Transcriptional and Post Transcriptional Regulation of Gene

TRANSCRIPTIONAL AND POST TRANSCRIPTIONAL REGULATION OF GENE

EXPRESSION: APPLICATIONS TO BIOLOGY AND CANCER

DISSERTATION

Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy

in the Graduate School of The Ohio State University

Ola Amr Elgamal

Graduate Program in Pharmaceutical Sciences

The Ohio State University

2016

Dissertation Committee:

Dr. Thomas D. Schmittgen, Advisor

Dr. Mitch A. Phelps, Co-Advisor

Dr. Robert W. Brueggemeier

Copyrighted by

Ola Amr Elgamal

2016

Abstract

miRNA dysregulation in cancer has been reported in numerous studies suggesting an important role for these small noncoding RNAs in cancer initiation or progression. In this study, we report the consequences of miR-205 and miR-217 dysregulation in breast cancer and in pancreatic acinar to ductal metaplasia, respectively. While reduction of miR-205 was previously reported in breast cancer, we confirmed reduced expression of miR-205 in triple negative breast cancer (TNBC) and identified a novel miR-205 target, HMGB3. The loss of miR-205 correlated with the upregulation of HMGB3 in patient specimens of breast cancer. Furthermore, patients with increased HMGB3 protein has poor survival compared to patients with low levels of HMGB3. siRNA knockdown of HMGB3 in TNBC cell lines reduced in vitro tumor cell proliferation and invasion. In summary, we report the tumor suppressive role for miR-205 is due in part to targeting HMGB3.

Acinar to ductal metaplasia (ADM) is an early event in pancreatic cancer where acinar cells lose their identity and transdifferentiate into ductal-like cells. In the presence of inflammation and mutations, two common risk factors for pancreatic cancer, ADM progresses into pancreatic intraepithelial neoplasia (PanIN) lesions, which further advances into pancreatic ductal adenocarcinoma (PDAC). Using a three dimensional in vitro culture of primary mouse acinar cells, we evaluated the molecular dysregulation of miRNAs during ADM. Previously we have shown that miR-217 targets the transcriptional repressor

REST/NRSF and during experimental ADM, miR-217 is reduced and REST/NRSF increases. In this dissertation, we confirmed REST regulation by miR-217 and studied the consequences of enforced expression of Rest on ADM. Using adenoviral vectors, we report that Rest promoted duct formation, increased ductal markers, and reduced several key acinar markers. Collectively, our data suggests an ADM promoting role for Rest and we hypothesize that miR-217 loss mediates the upregulation of REST during ADM. We propose a feedforward mechanism of regulation where miR-217 loss during ADM de- represses REST which in turn, silences acinar promoting transcription factors.

Our data suggest that de-repressing miR-205 or miR-217 in tumors, treating tumors with miRNA mimics or silencing the target genes of these miRNAs are promising therapeutic options. One approach to treat cancer with miRNA mimics or other oligonucleotides is to use a targeted nanoparticle approach. Recently, extracellular vesicles (EVs) have gained great interest for their potential as drug delivery vehicles. Here, we introduce a method to scale-up the production of HEK293T-derived EVs and evaluate their cellular uptake and in vitro safety in monocytic cell lines. The in vitro data provided herein should be beneficial to others who are proposing in vivo studies of therapeutic EVs.

iii

I dedicate this work to my family. First, and above all, I dedicate it to my parents. Mom and dad, I have and will always admire your wisdom and analytical mind; you have been a constant inspiration and the cornerstone of my life. Your ambition, strength, and continuous support made me who I am and your belief in me will always be my driving force and source of pride. No words can thank you enough, I thank you for our life, your endless support, love, and patience. Second, I dedicate this work to my sisters, Drs. Dalia and Sara Elgamal. Their guidance has been a constant and defining part in my life and it will always continue to be. Thank you for being the greatest loving sisters. Your support and experiences has guided me to where I am.

I deeply thank you all for the sacrifices you have made in your life to grant me the opportunity to be who I am and do this work today. Growing in a strong, caring, and scientific family has shaped me. You have been my role models and motivators. I could have never accomplished this or reached my potential without your support.

Acknowledgments

First of all I would like to thank my advisor, Dr. Thomas D. Schmittgen, for all the mentorship and guidance he has provided. These projects were challenging and had their fair amount of troubleshooting. Yet, I have had the opportunity to grow scientifically and develop a sense of critique because of that. Dr. Schmittgen’s confidence in my abilities is a key reason why I am able to write this dissertation today. Thank you for allowing me to work on such exciting and versatile projects and I will always be grateful for your guidance and trust. Second, I would like to thank all my lab members for the personal help, advice, friendship and many shared hours in the lab. My deepest thanks go to Dr. Jong-Kook Park and Dr. Jinmai Jiang. Both of you have been always there to teach me and I will always be thankful for your support. I also would like to thank Dr. Ana Clara Azevedo-Pouly, Dhruvit

Sutaria, Dr. Ji Hye Kim, Mohamed Badawi, and Steven Pomeroy for their support throughout my work. I would like to thank my committee members, Dr. Mitch A. Phelps and Dr. Robert W. Brueggemeier for their guidance and advice and Dr. Melissa Piper for her support during my candidacy, her loss has terribly saddened all of us. Finally, I would like to thank all of those who touched my life during my experience at OSU, Dr. William

Hayton, Kathy Brooks, Mary Kivel, and Betsy Bulgrin. Last but not least, I thank The Ohio

State University and College of Pharmacy for my scholarship. It has changed my life and shaped my future goals.

Vita

May 2005 ...... Victory College High School, Cairo, Egypt

May 2010 ...... B.S. Pharmaceutical Sciences, Cairo

University, Egypt

2010 to present ...... Graduate Research Associate, Department of

Pharmaceutics and Pharmaceutical

Chemistry, College of Pharmacy, The Ohio

State University

Publications

1. Rosas LE, Elgamal OA, Mo X, Phelps MA, Schmittgen TD, Papenfuss TL. In vitro

Immunotoxicity Assessment of Culture-derived Extracellular Vesicles in Human

Monocytes. J Immunotoxicol. 2016 Apr 14:1-14.

2. Azevedo-Pouly AC, Elgamal OA, Schmittgen TD: RNA isolation from mouse

pancreas: a ribonuclease-rich tissue. J Vis Exp 2014(90):e51779.

3. Elgamal OA, Park JK, Gusev Y, Azevedo-Pouly AC, Jiang J, Roopra A, Schmittgen

TD: Tumor suppressive function of mir-205 in breast cancer is linked to HMGB3

regulation. PLoS One 2013, 8(10):e76402.

Fields of Study

Major Field: Pharmacy

Pharmaceutical Sciences

vii

Table of Contents

Abstract ...... ii

Acknowledgments...... v

Vita ...... vi

Publications ...... vi

Fields of Study ...... vii

List of Tables ...... xiv

List of Figures ...... xv

Chapter 1: MicroRNA Deregulation in Cancer ...... 1

1.1. Introduction ...... 1

1.2. miRNA biogenesis ...... 3

1.3. miRNA implication in cancer ...... 6

1.4. miRNAs signature in tumor ...... 8

1.4.1. Methods for miRNAs detection ...... 8

1.4.2. Tumor suppressor miRNAs ...... 9

1.4.3. OncomiRs ...... 13

1.5. miRNAs implication in breast cancer development ...... 15 viii

1.6. miRNAs involved in pancreas development and tumorigenesis ...... 19

Chapter 2: MiR-205 Regulation of HMGB3 in Breast Cancer...... 26

2.1. Abstract ...... 26

2.2. Introduction ...... 27

2.3. Materials and methods ...... 29

2.3.1. Ethics Statement ...... 29

2.3.2. Cell lines ...... 29

2.3.3. Tissue procurement...... 29

2.3.4. RNA extraction ...... 31

2.3.5. Real-time PCR ...... 31

2.3.6. Transient transfection assays ...... 34

2.3.7. miR-205 overexpressing stable cells ...... 34

2.3.8. Lentiviral knockdown of REST in MCF7 cells ...... 34

2.3.9. Luciferase reporter assay ...... 35

2.3.10. Western Blotting and antibodies ...... 35

2.3.11. WST-1 proliferation assay ...... 36

2.3.12. Matrigel invasion assay ...... 36

2.3.13. Immunohistochemistry ...... 36

2.3.14. Drug treatment ...... 37

2.3.15. Kaplan Meier survival plot ...... 37

2.4. Results ...... 38

2.4.1. miR-205 expression in breast cell lines and tissues ...... 38

2.4.2. Tumor suppressive role of miR-205 ...... 40

2.4.3. miR-205 targets HMGB3 ...... 42

2.4.4. Functional effects of miR-205/HMGB3 regulation in breast cancer ...... 44

2.4.5. Relationship between miR-205, HMGB3 and EMT ...... 48

2.4.6. Chromatin modifying agents attenuate HMGB3 levels through de-repression

of miR-205 ...... 51

2.4.7. Relationship between REST, miR-205 and HMGB3 ...... 52

2.5. Discussion ...... 54

Chapter 3: Enhancement of Pancreatic Acinar Ductal Metaplasia by MiR-217

Derepression of REST/NRSF ...... 57

3.1. Abstract ...... 57

3.2. Introduction ...... 58

3.2.1. Pancreas development ...... 58

3.2.2. Acinar-to-ductal metaplasia ...... 60

3.3. RE1-silencing transcription factor ...... 62

3.3.1. REST implication in cancer ...... 64

3.3.2. Implications of REST in pancreas ...... 65

3.4. Materials and methods ...... 67

3.4.1. Cell Culture...... 67

3.4.2. Protein extraction and Western Blotting ...... 68

3.4.3. In vitro ADM of primary acinar cells ...... 68

3.4.4. RNA isolation and qPCR ...... 70

3.4.5. Primers ...... 70

3.4.6. Transient transfection assays ...... 72

3.4.7. WST-1 proliferation assay ...... 72

3.4.8. Luciferase reporter assay ...... 72

3.4.9. Histology ...... 73

3.4.10. Immunofluorescence ...... 73

3.4.11. Mouse Transcriptome Array ...... 74

3.4.12. Statistical analysis...... 75

3.4.13. Gene set enrichment analysis (GSEA) ...... 75

3.5. Results ...... 76

3.5.1. miR-217 regulates REST expression ...... 76

3.5.2. Validation of experimental ADM ...... 80

3.5.3. REST drives acinar to epithelial transdifferentiation ...... 82

3.5.4. Rest overexpression reduces key acinar genes ...... 85

3.5.5. Ptf1a is repressed by REST ...... 86

3.5.6. miR-217/REST regulation of pancreatic ADM ...... 87

3.5.7. Rest overexpression repressed a subset of REST target genes ...... 90

3.5.8. REST knockdown in cell lines using X5050 small molecule inhibitor ...... 94

3.6. Discussion ...... 98

Chapter 4: Characterization of HEK293T-Derived Extracellular Vesicles ...... 101

4.1. Abstract ...... 101

4.2. Introduction ...... 101

4.3. Materials and methods ...... 103

4.3.1. EVs donor cell line, HEK293T adaptation to suspension cell ...... 103

4.3.2. EVs isolation...... 105

4.3.3. EVs characterization ...... 107

4.3.4. EV staining ...... 108

4.3.5. Human monocyte cell lines culture and differentiation...... 109

4.3.6. Cells and EV co-incubation ...... 110

4.3.7. Apoptosis and necrosis assay ...... 110

4.3.8. Sample preparation for confocal microscopy imaging ...... 111

4.3.9. Flow cytometry and confocal microscopy ...... 112

xii

4.3.10. Statistical analyses ...... 112

4.4. Results ...... 112

4.4.1. Characterization of HEK293T-derived EVs ...... 112

4.4.2. EVs did not elicit a cytotoxic response in THP-1 or U937 cells ...... 115

4.4.3. PMA-differentiated THP-1 and U937 cells internalize EVs ...... 117

4.4.4. EVs are internalized in HeLa cell line ...... 119

4.5. Discussion ...... 121

Chapter 5: Synopsis and Discussion ...... 124

References ...... 134

xiii

List of Tables

Table 1. Deregulated tumor suppressor miRNAs in cancer...... 11

Table 2. Deregulated oncomiRs in cancer...... 14

Table 3. Tissue information of breast cancer patients...... 30

Table 4. List of qPCR primers...... 32

Table 5. List of mouse primers...... 71

xiv

List of Figures

Figure 1. Overview of miRNA biogenesis...... 5

Figure 2. miR-205 is down-regulated in breast cancer...... 39

Figure 3. Over-expression of miR-205 reduces the proliferation and in vitro invasion of breast cancer cell lines...... 41

Figure 4. HMGB3 is a target of miR-205 in breast cancer...... 43

Figure 5. Knockdown of HMGB3 reduces the proliferation and in vitro invasion of breast cancer cells...... 46

Figure 6. HMGB3 is over-expressed in primary breast cancer tissues...... 47

Figure 7. EMT markers protein levels in miR-205 treated BT549 cells...... 49

Figure 8. HMGB3, CDH1, and ZEB1 in siHMGB3 treated MDA-MB-231...... 50

Figure 9. Expression of miR-205 and HMGB3 in 5-Aza and TSA treated cells...... 52

Figure 10. Change in miR-205 and HMGB3 expression in REST-less cells...... 53

Figure 11. Transcriptional determinants of pancreas cell-lineage development...... 60

Figure 12. Regulation of REST by miR-217...... 78

Figure 13. Representative images of ADM at day one and day four...... 81

Figure 14. Rest promotes ADM and alters the mRNA level of ADM markers...... 83

Figure 15. Bright field images for control and Rest treated acini during ADM...... 84

Figure 16. Rest represses acinar transcription factors...... 86

Figure 17. Rest binding site at 20 kbp upstream of Ptf1a transcription start site...... 87

Figure 18. Proposed mechanism between ptf1a, miR-217 and REST...... 88

Figure 19. Regulation of HNF1B by miR-217...... 89

Figure 20. Overview of experimental design and GSEA data analysis strategy...... 91

Figure 21. GSEA for approximately 1000 common REST target genes...... 92

Figure 22. GSEA for the top 150 acinar expressed REST target genes...... 92

Figure 23. GSEA for top 50 differentially expressed acinar REST target genes...... 92

Figure 24. List of top 50 acinar REST target genes...... 93

Figure 25. REST protein levels in pancreatic cancer cell lines...... 95

Figure 26. X5050 dose response in 96 hours treatment...... 96

Figure 27. REST protein expression using in X5050 treated cells...... 97

Figure 28. Schematic overview for HEK293T adaptation process...... 104

Figure 29. EVs standard isolation protocol...... 106

Figure 30. Extracellular vesicles (EV) characterization...... 114

Figure 31. Assessment of EV effects on apoptosis and necrosis in THP-1 and U937 cells.

