NEUREGULIN1-ERBB4 SIGNALING MEDIATES SYNAPTIC MATURATION AND INDUCES DENDRITIC BRANCHING IN HIPPOCAMPAL NEURONS
by
DARIA VASILIEVNA KRTVOSHEYA
B.Sc. The University of British Columbia, 2006
A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF
MASTER OF SCIENCE
in
THE FACULTY OF GRADUATE STUDIES
(Neuroscience)
THE UNIVERSITY OF BRITISH COLUMBIA
July 2007
© Daria Vasilievna Krivosheya, 2007 ABSTRACT
Central nervous system (CNS) synapse formation is a complex process that ensures precise alignment, as well as complementarity of the presynaptic and postsynaptic components.
Numerous players are involved in different stages of CNS synaptogenesis, however, the list is far from complete. Neuregulin-1 (NRG1) and its receptor ErbB4 tyrosine kinase are widely expressed in the developing and adult brain. ErbB4 is specifically expressed in inhibitory
GABAergic interneurons. Moreover, ErbB4 is localized to synapses and associates through it
PDZ-binding motif with the postsynaptic density protein PSD-95, a major scaffolding protein involved in glutamatergic synapse stabilization and maturation. Given its location, ErbB4 is capable to take part in synapse development in GABAergic interneurons; however, little is known of its function at the synapse.
In the following work, we manipulated levels of ErbB4 protein expression in primary hippocampal neuron cultures to determine the role of ErbB4 at the synapse. We found that cells overexpressing the receptor formed larger excitatory and inhibitory presynaptic terminals, while the number of synapses per unit length remained the same. This process did not depend on the kinase domain activity. Moreover, highly clustered exogenous ErbB4 recruited PSD-95 to the site of the synapse, a process dependent on the PDZ interaction, since deletion of the PDZ- binding motif severely perturbed ErbB4 localization. However, ErbB4 is not a synapse inducing factor, since expression in heterologous cells failed to induce presynaptic differentiation.
n Treatment of neurons overexpressing ErbB4 with the NRG1 ligand dramatically
enhances primary neurite formation, a process dependent on the kinase activity of ErbB4.
- Moreover, when applied to the neurons expressing ErbB4 endogenously, NRG1 induces increase
in the number of primary dendrites in ErbB4-positive cells only. Taken together, these findings
suggest that ErbB4 is involved in specific aspects of synaptic maturation and dendritic
outgrowth, possibly coordinating the two processes in GABAergic interneurons.
iii TABLE OF CONTENTS Page ABSTRACT ii
TABLE OF CONTENTS iv
LIST OF FIGURES vi
ACKNOWLEDGEMENTS vii
INTRODUCTION 1 1. Structure of a synapse 1 2. Neuromuscular junction formation 2 2a. NMJ pre-patterning 2 2b. AChR clustering and transcription 3 2c. Presynaptic maturation 5 3. Principles of glutamateric synapse formation in central nervous system 6 3a. Establishing the contact 8 3b. Contact stabilization 9 3c. Recruitment of presynaptic and postsynaptic proteins 10 3c.i NARP 10 3c.ii EphrinB 11 3c.iii Neuroligins and neurexins 11 3c.iv SynCAM 13 3d. Maturation and Spine Morphogenesis 13 4. Neuregulin ligands and ErbB receptorsin the CNS 15 4a. The neuregulin-1 family 15 4a.i. Neuregulin structure and processing 15 4a.ii. Distribution and function of neuregulins at the CNS synapses 16 4b. ErbB receptors 17 4b.i. ErbB4 structure 18 4.b.ii. ErbB4 signaling 19 4.b.iii ErbB4 distribution and function at the CNS synapses 20 5. Potential disfunctioning of NRGl-ErbB4 signaling in mental illness 22
Thesis objectives 23
MATERIALS AND METHODS 24 cDNA cloning and mutagenesis 24 Cell culture and mixed culture assay 25 Immunocytochemistry and reagents 25 Western Blotting and NRG1 treatment 27 Imaging and Analysis 28 Page RESULTS Chapter 1. Effects of ErbB4 on synapse development in hippocampal neurons 29 1. Characterization of endogenous ErbB4 localization in hippocampal neurons 29 2. Overexpression of ErbB4 results in enhanced maturation of the presynaptic terminals 34 3. ErbB4 is insufficient to induce presynaptic terminal formation 44 4. Effects of ErbB4 overexpression on PSD-95 distribution 46 5. Structural determinants of ErbB4-mediated enhancement of presynaptic maturation 51
Chapter 2. Effects of NRG1 stimulation on hippocampal neurons 59 1. NRG1 treatment promotes primary neurite formation in cells overexpressing ErbB4 59 2. Endogenous NRG 1-mediated primary dendrite formation 63 3. NRG1 stimulated neurite formation requires intact kinase activity of ErbB4 66
DISCUSSION 71 Endogenous ErbB4 distribution 71
Presynaptic protein enhancement by ErbB4 74
Trans-synaptic mechanism of enhanced presynaptic cluster size 75
Postsynaptic mechanism of ErbB4-mediated enhancement of
glutamatergic presynaptic terminals 77
ErbB4 mediated enhancement of GABAergic presynaptic terminals 80
Effects of ErbB4 on dendrite morphology 81
ErbB4 signaling is capable of altering cytoskeleton dynamics 82
Implications for kinase signaling 84
Model of NRGl-ErbB4 signaling resulting in enhanced primary neurite formation.85
Conclusions 87
REFERENCES 89 LIST OF FIGURES
Page
Figure 1. Stages of CNS synaptogenesis 7 Figure 2. Distribution of ErbB4 puncta at excitatory and inhibitory synapses 30 Figure 3. ErbB4 is localized to dendrites in hippocampal neurons 32 Figure 4. ErbB4 induces presynaptic terminal maturation 35 Figure 5. ErbB4 induces glutamatergic presynaptic terminal maturation 38 Figure 6. ErbB4 induces GABAergic presynaptic terminal maturation 41 Figure 7. Direct versus indirect mechanism of presynaptic enhancement 45 Figure 8. Mixed culture assay to study excitatory presynaptic terminal differentiation 47 Figure 9. Mixed culture assay to study inhibitory presynaptic terminal differentiation 48 Figure 10. ErbB4 induces PSD-95 clustering 49 Figure 11. Schematic diagram of deletion mutant forms of ErbB4 52 Figure 12. Surface labeling of ErbB4ACT, ErbB4ANT and ErbB4APDZ 53 Figure 13. Basal phosphorylation level of ErbB4ACT, ErbB4ANT and ErbB4APDZ 55 Figure 14. PDZ-binding motif regulates ErbB4 trafficking to the synapse ; 56 Figure 15. ErbB4K751R induces presynaptic terminal maturation 58 Figure 16. Neuregulin 1 treatment induces primary neurite formation in cells overexpressing ErbB4 60 Figure 17. One day NRG1 treatment dramatically enhances primary neurite formation in cells overexpressing ErbB4 61 Figure 18. NRG1 treatment of cells expressing ErbB4 endogenously 64 Figure 19. Constitutively active ErbB4 kinase displays an enhanced number of primary neurites 67 Figure 20. Kinase activity of ErbB4 is required to induce enhanced number of neuritis 68 Figure 21. Summary of signaling pathways activated in response to NRG1 stimulation 86 ACKNOWLEDGEMENTS
I would like to thank my supervisor, Dr. Alaa El-Husseini, for his input and advice over the last two years. His immediate supervision and guidance of my research work allowed me to acquire and master many important skills important for being a successful researcher, such as scientific inquiry and critical thinking. His enthusiasm and encouragement played a major role in stimulating my interest in neuroscience research and pursuing further academic development.
I would also like to thank Dr. Shernaz Bamji for her excellent critique of my work and priceless technical assistance in the last year. Her assistance together with Dr. Lucia Tapia with primary neuron cultures allowed me to advance my project at a faster rate. Many thanks to Dr.
Ann-Marie Craig for allowing me to master mixed culture technique in her laboratory, as well as to Dr. Yunhee Kang for her technical assistance with the co-culture assay. Moreover, I would like to express sincere thanks to the following graduate students in Dr. El-Husseini laboratory:
Kim Gerrow for her assistance with immunofluorescence imaging, data analysis and interpretation, rigorous critique of the thesis and assistance with the diagram preparation included in this work; Joshua Levinson for his assistance with molecular cloning and. troubleshooting throughout my work on this project; and as well as to Marie-France Lise for her cheerfulness and enthusiasm about research that inspired me to pursue an independent project in the laboratory.
I would also like to thank Dr. Kurt Haas and Dr. Brian Christie for their roles as members of my supervisory and examining committees, and Dr. Hakima Moukhles for her contribution as a member of my examining committee. I wish to thank Kun Huang, Dr. Rujun Kang and Dr.
Dove Keith for their assistance at various times during this project; and lastly, the graduate students and staff in the Department of Neuroscience for the most enjoyable two years.
vii INTRODUCTION
1. Structure of a synapse
The efficient functioning of the vertebrate nervous system relies on accurate and coordinated information exchange between neurons. The most prominent type of cell-cell contact through which the flow of information occurs in the nervous system is a chemical synapse - a specialized asymmetric junction formed between a neuron and its postsynaptic target, that could be another neuron, muscle cell or endocrine cell (Waites et al., 2005). A synapse is composed of several compartments that include (A) The presynaptic terminal containing neurotransmitter vesicles and the active zone - a presynaptic protein network that regulates vesicle release; (B)
The synaptic cleft, a small space between the cells that contains extracellular matrix proteins capable of modulating and stabilizing the synapse; and (C) The postsynaptic site composed of a dense mesh work of proteins that function to receive and process the information (Palay, 1956;
Sheng, 2001; Garner et al., 2002). Due to the complexity of synaptic structure, precise coordination of accumulation of pre- and postsynaptic molecules is required in order to support such complex mechanism of information exchange at a specific location.
1 2. Neuromuscular junction formation
Early studies on the neuromuscular junction (NMJ) have provided many clues on the principles governing synapse formation and maturation. The contact formed between a motoneuron and the myotube is large, readily accessible and is relatively simple (Sanes and
Lichtman, 2001), which made NMJ a favorite substrate to study synapse assembly and development. A model of reciprocal induction has been adopted to describe the mechanism of
NMJ formation and maturation (Goda and Davis, 2003), whereby signals between the axon and myotube lead to a positive feed-back loop resulting in the formation and the maturation of the synapse.
2a. NMJ pre-patterning
Before the axon of a motoneuron reaches the muscle, clusters of acetylcholine receptors
(AChRs) are detected in the central regions on the surface of the myofibers, a phenomenon called pre-patterning (Yang et al., 2000; Lin et al., 2001; Yang et al., 2001) that requires activation of muscle-specific receptor tyrosine kinase (MuSK) (Lin et al., 2001; Yang et al.,
2001). The pre-patterned AChR clusters form the preferred site of initial contact, however, they are not required for synaptogenesis to occur (Panzer et al, 2006). Thus, further analysis of the proteins present at the site of pre-patterned Ach receptors would help establish important players that determine the site of contact initiation.
2 2b. AChR clustering and transcription Following the arrival of the motoneuron, two important signaling pathways ensure firstly, the clustering of AChRs directly opposite the presynaptic terminal, and secondly, the subsequent local induction of transcription of AChR subunits. Agrin, a synaptic basal lamina protein, is released from the nerve terminal and enhances clustering of AChRs (Nitkin et al., 1987). Agrin trapped in the basal lamina helps to further stabilize AChR clusters through triggering activation of MuSK; however, the molecular basis of this activation remains unknown, since MuSK does not bind agrin directly (DeChiara et al., 1996; Witzemann, 2006). MuSK is a critical molecule in proper NMJ formation, since AChR clusters fail to form at all stages of development in knock out mice (DeChiara et al., 1996). One of downstream effectors of MuSK that directly modulates
AChR clustering is rapsyn (receptor associated protein of the synapse), a scaffolding protein that contains domains enabling association with the membrane, multimerization and for interaction with AChRs (Musil et al., 1989). While binding to the membrane, it tightly associates with
AChRs, which promotes receptor clustering and stabilization at the synapse (Froehner, 1993).
Although it is unclear how agrin-mediated MuSK activation leads to the recruitment of rapsyn to synaptic sites, it has been found to rely on increased association between a- and (3-catenins, thus linking rapsyn-AChR complex to the underlying actin cytoskeleton (Zhang et al., 2007). Further work is necessary to identify proteins involved in agrin-induced AChRs clustering to unravel the mechanism of initial stages of NMJ formation.
The second signaling pathway ensures the subsequent local induction of transcription of
ACh receptor subunits in the muscle nuclei adjacent to the site of synapse (Merlie and Sanes,
1985; Duclert and Changeux, 1995). Search for molecules capable inducing ACh receptor transcription level resulted in isolation of the protein called acetylcholine-receptor inducing
3 activity (ARIA) (Usdin and Fischbach, 1986), also known as neuregulin-1 (NRG1) (Falls et al.,
1993). Homozygous NRG1 knock out mice die at E10.5 due to abnormalities in heart development, thus complicating evaluation of the role of NRG1 in NMJ development (Meyer and Birchmeier, 1995; Kramer et al., 1996). However, heterozygous NRG1 knock out mice display a 50% reduction of the ACh receptor mRNA, as well as reduced density of ACh receptors at postsynaptic endplates (Sandrock et al., 1997), which supports a role for NRG1 in regulation of ACh receptor transcription.
NRG1 activates the epidermal growth factor (EGF) family of receptor tyrosine kinases, including ErbB2, ErbB3, and ErbB4, all of which are expressed in the muscle. In vitro studies indicated that ErbB receptor activation leads to the regulation of the transcription of AChR subunits through the phophatidyl inositol-3 kinase (PI3K) and Ras/MAP (mitogen activated protein) kinase pathways (Si et al, 1996; Tansey et al., 1996; Altiok et al., 1997). However,
NRG1 is not solely a neuron-derived factor; it is also expressed in the muscle cells, and therefore, could act in cis. It was demonstrated that agrin induces clustering of NRG1 and ErbB receptors at the end plate and regulates AChR transcription in a ErbB2-dependent mechanism
(Meier et al., 1998). Moreover, targeted disruption of ErbB2 and ErbB4 in the muscle cells has only mild effects on NMJ formation (Escher et al., 2005), suggesting that although NRG1 signaling modulates the expression of AChR in muscle, it is dispensable for NMJ formation and maintenance.
4 2c. Presynaptic maturation
Following contact initiation, both pre- and postsynaptic compartments of NMJ continue to develop to acquire characteristics necessary for efficient information transfer between the cells. Postsynaptic differentiation of NMJ is important in inducing presynaptic maturation, as motoneuron terminals fail to develop the presynaptic machinery for neurotransmitter vesicle release and spread erroneous collateral branches over the muscle surface in agrin or MuSK knock out mice that lack clustered ACh receptors (DeChiara et al, 1996; Gautam et al., 1996).
Laminin has been identified as one of the molecules that is involved in modulating presynaptic differentiation and assembly of the apparatus necessary for ACh release (Noakes et al., 1995).
Knock out mice of (32 laminin display compromised presynaptic differentiation, while oc4 laminin knock outs contain pre- and postsynaptic specializations that are frequently misaligned.
Futhermore, it was found that a4 laminin directly interacts with presynaptic Ca2+ channels, and thus, is thought to act trans-synaptically to mediate precise alignment of the presynaptic terminal and the postsynaptic endplate (Sunderland et al., 2000; Patton et al., 2001). Thus, laminins, as well as other proteins of the basal lamina, are likely candidates in mediating maturation of the presynaptic compartment following postsynaptic differentiation.
5 3. Principles of glutamateric synapse formation in central nervous system
Central nervous system (CNS) synapses are morphologically different from the NMJ in a number of different aspects: the axon terminal usually presents a dilation of the axon itself, that forms multiple en passant synapses with numerous cells; the synaptic cleft is significantly smaller and lacks basal lamina; moreover, the CNS synapses comprise a heterogeneous set of neuron-neuron contacts that utilize different molecules to mediate intercellular communication, which dramatically complicates the study of synapse formation in the CNS. Despite the heterogeneity of CNS synapses, as well as different molecular players involved, the major principles governing synapse formation could be adopted from the model of reciprocal induction developed from studies on the NMJ.
Synapses in the CNS are formed and modified throughout the development of the organism, as well as in the adulthood, through a series of phases: target recognition and contact initiation, recruitment of presynaptic and postsynaptic molecules, synapse maturation or elimination, and synaptic plasticity (Figure 1) (Waites et al., 2005). Most work has focused on the formation of excitatory synapses, namely glutamatergic synapses, since they are the most abundant type of synapse. Each stage requires a coordinated action of a number of molecules to enable successful formation of a functional synapse. The following sections oudine the key events and players involved in each stage of synapse formation and maturation.
6 1. Target Selection and Initial Contact 2. Contact Stabilization
3. Recruitment of Presynaptic and 4. Maturation and Postsyanptic proteins Spine Morphogenesis
Figure 1. Stages of CNS synaptogenesis. Upon target recognition and initial contact (1), the connection is stabilized via cis and trans clustering of cell adhesion molecules, such as N-cadherins (2). The next stage involves recruitment of presynaptic and postsynaptic proteins that further stabilize the connection (3), and trigger accumulation of ion channels and signaling proteins to form a functional glutamatergic synapse (4).
7 3a. Establishing the contact
A remarkable phenomenon in nervous system development is the ability of a specific axon from a particular brain region to find its respective target and establish the correct connection that will enables successful functioning of the organism. Two conceivable mechanisms exist to ensure the specificity of synapse formation. First mechanism may rely on the intrinsic developmental programs that would regulate neuronal growth and development and would delay synaptogenic competency until the right target is reached. However, very little progress has been made in identifying these factors, referred to as "priming molecules", despite the apparent simplicity of the concept. Alternatively, neurons may rely on a target-centered mechanism, using cues and signals at key decision points released by the target neuron, to ensure establishment of the correct contact. These factors are conventionally referred to as "inducing molecules", and a number of molecules that act in this fashion have been identified. Guiding molecules, such as netrins, semaphorins, and ephrins, have been shown to participate in guiding the axon to the appropriate target (Waites et al., 2005), while diffusible proteins, such as Wnt and fibroblast growth factor (FGF) families, and brain-derived neurotrophic factor (BDNF), have been shown to regulate axon and dendrite branching and prime synapse formation (Waites et al.,
2005). The main goal of these factors is to initiate programs of neuronal maturation that would enable them to proceed with synapse formation.
