F-Box Protein Skp2: a Novel Transcriptional Target Ofe2f

L Zhang and C Wang

Center for Molecular Biology of Oral Diseases, University of Illinois at Chicago, Chicago, IL, USA

The F-box-containing protein Skp2 plays a critical role in that select and ubiqutinate specific proteins for targeted coordinating the G1/S transition and progression through destruction by the 26S proteasome. SCF complexes are the S phase ofthe mammalian cell cycle. Skp2 is named for their core protein components Skp1, Cullin/ overexpressed in a broad spectrum ofhuman cancers cdc53, and Rbx1/Roc, and an F-box-containing protein and the expression level correlates with tumor malig- that determines substrate specificity (Zheng et al., 2002). nancy. However, the Skp2 gene is neither amplified nor Different SCF complexes are distinguished by the types rearranged in most human cancers and the underlying of F-box protein in association with the core proteins mechanism ofSkp2 overexpression remains poorly under- (Kipreos and Pagano, 2000; Willems et al., 2004). stood. We show here that the Skp2 gene contains a Skp2, which was initially identified as a protein stably functional E2F response element (hSRE2). Ectopic interacting with the cyclin A–cdk2 complex (Zhang expression ofE2F1 induces expression ofthe endogenous et al., 1995; Bai et al., 1996), is the substrate-recognition Skp2 gene in human fibroblast cells, whereas antisense- subunit of the SCFskp2 E3 ligase complex. Several lines of mediated knockdown ofE2F1 in human tumor cell lines evidence from both biochemical and genetic studies have reduces expression ofendogenous Skp2 gene. The hSRE2 shown that Skp2 is required for cell cycle progression at element not only participates in activation ofSkp2 multiple stages, including G1/S transition, S phase promoter function during normal cell cycle progression progression, and S/G2 transition (Deshaies, 1999; into S phase, it is also required for the high-level Skp2 Koepp et al., 1999; Nakayama et al., 2004). Skp2 gene expression in many human tumor cell lines. These knockout mice show cellular defects that include nuclear results reveal Skp2 as a novel target for E2F regulation enlargement, centrosome duplication, and polyploidy that is disrupted in several human tumor cell lines. (Nakayama et al., 2000). A principal substrate respon- Oncogene (2006) 25, 2615–2627. doi:10.1038/sj.onc.1209286; sible for the activity of Skp2 in these cell cycle phases is published online 5 December 2005 p27kip1, an inhibitor of cdk2 and cdk1 activities that promote entry into DNA synthesis and into mitosis, Keywords: transcription; SCFskp2; E2F; cell cycle respectively (Carrano et al., 1999; Sutterluty et al., 1999; Tsvetkov et al., 1999; Nakayama et al., 2000, 2004). Subsequently, several additional cell cycle regulatory proteins including Myc (Jin and Harper, 2003; Kim Introduction et al., 2003; von der Lehr et al., 2003; Amati, 2004), cyclin E (Yeh et al., 2001), p57kip2 (Kamura et al., 2003), WAP1 Ubiquitin-directed protein degradation plays an impor- p21 (Bornstein et al., 2003), p130 (Tedesco et al., tant role in regulating a broad spectrum of biological 2002; Bhattacharya et al., 2003), Cdt1 (Li et al., 2003), processes, including transcription, signal transduction, hOrc1p (Mendez et al., 2002), and E2F1 (Marti et al., cell cycle progression, apoptosis, cell growth and 1999) have also been reported as substrates of Skp2- differentiation, and development. Alterations in ubiqui- mediated protein degradation. tination (and deubiquitination) reactions are directly Like many cell cycle regulators, the Skp2 gene is linked to the pathogenesis of many diseases (Ciechan- periodically expressed throughout cell cycle (Zhang over and Schwartz, 2004). Proteins that are targeted for et al., 1995; Wirbelauer et al., 2000). Skp2 expression degradation by this mechanism undergo series of is lowest in quiescent cells and in early-mid G1 of cycling ubiquitin-modification steps carried out by the succes- cells. The level increases as cells approach the G1/S sive activity of E1 (activating), E2 (conjugating), and E3 transition and stays high during S phase before it starts (ligating) ubiquitin enzymes (Hershko and Ciechanover, to decrease in G2 and M phases. Both mRNA and 1998; Pickart and Eddins, 2004). SCF complexes belong protein levels of Skp2 are similarly regulated throughout to a large family of multi-subunit E3 ubiquitin ligases the cell cycle, although the level of protein expression is not completely dependent on the amount of mRNA present in cells (Wirbelauer et al., 2000; Bashir et al., Correspondence: Associate Professor C Wang, Center for Molecular 2004; Bashir and Pagano, 2004; Kurland and Tansey, Biology of Oral Diseases, University of Illinois at Chicago, 801 South 2004; Wei et al., 2004). This observation has led to the Paulina Street, Room 530E, m/c 860, Chicago, IL 60612, USA. E-mail: [email protected] discovery that the overall levels of Skp2 protein Received 14 July 2005; revised 4 October 2005; accepted 26 October expressed in cells are, in part, determined by changes 2005; published online 5 December 2005 in the rate of Skp2 degradation (stability) (Wirbelauer Regulation of human Skp2 promoter function L Zhang and C Wang 2616 et al., 2000; Bashir et al., 2004; Bashir and Pagano, 2004; 85) identified several potential regulatory elements Kurland and Tansey, 2004; Wei et al., 2004). To date, including binding sites for transcription factors c-Rel/ very little is known about the transcription regulation of NF-kap, AP1, SRY, Sp1, GATA, and E2F. Also shown Skp2 mRNA. A recent study by Imaki et al. (2003) has are the restriction sites used for constructing the CAT demonstrated that a GA-binding protein is involved in reporter vectors and the EMSA probes; these are regulating the promoter activity of the mouse Skp2 gene. indicated as N for NotI; S for SstII; A for ApaI, and P Owing to the central role of Skp2 in determining the for PstI throughout this report. To avoid complications degradation of a number of key cell cycle regulatory from possible translational effects, we removed the ATG proteins, aberrant Skp2 expression is thought to play translational start sequence at the 30 end of the DNA an active role in oncogenesis. Several additional lines fragment by using PstI(þ 212) restriction enzyme of evidence support this notion. Skp2 cooperates with digestion before inserting the B3.5-kb promoter frag- H-Ras in transforming primary rodent fibroblasts and ment into pKSCAT reporter plasmid to generate in inducing tumor formation in nude mice (Gstaiger p3CAT. In addition, we utilized both a 50- and a 30- et al., 2001). Ectopic expression of Skp2 blocks cell series of deletion constructs to locate important differentiation (Dow et al., 2001; Koga et al., 2003) and regulatory regions (Figure 2a). The promoter activity induces anchorage-independent cell growth (Carrano of these CAT constructs was evaluated following and Pagano, 2001). Skp2 expression is greatly induced in transient transfection into HeLa cells. As shown in a broad spectrum of human tumors and the levels of Figure 2b, the full-length sequence (p3CAT) possessed Skp2 mRNA and protein directly correlate with the high level promoter activity. Progressive deletion of the grade of malignancy (Latres et al., 2001; Bloom and B3.5 -kb of the 50 flanking region down to the SstII site Pagano, 2003; Oliveira et al., 2003). Given these links, at À59 had little effect on promoter activity (pSPCAT). very little is known about the molecular mechanisms By contrast, the 30- deletions results in substantial involved in the elevated Skp2 expression in malignant reduction in promoter activity when a specific region cells. In this report, we isolated and characterized a between þ 65 to þ 149 was deleted (cf pSACAT to 4237-bp human Skp2 promoter sequence, and identified pSNCAT). Consistent with the primer extension results, an E2F-responvie element, hSRE2, which plays a critical the region between þ 78 to þ 212 (del #19) did not have role in regulating the human Skp2 promoter activity in intrinsic promoter activity; however, this region con- both normal and transformed cells. tains the þ 65 to þ 149 segment that is critical for high level Skp2 promoter function.