...... 116

Figure 32. Phagocytosis of labeled EV by differentiated THP-1 and U937 cells...... 118

Figure 33. Phagocytosis of labeled EV by differentiated THP-1 and U937 cells...... 120

Figure 34. miR-375 regulation of REST...... 128

xvi

Chapter 1: MicroRNA Deregulation in Cancer

1.1. Introduction

The field of microRNA (miRNA) emerged when the Ambros and Ruvkun laboratories discovered the first endogenous small non-coding RNA, lin-4 in Caenorhabditis elegans

(C. elegans). Lin-4 small RNA inhibited the translation of the messenger RNA (mRNA) of another gene, lin-14 [1, 2]. Ever since this discovery, many studies have been conducted to understand the biology of these small endogenous non-coding RNAs and their implication in development and diseases. To date, there are over 45,000 articles listed in

PubMed studying microRNA from which 20,000 are addressing miRNA implication in cancer.

Lin-4 was described to contain a sequence complimentary to repeated elements in the 3’ untranslated region (3’ UTR) of lin-14 and lin-28 mRNA leading to translation repression.

Thus, Lee, et al., suggested lin-14 and lin-28 repression is a result of an antisense RNA duplex interaction with lin-4 [1]. This theory was soon corroborated when Wightman, et al., used reporter genes to demonstrate that lin-14 3’ UTR is essential for lin-4 mediated posttranscriptional repression as it harbored seven elements complimentary to lin-4 small

RNA [2]. Both of these independent studies were the first to describe lin-4 small RNA and the mechanism of its posttranscriptional translation repression [1, 2].

Another seven years later, a second miRNA was discovered when Reinhart, et al., [3] revealed the involvement of lethal-7 (let-7) in C. elegans development. Let-7, a 21 nucleotide (nt) RNA caused translational repression of LIN-41 and was essential for the transition of C. elegans from the L3/L4 larval stage to adult stage via its interaction with the 3’UTR of LIN-41 mRNA and consequently, LIN-41 translational repression [3]. The loss of let-7 impaired the worm’s development by causing the reappearance of a larval cell fate while the increase of let-7 led to precocious expression of the adult fate [3]. Soon afterwards, Slack, et al., reported similar observations [4] when they found that let-7 repression of LIN-41 led to the repression of another gene, LIN-29, a transcription factor essential for adult stage specification [4]. Due to the involvement of lin-4 and let-7 in C. elegans development, they were first referred to as small temporal RNAs [5] but in 2001 they were renamed miRNA [6]. Several miRNAs were discovered in many organisms such as plants [7], Drosophila melanogaster [8], mice, and human cell lines [9-13]. Pasquinelli, et al., described the conservation of let-7 among species when they identified the presence of let-7 RNA homologues in zebrafish, Drosophila melanogaster, and humans [5].

Additional studies were conducted which supported the presence and conservation of let-

7 miRNA across species, suggesting the importance of miRNA in eukaryotic gene regulation [6, 14, 15]. Ever since this pioneering work, numerous studies have discovered thousands of miRNAs and reported their involvement in development [16] and disease

[17]. In this chapter, I will provide an overview of miRNA biogenesis and its role in diseases, with particular emphasis on their implications in cancer.

1.2. miRNA biogenesis

miRNAs encoding genes, commonly referred to as miRNA host genes are present within exons, introns, and intergenic regions within the chromosomes [18] however, the majority of miRNAs are present within introns [19]. Approximately half of the miRNAs are present as polycistronic miRNAs, meaning that they are in clusters and transcribed under the control of a single common promoter [20]. As shown in figure 1, adapted from Iorio, et al.,

[21], the first step in miRNA biogenesis is the transcription of its host gene by the RNA polymerase II enzyme in the cell nucleus [22], resulting in the production of a primary miRNA transcript (pri-miRNA). The structure of pri-miRNA is a double stranded RNA

(dsRNA) stem attached to a loop (hairpin) and flanked by single stranded RNA. Similar to mRNA, pri-miRNA has at its 5’ end a 7-methyl-guanosine cap and a poly adenosine tail at its 3’ end [22, 23]. The pri-miRNA then undergoes processing by the microprocessor protein complex comprised of Drosha and its cofactor DGCR8 (DiGeorge syndrome chromosomal critical region 8) [24]. Drosha enzyme is a class 2 ribonuclease III containing two RNAse III domains and one double stranded RNA binding domain [20]. At the junction between the pri-miRNA stem loop structure and the flanking single stranded RNA,

DGCR8 interacts with the pri-miRNA double stranded RNA (stem) allowing the recruitment of the Drosha/DGCR8 complex and the asymmetric cleavage of the pri- miRNA transcript, approximately 11 base pairs (bp) away from the junction [20, 25, 26] resulting in a shorter precursor miRNA (pre-miRNA) transcript. Pre-miRNA contains a phosphate groups at the 5’ end and two unpaired nts overhang at its 3’ end [26] where the

3 latter being a characteristic essential for Exportin-5 recognition and pre-miRNA export to the cytoplasm [27-30]. Once pre-miRNA is in the cytoplasm, it is cleaved by a ribonuclease

III enzyme, Dicer, completing its processing into a 21 nt double stranded miRNA [20, 31].

Dicer is a class 3 ribonuclease enzyme containing one dsRNA binding domain, one helicase domain, and two RNAse III domains, both allow Dicer to bind to the pre-miRNA dsRNA stem [32, 33] and its cleavage from the loop structure, generating a 21 nt RNA duplex (miRNA:miRNA*) [31] with a single stranded two nt overhang at the 3’ end. One of the duplex strands is degraded and referred to as the passenger strand (miRNA*) whereas the other becomes the mature guide miRNA strand loaded into a ribonucleoprotein complex known as the RNA-induced silencing (RISC) complex [20, 31]. The mechanism of miRNA translation repression depends on its binding to the 3’ UTR region of the targeted mRNA. Perfect complementarity is essential between the seed sequence of the miRNA and its binding site within the mRNA 3’ UTR. As described by Lewis, et al., [34], the seed sequence is approximately seven nt long located at the 5’ end of the miRNA strand starting from nt two through eight [31]. RISC is responsible for scanning the cytoplasmic mRNA in search for an mRNA with reverse complementarity to the loaded miRNA. In cases of full complementarity to the mature miRNA, the targeted mRNA is cleaved and degraded [35], a phenomena often found in plants [36, 37]. However, in animals, partial complementarity is usually the case resulting in mRNA translation repression.

Pol II Nucleus

Pri-miR * 5’ * 3’

DGCR8 Cytoplasm Drosha

Pre-miR * 3’ 5’ miR:miR* Pre-miR * Dicer Helicase 3’ 5’

RISC RISC

7 3’ 5’ mGpppG AAA…An 3’ UTR Mature miR incorporation into RISC

Translation mRNA Repression Cleavage

Figure 1. Overview of miRNA biogenesis. Adapted from Iorio, et al., 2012.

1.3. miRNA implication in cancer

The first relationship between miRNA and cancer was with the discovery of miR-15 and miR-16-1 deletion in B-Cell chronic lymphocytic leukemia (B-CLL) [38]. Initially, the

Croce laboratory searched for canonical tumor suppressor genes within the 13q14 chromosomal region, a region commonly deleted in B-CLL patients. Instead of finding protein coding genes, the deleted region encoded for two miRNA genes, miR-15a and miR-

16-1 [38]. The consistent deletion or downregulation of these two miRNAs strongly suggested a correlation between miR-15a and miR-16-1 deletion and CLL and their potential role as tumor suppressor miRNAs [38]. In 2005, Cimmino, et al., from the same laboratory demonstrated the negative regulation of miR-15a and miR-16-1 to the antiapoptotic B cell lymphoma 2 (BCL2). Increased BCL2, as a result of reduced miR-15 and miR-16, would prevent the B cell lymphoma from undergoing apoptosis [39]. miRNAs are located in fragile sites, minimal regions of loss of heterozygosity or amplification or areas of common breakpoints [40]. He, et al., [41] used a human B-cell lymphoma mouse model expressing c-myc oncogene to overexpress a polycistronic miRNA cluster, miR-

17~92 in vivo. This cluster is commonly overexpressed in B-Cell lymphomas, suggesting a tumor promoting effect of this miRNA cluster. Indeed, enforced expression of miR-

17~92 cluster along with c-myc oncogene demonstrated enhanced lymphoma in mice [41] providing evidence of an oncogenic effect of overexpressed miRNAs, referred to later as oncomiRs [42]. O'Donnell, et al., corroborated the oncogeneic role of miR-17~92 cluster by discovering that the cluster is regulated by the c-Myc oncogene [43]. Another major

6 oncogene, RAS, was found to be regulated by miRNAs. The RAS oncogene 3’ UTR harbored multiple binding sites for let-7 miRNA. Johnson, et al., demonstrated the regulation of RAS by let-7 in vitro and highlighted the inverse correlation between let-7 and RAS levels in lung cancer [44]. In 2009, the first in vivo study demonstrated the ability of miRNAs alone to drive tumor formation was conducted by Costinean, et al., [45]. They developed a transgenic mouse model overexpressing miR-155 and demonstrated the formation of acute lymphoblastic leukemia and high grade lymphoma via negatively regulating SHIP and C/EBPβ [45]. miR-21 is found upregulated in many tumors. Medina, et al., in the Slack laboratory used a conditional inducible transgenic miR-21 overexpressing mouse model [46] to show that overexpressing miR-21 alone was sufficient to develop pre-B malignant lymphoid-like tumors [46]. When miR-21 expression was inactivated, the tumor remarkably regressed in a few days revealing the dependency of tumor growth on miR-21[46].

These studies and many others provide insight into the consequences of miRNA dysregulation in tumorigenesis. They report opposite roles for miRNA based on their level of expression in tumors and highlight the importance of understanding the shift in miRNA levels between the normal and diseased states.

1.4. miRNAs signature in tumor

1.4.1. Methods for miRNAs detection

Currently many techniques are employed to identify the signature of miRNAs in cancer. miRNA profiling can be achieved using quantitative reverse transcriptase polymerase chain reaction (qRT-PCR), microarrays, and RNA sequencing (RNAseq). For miRNA visualization, in situ hybridization is used to detect the level of miRNA expression in tissues and cellular localization [47]. As for methods for detecting miRNA expression levels, Northern blotting can identify miRNAs [48], however, it often fails to detect miRNAs of low abundance [49] and requires several hundreds of micrograms of starting material (total RNA). miRNA microarrays are most beneficial for the relatively low cost associated with its high throughput results, allowing them to be a valuable screening tool.

Although it is widely used for genome wide miRNA expression profiling, arrays have a lower sensitivity range when compared to qRT-PCR. qRT-PCR offers superior quantitative accuracy and specificity with the ability to provide an absolute miRNA quantity [50] even for low abundant miRNAs [51]. These methods of miRNA detection [52] allowed for the discovery of miRNA dysregulation signature in cancer for the potential applications in tumor classification, development of therapeutic applications, and biomarkers discovery.

1.4.2. Tumor suppressor miRNAs

Tumor suppressor miRNAs are miRNAs with reduced expression during tumor initiation, progression and/or metastasis. Tumor suppressive miRNAs would provide a growth suppressing role in normal cellular function that is lost during carcinogenesis. In more than

60% of human B-CLL, both miR-15 and miR-16 were deleted in chromosome 13q14 [38] suggesting their tumor suppressor role. To prove that, Dalla-Favera’s group [53] generated two knockout mice models; the first had the entire 13q14 portion deleted, while the other group only had miR-15a and miR-16-1 deletion. Interestingly, they found both knockout mice models developed CLL with phenotypic similarity to the disease progression in CLL patients. This study succeeded in demonstrating that miRNA loss was sufficient to induce tumor development which later was attributed to its anti-apoptotic role via targeting Bcl2

[39]. Other examples of tumor suppressor miRNAs are let-7, the miR-34 family, the miR-

200 family, and miR-206. Initially, let-7 was found to target let-60 in C. elegans which is the ortholog to the RAS human oncogene [44]. Johnson, et al., correlated the downregulation of let-7 and increased RAS oncogene expression in lung cancer tumor samples and validated the regulation of RAS in vitro using two human cell lines [44]. Let-

7 overexpression inhibits cell growth and reduces cell cycle progression [54] while its loss has been confirmed in many cancers and correlated with poor survival [55]. The miR-34 family is involved in regulating key genes in the cell cycle and apoptotic pathways.