8 3b. Contact stabilization
The stabilization of axonal and dendritic contacts is believed to occur through physical protein-protein interactions between a large class of cell adhesion molecules (CAMs) found on the surface of both cells. This chemoaffinity hypothesis, first postulated by Sperry (1963), suggests that different cells express a different subset of CAMs, and only contacts between cells expressing a complimentary set of CAMs will become stabilized (Sperry, 1963). The function of
CAMs is not exclusively structural, since they also modulate synapse formation and function through signaling cascades and multiple secondary protein-protein interactions (Dalva et al.,
2007).
Recent studies have implicated members of the cadherin family in mediating target recognition and the initial stabilization of synapses (Shapiro and Colman, 1999). Neuronal (N) cadherins are single-pass transmembrane proteins localized on both pre- and postsynaptic terminals (Fannon and Colman, 1996) and interact with a-, (3-, and pl20-catenins that link N- cadherins to the actin cytoskeleton (Jou et al., 1995). N-cadherin and [3-catenin are diffusely distributed along the filopodia, but upon contact, they are rapidly concentrated at the point of contact (Togashi et al., 2002; Jontes et al., 2004). Cadherins form cw-dimers through homophylic interactions that in turn associate with ds-dimers on the opposite site of the synapse to form a strong intercellular connection (Shan et al., 2000). Perturbation of N-cadherin function results in disruption of clustering of presynaptic, as well as postsynaptic proteins, indicating that intact cadherin interaction is critical in synapse formation (Togashi et al., 2002).
Through its association with a-amino-3-hydroxy-5-methylisoxazole-4-propionic acid
(AMPA)-type glutamate receptors via P-catenin, N-cadherin regulates trafficking of glutamate
9 receptors (Nuriya and Huganir, 2006). Presynaptically, (3-catenin functions to link cadherin- catenin complexes to the actin cytoskeleton, while at the same time controlling the number of presynaptic vesicle pool through its PDZ binding domain (Bamji et al., 2003). Disrupting the
PDZ binding motif of (3-catenin results in dispersion of the presynaptic proteins away from the cadherin clusters (Bamji et al., 2003). These findings support the active role for cadherins and catenins in stabilization of contacts and modulation of synapse formation, they do not however induce synaptogenesis (Sara et al., 2005).
3c. Recruitment of presynaptic and postsynaptic proteins
The recruitment of the appropriate neurotransmitter on the presynaptic side and their cognate receptors on the postsynaptic side occurs with high fidelity, since mismatches are seldom observed. Much work has focused on determination of the order of recruitment of molecules to the synapse; however, consensus on the hierarchal recruitment of each protein remains elusive. The recruitment of synaptic proteins can occur through the addition of protein packets or by the gradual accumulation of individual proteins (Waites et al., 2005). Several proteins have been implicated in inducing the recruitment of proteins to contact sites; however, only a few have been shown to be sufficient. Several of these protein families are discussed below.
3c.i NARP
The recruitment of neurotransmitter receptors by several factors has been documented, and neuronal activity-regulated pentraxin (NARP) was the first molecule that was shown to induce protein recruitment by enhancing the clustering of AMPA receptors through direct
10 association (O'Brien et al, 1999; O'Brien et al., 2002). While NARP has also been shown to promote clustering of N-methyl-D-aspartate (NMDA) type receptors, this activity was restricted to glutamatergic synapses formed on inhibitory interneurons (Mi et al., 2002).
3c.ii EphrinB
Another molecule that is capable recruiting glutamate receptors is ephrinB, a receptor tyrosine kinase that belongs to the family of ephrin axonal growth cone guidance molecules. The extracellular domain of ephrinB receptor - EphB - interacts with the NMDA type of glutamate receptors, and aggregation of EphB receptors by ephrinB ligand causes co-accumulation of
NMDA and AMPA receptors, the latter through the PDZ-dependent interaction, but surprisingly not other postsynaptic proteins, such as PSD-95 (Dalva et al., 2000; Henkemeyer et al., 2003;
Kayser et al., 2006). Even though ephrinB induces presynaptic terminal induction when expressed in HEK293 cells co-cultured with neurons, it appears that additional neuronal signals are necessary to complete the formation of a fully functional synapse.
3c.iii Neuroligins and neurexins
NARP and ephrinB synaptogenic activity seems to be limited to a certain degree, either selectively affecting glutamatergic synapse formation in a subset of cells, or exclusively regulating clustering of glutamate receptors. However, a number of molecules are capable of inducing fully functional synapses. The mechanism of induction of synapse maturation mediated through neurexin-neuroligin heterophylic trans-synaptic interaction is so far the best understood.
In vitro studies indicated that the number and the size of synapses formed in cells with altered expression level of neuroligins directly correlate with the amount of protein present in the cell
11 (Graf et al., 2004; Prange et al., 2004; Chih et al., 2005; Levinson et al., 2005). Moreover, expression of neuroligin in heterologous cells induces functional presynaptic differentiation in contacting axons (Scheiffele et al., 2000), while in a similar experimental paradigm, expression of neurexin induces clustering of postsynaptic proteins (Graf et al., 2004; Nam and Chen, 2005;
Chih et al., 2006). Interestingly, different isoforms of neuroligin induce formation of different types of synapses: while neuroligin 1 and 3 mediate excitatory synapse formation, neuroligin 2 is involved in inhibitory synaptogenesis (Graf et al., 2004; Chih et al., 2005).
Neuroligins contain a PDZ (PSD-95/Dlg/ZO) binding motif that enables them to interact with the scaffolding proteins at the postsynaptic site, such as PSD-95, which dictate the distribution of neuroligins to the excitatory and inhibitory contacts (Prange et al., 2004; Levinson et al., 2005). Disruption of normal neuroligin-PSD-95 interaction results in formation of an altered ratio of excitatory to inhibitory (E/I) contacts, which has a direct effect on neuronal excitability (Prange et al., 2004; Levinson et al., 2005). Neurexins also contain a PDZ binding motif that enables them to interact with the presynaptic scaffolding molecules calcium/calmodulin-dependent serine protein kinase (CASK) and Muncl8 interacting protein
(MINT) that links neurexins to the machinery regulating synaptic vesicle exocytosis (Hata et al.,
1996; Biederer and Sudhof, 2000). However, recent data on neuroligin knock out mice suggests that synaptogenic activity of these CAMs is not essential to trigger synapse formation in vivo, but rather they are more important at later stages of excitatory and inhibitory synapse development (Varoqueaux et al., 2006).
12 3c.iv SvnCAM
SynCAM (or synaptic CAM) is another molecule capable of inducing functional presynaptic terminal formation in axons contacting nonneuronal cells expressing this protein
(Biederer et al., 2002). It belongs to the Ig superfamily of proteins and is capable of coordinating pre- and postsynaptic alignment through homophilic calcium-dependent interactions (Biederer et al., 2002). Overexpression of SynCAM in neurons results in enhanced synapse formation, while disruption of protein-protein interactions of SynCAM and neurexins results in aberrant presynaptic differentiation (Biederer et al., 2002).
Among these cell adhesion molecules, many appear to have redundant functions in regulating glutamatergic synapse formation. Thus, they may be acting in parallel, modulating and finetuning the composition of individual synapses to ensure each cell receives a variety of synaptic input. Future studies aiming to delineate specific functions of these molecules will refine our understanding of the role each protein plays in synaptogenesis.
3d. Maturation and Spine Morphogenesis
Following the establishment of a contact, a number of other proteins are recruited to the site of synapse to ensure efficient information transfer between cells via the synapse. Some of these proteins further modulate synapse maturation and plasticity. In hippocampus, ephrinB localizes to synapses during CNS development, thus suggesting a role in synaptogenesis and spine formation (Torres et al., 1998; Buchert et al., 1999).Through activation of downstream signaling pathways, ephrinB controls spine morphogenesis via activation of the Rho GTPases
(Ethell et al., 2001). In addition to cell adhesion molecules, scaffolding molecules aid in the formation and organization of synapses. Specific scaffolding molecules are enriched at particular
13 synaptic sites, such as PSD-95 at glutamatergic synapses and gephyrin at GABAergic synapses, and thus help dictating the specificity of molecules retained at the synapse. Scaffolding molecules are involved in ion channel clustering, recruitment and retention of adhesion molecules, and signaling at the synapse (Gerrow and El-Husseini, 2006).
One of the proteins found enriched at glutamatergic synapses is PSD-95 - a scaffolding molecule that belongs to the family of proteins containing PDZ domains, which interact with the
PDZ-binding motives of other proteins and influencing their trafficking, stabilization at a particular location and sometimes function. PSD-95, just like in the case of CAMs, besides from serving as a molecular scaffolding molecule stabilizing proteins at the excitatory postsynaptic compartment, can direcdy influence synapse maturation and function. Overexpression of PSD-95 results in enhanced clustering of AMPA receptors that also corresponds to enhanced maturation of the presynaptic terminal (El-Husseini et al., 2000). This process is thought to be mediated through a corresponding accumulation of CAM neuroligin, that could mediate presynaptic maturation through its interaction with neurexins (Prange et al., 2004). In contrast, decreasing the endogenous levels of PSD-95 reduced the number of excitatory synapses formed (Prange et al.,
2004). Moreover, the direct interaction of PSD-95 with the inward rectifier K+ channels (Kir2.3) alters the conductance properties of the channel (Nehring et al., 2000), while its interaction with
NMDA receptors regulates the rate of endocytosis (Roche et al., 2001).
14 4. Neuregulin ligands and ErbB receptorsin the CNS
While CNS synapses use a variety of molecules to guide contact formation and maturation, some of the major players involved in NMJ formation have found their own niche in
CNS synaptogenesis. The transmembrane (TM) isoform of Agrin is expressed at high levels in the hippocampus and cortex (O'Connor et al., 1994; Cohen et al., 1997). Knock down of Agrin in
CNS neurons reduces synaptogenesis (Ferreira, 1999; Bose et al., 2000), whereas overexpression of TM-Agrin in hippocampal neurons induces formation of dendritic filopodia (McCroskery et al., 2006). These results suggest the involvement of neuronal agrin in CNS synaptogenesis in addition to regulating NMJ formation. Interestingly, both NRG1 and its receptors ErbB proteins are also expressed in the developing and adult brain, and a lot of effort has been dedicated to unravel function of the NRG 1-ErbB signaling in CNS.
4a. The neuregulin-1 family
4a.i. Neuregulin structure and processing
Neuregulins are a family of four related genes, (nrgl-4), each producing a large number of different isoforms via differential promoter usage and alternative splicing (Buonanno and
Fischbach, 2001). The main characteristic feature of all NRG products is the presence of EGF motif that enables them to bind to and activate EGF family of receptors (ErbB2-4). NRG1 is by far the most studied gene product, and as of today little is known of the physiological properties of NRG2-4 (Buonanno and Fischbach, 2001; Falls, 2003). NRG1 is initially synthesized as a transmembrane protein, that undergoes proteolytic processing, and the extracellular EGF-
15 containing fragment is released to the environment. The remaining intracellular fragment has been shown to translocate into the nucleus where it regulates survival of neurons, as well as transcription of PSD-95 (Bao et al., 2003; Bao et al., 2004). Proteolytic processing of NRG1 is regulated by neuronal activity and by interaction with the receptors of ErbB proteins (Bao et al.,
2003;Ozaki etal., 2004).
4a.ii. Distribution and function of neuregulins at the CNS synapses
NRG1 is widely expressed throughout development and adulthood, with the highest expression in nervous tissue (Corfas et al., 1995), and is essential for organism survival, as mice with targeted disruption of this gene do not survive past E10.5 and display gross abnormalities in heart and nervous system development. Initially identified as a factor inducing the AChR subunit transcription in NMJ, it was later found to have a variety of other physiological actions in the peripheral nervous system. For instance, the immunoglobulin (Ig) containing isoform of NRG1 is necessary and sufficient to induce muscle spindle differentiation during normal muscle development (Hippenmeyer et al., 2002).
In the central neurvous system, NRG1 is also required for differentiation, migration and development of neurons and glia, as well as for axonal myelination and pathfinding, dendritic development and neurotransmitter receptor maintenance. During development, NRGl-ErbB signaling mediates radial glia maintenance and elongation, while glial-derived NRG1 directs the migration of cortical and cerebellar neurons (Anton et al., 1997; Rio et al., 1997). Moreover,
NRGl-ErbB4 signaling is required to direct axons of thalamo-cortical projections to their targets
(Lopez-Bendito et al., 2006). In the brain and spinal cord, NRG1 regulates oligodendrocyte
16 differentiation, and in spinal cord explants from NRGl'" mice oligodendrocytes fail to develop
(Canoll et al., 1996; Vartanian et al, 1999; Calaora et al., 2001).
Similar to its role at the NMJ, NRG1 has been shown to regulate transcription of the neurotransmitter receptor subunits. In cerebellar granule cells, NRG1 up-regulates transcription of NR2C subunit in an NMDA receptor activity-dependent manner (Ozaki et al., 1997). The
effects of NRG1 application on the transcription of subunits of GABAA receptors are region specific: while in cerebellum NRG1 specifically enhances mRNA and protein levels of (32 subunit, resulting in up-regulation of GAB A mediated currents (Rieff et al., 1999), in hippocampus NRG1 treatment resulted in reduction of expression and protein levels of a subunits accompanied by a corresponding reduction of miniature inhibitory post synaptic currents (mlPSCs) (Okada and Corfas, 2004). Finally, NRG1 treatment of dissociated hippocampal neurons increases surface expression of the a7-containing nicotinic (n) AChRs specifically in inhibitory neurons (Liu et al., 2001). While the mice lacking cystein-rich domain
(CRD) isoform of NRG 1 and that have been rescued from embryonic lethality, die at birth due to lack of functional NMJ; they also show signs of neurodegeneration, and the survival of Schwann cells is severely affected (Wolpowitz et al., 2000).
4b. ErbB receptors
NRG1 signaling is mediated through its receptors - the ErbB family of proteins. There are four members in the ErbB family, named one through four; however, ErbBl specifically binds EGF and does not respond to NRG1. Out of the remaining three members, ErbB2 contains the functional kinase domain, but is unable to bind NRGl, and in fact, has no known ligands
(Klapper et al., 1999). ErbB3, on the other hand, binds NRGl, but is unable to propagate the
17 signal to the cells because of lack of the kinase activity (Guy et al., 1994). Therefore, out of these three members, only ErbB4 is a complete functional receptor that can recognize and bind different NRGs, as well as transmit the signal through the activation of its kinase domain
(Roskoski, 2004).
4b.i. ErbB4 structure
ErbB4 is a single-pass transmembrane protein of approximately 160 kDa with approximately equal extra- and intracellular regions (Plowman et al., 1993; Carpenter, 2003).
The ectodomain of ErbB4 contains two cystein-rich regions (domains II and IV), while based on homology with the ErbBl receptor, domain III confers the recognition of the EGF motif
(Carpenter, 2003). The intracellular region of ErbB4 contains the kinase domain, and the last four amino acids of the protein constitute the PDZ binding motif, that enables ErbB4 to interact with the PDZ-domain containing proteins, such as PSD-95 (Garcia et al., 2000; Huang et al.,
2000). Several isoforms of ErbB4 are naturally occurring due to alternative splicing of the gene:
JM-a and JM-b isoforms differ in their sensitivity to the first proteolytic cleavage by TACE
(tumor necrosis factor-alpha converting enzyme) metalloprotease, with only the JM-a isoform subjected to this cleavage (Rio et al., 2000); while the CYT-1 isoform differs from the CYT-2 isoform in that it contains a phosphoinositol-3 kinase (PI3K) binding region (Carpenter, 2003).
While both JM-a and JM-b isoforms are widely expressed in the brain (Elenius et al., 1997),
CYT-2 is specifically absent from the nervous tissue (Elenius et al., 1999). The presence of multiple ErbB4 isoforms and their differential distribution may further contribute to the biological diversity of ErbB4 signaling.
18 Following ligand binding, ErbB4 undergoes double proteolytic processing. The first cleavage is mediated by TACE, a member of the transmembrane ADAM metalloproteases, and releases the 120kDa extracellular fragment into the environment, while leaving the 80 kDa intracellular fragment associated with the membrane. The function of the soluble extracellular fragment is unknown, it does however raise the possibility of reverse signaling (Carpenter,
2003) . The resulting intracellular fragment retains its kinase activity, and in fact, has been shown to act as a constitutive kinase (Linggi et al., 2006) and propagate signaling from the cell surface.
A subsequent proteolytic cleavage mediated by the y-presenilin complex cleaves the receptor within the transmembrane domain and generates a soluble form of ErbB4 that is trafficked into the nucleus where it is capable of regulating gene expression (Ni et al., 2001; Vidal et al., 2005;
Linggi and Carpenter, 2006; Linggi et al., 2006).
4.b.ii. ErbB4 signaling
Upon ligand binding, conformation change in the receptor takes place that induces protein dimerization and subsequent rrans-phosphorylation on tyrosine residues (Roskoski,
2004) . The pattern of phosphorylation confers a recognition sequence for proteins containing Src homology-2 domains (SH2) that associate with the activated receptors and subsequently recruit downstream signaling molecules and adaptor proteins. This ultimately activates mitogen- activated protein kinase (MAPK) pathway (Yarden and Sliwkowski, 2001). Moreover, the two isoforms of ErbB4 present in the brain (CYT-1 and -2) differ in their ability to recruit PI3K and thus activate the Akt-mediated cell survival pathway (Elenius et al., 1999). The two isoforms are also differentially expressed, with the predominating isoform CYT-2 that lacks PI3K binding site expressed in the nervous tissues (Elenius et al., 1999). Interestingly, up-regulation of the
19 expression of the CYT-1 isoform has been reported in the brains of schizophrenia patients (see below) (Law et al, 2007).
