Kinesin-2 Family in Vertebrate Ciliogenesis

Kinesin-2 family in vertebrate ciliogenesis

Chengtian Zhaoa, Yoshihiro Omorib, Katarzyna Brodowskaa, Peter Kovacha, and Jarema Malickia,1

aDivision of Craniofacial and Molecular Genetics and Program in Genetics, Sackler School of Graduate Biomedical Studies, Tufts University, Boston, MA 02111; and bDepartment of Developmental Biology, Osaka Bioscience Institute, Osaka 565-0874, Japan

Edited by Kathryn V. Anderson, Sloan–Kettering Institute, New York, NY, and approved December 28, 2011 (received for review October 12, 2011) The differentiation of cilia is mediated by kinesin-driven transport. lethality (12, 13). Consequently, conditional KOs of Kif3a have As the function of kinesins in vertebrate ciliogenesis is poorly been performed in several organs, including kidney tubules, pan- characterized, we decided to determine the role of kinesin-2 family creas, and skin, and in all cases resulted in a loss of cilia, demon- motors—heterotrimeric kinesin-II and the homodimeric Kif17 kine- strating that Kif3a is necessary for ciliogenesis (14–16). As the sin—in zebraﬁsh cilia. We report that kif17 is largely dispensable vertebrate photoreceptor outer segment is among the best char- for ciliogenesis; kif17 homozygous mutant animals are viable and acterized cilia-derived structures (17, 18), several studies focused display subtle morphological defects of olfactory cilia only. In con- on the role of kinesins in photoreceptor ciliogenesis. A conditional trast to that, the kif3b gene, encoding a heterotrimeric kinesin KO of Kif3a in photoreceptor cells revealed a role for the het- subunit, is necessary for cilia differentiation in most tissues, al- erotrimeric kinesin II in the transport of opsin and arrestin, but though exceptions exist, and include photoreceptors and a subset not transducin or peripherin, suggesting the presence of multiple of hair cells. Cilia of these cell types persist even in kif3b/kif17 anterograde ciliary motor mechanisms (19). Rod and cone double mutants. Although we have not observed a functional re- photoreceptors appear to have different requirements for motor dundancy of kif3b and kif17, kif17 is able to substitute for kif3b in proteins: following conditional KOs of Kif3a speciﬁcally in rods some cilia. In contrast to kif3b/kif17 double mutants, simultaneous or in cones, rods degenerate much faster compared with cones interference with kif3b and kif3c leads to the complete loss of (20). Given these results, it appears likely that multiple kinesins photoreceptor and hair cell cilia, revealing redundancy of function. contribute to photoreceptor ciliogenesis. This is in agreement with the idea that Kif3b and Kif3c motor Based on biochemical studies, Kif3a functions as a hetero- subunits form complexes with Kif3a, but not with each other. In-

trimeric complex, consisting of another motor subunit, either BIOLOGY terestingly, kif3b mutant photoreceptor cilia differentiate with Kif3b or Kif3c, and an accessory protein, Kap3 (9, 10, 21). a delay, suggesting that kif3c, although redundant with kif3b at Similar to kif3a, the role of kif3b in different tissues is difficult to DEVELOPMENTAL later stages of differentiation, is not active early in photoreceptor evaluate because homozygous mouse mutants die at midg- ciliogenesis. Consistent with that, the overexpression of kif3c in estation, and few, if any, conditional KOs are available (13). The kif3b mutants rescues early photoreceptor cilia defects. These data role of kif3c in ciliogenesis also remained obscure, as mouse KOs reveal unexpected diversity of functional relationships between of this gene do not display any obvious phenotype (22, 23). The vertebrate ciliary kinesins, and show that the repertoire of kinesin contribution of kif17 to vertebrate ciliogenesis is even less clear motors changes in some cilia during their differentiation. as its studies produced contradictory results (11, 24). By using zebrafish as a model system, we show that vertebrate intraflagellar transport | opsin | outer segment | ciliary axoneme kif3b and kif17 kinesins are required for the formation of different subsets of cilia. Although the loss of kif3b function affects ilia and flagella are thin elongated cell surface protrusions that the majority of cilia, cone photoreceptor cilia and a subset of Cperform diverse biological functions. Motile cilia or flagella of kinocilia in the otic vesicle do not require kif3b function. In protozoans or sperm cells facilitate the movement of entire cells. contrast to that, among tissues analyzed so far, kif17 function is In multicellular organisms, motile cilia drive fluid flow in the lu- confined to the morphogenesis of olfactory cilia. Consistent with men of ducts and chambers such as kidney tubules or brain ven- biochemical studies, kif3b acts redundantly with kif3c in photo- tricles (1, 2). Apart from its ability to generate motion, the cilium is receptor and some hair cell cilia. Interestingly, the repertoire of a separate subcellular compartment that features cell surface and kinesins that function in photoreceptor cilia changes during de- cytoplasmic components. These characteristics provide basis for velopment; whereas kif3b alone appears to drive ciliogenesis the ability of cilia to mediate signal transduction in a variety of early on, kif3b and kif3c function redundantly at later stages contexts, including developmental signaling by the hedgehog or of differentiation. notch pathways, as well as sensory signal transduction. As the cilium itself is devoid of protein synthesis, polypeptides Results that contribute to the structure and function of cilia are trans- jj203 Mutant Embryos Display Cilia Defects. We identified the jj203 ported from the cell body. This transport, referred to as the mutant strain following N-ethyl-N-nitrosourea (ENU) muta- intraflagellar transport (IFT), relies on the function of two types genesis. The most obvious external phenotype of jj203 is curved of plus-end directed motors that are members of the kinesin-2 body axis (Fig. 1B). As such a phenotype is characteristic of cilia family (3), named heterotrimeric kinesin-II and homodimeric mutants (25, 26), we investigated ciliogenesis in jj203. The OSM-3 or KIF17 (4–7). In the flagella of algae Chlamydomonas, zebrafish embryo and larva feature a number of well character- mainly kinesin-II is thought to function in IFT (6). In Caeno- ized ciliated organs (27). Similar to defects in ovl and elipsa loci, rhabditis elegans, subunits KLP-20, KLP-11, and KAP-1 form the which affect IFT particle components, the jj203 mutation results single kinesin-II complex, which functions in parallel to homo- in a shortening or absence of cilia in the olfactory pit (Fig. 1 C dimeric OSM-3 (8). Vertebrates, on the contrary, are thought to form two kinesin-II complexes (KIF3A/3B/KAP3 and KIF3A/ 3C/KAP3) in addition to homodimeric KIF17 (9, 10). Both Author contributions: C.Z. and J.M. designed research; C.Z., Y.O., K.B., and P.K. performed kinesin-II and kif17 have been proposed to function in vertebrate research; C.Z. and J.M. analyzed data; and C.Z. and J.M. wrote the paper. ciliogenesis (11–13). The authors declare no conflict of interest. Given the diversity of cilia-mediated processes in vertebrate This article is a PNAS Direct Submission. tissues, it appears that kinesins may function differently in cilia of 1To whom correspondence should be addressed: [email protected]. different cells. The analysis of this issue is complicated, however, This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. because kinesin-II mouse knock-outs (KOs) lead to midgestation 1073/pnas.1116035109/-/DCSupplemental.