Upregulation of the miR-34 family was shown to inhibit cancer growth via targeting c-

Met, Notch, and Bcl2 genes while its loss promotes resistance of cancer cells following

9 chemotherapy [55]. The miR-200 family and miR-206 are downregulated in breast cancer

[55, 56]. The miR-200 family attenuates epithelial to mesenchymal transition (EMT), a process involved in tumor metastasis, by targeting ZEB1 and ZEB2 [56]. miR-206 targets

Cyclin D2 thereby suppressing cell proliferation [55]. Examples of tumor suppressor miRNAs are reviewed in table 1, adapted from [57].

miRNA Dysregulation Target Function Role in tumor

ITGA5, Inhibits pro- Downregulated Tumor FZD3, RDX, metastatic gene miR-31 in metastatic suppressor RHOA, AND expression and breast cancer [56] MMP16 preventing metastasis

Inhibit epithelial to

mesenchymal Downregulated transition promoting Tumor miR-200 in aggressive and ZEB1, ZEB2, genes and suppressor family metaplastic and BMI1 transforming growth [54, 57, 58] breast cancer factor signaling

pathway

Reduces cell motility

Downregulated and anchorage Tumor miR- HER2 and in HER2 positive dependent growth by suppressor 125a/b HER3 breast cancers inhibiting HER2 and [59, 60]

HER3 expression

Table 1. Deregulated tumor suppressor miRNAs in cancer. Continued 11

Table 1. Continued

Induces apoptosis Tumor Lost in breast and reduces miR-145 ERG suppressor cancer proliferation of [61] cancer cells

ITGA5, Inhibits pro- Downregulated Tumor FZD3, RDX, metastatic gene miR-31 in metastatic suppressor RHOA, AND expression and breast cancer [56] MMP16 preventing metastasis

Inhibit epithelial to

pathway

Reduces cell motility

Downregulated and anchorage Tumor miR- HER2 and in HER2 positive dependent growth by suppressor 125a/b HER3 breast cancers inhibiting HER2 and [59, 60]

HER3 expression

1.4.3. OncomiRs

OncomiRs are miRNAs up-regulated in cancer cell lines or patients tumor tissue samples and contributing to tumorigenesis. Examples of oncomiRs are miR-17~92 cluster [41-43], miR-21 and miR-155. miR-21 is overexpressed in hepatocellular carcinoma (HCC) [58], glioblastoma [59], leukemia and lymphoma [60, 61], breast [62], colon [63], bladder [64], ovarian [65], pancreatic [66-68], and gastric [69] cancer. In glioblastoma, silencing miR-

21 activated caspases resulting in increased apoptosis [70], in hematological malignancies, overexpressing miR-21 in vivo using Cre and TET-off technologies led to a pre-B malignant lymphoid-like phenotype in mice while its knock down caused tumor regression

[46]. miR-155 is located in a highly conserved region of BIC gene and is associated with cancers involving oncogene MYC such as leukemia and lymphomas [55]. Overexpression of miR-155 in B-cell lymphomas leads to oncogenesis [71]. It is also shown to prolong inflammation in hematopoietic cells leading to cancer [72]. In breast cancer, miR-155 targets VHL, Von-Hippel Lindau tumor suppressor gene causing an upregulation in HIF, hypoxia inducing factors (transcription factors) leading to angiogenesis [73]. Examples of oncomiRs are reviewed in table 2, adapted from [57].

13 miRNA Dysregulation Target Function Role in tumor

Upregulated in CLL Promoted cell miR- SHIP1 and Oncogene [78, and breast, colon, and proliferation and 155 MAF 79] lung cancers leukemia in mice

Upregulated in colon, PDCD4, Promote breast, liver, PTEN, Oncogene miR-21 tumorigenicity and pancreatic, prostate, TIMP3, and [80-82] inhibits apoptosis and stomach cancers TPM1

In vitro: Promoted

cell migration and

miR- Overexpressed in invasion In Oncogene HOXD10 10b metastatic cancer cells vivo: Initiated [83]

tumor invasion and

metastasis

Table 2. Deregulated oncomiRs in cancer. Continued

Table 2. Continued

Upregulated in lung,

miR- breast, stomach, E2F1, PTEN, Promotes Oncogene

17-92 pancreatic, and and BIM proliferation [84-86]

stomach cancers

Upregulated in lung, Stimulates prostate LSAST, miR- breast, stomach, and breast cancers Oncogene CD44, and 373 pancreatic, colon, and invasion and [87-89] p53 stomach cancers metastasis

1.5. miRNAs implication in breast cancer development

Chapter two of this dissertation focuses on breast cancer, thus, in this chapter, I will overview miRNA’s involvement in breast cancer. Breast cancer can be classified into several subtypes, luminal A, luminal B, HER2 positive/enriched, and basal like based on the expression status of the hormonal estrogen (ER) and progesterone (PR) receptors and human epidermal growth factor receptor, HER2 (reviewed in [74]). Each subtype has a distinct molecular and miRNA expression signature and phenotype. Breast cancer was among the first solid tumors to be profiled for miRNA expression. Iorio, et al., [75]

15 presented a miRNA signature composed of 13 miRNAs discriminating normal from tumor tissues with 100% accuracy. Among those miRNAs is miR-21 whose overexpression is associated with poor prognosis, advanced clinical stage, and lymph node metastasis [76,

77]. The oncogenic role of miR-21 is attributed to the suppression of three tumor suppressor genes, programmed cell death 4 (PDCD4), phosphatase and tensin homolog

(PTEN), and tropomyosin 1 (TPM1) hence, regulating cell proliferation and survival. On the contrary, miR-125b and miR-205 are tumor suppressor miRNAs regulating two important oncogenes in breast cancer, HER2 and HER3 [78, 79]. miR-205 reintroduction by in vitro ectopic expression in cell lines resulted in reduced proliferation and increased responsiveness to lapatinib and gefitinib tyrosine kinase inhibitors therapy [80].

Dysregulated miRNAs can not only distinguish normal or benign conditions from malignant ones, but also can assist in tumor classification and therapy outcome prediction. miR-206, which is elevated in estrogen receptor α (ERα) negative breast cancer, targets

ERα [81]. miR-221 and miR-222 confers tamoxifen resistance by regulating ERα and p27

[82, 83]. ERα negative breast cancer is aggressive and unresponsive to hormonal therapy such as tamoxifen. Levels of miR-221 and miR-222 are elevated in ERα negative breast as

ERα negatively regulates miR-221 and miR-222 expression [84]. Interestingly, there is a feedback regulatory loop between ERα and miR-221 and miR-222. Both miRNAs negatively regulate ERα. Thus, when ERα is silenced by methylation or miR-221 and miR-

222 dysregulation, it results in constitutive activation of miR-221 and miR-222. The upregulation of miR-221 and miR-222 consequently targets tumor suppressors such as p57,

16 p27, PTEN and TIMP3 [85] leading to the development of aggressive resistant ERα negative breast cancer [57, 86].

One of the main causes of breast cancer lethality is the metastasis , accounting for more than 90% of deaths [57]. miRNAs may be involved in regulating cancer initiating stem cells (CSCs) [87, 88], drug transport and efflux system [89, 90], the activation of cell survival and anti-apoptotic pathways [91], and EMT [92-94]. Example of oncomiRs involved in promoting EMT in breast cancer include miR-9 [95]. miR-9 levels were significantly elevated in patients with metastatic primary tumors compared to metastasis free patients [96]. miR-9 promotes EMT by inhibiting E-cadherin mRNA translation. On the contrary, miR-200 family and miR-205 were significantly downregulated in breast cancer and found to inhibit two important EMT promoting genes, ZEB1 and ZEB2 [97-

100].

CSCs share common properties with stem cells [101, 102] with the addition of having tumor seeding capabilities. CSCs can be responsible for tumor initiation. Al-Hajj, et al.,

[87] isolated (CD44+/CD24-) CSCs from breast cancer and showed remarkable tumor seeding ability. Later Yu, et, al., demonstrated let-7 to be a master regulator of self-renewal stem cell properties [88]. Let-7 inhibits the ability of breast cancer cells to de-differentiate and self-renew via targeting HMGB2 and RAS, respectively [88]. Thus, let-7 downregulation can initiate tumorigenesis in breast cancer.

Post tumor initiation therapy resistance is a major problem in hormonal and chemotherapy strategies. Mechanisms of resistance can be due to alterations in drug transportation into cancer cells, in which cancer cells can efflux the drug [89, 90] or the ability of cancer cells

17 to survive and evade apoptosis [91]. ATP-binding cassette transporter genes (ABC genes) can efflux anti-cancer drugs from the cells leading to drug resistance [103]. miR-326 and miR-451 regulates ABCC1 and ABCB1 genes, respectively [104, 105] resulting in chemosensitivity to doxorubicin while miR-487a enhances chemosensitivity to mitoxantrone therapy via targeting ABCG2 [106]. Another mechanism for drug resistance can be due to cell death evasion. P27kip1 tumor suppressor is a cell-cycle inhibitor [107] targeted by elevated miR-221 and miR-222 resulting in tamoxifen resistance [83]. miR-10 was the first miRNA identified for regulating metastasis in breast cancer when miR-10b levels was found significantly elevated in metastatic cell lines [108]. The overexpression of miR-10b in nonmetastatic cancer cells results in the negative regulation of homeobox D10 and subsequent upregulation of pro-metastatic RHOC oncogene [108].

By contrast, miR-335 and miR-126 are metastasis suppressors [109]. Restoration of downregulated miR-335 inhibited invasive cells metastasis via directly targeting SOX4 transcription factor while miR-126 restoration resulted in reduced cell proliferation and overall tumor growth [109].

In summary, dysregulation of miRNAs in breast cancer can promote aggressiveness of the primary tumor by converting a therapy responsive ERα positive tumor to a therapy resistant

ERα negative type [81], confer therapy resistance [82, 83, 89-91, 103-107], and promote metastasis [95-100, 108, 109] leading to poor prognosis and survival rates.

1.6. miRNAs involved in pancreas development and tumorigenesis

Chapter three of the dissertation studies with the potential regulation of early events during

PDAC development by miRNAs. Pancreatic cancer is one of the most deadly tumors in the United States. Ranked the fourth cause of cancer related deaths with five year survival rate less than 6% [110-112]. The most prevalent type of pancreatic cancer is pancreatic ductal adenocarcinoma (PDAC) which can arise from three different precursor lesions, mucinous cystic neoplasm, intraductal papillary mucinous neoplasm (IPMN), or more commonly pancreatic intraepithelial lesions (PanIN) [113]. Pancreatitis is a risk factor for pancreatic cancer. Patients with hereditary pancreatitis exhibit a 50-fold or higher rate for pancreatic cancer [114]. Tumor initiation and growth is promoted by gain of function in mutated oncogenes mainly, Kras and loss of function in tumor suppressor genes such as,

P16/CDKN2A, TP53, BRCA2, and SMAD4 [115-117] via deletion or mutations [118,

119]. This dismal outcome for pancreatic cancer has incited many studies to define the genetic aberrations initiating the tumor development or promoting its progression and resistance to therapy.

To understand the role of miRNAs in pancreatic cancer, it is essential to reveal their role in pancreas development. The pancreas comprises of two main compartments, the endocrine which consists of hormone secreting islet cells and the exocrine, which produces and secretes digestive enzymes. Pancreas development is dependent on the temporal expression of a hierarchy of transcription factors committing multipotent progenitor cells to an exocrine or endocrine pancreas fate. Thus, miRNAs could play a critical role in

19 posttranscriptional regulation of these developmental transcription factors, serving to fine- tune levels of gene expression for proper development and maintenance of differentiation.

To study the role of miRNA in pancreas development, Lynn, et al., generated the first pancreas specific Dicer1 knockout mouse model to inactivate the miRNA processing machinery in the pancreas during embryogenesis [120]. The Dicer-null mice exhibited defects in all pancreatic cells lineages yet more profoundly in the endocrine insulin producing beta-cells (β-cells). During normal endocrine development, Hnf6 allows the expression of pro-endocrine Ngn3 (figure 11) transcription factor by negatively regulating

Hes1 [121, 122], an important notch signaling transcription factor. In Dicer null mice, increased Hes1 levels were observed resulting in reduced Ngn3 positive endocrine progenitor cells thus, strongly suggesting the importance of miRNAs in pancreas and β – cells development [120]. This study was corroborated with Morita, et al., development of another Dicer1 hypomorphic mouse model in which Dicer1 expression was reduced to 20% in all tissues [123]. Interestingly, only the pancreas exhibited histological deformity at four weeks of age mice in both, the endocrine and exocrine cells, suggesting that miRNAs were also essential in adult pancreas [123]. Morris, et al., deleted dicer in a Kras driven pancreatic cancer mouse model. Dicer deletion compromised acinar cell identity and accelerated acinar to ductal metaplasia (ADM), a PDAC precursor lesion [124]. Several studies were conducted to identify miRNAs involved in pancreas development [125-129] revealing several miRNAs among which are miR-375, miR-376, miR-7, miR-9, and miR-

124 important in pancreas development. During pancreas organogenesis, miR-375 expression increased along with an increase in β-cells proliferation and insulin expression

[130]. Gain and loss of function experiments in mature pancreas revealed miR-375 interacting with insulin secretion regulators. Poy, et al., found a direct interaction between miR-375 and the 3’ UTR of myotrophin, where forced expression of miR-375 resulted in reduced glucose-mediated insulin release [129]. El Ouaamari, et al., found similar results via the interaction between miR-375 and PKD1 [131] suggesting an important role for miR-375 in glucose regulated insulin gene expression. The action of miR-375 is not restricted to β-cells only in fact, Poy, et al., developed a miR-375 knockout mouse model to find miR-375 deletion disrupted the endocrine mass, resulting in hyperglycemia due to increased glucagon levels, alpha-cells (α–cells) mass, gluconeogenesis, and reduced β– cells mass owing to impaired proliferation [132].