4.b.iii ErbB4 distribution and function at the CNS synapses
In central nervous system hybridization analysis detected ErbB4 immunoreactivity in the cortex, cerebellum and hippocampus. In adult and developing cortex and hippocampus, ErbB4 expression appears to be restricted to a subset of inhibitory GABAergic neurons (interneurons)
(Yau et al., 2003; Flames et al., 2004; Fox and Kornblum, 2005), as confirmed by immunocytochemical co-localization with a number of markers for inhibitory neurons.
Moreover, NRG1 has been shown to act as a permissive factor and as a chemoattractant for
ErbB4-expressing progenitors of GABAergic cortical interneurons (Flames et al., 2004). Studies on dissociated hippocampal cultures indicated that the restricted ErbB4 expression pattern remains intact, and ErbB4 immunostaining is exclusively detected in neurons positive for
GAD65 - a marker for GABAergic inhibitory neurons (Huang et al., 2000).
On the subcellular level, ErbB4 exhibits punctate staining restricted to dendrites (Huang et al., 2000). ErbB4 clusters co-localize with a number of markers for excitatory synapses, including NR1 subunit of NMD A receptors and PSD-95. Cellular fractionation studies confirmed
ErbB4 presence in the postsynaptic density fraction (Garcia et al., 2000). Interaction of ErbB4 with the PDZ-domain containing proteins has been established in vitro and in vivo. Yeast-two hybrid studies determined that ErbB4 interacts with PSD-95, PSD-95, SAP102 and (32-syntropin, proteins all enriched at the postsynaptic density and co-immunoprecipitate together with ErbB4
(Garcia et al., 2000; Huang et al., 2000; Huang et al., 2002). ErbB4 interacts with the first and second PDZ domains of PSD-95, therefore, PSD-95 can potentially interact with two ErbB4
20 molecules at the same time, thus facilitating NRGl signaling (Garcia et al., 2000; Huang et al.,
2000). Interestingly, the interaction between ErbB4 and PSD-95 is regulated by neuronal activity (Xie et al., 2007), and the increased interaction between these proteins is detected in brain lysates from schizophrenia patients (Hahn et al., 2006). Moreover, previous findings showed that ErbB-receptor mediated NRGl signaling modulates NMDAR function (Gu et al.,
2005), indicating that NMDA receptors constitute the immediate target of NRGl-ErbB4 signaling. At the synapse, ErbB4 also interacts with and regulates activation of two non-receptor protein kinases Fyn and pyk2 (proline-rich tyrosine kinase 2) that have been implicated to regulate NMDAR phosphorylation and LTP induction (Bjarnadottir et al., 2007).
21 5. Potential disfunctioning of NRGl-ErbB4 signaling in mental illness
Both NRGl and ErbB4 receptor have been recently associated with the development of schizophrenia. The initial finding that established a linkage of the NRGl gene with schizophrenia in Icelandic population (Stefansson et al., 2002), was later confirmed in other populations (Harrison and Law, 2006). As of today, NRGl is the number one candidate gene for the susceptibility to schizophrenia. However, no alterations within the coding sequence of the gene have been reported that would alter NRGl function. Rather, the expression pattern of
NRGl may be affected in schizophrenia patients, since a consistent polymorphism upstream of the gene in the regulatory region has been observed (Law et al., 2006). Consistent with this finding, a number of researchers observed altered expression pattern of NRGl isoforms
(Hashimoto et al., 2004; Petryshen et al., 2005; Law et al., 2006). Single nucleotide polymorphisms in the ErbB4 gene have also been associated with the schizophrenia phenotype
(Nicodemus et al., 2006; Silberberg et al., 2006; Law et al, 2007). Similar to NRGl, genetic differences lie outside of the coding sequence, and these intronic variations could influence alternative splicing of ErbB4, a finding consistent with the analysis of ErbB4 isoform distribution in schizophrenia patients (Law et al., 2007). How the altered NRGl-ErbB4 signaling could result in symptoms associated with schizophrenia disorders, still remains elusive however.
22 Thesis objectives:
NRG1 signaling through its receptor ErbB4 is important for normal CNS development and function, and this signaling mediates a variety of biological functions that affect CNS neuron physiology. The exact role of ErbB4 at the CNS synapse is still elusive. The following study aims to (A) delineate the role of ErbB4 signaling in neuronal development and synaptogenesis via manipulating the levels of ErbB4 expression, as well as (B) define the effects of NRG1 stimulation of developing hippocampal neurons expressing exogenous ErbB4.
A.l: Examine the effects of ErbB4 overexpression in dissociated hippocampal neurons
on the size and the number of presynaptic terminals formed onto the overexpressing cell
A.2: Determine whether ErbB4 is sufficient to induce presynaptic differentiation in the
mixed culture assay
A.3: Determine whether ErbB4 overexpression causes a corresponding enhanced
clustering of the postsynaptic scaffolding protein PSD-95, a binding partner of ErbB4
A. 4: Determine ErbB4 protein domains that are important for modulation of synaptic
maturation
B. l: Characterize the effects of NRG1 stimulation on cells expressing endogenous or
exogenous ErbB4
B.2: Determine ErbB4 protein domains that are important for changes observed upon
NRG1 stimulation in cells overexpressing ErbB4
Taken together, this study aims to characterize new roles of NRGl-ErbB4 signaling in developing hippocampal GABAergic interneurons.
23 MATERIALS AND METHODS
cDNA cloning and mutagenesis
The original full-length ErbB4 (JM-a, CYT-1 isoform) cDNA construct was a generous gift from Dr. Lin Mei (Medical College of Georgia, Augusta, GA and Southern Medical
University, China). The hemmagluttinin (HA) tag (YPYDVPDYA) was inserted into the sequence at the position equivalent to the amino acid 997 (generated by Alicia Davis). The hemagglutinin (HA)-tagged wild type NLG1 (lab splice variant) amplified from mouse cerebellum was a gift from Dr. Peter Scheiffele (Columbia University). GFP transfections were carried out using pEGFP-Cl plasmid (Clontech).
The generation of the ErbB4ACT, ErbB4ANT, and ErbB4APDZ was carried out by PCR subcloning in two steps. First, a construct that contains ErbB4 signal sequence followed by the
HA tag (ErbB4-ss-HA) was generated by PCR using oligonucleotides containing Aflll and Xbal restriction sites (GGGCCCCTTAAGCGATCGGCCACCATGAAGCCGGCGACAGGACTTTG
G and GGGCCCTCTAGACTATCTAGGTACCGCGGCCGCTAGCGTAATCTGGAACATC
GTATGGGTAGATATCAGAATCGCTGGGCTGGAC) and subcloning the resulting fragment into the pCDNA3.1(+) vector (Invitrogen). Second, the generation of the deletion mutants was carried out by PCR using oligonucleotides with the following restriction sites: ErbB4ACT -
Notl/Kpnl, ErbB4ANT - Notl/Xbal (ErbB4ACT, GGACTCGCGGCCGCCAGTCAGTGTGTG
CAGGAACG and CTCCTTC AGGT ACCC A A AT AC; ErbB4ANT, GGACTCGCGGCCGCCA
TTCCACTT TACCACAACATG and GGGCCCTCTAGATTACACCACAGTATTCCG) and subcloning amplified fragments into the ErbB4-ss-HA construct. Finally, ErbB4APDZ construct was made through amplification of the intracellular region of ErbB4 using oligonucleotides
24 containing Kpnl and Xbal restriction sites (GTATTTGGGTACCTGAAGGAG and
GGGCCCTCTAGATTACCGGTGTCTGTAAGGTGG) and subcloning the resulting fragment into the ErbB4ACT construct, in this way restoring the full sequence of ErbB4 lacking only the last four amino acids. A single point mutation in the ErbB4 kinase domain (K751R) was introduced using the Quick-change site-directed mutagenesis kit (Stratagene). Briefly, the entire plasmid has been amplified by PCR using oligonucleotides containing one base substitution
(AAG->AGG) (GTGAAGATTCCTGTGGCTATTAGGATTCTTAATGAGACAACTGG), the template methylated strand was destroyed enzymatically with Dpnl, purified construct was transformed into bacteria, and verified by direct sequencing.
All constructs were subject to DNA restriction analysis to ensure that correct size DNA fragments were introduced, and western blot analysis to verify expression of the protein. All constructs expressed well in heterologous cells, as analyzed by western blotting, and formed single bands of expected molecular weight upon separation on SDS-PAGE and visualized using anti-HA antibodies. All constructs have been sequenced in their entirety.
Cell culture and mixed culture assay
Dissociated primary neuronal cultures were prepared from hippocampi of embryonic day
18/19 Wistar rats. Cells were dissociated by papain digestion followed by brief mechanical trituration, and plated on the poly-D(or L)-Lysine (Sigma) treated coverslips at a density of 105 per 8 mm glass coverslip into the Mimimal Essential Medium (GIBCO) supplemented with 10% fetal bovine serum (FBS) (Hyclone), glucose (Sigma), sodium pyruvate, GlutaMAX, and penicillin/streptomycin (GIBCO). After 2 hours, the medium was replaced with the NeuroBasal mediuim (GIBCO-Invitrogen) supplemented with B-27, GlutaMAX, penicillin and streptomycin
25 (GIBCO) as previously described (Brewer et al., 1993). Every 3-4 days, half of the volume of maintenance medium was taken out and replaced with fresh solution. Cultures were transfected by lipid-mediated gene transfer using Lipofectamine 2000 agent following manufacturer's protocol (Invitrogen), or by calcium-phosphate technique (Clontech), as previously described
(Jiang et al., 2004), at least 4 days prior to immunostaining.
COS7 cells were grown in Dulbecco's Modified Eagle's Medium (DMEM) (GEBCO-
Invitrogen) supplemented with 10% fetal bovine serum (Hyclone), sodium pyruvate and penicillin/streptomycin (GIBCO-Invitrogen). For protein expression, cells were treansfected with
Lipofectamine 2000 reagent (Invitrogen) and collected/fixed 24-36 hours later. For fibroblast- neurons cocultures, COS7 cells were transfected with Lipofectamine 2000 (Invitrogen) and trypsinized 24 hours later. Cells were washed twice with FBS supplemented DMEM, resuspended in NeuroBasal medium, and plated onto neurons. Fibroblast cells were allowed to adhere and grow on neurons for 24 hours before fixation.
Immunocytochemistry and reagents
Coverslips were fixed in -20°C methanol for staining for synaptic proteins, or in 4% paraformaldehyde with 4% sucrose (Sigma) and permeablized with 0.3% Triton-X 100 in phosphate-buffered saline. The following primary antibody solutions were used: HA (mouse,
1:1000, BABCO and rat, 1:1000, Roche), GFP (chicken, 1:1000, Abeam), Synaptophysin
(mouse, 1:1000, Sigma and rabbit, 1:500, Pharmigen), VGLUT1 (rabbit, 1:1000, Synaptic
Systems), VGAT (rabbit, 1:1000, Synaptic Systems), PSD-95 (mouse 1:500,
AffinityBioReagents and rabbit, custom made by AffinityBioReagents), ErbB4 (mouse, 1:200,
NeoMarkers and rabbit, 1:200, Santa Cruz), MAP2 (mouse, 1:500, BD Pharmingen), p-Tyr
(mouse, Cell Signaling). Secondary antibodies were generated in goat and conjugated with Alexa
26 488 (1:1000) and Alexa568 (1:1000, Molecular Probes), or AMCA-conjugated (1:100, Jackson
ImmunoResearch). All antibody reactions were performed in blocking solution containing 2%
Normal Goat Serum for 1 hour at room temperature or overnight at 4°C. Human recombinant neuregulin(3l (NRG1) containing EFG motif was purchased from R&D Systems (Minneapolis,
MN, USA), resuspended in PBS with 0.1% bovine serum albumin at concentration of 10p,g/mL, aliquoted and stored at -20°C.
Western Blotting and NRG1 treatment
Transfections were performed using Lipofectamine 2000 reagent (Invitrogen). For
NRG 1-treatment experiments, COS7 cell were starved in serum-free DMEM for 2 hours, treated with lOnM NRG1 for 10 min at 37°C, washed with ice-cold PBS and resuspended in 500p1 of lysis buffer, containing 20 mM HEPES, pH 7.0, 0.5% deoxycholic acid, 0.1% NP-40, 150 mM
NaCI, 2mM EDTA, 10 mM NaF, 2 mM sodium orthovanadate and 0.25 mM phenylmethylsulphonylfluoride, and 1 protease inhibitor tablet/lOmL (Roche Applied Science).
After extracting for 20 min at 4°C, insoluble material was removed by centrifugation at
13,000xg for 15 min at 4°C. Samples were boiled for 3 min upon addition of 4xSDS-PAGE sample buffer containing 10% (3-mercaptoethanol and were analyzed by SDS-PAGE.
Nitrocellulose membranes were blocked in 1% of bovine serum albumin or 5% milk, incubated with the primary antibody solutions overnight at 4°C. Western blot signals were detected with Odyssey machine (Li-Cor) using infrared-conjugated antibodies, as previously described (Swayze et al., 2004), or by ECL (Amersham Biosciences).
27 Imaging and Analysis
Images were acquired on a Zeiss Axiovert M200 motorized microscope with a 63x1.4
NA ACROMAT oil-immersion lens and a monochrome 14 bit Zeiss Axiocam HR charge- coupled camera with 1300x1030 pixels. The exposure time was adjusted per individual experiment to achieve maximal brightness without saturation; for intensity measurement experiments, all pictures were taken at equal exposure for all experimental conditions. To correct for out-of focus areas within the field of view, focal planes (z-) stacks were collected and the maximum intensity projections were compiled. Images were scaled to 16-bits and analyzed in
Northern Eclipse (Empix Imaging Inc., Mississauga, Canada) by using custom written software routines as previously described (Prange et al., 2004). In brief, Images were processed at a constant threshold level (of 32,000 pixel values), and dendrites visualized by immunofluorescence signal were outlined. Only clusters with average pixel values 3 times greater than background pixel values were selected for analysis. The number of dendritic clusters per unit length was measured as a function of dendritic length, and normalized to the contol.
For intensity analyisis, the average background intensity was subtracted from the average intensity of individual punctum and multiplied by the punctum area to obtain integrated intensity value. For colocalization analysis, background-subtracted immunofluorescence clusters for all imaging channels (red, green, and blue) were correlated for overlapping signal. Colocolization was scored if clusters in two channels were overlapping by at least 1 pixel for a postsynaptic and presynaptic protein. Two-tailed Student's T-test was performed to calculate the statistical significance of results between experimental groups.
28 RESULTS
Chapter 1
Effects of ErbB4 on synapse development in hippocampal neurons
1. Characterization of endogenous ErbB4 localization in hippocampal neurons
Previous studies indicated that the receptor tyrosine kinase ErbB4 is expressed in developing and adult brain in a subpopulation of inhibitory GABAergic interneurons (Yau et al.,
2003; Flames et al., 2004; Fox and Kornblum, 2005). Moreover, this restricted pattern of expression is unaltered in the dissociated hippocampal cultures. These studies reveal that ErbB4 is mainly expressed in GAD65-positive GABAergic interneurons (Huang et al., 2000).
Consistent with these previous findings, analysis of ErbB4 staining in hippocampal neurons examined at day in vitro (DIV) 14 showed specific immunostaining in vesicular GABA transporter (VGAT) positive neurons (Figure 2). Thus, ErbB4 expression was exclusive to the
GABAergic interneurons in our hippocampal neurons.
ErbB4 immunostaining was observed mainly in dendrites, as confirmed by co-staining with the dendritic marker microtubule-associated protein 2 (MAP2), and was highly clustered in hippocampal neurons at DIV 14 (Figure 3). Previous studies indicated that ErbB4 is enriched at excitatory synapses and colocalizes with PSD-95, a major scaffolding postsynaptic protein present at glutamatergic synapses (Huang et al., 2000). To determine whether ErbB4 localization was exclusive to excitatory glutamatergic synapses, double labeling of dissociated hippocampal neurons was performed for ErbB4 and markers for glutamatergic excitatory (VGLUT1) and inhibitory GABAergic (VGAT) synapses. Consistent with the previous findings, ErbB4 clusters
29 Figure 2. Distribution of ErbB4 puncta at excitatory and inhibitory synapses. (A, B) Hippocampal neurons were fixed at DIV14, and immunostained for endogenous ErbB4 (green) and presynaptic excitatory VGLUT1 (A) and inhibitory VGAT (B) markers (red). ErbB4 clusters colocalized with both glutamatergic (A) and GABAergic (B) presynaptic puncta (arrows). (B) Perinuclear staining for VGAT indicative for ErbB4-expressing neurons. (C) Percent colocalization of ErbB4 clusters at excitatory and inhibitory synapses. (64±3%) of ErbB4 clusters are found at glutamatergic (VGLUT) synapses, while (15±3%) percent of ErbB4 clusters colocalize with GABAergic (VGAT) synapses (n=7). (D) Percent of excitatory and inhibitory clusters that contain ErbB4. (64±3%) of VGUT clusters contain ErbB4, while only (32+6%) of VGAT puncta colocalize with ErbB4 (n=7). (Scale bars: 10pm, insets: 5pm)
30 A
ErbB4 . >
VGLUT1 » K 0^ U * B
ErbB 4 >
VGAT
D
80
70
60 2 50'
30 H 20 10 0 MAP2
f - i : if ' 0. " : .•• •
;
• V . H -
/ "fl • • L V .
Figure 3. ErbB4 is localized to dendrites in hippocampal neurons. Hippocampal neurons were fixed at DIV 11 and immunostained for endogenous ErbB4 (green) and the dendritic neuronal marker MAP2 (red). ErbB4 immunostaining was only observed in MAP2 positive processes, thus indicating that ErbB4 is localized to dendrites in hippocampal interneurons. (Scale bar: lOpm)
32 were observed opposing the presynaptic VGLUT1 positive puncta (Figure 2). Interestingly, a significant proportion of ErbB4 clusters colocalized with a marker for the inhibitory synapses
VGAT (Figure 2), indicating that ErbB4 is present not only at excitatory, but also at inhibitory synapses.