www.pnas.org/cgi/doi/10.1073/pnas.1116035109 PNAS Early Edition | 1of6 Downloaded by guest on September 29, 2021 Fig. 1. The jj203 mutant locus encodes the kif3b kinesin subunit. (A) Positional cloning of jj203 mutant locus. Top: Map of the jj203 genomic region and exon/ intron structure of the kif3b transcript. Middle: Sequence of the jj203 transcript in WT and mutant animals. Bottom: Approximate diagram of Kif3b protein domain structure. Arrow indicates the site of the stop codon in the jj203 mutant allele. (B) The external phenotype of WT (Upper)andjj203 mutant (Lower) larvae at 5 dpf. (C–F′) Confocal images of WT (C, D, E, and F) and jj203 mutant (C′,D′,E′, and F′) larvae immunostained to visualize ciliogenesis in olfactory epithelium (C and C′), auditory maculae (D and D′), lateral line neuromasts (E and E′), and kidney tubules (F and F′) at 2 dpf (C and C′) or 3 dpf (D–F′). C–E′ show images of whole animals; F and F′ show transverse cryosections. (G–H′) Confocal images of olfactory pits (G and G′) and lateral line neuromasts (H and H’)in zebraﬁsh larvae treated with anti-kif3b or with a control (CMO) antisense morpholino as indicated. (I and I′) Confocal images of anterior auditory maculae in jj203 mutants following overexpression of GFP (I)orkif3b (I′) mRNA. Larvae in C–I′ were stained with anti-acetylated tubulin antibodies (in green) and in some cases counterstained with phalloidin to visualize actin (red). Images in G–I′ were collected at 3 dpf. Arrows in C–I′ indicate cilia.

and C′), ear macula (Fig. 1 D and D′), lateral line neuromasts defects, possibly because of the presence of maternal contribu- (Fig. 1 E and E′), and pronephros (Fig. 1 F and F′). In the tion (Fig. S1). These observations indicate that the jj203 locus Kupffer’s vesicle, however, we do not see any obvious cilia plays a role in ciliogenesis.

Fig. 2. A subset of cilia differentiate in kif3b mutant embryos. (A, A′, B, and B′) Transverse cryosections through the photoreceptor cell layer (bracket) in WT (A and B) and jj203 mutant (A′ and B′) embryos stained with anti-acetylated tubulin antibody (red) at 3 dpf (A and A′) and 5 dpf (B and B′). (C and D′) EM images of sections through WT (C and D) and jj203 mutant (C′ and D′) photoreceptor cells at 3 dpf (C and C′) and 5 dpf (D and D′). (E and E′) EM images of sections perpendicular to outer segment (OS) microtubules in WT (E) and mutant (E′) photoreceptors. Arrows point to microtubule singlets. Enlargements are shown to the right: mutant (Upper) and WT (Lower). (F) The length of the connecting cilium in WT (blue bars) and mutant (red bars) retinae expressed as the percentage of WT length at 7 dpf. Measurements were performed on confocal images of transverse cryosections stained with anti-acetylated tubulin antibody. Data were collected at 3, 3.5, 4, and 7 dpf as indicated. Sample sizes (number of retinae/number of cilia) are provided. (G and G′) Confocal images of cilia in ear cristae of WT (G) or mutant (G′) embryos stained with anti-acetylated tubulin antibody (in green) and counterstained with phalloidin (in red) at 7 dpf.