Results Increased Skp2 promoter activity in transformed cells correlates with elevated Skp2 mRNA levels Isolation and characterization of human Skp2 promoter We screened a number of transformed human cell lines Skp2 mRNA and protein content is cell cycle regulated to identify those with increased Skp2 mRNA levels and with highest expression levels at the G1/S transition and Skp2 promoter activity compared to normal human early S phase. There is evidence that this regulation diploid fibroblast (HF) cells. As shown in Figure 3a, occurs at the transcriptional and post-translational three of the four transformed cell lines (HeLa, MG63, levels. Skp2 gene expression is constitutively elevated U343) have increased Skp2 mRNA levels compared to in many transformed human cells and primary tumors. the levels in normal fibroblast HF cells. Skp2 mRNA It seems likely that aberrant regulation at one or both of levels in the fourth transformed cell line, U87, were these levels may contribute to the transformed pheno- similar to the levels in HF cells. The southern analysis type. showed that the increased Skp2 content was not due to In order to evaluate the mechanisms and factors that gene amplification, but more likely reflected increased are involved in the transcriptional regulation of Skp2, transcription or mRNA stability. To distinguish these we isolated 4237 bp of the human Skp2 gene as two possibilities, we tested whether the Skp2 promoter described under Materials and methods. The sequence activity corresponded to the Skp2 mRNA levels in the of the 4237-bp PCR product has been submitted to transformed cell lines using transient transfection. We GenBank (Accession Number DQ021501). In Figure 1a, opted to use the pSPCAT promoter for these initial we show the proximal promoter sequence encompassing studies since its activity in HeLa cells is similar to the B500 bp upstream of the ATG translational start site of activity detected using the entire B3.5-kb promoter. We the human Skp2 gene. Comparison of the 4237-bp also evaluated the pSNCAT promoter activity since this human Skp2 promoter to that of mouse Skp2 promoter construct lacked the region critical for high-level reported by Imaki et al. (2003) revealed that the two promoter function and potentially represented the basal promoters shared strong sequence similarity (B67%) Skp2 promoter function. Finally, we included the SV40 only within the B500-bp proximal promoter regions early promoter (pSV40CAT) as a control for transfec- (see Discussion). Using primer extension analysis, we tion efficiency or variability in transcription activity of localized the transcription start site to a region 186-bp the cell lines. Strikingly, the Skp2 promoter pSPCAT upstream of the translational start site (Figure 1b). The that contained the region þ 65 to þ 212 was expressed human Skp2 promoter did not contain any recognizable at high levels in all three transformed cell lines that had TATAA and CCAAT box sequences. Comparison to a elevated Skp2 mRNA levels. By contrast, pSPCAT transcription factor binding site database (confidence of promoter activity was substantially lower in the U87

Oncogene Regulation of human Skp2 promoter function L Zhang and C Wang 2617

Figure 1 (a) Comparative alignment of the human (top) and mouse (bottom) Skp2 promoter sequences (B500-bp) upstream of the ATG translation start site (in rectangle box) is presented. Transcription start sites ( þ 1) are underlined in bold. Putative transcription factor binding sites in the human Skp2 promoter, which were identified by TRANSFAC database, are shown by bold highlighting and with arrows. Sequence similarities and gaps between the mouse and human sequences are indicated by colons and dashed lines, respectively. SstII: À59; NotI: þ 65; ApaI: þ 149; PstI: þ 212. (b) Identification of transcription start site in the human Skp2 promoter by primer extension analysis. and HF cell lines where Skp2 mRNA levels were low recognition sites identified through computer analysis of (Figure 3b). Collectively, these data support the notion transcription factor binding sites database; this raised that the increased Skp2 expression is associated with the possibility that E2F might play a major role in increased Skp2 promoter activity that leads to accumu- regulating Skp2 gene transcription in transformed cells. lation of Skp2 mRNA in these transformed cells. This notion is supported by the findings of dysregulation of expression/or activity of E2F family members in many human tumors. To explore this regulatory link E2Fpositively regulates Skp2 promoter between E2F and Skp2 genes, we examined whether E2F The increased Skp2 promoter activity in transformed controlled Skp2 gene expression and promoter activity. cells mapped to a minimum region from þ 65 to þ 212 First, we ectopically expressed E2F1 using adenovirus (Figure 2b). As noted in Figure 1b, the region from þ 65 infection of HF and U87 cells that normally have low to þ 212 contained two of the three putative E2F levels of Skp2 and E2F1. As shown in Figure 4a (left

Oncogene Regulation of human Skp2 promoter function L Zhang and C Wang 2618

Figure 2 (a) Schematic representation of 50 and 30 deletion constructs of the human Skp2 promoter-CAT reporter constructs. The coordinates of the Skp2 promoter present in each of the constructs are indicated in parenthesis. The restriction enzymes used in the construction of the smaller constructs, pSP, pSA, and pSN, are indicated by their first letter, that is, S refers to SstI, N refers to NotI, A refers to ApaI, and P refers to PstI. pKSCAT is Figure 3 (a) Top panel: Measurement of the levels of Skp2 the original CAT reporter vector lacking any promoter. (b) The mRNA in four human transformed (HeLa, MG63, U343, U87) promoter activity of these constructs was determined by CAT assay and nontransformed (HF) cell lines by Northern blot. 36B4 was following CaPO4 transient transfection into HeLa cells as used to normalize sample loading. In total, 20 mg of total RNA was described in Materials and methods. A total of 20 mg of DNA loaded per lane. Bottom panel: Determination of Skp2 gene copy containing 5 mg CAT reporter DNA was transfected along with number in these human cell lines by Southern blot. A total of 20 mg 1 mg b-gal (internal control). The amount of lysates used for CAT of EcoRI-digested genomic DNA from the indicated cell line was assays was normalized to the b-galactosidase activity. The relative used for the analysis as described in Materials and methods. CAT activity was calculated as the ratio of CAT activity from Hybridization to p27Kip1, a gene not amplified in human tumor promoter construct to the promoterless CAT construct, pKSCAT. cells, was used for normalization. (b) Measurement of Skp2 The data represent the mean of a minimum of three experiments. promoter activity in human cell lines. Cells were transiently The standard deviation is defined as the root mean square transfected with a total of 20 mg of DNA containing 2 mgof deviation of n 1 determinations. À pSPCAT, pSNCAT or pSV40CAT (without enhancer) as described in Materials and methods. The amount of lysates used for CAT assays was normalized to the b-galactosidase activity. The relative panel), there was a substantial increase in Skp2 mRNA CAT activity was determined as defined in the Figure 2 legend. The data represent the means of a minimum of three experiments. The levels in E2F1-expressing cells compared to control cells. standard deviation is defined as the root mean square deviation of To investigate the mechanism for E2F activation of nÀ1 determinations. Skp2 gene expression, we tested whether the E2F1 expression vector could transactivate the Skp2 promoter. We used pSPCAT, pSACAT, and pSNCAT reporter constructs to identify which, if any, of the promoter and supported that the effect of ectopic three putative E2F sites (referred to as human Skp2 E2F1 expression to induce endogenous Skp2 mRNA regulatory element hSRE in this report) were responsive expression (Figure 4a) occurred in part through to E2F transactivation (Figure 4b). The promoterless transcriptional activation of the Skp2 gene. pKSCAT, as well as a Myogenin promoter CAT construct (MyoG-CAT), were used as negative controls since neither is known to be transactivated by E2F1. As E2Fdirectly interacts within the human Skp2 promoter shown in Figure 4b, the pSPCAT construct that We next asked whether the effect of E2F on the human contained all three hSRE sites was transactivated by Skp2 promoter was a direct one. To address this E2F1. Deletion of hSRE3 (pSACAT) did not change the question, we first tested whether there was a direct transactivation ability; however, further deletion of the interaction between E2F and Skp2 promoter in vivo hSRE2 (pSNCAT) drastically reduced transactivation using chromatin immunoprecipitation (ChIP) assay by E2F1. As expected, neither the MyoG promoter nor (Figure 5). To this end, HeLa chromatin extract was the promoterless CAT vector could be transactivated by immunoprecipitated with E2F1 or E2F4 antibody and E2F1. Together, these data pointed to hSRE2 as a key analysed by PCR amplification using primers specific for element for the E2F responsiveness of the Skp2 the relevant Skp2 promoter region or for the myogenin