To quantitatively assess the distribution of ErbB4 at excitatory and inhibitory synapses, the proportion of ErbB4 clusters apposed to VGLUT1 and VGAT was measured. Analysis revealed that most of ErbB4 clusters (64+3%) was localized to excitatory synapses, and a smaller proportion of ErbB4 was found at inhibitory synapses (15+3%). Reciprocally, many but not all of VGLUT1 clusters contain ErbB4 (64+3%), and a small subset of VGAT clusters contain
ErbB4 (32+6%, n=7, Figure 2).
Together these results reveal that ErbB4 is expressed in inhibitory GABAergic hippocampal interneurons and is largely localized at postsynaptic sites. The majority of ErbB4 clusters are present at excitatory synapses, and a proportion of ErbB4 is localized at inhibitory synapses; however, analysis also revealed that not all synapses contain ErbB4.
33 2. Overexpression of ErbB4 results in enhanced maturation of the presynaptic
terminals
ErbB4 is present at postsynapstic sites and has been shown to interact with the PSD-95
(Garcia et al., 2000; Huang et al., 2000), and thus may influence synapse development. To elucidate the role ErbB4 may play in synaptogenesis, we chose to manipulate the levels of expression of this protein in dissociated hippocampal neurons. Previous studies have successfully used this technique to help characterize the function of neuroligins and PSD-95 at the synapse
(El-Husseini et al., 2000; Prange et al., 2004). To determine whether ErbB4 modulates synapse development, dissociated hippocampal neurons were transfected at DIV5-6 with the hemmaglutinin (HA)-tagged construct of full length wild-type ErbB4 and fixed at 4-6 days posttransfection at the age of DIV10-11 at the peak of synaptogenesis. The HA tag was inserted at the amino acid position 997 within the coding sequence of ErbB4 after the tyrosine kinase domain (Figure 11). The position of the HA tag was chosen to minimize the interference with
PDZ dependent interactions (Huang et al., 2000), and to ensure detection of the full-length protein that might undergo proteolytic processing, which results in cleavage of the extracellular domain (Carpenter, 2003).
Staining with the presynaptic marker synaptophysin was used to visualize all presynaptic contacts formed on neurons overexpressing ErbB4. To examine whether ErbB4 modulates synapse maturation, the size and the number per unit length of synapses formed onto the ErbB4- overexpressing neurons were measured and normalized to the control cells transfected with green fluorescent protein (GFP). The analysis revealed that ErbB4 overexpression significantly enhanced the size of the presynaptic terminals (154±6%, n=30, p<0.001, Figure 4) contacting the cell. In contrast, there was no significant change in the number of clusters formed with the
34 Figure 4. ErbB4 induces presynaptic terminal maturation. Hippocampal neurons were transfected with GFP (A) or ErbB4-HA (B) and immunostained for the presynaptic marker synaptophysin (SYN). (C) Summary of changes in presynaptic cluster size in cells overexpressing ErbB4 compared to the GFP expressing cells. ErbB4 significantly enhanced VGLUT1 cluster integrated intensity, compared to GFP. (D) Summary of changes in presynaptic cluster density in cells expressing ErbB4 compared to the GFP-expressing cells. ***, p<0.001 (Scale bars: 10pm, insets: 5pm)
35 36 ErbB4-overexpressing cell. The enhancement of the size, but not the number of synapses indicates that ErbB4 modulates certain aspects of synapse maturation, rather than synapse induction per se.
Since ErbB4 is found at both excitatory and inhibitory contacts, the observed changes could be attributable to enhancement of excitatory or inhibitory synapses, or both. To distinguish between different types of contacts, cultures were stained with VGLUT1 and VGAT (Figure 5 and 6). As before, the size and the number of clusters formed onto the ErbB4-overexpressing cells were measured and normalized to the control cells expressing GFP. ErbB4 overexpression resulted in enhancement of the size of VGLUT1 (170±10%, n=16, p<0.001) and VGAT clusters
(140±10%, n=17, p<0.001). Consistent with synaptophysin data, no significant changes were detected in the number of VGLUT1 and VGAT clusters formed (84±9% and 94±14%, respectively, Figure 5 and 6). Analysis of cells transfected with Neuroligin-1 (NLG1), a potent inducer of the size and number of both VGLUT1 and VGAT (Prange et al., 2004), was used as a positive control to verify the validity of the observed results. Enhancement of the size of
VGLUT1 and VGAT clusters was observed, as well as an increase in the number of clusters formed on NLG1 transfected cells was found to be similar to previously published data (Prange et al., 2004), while the size of synapses formed was comparable between the ErbB4 and NLG1 overexpressing cells. Thus, the enhancement of the size of synaptophysin clusters observed is representative of an enhancement of both VGLUT1 (excitatory) and VGAT (inhibitory) positive presynaptic contacts.
37 Figure 5. ErbB4 induces glutamatergic presynaptic terminal maturation. Hippocampal neurons were transfected with GFP (A), ErbB4-HA (B), or NLG1-HA (C) (green), and immunostained for the glutamatergic presynaptic marker VGLUT1 (red). (D) Summary of changes in presynaptic cluster size in cells overexpressing ErbB4 compared to the GFP expressing cells. ErbB4 and NLG1 significantly enhanced VGLUT1 cluster integrated intensity, compared to GFP. (E) Summary of changes in presynaptic cluster density. NLG1 significandy enhanced the number of VGLUT puncta per unit length, in contrast to ErbB4 that showed no significant change in cluster number, when compared to GFP controls. ***, p<0.001; **, p<0.01 (Scale bars: lOpim, insets: 5p.m)
38 39 Normalized intensity of VGLUT1
i— i— i— i—• i— KJ N*.O\00OM*.C\»O OOOOOOOOOOO
Normalized density of VGLUT1 ,— —' —I > h— t—» OOOOOOOOOOO Figure 6. ErbB4 induces GABAergic presynaptic terminal maturation. Hippocampal neurons were transfected with GFP (A), ErbB4-HA (B), or NLG1-HA (C) (green), and immunostained for the GABAergic presynaptic marker VGAT (red). (D) Summary of changes in presynaptic cluster size in cells overexpressing ErbB4 compared to the GFP expressing cells. ErbB4 and NLG1 significantly enhanced VGAT cluster integrated intensity, compared to GFP. (E) Summary of changes in presynaptic cluster density. NLG1 significantly enhanced the number of VGAT puncta per unit length, in contrast to ErbB4 that showed no significant change in cluster number, when compared to GFP controls. ***, p<0.001; **, p<0.01 (Scale bars: lOpjm, insets: 5p,m)
41 42
3. ErbB4 is insufficient to induce presynaptic terminal formation
The observed ErbB4-induced enhancement of clusters of presynaptic markers could potentially be mediated through two mechanisms: (1) Directiy through a transsynaptic interaction of ErbB4 with its ligand NRG1; or (2) through interactions of ErbB4 with PDZ proteins, such as PSD-95, which can induce recruitment of other cell adhesion molecules that enhance presynaptic terminal maturation (Figure 7).
To determine whether ErbB4 is sufficient to induce formation of presynaptic terminals, we used a mixed culture of primary neurons and heterologous cells (Scheiffele et al., 2000). This technique has been previously used to characterize the direct synaptogenic activity of neuroligins
(Scheiffele et al, 2000; Kim et al., 2006), neurexins (Graf et al., 2004; Graf et al., 2006),
SynCAM (Biederer et al., 2002) and other cell adhesion molecules. Heterologous (COS7) cells expressing ErbB4 or NLG1 were cultured with dissociated hippocampal (DIV8-9) for 24 hours and subsequently analyzed for the presence of induced presynaptic protein clusters. To distinguish between clusters induced by the transfected protein and endogenous clusters that might underlie the transfected COS cell, immunostaining for pre- and postsynaptic markers was used, and absence of immunoreactivity for postsynaptic proteins was characteristic of induced presynaptic clusters. Immunostaining with VGLUT1/PSD-95 and VGAT/Gephyrin antigen combinations was used to assay the induction of the excitatory and inhibitory presynaptic terminals, respectively.
44 Figure 7. Direct versus indirect mechanism of presynaptic enhancement. ErbB4 may be interacting with a transmembrane form of NRGl trans-synaptically. NRGl, in turn, induces maturation of the presynaptic terminal (top panel) ErbB4 may be indirectly inducing presynaptic terminal maturation via its interaction with PSD- 95. Enhanced PSD-95 clustering recruits cell adhesion molecules, such as neuroligin-1 (NLG) that in turn causes recruitment of the presynaptic proteins via its direct interaction with neurexin (NXN).
45 Consistent with previous findings (Scheiffele et al., 2000), NLG1 induced VGLUT1 and
VGAT clustering (Figure 8 and 9). In contrast, COS7 cells expressing ErbB4 failed to induce clustering of either VGLUT1, or VGAT in four independent experiments (Figure 8 and 9). These data suggest that ErbB4 is not sufficient to induce clustering of VGLUT1 and VGAT directly, and that the enhancement of the size of the presynaptic markers observed when ErbB4 is overexpressed in neurons more likely occurs through recruitment of neurons-specific proteins that participate in synapse maturation.
4. Effects of ErbB4 overexpression on PSD-95 distribution
The last three carboxy-terminal amino acids of ErbB4 (-TVV) constitute a PDZ-binding motif that allows ErbB4 to interact with PDZ domain containing proteins (Carpenter, 2003).
Direct interaction between ErbB4 and PSD-95 has been documented to occur in vitro and in vivo
(Garcia et al., 2000; Huang et al., 2000). These results, combined with previous observations showing that PSD-95 overexpression promotes synapse maturation, but not induction of new synapses (El-Husseini et al., 2000), suggest that ErbB4 effects on the enhancement of the size of presynaptic clusters are attributable to enhanced recruitment of PSD-95 at synapse. To test this hypothesis, dissociated hippocampal neurons were transfected with the HA-tagged ErbB4 at
DIV6, and at DIV10 the effects of ErbB4 overexpression on PSD-95 distribution were assessed by immunostaining. Analysis of endogenous PSD-95 clusters formed in neurons overexpressing
ErbB4 revealed a moderate, but significant enhancement in the size of the PSD-95 puncta formed (131±12%, n=ll, p<0.05) when compared to GFP-transfected control (Figure 10).
Therefore, it is plausible that ErbB4 is able to indirecdy enhance presynapstic cluster size via enhancement of PSD-95 at synapses.
46 VGLUT1
Figure 8. Mixed culture assay to study excitatory presynaptic terminal differentiation. NLG1 or ErbB4 were transfected in to COS7 cells and grown with the hippocampal neurons for 24 hours, and immunostainied for NLG1 and ErbB4 (green) and VGLUT1 (red) to determine synaptogenic potential of ErbB4. NLG1 robustly induced glutamatergic presynaptic terminal differentiation, as evidenced by discrete bright VGLUT1 clusters. ErbB4, in contrast, failed to induce excitatory presynaptic terminal differentiation. (Scale bars: 10p.m)
47 Figure 9. Mixed culture assay to study inhibitory presynaptic terminal differentiation. NLG1 or ErbB4 were transfected in to COS7 cells and grown with the hippocampal neurons for 24 hours, and immunostainied for NLG1 and ErbB4 (green) and VGAT (red) to determine synaptogenic potential of ErbB4. NLG1 robustly induced GABAergic presynaptic terminal differentiation, as evidenced by discrete bright VGAT clusters. ErbB4, in contrast, failed to induce excitatory presynaptic terminal differentiation. (Scale bars: 10pm)
4.X Figure 10. ErbB4 induces PSD-95 clustering. Hippocampal neurons were transfected with GFP (A), or ErbB4-HA (B) (green), and immunostained for the PSD-95 (red). (C) Summary of changes in PSD-95 cluster size in cells overexpressing ErbB4 compared to the GFP expressing cells. ErbB4 significantly enhanced PSD-95 cluster integrated intensity, compared to GFP. *, p<0.05 (Scale bars: 10pm, insets: 5pm)
49 160 -i
140 - SL, •— 0 100 ~ c- 80 ~ :en s c 60 ~ Iize d - 40 No t 20 5. Structural determinants of ErbB4-mediated enhancement of presynaptic maturation In order to dissect the domains of ErbB4 that mediate enhancement of presynaptic cluster size, a number of deletion mutant forms of ErbB4 were generated. N-terminal HA tagged constructs were generated that lacked the extracellular (ErbB4ANT), the intracellular domain (ErbB4ACT) domain of ErbB4, and the PDZ binding motif of ErbB4 (ErbB4APDZ) (Figure 11). In addition, ErbB4 with a single point mutation K751R at the ATP binding site was generated, which abolishes the tyrosine kinase activity of ErbB4 (ErbB4K751R) (Figure 11). First, the surface expression of these mutants was examined to determine whether deletion of any of the domains described above interferes with ErbB4 trafficking to cell surface. In order to assess surface expression of these deletion mutants, immunostaining of neurons under non-permeablizing conditions was performed. Constructs were transfected into the dissociated hippocampal neurons at DIV6, fixed lightly with 2% paraformaldehyde four days posttransfection and labeled with the HA antibody in non-permeablizing (without detergent) conditions. Subsequently, neurons were permeablized with detergent, and staining with a different-species HA antibody was used to label proteins inside the cell. MAP2 staining was used to monitor the extent of permebealization. Analysis revealed that all constructs are detectable at the cell surface (Figure 12). 51 ErbB4-HA. JM-a, CYT-2 isoform Cysteine-rich domains 996 I | ss I 1 II 1 III 1 VI TM HA Hi T 1 1 1 Putative ligand- 625 675 713 988 1005 1305 binding site HA-ErbB4 ANT mutant HA TM 640 HA-ErbB4 ACT mutant SS HA I I I II 1 III 1 VI 1 TM 1 739 EibB4-HA APDZb mutant HA I I | II | III I VI I TM 1305 ErbB4-HA K751R mutant K->R I I II I HI I VI 1 TM HA 751 Figure 11. Schematic diagram of deletion mutant forms of ErbB4. 52 Figure 12. Surface labeling of ErbB4ACT, ErbB4ANT and ErbB4APDZ. Hippocampal neurons were transfected with ErbB4ACT (A), ErbB4ANT (B) and ErbB4APDZ (C). Upon light PFA fixation (2%), HA antibody staining was used to visualize surface protein (green). Then the cells were perbeablized with Triton-X 100 (0.03%), and the internal pool of protein was visualized with a different species HA antibody (red). All constructs showed surface labeling. (Scale bar: lO^im) 53 To assess whether these mutants retain a functional basal tyrosine kinase activity, receptor auto-phosphorylation of these constructs was assessed in heterologous cells. For this analysis, constructs were transfected into COS7 cells, separated on SDS-PAGE and probed with anti-HA and anti-phosphotyrosine antibodies to detect total and phosphorylated protein, respectively (Figure 13). Both, full length ErbB4 and ErbB4APDZ demonstrated similar phosphorylation levels (Figure 13), which indicated that deletion of the PDZ binding motif did not compromise kinase activity of ErbB4. However, as expected, ErbB4ACT and ErbB4K751R constructs showed no detectable tyrosine phosphorylation (Figure 13, data not shown). In contrast, ErbB4ANT construct was heavily phosphorylated compared to full-length, even in the absence of NRG1 treatment (Figure 13). The robust phosphorylation of ErbB4ANT is consistent with a previous report showing that deletion of the extracellular domain of ErbB4 results in a constitutively active kinase (Linggi et al., 2006). Among all constructs, the deletion of the PDZ binding motif of ErbB4 dramatically affected protein distribution resulting in apparent non-synaptic localization; however, the protein still formed distinct clusters. To determine whether those clusters were synaptic, the dissociated hippocampal neurons were transfected with the wild-type HA-tagged ErbB4 or ErbB4APDZ at DIV5-6, were fixed and immunostained on DIV14 for the presynaptic marker synaptophysin, as well as the postsynaptic marker PSD-95 (Figure 14). To identify the percent of ErbB4 clusters found at functional synapses, the proportion of ErbB4 clusters present at puncta containing both synaptophysin and PSD-95 was determined. This analysis revealed that virtually none of the clusters formed by the ErbB4APDZ protein colocalized with the puncta containing both synaptophysin and PSD-95 (Figure 14), showing a significant 90% reduction in synaptic localization when compared to the percent of the full-length ErbB4 colocalized with puncta 54 160kDa- IB: HA 120kDa- SOkDa" 160kDa- IB: pTyr 120kDa- SOkDa" Figure 13. Basal phosphorylation level of ErbB4ACT, ErbB4ANT and ErbB4APDZ. ErbB4ACT, ErbB4ANT and ErbB4APDZ proteins were separated on the SDS-PAGE gel.Total protein was visualized with the HA antibody (top panel). Phosphotyrosine antibody (pTyr) (bottom panel) was used to visualize the phosphorylated form of ErbB4. (1) Full length ErbB4- HA showed a level of basal phosphorylation comparable to the ErbB4APDZ (2). ErbB4ANT was heavily phosphorylated (3), while no phosphorylated ErbB4ACT was detected (4). 55 SYN • •• PSD-95 Figure 14. PDZ-binding motif regulates ErbB4 trafficking to the synapse. Hippocampal neurons were transfected with the full length ErbB4 or with the ErbB4APDZ, and immunostained for the presynaptic terminal protein synaptophysin (SYN) and postsynaptic scaffolding protein PSD-95. (A) Full length ErbB4 was highly clustered at synaptic sites, containing both SYN and PSD-95. (B) In contrast, deletion of the PDZ-binding motif dramatically reduced ErbB4 presence at the synapses. 