Similar to miR-375, studies have shown elevated levels of miR-7 in pancreatic islets during development and differentiation [128, 130, 133] suggesting an important role for this miRNA in development and functionality. Using in situ hybridization and immunostaining,

Nieto, et al., showed the preferential expression of miR-7 in endocrine cells [134]. To understand the role miR-7 plays in pancreas development, they developed a miR-7 knockdown mouse model by injecting miR-7 antisense in embryos at embryonic day 10.5

(E10.5) using intrauterine fetal heart injection [134]. Loss of miR-7 at this early developmental stage decreased β-cells number, an over-all reduced insulin production, and glucose intolerance during the postnatal period. Altogether, these studies have shown the importance of miRNAs in pancreas endocrine development by demonstrating detrimental outcomes in both miRNA-375 and miR-7 loss of function studies. mir-124a is another critical player in pancreas development via regulating Foxa2, a transcription factor needed

21 during early pancreas development [125]. miR-124a has different roles in different stages of pancreas development. It has higher levels (six-fold) at E18.5 compared to E14.5 [125] which corresponds to the β-cells differentiation stage, suggesting miR-124a has a critical role in this process. Indeed, miR-124a regulated the levels of Foxa2, an upstream regulator of the pancreatic duodenum homeobox-1 (Pdx-1), a crucial transcription factor in pancreas development, differentiation, and glucose homeostasis by regulating insulin gene expression [135-138]. Manipulation of Foxa2 expression via gain and loss of miR-124a function led to corresponding decrease and increase in Pdx1 levels, respectively [125] leading to a decrease and increase in insulin levels, respectively [125].

The implications of miRNAs in pancreatic cancer were highlighted from miRNA expression profiling studies comparing their differential levels in normal pancreas to pancreatitis [67, 139, 140], precancerous lesions such as IPMN [141-144], PanIN lesions

[140, 145-148], and PDAC [67, 139, 149-153]. Two signatures of miRNAs dysregulation were identified, miRNAs significantly downregulated or lost and miRNAs overexpressed

[67, 139, 148, 149, 154-156]. Among the downregulated miRNAs were miR-34a, miR-

216, miR-217, miR-148a, and miR-375. These miRNAs were lost or barely detected in tumor suggesting that they might have a tumor suppressor role in PDAC [153, 157-159].

Interestingly, both miR-216 and miR-217 were preferentially expressed in pancreas tissues

[139] and more specifically in the exocrine tissues [133] suggesting these pancreas enriched miRNAs are essential for normal pancreas function. Indeed, two independent groups showed the tumor suppressor role of miR-217 in pancreatic cancer [160, 161].

Zhao, et al. revealed the regulation of KRAS oncogene by miR-217 resulting in reduced

KRAS protein translation and subsequent downstream phosphorylation of AKT [160].

Deng, et al., discovered that miR-217 downregulation induced EMT in pancreatic cancer cells similar to the effect of increased TGF beta, suggesting that during inflammation, TGF beta levels increase leading to miR-217 downregulation in chronic pancreatitis and pancreatic cancer [161]. miR-34a is a tumor suppressor miRNA inactivated in several tumors including PDAC as a result of aberrant CpG methylation of miR-34a promotor [162, 163]. miR-34a transactivation via p53 can induce apoptosis and inhibit proliferation and angiogenesis

[164]. Consequently, when miR-34a is epigenetically silenced, it allows the expression of miR-34a target genes which were found to be involved in cell cycle regulation in cancer

[165]. Kent, et al., showed a significant reduction in cell growth with enforced miR-34a expression in several PDAC cell lines [166] suggesting a tumor promoting role in PDAC as result of its loss.

Mucin 4 (MUC4) expression is found in early PanIN lesions but not in healthy pancreas

[167]. MUC4 has been implicated in promoting pancreatic oncogenesis and chemoresistance [168-171]. miR-150 is downregulated in pancreatic cancer tissues with an observed overexpression in MUC4 levels. Srivastava, et al., [172] showed that miR-150 regulates MUC4 expression resulting in reduced levels of EGFR2 and p-EGFR2 and the inhibition of clonogenicity, growth, migration, and invasion of tumor cells thus, demonstrating evidence for the tumor suppressor role of miR-150 in pancreatic cancer

[172].

On the contrary, reviewed in [155], several miRNAs were found significantly upregulated in PanIN lesions and PDAC specimens [148] suggesting an oncogenic activity of these miRNAs. Among those miRNAs with increased expression are miR-155, miR-21, and miR-221 [67, 141, 159, 173-176]. In pancreatic cancer, miR-155 has been found to be among the highly expressed miRNAs in a noninvasive pancreatic cancer precursor lesion,

IPMN [140, 145-148]. miR-155 expression levels correlated with low overall survival in pancreatic cancer patients [159]. Patients with elevated miR-155 expression levels exhibited a 6.2-fold increased risk of succumbing to the disease when compared to patients with low miR-155 expression levels [159]. A reason for an oncogenic role of miR-155 is preventing p53-induced cell apoptosis via its direct targeting of tumor protein 53-induced nuclear protein 1 (TP53INP1) gene [177]. Similarly, miR-21 overexpression was evident in early IPMN [141]. Using in situ hybridization, miR-21 expression was found upregulated in 79% of pancreatic cancer patients and 27% of chronic pancreatitis compared to 8% only in benign pancreas [66]. The level of miR-21 expression was predictive for the outcome where in patients without lymph node metastasis, patients with elevated miR-21 exhibited poorer outcomes when compared to patients with low miR-21 expression [66].

The elevated levels of miR-21 in earlier precancerous events and advanced stages suggests its role in cancer initiation and / or progression. To understand the effect of miR-21, levels of miR-21 was found upregulated in pancreatic cancer cell lines, using in vitro enforced expression of miR-21 resulted in increased cell proliferation and invasion as well as chemoresistance in which all was reversed upon miR-21 knockdown [68, 178]. The tumor suppressor effect of miR-21 knock down is probably mediated by the upregulation of miR-

21 target, PTEN and the inhibition of matrix metalloproteinase, MMP-9, MMP-2, and vascular endothelial growth factor resulting in reduced cell proliferation, invasion, and therapy resistance [68, 178]. miR-221, a known oncogenic miRNA [176] had elevated expression levels in mouse pancreas having PanIN lesions compared to non-pathological mouse pancreas [179] as well as in human pancreatic cancer [67]. miR-221 silencing resulted in cell proliferation and invasion inhibition as well as increased chemosensitivity by sensitizing the cancer cells to chemotherapy [68, 179]. The oncogenic mechanism of miR-221 is partially mediated by miR-221 direct targeting of p27kip1 cell cycle inhibitor gene, a key regulator of cellular proliferation and invasion [68].

In summary, differential expression studies reveal aberrant miRNAs expression in early precancerous lesions and cancer. Studying the mechanisms and consequences of their dysregulation would help decipher the role of miRNAs in carcinogenesis.

Chapter 2: MiR-205 Regulation of HMGB3 in Breast Cancer

2.1. Abstract

Identifying targets of dysregulated microRNAs (miRNAs) will enhance our understanding of how altered miRNA expression contributes to the malignant phenotype of breast cancer.

The expression of miR-205 was reduced in four breast cancer cell lines compared to the normal-like epithelial cell line MCF10A and in tumor and metastatic tissues compared to adjacent benign breast tissue. Two predicted binding sites for miR-205 were identified in the 3’ untranslated region of the high mobility group box 3 gene, HMGB3. Both dual- luciferase reporter assay and Western blotting confirmed that miR-205 binds to and regulates HMGB3. To further explore miR-205 targeting of HMGB3, WST-1 proliferation and in vitro invasion assays were performed in MDA-MB-231 and BT549 cells transiently transfected with precursor miR-205 oligonucleotide or HMGB3 small interfering RNA

(siRNA). Both treatments reduced the proliferation and invasion of the cancer cells. The mRNA and protein levels of HMGB3 were higher in the tumor compared to adjacent benign specimens and there was an indirect correlation between the expression of HMGB3 mRNA and patient survival. Treatment of breast cancer cells with 5-Aza/TSA derepressed miR-205 and reduced HMGB3 mRNA while knockdown of the transcriptional repressor

NRSF/REST, reduced miR-205 and increased HMGB3. In conclusion, regulation of

HMGB3 by miR-205 reduced both proliferation and invasion of breast cancer cells. Our findings suggest that modulating miR-205 and/or targeting HMGB3 are potential therapies for advanced breast cancer.

2.2. Introduction

Breast cancer is the second most prevalent cancer in the USA and is the second most common cause of cancer-related death in this country [180]. It is estimated that 246,660 women will develop breast cancer in 2016 and 40,450 will die of this disease [181]. Like many cancers, breast cancer is a heterogeneous disease that differs molecularly, biologically and clinically. Breast cancer is commonly classified by the estrogen/progesterone (ER/PR) receptor status and the HER2 (ERBB2) amplification status. Breast cancers that are ER+ and or PR+ are treatable with hormonal therapies such as Tamoxifen, while patients having HER2 amplification respond to receptor tyrosine kinase inhibitors such as Trastuzumab. Triple-negative breast cancer (TNBC) is defined by the absence of ER and PR expression and HER2 amplification. Approximately 10-20% of breast cancers are TNBC [182]. These patients have the worse prognosis because of the lack of effective targeted therapeutics [183]. The molecular basis for the TNBC is poorly understood. Successful treatments for TNBC may be possible once a more fundamental understanding of the aggressive phenotype is understood.

Expression of the microRNA, miR-205 is enriched in esophagus, trachea, breast, thymus and prostate tissues [184]. miR-205 is deregulated in many solid tumors, the expression is

27 increased in some tumors while it is decreased in others. miR-205 was overexpressed in endometrial cancer [185] and non-small cell lung cancer [186-188], while its’ expression was downregulated in prostate cancer [189], melanoma [190-192] and breast cancers [79,

80]. miR-205 is found exclusively in normal ducts and lobular myoepithelial cells of the breast but is significantly reduced in breast tumor tissues [80, 193]. The purported tumor suppressive functions of miR-205 in breast cancer is due to direct targeting of several oncogenes such as VEGFA, E2F1, E2F5, PKC epsilon and HER3 (reviewed in [193]) as well as attenuating epithelial to mesenchymal transition (EMT) by suppressing ZEB1 and

ZEB2 [56, 193, 194].

The intent of this study was to identify additional target genes for miR-205 that may be involved in the aggressive phenotype of TNBC. We identified HMGB3, a member of the high mobility group protein superfamily. We show that increased expression of HMGB3, due to reduced miR-205 expression, causes increased cell proliferation and in vitro invasion. Furthermore, breast cancer patients with increased HMGB3 expression have worse survival. These findings suggest that HMGB3 may serve as a biomarker and/or therapeutic target for breast cancer.

2.3. Materials and methods

2.3.1. Ethics Statement

All research involving human specimens has been approved by the Ohio State University institutional review board.

2.3.2. Cell lines

MCF10A, MCF7, MDA-MB-231, MDA-MB-436 and BT549 cell lines were obtained from the American Type Culture Collection or were supplied by various investigators.

MCF-10A cells stably expressing REST shRNA were generated as described in [195].

MCF10A was cultured in DMEM and F-12 media (1:1 ratio) containing 5% horse serum, hydrocortisone, human EGF, cholera toxin, insulin and 1% penicillin and streptomycin as described in [195]. MCF7 and BT549 cell lines were maintained in MEM media supplemented with 10% FBS. MDA-MB-231 and MDA-MB-436 cells were cultured in

DMEM with 10% FBS. All cell lines were cultured under standard conditions.

2.3.3. Tissue procurement

Snap frozen specimens of 33 human breast tissues were supplied by the Midwest division of the Cooperative Human Tissue Network (Columbus, OH). These included 11 matched

29 pairs of tumor and normal adjacent tissue as well as metastatic disease. Clinical data on these tissues are provided in Table 3.

Weight I.D code ID number Age Race Gender Tissue Type Metastasis ER PR HER2 RIN (grams) 1A M1120803A1 77 White Female Malignant 0.2 IDC Positive Positive NA 8.4 1B M1120803B1 77 White Female Normal 0.15 NAT (Adipose) 7.7 2A M1120799A1 65 Other Female Malignant 0.1 IDC Positive Positive Negative 8 2B M1120799B1 65 Other Female Normal 0.1 NAT 6.8 3A M1120620A1 72 White Female Malignant 0.1 IDC, Metastatic Lymph node 8.7 3B M1120620B1 72 White Female Normal 0.2 NAT 8.3 4A M1120696A1 51 White Male Malignant 0.1 DCIS Positive Negative Positive 8.5 4B M1120696B1 51 White Male Normal 0.15 NAT 6.7 5A M1120627A3 37 White Female Malignant 0.1 8.4 5B M1120627B3 37 White Female Normal 0.1 NAT 6.9 6A M1120840A2 64 White Female Malignant IDC Positive Positive NA 8.7 6B M1120804B2 64 White Female Normal 0.2 NAT 7.8 7A M1120679A1 37 White Female Malignant 0.2 IDC Positive Positive Negative 8.9 7B M1120679B1 37 White Female Normal 0.6 NAT 7.6 8A M1120678A1 37 White Female Malignant 0.15 IDC Positive Positive Positive 8.3 8B M1120678B1 37 White Female Normal 0.15 NAT 6.8 9A M1120847A1 59 White Female Malignant 0.1 IDC 8.6 9B M1120847B1 59 White Female Normal 0.45 NAT 7.9 10A M1120734A1 51 White Female Malignant 0.15 IDC Positive Positive Negative 8.8 10B M1120734B1 51 White Female Normal 0.36 NAT 8.3 11A M1120749A3 67 White Female Malignant 1.1 Metastatic Liver 7.9 11B M1120749B1 67 White Female Normal 0.5 8.1 1 3081178A 73 White Female Primary 0.26 7.00 2 4070975A 43 Black Female Primary 0.19 8.90 3 1090025A 37 White Female Primary 0.25 IDC Negative Negative NA 7.70 4 3071778A 60 White Female Primary 1 NA 5 3081284A 50 White Female Primary 0.36 8.10 6 1071686A 33 Black Female Metastatic 0.3 IDC Negative Negative Negative 8.80 7 1081353A 58 Black Female Metastatic 0.15 Lymph node 8.80 8 4080947A 66 Black Female Metastatic 0.17 Lymph node 8.60 9 1030248A 69 White Female Metastatic 0.3 Lung Negative Negative Negative 7.30 10 1030363A 64 Black Female Metastatic 1.9 Brain 8.50 11 4040534A 63 Other Female Metastatic 0.34 Lymph node 9.20 Table 3. Tissue information of breast cancer patients.

