of the CYP3A4 gene and related them to a dec­ lated from whole blood using the Wizard® genomic reased urinary 6-^-hydroxycortisol/cortisol ratio in DNA purification kit (Promega, UK) and used directly heterozygotes. In a further study of 213 subjects Eiselt for PCR amplifications. et al. [17] have identified 18 new CYP3A4 variants of which several showed altered enzyme activity. 2.2. PCR amplifications In the case of CYP3A5, there is also evidence of polymorphism in the coding [21] and promoter re­ The specific primers used to amplify the proximal gions [22] which may contribute to variation in the regulatory and distal enhancer regions of the CYP3A4 overall hepatic metabolism of CYP3A substrates. All gene are shown in Table 1. The proximal 1140 bp 5'

Table 1 Primer pairs used for PCR amplification of the CYP3A4 5' regulatory and XREM regions

Region Sequence Position^ Size (bp) 5' Proximal region PI: 5'-GACCACTGCCCCATCATTGC-3' 1201/-778 423 P2: 5'-GCTGGTGGAGTTGACTTAGC-3' P3: 5'-GCACAGCCAAGAGCTCTGGC-3' -884/-391 493 P4: 5'-CrrGCCCTTGTCTCTATGGC-3' P5: 5'-GGCACAGGCACACTCCAGGC-3' -4 9 3 /-6 1 433 P6: 5'-TGCTGGGCTATGTGCATGGAGC-3' Modified PI and P6 5'-cccaagcttGACCACTGCCCCATCArrGC-3' 5'-ccggaattcTGCTGGGCTATGTGCATGGAGC-3' Distal XREM P7: 5'-ACTTCATGCAAAAATGCTGG-3' -7972/-7671 300 P8: 5'-GTTCTrGTCAGAAGrrCAGC-3'

'Numbering system defines the first coding ATG as position +1. H. Hamzeiy et al/Mutation Research 500 (2002) 103-110 105 regulatory region was amplified as three short overlap­ (except for the annealing temperatures) were used to ping segments to aid the single strand conformation amplify the distal XREM region and the coding ex­ polymorphism (SSCP) analysis. All PCR amplifica­ ons. The annealing temperature used for amplification tions were carried out in a 50 p-1 reaction volume, using of the distal XREM region was 60 °C. PCR primers the Advantage-HF2 (high fidelity) PCR kit (Clontech, and annealing temperatures used for amplification of Palo alto, CA, USA). Each reaction contained 5 p,l of the individual CYP3A4 exons are shown in Table 2. 10 X HF2 PCR buffer, 5 p.1 of 10 x HF2 dNTP mixture, 1 p.1 of 50 X Advantage-HF2 polymerase mixture, 2.3. Non-radioactive Cold-SSCP analysis 6 pul of relevant primer mixture (15pmol each) and 100-200 ng of genomic DNA template. The reaction An efficient Cold-SSCP technique was developed conditions for the CYP3A4 proximal 5' regulatory empirically for analysis of PCR products of up to region segments were: 1 min at 94 °C for 1 cycle; 30 s 500 bp in length. Previous methods had only been at 94 °C, 30 s at 65 °C and 1 min at 72 °C for 30 cy­ able to use the technique for analysis of PCR prod­ cles; 7 min at 72 °C for 1 cycle. The same conditions ucts up to 300 bp [23-27]. Five microliters of PCR

Table 2 Primers used for PCR amplification of the CYP3A4 exons^

Primer pairs Sequence Size cDNA position PCR aimealing temperature (°C) Exon 1-A* 5'-GTGGAGAAGCCTCTTCCAACTG-3' 357 -216/71 62 Exon 1-B* 5'-GGGAAAGAGAGGCCTGATTAGC-3'

Exon 2-A 5'-CATTGCCGTCAGAGTTACTG-3' 439 72/165 60 Exon 2-B 5'-CTGAGGCAAACCTGAGGTTC-3'

Exon 3-A 5'-GCTTCCTCTAACTGCCAGCAAG-3' 365 166/218 62 Exon 3-B* 5'-GGCATGCAGATTCCCATTGC-3'

Exon 4-A* 5' -GTGTC AGACTCTTGCTGTGTG-3' 387 219/318 60 Exon 4-B 5'-GAAGTGGACGTGGAACCTTC-3'

Exon 5-A 5'-CATCACCCAGTAGACAGTCAC-3' 351 319/432 60 Exon 5-B 5'-GGCAGCTCAAATTCAGTGGAC-3'