56 containing both PSD-95 and synaptophysin (Figure 14). These results indicate that PDZ-binding motif of ErbB4 regulates trafficking of ErbB4 to the synapse. Next, to determine whether the enhancement of presynaptic cluster size requires the kinase activity of ErbB4, ErbB4K751R was transfected into the DIV5-6 hippocampal neurons, fixed on DrV10-ll and immunostained for the presynaptic marker synaptophysin. The intensity of synaptophysin clusters apposing ErbB4K751R transfected neurons was compared to GFP transfected controls. ErbB4K751R expression enhanced the intensity of synaptophysin puncta to similar levels observed in cells expressing the full length ErbB4 (Figure 15). This analysis revealed that the kinase activity of ErbB4 is not essential for ErbB4-mediated enhancement of presynaptic protein recruitment. Taken together, these results reveal that PDZ-dependent interactions are required for ErbB4 clustering at the synapse, and that the presynaptic terminal maturation is independent of signaling mediated through the kinase domain of ErbB4. 57 bMKTSIR Figure 15. ErbB4K751R induces presynaptic terminal maturation. Hippocampal neurons were transfected with GFP, ErbB4-HA, or ErbB4K751R (A) (green), and immunostained for the presynaptic marker synaptophysin (SYN) (red). (B) Summary of changes in SYN cluster size in cells overexpressing ErbB4-HA and ErbB4K751R compared to the GFP expressing cells. ErbB4K751R significantly enhanced SYN cluster integrated intensity, compared to GFP. ***, p<0.001 (Scale bars: 10pm, insets: 5p,m) 58 Chapter 2 Effects of NRG 1 stimulation on hippocampal neurons 1. NRG1 treatment promotes primary neurite formation in cells overexpressing ErbB4 In order to assess the role of NRG 1-mediated ErbB4 signaling on synapse maturation, dissociated hippocampal neurons transfected with full length ErbB4-HA were treated with lOnM NRG1 for four days and changes in synapse and neuronal morphology, were compared to untreated ErbB4-HA transfected cells. Surprisingly, this treatment resulted in a striking change in neuronal morphology, resulting in a dramatic increase in the number of immature neurite outgrowth mainly extending from the soma. This increase was specific to cells overexpressing ErbB4 and treated with NRG1 (Figure 16) and correlated with a decrease in total number of synapses (data not shown). In contrast, untreated cells transfected with ErbB4-HA frOm matched cultures displayed normal dendritic arborization (Figure 16). Moreover, NRGl-treated neurons expressing GFP had a morphology indistinguishable from untreated cells (Figure 17), thus indicating that the observed effects are specifically mediated by ErbB4 overexpression. The identity of transfected cells was verified by immunostaining with a neuronal marker MAP2, which confirmed that the observed morphological changes were manifested in neurons (Figure 16). 59 Figure 16. Neuregulinl treatment induces primary neurite formation in cells overexpressing ErbB4 Hippocampal neurons were treated with a soluble form of NRGl for four days, and upon fixation, immunostained for ErbB4 (green) and a neuronal marker MAP2 (red). 4 day treatment with NRGl dramatically enhanced the number of primary neurites in neurons (as evidenced by the MAP2 staining) overexpressing ErbB4, compared to untreated controls (26±2 primary neurites, vs 11±1, n=24, p<0.001). 60 Figure 17. One day NRGl treatment dramatically enhances primary neurite formation in cells overexpressing ErbB4. (A) Hippocampal neurons were treated with a soluble form of NRGl for one and three days, and upon fixation, immunostained for HA to visualize transfected cells. One day treatment with NRGl dramatically enhanced the number of primary neurites in neurons overexpressing ErbB4, and the number gradually increases with prolonged treatment. GFP expressing cells were unaffected by this treatment. (B) Summary of enhanced primary neurite formation, light bars - GFP; dark bars - ErbB4-HA. The number of primary neurites in ErbB4-HA overexpressing cells increased from (8.2±0.5), to (22±2) after one day, and to (31±3) after 3 day NRGl treatment; while the number of primary dendrites of GFP cells was (7.3±0.3), (9.4±0.6), and (11±2), respectively.(n=8, ***, p<0.001, Scale bar: 10pm) 61 A 62 To determine the time course for induction of changes in neuronal morphology upon NRG1 treatment, neurons were transfected with GFP or full length ErbB4-HA, treated with lOnM NRG1 for 1 and 3 days, and the number of primary neurites was then assessed. One day post-treatment, a 2.5 fold increase in the number of primary neurites was detectable in ErbB4- HA transfected cells, compared to GFP controls (Figure 17). Furthermore, a gradual increase in the number of primary neurites with prolonged treatment was also observed (Figure 17). These results are consistent with previous findings reporting that ErbB4 activation in pheochromocytoma (PC12) cells promotes neurite formation (Vaskovsky et al., 2000), and induces neurite outgrowth in cerebellar granule cells (Rieff et al., 1999) suggesting the involvement of ErbB4 signaling in neurite formation. Evidence presented here, however, unambiguously indicates the important role for NRGl-ErbB4 signaling in the control of dendritic arborization in developing hippocampal neurons. 2. Endogenous NRGl-mediated primary dendrite formation To establish whether the effects observed in cells expressing ErbB4 in response to NRG1 treatment were not an artifact of overexpression, the effect of NRG1 treatment was studied in hippocampal neurons that express endogenous ErbB4 at DIV4 - a period that correlates with rapid dendritic growth and branching. Dissociated hippocampal neurons were treated with lOnM of NRG1 for two days, fixed at DIV4 and immunostained with MAP2 in order to count primary dendrites, and ErbB4 to distinguish between endogenously expressing cells and non-expressing controls. Consistent with the effects observed in neurons overexpressing endogenous ErbB4, a significant increase in primary neurite formation in cells expressing ErbB4 was observed following NRG1 treatment, compared to ErbB4-negative controls (Figure 18). 63 Figure 18. NRGl treatment of cells expressing ErbB4 endogenously. (A) Hippocampal neurons were treated with NRGl for two days, fixed at DIV4, and immunostained for ErbB4 (green) and MAP2 (red). (B) Summary of the number of primary dendrites, as determined by MAP2 staining. ErbB4-expressing neurons displayed a significant increase in primary dendrite number after NRGl treatment (untreated: (5.8±0.5); treated (7.5±0.5) n=8, p<0.05), while neurons negative for ErbB4 staining showed no significant difference in the number of primary dendrites formed (9±1) with and without NRGl (n=8). (Scale bar: 10pm). 64 65 While previous data has indicated an increase in dendrite formation and branching in all neurons examined (Gerecke et al., 2004), the evidence presented above suggests that the effects of NRG 1 treatment on dendrite formation is restricted to cells endogenously expressing ErbB4. 3. NRG1 stimulated neurite formation requires intact kinase activity of ErbB4 To further characterize ErbB4 domains required for neurite outgrowth, the deletion mutant forms of ErbB4 were used. Interestingly, transfecting the mutant form of ErbB4 lacking the extracellular domain (ErbB4ANT) resulted in a two-fold enhancement in the formation of the primary neurites in the absence of NRG1, compared to full-length ErbB4-FJA used as a control (Figure 19). Since the data within (Chapter 1, Section 5) and previous findings suggest that ErbB4ANT has a constitutive kinase activity (Linggi et al., 2006), the enhanced primary neurite formation observed following NRG1 treatment suggested that downstream ErbB4 signaling upon activation of its tyrosine kinase domain is required for this process. If this was the case, one would predict that expression of the kinase dead mutant of ErbB4 (ErbB4K751R) would fail to induce primary neurite formation upon NRG1 treatment. To address this issue, cultured hippocampal neurons were transfected with the full length ErbB4-HA or ErbB4K751R, and the effects of four-day treatment with lOnM NRG1 were contrasted to untreated controls. As expected, expression of the ErbB4K751R failed to induce primary neurite outgrowth following NRG1 treatment (Figure 20). These results added further support to the notion that activation of downstream signaling pathways mediated by ErbB4 kinase domain are required for the morphological changes observed upon treatment with NRG1. 66 Figure 19. Constitutively active ErbB4 kinase displays an enhanced number of primary neurites Hippocampal neurons were transfected with full length ErbB4-HA or with ErbB4ANT and immunostained with the HA antibody to visualize transfected cells. (A) ErbB4-HA transfected neurons displayed normal morphology, while ErbB4ANT expressing cells displayed increased number of short primary dendrites (B), phenotype resembling that of NRG 1-treated neurons overexpressing ErbB4-HA (C). (D) Summary of the increased number of primary neurites by ErbB4ANT-expressing cells compared to the full length ErbB4-HA in the absence of NRG1, (12±1) versus (7.3±0.6) respectively (n=25, **, p<0.01, Scale bars: 10 um) 67 Figure 20. Kinase activity of ErbB4 is required to induce enhanced number of neurites Hippocampal neurons were transfected with the full length ErbB4-HA or kinase dead ErbB4K751R, treated with NRGl for four days, and immunostained for HA to visualize neurons. (A) Neurons expressing full length ErbB4 displayed an enhanced number of primary neurites following NRGl treatment. The ErbB4K751R-expressing neurons were not affected by the treatment and displayed normal morphology after NRGl treatment (B). (C) Summary of the number of primary neurites formed by neurons expressing full length ErbB4-HA or ErbB4K751R before and after NRGl treatment: ((11±1) vs (27±2), p<0.001), (Q3±l) vs (12±1), n.s.). (Scale bar: 10pm) 68 In conclusion, my work revealed novel important roles for ErbB4 in synapse maturation and process outgrowth. These effects are differentially modulated by PDZ dependent interactions and activation of downstream signaling of ErbB4 that require the tyrosine kinase domain. Prolonged treatment with the NRGl results in dramatic changes in neurite outgrowth in neurons expressing ErbB4. These results suggest that the duration of ErbB4 stimulation by NRGl may modulate different cellular processes that influence synapse maturation and dendritic arborization. 70 DISCUSSION Establishment of functional contacts between neurons is essential for successful information transfer between these cells. This process, which occurs through several steps, initially requires a dynamic neurite outgrowth to allow targets to find each other, which upon contact with the appropriate partner, is followed by recruitment of proteins essential for synaptic functioning. Numerous proteins have been implicated in regulating the formation and maturation of synapses. This study reveals that the receptor tyrosine kinase ErbB4 regulates two different aspects of neuron physiology that affect synapse formation onto inhibitory GABAergic interneurons. Firstiy, ErbB4 modulates synapse maturation by enhancing recruitment of presynaptic vesicle proteins in a PDZ-dependent manner. Secondly, NRGl-mediated kinase signaling increases the number of primary neurites, thus increasing the chances of contact between the axon and the dendrite. Together, these results suggest that NRGl and ErbB4 have a role in the formation and maturation of synaptic contacts, and may in turn, influence how connectivity is established in the vertebrate central nervous system. Endogenous ErbB4 distribution Numerous studies point to a restricted pattern of ErbB4 expression that is exclusive to the inhibitory GABAergic interneurons (Huang et al., 2000; Yau et al, 2003). In accordance with these previous data, we find that in dissociate hippocampal neuron cultures ErbB4 is solely expressed in neurons that were positive for VGAT perinuclear immunostaining, and are thus, inhibitory GABAergic interneurons (Chapter 1, Section 1). In these cultures, GABAergic interneurons constitute only about 10% of all cells; consequently, when transfecting ErbB4 in 71 this system, the vast majority of cells expressing exogenous ErbB4 are glutamatergic neurons. Since this study indicates that ErbB4-induced maturation of the presynaptic terminal is mediated through the PDZ-dependent interactions with PSD-95, a major postsynaptic scaffolding protein localized at excitatory glutamatergic synapses in both types of neurons, it is probable that the determined mechanism of presynaptic enhancement is also applicable to interneurons. Further direct comparison of the effects of ErbB4 overexpression on enhancement of presynaptic terminals between the glutamatergic and GABAergic neurons is necessary to establish to which extent the results of this study could be extrapolated to describe the endogenous role of ErbB4 is synapse development in GABAergic interneurons. Numerous studies have characterized synaptic localization of ErbB4; ErbB4 presence in synaptosomal fraction, as well as the direct interaction of ErbB4 with PSD-95 by immunopreceipitation (Garcia et al., 2000; Huang et al., 2000) suggests that ErbB4 is localized at excitatory postsynaptic densities. The present study reveals that ErbB4 is not exclusively localized at excitatory synapses, but is also present at inhibitory contacts. Moreover, ErbB4- expressing neurons show a pattern of ErbB4 distribution that is mainly restricted to dendrites, as evidenced by the MAP2 staining (Chapter 1, Section 1). Therefore, in dissociated hippocampal neuron cultures, ErbB4 is present at the excitatory and inhibitory postsynaptic sites. A recent study revealed that NRG 1-mediated ErbB4 signaling could modulate the physiology of GABAergic terminals (Woo et al., 2007). Surprisingly, the data presented supported a presynaptic mechanism via two lines of evidence. Firstly, the authors demonstrated colocalization of ErbB4 with the inhibitory presynaptic marker GAD65 by immunostaining in brain slices. Secondly, NRG1 signaling was shown to modulate presynaptic release of GABA, 72 identified using radioactive labeling of the amount of neurotransmitter liberated from the vesicles, and measurements of paired-pulse facilitation, and this NRGl-mediated facilitation of evoked GAB A release was due to the presence of ErbB4 on GABAergic terminals. However, the possibility remains that postsynaptic ErbB4 at GABAergic synapses, as described in this thesis, may also be modulating presynaptic GABA release through an indirect mechanism under the experimental conditions of this paper. Further studies assessing subcellular fractionation of ErbB4 and electron microscopy are required to characterize in detail ErbB4 distribution at subcellular level. The developmental changes that occur in ErbB4 distribution, as well as subcellular ErbB4 distribution in different brain areas remain unknown. Previous characterization of the distribution of the EphB ligand ephrinB s revealed that in hippocampus postsynaptic ephrinB 3 is present at the synapse between CA3 and CAI neurons (Contractor et al., 2002; Armstrong et al., 2006), while at the mossy fiber-CA3 synapse ephrinBs signal presynaptically (Armstrong et al., 2006). Since Woo et al. (2007) used P28-36 mice and all recordings were performed on prefrontal cortical slices (Woo et al., 2007), while the experiments described in this thesis used primary hippocampal neuron cultures isolated from El8-19 rat embryos, it is possible that the differences in NRGl-ErbB4 signaling could be due to species and region-specific ErbB4 expression and distribution. Importantly, the results herein and the paper by Woo et al. (2007), support a model whereby ErbB4 is present and positioned appropriately to modulate transmission at excitatory glutamatergic, and describe a new function for ErbB4 at inhibitory GABAergic synapses. 73 Presynaptic protein enhancement by ErbB4. Overexpression of ErbB4 in hippocampal neurons leads to an increase in the size of presynaptic terminals, as measured by the intensity of staining for presynaptic proteins synaptophysin, VGLUT1 and VGAT. The number of excitatory or inhibitory synapses remained the same however, when compared to GFP-transfected control (Chapter 1, Section 2). Since the amount of neurotransmitter released from a presynaptic terminal is proportional to the number of synaptic vesicles at these sites (Waites et al., 2005), the finding that ErbB4 can increase the amount of synaptophysin, which is proportional to the number of synaptic vesicles at a contact point, suggests that ErbB4 is able to influence the strength of individual synapses. Enhanced clustering of presynaptic proteins is not unique to ErbB4, since overexpression of other molecules, such as neuroligin-1 and PSD-95, have been shown to exert a similar effect (El-Husseini et al., 2000; Prange et al., 2004). Since many proteins are able to perform similar biological function, it is probable that these proteins work in parallel in order to ensure the recruitment of presynaptic proteins. This redundancy is apparent in knock-out mice for these proteins. For instance, knock-out of neuroligin-1 does not cause any observable abnormalities in development of synapses. However, knock-out of three neuroligin genes of leads to an impairment in the ratio of excitatory and inhibitory synapses, but does not impair their formation (Varoqueaux et al., 2006). Since ErbB4 knock out mice are lethal at embryonic stages, whether the lack of ErbB4 affects synapses in vivo is unknown (Gassmann et al., 1995), and future experiments using cell specific or conditional knock-outs will be important to clarify this. In addition to being able to enhance clustering of synaptic proteins at contact sites, some proteins such as neuroligin-1 and SynCAM, have been shown to also increase the number of these sites (Scheiffele et al, 2000; Biederer et al., 2002; Prange et al., 2004; Chih et al., 2005). 