2.3.4. RNA extraction

Total RNA was extracted from the cell lines and tissues using Trizol (Invitrogen) and

RNeasy mini kit (Qiagen), respectively, according to the manufacturer’s instructions.

Integrity of the RNA was measured by the Agilent Bioanlyzer; RIN (RNA integrity number) of 7 or higher were considered to have satisfactory integrity.

2.3.5. Real-time PCR

Mature miR-205-5p levels were assayed using TaqMan microRNA Reverse Transcription kit and TaqMan MicroRNA Assay (Applied Biosystems) per the manufacturer’s instructions. Data were normalized to 18S rRNA and the relative gene expression was calculated using the comparative CT method as described in [196]. Primers used in the qRT-PCR are provided in Table 4. Continued

Gene (Human) Primer sequence 5' to 3' Sense GACCAGCTAAGGGAGGCAA HMGB3 Anti-sense ACAGGAAGAATCCAGACGGT Sense GTTACCAGGGAGGAGCAGTGA ZEB1 Anti-sense TTCTGCATCTGACTCGCATTC Sense TGGATAGAGAACGCATTGCCA CDH1 Anti-sense TCGGGCTTGTTGTCATTCTGAT Sense AAAGATCAGCTACCGCATCCT CDH3 Anti-sense ACAAACTGCTCATCCTCACGGT Sense CAGCTAACCAACGACAAAGCC Vimentin Anti-sense ATCCTGTCTGAAAGATTGCAGGG Sense GGTCCACGAGTCACAATCAA Dicer1 Anti-sense CAACTCTCGGGTTCTGCAT Sense AGGCAAGACGAGGACCAGA Tead1 Anti-sense TTCCTTCTGGCAAGAACCTG Sense CAGTGGGTATCTCTGCCAGTG Notch4 Anti-sense TCCTTTGAGCAGTTCTGTCCA Sense ACCAGTGCATAAGCCGAAGA Gab2 Anti-sense AGAGAAGCTGGCACTCCTTG Sense GATGGAATGCAGGTCTGGAG Bcas3 Anti-sense GAGCTCTTGTGCTTCACCACT Sense AGTACCTGAACCGGCACCT Bcl2 Anti-sense CGTACAGTTCCACAAAGGCAT Sense ACCTGCAGATGGAGCATGTT Bcl6 Anti-sense CTTGATGGCAGAAACCATCTCT Sense TCACAGCCATTGCCAAGTT Adrb2 set 1 Anti-sense GATGAAGTAGTTGGTGACCGTC Sense CATCATCATGGGCACTTTCA Adrb2 set 2 Anti-sense GATGAGGTTATCCTGGATCACA Sense GAATTCCAGTACCTGCCAGATA Rela Anti-sense TGCTCTTGAAGGTCTCATATGTC Continued Table 4. List of qPCR primers.

Table 4. Continued

Sense TCTGGAATCAATACTTGGCAGT Cnot8 Anti-sense TGGGAGTACATGTCCTCTGTAAG Sense GAAATTCGGTGGACTGAGAGAT Ran Anti-sense CTATGCCAGTTAGGCACATTCT Sense AGCTGACCAGCTGGAAGAGT Bag1 Anti-sense GAGAGCTTCAGCTTGCAAATC Sense AAAACGAACAAGTTAGTCGCAG Brf2 Anti-sense AGAACTCGACAAAGGTCTCTCAC Sense GAGTATCTGGCCTCCAAGAAGT Fgfr1 Anti-sense TGTCCTCTGTCACCAGGACA Sense GACCATCAGCACCTACCAGA Mina Anti-sense ATACAAGCCCCGAGATGGTA Sense GAGTGAGAATTGAAGGGGACAA Fxr1 Anti-sense CAAATGGAACCATACCGTCTTC Sense CTGGTGGACATGAGTCAAAACT Ereg Anti-sense TGTTCACATCGGACACCAGT Sense GTTTCCAAAGGACTGGACTGTT Dock4 Anti-sense TTACGAAGTGCATCTGAGAGGT Sense GAAGACTGGCTACAACGTGAAG Rab6b Anti-sense CTTTTCTCCTGGACATTCTCCA Sense TTCAATGGCAAAGAATCTGTCA Plxna4 Anti-sense TGAGGGTGGTTGTGTTCACA Sense AGTAGCAAGGTTCAACGATCTG Runx2 Anti-sense AGGATTTGTGAAGACGGTTATG Sense TGACAAGCAGCCTTATGAAAAG HMGB1 Anti-sense CTTTAGCTCGATATGCAGCAAT miR-205 primary/precursor Sense GACCGAATTCACGTGTTGAACTAGCTCTCT insert for pcDNA3.1+ cloning using EcoRI and XhoI restriction Anti-sense ATGCCTCGAGTCATTGATCACATTTCTCTC enzymes

2.3.6. Transient transfection assays

For HMGB3 functional studies, MDA-MB-231 and BT549 cell lines were transfected using lipofectamine 2000 (Invitrogen) with HMGB3 siRNA or control siRNA

(Dharmacon). Target identification studies were conducted by transfecting the same cell lines with precursor miR-205-5p mimic oligonucleotides (pre-miR-205-5p) or pre-miR negative control (Dharmacon). Transient transfection assays were conducted for 48 h with

100 nM of oligonucleotides.

2.3.7. miR-205 overexpressing stable cells

Partial length of the miR-205 primary precursor sequence was cloned and inserted into the pcDNA3.1(+) vector. MDA-MB-231 cells were transfected with the construct and selected using G418, Geneticin®.

2.3.8. Lentiviral knockdown of REST in MCF7 cells

Stable REST knockdown in MCF7 cells was achieved using a Dharmacon SMARTvector lentiviral shRNA delivery system as per manufacturer’s instructions. Briefly, cells were infected in the presence of 8 mg/mL polybrene at an MOI of 5 with virus expressing a non- targeting control or REST shRNA. Puromycin selection was initiated 48 h after infection and maintained during cell expansion. SMARTvector Lentiviral Particles (catalog # SH -

042194-01-25) towards REST targeted the sequence GCAAACACCTCAATCGCCA, Non-

Targeting SMARTvector shRNA Lentiviral particles (catalog # S-005000- 01) were used as an infection control.

2.3.9. Luciferase reporter assay

Approximately 2.8 kbp of the HMGB3 3’ untranslated region (3’ UTR) containing two predicted miR-205 binding sites was PCR amplified and inserted downstream of the renilla luciferase gene in the PsiCheck-2 plasmid (Promega). MDA-MB-231 cells were cotransfected with the HMGB3 PsiCheck-2 construct and 100 nM of pre-mir-205 or control oligo. After 48 h, the renilla and firefly luciferase activities were measured using the Dual-Luciferase Reporter Assay kit (Promega).

2.3.10. Western Blotting and antibodies

Protein was extracted from cell lines and human tissues using standard conditions. Anti-

HMGB3 antibody (Abgent, # AJ1365) and anti-GAPDH (SC-32233, Santa Cruz

Biotechnology).

2.3.11. WST-1 proliferation assay

Cells were plated in 96-well plate overnight and then transfected with 100 nM oligos.

Following 96 h, WST-1 reagent (Roche) was added for 1.5 h and absorbance was measured using standard conditions.

2.3.12. Matrigel invasion assay

Cells (2×105) were plated in 60 mm dishes. Following an overnight incubation, they were transfected with 100 nM oligonucleotides. After 48 h, the cells were collected and 5×104 cells were seeded onto Matrigel coated inserts (3µm pore size, BD Biosciences) for 24 h.

Cells that migrated through the Matrigel were visualized following fixation with methanol and staining with crystal violet.

2.3.13. Immunohistochemistry

Human breast tissues were fixed overnight in 10% formalin and then stained for HMGB3 using anti-HMGB3 antibody (Abgent, # AJ1365) following standard techniques.

2.3.14. Drug treatment

In a 6-well plate, 2×105 cells were plated per well. Following an overnight incubation, the cells were exposed to 10 µM 5-Aza-2’-Deoxycytidine (5-Aza) (InSolution™ Millipore),

600 nM TSA (Trichostatin A, Sigma) or a combination of both. The cells were exposed to

5-Aza for 96 h, fresh drug was added after 48 h. For the combination treatment, TSA was added on the third day and cells were collected on fourth day.

2.3.15. Kaplan Meier survival plot

A disease free survival for breast cancer patients was analyzed as a function of HMGB3 gene expression using open access web resource G-DOC developed at Georgetown

University Medical Center [197].

The G-DOC data repository is designed to store multiple types of metadata associated with individual samples and patients including demographic data, clinical outcome, and tumor- specific phenotype data as well as molecular profiling data such as gene and microRNA expression. The data in G-DOC are uniformly processed using validated algorithms within the R-based bioinformatics toolbox (Bioconductor) [198], formatted and mapped using R scripts, and then uploaded to the central database. Current version of G-DOC 2.0 contains

26 breast cancer studies with total number of 3653 patients. To assess a role of HMGB3 gene expression in clinical outcome of breast cancer we have analyzed a dataset from Loi, et al., study [199] using KM survival analysis tools that are build-in in G-DOC web portal

[197]. Log ratios of gene expression was used to construct KM for disease free survival of breast cancer patients. 3 groups of patients were compared, patients with HMGB3 gene down-regulated by more than 1.2 fold, patients with genes overexpressed by more than 1.2 fold, and patients with intermediate values of fold change. A significance of differences between each pair of KM curves was estimated based on p-values of logrank test [200].

The breast cancer studies and the analysis tools are freely available via open access web portal at gdoc.georgetown.edu.

2.4. Results

2.4.1. miR-205 expression in breast cell lines and tissues

The levels of miR-205 were measured in five breast cell lines. miR-205 was significantly reduced in BT549, MDA-MB-231 and MDA-MB-436 compared to the normal-like

MCF10A breast cell line (Figure 2A). MCF7 is an ER/PR positive breast cancer cell line while BT549, MDA-MB-231 and MDA-MB-436 are TNBC cell lines. The levels of miR-

205 were undetectable (CT > 37) in the TNBC cell lines. miR-205 was measured in 33 human breast tissues by qRT-PCR. There was a trend of reduced miR-205 expression when progressing from the normal adjacent tissue to non-metastatic and metastatic disease

(Figure 2B). These results are in accordance with previous reports about the significant reduction of miR-205 in TNBC compared to other types of breast cancer [201, 202].

Figure 2. miR-205 is down-regulated in breast cancer. (A) Expression pattern of miR-205-5p in MCA10A, MCF7, BT549, MDA-MB-231, and

MDA-MB-436 cells. The data in cancer cell lines are expressed as fold-change compared to MCA10A, which was assigned a value of “1”. (B) miR-205-5p levels in the normal adjacent breast tissues (N), non-metastatic tumor (T), and metastatic breast cancer specimens (M) were determined by qPCR. Data are presented relative to 18S rRNA. Mean values are indicated by horizontal bars.

2.4.2. Tumor suppressive role of miR-205

Functional studies of miR-205 were conducted in MDA-MB-231 and BT549 TNBC cell lines using both transient transfection of pre-miR-205 oligo and stable miR-205 over expression. Cell proliferation (Figure 3A) and in vitro invasion (Figure 3B) of MDA-MB-

231 and BT549 cells decreased following pre-miR-205 oligo transfection. Stable over expression of miR-205 in MDA-MB-231 and BT549 cells was confirmed by qRT-PCR

(Figure 3C). Stable expression of pre-miR-205 reduced colony formation (Figure 3D) and proliferation (Figure 3E) of MDA-MB-231 and BT549 cells. These functional studies support the tumor suppressive role of miR-205 in breast cancer as reported by others [80].

Figure 3. Over-expression of miR-205 reduces the proliferation and in vitro invasion of breast cancer cell lines. (A) MDA-MB-231 and BT549 cells were transfected with 100 nM of pre-miR-205 or control oligonucleotides. Following a 96 h exposure, cell proliferation was measured using a WST-1 assay. (B) Representative photographs showing in vitro Matrigel invasion assay of MDA-MB-231 and BT549 cells after transfection with pre-miR-control or pre-miR-205-

5p 48 hr prior to seed into the upper chamber of 24-well transwell units.

Continued

Figure 3. Continued

Bar graphs represent the mean ± SD values of the relative number of invasive cells (n=4).

(C) Real time TaqMan analysis of miR-205 levels in stable cell lines over-expressing primary transcripts of miR-205. (D) Relative representation of the number of colonies in

MDA-MB-231 and BT549 cells stably expressing miR-205-5p. (E) Overall proliferation of miR-205-5p stably expressing MDA-MB-231 and BT549 cells up to 96 hrs.