2of6 | www.pnas.org/cgi/doi/10.1073/pnas.1116035109 Zhao et al. Downloaded by guest on September 29, 2021 jj203 Encodes Kif3b Subunit of Heterotrimeric Kinesin II. To de- formation, whereas another motor contributes to outer segment termine the molecular nature of the jj203 locus, we performed differentiation in parallel to kif3b at later stages. positional cloning (Fig. 1A). This effort revealed a single nu- Although we determined that cilia are missing in ear maculae cleotide substitution (nucleotide 1,105, C to T) in the second of kif3bjj203 mutants by 3 dpf, the staining of ear of cristae cilia exon of the kif3b gene, which introduces a nonsense codon in the is normal even as late as at 7 dpf (Fig. 2 G and G′). Although place of a glutamine at the position 369 of the polypeptide (Fig. we cannot exclude minor defects in the structure of crista cilia, 1A). The truncated mutant protein lacks the coiled-coil stalk these results indicate that mechanisms of cilia formation are domain and the C-terminal tail domain (Fig. 1A). To confirm different in maculae and cristae, and that kif3b is not required that defects in the kif3b gene are responsible for the jj203 phe- for the differentiation of cristaeciliaatleastduringthefirst notype, we performed a knockdown with two morpholinos tar- 7 d of development. jj203 geted against this gene. This treatment produces a curly body The presence of outer segments in kif3b mutants suggests axis phenotype by 3 d postfertilization (dpf), which closely that opsin is transported fairly normally in mutant photo- fi resembles that of jj203 mutant larvae [88% (n = 87) vs. 2% (n = receptors. To evaluate opsin transport ef ciency, we expressed GFP–Opsin–CT44 fusion gene under the control of a heat shock 85) in control morpholino-treated animals]. Cilia length in the jj203 olfactory placode and lateral line neuromasts is also obviously promoter in kif3b mutants as described previously (29) (Fig. shorter in morphant animals (Fig. 1 G–H′). In a complementary S1). Heat shock was applied at 5 dpf to eliminate the contribu- experiment, we overexpressed the kif3b mRNA in embryos from tion of rods, which degenerate almost completely by that time crosses between jj203 heterozygotes. This treatment rescues cil- (Fig. S2). Larvae were collected at 4, 9, and 24 h after heat shock, and GFP intensity was measured in the photoreceptor cell body. iogenesis in the ear of homozygous mutant embryos (n = 7 of 7 Four hours after heat shock, GFP intensity is much higher in cell vs. 0 of 3 in embryos treated with control GFP mRNA; Fig. 1 I bodies of mutant photoreceptors compared with cells in the WT and I′). Taken together, these data demonstrate that a defect in (Fig. S1 D and E). This result indicates that kif3b contributes to the kif3b gene is responsible for the jj203 phenotype. opsin transport. Importantly, we found that GFP–opsin fusion is cleared from the cell body by 9 h after heat shock even in the kif3b Function Is Not Required in a Subset of Cilia. Vertebrate absence of kif3b function (Fig. S1), indicating that another motor photoreceptor cells feature highly differentiated cilia, known as mechanism transports opsin in parallel to the kif3b kinesin outer segments (17, 18). Loss of IFT genes, such as oval/ift88, complex. The persistence of some cilia in kif3b mutant homo- BIOLOGY leads to outer segment absence (25, 28). At 3 dpf, antibody

zygotes is surprising given that kif3a KOs in the mouse result in DEVELOPMENTAL staining reveals ciliary axoneme at the base of the outer segment the absence of cilia (14–16). in WT animals but not in kif3bjj203 larvae (Fig. 2A′ vs. 2A). By 5 dpf, however, connecting cilia form in mutants, although they are kif3b Functions Differently in Rods and Cones. To assess the ciliary ′ jj203 shorter than the WT ones (Fig. 2B vs. 2B; graph in Fig. 2F). phenotype in photoreceptors of kif3b mutant animals further, Ultrastructural analysis revealed that, at 3 dpf, no outer seg- we carried out whole-mount in situ hybridization using probes to jj203 ments are found in kif3b retinae (Fig. 2 C and C′). By 5 dpf, genes specifically expressed in cones or rods. The expression of jj203 however, outer segments also form in kif3b mutants (Fig. 2 D cone-specific genes, such as cone transducin, cone arrestin, or and D′). Mutant and WT outer segments feature similar mi- cone opsins, is normal in kif3bjj203 animals. On the contrary, the crotubule organization, including the presence of microtubule expression of rod-specific genes, such as rod transducin and rod singlets at 6 dpf (Fig. 2 E and E′). Nonetheless, outer segments opsin, dramatically decreases in kif3bjj203 mutants by 5 dpf (Fig. of some mutant photoreceptors are abnormally shaped or bro- S2) as a result of cell death (Fig. S3). However, rod opsin ex- ken. These observations suggest that the kif3bjj203 locus plays pression is normal at 3 dpf (Fig. S2A). These results were con- a particularly prominent role in the initiation of outer segment firmed by using antibody staining to opsins and the rod-specific