74 Overexpression of ErbB4 protein did not increase the number of synapses compared to GFP- transfected controls, therefore, it appears that ErbB4 does not play a significant role in synapse induction, and is more likely to be involved in synaptic maturation due to it's ability to recruitment or stabilization of presynaptic vesicles. Trans-synaptic mechanism of enhanced presynaptic cluster size The observed ErbB4-induced size enhancement of clusters of presynaptic markers could be mediated through the direct trans-synaptic action of ErbB4 via presynaptic NRGl, or by indirect postsynaptic mechanism via interactions between ErbB4 and other protein complexes, such as PSD-95 and neuroligin-1, which would in turn cause enhanced presynaptic cluster size. A large variety in NRGl splice isoforms are expressed in the brain, and a number of them exist as transmembrane proteins. Since trans-synaptic complexes formed between molecules found at the pre-and postsynaptic membranes are not uncommon in the CNS synapses, and examples include neuroligin/neurexin and homophylic N-cadherin interactions (Nguyen and Sudhof, 1997; Shan et al., 2000), it is possible that postsynaptic ErbB4 interacts with the presynaptic transmembrane NRGl and in this way mediates accumulation of the presynaptic proteins. The intracellular domain of NRGl has been found to interact with some of the proteins involved in endocytic recycling and presynaptic release machinery, such as dystrophin complex, sorting nexin 27, and a-kinase anchor protein-8 like protein (Dr. Holt, Personal communication), thus suggesting a possible direct influence of NRGl on the structure of presynaptic terminal. Further characterization of presynaptic complexes that exist with NRGl would help to define the role of NRGl in presynaptic terminal maturation. 75 A powerfull assay used to test the possibility of a direct influence of a postsynaptic protein on the presynaptic terminal formation is the mixed culture assay, where a protein of interest is expressed in heterologous cells that are cocultured with hippocampal neurons (Scheiffele et al., 2000). The inducing potential of the protein is then assessed based on the presence of induced presynaptic clusters in axons contacting the cell. This assay is now commonly used to assess the synaptogenic potential of proteins implicated in trans-synaptic signaling, and has been previously used to show the induction potential of neuroligins/neurexins, SynCAM, EphB, ephrinBs, and lack of thereof of N-cadherins and SALM2 proteins (Scheiffele et al., 2000; Biederer et al., 2002; Sara et al., 2005; Kayser et al., 2006; Ko et al., 2006). To test whether trans-synaptic ErbB4-NRGl interaction could influence presynaptic terminal formation, heterologous (COS7) cells expressing exogenous ErbB4 were cocultured with hippocampal neurons. However, ErbB4 expressed in heterologous cells was not sufficient to induce presynaptic differentiation in co-cultured hippocampal neurons (Chapter 1, Section 3), suggesting that ErbB4 is not a synapse-inducing factor. However, this negative result cannot rule out the possibility that NRGl-ErbB4 trans-synaptic interaction is contributing to the synapse maturation per se, since ErbB4 may require additional proteins specific to neurons to mediate its effects on presynaptic cluster size. Moreover, it is possible that insufficient post-translational modifications of ErbB4 in heterologous cells prevent efficient interaction with the presynaptic NRG1, or that contacting axons do not express an appropriate isoform of NRG1. Since little is known of regional NRG1 expression, with previous in-situ hybridization experiments indicating NRG1 expression specifically in CAI area of hippocampus (Law et al., 2004; Okada and Corfas, 2004), it is possible that lack of the appropriate presynaptic ligand impair our ability to detect synaptogenic potential of ErbB4. 76 To further address the involvement of NRGl-ErbB4 transsynaptic signaling, a similar assay could be attempted expressing a transmembrane isoform of NRGl in heterologous cells and subsequently screening for potential contacts of the COS7 cell with the ErbB4 expressing dendrites. Moreover, it would interesting, to determine whether coexpression of ErbB4 together with an inducing cell adhesion molecule, such as NLG1 or SynCAM, would further contribute to the enhancement of the size of induced clusters in this assay. Postsynaptic mechanism of ErbB4-mediated enhancement of glutamatergic presynaptic terminals Data presented within this thesis indicated that ErbB4 overexpression affected the size of existing glutamatergic presynaptic terminals, as measured by the intensity of staining for the excitatory presynaptic marker VGLUT1, and did not affect the number of excitatory connections formed (Chapter 1, Section 2). A recent study that addressed the role of ErbB4 in synaptic maturation and plasticity reported that ErbB4 overexpression in CAI pyramidal neurons affects spine morphology, increasing the size of spines formed, while leaving the number of spines per unit length unaffected (Li et al., 2007). Although it is unclear the physiological relevance of ErbB4's ability to enhance spine maturation, since it is endogenously expressed in aspiny GABAergic interneurons, this study parallels and complements our findings that ErbB4 overexpression induces maturation of excitatory glutamatergic synapses. The effect of ErbB4 on presynaptic maturation may require recruitment of other postsynaptic proteins interacting with ErbB4. PSD-95 is a leading candidate at glutamatergic synapses, since it was shown to directly interact with ErbB4 via the PDZ-binding motif found on the C-terminal of ErbB4 (Garcia et al., 2000; Huang et al., 2000). Moreover, studies on PSD-95 77 demonstrated that overexpression of PSD-95 in neurons promotes an increase in size of existing synapses, as measured by the intensity of staining for the presynaptic marker synaptophysin and by the intensity of the postsynaptic AMPA receptors, but does not increase the number of synapses in these neurons (El-Husseini et al., 2000). These results are similar to the effects observed in cells overexpressing ErbB4 within this study (Chapter 1, Section 2). A recent study showed that ErbB4 overexpression enhances activity dependent AMPA receptors-mediated currents, thus suggesting ErbB4-mediated increase in the number of AMPA receptors at synaptic sites (Li et al., 2007). Interestingly, ErbB4 overexpression caused an increase in accumulation of PSD-95 at the sites of high ErbB4 clustering (Chapter 1, Section 4). Thus, increasing the level of ErbB4 at a synapse may lead to increased PSD-95 at these sites, and the subsequent increase in the amount of other proteins that PSD-95 interact with. A similar finding has been reported for SALM2, where direct aggregation of GFP-tagged SALM-2 via anti-GFP antibody-coated neutravidin beads was shown to cause co-accumulation of PSD-95. Similar experiments on ErbB4 in the future may determine whether clustering of ErbB4 can enhance the clustering of other post• synaptic proteins at these sites (Ko et al., 2006). In accordance with data presented in this thesis, Bo et al. (2007) found that overexpressing the ErbB4 mutant lacking the last amino acid (V) of the PDZ-binding motif of ErbB4 reduces ErbB4 enrichment at spines and reverses ErbB4-mediated activity-dependent enhancement of AMPAR currents to control levels (Chapter 1, Section 5). Further assessment of intensity of the presynaptic marker synaptophysin in cell expressing ErbB4 mutant lacking the 78 PDZ-binding motif would allow to determine whether a corresponding reversal of the size enhancement of the presynaptic terminal would also occur in our system. ErbB4 may also influence clustering of the presynaptic proteins through activation of the kinase domain upon binding to NRG1. However, this mechanism is unlikely, since over- expression of ErbB4 mutant that lacks kinase activity still induces maturation of the presynaptic terminal, thus indicating a prevailing role of PDZ-dependent interactions in enhancement of presynaptic proteins (Chapter 1, Section 5). In contrast, Bo et al. (2007) reported that expression of the kinase dead mutant of ErbB4 reduced both NMDAR- and AMPAR-mediated currents, thus indicating that ErbB4 kinase signaling is important for postsynaptic differentiation. These findings raise a possibility that the enhancement of the presynaptic terminal maturation and the recruitment of postsynaptic proteins are regulated through different mechanisms: while the kinase domain is important to mediate postsynaptic differentiation, presynaptic maturation occurs in kinase-signaling independent manner. These findings raise the possibility of trans- synaptic interaction between NRG1 and ErbB4 and its importance in presynaptic differentiation. Results within this thesis support the hypothesis that ErbB4 through its interaction with PSD-95 is able to enhance accumulation of presynaptic vesicle proteins at glutamatergic synapses. What remains unclear, are the downstream effectors that carry out this phenomena. One possibility is neuroligin-1. ErbB4 interacts with the first and second PDZ domains of PSD- 95 (Garcia et al., 2000; Huang et al., 2000), while neuroligin-1 interact with PSD-95 via the third PDZ domain (Irie et al., 1997). Thus, ErbB4-PSD-95 interaction would not interfere with PSD- 95-neuroligin complex formation, and this could contribute to neuroligin recruitment to the sites with ErbB4. The ability of neuroligin-1 to promote presynaptic terminal maturation via trans- 79 synaptic neurexin interactions is well-documented (Scheiffele et al., 2000; Prange et al., 2004; Chih et al., 2005). ErbB4 mediated enhancement of GABAergic presynaptic terminals. ErbB4 is also able to enhance the presynaptic accumulation of GABAergic proteins (Chapter 1, Section 2). A hallmark of these inhibitory synapses is the lack of PDZ-proteins, such as PSD-95, and as such, is unlikely to play a role in the observed enhancement of VGAT. However, one PDZ protein has been shown to be present on the postsynaptic side of GABAergic synapses: The GRIP family of proteins (GRfPl and GRIP2 also known as ABP; AMPA receptor binding protein) represent another important family of scaffolding proteins, which contain up to seven PDZ domains and have been implicated in clustering of glutamate receptors (Dong et al., 1997; Rong-Wen Li, 2005). Therefore, members of the GRIP family represent a class of scaffolding proteins potentially involved in the development of both excitatory and inhibitory contacts. The scaffolding protein gephyrin is concentrated within the postsynaptic domain of GABAergic synapses and is implicated in synaptic clustering of GABAA receptor subunits (Feng et al., 1997; Levi et al., 2004). One may envision a paradigm where ErbB4, through interaction with scaffolding molecules such as GRIP or gephyrin, can promote their clustering, and that the clustering of these scaffolds can in turn affect the recruitment/retention of GABAergic specific adhesion molecules, such as LI-CAM or neuroligin-2, which can act trans-synaptically to affect the accumulation of presynaptic proteins (Gerrow and El-Husseini, 2006). 80 Effects of ErbB4 on dendrite morphology Neuronal activity is determined by the number and type of synaptic input it receives; and integration of activity at multiple contacts determines the overall excitability of the cell (McAllister, 2000). Most synapses are formed on neuronal dendrites, and the extent of dendritic arborization determines the pattern of synaptic input a given cell will receive (Purves et al., 1986). During development, the extent of synaptogenesis correlates with the increasing complexity of the dendritic arbor, which lead to the hypothesis that synapse stabilization may lead dendritic growth. "Synaptotropic hypothesis" of dendritic growth, first proposed by Vaughn in 1989, postulates that new dendritic branches are stabilized by synapses and provide a positive feed-back loop that promotes new branch formation at points of contact (Vaughn, 1989). The intimate relationship between synapse formation and dendrite outgrowth has recently been demonstrated in a series of studies using two-photon imaging in an intact live animal (Cantallops et al, 2000; Sin et al., 2002; Niell et al, 2004; Haas et al., 2006). These studies highlighted the importance of activity-mediated synaptic input in guiding dendritic stability and elaboration. Given the proposed role of ErbB4 is synapse maturation and stability, as described in this thesis, it was interesting to find that NRG1 treatment promotes a striking increase in primary neurite formation in cells that endogenously and exogenously express ErbB4 (Chapter 2, Section 1 and 2). The role of NRGl-ErbB4 signaling in neurite outgrowth has previously been suggested based on the findings that NRG1 application promotes neurite outgrowth in PC12 cells, and that ErbB4 signaling enhances primary neurite sprouting in cerrebellar granule cells (Rieff et al., 1999; Vaskovsky et al., 2000). In contrast with the mechanism of the presynaptic terminal maturation, which is dependent on PDZ-interactions, two pieces of evidence indicate that the enhanced neurite formation relies on ErbB4 kinase activity (Chapter 2, Section 3). First, 81 expression of a constitutively active ErbB4 lacking the extracellular domain (ErbB4ANT) resulted in an enhancement in the formation of the primary dendrites in the absence of NRGl stimulation (Chapter 2, Section 3). Second, expression of ErbB4 with an inactive kinase (ErbB4K751R) inhibits primary dendrite formation by NRGl treatment (Chapter 2, Section 3). Therefore, one could imagine a double function of ErbB4 receptor tyrosine kinase at the synapse mediated by two distinct mechanisms: while PDZ-dependent interactions of ErbB4 with scaffolding molecules regulate synapse maturation, NRGl-mediated activation of ErbB4 kinase signaling promotes dendritic outgrowth, thus enhancing new branch formation. ErbB4 signaling is capable of altering cytoskeleton dynamics A number of signaling pathways activated by ErbB4 kinase activity could potentially influence dendrite morphology via altering both microtubule and actin dynamics. NRG1- triggered tyrosine phosphorylation of ErbB4 causes a recruitment of adaptor proteins, such as SH2 and growth factor receptor-bound protein 2 (Grb2), which in turn activates Ras/MAPK signaling pathway. The resulting phosphorylation of MAP2 protein decreases its affinity for microtubules, thus suppressing dynamic polymerization and increasing microtubule instability. Since microtubules are highly prominent in the dendritic shaft, phosphorylation of MAP2 results in destabilization of microtubules, thus promoting enhanced dendritic extension and retraction. ErbB4 also activates the phosphoinositide kinase-3 (PI3K) signaling pathway via several mechanisms. First, phosphorylated ErbB4 interacts via SH2 homology domains with the p85 regulatory subunit of PI3K, thus causing PI3K recruitment to the membrane (Rodgers and Theibert, 2002). It should be noted, however, that the ErbB4 isoform used in the above experiments specifically lacks PI3K-binding site (Figure 11). Nevertheless, ErbB4 is still capable 82 of activation of PI3K kinase pathway via Ras, a pathway that is of particular importance in CNS neurons (Kaplan and Miller, 2000). Second messengers of PI3K activation, 3-phosphoinositides, recruit guanine-nucleotide exchange factors for Rho family of GTPases, Cdc42, Rac and Rho, to the membrane (Reichardt, 2006). While activation of Cdc42 and Racl induces dendritic branching, RhoA activity slows down actin dynamics and causes retraction of dendrites (Ruchhoeft et al., 1999; Li et al, 2000). One of the main PI3K effectors Akt, besides regulating neuron survival, also affects actin cytoskeleton dynamics through activation of Racl that results in recruitment of the Arp2/3 actin nucleator complex and thus promoting actin polymerization. Overall, the concerted action of these GTPases regulates the rate of branch addition and retraction in activity-dependent manner (Li et al., 2000; Sin et al., 2002). Two other signaling pathways activated by ErbB4 directly control the dynamics of the actin cytoskeleton: PLCyand cdk5 activation. ErbB4-mediated activation of phospholypase C gamma (PLCy) and subsequent generation of inositol triphosphate (IP3) causes a release of Ca2+ from the intracellular stores (Miller and Kaplan, 2003; Rose et al., 2003). Ca2+-dependent activation of CaMKII in turn causes activation of Ras, resulting in microtubule destabilization and enhanced actin dynamics. Moreover, tyrosine phosphorylation of ErbB4 activates non• receptor tyrosine kinase fyn that can signal to the actin cytoskeleton through cyclin-dependent kinase 5 (cdk5) (Sasaki et al., 2002; Bjarnadottir et al., 2007). The mechanism of increased cdk5 activity following neurotrophin stimulation is thought to involve upregulation of expression of p35, the regulatory subunit of cdk5, via sustained Ras-MAPK signaling (Harada et al., 2001). It is conceivable that sustained ErbB4 activation could also result in increased cdk5 activity through a similar mechanism. 