Exon 6-A* 5'-TGTCCTTCTGGGACTAGAGTC-3' 351 433/521 60 Exon 6-B* 5'-GGGAGAAGATCCTTTTCCTCC-3'

Exon 7-A 5'-CCTGTTGCATGCATAGAGG-3' 366 522/670 58 Exon 7-B 5'-GATGATGGTCACACATATC-3'

Exon 8-A 5'-GCrrCCAGTTGAGAACCTTG-3' 393 671/798 60 Exon 8-B* 5'-CTCTTGCTCTAAACATGAGCAG-3'

Exon 9-A* 5'-ACATCCTGCnTCCAAGGA-3' 419 799/865 60 Exon 9-B 5'-CCTGCATGCCTCTAGAAAGTG-3'

Exon 10-A 5'-CCAGTGTACCTCTGAATTGC-3' 430 866/1027 60 Exon 10-B 5'-CAGAGCCrrCCTACATAGAG-3'

Exon 11-A* 5'-CCAGTATGAGTrAGTCTCTGGA-3' 416 1028/1253 60 Exon 11-B* 5'-TGTCCTGTAGArrAAGAGAGGC-3

Exon 12-A* 5'-AGGGGTGGCCCTAAGTAAG-3' 396 1254/1416 62 Exon 12-B 5'-GATCACAGATGGGCCTAATTG-3'

Exon 13-A* 5'-TGAAGGAGTGTCTCACTCAC-3' 735 1417/2065 60 Exon 13-B* 5'-ACGCCAACAGTGATTACAATG-3'

'(*): Indicates primers modified from Sata et al. [15]. 106 II. Hamzeiy et ai./Mutation Research 500 (2002) 103-110 product was mixed with 10 |xl of a denaturing-loading the —392 A -A- G mutation. Subsequently, long-range dye (95% formamide, 4M urea, 0.1% bromophenol allele-specific PCR products (-858/4-14536) were blue, 0.1% xylene cyanol FF and 0.5 p.1 15% Ficoll). used as templates to amplify each corresponding exon The mixture was heated to 94 °C for 10 min and 6 and determine whether the 5' regulatory region loaded into the wells of a 15% polyacrylamide mutations were linked to the exon 6 mutation. (39:1 acrylamide/bis-acrylamide) gel. Each gel First the C Y P 3 A 4 proximal regulatory region in (8 cm X 7.3 cm x 1 mm) was cast using the Bio-Rad M-42 was amplified using modified PI and P6 primers mini Protean set and pre-run in I x TBE buffer (Table 1) creating H i n d l l l and EcoRI sites at the 5 ' and for 1 h before loading the samples. The electrophore­ 3 ' ends of the PCR product, respectively. The restric­ sis was carried out in a 4 °C cold room at 15 V/cm for tion digested and purified PCR products (PCR prod­ 65-70 h for 5' regulatory region PCR products or for uct purification kit, QIAGEN, Germany) were then 48 h for the XREM region PCR products. After elec­ cloned into plasmid pSEAP2-Basic (Clontech, Palo trophoresis the gels were stained with SYBR® Gold alto, CA, USA). The recombinant plasmid DNA was nucleic acid stain (Molecular Probes, Oregon, USA), transformed into E . c o l i TOPI OF' (Invitrogen, CA, for 30-40 min and photographed under UV light USA) cells and transformed colonies were isolated. using a SYBR® gel stain photographic filter [28]. Sequencing of DNA from plasmid minipreps was used to identify the mutant and wild-type alleles. Secondly, 15.5 kb products from —858 bp of the 5' 2.4. DNA sequencing proximal regulatory region to the end of exon 6, were amplified from M-42 genomic DNA using a long- PCR products showing altered SSCP patterns were range PCR kit (TripleMaster PCR system, Eppendorf re-amplified from genomic DNA then purified with AG, Germany) and allele-specific forward primers the Ultra Clean ^ ^ 15 DNA purification kit (MO BIO, 5 -AATGACCTAAGAAGTCACCAGAA-3' (wild- Solana beach, CA, USA). The purified samples were type) or 5-AATGACCTAAGAAGATGGAGT-AG-3' then used directly for DNA sequencing of both strands (insertion-mutant) with a common exon 6 reverse without any further treatment. Where a variation in primer 5 -TGGATATGTAAACCCTGGCCC-3'. The DNA sequence from the wild-type was found, the orig­ reaction conditions were: 2 min at 94 °C for 1 cycle; inal PCR product was also sequenced for confirma­ 25 s at 94 °C, 30 s at 62 ° C and 12 min at 68 °C for 28 tion. In the case of novel mutations, additional repeat amplification and sequencing was performed. In all samples where novel 5' regulatory region mutations were found, direct sequencing of PCR products from 23.1 kb the 13 C Y P 3 A 4 exons was also performed to iden­ 9.4 kb <—15.5 kb tify any linked coding region mutations. Numbering 6.6 kb of nucleotides has been carried out by assigning the figure +1 to the base A in the translation ATG initia­ 4.3 kb tion codon and —1 to the base before the A [18]. 2.3 kb -> 2.0 kb —> 2.5. Linkage analysis of mutations in .sample M -42