Oncogene Regulation of human Skp2 promoter function L Zhang and C Wang 2619

Figure 5 Demonstration of direct interaction between E2F and human Skp2 promoter in vivo. ChIP assay was performed on HeLa cells as described in Materials and methods. Opposing arrows indicates locations of the PCR primer sets used to speciﬁcally detect the human Skp2 promoter (top panel) and myogenin promoter (bottom panel) sequence in the chromatin samples.

initial study. As a positive control for E2F binding, we utilized the well-characterized E2F site from adenovirus E2 promoter (referred to as E2 probe in this study). As shown in Figure 6b, the E2 and NA probes readily formed nucleoprotein complex with GST-E2F1 and -DP proteins, whereas the SN or the AP probe had little or no binding. We used mutated E2 and NA probes to evaluate the sequence specificity of E2F/DP binding to the NA probe. Since E2F interacts with its DNA targets through the GCG core sequence, we replaced the GCG- rich nucleotides with TA to generate the mutant probes Figure 4 (a) Ectopic E2F1 expression induces expression of the (see legend, Figures 6c and 7a). As shown in Figure 6c, endogenous Skp2 gene. Human diploid fibroblast (HF) and human the adenovirus E2 site readily competed for binding of glioblastoma (U87) cell lines were infected with adenovirus containing either empty expression vector or E2F1 expression E2F/DP to the NA probe. However, mutation of the vector. The cells were collected and RNA was isolated at 20 h adenovirus E2F sequence (mE2) or of the Skp2 hSRE2 postinfection. A total of 25 mg of RNA was analysed by Northern sequence (mNA) completely abolished the ability of blot. The membrane was hybridized with cDNA probes specific for these DNAs to compete for E2F/DP binding to NA. human Skp2 and E2F1. The blot was reprobed with 36B4 to normalize sample loading. (b) Transactivation of the human Skp2 Likewise, the mNA DNA probe failed to form promoter by E2F1. Schematic shows the CAT reporter constructs. nucleoprotein complex with E2F/DP proteins. These To measure the effect of E2F on Skp2 promoter, HeLa cells were results confirmed and extended the ChIP and the cotransfected with 1 mg of either empty pcDNA3 expression vector transactivation studies that identified hSRE2 as a or E2F1 expression vector and 2 mg of human Skp2 promoter CAT critical cis-element for E2F activation of the Skp2 constructs or 10 mg of the human MyoG promoter CAT construct. The MyoG-CAT DNA contained 247 bp of the proximal promoter promoter. (À205 to þ 42) and serves as a negative control since it is We also investigated the binding of nuclear extracts to unresponsive to E2F1 transactivation. the hSRE2 site and compared them to binding of the extracts to the adenovirus consensus E2F site. Binding to the latter has been extensively characterized and promoter as a negative control. As expected, the results in the formation of three distinct E2F-containing myogenin promoter that is not regulated by E2F was nucleoprotein complexes; in order of mobility, they are not detected in the immunoprecipitated chromatin. the S phase complex, the G0/G1 complex, and the free However, the Skp2 promoter was present within this E2F heterodimers (Figure 6d, left panel). We have fraction, confirming that E2F family members regulate confirmed the identity of each of these three complexes the Skp2 promoter in vivo. by supershift or blocking EMSA assay with antibodies Data presented in Figures 4 and 5 strongly indicated a specific for each complex as have been previously direct association of E2F proteins to the hSRE contain- described (Devoto et al., 1992; Lees et al., 1992; Smith ing proximal promoter region of the human Skp2 gene. et al., 1996). The NA fragment containing only the To map which of the three hSRE sites were recognized hSRE2 site was able to compete for the formation of all by E2F, we utilized three DNA probes each containing a three complexes, whereas the mNA, SA, and AP single hSRE: SN (hSRE1), NA (hSRE2), AP (hSRE3) in fragments were unable to compete for binding EMSA studies (Figure 6a). Since E2F binds DNA as a (Figure 6d, left panel). heterodimer with E2F-related DP protein, we used Direct binding of the nuclear extracts to hSRE2 probe purified GST-E2F1 and -DP1 as a protein source in the resulted in the formation of two complexes (A and B)

Oncogene Regulation of human Skp2 promoter function L Zhang and C Wang 2620 with different mobility than the complexes detected with adenovirus E2F site. The sequence speciﬁcity of complex the E2 probe (Figure 6d, right panel). Of these two A was conﬁrmed by the ability of NA, but not the complexes, only complex B was competed by the mutated hSRE2 site (mNA) to compete for formation of