83 Implications for kinase signaling NRGl-mediated activation of ErbB4 kinase activity results in initiation of multiple signaling cascades that directly influence the dynamics of microtubule and actin cytoskeleton. In this respect, NRGl signaling is similar to the neurotrophin-mediated effects on dedritic growth. The neurotrophins include four structurally and functionally related proteins: nerve growth factor NGF, brain-derived neurotrophic factor (BDNF), neurotrophin-3 and -4, that signal through binding to a family of Trk tyrosine kinase receptors. The role of neurotrophins in regulation of dendritic growth has been extensively studied (Reichardt, 2006). Neurotrophin treatment has been shown to dramatically increase the length and complexity of dendritic arbors (Snider, 1994; McAllister et al., 1995). Moreover, BDNF overexpression in pyramidal neurons results in enhanced number of basal dendrite formation that correlated with decrease in spine number, possibly due to structural instability of the underlying cytoskeleton (Horch et al., 1999). This effect required TrkB activation in the overexpressing neuron, suggesting a signaling mediated response (Horch et al., 1999). Interestingly, the morphology of these neurons highly resembles the phenotype of ErbB4-overexpressing cells following stimulation with NRGl (Chapter 2, Section 1). Due to similarities in intracellular signaling mediated by TrkB and ErbB4 kinases, it is possible that they signal in parallel influencing cytoskeletal dynamics in complimentary mechanisms. NRGl stimulation of ErbB4 also activates non-receptor tyrosine kinases, such as fyn and pyk2 that regulate phosphorylation of NMDA receptors. The latter was shown to increase channel open probability and the mean open time. Increased NMDA receptor activity would result in increased Ca2+ influx into the cell, and therefore facilitate CaMKII activation. In fact, this mechanism has been shown to have a direct effect on actin stability via Rho GTPases thus 84 regulating actin dynamics. Therefore, ErbB4 activation would result in an increase of neuronal excitability, as well as increase localized actin dynamics. Interestingly, previous seemingly conflicting findings that NRG1 application specifically decreases NMDAR currents in pyramidal cells in prefrontal cortex (Gu et al., 2005) could be explained from the perspective of increased tonic inhibition of these cells due to increased activity of ErbB4-expressing GABAergic interneurons. Another interesting consequence of ErbB4 activation is the increased function of Cdk5 that has been implicated in regulation of synaptic stability. Recently, PSD-95 has been identified as one of the substrates for cdk5 phosphorylation. Increase in phosphorylation of PSD-95 following cdk5 activation results in dissociation of PSD-95 multimeric scaffold at CNS synapses and reduces PSD-95 mediated clustering of NR1 subunits of NMD A receptor (Morabito et al., 2004). Thus, it appears that initial ErbB4 kinase activity causes upregulation of synaptic activity, while sustained ErbB4 activation would cause dispersion of postsynaptic molecules. Model of NRGl-ErbB4 signaling resulting in enhanced primary neurite formation In light of the evidence presented above, one could envision the following sequence of events would ultimately lead to the presence of the phenotype of enhanced primary dendrite formation in neurons overexpressing ErbB4 upon stimulation with NRG1 (Figure 21). The first step in response to NRG1 treatment would be the activation of the ErbB4 kinase domain, which will result in activation of the Ras-mediated activation of MAPK and PI3K signaling pathways (Figure 21: 1,2,3,4), resulting in activation of the Rac and Cdc42 Rho family GTPases, and would enhance actin dynamics (Figure 21: 2). Concurrently, activation of the fyn kinase results 85 u. dissociation of Fyn multimeric complex NMDA increase in intracellular Ca2+ PSD-95 Ras cdk5 active p35 Raf PI3K •9^ SHCJRT 4 MAI microtubule dynamics actin dynamics dendrite extension Figure 21. Summary of signaling pathways activated in response to NRG1 stimulation. (see text for details). 86 in phosphorylation of NMDARs, thus increasing the calcium influx with subsequent activation of the CaMKII that further activates Ras signaling (Figure 21: 1). Together these signaling pathways may be responsible for the initial response to the NRGl activation of ErbB4, leading to an increase in actin dynamics. Second, upon prolonged stimulation with NRGl, MAPK signaling will result in changes in gene expression, and subsequent increase of the p35 activator of cdk5 kinase (Figure 21: 5). Cdk5 will increase the level of PSD-95 phosphorylation that results in disassembly of the multimeric complex at the postsynaptic terminals. Loss of PSD-95 scaffold at synapses would cause dispersion of postsynaptic proteins away from synapse, thus decreasing local activity at the synapse. Third, loss of local Ca influxes will stop CaMKII-mediated signaling that results in branch retraction. Simultaneously, NRGl signaling at the cell body will continue to activate Rac signaling pathway that results in enhanced number of primary dendrites. This proposed model accounts for the observed effect of NRGl treatment of ErbB4 overexpressing cells and highlights the role of ErbB4-mediated signaling in dendritic branching. Further experiments directed to test the predictions of this model would allow to further refine the molecular mechanism of ErbB4-mediated activity-dependent dendritic outgrowth. Conclusions The findings presented within this thesis describe the mechanism through which NRGl and its receptor ErbB4 may affect synapse development and dendritic branching. Two important aspects of neuronal development are controlled by NRGl-ErbB4 interaction: synapse maturation 87 and dendritic arborization; and the above study attempted to dissect the mechanism underlying each process. ErbB4-induced maturation of the presynaptic terminal requires the PDZ-binding domain of ErbB4, and thus, intact interaction with PSD-95, a major scaffolding protein at gutamatergic synapses. Moreover, the tyrosine kinase activity of ErbB4 is not essential to induce enhanced clustering of presynaptic proteins, further suggesting a role for protein-protein interactions in modulating presynaptic terminal development. Further characterization of the effectors of the indirect ErbB4-induced presynaptic maturation, as well as NRGl-ErbB4 trans-synaptic interaction would provide a greater insight on the mechanisms of ErbB4-mediated presynatpic maturation. In contrast to the mechanism of ErbB4-mediated enhancement of presynaptic protein recruitment, NRGl-induced enhancement of dendritic branching relies on the kinase activity of ErbB4. NRGl triggers activation of the tyrosine kinase domain of ErbB4, which in turn causes activation of the downstream signaling pathways and possibly affects microtubule and actin cytoskeleton stability, thus regulating dendritic outgrowth in GABAergic interneurons. Taken together, the evidence presented in this thesis indicates a new role for synaptic ErbB4: while stabilizing nascent synapses through its interaction with PSD-95, it enhances dendritic dynamics through NRGl-mediated activation of its kinase activity, thus promoting dendritic arborization in activity-dependent manner in GABAergic interneurons. Further studies aiming to characterize the mechanism of presynaptic enhancement, as well as to determine the downstream effectors of ErbB4 activation would help our better understanding of ErbB4 role in the physiology of GABAergic interneurons. 88 REFERENCES Altiok N, Altiok S, Changeux JP (1997) Heregulin-stimulated acetylcholine receptor gene expression in muscle: requirement for MAP kinase and evidence for a parallel inhibitory pathway independent of electrical activity. Embo J 16:717-725. Anton E, Marchionni M, Lee K, Rakic P (1997) Role of GGF/neuregulin signaling in interactions between migrating neurons and radial glia in the developing cerebral cortex. Development 124:3501-3510. Armstrong JN, Saganich MJ, Xu NJ, Henkemeyer M, Heinemann SF, Contractor A (2006) B- ephrin reverse signaling is required for NMDA-independent long-term potentiation of mossy fibers in the hippocampus. J Neurosci 26:3474-3481. Bamji SX, Shimazu K, Kimes N, Huelsken J, Birchmeier W, Lu B, Reichardt LF (2003) Role of [beta]-Catenin in Synaptic Vesicle Localization and Presynaptic Assembly. Neuron 40:719-731. Bao J, Wolpowitz D, Role LW, Talmage DA (2003) Back signaling by the Nrg-1 intracellular domain. J Cell Biol 161:1133-1141. Bao J, Lin H, Ouyang Y, Lei D, Osman A, Kim T-W, Mei L, Dai P, Ohlemiller KK, Ambron RT (2004) Activity-dependent transcription regulation of PSD-95 by neuregulin-1 and Eos. 7:1250-1258. Biederer T, Sudhof TC (2000) Mints as adaptors. Direct binding to neurexins and recruitment of muncl8. J Biol Chem 275:39803-39806. Biederer T, Sara Y, Mozhayeva M, Atasoy D, Liu X, Kavalali ET, Sudhof TC (2002) SynCAM, a synaptic adhesion molecule that drives synapse assembly. Science 297:1525-1531. Bjarnadottir M, Misner DL, Haverfield-Gross S, Bruun S, Helgason VG, Stefansson H, Sigmundsson A, Firth DR, Nielsen B, Stefansdottir R, Novak TJ, Stefansson K, Gurney ME, Andresson T (2007) Neuregulinl (NRG1) Signaling through Fyn Modulates NMD A Receptor Phosphorylation: Differential Synaptic Function in NRG1+/- Knock-Outs Compared with Wild-Type Mice. J Neurosci 27:4519-4529. Bose CM, Qiu D, Bergamaschi A, Gravante B, Bossi M, Villa A, Rupp F, Malgaroli A (2000) Agrin controls synaptic differentiation in hippocampal neurons. J Neurosci 20:9086- 9095. Brewer GJ, Torricelli JR, Evege EK, Price PJ (1993) Optimized survival of hippocampal neurons in B27-supplemented Neurobasal, a new serum-free medium combination. J Neurosci Res 35:567-576. 89 Buchert M, Schneider S, Meskenaite V, Adams MT, Canaani E, Baechi T, Moelling K, Hovens CM (1999) The junction-associated protein AF-6 interacts and clusters with specific Eph receptor tyrosine kinases at specialized sites of cell-cell contact in the brain. J Cell Biol 144:361-371. Buonanno A, Fischbach GD (2001) Neuregulin and ErbB receptor signaling pathways in the nervous system. Current Opinion in Neurobiology 11:287-296. Calaora V, Rogister B, Bismuth K, Murray K, Brandt H, Leprince P, Marchionni M, Dubois- Dalcq M (2001) Neuregulin Signaling Regulates Neural Precursor Growth and the Generation of Oligodendrocytes In Vitro. J Neurosci 21:4740-4751. Canoll PD, Musacchio JM, Hardy R, Reynolds R, Marchionni MA, Salzer JL (1996) GGF/neuregulin is a neuronal signal that promotes the proliferation and survival and inhibits the differentiation of oligodendrocyte progenitors. Neuron 17:229-243. Cantallops I, Haas K, Cline HT (2000) Postsynaptic CPG15 promotes synaptic maturation and presynaptic axon arbor elaboration in vivo. Nat Neurosci 3:1004-1011. Carpenter G (2003) ErbB-4: mechanism of action and biology. Exp Cell Res 284:66-77. Chih B, Engelman H, Scheiffele P (2005) Control of excitatory and inhibitory synapse formation by neuroligins. Science 307:1324-1328. Chih B, Gollan L, Scheiffele P (2006) Alternative splicing controls selective trans-synaptic interactions of the neuroligin-neurexin complex. Neuron 51:171-178. Cohen NA, Kaufmann WE, Worley PF, Rupp F (1997) Expression of agrin in the developing and adult rat brain. Neuroscience 76:581-596. Contractor A, Rogers C, Maron C, Henkemeyer M, Swanson GT, Heinemann SF (2002) Trans- synaptic Eph receptor-ephrin signaling in hippocampal mossy fiber LTP. Science 296:1864-1869. Corfas G, Rosen KM, Aratake H, Krauss R, Fischbach GD (1995) Differential expression of ARIA isoforms in the rat brain. Neuron 14:103-115. Dalva MB, McClelland AC, Kayser MS (2007) Cell adhesion molecules: signalling functions at the synapse. Nat Rev Neurosci 8:206-220. Dalva MB, Takasu MA, Lin MZ, Shamah SM, Hu L, Gale NW, Greenberg ME (2000) EphB receptors interact with NMDA receptors and regulate excitatory synapse formation. Cell 103:945-956. DeChiara TM, Bowen DC, Valenzuela DM, Simmons MV, Poueymirou WT, Thomas S, Kinetz E, Compton DL, Rojas E, Park JS, Smith C, DiStefano PS, Glass DJ, Burden SJ, 90 Yancopoulos GD (1996) The Receptor Tyrosine Kinase MuSK Is Required for Neuromuscular Junction Formation In Vivo. Cell 85:501-512. Dong H, O'Brien RJ, Fung ET, Lanahan AA, Worley PF, Huganir RL (1997) GRIP: a synaptic PDZ domain-containing protein that interacts with AMPA receptors. Nature 386:279- 284. Duclert A, Changeux JP (1995) Acetylcholine receptor gene expression at the developing neuromuscular junction. Physiol Rev 75:339-368. Elenius K, Choi CJ, Paul S, Santiestevan E, Nishi E, Klagsbrun M (1999) Characterization of a naturally occurring ErbB4 isoform that does not bind or activate phosphatidyl inositol 3- kinase. Oncogene 18:2607-2615. Elenius K, Corfas G, Paul S, Choi CJ, Rio C, Plowman GD, Klagsbrun M (1997) A Novel Juxtamembrane Domain Isoform of HER4/ErbB4. Isoform-specific tissue distribution and differential processing in response to phorbol ester. J Biol Chem 272:26761-26768. El-Husseini AE-D, Schnell E, Chetkovich DM, Nicoll RA, Bredt DS (2000) PSD-95 Involvement in Maturation of Excitatory Synapses. Science 290:1364-1368. Escher P, Lacazette E, Courtet M, Blindenbacher A, Landmann L, Bezakova G, Lloyd KC, Mueller U, Brenner HR (2005) Synapses form in skeletal muscles lacking neuregulin receptors. Science 308:1920-1923. Ethell JM, Irie F, Kalo MS, Couchman JR, Pasquale EB, Yamaguchi Y (2001) EphB/syndecan-2 signaling in dendritic spine morphogenesis. Neuron 31:1001-1013. Falls DL (2003) Neuregulins: functions, forms, and signaling strategies. Exp Cell Res 284:14-30. Falls DL, Rosen KM, Corfas G, Lane WS, Fischbach GD (1993) ARIA, a protein that stimulates acetylcholine receptor synthesis, is a member of the neu ligand family. Cell 72:801-813. Fannon AM, Colman DR (1996) A model for central synaptic junctional complex formation based on the differential adhesive specificities of the cadherins. Neuron 17:423-434. Feng Y, Absher D, Eberhart DE, Brown V, Maker HE, Warren ST (1997) FMRP associates with polyribosomes as an mRNP, and the I304N mutation of severe fragile X syndrome abolishes this association. Mol Cell 1:109-118. Ferreira A (1999) Abnormal synapse formation in agrin-depleted hippocampal neurons. J Cell Sci 112(Pt24):4729-4738. Flames N, Long JE, Garratt AN, Fischer TM, Gassmann M, Birchmeier C, Lai C, Rubenstein JL, Marin O (2004) Short- and long-range attraction of cortical GABAergic interneurons by neuregulin-1. Neuron 44:251-261. 91 Fox IT, Kornblum HI (2005) Developmental profile of ErbB receptors in murine central nervous system: implications for functional interactions. J Neurosci Res 79:584-597. Froehner SC (1993) Regulation of Ion Channel Distribution at Synapses. Annual Review of Neuroscience 16:347-368. Garcia RAG, Vasudevan K, Buonanno A (2000) The neuregulin receptor ErbB-4 interacts with PDZ-containing proteins at neuronal synapses. PNAS 97:3596-3601. Garner CC, Zhai RG, Gundelfinger ED, Ziv NE (2002) Molecular mechanisms of CNS synaptogenesis. Trends Neurosci 25:243-251. Gassmann M, Casagranda F, Orioli D, Simon H, Lai C, Klein R, Lemke G (1995) Aberrant neural and cardiac development in mice lacking the ErbB4 neuregulin receptor. Nature 378:390-394. Gautam M, Noakes PG, Moscoso L, Rupp F, Scheller RH, Merlie JP, Sanes JR (1996) Defective neuromuscular synaptogenesis in agrin-deficient mutant mice. Cell 85:525-535. Gerecke KM, Wyss JM, Carroll SL (2004) Neuregulin-1 beta induces neurite extension and arborization in cultured hippocampal neurons. Mol Cell Neurosci 27:379-393. Gerrow K, El-Husseini A (2006) Cell adhesion molecules at the synapse. Front Biosci 11:2400- 2419. Goda Y, Davis GW (2003) Mechanisms of Synapse Assembly and Disassembly. Neuron 40:243- 264. Graf ER, Kang Y, Hauner AM, Craig AM (2006) Structure function and splice site analysis of the synaptogenic activity of the neurexin-1 beta LNS domain. J Neurosci 26:4256-4265. Graf ER, Zhang X, Jin SX, Linhoff MW, Craig AM (2004) Neurexins induce differentiation of GABA and glutamate postsynaptic specializations via neuroligins. Cell 119:1013-1026. Gu Z, Jiang Q, Fu AKY, Ip NY, Yan Z (2005) Regulation of NMDA Receptors by Neuregulin Signaling in Prefrontal Cortex. J Neurosci 25:4974-4984. Guy PM, Platko JV, Cantley LC, Cerione RA, Carraway KL, 3rd (1994) Insect cell-expressed pl80erbB3 possesses an impaired tyrosine kinase activity. Proc Natl Acad Sci U S A 91:8132-8136. Haas K, Li J, Cline HT (2006) AMPA receptors regulate experience-dependent dendritic arbor growth in vivo. Proc Natl Acad Sci U S A 103:12127-12131. 92 Hahn CG, Wang HY, Cho DS, Talbot K, Gur RE, Berrettini WH, Bakshi K, Kamins J, Borgmann-Winter KE, Siegel SJ, Gallop RJ, Arnold SE (2006) Altered neuregulin 1- erbB4 signaling contributes to NMDA receptor hypofunction in schizophrenia. Nat Med 12:824-828. Harada T, Morooka T, Ogawa S, Nishida E (2001) ERK induces p35, a neuron-specific activator of Cdk5, through induction of Egrl. Nat Cell Biol 3:453-459. Harrison PJ, Law AJ (2006) Neuregulin 1 and schizophrenia: genetics, gene expression, and neurobiology. Biol Psychiatry 60:132-140. Hashimoto R, Straub RE, Weickert CS, Hyde TM, Kleinman JE, Weinberger DR (2004) Expression analysis of neuregulin-1 in the dorsolateral prefrontal cortex in schizophrenia. Mol Psychiatry 9:299-307. Hata Y, Butz S, Sudhof TC (1996) CASK: a novel dlg/PSD95 homolog with an N-terminal calmodulin-dependent protein kinase domain identified by interaction with neurexins. J Neurosci 16:2488-2494. Henkemeyer M, Itkis OS, Ngo M, Hickmott PW, Ethell FJVI (2003) Multiple EphB receptor tyrosine kinases shape dendritic spines in the hippocampus. J Cell Biol 163:1313-1326. Hippenmeyer S, Shneider NA, Birchmeier C, Burden SJ, Jessell TM, Arber S (2002) A Role for Neuregulinl Signaling in Muscle Spindle Differentiation. Neuron 36:1035-1049. Horch HW, Kruttgen A, Portbury SD, Katz LC (1999) Destabilization of cortical dendrites and spines by BDNF. Neuron 23:353-364. Huang YZ, Wang Q, Won S, Luo ZG, Xiong WC, Mei L (2002) Compartmentalized NRG signaling and PDZ domain-containing proteins in synapse structure and function. International Journal of Developmental Neuroscience 20:173-185. Huang YZ, Won S, Ali DW, Wang Q, Tanowitz M, Du QS, Pelkey KA, Yang DJ, Xiong WC, Salter MW, Mei L (2000) Regulation of Neuregulin Signaling by PSD-95 Interacting with ErbB4 at CNS Synapses. Neuron 26:443-455. Irie M, Hata Y, Takeuchi M, Ichtchenko K, Toyoda A, Hirao K, Takai Y, Rosahl TW, Sudhof TC (1997) Binding of neuroligins to PSD-95. Science 277:1511-1515. Jiang M, Deng L, Chen G (2004) High Ca(2+)-phosphate transfection efficiency enables single neuron gene analysis. Gene Ther 11:1303-1311. Jontes JD, Emond MR, Smith SJ (2004) In Vivo Trafficking and Targeting of N-Cadherin to Nascent Presynaptic Terminals. J Neurosci 24:9027-9034. 