In order to determine whether the three heterozy­ gous mutations found in genomic DNA amplifica­ tions from subject M-42 were in the same allele, Fig. 1. Allele-specilic long-range-PCR of the wild-type and mutant linkage analysis was performed. An initial amplifica­ alleles of sample M-42 using genomic DNA as template and the primers described in Section 2.4. Arrow indicates the 15.5 kb tion and cloning of the 5' proximal promoter region desired PCR product. (A) Lambda DNA///mdIlI DNA marker. (B) (—1201/—61) was used to separate the alleles and Negative PCR control. (C) M-42 mutant allele PCR product. (D) determine if the 9 bp insertion at —845 was linked to M-42 wild-type allele PCR product. II. Hamzeiy et al./Mutation Research 500 (2002) 103-110 107

cycles; 10 min at 68 °C for 1 cycle. Following elec­ heterozygous in 9 out of 10 samples. A new allele trophoresis, the 15.5 kb bands (Fig. 1) were extracted (designated C Y P 3 A 4 * 1 E [18]) containing a -369 from the gel, purified with the Ultra Clean 15 DNA T -» A transversion was found in sample F-14 purification kit (MO BIO, Solana beach, CA, USA) (Fig. 3A). The SSCP pattern of this mutation was and used as templates to re-amplify exon 6. The exon not distinguishable from that of the other nine sam­ 6 PCR products were then sequenced to identify on ples. In the —884/—391 section 18 samples showed which allele the exon 6 mutation was present. altered SSCP patterns indicating possible mutations (Fig. 2B). Subsequent sequencing revealed 17 sam­ ples with a novel allele (designated C Y P 3 A 4 * I F [18]) 3. Results containing a —747 C ^ G transversion (Fig. 3B). The remaining sample (M-42) showed a nine-nucleotide All PCR primers were checked initially for speci­ heterozygous insertion (ATGGAGTGA) after —845 ficity by sequencing of the PCR products. No evidence G (Fig. 3D). This sequence has close similarity to the was found to indicate non-specific cross-amplification ‘HFL-a’ motif in the C Y P 3 A 7 promoter region [8] of the C Y P 3 A 5 or C Y P 3 A 7 5' regulatory regions. For and may have arisen by recombination. The insertion amplification of the C Y P 3 A 4 exons the primers and was also detected in the SSCP and sequencing anal­ conditions in Sata et al. [15] were used initially. In ysis of the overlapping —1201/—778 segment of the some instances, however the primers and annealing M-42 promoter and was the only sample from this temperatures were modified to optimise the amplifi­ segment with an altered SSCP pattern (Fig. 2C). All cations (Table 2). In the case of the primers for exons DNA samples containing novel mutations were sub­ I and 2 these did not distinguished between C Y P 3 A 4 ject to confirmatory PCR and sequencing to eliminate and C Y P 3 A 7, causing double sequence readings for the possibility of PCR artefacts. the PCR products. However, the two sequences could Sequencing results for the 13 exons of the C Y P 3 A 4 be read manually from the sequencer printout and gene for samples with new mutations in the 5' regula­ analysed for mutations by inspection. tory region showed no mutations in the coding region SSCP analysis of PCR products from the —493/—61 except in the case of sample M-42 where a heterozy­ section of the promoter region revealed 10 samples gous G ^ A transition in exon 6 (cDNA position with an altered electrophoresis pattern indicating 485), creating R162Q in the protein structure, was likely mutations (Fig. 2A). These samples were re­ found (Fig. 3D). It should be noted that in addition to amplified and the PCR products were sequenced in the insertion at —845 this sample also contained het­ both directions. The previously described C Y P 3 A 4 * 1 B erozygous ly a —392 A ^ G transition [13]. Results of allele (—392 A G) [13] was found to be the linkage analysis revealed that the three mutations