Oncogene Regulation of human Skp2 promoter function L Zhang and C Wang 2621 the complex. Inclusion of an antibody specific for DP1, the Skp2 promoter by E2F1. By contrast, mutation of a heterodimeric partner of most E2F members, effec- hSRE2 in any context abolished the transactivation of tively blocked formation of the complex B, but not the Skp2 promoter in the pSPCAT constructs, for complex A (Figure 6e). To determine that E2F was example, mpSPCAT-2, mpSPCAT-1/2, and mpSPCAT- present in complex A, we extracted proteins from 2/3. These data unequivocally confirmed the essential complex A and analysed their content by Western blot role of hSRE2 element in mediating activation of the using antibodies to E2F1 and E2F4. As shown in Skp2 promoter by E2F1 and ruled out an ancillary role Figure 6e (inset), both E2F1 and E2F4 were indeed for the other E2F sites. present in complex A (inset, lane1). As a negative Since E2F1 activity and Skp2 expression is increased control, we did not detect E2F proteins from lanes that during progression from G1 to S phase, we evaluated the contained only nuclear extract without DNA probe role of the E2F response element hSRE2 in cell-cycle- (inset, lane2). Using the same assay, we tested for the dependent activation of the Skp2 promoter. NIH3T3 presence of additional proteins that are known to be cell line stably transfected with pSPCAT constructs with present in E2F-containing nucleoprotein complexes. either intact or a mutated hSRE2 element (mpSPCAT-2) Although we could detect DP1 in complex A, we were were used for this study. Cells were synchronized to not able to detect the presence of the other proteins (e.g., quiescence by serum deprivation followed by release Sp1, p130, p107, pRB, cyclin A, and cdk2) that we into cell cycle by the addition of serum. At various times examined (data not shown). Previous studies of non- after addition of serum, RNA was isolated and the levels consensus E2F-binding sites have also identified com- of CAT mRNA and endogenous Skp2 mRNA were plexes that contain E2F and DP1 but lack other proteins measured (Figure 7b). We observed an induction of the usually associated with E2F complexes (Weinmann CAT mRNA levels from the wild-type construct in a et al., 2001; Wells et al., 2002). We could not detect time-dependent manner parallel to that of the endogen- formation of complexes A or B using hSRE1 or hSRE3 ous Skp2 mRNA levels. By contrast, mutation of probes with the same extracts (data not shown). hSRE2 significantly impaired activation of the Skp2 Collectively, these DNA-binding analyses support a promoter during the G1 to S phase transition, support- role for the hSRE2 in E2F interaction with the human ing a role for hSRE2 and E2F in cell-cycle-dependent Skp2 promoter, and the importance of the GCG core activation of Skp2. sequence of hSRE2 for recognition by E2F-containing Next, we examined if hSRE2 was required for the complexes. increased Skp2 promoter activity observed in the Skp2 overexpressing transformed cell lines, HeLa, MG63, and U343 (Figure 3b). Mutation of hSRE2 drastically Role of hSRE2 in human Skp2 promoter function reduced the relative levels of promoter activities in these While neither hSRE1- nor hSRE3-containing DNA transformed cell lines (Figure 7c). By contrast, there was fragment was capable of forming nucleoprotein com- little effect of the mutation on promoter activity in plexes with purified E2F/DP1 or nuclear extracts by in normal human fibroblasts (HF). Finally, we found that vitro EMSA analysis, we could not exclude the there was a substantial increase in expression of several possibility that either one could have a supporting role E2F family members (E2F1-3) in the HeLa, MG63, and in regulating the Skp2 promoter. Thus, we created a U343 transformed cell lines compared to normal human series of pSPCAT constructs that contained mutations HF cells (Figure 7d, left panel). This was reflected in the of the core GCG sequence of each hSRE or various amount of E2F complexes A and B that could be combinations (Figure 7a, top panel). To assay the effects detected when nuclear extracts from the transformed of these mutations, E2F1 transactivation assays of the cells were analysed for binding to hSRE2 site by EMSA Skp2 promoter were conducted in HeLa cells. As shown (Figure 7d, right panel). We also find increased levels of in the bottom panel of Figure 7a, mutation of hSRE1, complexes A and B from additional human tumor cell hSRE3, or both had no effect on the transactivation of lines that express high levels of E2F and Skp2, including

Figure 6 (a) Schematic illustration of the DNA probes used to analyze DNA–protein interaction by EMSA. SN, NA, and AP probes contained single hSRE1, hSRE2 site, and hSRE3 site of the human Skp2 promoter, respectively. The mNA probe is identical to NA except that the central GCG core of hSRE2 has been mutated to TAT (see Figure 7a). (b) Binding of purified GST-E2F1/GST-DP1 proteins to hSRE sites and the adenovirus E2F site. The E2 probe contained two tandem copies of a consensus E2F site derived from the E2 adenovirus promoter (TTTCGCGGCAAAAAGGATTTGGCGCGTAAAA). Equal amounts of purified GST-E2F1 and GST-DP1 were incubated with radiolabeled DNA probe in the EMSA reaction, and protein–DNA complexes were analysed as described in Materials and methods. (c) Left panel: sequence specificity of binding is shown by competing for GST-E2F1/GST-DP1 heterodimer binding to labeled hSRE2 probe (NA) with excess amount of unlabeled wild-type E2, mE2 (TTTCGAAACAAAAAG GATTTGGAAAGTAAAA), and mNA. Right panel: analysis of GST-E2F/DP interaction with mNA probe containing a mutated hSRE2 site. (d) Binding of the nuclear extract proteins to hSRE2. Sequence-specific recognition of the consensus adenovirus E2 (left panel) or NA (right panel) probes by nuclear extracts prepared from NIH3T3 cells. Nuclear extract (10 mg) was incubated with radiolabeled DNA probe in the EMSA reaction and analysed as described in Materials and methods. Specificity of protein binding to each sequence was assessed by inclusion of excess unlabeled DNA as indicated. (e) E2F is present in complexes A and B as determined by DP1 blocking antibody (complex B) and by Western blot (complex A, inset). HeLa nuclear extract (5 mg) was incubated with antibody against DP1 for 10 min prior to the addition of radiolabeled DNA probe. Inset: Western blot detection of E2F1 and E2F4 proteins in protein samples extracted from complex A as described in Materials and methods. Lane 1, hSRE2 þ extract; lane 2, extract alone.

Oncogene Regulation of human Skp2 promoter function L Zhang and C Wang 2622 U2OS (osteosarcoma), RD (embryonal rhabdomyosar- mechanistic basis linking elevated E2F expression to coma), and RH30 (alveolar rhabdomyosarcoma) (data increased activation of the Skp2 promoter in many not shown). Taken together, these data suggest a transformed cells.

Oncogene Regulation of human Skp2 promoter function L Zhang and C Wang 2623 Finally, we evaluated whether E2F activity is required for high-level Skp2 expression. In the first approach, we reduced endogenous E2F activity through ectopic expression of RB, a repressor of E2F activity, in C33A cells. These cells lack endogenous RB and have been previously utilized to study E2F activity (Ross et al., 2001). As shown in Figure 8a, the E2F-responsive Skp2 promoter (pSACAT) had high-level activity in C33A cells. This activity was greatly reduced by RB expression. By contrast, the low-level activity of the Skp2 promoter lacking the hSRE2 (pSNCAT) was not affected by RB expression. In the second approach, we used previously described specific AS-ODN (Simile et al., 2004) to knockdown expression of E2F1 in HeLa cells. As shown in Figure 8b, Skp2 mRNA and protein levels were substantially reduced when E2F1 levels were Figure 8 (a) Inhibition of endogenous E2F-dependent transactivation of Skp2 promoter activity by RB. C33A cells were reduced by transfection of E2F1 AS-ODN. By contrast, cotransfected with 2 mg of human Skp2 promoter CAT constructs transfection of S-ODN or unrelated control ODN had (pSACAT and pSNCAT) with either empty pcDNA3 expres- no effect on Skp2 mRNA or protein expression sion vector (15 mg) or RB expression vector (10 or 15 mg). The rela- (Figure 8b). Similar results were observed in C33A cell tive CAT activity was calculated as ratio of CAT activity from line (data not shown). Thus, endogenous E2F1 activity cells transfected with Skp2 promoter CAT construct to that of pKS-CAT construct. Values shown represent means of a minimum is required for the high-level Skp2 expression associated of three experiments. The standard deviation is defined as the root with human tumor cells as well as for high-level human mean square deviation of nÀ1 determinations. (b) Inhibition of Skp2 promoter activity. Skp2 gene transcription by downregulating E2F1 expression. Duplicate plates of HeLa cells were MOCK transfected or transfected with E2F1 antisense oligonucleotides (AS-ODN), sense oligonucleotides (S-ODN), and control ODN under condition described in Materials and methods. At 48 h post-transfection, one Discussion set was used to prepare protein extract for Western blot analysis (top panel) and the other set was used to prepare total RNA for The SCFSkp2 E3 ligase complex is a critical regulator of Northern blot analysis. cell cycle progression that targets several G1/S cell cycle regulators for degradation. Skp2, the substrate-binding subunit of the E3 ligase, determines the specificity of this Presently, the precise mechanisms involved in Skp2 complex and plays a key role in targeting proteins for upregulation in tumors remain poorly understood. 26S-proteasome-mediated degradation. Expression of Recent studies have reported that the entire chromo- Skp2 leads to the degradation of the major G1 cyclin some 5 or a region of chromosome 5 containing the kinase inhibitor p27Kip1 that controls G1/S transition by Skp2 gene is amplified in selective human tumors inhibiting cyclin A/E-associated cdk2 complexes. Given (Dowen et al., 2003; Yokoi et al., 2004; Coe et al., Skp2’s central role in promoting S phase entry, aberrant 2005). Thus, in some cases, amplification of the Skp2 activation of Skp2 gene expression is detected in a large gene results in higher expression of this gene in tumor number of human cancers and the level of Skp2 cells. However, gene amplification is largely detected in activation is strongly correlated with tumor aggression tumors at metastatic stage, whereas an increased level of and poor prognosis. Thus, identification of the regula- Skp2 expression can be readily detected in tumors even tory mechanism(s) leading to increased Skp2 expression at early dysplastic stages. Thus, Skp2 gene amplification may offer new insight into the control of tumor cell is likely to be associated with advanced stage of proliferation. tumor progression while other control mechanisms not