2.4.3. miR-205 targets HMGB3

To investigate novel targets, we noted that TargetScan predicted two miR-205 binding sites in the 3’ UTR of human HMGB3 (Figure 4A). Binding of miR-205 to the 3’ UTR of

HMGB3 was validated using luciferase reporter assays (Figure 4B). HMGB3 protein was reduced in MDA-MB-231 and BT549 cells transfected with pre-miR-205 oligo compared to control oligo (Figure 4C). In an effort to identify other predicted targets of miR-205, we measured their mRNA expression in MDA-MB-231 and BT549 cell lines following transfection of pre-miR-205 or pre-miRNA control oligos. Of the 23 genes measured by qRT-PCR, 6 (DOCK4, RAB6B, PLXNA4, RUNX2, HMGB1 and HMGB3) were significantly reduced in the miR-205 transfected cells (Figure 4D). These data confirm that the reduction in HMGB3 protein by miR-205 results from a decrease in the HMGB3 mRNA and identifies a number of potential miR-205 target genes.

Figure 4. HMGB3 is a target of miR-205 in breast cancer. (A) Schematic diagram of miR-205 binding sites in the 3' UTR region of HMGB3 mRNA.

(B) Luciferase reporter plasmids carrying the full length of HMGB3 3' UTR were transiently co-transfected with the negative control of pre-miR precursor (N) or the miR-

205 precursor (205) at 50 and 100 nM concentrations. Luciferase activity was measured

24 h after transfection. The data are the mean ± SD of at least 3 independent transfections.

BT549 cells. Normalized expression to β-actin is included.

Continued 43

Figure 4. Continued

(D) Expression of the selected predicted oncogenic target genes of miR-205 was evaluated in both MDA-MB-231 and BT549 cells 48 h after transfection of either control oligonucleotides or pre-miR-205-5p. Expression levels were calculated relative to 18S rRNA and the data are expressed as fold-increase compared to cells treated with control oligo (assigned a value of “1”).

2.4.4. Functional effects of miR-205/HMGB3 regulation in breast cancer

To determine functions of HMGB3 overexpression in breast cancer, we conducted WST-

1 proliferation and in vitro invasion assays in breast cancer cell lines. We found a significant reduction of proliferation (Figure 5A) and invasion (Figure 5B) of MDA-MB-

231 and BT549 cells treated with HMGB3 siRNA compared to scrambled control siRNA.

Thus, the effects of suppressing HMGB3 mRNA either by miR-205 oligo or HMGB3 siRNA are identical in these cell lines (figures 3 and 5). The expression of HMGB3 mRNA was quantified in the 33 human breast tissues and was elevated in the metastatic group and in the breast tumors compared to unaffected adjacent benign tissue (figure 6A). The

HMGB3 protein levels were assayed in 5 matched pairs of the human breast tissues.

HMGB3 was undetected in the normal adjacent tissue samples while abundantly present in the tumor tissue (figure 6B). To identify tissue localization, we performed immunohistochemistry staining against HMGB3 protein and found that HMGB3 is localized in the glands and ducts of normal adjacent tissue while widespread in tumor tissue

(figure 6 C and 6D). To determine if a correlation exists between HMGB3 expression and patient survival, we analyzed published breast cancer data sets. Three groups of patients were identified, those with an intermediate tumor levels of HMGB3 and those with increased or decreased HMGB3 expression in the tumors. Those patients with over expressed HMGB3 expression had the poorest survival (P<0.05). Patients with down regulated HMGB3 expression survived longer than those with intermediate expression, however the difference was not significant (p=0.09) (figure 6E).

Figure 5. Knockdown of HMGB3 reduces the proliferation and in vitro invasion of breast cancer cells. (A) Proliferation of MDA-MB-231 and BT549 cells transfected with HMGB3 siRNA or control siRNA. (B) in vitro Matrigel invasion assay of MDA-MB-231 and BT549 cells after transfection with HMGB siRNA or control siRNA 48 hr prior to seed into the upper chamber of 24-well transwell units. Bar graphs represent the mean ± SD values of the relative number of invasive cells.

Figure 6. HMGB3 is over-expressed in primary breast cancer tissues. (A) Expression pattern of HMGB3 mRNA level in normal adjacent (N), non- metastatic tumor (T) and metastatic (M) breast cancer tissues. mRNA expression levels were calculated relative to 18S rRNA. Continued 47

Figure 6. Continued

(B) HMGB3 and GAPDH protein levels in non-metastatic and metastatic breast cancer compared to paired normal tissues was determined by western blotting. HMGB3 expression was confirmed by immunohistochemistry staining in human breast tissues.

Brown color indicates HMGB3 staining in adjacent benign tissue (C) and tumor (D). (E)

Kaplan Meier plot of disease free survival based on HMGB3 expression in breast cancer samples. Blue, patients with gene down-regulated by more than 1.2 fold; red, patients with genes overexpressed by more than 1.2 fold; yellow patients with intermediate values of fold change. P-values of log-rank test for each pair of KM curves are provided at the bottom of the plot.

2.4.5. Relationship between miR-205, HMGB3 and EMT

Since miR-205 directly targets ZEB1 and ZEB2 in Madin Darby canine kidney cells [56], reduced expression of miR-205 could maintain breast cancer cells in the mesenchymal state through ZEB1/ZEB2 inhibition of E-cadherin (CDH1). We validated these findings in the

TNBC cell lines MDA-MB-231 and BT549. These cell lines are considered to be mesenchymal-like [203]. miR-205 transfection for 48 hours decreased the protein levels of the mesenchymal N-cadherin, vimentin, and ZEB1 in BT549 cells. Normalized expression to β-actin is indicated at each concentration condition (figure 7).

To relate HMGB3 to EMT, we measured epithelial and mesenchymal markers in MDA-

MB-231 cells exposed to HMGB3 siRNA for 48 hours. Individual mRNA expression

48 levels were calculated relative to 18S rRNA and the data are expressed as fold change under input control, which was assigned a value of “1”. Knocking down of HMGB3 increased the mRNA expression level (figure 8A) and protein level (figure 8B) of CDH1 while ZEB1 was essentially unchanged (figure 8B). GAPDH served as a loading control.

Relative intensities are indicated above each band. Our data indicated that HMGB3 promotes EMT, however it is not through inhibition of ZEB1 protein levels.

Figure 7. EMT markers protein levels in miR-205 treated BT549 cells. N-cadherin, Vimentin, ZEB1 and β-actin protein levels were determined by

western blotting in BT549 cells 48 hr after transfection of pre-miR-negative or

pre-miR-205. Protein was harvested using CellLytic™ MT (Sigma Aldrich, St.

Louis, MO) and 1X protease and phosphatase inhibitor (Pierce, Rockford, IL)

using standard techniques. Normalized expression to β-actin is indicated at each

concentration condition.

Figure 8. HMGB3, CDH1, and ZEB1 in siHMGB3 treated MDA-MB- 231. (A) qPCR verification of relative expression levels of CDH1 in MDA-MB-

231 cells after transfection of HMGB3 siRNA. Individual mRNA expression levels were calculated relative to 18S rRNA and the data are expressed as fold change under input control, which was assigned a value of “1”. (B)

MDA-MB-231 cells were transfected with control siRNA or HMGB3 siRNA for 48 hours. HMGB3, CDH1 and ZEB1 proteins were measured by immunoblotting in MDA-MB-231 cells transfected with control siRNA or

HMGB3 siRNA. GAPDH served as a loading control. Relative intensities are indicated above each band.

2.4.6. Chromatin modifying agents attenuate HMGB3 levels through de-repression of miR-205

Repression of miR-205 in prostate and breast cancer cell lines has been linked to promotor hypermethylation of the miR-205 host gene LOC642587 [204]. Also H3K9 deacetylation contributed to the miR-205 suppression in prostate cancer cell lines [204]. Attempts as miR-205 derepression in TNBC cells were done by treating MDA-MB-231 cells with 5-

Aza/TSA. 5-Aza/TSA treatment increased the miR-205 expression by more than 2-fold

(figure 9A) and decreased HMGB3 mRNA nearly 2-fold (figure 9B). Thus small molecule treatment of breast cancer may impact HMGB3 via derepression of miR-205.

Figure 9. Expression of miR-205 and HMGB3 in 5-Aza and TSA treated cells. Expression levels of (A) miR-205 and (B) ced HMGB3 expression in MDA-MB-231 cells treated with a combination of 5-Aza and TSA as described in Methods.

2.4.7. Relationship between REST, miR-205 and HMGB3

REST/NRSF is a transcriptional repressor of neuronal genes in non-neuronal tissues. A

subset of breast cancers with reduced expression of REST (i.e. REST-less tumors) display

a highly aggressive phenotype that includes poor prognosis and increased likelihood of

disease recurrence within the first three years after diagnosis [195]. We examined the miR-

205 expression in REST-less MCF-7 and MCF-10A cells (i.e. cells stably expressing REST

shRNA). REST knockdown significantly reduced the miR-205 expression in MCF-7 but

52 not MCF-10A cells (figure 10A). Concomitantly, HMGB3 levels had a significant increase by REST knockdown in MCF-7 but not MCF-10A cells (figure 10B). Thus, knockdown of REST enhanced the HMGB3 up-regulation, presumably through reduced miR-205, in the cancerous MCF-7 cells but had no effect on MCF-10A cells supporting the hypothesis that REST-less tumor cells display an aggressive phenotype [195].

Figure 10. Change in miR-205 and HMGB3 expression in REST-less cells.

(A) The amount of miR- 205 in MCF7 cells stably expressing shRNA to REST

(RESTless cells) was decreased compared to control but was unchanged in the

RESTless MCF10A cell line. (B) HMGB3 mRNA levels increased only in the

RESTless MCF7 cell line.

2.5. Discussion

The overall aim of this study is to support the tumor suppressor role of miR-205 in breast cancer and demonstrate that reintroduction or derepression of the miRNA in TNBC cell lines is beneficial. We report that the expression of HMGB3, a member of the high mobility group protein superfamily, is increased in advanced breast cancer. A link between HMGB3 and the invasive, metastatic phenotype has been made by demonstrating that HMGB3 mRNA levels are increased in metastatic breast cancers (figure 6A), that knockdown of

HMGB3 decreases in vitro invasiveness (figure 5B) and patients with increased HMGB3 expression have poor survival (figure 6E). Moreover, we link the up-regulation of HMGB3 in breast cancer to miR-205, a miRNA that has been shown here (figure 2) and in other studies [79, 80, 193, 194] to have reduced expression in breast cancer.

The HMG superfamily of DNA binding proteins recognize the HMG box, typically located in promoters. HMG proteins are referred to as architectural transcription factors [205]. The

HMG family binds to and distorts DNA causing chromatin modification and facilitating either activating or repressing transcription factors to bind to the promoter [206]. There are two major subclasses of HMG proteins, HMGA and HMGB. There is structural resemblance between HMGB1, HMGB2 and HMGB3 which indicates similar biological functions for these proteins. Of the 4 HMGB proteins, HMGB1 has been the most heavily studied. HMGB1 is involved in many biological processes including DNA repair [reviewed in [205]]. Previous studies have shown the oncogenic role of HMGB1 in cancer. When

HMGB1 binds to its’ receptor RAGE (receptor for advanced glycation end-products) it promotes tumor growth and metastasis [207].

HMGB3 is present mainly in the bone marrow and is involved in hematopoietic stem cell renewal [208, 209]. Recently, HMGB3 was reported to be a target for miR-206 and is involved in muscle regeneration [209]. It was among a group of embryonic stem cell-like transcriptional regulators overexpressed in poorly differentiated, high-grade tumors [210].

With the exception of the work by Ben-Porath, et al., [210], we are unaware of any studies linking HMGB3 and breast cancer.

In summary, miR-205 is an important tumor suppressor in breast cancer. It has been shown to regulate a number of important oncogenic targets including ZEB1, VEGFA and HER3

[reviewed in [193]]. Our data suggest that in addition to HMGB3, miR-205 may modulate several additional targets such as PLXNA4 and RUNX2 (figure 4C). It is possible therefore that HMGB3 and other oncogenic proteins may be reduced in advanced breast cancer via miR-205 derepression using epigenetic modifying drugs. Of note is the fact that 5-Aza is currently in phase II clinical trials for advanced breast cancer (ClinicalTrials.gov).

Modulation of downstream targets of miR-205 such as HMGB3, through miR-205 derepression may enhance our understanding of the therapeutic benefit of these drugs.

Acknowledgment

I thank Dr. Jong-Kook Park for experiment design, cloning and invasion assay, Dr. Yuriy

Gusev for Kaplan Meier survival plot, and Dr. Avtar Roopra for generating REST shRNA stable cells.

Chapter 3: Enhancement of Pancreatic Acinar Ductal Metaplasia by MiR-217

Derepression of REST/NRSF

3.1. Abstract

PDAC develops through a series of precursor lesions, the first of which is the acinar ductal metaplasia, whereby acinar cells transdifferentiate into ductal cells. We explored potential new mechanisms of pancreatic acinar ductal metaplasia (ADM) by first focusing on miR-

217, a miRNA that has been reported as reduced in PDAC specimens and in mouse models of PDAC. Previous work in our lab identified the transcriptional repressor REST/NRSF as a direct target of miR-217. We showed in previous work that miR-217 levels decreased and Rest increased during an experimental in vitro ADM model, where freshly isolated mouse acini cells transdifferentiate into ductal cells within four days when plated in

Matrigel. To study the role of REST during ADM, mouse acini were infected with adenovirus constructs of Rest or control adenovirus prior to initiating a four day transdifferentiation experiment. Compared to control, Rest infection increased the number of ducts formed and maintained lower levels of acinar genes and higher expression of epithelial marker. Using gene set enrichment analysis, we show that Rest infected acini were negatively enriched for REST target genes and in acinar transcription factors. To further implicate REST in the regulation of ADM, we identified a Rest binding site in Ptf1a,

57 a major acinar transcription factor. We propose a mechanism by which high levels of miR-

217 indirectly maintain acinar related transcription factors by repressing REST and upon loss of miR-217 promotes ADM by reversing this process.