(A) (B) (C) 1 B Q M WT M WT WT

F'ig. 2. Representative non-radioactive SSCP of CYP3A4 5' regulatory region PCR products. M and WT indicate mutant and wild-type samples. (A-C) Indicate SSCP patterns for mutant and wild-type samples in the -4 9 3 /-6 1 , -8 8 4 /-3 9 1 and -1 2 0 1 /-7 7 8 sections of the 5' regulatory region, respectively. Arrows show the site of appearance of extra SSCP bands indicating likely mutations. 108 II. Hamzeiy et al. / Mutation Research 500 (2002) 103-110

-3 6 9

-747

100 v n o 0 T OT OT OTACA OCACgCTOOTAGOOA

(A) (B)

-8 4 5

310 320 ^ 330 340 350 360 370 T TA A T GAC C T A A G AAG A ■ C C G A GAG AC C AG G C A G GC A . GGC • C A G - C - C A GC 1

TCACCAGAAAGTCAGAAGGGATGACATGCAGAGGCCCAGCAATCTCAGC ATGGAGTAGTCACCAGAAAGTCAGAAGGGATGACATGCAGAGGCCCAGC (C)

485 (cDNA)

80 90 100 AAATCT GAGGCAGOOAAOCAGAO

(D)

-845 -392 485 (cDNA)

500 310 520 50 ^ 9 0 100 \C CT AAG AAG AT 0 0 .-.OTA G TCAC G AGAÇA A 0 0 0 C AGO AO AGAOOC G A I ATCT OAGOCAGGAAGCAGAGAC.i

(E)

Fig. 3. Sequence confirmation of novel mutations identified by SSCP. (A-C) Indicate tlie heterozygous —369 T A, —747 C ^ G and nine-nucleotide insertion (after -8 4 5 G, underlined) mutations respectively. In (C) the double sequence read out due to the insertion and its normal interpretation are demonstrated. (D) Indicates the heterozygous G ^ A mutation in exon 6 of sample M-42. (E) Shows sequence data from the CYP3A4* I5B allele in sample M-42 containing the three linked mutations. H. Hamzeiy et al/Mutation Research 500 (2002) 103-110 109