Fig. 3. kif17 mutant phenotype. (A) Upper: Sequences of WT and kif17sa0119 mutant allele. Lower: Diagram of the Kif17 protein. Arrow indicates the site of the stop codon. (B) Upper: Quantitative RT-PCR. Expression level relative to WT is provided. Data were normalized for actin expression (P < 0.05). Lower: RT-PCR ampliﬁcation of the kif17 transcript in WT and mutant embryos at 5 dpf. (C and C′)Ex- ternal phenotype of WT (C) and kif17sa0119 (C′) larvae at 7 dpf. (D) Confocal and ultrastructural analysis of cilia in WT and kif17sa0119 mutants. Larvae were stained with anti- acetylated tubulin antibody to visualize cilia in the nasal pit (a and d) and ear cristae (b and e). c and f, Ultrathin sections perpendicular to the distal tips of olfactory cilia in WT and mutant, respectively. (E) Graph showing the length distribution of nasal cilia in WT and kif17sa0119 mutants at 7 dpf. Each dot represents the average cilia length measured in a single individual. “n” is the number of individuals analyzed (P ≤ 0.001). (F) Confocal images of transverse cryosections through the retina of adult WT (a and c) and kif17 homozygous mutant (b and d) individuals stained with Zpr-1 (a and b) or anti-rod opsin (c and d) antibodies (green) and counterstained with phalloidin (red). Arrow- heads indicate the outer limiting membrane, asterisks the outer plexiform layer. (G) Measurement of opsin transport efﬁciency from the inner to the outer segment in WT and kif17sa0119 mutant animals at 4 dpf. The intensity of GFP–opsin signal in the cell body is measured at 4, 9, and 24 h after heat shock. For each data point, 15 to 20 retinae, and 30 to 36 photoreceptors were analyzed. This experiment was performed as published (29) and illustrated in Fig. S1 (*P < 0.05; **P < 0.001).

Zhao et al. PNAS Early Edition | 3of6 Downloaded by guest on September 29, 2021 Nr2e3 transcription factor (Fig. S2D). Similar to WT cells, cone Immunostaining did not reveal any ciliogenesis defects in the opsins localize mainly to outer segments of mutant photo- ear, the retina, the spinal cord, or the pronephric duct of mutant receptors. These data suggest that rod photoreceptors degenerate homozygotes (Fig. 3D and Fig. S4). However, the nasal cilia were in mutants between 3 and 5 dpf. In contrast to that, cone photo- somewhat shorter at 7 dpf (P < 0.001; Fig. 3 D and E), and 8 dpf receptors survive longer and frequently feature grossly normal (P < 0.01; n ≥ 10 for WT and mutant). In contrast to nematode outer segments. osm-3 mutant phenotype (30), singlet microtubules persist in nasal cilia of kif17 mutants (Fig. 3D), which continue to be kif17 Plays a Minor Role in Ciliogenesis. The formation of C. elegans motile (Movies S1 and S2). Antibody staining did not reveal rod cilia involves the function of the homodimeric osm-3 kinesin (30– opsin or green cone opsin mislocalization in mutant retinae at 5 32). To determine whether this kinesin functions in vertebrate dpf (Fig. S4). Similarly, we did not observe obvious morpho- ciliogenesis, perhaps redundantly with the heterotrimeric kinesin logical defects or opsin mislocalization in the retinae of adult II, we investigated mutant phenotypes of its vertebrate ortho- mutant homozygotes (Fig. 3F). As kif17 may not be required for logue, kif17. We studied a chemically induced mutant allele, opsin localization and may only contribute to its transport, we sa0119 kif17 , which contains a stop codon at position 551 (Fig. 3A). applied GFP–opsin transient overexpression assay at 4 dpf (Fig. The resulting truncated Kif17 protein lacks 271 C-terminal S1). Opsin transport is not affected in this test (Fig. 3G). These amino acids. Several lines of evidence suggest that this mutation results indicate that the kif17 kinesin plays a minor role in cilia results in a null or a near-null phenotype. First, it eliminates formation, and does not contribute to the transport of opsin, the several highly conserved sequences in the C terminus of the most abundant cargo in photoreceptor cilia. Kif17 protein. Second, the C-terminal region of this polypeptide is involved in cargo interactions (33, 34). Third, this mutation kif17 Can Substitute for Loss of kif3 Function in Some Cilia. Given results in a nonsense-mediated decay that severely reduces the that kif3 and kif17 function redundantly in C. elegans,wetested kif17 transcript expression (Fig. 3B). Finally, morpholino whether they are functionally interchangeable in a vertebrate. knockdown of kif17 function in kif17sa0119 mutant homozygotes We injected kif17 mRNA into embryos from crosses between does not result in any obvious enhancement of cilia defects (Fig. two kif3bjj203 heterozygotes, and found a signiﬁcant decrease in S4B). kif17sa0119 mutant homozygotes do not display any obvious the frequency of severe curly body phenotype. Four percent external phenotype (Fig. 3 C and C′) and survive to adulthood. (n = 433) of embryos displayed this phenotype, compared with