93 Jou TS, Stewart DB, Stappert J, Nelson WJ, Marrs JA (1995) Genetic and biochemical dissection of protein linkages in the cadherin-catenin complex. Proc Natl Acad Sci U S A 92:5067- 5071. Kaplan DR, Miller FD (2000) Neurotrophin signal transduction in the nervous system. Curr Opin Neurobiol 10:381-391. Kayser MS, McClelland AC, Hughes EG, Dalva MB (2006) Intracellular and trans-synaptic regulation of glutamatergic synaptogenesis by EphB receptors. J Neurosci 26:12152- 12164. Kim S, Burette A, Chung HS, Kwon SK, Woo J, Lee HW, Kim K, Kim H, Weinberg RJ, Kim E (2006) NGL family PSD-95-interacting adhesion molecules regulate excitatory synapse formation. Nat Neurosci 9:1294-1301. Klapper LN, Glathe S, Vaisman N, Hynes NE, Andrews GC, Sela M, Yarden Y (1999) The ErbB-2/HER2 oncoprotein of human carcinomas may function solely as a shared coreceptor for multiple stroma-derived growth factors. Proc Natl Acad Sci USA 96:4995-5000. Ko J, Kim S, Chung HS, Kim K, Han K, Kim H, Jun H, Kaang BK, Kim E (2006) SALM synaptic cell adhesion-like molecules regulate the differentiation of excitatory synapses. Neuron 50:233-245. Kramer R, Bucay N, Kane DJ, Martin LE, Tarpley JE, Theill LE (1996) Neuregulins with an Ig- like domain are essential for mouse myocardial and neuronal development. Proc Natl Acad Sci U S A 93:4833-4838. Law AJ, Kleinman JE, Weinberger DR, Weickert CS (2007) Disease-associated intronic variants in the ErbB4 gene are related to altered ErbB4 splice-variant expression in the brain in schizophrenia. Hum Mol Genet 16:129-141. Law AJ, Shannon Weickert C, Hyde TM, Kleinman JE, Harrison PJ (2004) Neuregulin-1 (NRG- 1) mRNA and protein in the adult human brain. Neuroscience 127:125-136. Law AJ, Lipska BK, Weickert CS, Hyde TM, Straub RE, Hashimoto R, Harrison PJ, Kleinman JE, Weinberger DR (2006) Neuregulin 1 transcripts are differentially expressed in schizophrenia and regulated by 5' SNPs associated with the disease. Proc Natl Acad Sci USA 103:6747-6752. Levi S, Logan SM, Tovar KR, Craig AM (2004) Gephyrin is critical for glycine receptor clustering but not for the formation of functional GABAergic synapses in hippocampal neurons. J Neurosci 24:207-217. Levinson JN, Chery N, Huang K, Wong TP, Gerrow K, Kang R, Prange O, Wang YT, El- Husseini A (2005) Neuroligins mediate excitatory and inhibitory synapse formation: 94 involvement of PSD-95 and neurexin-lbeta in neuroligin-induced synaptic specificity. J Biol Chem 280:17312-17319. Li B, Woo RS, Mei L, Malinow R (2007) The neuregulin-1 receptor erbB4 controls glutamatergic synapse maturation and plasticity. Neuron 54:583-597. Li Z, Van Aelst L, Cline HT (2000) Rho GTPases regulate distinct aspects of dendritic arbor growth in Xenopus central neurons in vivo. 3:217-225. Lin W, Burgess RW, Dominguez B, Pfaff SL, Sanes JR, Lee K-F (2001) Distinct roles of nerve and muscle in postsynaptic differentiation of the neuromuscular synapse. 410:1057-1064. Linggi B, Carpenter G (2006) ErbB receptors: new insights on mechanisms and biology. Trends Cell Biol 16:649-656. Linggi B, Cheng QC, Rao AR, Carpenter G (2006) The ErbB-4 s80 intracellular domain is a constitutively active tyrosine kinase. Oncogene 25:160-163. Liu Y, Ford B, Mann MA, Fischbach GD (2001) Neuregulins increase alpha7 nicotinic acetylcholine receptors and enhance excitatory synaptic transmission in GABAergic interneurons of the hippocampus. J Neurosci 21:5660-5669. Lopez-Bendito G, Cautinat A, Sanchez JA, Bielle F, Flames N, Garratt AN, Talmage DA, Role LW, Charnay P, Marin O, Garel S (2006) Tangential Neuronal Migration Controls Axon' Guidance: A Role for Neuregulin-1 in Thalamocortical Axon Navigation. Cell 125:127- 142. McAllister AK (2000) Cellular and molecular mechanisms of dendrite growth. Cereb Cortex 10:963-973. McAllister AK, Lo DC, Katz LC (1995) Neurotrophins regulate dendritic growth in developing visual cortex. Neuron 15:791-803. McCroskery S, Chaudhry A, Lin L, Daniels MP (2006) Transmembrane agrin regulates filopodia in rat hippocampal neurons in culture. Molecular and Cellular Neuroscience 33:15-28. Meier T, Masciulli F, Moore C, Schoumacher F, Eppenberger U, Denzer AJ, Jones G, Brenner HR (1998) Agrin can mediate acetylcholine receptor gene expression in muscle by aggregation of muscle-derived neuregulins. J Cell Biol 141:715-726. Merlie JP, Sanes JR (1985) Concentration of acetylcholine receptor mRNA in synaptic regions of adult muscle fibres. 317:66-68. Meyer D, Birchmeier C (1995) Multiple essential functions of neuregulin in development. Nature 378:386-390. 95 Mi R, Tang X, Sutter R, Xu D, Worley P, O'Brien RJ (2002) Differing Mechanisms for Glutamate Receptor Aggregation on Dendritic Spines and Shafts in Cultured Hippocampal Neurons. J Neurosci 22:7606-7616. Miller FD, Kaplan DR (2003) Signaling mechanisms underlying dendrite formation. Curr Opin Neurobiol 13:391-398. Morabito MA, Sheng M, Tsai LH (2004) Cyclin-dependent kinase 5 phosphorylates the N- terminal domain of the postsynaptic density protein PSD-95 in neurons. J Neurosci 24:865-876. Musil L, Frail D, Merlie J (1989) The mammalian 43-kD acetylcholine receptor-associated protein (RAPsyn) is expressed in some nonmuscle cells. J Cell Biol 108:1833-1840. Nam CI, Chen L (2005) Postsynaptic assembly induced by neurexin-neuroligin interaction and neurotransmitter. PNAS 102:6137-6142. Nehring RB, Wischmeyer E, Doring F, Veh RW, Sheng M, Karschin A (2000) Neuronal inwardly rectifying K(+) channels differentially couple to PDZ proteins of the PSD- 95/SAP90 family. J Neurosci 20:156-162. Nguyen T, Sudhof TC (1997) Binding properties of neuroligin 1 and neurexin lbeta reveal function as heterophilic cell adhesion molecules. J Biol Chem 272:26032-26039. Ni CY, Murphy MP, Golde TE, Carpenter G (2001) gamma -Secretase cleavage and nuclear localization of ErbB-4 receptor tyrosine kinase. Science 294:2179-2181. Nicodemus KK, Luna A, Vakkalanka R, Goldberg T, Egan M, Straub RE, Weinberger DR (2006) Further evidence for association between ErbB4 and schizophrenia and influence on cognitive intermediate phenotypes in healthy controls. Mol Psychiatry 11:1062-1065. Niell CM, Meyer MP, Smith SJ (2004) In vivo imaging of synapse formation on a growing dendritic arbor. Nat Neurosci 7:254-260. Nitkin R, Smith M, Magill C, Fallon J, Yao Y, Wallace B, McMahan U (1987) Identification of agrin, a synaptic organizing protein from Torpedo electric organ. J Cell Biol 105:2471- 2478. Noakes PG, Gautam M, Mudd J, Sanes JR, Merlie JP (1995) Aberrant differentiation of neuromuscular junctions in mice lacking s-laminin/laminin beta 2. Nature 374:258-262. Nuriya M, Huganir RL (2006) Regulation of AMPA receptor trafficking by N-cadherin. J Neurochem 97:652-661. 96 O'Brien R, Xu D, Mi R, Tang X, Hopf C, Worley P (2002) Synaptically targeted narp plays an essential role in the aggregation of AMPA receptors at excitatory synapses in cultured spinal neurons. J Neurosci 22:4487-4498. O'Brien RJ, Xu D, Petralia RS, Steward O, Huganir RL, Worley P (1999) Synaptic clustering of AMPA receptors by the extracellular immediate-early gene product Narp. Neuron 23:309-323. O'Connor LT, Lauterborn JC, Gall CM, Smith MA (1994) Localization and alternative splicing of agrin mRNA in adult rat brain: transcripts encoding isoforms that aggregate acetylcholine receptors are not restricted to cholinergic regions. J Neurosci 14:1141- 1152. Okada M, Corfas G (2004) Neuregulinl downregulates postsynaptic GABAA receptors at the hippocampal inhibitory synapse. Hippocampus 14:337-344. Ozaki M, Sasner M, Yano R, Lu HS, Buonanno A (1997) Neuregulin-beta induces expression of an NMDA-receptor subunit. Nature 390:691-694. Ozaki M, Itoh K, Miyakawa Y, Kishida H, Hashikawa T (2004) Protein processing and releases of neuregulin-1 are regulated in an activity-dependent manner. Journal of Neurochemistry 91:176-188. Palay SL (1956) Synapses in the central nervous system. J Biophys Biochem Cytol 2:193-202. Panzer JA, Song Y, Balice-Gordon RJ (2006) In Vivo Imaging of Preferential Motor Axon Outgrowth to and Synaptogenesis at Prepatterned Acetylcholine Receptor Clusters in Embryonic Zebrafish Skeletal Muscle. J Neurosci 26:934-947. Patton BL, Cunningham JM, Thyboll J, Kortesmaa J, Westerblad H, Edstrom L, Tryggvason K, Sanes JR (2001) Properly formed but improperly localized synaptic specializations in the absence of laminin alpha4. Nat Neurosci 4:597-604. Petryshen TL, Middleton FA, Kirby A, Aldinger KA, Purcell S, Tahl AR, Morley CP, McGann L, Gentile KL, Rockwell GN, Medeiros HM, Carvalho C, Macedo A, Dourado A, Valente J, Ferreira CP, Patterson NJ, Azevedo MH, Daly MJ, Pato CN, Pato MT, Sklar P (2005) Support for involvement of neuregulin 1 in schizophrenia pathophysiology. Mol Psychiatry 10:366-374, 328. Plowman GD, Culouscou JM, Whitney GS, Green JM, Carlton GW, Foy L, Neubauer MG, Shoyab M (1993) Ligand-specific activation of HER4/pl80erbB4, a fourth member of the epidermal growth factor receptor family. Proc Nad Acad Sci U S A 90:1746-1750. Prange O, Wong TP, Gerrow K, Wang YT, El-Husseini A (2004) A balance between excitatory and inhibitory synapses is controlled by PSD-95 and neuroligin. PNAS 101:13915- 13920. 97 Purves D, Hadley RD, Voyvodic JT (1986) Dynamic changes in the dendritic geometry of individual neurons visualized over periods of up to three months in the superior cervical ganglion of living mice. J Neurosci 6:1051-1060. Reichardt LF (2006) Neurotrophin-regulated signalling pathways. Philos Trans R Soc Lond B Biol Sci 361:1545-1564. Rieff HI, Raetzman LT, Sapp DW, Yeh HH, Siegel RE, Corfas G (1999) Neuregulin induces GABA(A) receptor subunit expression and neurite outgrowth in cerebellar granule cells. J Neurosci 19:10757-10766. Rio C, Buxbaum JD, Peschon JJ, Corfas G (2000) Tumor necrosis factor-alpha-converting enzyme is required for cleavage of erbB4/HER4. J Biol Chem 275:10379-10387. Rio C, Rieff HI, Qi P, Khurana TS, Corfas G (1997) Neuregulin and erbB Receptors Play a Critical Role in Neuronal Migration. Neuron 19:39-50. Roche KW, Standley S, McCallum J, Dune Ly C, Ehlers MD, Wenthold RJ (2001) Molecular determinants of NMDA receptor internalization. Nat Neurosci 4:794-802. Rodgers EE, Theibert AB (2002) Functions of PI 3-kinase in development of the nervous system. International Journal of Developmental Neuroscience 20:187-197. Rong-Wen Li DRS, Celia P. Miralles, Xuejing Li, Erik Charych, Raquel Riquelme, Richard L. Huganir, Angel L. de Bias, (2005) GRIP1 in GABAergic synapses. The Journal of Comparative Neurology 488:11-27. Rose CR, Blum R, Pichler B, Lepier A, Kafitz KW, Konnerth A (2003) Truncated TrkB-Tl mediates neurotrophin-evoked calcium signalling in glia cells. Nature 426:74-78. Roskoski R, Jr. (2004) The ErbB/HER receptor protein-tyrosine kinases and cancer. Biochem Biophys Res Commun 319:1-11. Ruchhoeft ML, Ohnuma S, McNeill L, Holt CE, Harris WA (1999) The neuronal architecture of Xenopus retinal ganglion cells is sculpted by rho-family GTPases in vivo. J Neurosci 19:8454-8463. Sandrock AW, Jr., Dryer SE, Rosen KM, Gozani SN, Kramer R, Theill LE, Fischbach GD (1997) Maintenance of Acetylcholine Receptor Number by Neuregulins at the Neuromuscular Junction in Vivo. Science 276:599-603. Sanes JR, Lichtman JW (2001) Induction, assembly, maturation and maintenance of a postsynaptic apparatus. Nat Rev Neurosci 2:791-805. 98 Sara Y, Biederer T, Atasoy D, Chubykin A, Mozhayeva MG, Sudhof TC, Kavalali ET (2005) Selective capability of SynCAM and neuroligin for functional synapse assembly. J Neurosci 25:260-270. Sasaki Y, Cheng C, Uchida Y, Nakajima O, Ohshima T, Yagi T, Taniguchi M, Nakayama T, Kishida R, Kudo Y, Ohno S, Nakamura F, Goshima Y (2002) Fyn and Cdk5 mediate semaphorin-3A signaling, which is involved in regulation of dendrite orientation in cerebral cortex. Neuron 35:907-920. Scheiffele P, Fan J, Choih J, Fetter R, Serafini T (2000) Neuroligin expressed in nonneuronal cells triggers presynaptic development in contacting axons. Cell 101:657-669. Shan WS, Tanaka H, Phillips GR, Arndt K, Yoshida M, Colman DR, Shapiro L (2000) Functional cis-heterodimers of N- and R-cadherins. J Cell Biol 148:579-590. Shapiro L, Colman DR (1999) The diversity of cadherins and implications for a synaptic adhesive code in the CNS. Neuron 23:427-430. Sheng M (2001) Molecular organization of the postsynaptic specialization. Proc Natl Acad Sci U S A 98:7058-7061. Si J, Luo Z, Mei L (1996) Induction of Acetylcholine Receptor Gene Expression by ARIA Requires Activation of Mitogen-activated Protein Kinase. J Biol Chem 271:19752-19759. Silberberg G, Darvasi A, Pinkas-Kramarski R, Navon R (2006) The involvement of ErbB4 with schizophrenia: association and expression studies. Am J Med Genet B Neuropsychiatr Genet 141:142-148. Sin WC, Haas K, Ruthazer ES, Cline HT (2002) Dendrite growth increased by visual activity requires NMDA receptor and Rho GTPases. Nature 419:475-480. Snider WD (1994) Functions of the neurotrophins during nervous system development: what the knockouts are teaching us. Cell 77:627-638. Sperry RW (1963) Chemoaffinity in the Orderly Growth of Nerve Fiber Patterns and Connections. Proc Natl Acad Sci U S A 50:703-710. Stefansson H, Sigurdsson E, Steinthorsdottir V, Bjornsdottir S, Sigmundsson T, Ghosh S, Brynjolfsson J, Gunnarsdottir S, Ivarsson O, Chou TT, Hjaltason O, Birgisdottir B, Jonsson H, Gudnadottir VG, Gudmundsdottir E, Bjornsson A, Ingvarsson B, Ingason A, Sigfusson S, Hardardottir H, Harvey RP, Lai D, Zhou M, Brunner D, Mutel V, Gonzalo A, Lemke G, Sainz J, Johannesson G, Andresson T, Gudbjartsson D, Manolescu A, Frigge ML, Gurney ME, Kong A, Gulcher JR, Petursson H, Stefansson K (2002) Neuregulin 1 and susceptibility to schizophrenia. Am J Hum Genet 71:877-892. 99 Sunderland WJ, Son YJ, Miner JH, Sanes JR, Carlson SS (2000) The presynaptic calcium channel is part of a transmembrane complex linking a synaptic laminin (alpha4beta2gammal) with non-erythroid spectrin. J Neurosci 20:1009-1019. Swayze RD, Lise MF, Levinson JN, Phillips A, El-Husseini A (2004) Modulation of dopamine mediated phosphorylation of AMPA receptors by PSD-95 and AKAP79/150. Neuropharmacology 47:764-778. Tansey M, Chu G, Merlie J (1996) ARIA/HRG regulates AChR epsilon subunit gene expression at the neuromuscular synapse via activation of phosphatidylinositol 3-kinase and Ras/MAPK pathway. J Cell Biol 134:465-476. Togashi H, Abe K, Mizoguchi A, Takaoka K, Chisaka O, Takeichi M (2002) Cadherin regulates dendritic spine morphogenesis. Neuron 35:77-89. Torres R, Firestein BL, Dong H, Staudinger J, Olson EN, Huganir RL, Bredt DS, Gale NW, Yancopoulos GD (1998) PDZ proteins bind, cluster, and synaptically colocalize with Eph receptors and their ephrin ligands. Neuron 21:1453-1463. Usdin T, Fischbach G (1986) Purification and characterization of a polypeptide from chick brain that promotes the accumulation of acetylcholine receptors in chick myotubes. J Cell Biol 103:493-507. Varoqueaux F, Aramuni G, Rawson RL, Mohrmann R, Missler M, Gottmann K, Zhang W, Sudhof TC, Brose N (2006) Neuroligins determine synapse maturation and function. Neuron 51:741-754. Vartanian T, Fischbach G, Miller R (1999) Failure of spinal cord oligodendrocyte development in mice lacking neuregulin. PNAS 96:731-735. Vaskovsky A, Lupowitz Z, Erlich S, Pinkas-Kramarski R (2000) ErbB-4 activation promotes neurite outgrowth in PC 12 cells. J Neurochem 74:979-987. Vaughn JE (1989) Fine structure of synaptogenesis in the vertebrate central nervous system. Synapse 3:255-285. Vidal GA, Naresh A, Marrero L, Jones FE (2005) Presenilin-dependent gamma-secretase processing regulates multiple ERBB4/HER4 activities. J Biol Chem 280:19777-19783. Waites CL, Craig AM, Garner CC (2005) Mechanisms of vertebrate synaptogenesis. Annu Rev Neurosci 28:251-274. Witzemann V (2006) Development of the neuromuscular junction. Cell Tissue Res 326:263-271. Wolpowitz D, Mason TB, Dietrich P, Mendelsohn M, Talmage DA, Role LW (2000) Cysteine- rich domain isoforms of the neuregulin-1 gene are required for maintenance of peripheral synapses. Neuron 25:79-91. 100 Woo RS, Li XM, Tao Y, Carpenter-Hyland E, Huang YZ, Weber J, Neiswender H, Dong XP, Wu J, Gassmann M, Lai C, Xiong WC, Gao TM, Mei L (2007) Neuregulin-1 enhances depolarization-induced GABA release. Neuron 54:599-610. Xie F, Padival M, Siegel RE (2007) Association of PSD-95 with ErbB4 facilitates neuregulin signaling in cerebellar granule neurons in culture. J Neurochem 100:62-72. Yang X, Li W, Prescott ED, Burden SJ, Wang JC (2000) DNA Topoisomerase II and Neural Development. Science 287:131-134. Yang X, Arber S, William C, Li L, Tanabe Y, Jessell TM, Birchmeier C, Burden SJ (2001) Patterning of Muscle Acetylcholine Receptor Gene Expression in the Absence of Motor Innervation. Neuron 30:399-410. Yarden Y, Sliwkowski MX (2001) Untangling the ErbB signalling network. Nat Rev Mol Cell Biol 2:127-137. Yau HJ, Wang HF, Lai C, Liu FC (2003) Neural development of the neuregulin receptor ErbB4 in the cerebral cortex and the hippocampus: preferential expression by interneurons tangentially migrating from the ganglionic eminences. Cereb Cortex 13:252-264. Zhang B, Luo S, Dong X-P, Zhang X, Liu C, Luo Z, Xiong W-C, Mei L (2007) {beta}-Catenin Regulates Acetylcholine Receptor Clustering in Muscle Cells through Interaction with Rapsyn. J Neurosci 27:3968-3973. 101