identified in sample M-42 were located on the same R162Q). There has been a substantial debate regard­ allele, designated CYP3A4*15B [18], (Fig. 3E). ing the effects of the —392 A ^ G transition on No mutations were found in the CYP3A4 distal enzyme level [19,20] and this issue has yet to be XREM enhancer region indicating high sequence con­ resolved. However, an insertion of nine nucleotides at servation in this essential regulatory element. position —845 (which is identical in eight out of nine nucleotides to the ‘HFL-a’ response element in the CYP3A7 promoter) makes this region of the CYP3A4 4. Discussion gene in this allele similar to CYP3A7. Since, CYP3A7 expression is repressed in adult liver and ‘HFL-a’ is The discovery of variant alleles for the enzymes one of the few substantial differences between the CYP2D6, CYP2C19, CYP2C9, CYP2A6 and CYP3A4 and CYP3A7 promoter regions this insertion CYP3A5 which markedly influence the activity or may cause down-regulation of CYP3A4 expression expression of these enzymes [22] has added impe­ from this allele, hi the case of the linked mutation in tus to the search for CYP3A4 variants which may M-42 exon 6 the conservative substitution of arginine similarly affect the hepatic CYP3A4 phenotype. for glutamine may not have a substantial effect on A report by Rebbeck et al. [13] that a —392 A enzyme activity [29-31]. We are presently investigat­ G transition in the CYP3A4 promoter may be associ­ ing in vitro the possible impact of the novel alleles ated with a higher clinical stage and grade of prostate on hepatic CYP3A4 gene expression. tumours challenged investigators to determine if this In summary, we have further developed a simple, variant indeed had any impact on CYP3A4 activity. It non-radioactive SSCP analysis method so that it can also greatly encouraged population-screening efforts reliably detect single nucleotide changes in PCR prod­ to investigate the frequency of this variant and to iden­ ucts of up to 500 bp in length. We have utilised this tify other mutations in the promoter or coding regions system to identify novel mutations in the 5' promoter of CYP3A4. Our results for this mutation indicated a region of the human CYP3A4 gene. frequency of 9.6% in the Caucasian population, a fig­ ure in agreement with previous authors [20]. In the Iranian samples the frequency was lower at 6%. Acknowledgements The initial goal of this study was the identification of novel mutations in the promoter of the CYP3A4 We would like to thank Dr. Nick Plant for helpful gene and determination of their frequencies. In fact we discussions and critical reading of the manuscript. The have extended the work of previous authors by scan­ Iranian Ministry of Health and Medical Education has ning the 5' proximal regulatory region up to —1140 bp supported H.H. and N.V.M. during this study. and including the XREM at —7.9kp. We have identi­ fied three new mutations in the 5' proximal regulatory region. The —369 T ^ A transversion which was References found only in one Caucasian subject may have some effect on enzyme expression because of its proxim­ [1] F.J. Gonzalez, Cytochrome P450 in humans, in: Schenkman ity to the CAAT box and other regulatory motifs. The J.B., Greim H. (Eds.), Cytochrome P450, Springer, Berlin, —747 C -A- G transversion is a mutation with rela­ 1993, pp. 239-249. tively high frequency, i.e. 20% in Caucasian and 18% [2] F.P. Guengerich, Cytochrome P-450 3A4: regulation and role in drug metabolism, Ann. Rev. Pharmacol. Toxicol. 39 (1999) in Iranian populations. This mutation is not located 1-17. in or near a known transcriptional element and might [3] D. R Nelson, L. Koymans, T. Kamtaki, J.J. Stegeman, thus have little or no effect on gene expression. R. Feyereisen, D.J. Waxman, M R. Waterman, G. Osamu, Perhaps the most surprising of our findings is the M.J. Coon, R.W. Estabrook, EC. Gunsalus, D.W. Nebert, genotype of subject M-42. This Caucasian male has P450 super family: update on new sequence, gene mapping, accession numbers and nomenclature. Pharmacogenetics 6 inherited an allele containing a nine-nucleotide inser­ (1996) 1-42. tion after —845 G, a —392 A ^ G transition [13], [4] T.L. Domanski, C. Finta, J.R. Halpert, P.G. Zaphiropoulos, and a G ^ A transition in exon 6 (resulting in cDNA cloning and initial characterisation of CYP3A43, a 110 H. Hamzeiy et al./Mutation Research 500 (2002) 103-110