Fig. 4. kif3c function in ciliogenesis. (A and A′) Confocal images of transverse cryosections through the retina stained with Zpr-1 (to visualize double cones; green), and anti-green opsin antibodies (red). (B and B′) Confocal images of lateral cristae in whole animals stained with anti- acetylated tubulin antibody to visualize kinocilia (green) and counterstained with phalloidin (red). WT and kif3bjj203−/−;kif17sa0119−/− double mutant animals were analyzed as indicated. (C) Cilia length in WT, mutant, and double mutant cristae as indicated. The average WT length is set at 100%. “n” is the number of individuals analyzed. (D) A schematic drawing of the exon/intron structure for the kif3c and kif3c-like genes. Morpholino-targeted exons are in color. Target sites are indicated as red horizontal bars. (E) Confocal images of lateral cristae in whole animals stained as in B. The number of individuals tested that differentiate cilia is indicated in lower left corner of each panel. (F) Confocal images of transverse cryosections through the retina stained with an anti-acetylated tubulin antibody to visualize cilia (arrows). For E and F, genotypes are indicated below. Brackets indicate the photoreceptor cell layer, arrowheads the outer limiting membrane. (G) The frequency of photoreceptor cilia at 4 dpf in different mutant/morphant backgrounds as indicated. (H) The fre- − − quency of photoreceptor cilia in kif3b / mutant homozygotes at 3 dpf, following rescue with kif3c or control GFP mRNA. In G and H, each dot represents the number of cilia per an arbitrary segment of the photoreceptor cell layer in a single retina. (I and I′) Confocal images of photoreceptor cilia (arrows) at 3 dpf visualized as in F.(J) Relative sizes of apical opsin-positive compartments (presumably outer segments) in kif3bjj203 homozygous mutant and pheno- typically WT animals treated with kif3c or control GFP mRNA. Each dot represents the total size of apical opsin- positive domains on a single section through the retina, adjusted for the length of the photoreceptor cell layer. The average WT size equals 100%. (K)Efﬁciency of GFP–opsin transport in kif3c morphants measured as in Fig. S1. “n” is the number of photoreceptors analyzed. A minimum of 30 sections from six retinae were used to calculate each data point. In G, H, and J, “n” is the number of retinae analyzed. In all images, apical direction is up (*P < 0.05; **P < 0.001).