Figure 7 (a) Mutational analysis of Skp2 promoter. Top panel: schematic illustration of the sequences and positions of the wild-type and mutant hSREs within the pSPCAT construct. The lower inset shows the speciﬁc mutation of each hSRE site (underlined). Bottom panel: effect of hSRE mutations on E2F1 transactivation of the human Skp2 promoter. HeLa cells were cotransfected with 2 mg of the indicated CAT reporter constructs with 1 mg pcDNA3 empty expression vector or E2F1 expression vector. Fold activation was calculated as the ratio of CAT activity from cells transfected with E2F expression vector to empty expression vector. Values shown represent means of a minimum of three experiments. The standard deviation is deﬁned as the root mean square deviation of nÀ1 determinations. (b) Role of hSRE2 in regulating cell-cycle-dependent gene expression. Pooled NIH3T3 cells that stably expressed pSPCAT construct containing wild-type or mutant hSRE2 element were synchronized to G0 by 30 h-serum starvation before releasing back to cell cycle by addition of serum. At the indicated time points after addition of serum, polyA þ RNA was prepared from cells and analysed for expression of CAT mRNA and endogenous Skp2 mRNA levels by Northern blot hybridization. The membrane was rehybridized with 36B4 DNA for normalization of sample loading. (c) Loss of high-level promoter activity in Skp2 expressing tumor cell lines due to hSRE2 mutation. The CAT assay and calculation of relative CAT activity were carried out as described in the Figure 2 legend. (d) Left panel: comparative analysis of the levels of E2F and DP protein expression in untransformed (HF) and transformed (HeLa, MG63, U343) cell lines. Right panel: EMSA analysis on the binding of the nuclear extract proteins (5 mg) from these cell lines to hSRE2 DNA probe. Condition used in this analysis was the same as described in Figure 6d and Materials and methods.

Oncogene Regulation of human Skp2 promoter function L Zhang and C Wang 2624 involving a gross genomic alteration are involved in the both active (e.g., E2F1) and repressive (e.g. E2F4) E2Fs initial accumulation of Skp2 mRNA during oncogen- with the Skp2 promoter using in vitro EMSA and in vivo esis. This implies a change in the rate of either ChIP assays. transcription or mRNA degradation. Our preliminary The role of E2F in regulating the transcription of analysis reveals no significant difference in the half-life genes that play a critical role in cell cycle progression of Skp2 mRNA between nontransformed and trans- (e.g., G1/S transition) and DNA replication is well formed human cell lines (Zhang and Wang, unpublished established. Cell-cycle-dependent gene activation by result). Therefore, one plausible mechanism is a E2F at the G1–S transition is principally determined dysregulated Skp2 promoter function. through its association with the pocket proteins (pRB, In this report, we show for the first time that Skp2 p107, p130) (Helin et al., 1993; Qin et al., 1995; Frolov promoter has increased activity in human tumor cell and Dyson, 2004). However, there is now increasing lines. Several lines of evidence indicates that E2F family evidence to suggest that E2F may interact with other members are directly involved in this aberrant activa- regulatory proteins in complexes that target promoters tion: we have demonstrated that (1) there is a good through noncanonical E2F DNA-binding sites (Kel correlation between elevated E2F levels and Skp2 et al., 2001; Muller et al., 2001; Weinmann et al., 2001). mRNA levels in human tumor cell lines, (2) a direct In this report, we have shown that a unique E2F- activation of the human Skp2 promoter by E2F1 in containing protein complex A binds to the hSRE2 site of transient transactivation assays suggests that the effect the Skp2 promoter. Although this complex is not of increased E2F either in tumor cells or in ectopic competed by the canonical adenoviral E2F-binding site, expressing cells result from transcriptional activation, mutation of the hSRE2 central GCG core sequence, (3) E2F containing complexes bound to the Skp2 characteristic for E2F binding, disrupts binding to promoter can be detected in vivo using the ChIP assay, hSRE2. The behavior of complex A is similar to a and direct binding of GST-E2F/DP heterodimers to the previously described E2F-containing protein complex Skp2 promoter identifies hSRE2 site as critical for this that interacts specifically with the b-myb promoter binding, (4) a role of E2F activation of Skp2 promoter (Weinmann et al., 2001). In that study, the complex in in transformed cells is indicated by our finding that question was effectively competed only by atypical E2F mutation of the hSRE2 strongly reduces Skp2 promoter DNA-binding sequences identified from E2F ChIP activity in tumor cells, (5) ectopic expression of E2F1 assay, and does not appear to contain typical E2F- increases endogenous Skp2 mRNA content in normal interacting proteins such as pRB or other pocket human diploid fibroblasts, and (6) inhibition of E2F1 proteins. Other studies using ChIP assays have revealed activity by RB expression or by E2F1 antisense that many E2F bound promoters do not contain oligonucleotides significantly reduces Skp2 mRNA elements closely matching to E2F consensus sequences levels in human tumor cell lines. (Weinmann et al., 2001; Wells et al., 2002). Thus, there Functional studies using deletion and mutation is a growing evidence to support an expanded model of strategies indicate that the hSRE2 site in the 50 E2F action involving combinations of novel positive untranslated region of exon 1 is critical for the and negative regulatory E2F-interacting proteins other activation of the Skp2 promoter by E2F in both normal than pocket proteins bound to E2F-binding sites. and transformed cells (Figure 7). It is rare but not Presumably, these are responsible for determining unprecedented for cell cycle genes to be transcriptionally variable E2F target gene expression at different stages regulated by factors acting downstream of the transcrip- of the cell cycle, and have been hypothesized to also play tion start site (Kel et al., 2001). Studies of a large a role in regulating non-cell-cycle-associated gene number of well-characterized E2F target genes suggest expression. that, in general, E2F regulates cell-cycle-dependent gene It is intriguing that the Skp2 promoter is activated by expression by three modes of action: active induction, E2F1 since one of the targets of Skp2-mediated derepression, and active repression (Dyson, 1998; degradation during the late stages of S phase is E2F1 Koziczak et al., 2000; Muller et al., 2001). In the active (Marti et al., 1999). Our results suggest a novel induction model, a mutation of the E2F site prevents regulatory feedback loop between Skp2 and E2F in binding of active E2Fs (e.g., E2F1-3), thus leading to a normal cell cycle progression, where E2F and Skp2 loss of transcriptional activation by E2F. By contrast, a mutually control the expression of each other. The mutation of the E2F site in both derepression and active coupling of E2F1 as the positive regulator of Skp2 repression models results in early and/or constitutive expression at G1/S boundary with Skp2 as the negative activation of the promoter function. In our study, we effector on E2F1 degradation in late S phase would showed that the mutation of the hSRE2 site in the Skp2 serve as vital checkpoint control on cell cycle progres- promoter did not increase promoter activity in normal sion. Disruption of this regulatory loop may play a cells and greatly reduced promoter activity in tumor significant role in uncontrolled cell proliferation in cells. Thus, we believe that E2F most likely regulates human tumor cells. Indeed, many human tumors exhibit Skp2 promoter function through an active induction elevated expression of both E2F and Skp2 genes. mechanism where gene transcription is induced upon Disruption of the E2F/RB regulatory pathway is known replacement of repressive E2Fs (e.g., E2F4-5) by active to be a major contributor to increased E2F action in E2Fs (e.g., E2F1-3). This notion is supported by our many human tumors. Our finding that E2F directly finding in asynchronous cells of a direct interaction of controls the Skp2 promoter offers a novel mechanism