3.2. Introduction

3.2.1. Pancreas development

The pancreas is formed from the ventral and dorsal buds of the foregut endoderm during embryogenesis [211]. The pancreas comprises of different cell lineages developing into the exocrine and endocrine systems. The exocrine portion, representing greater than 95% of the organ [212, 213] is composed of digestive enzymes secreting acinar cells and ductal cells that serve to drain the enzymes into the intestine. The endocrine portion consists of islets of Langerhans comprising of glucagon secreting alpha-cells (α-cells), insulin secreting beta-cells (β-cells), somatostatin secreting delta cells (δ-cells), ghrelin secreting

(ε-cells), and pancreatic polypeptide secreting PP-cells (γ-cells), [211, 214].

Pancreas development arises from a population of highly proliferative multipotent progenitor cells (MPCs) with the ability to form all three pancreatic lineages under the influence of a hierarchy of transcription factors. Murine pancreas develops after gastrulation at embryonic day 8.5 (E8.5) [215]. Pancreatic and duodenal homeobox 1-

(Pdx1) positive cells give rise to ventral and dorsal pancreas [216]. Pdx1 positive cells can give rise to different cell populations, revealing the multipotent progenitor role of Pdx1

58 positive cells [215, 217]. Pdx1 MPCs ensures the formation of different cellular lineages responsible for conducting the main functions of the pancreas organ, production and transport of digestive enzymes and glucose homeostasis [216, 217]. The use of tamoxifen inducible Pdx1-CreERTM mouse model has demonstrated that Pdx1 positive cells gave rise to exocrine, ductal, and endocrine cells when tamoxifen was administered at E9.5

[216]. After E9.5, other transcription factors play imperative roles in ensuring a pancreatic cellular fate. Around E9.5-E10.5, pancreas specific transcription factor, 1a (Ptf1a/P48) is expressed and ensures the acquisition of an exocrine pancreatic fate while endocrine cells arise from Ptf1a negative cell population [215, 218]. In the adult pancreas, Pdx1 is restricted to endocrine β-cells [219] and Ptf1a remains in acinar cells exclusively [220].

Adapted from MacDonald, et al., [213], figure 11 reveals an intricate network of transcription factors responsible for the proper differentiation of MPCs into all pancreatic cell lineages.

Ptf1a is a basic helix-loop-helix (bHLH) DNA-binding transcription factor promoting the expression of acinar genes [220]. It is required for MPCs formation and its preferential development into an acinar fate over an endocrine fate [221]. Ptf1a loss of function studies revealed its importance in determining the acinar fate when partial loss of Ptf1a led to endocrine development in cells that would normally become acinar [213].

Ductal

Pdx1 Hnf1b α-cells Ptf1a Sox9 β-cells (P48) Ngn3 Islet δ-cells Sox9 Myc ε-cells Preendocrine Nr5a2? γ-cells Early pancreatic MPC epithelium Ptf1a Mist1 Nkx6-1 Rbpjl Gata4 Prox1? Nr5a2 Atf4 Preacinar Xbp1 Atf6 Acinar

Figure 11. Transcriptional determinants of pancreas cell-lineage development. Modified from Macdonald, et al., 2010.

3.2.2. Acinar-to-ductal metaplasia

PDAC was presumed to originate from ductal cells of the pancreas owing to the ductal phenotype of the tumor. However, this theory has been challenged and many studies have demonstrated an acinar origin of PDAC [222-232]. Acinar cell clusters transdifferentiate into ductal cells, a reversible process resulting from pancreatic injury such as inflammation in the pancreas [233]. The process of ADM was mentioned in early pancreatitis studies

[234, 235], when repeated injections of caerulein, a cholecystokinin analogue, induced acute pancreatitis as a result of pancreas autodigestion [215]. In response to the injury,

60 acinar cells appeared to transdifferentiate to duct-like cells before a complete regeneration of the pancreas. In 2008, Fendrich, et al., confirmed the acinar origin of the transdifferentiated ductal cell using lineage tracing studies in a murine pancreatitis model

[236]. In cases of persistent inflammation from chronic pancreatitis, activation of Kras and/or epidermal growth factor receptor (EGF-R) signaling pathway, ADM can progress to PanIN lesions leading ultimately to PDAC [233]. This finding revealed a link between early pancreatitis and PDAC.

The importance of studying ADM was emphasized when a lineage tracing study failed to show PDAC development after oncogenic Kras was activated in ductal lineages [237]. This study not only revealed that oncogenic Kras alone may be insufficient to cause PDAC, but also it led to consideration of an alternative theory for PDAC cell of origin. PDAC could arise from a different cell lineage and following insult or injury, these cells could transdifferentiate and gain a ductal-like phenotype. Indeed, several pioneering studies

[222-232, 238] showed activation of oncogenic Kras in acinar cells developed PanIN lesions which progressed to PDAC in young mice but not in adult mice unless a secondary insult was induced such as caerulein-induced pancreatitis [232].

These ground breaking studies [230-232, 239] strengthened the acinar cell origin of PDAC theory. When Kras mutation was induced downstream of acinar promotors such as elastase

[240] and Mist1 [238], both developed ADM. However, in the elastase model, full blown

PDAC was not developed, only pre-invasive lesions, suggesting the need of a secondary insult [240]. Meanwhile, the Mist1 model revealed a more aggressive fate where ADM developed as early as two months and carcinoma developed at three months [238]. Further

61 characterization of ADM revealed the gain of pancreatic embryonic progenitor cell markers such as Hes1, Pdx1, and Sox9 [236, 241, 242]. A study reported PanIN lesions formation when mutant Kras was expressed in ductal cells, however, PanIN lesions were formed at a very much lower frequency [243]. Elegant studies by Kopp, et al., used a tamoxifen inducible Sox9CreER and Ptf1aCreER mutant Kras mice models to induce Kras in ductal/ centroacinar cells and acinar cells, respectively [229]. Transformation of acinar cells into

PanIN lesions occurred when Kras was induced only in acinar cells in all Ptf1aCreER;LSL-

KrasG12D;R26RYFP. While in Sox9CreER;LSL-KrasG12D;R26RYFP, ductal cells including centroacinar cells failed to transform into PanIN lesions at the same rate [229]. Recently,

Krah, et al., utilized an inducible conditional Ptf1a knockout mouse model in which Ptf1a deficient mice exhibited accelerated ADM, dramatic sensitization to Kras, transformation, and accelerated invasive PDAC development [244].

In summary, multiple studies support the acinar origin for PanIN lesions which progresses into PanINs and PDAC, suggesting ADM to be an important precursor lesion.

3.3. RE1-silencing transcription factor

Repressor element-1 silencing transcription factor (REST) also known as the neuron- restrictive silencer factor (NRSF) is a zinc finger repressive transcription factor that binds to a specific 23 base pair consensus sequence [245, 246] called the neuron restrictive silencer element (NRSE/RE-1). These sequences lie within regulatory regions of targeted genes (referred to as REST target genes) and upon REST binding, REST restricts their

62 expression in non-neuronal cells [245, 247-251]. REST consists of two independent repression domains (RDs); an N-terminal domain and a C-terminal zinc finger domain

[252]. The precision of REST in silencing neuronal genes in non-neuronal tissues is remarkable and crucial for proper development. REST and its cofactor CoREST orchestrate the repression of neuronal genes in differentiated non-neuronal tissues [253] by recruiting silencing machinery complexes such as methyl DNA binding protein MeCP2,

SuVar39H1, and histone H3 K9 methyltransferases G9a [249, 254, 255]. The molecular mechanism of REST depends on the binding of REST RDs to their NRSE/RE-1 binding sites in REST target genes and negatively regulate their expression [249] via the recruitment of histone deacetylases by mSin3 and CoREST corepressors [256]. The N- terminal RD recruits the mSin3 and histone deacetylase1 (SIN3A/B HDAC) complex [215,

257-259] while the C-terminal RD interacts with CoREST and recruits a distinct HDAC complex [253, 256].

To date, REST was found to regulate more than 2000 neuronal specific genes making it a determinant factor for the expression of neuron specific genes outside the central nervous system [260, 261]. REST is mainly expressed in embryonic stem cells and adult non- neuronal tissues [262]. In the nervous system, its expression is restricted to undifferentiated neuroepithelium [262] and maintained at minute levels in mature neurons after differentiation [263, 264]. Low levels of REST allows the transcription of REST target genes essential for neural phenotype acquisition [265] thus, corroborating the importance of REST in regulating brain development and functions.

3.3.1. REST implication in cancer

REST expression is overexpressed in neural tumors and downregulated in some epithelial cell type tumors. High expression levels of REST was detected and correlated with tumor aggressiveness [266] in the cases of neuroblastomas [267], medulloblastomas [268], pheochromacytoma [269], and multiform glioblastoma [266]. The opposite pattern was discovered in epithelial cancers, colon cancer [270], breast cancer [195, 271], and small- cell lung cancer [272, 273] where REST expression was significantly lower in tumor indicating a tumor suppressor role in these cancers. Wagoner, et al., reported that REST expression is lost in breast cancer [195]. They reported that REST-less breast cancer patients had twice the chance of disease recurrence and much poorer prognosis [195].

This dual role of REST suggests a tissue specific role depending on the cell type, REST expression level, and the chromatic architecture of specific genes [274, 275]. Chromatin immunoprecipitation coupled with high-throughput sequencing (Chip-Seq) has been used to identify hundreds of genes harboring a putative NRSE REST binding site [276-279].

However, it has been reported that REST regulation in vivo is tissue specific [278] and only a group of predicted REST target genes are actually regulated in a particular cell context

[280, 281]. This suggests that not only the presence of REST is a prerequisite for REST binding and regulation but also, the chromatin architecture of the NRSE harboring REST target genes. In a particular cell type/tissue, the chromatin architecture of the target genes decides whether REST can access the NRSE binding site or not to repress its transcription

[274]. Thus, it is crucial to determine the physiological function of REST in different

64 tissues [274] by identifying which subset of REST target genes are repressed to understand the biological relevance of REST in different organs.

3.3.2. Implications of REST in pancreas

In the pancreatic islets of Langerhans, early studies have shown a similar inhibitory role for REST in insulin and glucagon producing cells. Atouf, et al., has shown the absence of

REST in INS-1, RINm5F, and β-TC insulin producing cell lines as well as α-TC glucagon producing cell line [282]. The importance of REST during β-cell differentiation was reported by Kemp, et al., who identified the regulatory role of REST in Pax4 expression.

Pax4 is essential in β-cell lineage differentiation [283] as suggested by the severe deficiency of β-cells and failure to develop β-cells in Pax4 null mice [283]. However, in the developing pancreas, an intricate temporal expression of transcription factors is crucial to commit progenitor cells to pancreatic lineages. Thus, REST is vital for pancreatic islet development via its temporal repressive effect on Pax4 that otherwise would be active in the absence of REST [283].

With the use of large-scale Chip assays to uncover all possible REST target genes, Johnson, et al., [277] identified non-canonical REST binding motifs and discovered new REST target genes. Among these were a set of key transcription factors involved in driving pancreatic islet cell development. This study was the first to identify the transcription factors hepatocyte nuclear factors HNF4A, HNF6, and HES1 as in vivo binding REST target genes as well as NEUROG3, corroborating a previously identified target gene [284].

With the discovery of the importance of REST in pancreatic islet development, some studies have investigated the use of REST in generating insulin producing cells. Li, et al., attempted to take advantage of the ability of REST to differentiate cells into insulin producing β-cells [285]. They examined the effect of silencing REST in human amniotic fluid-derived stem cells (hAFSCs) in an effort to induce human amniotic fluid stem cells

(hAFSCs) to differentiate into insulin producing islet β-cells [285]. Successful REST knockdown in hAFSCs was achieved using small interference NRSF lentiviral vector

(siNRSF). The corresponding siNRSF-hAFSCs cells differentiated into insulin producing cells as confirmed by the expression of Insulin, Glut2, Hnf4a, Pdx1, Isl1, and Nkxx6.1 and the production of C-peptide in response to glucose [285]. A similar study succeeded in generating insulin producing cells using rat bone marrow-derived mesenchymal stem cells

(bmMSCs) via repressing REST and sonic hedgehog (Shh) and overexpressing Pdx1 [286].

A most recent study was conducted to study the developmental role of REST in pancreas.

Martin, et al., used an in vivo mouse model to examine the effects of REST gain of function in the epithelial pancreatic progenitor cells using an inducible Pdx1-tTA;TetO-REST bigenic mouse model [287]. The bigenic Pdx1-tTA;TetO-REST mice bear a Tet-off regulatory cassette which allows the expression of REST in the absence of Doxycycline in all the epithelial cells at an early stage to investigate the consequences of REST deregulated levels on endocrine differentiation. Enforced expression of REST in progenitor cells impaired the rise of Neurogenin 3 (a REST target gene) positive endocrine precursor cells.

This lead to impaired endocrine cell differentiation as well as the development of diabetic adult mice [287] due to impaired glucose homeostasis and hyperglycemia. REST

66 expression is present in pancreatic endocrine progenitor cells. This finding corroborated recent studies showing the REST gene acquiring a repressive polycomb meditated

H3K27me3 mark post pancreatic precursor stage [288].