4of6 | www.pnas.org/cgi/doi/10.1073/pnas.1116035109 Zhao et al. Downloaded by guest on September 29, 2021 18% (n = 348) in GFP mRNA-treated controls. Immunostain- this function at later stages. The significance of this develop- ing revealed that spinal canal cilia but not nasal cilia were res- mental change is not clear, but it may facilitate the transport of cued at 3 dpf in mutant embryos treated with kif17 mRNA (Fig. the massive amount of cargo that needs to be moved from the S5). We did not observe rescue in control kif3bjj203 embryos cell body into the outer segment. treated with GFP mRNA. These results indicate that kif17 kinesin can substitute for kif3b function to drive ciliogenesis in Discussion some tissues. Experiments presented in this work reveal that kif3b and kif17, the two kinesins known to play major roles in nematode cilio- kif3b;kif17 Double Mutant. The persistence of cilia in kif3b mutants genesis, display very different contributions to the formation of suggested that kif3 and kif17 may function redundantly. To test vertebrate cilia. In C. elegans, the homodimeric kif17/osm-3 sa0119 sa0119 this idea, we investigated the phenotype of kif17 /kif17 ; kinesin is required for the differentiation of distal microtubule jj203 jj203 kif3b /kif3b double homozygotes. Staining with anti-green singlets of amphidial channel cilia (30). In addition, in this set of opsin antibodies in double mutants did not reveal obvious mis- cilia, and in the cilia of AWC cells, the homodimeric and the localization of this visual pigment (Fig. 4 A and A′). Similarly, in heterotrimeric kinesin function redundantly. In contrast to the absence of both kinesins, cilia of auditory cristae differentiate channel cilia, kif17/osm-3 is not required for the differentiation of normally and display normal length (Fig. 4 B, B′, and C). These distal singlets in neighboring AWB amphidial cilia, although the results indicate that neither kif3b nor kif17 is required for cilio- two kinesins still function redundantly (35). Functional inter- genesis in cone photoreceptors and in a subset of hair cells. actions between kinesins are even more complex in the cephalic Moreover, unless the third parallel motor mechanism is involved, male cilia (32). Our data reveal that diverse functional rela- these two kinesins do not function redundantly in the cilia of tionships also exist between vertebrate ciliary kinesins (Fig. S9). these cells. A limited role for kif17 in zebrafish ciliogenesis, especially in kif3b kif3c double mutants with kif3b, is surprising, given the prominent and Display Redundant Functions. The Kif3c kinesin function of this kinesin in C. elegans cilia (31, 36). In vertebrates, subunit is thought to form complexes with Kif3a (9, 10). Al- the function of kif17 has been studied in tissue culture as well as though the mouse Kif3c protein appears to be absent from the in mouse and zebrafish models. Tissue culture studies provided photoreceptor cell layer (10, 22, 23), we considered the possi- fi evidence that kif17 is necessary for the transport of a cyclic nu- bility that the zebra sh kif3c functions redundantly with kif3b. BIOLOGY cleotide-gated channel subunit but not for the elongation of cilia The zebrafish has two kif3c-related genes, which we will refer to (37), whereas the mouse KO analysis revealed a role in learning DEVELOPMENTAL as kif3c and kif3c-like (Fig. 4D and Fig. S6). To block their ex- and memory (24). Our studies demonstrate a function for kif17 pression, we designed anti-splice site morpholinos and verified in the morphogenesis of a subset of vertebrate cilia. However, their efficiency by real-time-PCR (Fig. S7). We tested the idea the role of kif17 is surprisingly limited. Combined with previous that in the absence of kif3b, these kinesins may be necessary for studies, our data indicate that kif17 functions in the transport of the formation of cilia in cristae and in photoreceptor cells. This structural and signaling components in a limited subset of cilia. turned out to be the case: although neither kif3c nor kif3c-like The results of our analysis are in agreement with reports that morphants display cilia defects, simultaneous morpholino jj203 kif3c KO mice are viable and do not display photoreceptor knockdown of kif3c and kif3c-like in kif3b mutants results in defects (22, 23). However, a redundancy of kif3c/kif3b function in a loss of cristae and photoreceptor cilia (Fig. 4 E and F; graph in Fig. 4G). Subsequent single knockdowns of kif3c or kif3c-like photoreceptor cells is surprising in light of previous reports that revealed that kif3c, but not kif3c-like, functions redundantly with kif3c is primarily expressed in ganglion cell axons and in ama- kif3b (P < 0.0001; Fig. 4G). crine cells (9, 10). The same studies reported that Kif3c is structurally related to Kif3b and, similar to Kif3b, associates with Developmental Changes in Kinesin Repertoire. The redundancy of Kif3a, which suggests that Kif3b and Kif3c proteins may function kif3c and kif3b function becomes obvious only at 4 dpf after redundantly as alternative binding partners of Kif3a. Although photoreceptor cilia are formed in kif3b mutants, suggesting that redundancy of kif3b and kif3c function has been hypothesized (9, fi kif3c does not function during early stages of ciliogenesis. GFP– 22), to our knowledge, this is the rst study to demonstrate that it opsin transient overexpression assay in kif3c morphants at 3 dpf actually exists. In the ear, this redundancy is limited to cilia in did not reveal significant differences in opsin transport efficiency a subset of auditory hair cells. Hair cells that display the re- between kif3c and control morphants at 3 dpf (Fig. 4K), in- dundancy of function are very similar to those that do not. This dicating that, consistent with the kif3b phenotype, kif3c does not may be a result of somewhat different cargo requirements. Cilia contribute to this process at this stage. By 5 dpf, however, GFP- of hair cells in cristae are particularly long, so they may require opsin transport was somewhat slower in kif3c morphants com- a more robust transport compared with neighboring cells in ear pared with control animals (P < 0.05; Fig. 4K). To further test maculae. Similarly, somewhat different cargo molecules are the idea that the absence of cilia at the early stages of photo- transported in rod and cone cilia, which may account for dif- jj203 receptor differentiation in kif3b mutants is caused by the absence ferences of kif3b phenotype in these two cell types (18, 38). of kif3c function, we overexpressed kif3c mRNA in kif3bjj203 Further biochemical analysis as well as in vivo imaging of IFT mutant homozygotes. This treatment resulted in a significant movement will be necessary to fully understand the diversity of rescue of body curvature (13% vs. 23% following kif3c and GFP kinesin functions in cilia. RNA injections, respectively; n = 520 and 261, respectively) and Interestingly, cilia formation in photoreceptor cells is initially cilia differentiation in kif3bjj203 mutants at 3 dpf (P < 0.001; Fig. driven by kif3b only. At later stages, kif3c also contributes to 4 H, I, and I′) and 4 dpf (P < 0.001; Fig. S8B). Finally, this ciliogenesis in this cell type and is largely sufficient to drive the treatment increased opsin accumulation at the apical terminus of differentiation of outer segments. This, to our knowledge, is the the photoreceptor cell, a phenotype that most likely reflects first example of a developmental change in the repertoire of outer segment formation (P < 0.001; Fig. 4J and Fig. S8A). An ciliary kinesins during differentiation of a single cell type. The incomplete rescue is most likely a result of limited stability of outer segments of kif3b mutant homozygotes, although relatively injected mRNA. Based on these results, we propose that the robust, do not appear to be entirely normal. It remains to be functional repertoire of ciliary kinesins undergoes a develop- investigated whether this results from quantitative differences in mental change during photoreceptor differentiation: whereas kinesin expression, or reflects differences in cargo specificity only kif3b drives cilia formation early on, kif3b and kif3c perform between Kif3c and Kif3b kinesins.