novel human cytochrome P450, Mol. Pharmacol. 59 (2001) expression of CYP3A4: relationship to genetic polymorphism 386-392. in the 5' upstream regulatory region, Biochem. Biophys. Res. [5] A.P. Li, D.L. Kaminiski, A. Rasmussen, Substrates of human Commun. 259 (1999) 201-205. hepatic cytochrome P450 3A, Toxicology 104 (1995) 1-8. [20] S.E. Ball, J. Scantia, J. Kado, G.M. Ferron, R. Fruncillo, P. [6] A.K. Daly, S. Cholerton, W. Gregory, J.R. Idle, Metabolic Mayer, I. Weinryb, M. Guido, P.J. Hopkins, N. Warner, J. polymorphisms, Pharmacol. Ther. 57 (1993) 129-160. Hall, Population distribution and effects on drug metabolism [7] F.P. Guengerich, Human cytochrome P-450, in: PR. Ortize of a genetic variant in the 5' promoter region of CYP3A4, de Montellano (Ed.), Cytochrome P450, Plenum Press, New Clin. Pharmacol. Ther. 66 (1999) 288-294. York, 1995, pp. 473-535. [21] Y. Jounaidi, V. Hyraillles, L. Gervot, P. Maurel, Detection [8] H. Hashimoto, K. Toide, R. Kitamura, M. Fujita, S. Tagawa, of a CYP3A5 allelic variant: candidate for the polymorphic S. Itoh, T. Kamataki, Gene structure of CYP3A4, an adult- expression of the protein? Biochem. Biophys. Res. Commun. specific form of cytochrome P450 in human livers, and its 221 (1996) 466-470. transcriptional control, Eur. J. Biochem. 218 (1993) 585-595. [22] A. Paulussen, K. Lavrijsen, H. Bohets, J. Hendrickx, P. [9] B.J. Goodwin, E. Hodgson, C. Liddle, The orphan human Verhasselt, W. Luyten, F. Konings, M. Armstrong, Two linked pregnane X receptor mediates the transcriptional activation mutations in transcriptional regulatory elements of CYP3A5 of CYP3A4 by rifampicin through a distal enhancer module. gene constitute the major genetic determinant o f polymorphic Mol. Pharmacol. 56 (1999) 1329-1339. activity in humans. Pharmacogenetics 10 (2000) 415^24. [10] M.W. Linder, R.A. Prough, R. Valdes, Pharmacogenetics: a [23] K. Hayashi, Y. Kukita, M. Inazuka, T. Tahira, Single-strand laboratory tool for optimising therapeutic efficiency, Clin. conformation polymorphism, in: R.G.H. Cotton, E. Edkins, Chem. 43 (1997) 254-266. S. Forrest (Eds.), Mutation Detection: A Practical Approach, [11] D.F.V. Lewis, J.M. Pratt, The catalytic cycle and oxygenation IRE Press, Oxford, 1998, pp. 7-24. mechanism. Drug Metab. Rev. 30 (1998) 739-786. [24] T. Hongyo, G.S. Buzzard, R.J. Calvert, C.M. Weghorst, [12] D.F.V. Lewis, E. Watson, B.G. Lake, Evolution of the Cold-SSCP: a simple, rapid and non-radioactive method for cytochrome P450 super family: sequence alignments and optimized single-strand conformation polymorphism. Nucleic pharmacogenetics, Mutat. Res. 410 (1998) 245-270. Acids Res. 21 (1993) 3637-3642. [13] T.R. Rebbeck, J.M. Jaffe, A.H. Walker, A.J. Wein, S.B. [25] P.J. Ainsworth, D.I. Rodenhise, A non-radioactive method for Malkowicz, Modification of clinical presentation of prostate the detection of single-strand conformational polymorphism tumours by a novel genetic variant in CYP3A4, J. Natl. Cancer (SSCP), in: A.J. Hawood (Ed.), Methods in Molecular Inst. 90 (1998) 1125-1229. Biology: Protocols for Gene Analysis, Vol. 31, Humana Press, [14] P. Kuehl, J. Zhang, J. Lamba, M. Assem, J. Schuetz, P.B. Totowa, NJ, USA, 1994, pp. 205-210. Watkins, A. Daly, S.A. Wrighton, S.D. Hall, P. Maurel, M. [26] Y. Kukita, T. Tahira, S.S. Sommer, K. Hayashi, SSCP analysis Relling, C. Brimer, K. Yasuda, R. Ventaramanan, S. strom, of long DNA fragments in low pH gel. Hum. Mutat. 10 K. Thammel, M.S. Boguski, E. Schuetz, Sequence diversity (1997) 400-407. in CYP3A promoters and characterization of the genetic basis [27] S.P. Yip, D.A. Hopkinson, D.B. Whitehouse, Improvement of polymorphic CYP3A5 expression, Nat. Genet. 27 (2001) of SSCP analysis by use of dénaturants. Biotechniques 27 383-391. (1999) 20-24. [15] F. Sata, A. Sapone, G. Elizondo, P. Stocker, V.P. Miller, W. [28] R.S. Tuma, M.P. Beaudet, X. Jin, L.J. Jones, C.Y. Chueng, Zheng, H. Raunio, C.L. Grespi, F.J. Gonzalez, CYP3A4 allehc S. Yue, V.L. Singer, Characterisation of SYBR gold nucleic variants with amino acid substitution in exons 7 and 12: acid gel stain: a dye optimised for use with 300 nm evidence for an allelic variant with altered catalytic activity, ultraviolet transilluminators. Anal. Biochem. 268 (1999) 278- Clin. Pharmacol. Ther. 67 (2000) 48-56. 288. [16] K.P. Hsieh, Y Y Lin, C.L. Cheng, M.L. Lai, M.S. Lin, J.P. [29] D.F.V. Lewis, P.J. Eddershaw, PS. Goldfarb, M.H. Tarbit, Siest, J.D. Huang, Novel mutations of the CYP3A4 in Chinese, Molecular modelling of CYP3A4 from an alignment with Drug Metab. Dispos. 29 (2001) 268-273. CYP 102: identification of key interactions between active [17] R. Eiselt, T.L. Domanski, A. Zibat, R. Muller, E. site residues and CYP3A-specific chemicals, Xenobiotica 26 Presecan-Siedel, E. Hustert, U.M. Zanger, J. Brockmoller, (1996) 1067-1086. H P. Klenk, U.A. Meyer, K.K. Khan, Y.A. He, J.R. Halpert, L. [30] G.D. Szklarz, J.R. Halpert, Molecular modelling of Wojnowski, Identification and functional characterization of cytochrome P450 3A4, J. Computer-Aided Mol. Des. 11 eight CYP3A4 protein variants, Pharmacogenetics 11 (2001) (1997) 265-272. 