Oncogene Regulation of human Skp2 promoter function L Zhang and C Wang 2625 for the upregulated Skp2 expression seen in tumor cells. Chicago), human p27kip1 cDNA from Dr Kei-ichi Nakayama Given the regulatory loop mentioned above, one might (Medical Institute of Bioregulation, Kyushu University, question why the elevated Skp2 expression in tumors Fukuoka, Japan), and human p45Skp2 from Dr Hideyo Yasuda does not lead to increased degradation of E2F and (Tokyo University of Pharmacy and Life Sciences, Japan). ultimately low E2F level in tumor cells. It is presently Adenoviruses containing CMV-expression vector and CMV- E2F vector were obtained from Dr Srilata Bagchi. Antibodies unknown whether the E2F proteins are more stable in against E2F-1 (KH95) and E2F4 (C-108) for ChIP and against tumor cells with elevated Skp2. Moreover, ubiquitina- DP-1 (K-20) for EMSA were from Santa Cruz. The promoter tion and degradation of E2F1 has been shown to also for human Skp2 gene was obtained by PCR amplification of occur by Skp2-independent mechanism (Ohta and human diploid fibroblast genomic DNA using the following Xiong, 2001). Thus, the proposed regulatory loop does primers: (forward) 50 ACCAAGAGCTGAGTTGGCGA 30 not need to be a closed or exclusive loop. Since tumor and 50 GAGAGAGACAGGGCAATCATACAC 30 (reverse). cells frequently exploit multiple mechanisms to evade The PCR reaction was carried out in the following steps: 1 one normal regulatory processes that limit uncontrolled cell cycle at 941C for 40 s-35 cycles of denaturing (941C/40 s), - proliferation, it will not be surprising if a dysregulation annealing (551C/1 min) and extension (721C/4 min) 1 cycle 1 of Skp2-dependent and/or -independent destruction of 72 C at 5 min. The DNA sequence of two independent clones was compared to the NIH and Celera databases to verify the E2F does exist. Future studies will be needed to address identity and accuracy of our PCR products. these possibilities and determine the mechanisms involved. Although the sequence of the proximal 500 nts of the Cell culture mouse and human Skp2 promoters is highly conserved, All cell lines were maintained in Dulbecco’s modified Eagle’s it is notable that there are differences in nearly all high glucose medium supplemented with 200 U/ml of peni- putative transcription factor-binding sites identified in cillin, 50 mg/ ml of streptomycin, 1 mM glutamine, and 10% (v/v) the TRANSFAC database (Figure 1a). While this study bovine calf serum (NIH3T3 cells) or 10% fetal bovine serum of the human promoter points to the region downstream (HeLa, MG63, U343, U87, human foreskin diploid fibroblast of the transcription start site as critical for high-level HF). NIH3T3 cells stably expressing CAT reporter constructs and cell cycle expression, a previous study of the mouse were established by CaPO4 transfection method followed by promoter points to the region upstream of the tran- 3 weeks of 400 mg/ml G418 drug selection. Both clonal cell lines scription start site. In the later study, a GABP response and pooled cells were prepared and analysed to show similar element is identified as the critical element for mouse findings. For synchronized cell studies, the cells were arrested in G0 state by maintaining cells at 0.5% serum in methinoine- promoter function (Imaki et al., 2003). We cannot free media for 30 h. To induce re-entry into cell cycle, cells were reconcile this difference of their finding to ours that rinsed with PBS and fed with 10% serum containing media. At shows an E2F response element (hSRE2) as crucial for various time points, cells were collected and poly A þ -mRNA human promoter function. However, it is notable that was prepared using RNA purification kit from Ambion under the sequences for the GABP and E2F response elements, conditions recommended by the manufacturer. The RNA was although present in similar positions of the mouse and analysed for Skp2, CAT, and 36B4 mRNA by Northern blot human promoters, are not identical. Thus, it is possible analysis. that these factors may not be able to recognize and regulate the different promoters. This might suggest that Primer extension analysis different regulatory mechanisms exist for the cell cycle The primer extension analysis was performed under conditions regulatory response in different species. If true, this recommended by the manufacturer (Promega). Reverse might account for some aspects of the well-known transcription was carried out in the presence of 10 mg of poly failure of successful murine tumor therapies when (A) þ mRNA isolated from RH4 cells and 1 ng end-labeled Skp2 gene specific reverse primer (50 TTTAAAATACGTG translating into treatment for human tumors. Clearly, 0 additional studies are required to address these intri- CATTAA 3 ). In the parallel reaction, dideoxynucleotide- based sequencing analysis was carried out using the same guing findings. Finally, it should be noted that our reverse primer and human Skp2 promoter fragment as the results are in agreement with and validate the results DNA template. Products from the sequencing and extension of Vernell et al. (2003) who reported that Skp2 was a reactions were analysed together by 6% denatured urea- target for E2F activation in asynchronous cultures. It is polyacrylamide gel electrophoresis. The gel was then dried and not clear why other studies searching for E2F targets exposed to X-ray film. Same results were obtained from primer using ChIP-coupled microarray technology were extension analysis using RNA samples isolated from other not able to identify Skp2 (Ren et al., 2002; Weinmann human cell lines (e.g., HF, HeLa, U343, UU87). et al., 2002). Clearly, these types of global strategies cannot be expected to identify all targets and the results CAT assay are critically dependent on the experimental paradigm For transient transfection, cells (HeLa, MG63, U343, U87, used to design the study as suggested by Vernell et al. HF) were plated at a density of 1 Â 106 cells per 100 mm tissue culture dish 24 h prior to transfection. Transient transfection was carried out with a total of 20 mg of DNA that includes 1–3 mgofb-galactosidase DNA (LacZ) driven by CMV promoter Materials and methods as an internal standard for monitoring transfection efficiency. Cells were exposed to DNA-CaPO4 precipitate for 17 h before Reagents they were transferred to growth medium for an additional We obtained DNA constructs containing CMV-E2F and 30–48 h. Cell lysates for LacZ and CAT assays were prepared CMV-RB from Dr Srilata Bagchi (University of Illinois at as described previously (Ausubel, 1990; Cao and Wang, 2000).