Zhao et al. PNAS Early Edition | 5of6 Downloaded by guest on September 29, 2021 Materials and Methods Quantitative PCR. kif17 transcripts were amplified from 5-d-old WT or kif17 β Animals. Zebrafish strains were maintained following the standard protocols homozygous mutant larvae. -actin was used as an internal reference con- approved by the Tufts University Animal Care Committee. trol. Analysis was performed by using Qiagen SYBR Green PCR Kit on a Stratagene MX3000 cycler with the following settings: 95 °C for 30 s, 57 °C Genetic Screen. ENU mutagenesis was performed as described (39). To en- for 1 min, and 72 °C for 1 min for 40 cycles. The data were collected from hance our ability to identify subtle photoreceptor defects, we crossed three independent experiments (each in triplicate). The relative expression a transgene that expresses GFP in rod photoreceptors into ENU-mutagen- level of kif17 transcripts in WT and mutant larvae were analyzed with Qia- ized animals. Mutants were identified in the F2 generation by using the gen REST 2009 software. The following primers were used for amplification: early pressure screening approach (40). kif17 forward, GCTTCACAAGAACAGGCTAAG; kif17 reverse, CATCTCAAAC- TCTGCCTGTAG; β-actin forward, ATGGATGATGAAATTGCCGCAC; and β-actin Knockdown and Rescue Experiments. Morpholino knockdowns and rescue reverse, ACCATCACCAGAGTCCATCACG. experiments were performed as described previously (25, 26). During rescue experiments, embryos were genotyped by sequencing. The following morpho- Videomicroscopy and Image Analysis. To image nasal cilia movement, larvae linos were used: kif3c-like, GACGTACTTGAATTTCATCTCTCTT; kif3c,TCAGT- were embedded head down in 1% agarose on a glass bottom dish and filmed CCTCA GACACATACC TTAAA; kif3b (ATG), AGCTCTTGCT TTTAGACATT TTGAC; using a QuantEM 512SC camera and a 63× water immersion lens on a Zeiss kif3b (SP), AGCTTGAAGT TTCTAACCTT AACT; and kif17 (SP) the same as in the study of Insinna et al. (11): TTGTAAACTG GTTACCTGGA TTGTC. Knockdown Axio Observer Z1 inverted microscope. To evaluate ciliogenesis in the pho- efficiency was confirmed by using the following RT-PCR primers: for kif3c, toreceptor cell layer, cilia were counted relative to the length of the outer ATCCGCGACCTGCTCACCAAAG and CAGTGATGATGAAGATGGCGTGAG; for limiting membrane on each confocal image. For the analysis of rod opsin kif3c-like, AACGAGGGATGCTGGCGAAAGA and TGGTCTCTTCATCTTGTTCA. distribution, the areas of apical rod opsin accumulation were selected with the wand tool (tolerance of 20), and their sizes were calculated by using Immunohistochemistry. Sectioning and immunohistochemistry were per- ImageJ software (National Institutes of Health). formed by using standard protocols (27). The following antibodies were used: anti-acetylated α-tubulin (1:500; Sigma), zpr3 (1:1,000; Zebrafish In- ACKNOWLEDGMENTS. We thank Dr. Thomas Vihtelic for anti-green opsin ternational Resource Center), zpr1 (1:250; Zebrafish International Resource and Dr. Jeremy Nathans for anti-Nr2e3 antibodies; Dr. James Fadool for Center), anti–γ-tubulin (1:500; Sigma), anti-green opsin (gift from Thomas providing the rod-GFP transgenic line; the Louisville mapping facility for Vihtelic), and anti-Nr2e3 (gift from Jeremy Nathans). assistance in cloning the jj203 mutant allele; Dr. Xinjun He for help with phylogenetic analysis and Dr. Viktoria Andreeva with quantitative PCR; Dr. Tomer Avidor-Reiss for commenting on an earlier version of this manu- Opsin Transport Analysis. Opsin transport was analyzed as described pre- script; and the Sanger Institute Zebrafish Mutation Resource, sponsored by – viously (29). GFP opsin fusion construct was injected into kif17 or kif3b Wellcome Trust Grant WT 077047/Z/05/Z, for providing the zebrafish mutant homozygotes or, alternatively, injected together with anti-kif3c kif17sa0119 allele. This work was supported by National Institutes of Health morpholinos into WT embryos. Grants R01 EY018176 and R01 EY016859 (to J.M.).