447-458. [31] H. Wang, R. Dick, H. Yin, E. Licad-Coles, D.L. Kroetz, [18] Home page of the Human Cytochrome P450 (CYP) Allele G. Szklarz, J.R. Halpert, M.A. Correia, Structure-function Nomenclature Committee, http://www.imm.ki.se/CYPalleles. relationship of human liver cytochrome P450 3A: aflatoxin [19] A. Westlind, L. Lofberg, N. Tindberg, T.B. Andersson, M. B1 metabolism as a probe. Biochemistry 37 (1998) 12536- Ingelman-Sundberg, Inter-individual differences in hepatic 12545. POLYMORPHIC VARIATION IN THE CYP3A4 GENE 5' REGULATORY REGION: EFFECT ON XENOBIOTIC TRANSCRIPTIONAL INDUCTION. Hossein Hamzeiy, Nasser Vahdati-Mashhadian, Helen J. Edwards, Gemma L Swaisland, Peter S. Goldfarb I 1 I Toxicology Group, School of Biomedical and Life Sciences, University of Surrey, Guildford, Surrey GU2 7XH, UK ^ I iduction A4 is usually the major cytochrome P450 enzyme in adult In addition to detection of the previously reported 1 liver. It is known to metabolise a wide variety of xenobiotic CYP3A4*1B allele [2] in ninesubjects, three novel HepG2 idogenous compounds. Substantial inter-individual variation alleles were found: CYP3A4*1E (having a T ^ A m 5 0 0 0 0 )atic levels of CYP3A4 has been observed and although transversion at -369 in one subject), CYP3A4*1F orphIc mutations have been reported in both the 5‘ (having a C->G transversion at -747 in 17 subjects) 4 0 0 0 0 tory and coding regions of the CYP3A4 gene, those and CYP3A4*15B having a nine-nucleotide insertion 3 0 0 0 0 gated [1] so far do not appear to make a major contribution between -845 and -844linked to an A->G transition P3A4 variation in the population as a whole. To determine at -392 and a G ^ A transition in exon 6 (position 485 > 20000 sr regulatory mutations might occur in more distal regions ofin the cDNA) in one subject [3], In all samples where g 10000 jmoter, we have performed a new population screening on a novel CYP3A4 regulatory region mutations were of 101 human DNA samples. found, direct sequencing of PCR products from all 13 exons was performed to identify any linked coding WT M-42 M-18 F-27 F - 14 region mutations. As indicated in Fig 2 one such llts mutation was found in subject M42, Linkage of the HuH7 60000 )p of the proximal 5' regulatory region of theCYP3A4 gene three mutations in M42 was confirmed using cloning 00 bp of the distal enhancer region at -7 ,9 kb, both and long range PCR to separate the alleles. 5 0 0 0 0 ling numerous regulatory motifs, were amplified from 4 0 0 0 0 lie DNA, Screening for mutations in the resulting PCR Functional analysis of the regulatory region mutants 3 0 0 0 0 Its was carried out using non radioactive single strand was performed in vitro using reporter DNA constructs mation polymorphism (SSCP), Analysis of PCR products in wfiich the whole 1140 bp proximal promoter region ^ 20000 the proximal 5' regulatory region (amplified as three from each mutant allele was inserted between a o) 10000 iping segments) revealed several samples with altered single copy of the 300 bp core distal enhancer phoretic patterns (Fig 1), sequence and the cDNA for human secreted alkaline phosphatase (SEAP), The individual reporter WT M-42 M-18 F-27 F-14 constructs were co-transfected with an hPXR expression vector into human liver (HepG2, HuH7) Caco-2 and intestinal (Caco-2) cell lines, Xenobiotic 4 0 0 0 0 modulation of CYP3A4 promoter activity was .,^ 3 5 0 0 0 measured by chemiluminescent SEAP assay (Fig 3), 3 3 0 0 0 0 Z 2 5 0 0 0 HepG2 'Zi 20000 lepresentative non-radioactive SSCP of the CYP3A4 gene regulatory 5 0 0 0 ^CR products, (A-G) patterns for mutant (M) and wild-type (WT) 0000 1 in the -493/-61,-884/-391 and -1201/-778 segments respectively, 5 0 0 0 ndicate the presence of additional bands In the SSCP pattern, f l WT M-42 M-18 F-27 F-14 iant electrophoretic pattems were found in PCR products le distal enhancer region (amplified as two overlapping Fig 4, Xenobiotic induction of SEAP expression from wild-type and mutant nts) indicating extensive consen/ation of sequence in this Rifampicin (p,M) CY3A4 promoters in different cell lines, M 42:CYP3A4‘15B, ^^^3:CYP3A4*1F, al regulatory region. The presence of proximal 5' regulatory F27:CYP3AriB, F14:CYP3A4*J£, □ DMSO; HDEX 10 ,utVI;DPB 1 mlVl; □ CLTZ, ■ MIF, □ RIF and ■ RIF without hPXR 10 p.lVt, mutations was confirmed by sequencing of both DNA Fig 3. Dose response curve for rifampicin induction of SEAP ! in the original and freshly amplified PCR products (Fig 2), expression from the wild-type and IVI42 CYP3A4 prom oters in hPXR co-transfected HepG2 cells (n=6, P<0,01 at 10-40 piM), Conclusions While there was close similarity between the xenobiotic The evidence presented in this report suggests that inherited induction patterns for wild type and mutant promoters in mutations in the CYP3A4 gene 5' regulatory region can HepG2 and HuH7 cells, the pattern in Caco-2 cells was significantly affect in vitro transcriptional responses to different substantially different (Fig 4), Significant variation in xenobiotic inducers. However, considering the different activation ilM'M/Lk, promoter strength was found among the mutant profiles of the mutant alleles In different cell types, it can be CYP3A4 alleles depending on the Inducer used and the deduced that these responses are depend on the cellulat recipient cell line. Also different induction pattems were environment, the availability of the transcription factors goveming observed in different cell lines with different CYP3A4 the expression of a specific gene in a specific tissue and the inducers (most notably by phénobarbital and presence of endogenous or xenobiotic ligands and theii mifepristone). This indicates the role of endogenous concentrations. transcription factors (such as CAR and PXR) and their concentration relative to each other. Finally, in spite of a great deal of effort to search for genetic factors goveming the inter-individual variability in CYP3A enzyme 485 (cDNA) Transfection of wild type and mutant containing reporter expression during last four years and the identification of a long constructs in HepG2, HuH7 and Caco-2 cells, in list of mutations in both coding and regulatory regions of the general, produced similar pattem of Induction by the CYP3A4 gene (http://ww,imm,ki,se/CYPalleles/cyp3a4,htm), a W ' same drugs. The only exception was phénobarbital genetic polymorphism with a conclusive and clear functional effeci