Oncogene Regulation of human Skp2 promoter function L Zhang and C Wang 2626 Deacetylase activity was inactivated by heating the lysates to Site-directed mutagenesis 601C for 7 min. (Mercola et al., 1985). A typical CAT assay We used the Quick change in vitro mutagenesis system to reaction mixture consisted of 0.7 mg Acetyl-CoA, 0.2 mCi of generate various mutant constructs under the conditions [C14]chloramphenicol (1 Ci ¼ 37 GBq), and cell lysates in a final recommended by the supplier (Stratagene). All the constructs volume of 200 ml. The amount of cell lysate used in each CAT made using this method were verified by DNA sequence reaction was standardized by the b-galactosidase activity. analysis. The sequences of the primers containing mutations Routine CAT assays were carried out at 371C for 1–3 h and (top strand shown) were: 50 GGTATCTCGAAGATAGGTA terminated by extraction with 1 ml of ice-cold ethyl acetate. AAGCTGC 30 (mE2F-A); 50 GTAGAGCCTTGCTATCGCA Overnight incubation was used when the transfection efficiency GTGG 30 (mE2F-B); 50 GCCGCCGCATACCAAAGCGG of a particular cell line was low. Quantitative analysis of CAT GAATC 30 (mE2F-C). activity was carried out by phosphoimager analysis. ChIP E2F-ChIP analysis was carried out using conditions previously EMSA described (Weinmann et al., 2001). In brief, a total of 1 Â 108 EMSA was performed by preincubating bacterial expressed HeLa cells were used for each immunoprecipitation reaction. GST-fusion protein (50 ng) or nuclear extract (5–10 mg) with Cells were crosslinked with 1% formaldehyde followed by nonspecific salmon sperm DNA (0.05 mg/ml) in a binding chromatin isolation. Genomic DNA in the extract was buffer containing 20 mM HEPES pH 7.4, 0.5 mM EDTA, 10% sonicated to achieve an average of 500 bp in length and glycerol, 5 mM DTT, 1 mM MgCl2, and 50 mM KCl for 5 min 32 snapped frozen for storage until use. Extract containing on ice. Routinely, 0.2 ng of a P-labeled DNA probe prepared sheared DNA was precleared with protein-G before specific by Klenow end labeling was added to the EMSA reaction antibody against E2F1 or E2F4 (1–3 mg/ml) were added to the mixture and allowed to form DNA–protein complexes during extract. A fraction of the precleared extract served as total a 20-min incubation at room temperature. The reaction input control. Immunoprecipitated protein–DNA complexes complex was subjected to electrophoresis on a 4% native were de-crosslinked and protein components removed by 1 polyacrylamide gel at 4 C in 0.25 Â Tris-Boric acid buffers at Proteinase K digestion. The released genomic DNA fragment 200 V until the bromophenol blue dye reached the bottom. Gel was purified by PCR-purification kit under the condition was dried and autoradiographed. E2F proteins were detected recommended by the manufacturer (Qiagen). in complex A using EMSA and Western blot analysis. On a PCR primers used for detecting hSkp2 promoter ChIP in preparative EMSA gel, we ran the nuclear extract with and HeLa cells were: 50 GAGAGAGACAGGGCAATCATACAC without the DNA probe in separate lanes. Following 30 (forward) and 50 ATCACCAGAAGGCCTGCGGGCT 30 visualization of complex A by autoradiography, we cut out (reverse). PCR primers used for detecting human Myogenin analogous portions of the two samples from the gel and promoter were: 50 TGCACAGGAGCCCGCCTGGGCCAG isolated the proteins from each. The samples were then 30 (forward) 50 AACCTGAGCCCCCTCTAAGCTG 30(re- subjected to SDS-PAGE followed by Western blot analysis verse). using antibodies specific for E2F1 or E2F4. Antisense oligonucleotide (AS-ODN) and transfection Northern and Southern hybridization The AS-ODNs used to knockdown E2F1 and E2F4 were Total RNA was prepared from culture cells by Trizol synthesized as s-oligonucleotides and purified by HPLC, as extraction method according to the manufacturer’s recom- previously described (Simile et al., 2004). AS-ODN sequence mendations (Invitrogen). Total RNA isolated from cells was for E2F1 was 50 TAGATCCGATCCAGCTCAGTGACA 30. denatured, electrophoresed on a formaldehyde–agarose gel, Control ODNs contained the sense sequence complementary and blotted to nitrocellulose membrane. For normalization of to AS-ODN and unrelated sequences 50 CAGGTCTTTCATC sample loading, membrane was stripped and hybridized with TAGAACGATGCGGG 30. HeLa cells were plated in six-well nick-translated 36B4 DNA probe. Total genomic DNA was dish at 2 Â 105 cells/well 1 day before transfection. Cells were prepared as previously described (Blin and Stafford, 1976). A transfected with 200 nM antisense, sense, or control ODN by total of 20 mg of genomic DNA from different human cell lines lipofectamine method as recommended by the manufacturer was digested to completion with EcoRI. Digested DNA was (Invitrogen). Cells were harvested 48 h post-transfection to size-fractionated by agarose gel electrophoresis and transferred check the expression levels of the mRNA and protein. to nitrocellulose membrane. The membrane was hybridized to nick-translated Skp2 DNA probe that detected a 3891-bp Acknowledgements DNA fragment corresponding to nucleotide positions 69 278–73 169 of the human Skp2 gene (AC008942.6). For We thank Drs Reed Graves, Peter Tontonoz, and Charles normalization, membrane was stripped and hybridized with Stiles for their critical review of this manuscript. We also like nick-translated p27kip1 DNA probe that detected a 12.7 kb to thank Ms Galina Grechkina for her technical support in fragment corresponding to nucleotide positions 4561–17 281 of EMSA analysis. The work is supported by grant from NIH the human p27kip1 gene (AC008115.3). (CA074907).

References

Amati B. (2004). Proc Natl Acad Sci USA 101: 8843–8844. Bashir T, Dorrello NV, Amador V, Guardavaccaro D, Pagano M. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman (2004). Nature 428: 190–193. JG, Smith JA et al. (eds). (1990). Current Protocols in Bashir T, Pagano M. (2004). Cell Cycle 3: 850–852. Molecular Biology (Green and Siley-Interscience, New Bhattacharya S, Garriga J, Calbo J, Yong T, Haines DS, York), Vol. 1. Grana X. (2003). Oncogene 22: 2443–2451. Bai C, Sen P, Hofmann K, Ma L, Goebl M, Harper JW et al. Blin N, Stafford DW. (1976). Nucleic Acid Res 3: 2303–2307. (1996). Cell 86: 263–274. Bloom J, Pagano M. (2003). Semin Cancer Biol 13: 41–47.