1. Rosenbaum JL, Witman GB (2002) Intraflagellar transport. Nat Rev Mol Cell Biol 3: 21. Yamazaki H, Nakata T, Okada Y, Hirokawa N (1996) Cloning and characterization of 813–825. KAP3: A novel kinesin superfamily-associated protein of KIF3A/3B. Proc Natl Acad Sci 2. Satir P, Christensen ST (2007) Overview of structure and function of mammalian cilia. USA 93:8443–8448. Annu Rev Physiol 69:377–400. 22. Yang Z, Roberts EA, Goldstein LS (2001) Functional analysis of mouse kinesin motor – 3. Lawrence CJ, et al. (2004) A standardized kinesin nomenclature. J Cell Biol 167:19 22. Kif3C. Mol Cell Biol 21:5306–5311. fi 4. Cole DG, et al. (1993) Novel heterotrimeric kinesin-related protein puri ed from sea 23. Jimeno D, Lillo C, Roberts EA, Goldstein LS, Williams DS (2006) Kinesin-2 and pho- – urchin eggs. Nature 366:268 270. toreceptor cell death: requirement of motor subunits. Exp Eye Res 82:351–353. 5. Shakir MA, Fukushige T, Yasuda H, Miwa J, Siddiqui SS (1993) C. elegans osm-3 gene 24. Yin X, Takei Y, Kido MA, Hirokawa N (2011) Molecular motor KIF17 is fundamental mediating osmotic avoidance behaviour encodes a kinesin-like protein. Neuroreport for memory and learning via differential support of synaptic NR2A/2B levels. Neuron 4:891–894. 70:310–325. 6. Walther Z, Vashishtha M, Hall JL (1994) The Chlamydomonas FLA10 gene encodes 25. Tsujikawa M, Malicki J (2004) Intraflagellar transport genes are essential for differ- a novel kinesin-homologous protein. J Cell Biol 126:175–188. entiation and survival of vertebrate sensory neurons. Neuron 42:703–716. 7. Jana SC, Girotra M, Ray K (2011) Heterotrimeric kinesin-II is necessary and sufficient to 26. Omori Y, et al. (2008) Elipsa is an early determinant of ciliogenesis that links the IFT promote different stepwise assembly of morphologically distinct bipartite cilia in – Drosophila antenna. Mol Biol Cell 22:769–781. particle to membrane-associated small GTPase Rab8. Nat Cell Biol 10:437 444. 8. Signor D, Wedaman KP, Rose LS, Scholey JM (1999) Two heteromeric kinesin com- 27. Malicki J, Avanesov A, Li J, Yuan S, Sun Z (2011) Analysis of cilia structure and function fi – plexes in chemosensory neurons and sensory cilia of Caenorhabditis elegans. Mol Biol in zebra sh. Methods Cell Biol 101:39 74. Cell 10:345–360. 28. Doerre G, Malicki J (2002) Genetic analysis of photoreceptor cell development in the 9. Yang Z, Goldstein LS (1998) Characterization of the KIF3C neural kinesin-like motor zebrafish retina. Mech Dev 110:125–138. from mouse. Mol Biol Cell 9:249–261. 29. Zhao C, Malicki J (2011) Nephrocystins and MKS proteins interact with IFT particle and 10. Muresan V, et al. (1998) KIF3C and KIF3A form a novel neuronal heteromeric kinesin facilitate transport of selected ciliary cargos. EMBO J 30:2532–2544. that associates with membrane vesicles. Mol Biol Cell 9:637–652. 30. Snow JJ, et al. (2004) Two anterograde intraflagellar transport motors cooperate to 11. Insinna C, Pathak N, Perkins B, Drummond I, Besharse JC (2008) The homodimeric build sensory cilia on C. elegans neurons. Nat Cell Biol 6:1109–1113. kinesin, Kif17, is essential for vertebrate photoreceptor sensory outer segment de- 31. Evans JE, et al. (2006) Functional modulation of IFT kinesins extends the sensory velopment. Dev Biol 316:160–170. repertoire of ciliated neurons in Caenorhabditis elegans. J Cell Biol 172:663–669. 12. Marszalek JR, Ruiz-Lozano P, Roberts E, Chien KR, Goldstein LS (1999) Situs inversus 32. Morsci NS, Barr MM (2011) Kinesin-3 KLP-6 regulates intraflagellar transport in male- and embryonic ciliary morphogenesis defects in mouse mutants lacking the KIF3A specific cilia of Caenorhabditis elegans. Curr Biol 21:1239–1244. subunit of kinesin-II. Proc Natl Acad Sci USA 96:5043–5048. 33. Setou M, Nakagawa T, Seog DH, Hirokawa N (2000) Kinesin superfamily motor pro- 13. Nonaka S, et al. (1998) Randomization of left-right asymmetry due to loss of nodal tein KIF17 and mLin-10 in NMDA receptor-containing vesicle transport. Science 288: fl fl cilia generating leftward ow of extraembryonic uid in mice lacking KIF3B motor 1796–1802. – protein. Cell 95:829 837. 34. Guillaud L, Wong R, Hirokawa N (2008) Disruption of KIF17-Mint1 interaction by 14. Cano DA, Sekine S, Hebrok M (2006) Primary cilia deletion in pancreatic epithelial cells CaMKII-dependent phosphorylation: A molecular model of kinesin-cargo release. Nat results in cyst formation and pancreatitis. Gastroenterology 131:1856–1869. Cell Biol 10:19–29. 15. Croyle MJ, et al. (2011) Role of epidermal primary cilia in the homeostasis of skin and 35. Mukhopadhyay S, et al. (2007) Distinct IFT mechanisms contribute to the generation hair follicles. Development 138:1675–1685. of ciliary structural diversity in C. elegans. EMBO J 26:2966–2980. 16. Lin F, et al. (2003) Kidney-specific inactivation of the KIF3A subunit of kinesin-II in- 36. Ou G, Blacque OE, Snow JJ, Leroux MR, Scholey JM (2005) Functional coordination of hibits renal ciliogenesis and produces polycystic kidney disease. Proc Natl Acad Sci fl – USA 100:5286–5291. intra agellar transport motors. Nature 436:583 587. 17. Rodieck RW (1973) The Vertebrate Retina. Principles of Structure and Function (W. H. 37. Jenkins PM, et al. (2006) Ciliary targeting of olfactory CNG channels requires the – Freeman, San Francisco). CNGB1b subunit and the kinesin-2 motor protein, KIF17. Curr Biol 16:1211 1216. 18. Kennedy B, Malicki J (2009) What drives cell morphogenesis: A look inside the ver- 38. Pugh E, Lamb T (2000) Phototransduction in vertebrate rods and cones. Handbook of tebrate photoreceptor. Dev Dyn 238:2115–2138. Biological Physics (Elsevier, Amsterdam), Vol 3, pp 183–255. 19. Marszalek JR, et al. (2000) Genetic evidence for selective transport of opsin and ar- 39. Malicki J, et al. (1996) Mutations affecting development of the zebrafish retina. restin by kinesin-II in mammalian photoreceptors. Cell 102:175–187. Development 123:263–273. 20. Avasthi P, et al. (2009) Trafficking of membrane proteins to cone but not rod outer 40. Malicki J (2000) Harnessing the power of forward genetics—analysis of neuronal di- segments is dependent on heterotrimeric kinesin-II. J Neurosci 29:14287–14298. versity and patterning in the zebrafish retina. Trends Neurosci 23:531–541.

6of6 | www.pnas.org/cgi/doi/10.1073/pnas.1116035109 Zhao et al. Downloaded by guest on September 29, 2021