485 (cDNA) which produced more induction with all CYP3A4 alleles on GYP3A4 activity has yet to be identified. in HuH7 and Caco-2 cells compared to FlepG2 cells, Flowever, the Induction pattern of the CYP3A4 alleles References was substantially different in Caco-2 cells. Only the /m illA , ûü M-42 reporter construct showed a significantly different 1. Home page of the Human Cytochrome P450{CYP} Allele (increased) activity in comparison to the wild type Nomenclature Committee, http:// www.imm.ki.se/CYPalleles )NA sequence confirmation of novel mutations identified by SSCP, promoter in this cell line. This may suggest the licatethe heterozygous -369 T^A , -747 C-^G and, 9 nucleotide 2. Rebbeck, T.R., Jaffe, J.M., Walker, A.H., Wein, A.J., possibility of binding of a specific transcription factor to (after -845 G,underlined) respectively, (D) indicates the Malkowicz, S.B. (1998).J. Natl. Cancer. Inst. 90:1225-1229 jous G—>A mutation in exon 6 ofsubject IVI42, (E) shows sequence the nine-nucleotide insertion site in the M-42 promoter in I the novel CYP3A4'15B allele from subjectM42 containing the three these cells. Further studies are required to evaluate this 3. Hamzeiy, H., Vahdati-Mashhadian, N., Edwards, H.J. and rtations. assumption, Goldfarb, P.S. (2002).Mutat. Res. 500:103-110 UNIVBffiSiTV OF îaiRRFV

Reproduced with permission of copyright owner. Further reproduction prohibited without permission.