Oncogene Regulation of human Skp2 promoter function L Zhang and C Wang 2627 Bornstein G, Bloom J, Sitry-Shevah D, Nakayama K, Pagano M, Mercola M, Goverman J, Mirell C, Calame K. (1985). Science Hershko A. (2003). J Biol Chem 278: 25752–25757. 227: 266–270. Cao Y, Wang C. (2000). J Biol Chem 275: 9854–9862. Muller H, Bracken AP, Vernell R, Moroni MC, Christians F, Carrano AC, Eytan E, Hershko A, Pagano M. (1999). Nat Cell Grassilli E et al. (2001). Genes Dev 15: 267–285. Biol 1: 193–199. Nakayama K, Nagahama H, Minamishima YA, Matsumoto M, Carrano AC, Pagano M. (2001). J Cell Biol 153: 1381–1390. Nakamichi I, Kitagawa K et al. (2000). EMBO J 19: 2069– Ciechanover A, Schwartz AL. (2004). Biochim Biophys Acta 2081. 1695: 3–17. Nakayama K, Nagahama H, Minamishima YA, Miyake S, Coe BP, Henderson LJ, Garnis C, Tsao MS, Gazdar AF, Ishida N, Hatakeyama S et al. (2004). Dev Cell 6: 661–672. Minna J et al. (2005). Genes Chromosomes Cancer 42: Ohta T, Xiong Y. (2001). Cancer Res 61: 1347–1353. 308–313. Oliveira AM, Okuno SH, Nascimento AG, Lloyd RV. (2003). Deshaies RJ. (1999). Annu Rev Cell Dev Biol 15: 435–467. J Clin Oncol 21: 722–727. Devoto SH, Mudryj M, Pines J, Hunter T, Nevins JR. (1992). Pickart CM, Eddins MJ. (2004). Biochim Biophys Acta 1695: Cell 68: 167–176. 55–72. Dow R, Hendley J, Pirkmaier A, Musgrove EA, Germain D. Qin XQ, Livingston DM, Ewen M, Sellers WR, Arany Z, (2001). J Biol Chem 276: 45945–45951. Kaelin Jr WG. (1995). Mol Cell Biol 15: 742–755. Dowen SE, Neutze DM, Pett MR, Cottage A, Stern P, Ren B, Cam H, Takahashi Y, Volkert T, Terragni J, Young RA Coleman N et al. (2003). Oncogene 22: 2531–2540. et al. (2002). Genes Dev 16: 245–256. Dyson N. (1998). Genes Dev 12: 2245–2262. Ross JF, Naar A, Cam H, Gregory R, Dynlacht BD. (2001). Frolov MV, Dyson NJ. (2004). J Cell Sci 117: 2173–2181. Genes Dev 15: 392–397. Gstaiger M, Jordan R, Lim M, Catzavelos C, Mestan J, Simile MM, De Miglio MR, Muroni MR, Frau M, Asara G, Slingerland J et al. (2001). Proc Natl Acad Sci USA 98: Serra S et al. (2004). Carcinogenesis 25: 333–341. 5043–5048. Smith EJ, Leone G, DeGregori J, Jakoi L, Nevins JR. (1996). Helin K, Harlow E, Fattaey A. (1993). Mol Cell Biol 13: Mol Cell Biol 16: 6965–6976. 6501–6508. Sutterluty H, Chatelain E, Marti A, Wirbelauer C, Senften M, Hershko A, Ciechanover A. (1998). Annu Rev Biochem 67: Muller U et al. (1999). Nat Cell Biol 1: 207–214. 425–479. Tedesco D, Lukas J, Reed SI. (2002). Genes Dev 16: Imaki H, Nakayama K, Delehouzee S, Handa H, Kitagawa M, 2946–2957. Kamura T et al. (2003). Cancer Res 63: 4607–4613. Tsvetkov LM, Yeh KH, Lee SJ, Sun H, Zhang H. (1999). Curr Jin J, Harper JW. (2003). Cancer Cell 3: 517–518. Biol 9: 661–664. Kamura T, Hara T, Kotoshiba S, Yada M, Ishida N, Imaki H Vernell R, Helin K, Muller H. (2003). J Biol Chem 278: et al. (2003). Proc Natl Acad Sci USA 100: 10231–10236. 46124–46137. Kel AE, Kel-Margoulis OV, Farnham PJ, Bartley SM, von der Lehr N, Johansson S, WuS, Bahram F, Castell A, Wingender E, Zhang MQ. (2001). J Mol Biol 309: 99–120. Cetinkaya C et al. (2003). Mol Cell 11: 1189–1200. Kim SY, Herbst A, Tworkowski KA, Salghetti SE, Tansey WP. Wei W, Ayad NG, Wan Y, Zhang GJ, Kirschner MW, Kaelin (2003). Mol Cell 11: 1177–1188. Jr WG. (2004). Nature 428: 194–198. Kipreos ET, Pagano M. (2000). Genome Biol 1: RE- Weinmann AS, Bartley SM, Zhang T, Zhang MQ, Farnham VIEWS3002. PJ. (2001). Mol Cell Biol 21: 6820–6832. Koepp DM, Harper JW, Elledge SJ. (1999). Cell 97: 431–434. Weinmann AS, Yan PS, Oberley MJ, Huang TH, Farnham PJ. Koga H, Harada M, Ohtsubo M, Shishido S, Kumemura H, (2002). Genes Dev 16: 235–244. Hanada S et al. (2003). Hepatology 37: 1086–1096. Wells J, Graveel CR, Bartley SM, Madore SJ, Farnham PJ. Koziczak M, Krek W, Nagamine Y. (2000). Mol Cell Biol 20: (2002). Proc Natl Acad Sci USA 99: 3890–3895. 2014–2022. Willems AR, Schwab M, Tyers M. (2004). Biochim Biophys Kurland JF, Tansey WP. (2004). Cancer Cell 5: 305–306. Acta 1695: 133–170. Latres E, Chiarle R, Schulman BA, Pavletich NP, Pellicer A, Wirbelauer C, Sutterluty H, Blondel M, Gstaiger M, Peter M, Inghirami G et al. (2001). Proc Natl Acad Sci USA 98: Reymond F et al. (2000). EMBO J 19: 5362–5375. 2515–2520. Yeh KH, Kondo T, Zheng J, Tsvetkov LM, Blair J, Lees E, Faha B, Dulic V, Reed SI, Harlow E. (1992). Genes Zhang H. (2001). Biochem Biophys Res Commun 281: Dev 6: 1874–1885. 884–890. Li X, Zhao Q, Liao R, Sun P, Wu X. (2003). J Biol Chem 278: Yokoi S, Yasui K, Mori M, Iizasa T, Fujisawa T, Inazawa J. 30854–30858. (2004). Am J Pathol 165: 175–180. Marti A, Wirbelauer C, Scheffner M, Krek W. (1999). Nat Cell Zhang H, Kobayashi R, Galaktionov K, Beach D. (1995). Cell Biol 1: 14–19. 82: 915–925. Mendez J, Zou-Yang XH, Kim SY, Hidaka M, Tansey WP, Zheng N, Schulman BA, Song L, Miller JJ, Jeffrey PD, Wang Stillman B. (2002). Mol Cell 9: 481–491. P et al. (2002). Nature 416: 703–709.

Oncogene