All the reported studies to investigate the role of REST in pancreas focused on REST in the development of endocrine pancreas and its use in generating functional insulin producing β-cells. No studies are reported to our knowledge to examine the role of REST in exocrine pancreas, PanIN lesions or pancreatic cancer. In this chapter we used an experimental ADM model to show the effect of enforced Rest overexpression on murine exocrine acinar cells during ADM.

3.4. Materials and methods

3.4.1. Cell Culture

Panc-1, MiaPaca-2, BXPC3, and AR42J cell lines were obtained from The American Type

Culture Collection (ATCC). Other cell lines were generous gifts from various investigators,

HPNE (Dr. Michel Ouellette), PaTu-T, and PaTu-S (Dr. Irma van Die), KPC (Dr. Anirban

Maitra). Cell lines were cultured per guidelines or frozen cell pellets were directly lysed for protein analysis.

3.4.2. Protein extraction and Western Blotting

Total protein was extracted after cells were lysed using RIPA Buffer (Sigma-Aldrich) supplemented with 1X protease and phosphatase inhibitors (Pierce). Lysates were sonicated then spun at 14,000 rcf for 15 minutes at 4oC. Protein concentration was measured using Bicinchoninic acid protein assay (BCA) kit (Pierce). Once measured, 30

µg of protein was mixed with 4X non-reducing lithium dodecyl sulfate sample loading buffer (NuPAGE® LDS Sample Buffer) with 3% of 2-mercaptoethanol then heated at 70oC for 10 minutes. Protein was separated using SDS-PAGE at 85 V for 2 hours using a precast

SDS-PAGE gel (NuPAGE®, Life Technologies). Protein was transferred onto nitrocellulose membranes at 400 mA for 1.5 hours at 4oC. Membranes were blocked in 5% milk in 1X TBS-T washing buffer for 1 hour then incubated over night at 4oC in primary antibodies; anti-REST (Millipore# 07-579), anti-GAPDH (SC-32233), and anti-β-Actin

(CST#4970). Membranes were washed and incubated in secondary antibody for 1 hour, washed and visualized using enhanced chemiluminescence (ECL) detection system (GE

Healthcare). GAPDH or β-Actin were used to confirm equal protein loading.

3.4.3. In vitro ADM of primary acinar cells

Experimental in vitro ADM was done using primary acinar cells isolated freshly from mouse pancreas using an adapted protocol modified from previous studies [289-292]. All mouse work was done using an approved protocol from OSU IACUC.

Four 4-7 weeks old C57BL/6J female mice (JAX mice Stock#:000664) were euthanized for isolation of primary acinar cells. Briefly, each pancreas was minced into 1 mm3 pieces using a blade and scalpel, transferred to a T-25 cm2 flask for digestion using 0.2 mg/ml of

Collagenase P (Roche) for 20 minutes with continuous gentle pipetting every 5 minutes.

To inactivate Collagenase P, Hank's Balanced Salt Solution (HBSS) containing 5% FBS was added and acinar cells were isolated by several washes in FBS supplemented HBSS.

Both pancreas acinar cells pellets were combined after re-suspension in Waymouth's media supplemented with 10% FBS, 1% penicillin/streptomycin, Soybean trypsin inhibitor, and dexamethasone (complete Waymouth’s media).

For virus infection studies, primary mouse acinar cells were infected with mouse control expressing adenovirus (abm, Cat. No. m009) or mouse Rest adenovirus (abm, Cat. No.

213793A). For adenovirus transduction, using two different 12-well plates, equal volumes of cell suspension were added to 5 µl of either control or REST stock mouse adenovirus

6 o (10 pfu/ml), incubated at 37 C and 5% CO2 for 1.5 hours with gentle rocking every 10 minutes.

Finally, 2 parts of Matrigel (Corning® Product #354230) was added to 1 part of virus transduced cell suspension then plated in a 24-well collagen coated plate. The collagen coat was made using collagen I, rat tail (ThermoFisher Scientific A1048301) at a concentration of 2.6 mg/ml. Plated cells were then incubated for 20 minutes for Matrigel solidification and complete Waymouth’s media was added and refreshed daily. Each plate had attached grids (GRID-1000 Slide Grids, 20mm x 20mm, Diversified Biotech) on the plate’s bottom surface for counting ducts throughout the four days of culture.

Samples for day 1 and day 4 were lysed with Trizol or fixed in freshly prepared 4% paraformaldehyde.

3.4.4. RNA isolation and qPCR

Total and small RNA was isolated from samples frozen in Trizol using miRNeasy Mini

Kit (Qiagen) according to manufacturer’s protocol. Six hundred ng of total RNA was converted to cDNA using random primers or 100 ng of total RNA was used for mature miRNA quantification using TaqMan MicroRNA assays (Applied Biosystems). Briefly,

100 ng of RNA was DNAse treated, added to 10 µM mixture of 18S rRNA and U6 rRNA primers, heated for 5 minutes at 80o C followed by 60o C for 5 minutes then placed on ice.

TaqMan miRNA stem loop primers were added and cDNA was made using manufacturer’s protocol.

For genes and miRNA quantification, quantitative PCR (qRT-PCR) was done using a 7900

HT instrument (Applied Biosystem). Data was normalized to 18S rRNA and the relative gene expression was calculated using the comparative CT method as previously described

[196].

3.4.5. Primers

Mouse primers were used in measuring molecular deregulation in experimental ADM control and REST treated samples. List of primer sequences are provided in table 5.

Gene (Mouse) Primer sequence 5' to 3' Sense TCCCATCCCCTTACTTTGATGA Ptf1a Anti-sense GTAGCAGTATTCGTGTAGCTGG Amylase Sense TTGCCAAGGAATGTGAGCGAT (Amy2a) Anti-sense CCAAGGTCTTGATGGGTTATGAA Sense GGGGGTTCAGTACGCATTGG Krt19 Anti-sense GAGGACGAGGTCACGAAGC Sense GGCAGATGGCCGAATTGATG Rest Anti-sense CTTTGAGGTCAGCCGACTCT Sense GATCAAGAGCGTGAAGAGATGC Cpa2 Anti-sense AGCCACGAGGTTATCCATTTCT Sense ATGCCAAGGTGGCTGAGAAAT Rbpjl Anti-sense CTTGGTCTTGCATTGGCTTCA Sense CGGTCCACAGACTCGTGTTC Atf6 Anti-sense GCTGTCGCCATATAAGGAAAGG Sense CACCCCAATCTCGATATGTTTGA Gata4 Anti-sense GCACAGGTAGTGTCCCGTC Sense AGCAGCAAGTGGTGGATTTG Xbp1 Anti-sense GAGTTTTCTCCCGTAAAAGCTGA Sense TCTGAGCCATGTAGCCTTGC Nr5a2 Anti-sense GGAAAGTGACCATAGGGTTGGTA Table 5. List of mouse primers.

3.4.6. Transient transfection assays

All transient transfections were conducted for 48 h with 100 nM of oligonucleotides using lipofectamine 3000 (Invitrogen) using manufacturer’s instructions.

To investigate miR-217 regulation of REST, human cell lines, HEK293T, PaTu-T, and

MiaPaca-2 were transfected with Ambion pre-miR- negative control (Thermo Fisher catalog # AM17110) or hsa-pre-miR-217 (Thermo Fisher catalog # AM17100) oligo.

Treated cells were collected for RNA and protein isolation.

3.4.7. WST-1 proliferation assay

Cells were plated in 96-well plate overnight then exposed to DMSO or X5050 REST inhibitor (EMD Millipore # 506026). Following 96 h, WST-1 reagent (Roche) was added for 1 h and absorbance was measured at 450 nm.

3.4.8. Luciferase reporter assay

The portion containing miR-217 binding site in the mouse Rest or human HNF1B 3’ untranslated region (3’ UTR) was PCR amplified and inserted downstream of the renilla luciferase gene in the PsiCheck-2 plasmid (Promega). KPC cells were cotransfected with the Rest or Hnf1b PsiCheck-2 construct and pre-miR- negative control or mmu-pre-miR-

217 oligo. After 24 h, the renilla and firefly luciferase activities were measured using the

Dual-Luciferase Reporter Assay kit (Promega # E1910).

3.4.9. Histology

HistoGel was used as described in [293]. Briefly, HistoGel (Richard-Allan Scientific) was melted 2 hours prior to use in a 69 °C water bath. Two hundred µl of HistoGel was used to coat the bottom of a biopsy cryomold and left to solidify on ice for 10 minutes. Media was removed from the top of cells/Matrigel block, scraped out of the well and layered on top of the HistoGel coat. Three hundred-fifty µl of melted HistoGel was added, placed immediately on ice for 10 minutes to sandwich the cells/Matrigel block during solidification.

The Matrigel-HistoGel sandwich was conveniently transferred into pathology cassettes, fixed in 4% paraformaldehyde for processing and paraffin embedding. Hematoxylin and eosin (H&E) staining was done at the Comparative Pathology & Mouse Phenotyping

(CPMPSR) Shared Resource at OSU.

3.4.10. Immunofluorescence

Unstained slides were cut from paraffin blocks. First, antigen retrieval was done to reverse the cross-linking, which occurred during fixation. Slides were washed with xylene, 100% ethanol, 95% ethanol, 80% ethanol, then rinsed with water and immersed for 30 minutes

73 in preheated sodium citrate buffer in a water bath at 95-100o C. Slides were then rinsed with wash buffer (1X PBS containing 0.1% Tween 20) and blocked with 1% bovine serum albumin (BSA) prepared in wash buffer for 1 hour at room temperature. Primary antibodies, Amylase (Thermo Scientific Catalog number PA5-25330) and Cytokeratin 19

(Santa Cruz product number SC-33111) were mixed and added to slides overnight at 4o C.

On the following day, slides were washed and incubated in the dark with florescent secondary antibodies for 1 hour at room temperature. Slides were rinsed and stained with

Dapi (Life Technologies) then covered with glass cover slips using Permount (Fisher

Scientific) for imaging. Images were taken using The Olympus FV 1000 Spectral Confocal system, at the Campus Microscopy and Imaging Facility (CMIF) at OSU.

3.4.11. Mouse Transcriptome Array

Three biological replicates for control and REST day 1 and day 4 samples were submitted to OSU microarray core for gene expression analysis using the Mouse Transcriptome Array

2.0 (Affymetrix, Santa Clara, CA). RNA integrity was determined using the Agilent 2100

Bioanalyzer (Agilent Technologies, Palo Alto, CA). A 100-ng aliquot of total RNA was linearly amplified. Then, 5.5 µg of cDNA was labeled and fragmented using the

GeneChip® WT PLUS reagent kit (Affymetrix, Santa Clara, CA) using the manufacturer's instructions. Labeled cDNA targets were hybridized to Affymetrix GeneChip® Mouse

Transcriptome Array 1.0 for 16 h at 45° C rotating at 60 rpm. The arrays were washed and then stained using the Fluidics Station 450 and scanned using the GeneChip Scanner 3000.

For gene expression analysis, arrays were normalized using Expression Console RMA-

SST algorithm. Comparisons were made in Transcriptome Analysis Console (Affymetrix,

Santa Clara, CA). Significance was analyzed using Analysis of variance (ANOVA) method.

3.4.12. Statistical analysis

All qPCR data was generated from four biological replicates and analyzed using Microsoft

Excel, significance was analyzed using Student’s t-test in which a p-value < 0.05 was considered statistically significant.

3.4.13. Gene set enrichment analysis (GSEA)

REST target genes enrichment analysis was performed against a combined list of previously reported REST target genes in “The Molecular Signatures Database” (Broad

Institute) and other studies [195, 277] using the GSEA algorithm [294].

3.5. Results

3.5.1. miR-217 regulates REST expression

The miR-216/-217 cluster consisting of miR-216a, miR-216b and miR-217 is located on chromosomes 2p16.1 and 11qA3.3 in humans and mice, respectively. The miRNA cluster interested us because its expression was reduced in human [139, 150, 151, 161, 295] and mouse [296, 297] PDAC, they are enriched in the pancreatic acini [184, 298], and target

KRAS [160, 299]. Our laboratory previously [291] assayed 9 different human PDAC and normal pancreas cell lines (PANC-1, MiaPaca-2, PL45, MPanc-96, CaPan-1, SW1990,

BxPC3, HPDE and HPNE) for miR-216a/b and miR-217 but the miRNAs were undetectable. An exception was that very modest levels of miR-216a, -216b and -217 were present in BxPC3 cells. High levels of miR-217 were present in the rat pancreatic acinar cell line AR42J [291]. Thus, human pancreatic cancer cell lines that are epithelial, lack miR-217 while the rat cell line that was derived from an acinar pancreatic tumor [300] expressed the miRNAs. Previous work in our lab identified a striking inverse correlation between the expression of miR-216a, miR-216b, miR-217 and REST from mining published expression array data of 134 human cancer cell lines [291].

Our lab went on to show that the human miR-217 reduced the expression of luciferase containing a human 3’ UTR of REST [291]. We therefore conclude that miR-217 directly interacts with human REST 3’UTR. To confirmed miR-217 post-transcriptionally regulated Rest in mouse cell lines as predicted in TargetScan (figure 12A), we co-

76 transfected the KPC cell line, established from LSL-Kras;P48-Cre bigenic mouse model with Rest 3’ UTR construct and negative or mmu-pre-mir-217 oligo. We found reduction in luciferase expression (figure 12B) corroborating the post-transcriptional regulation of

REST by miR-217 in human cell lines where the increase in miR-217 mature levels (figure

12C) led to a significant reduction in REST mRNA levels (figure 12D).

To see if miR-217 reduces REST protein expression, Western blotting was performed in

HEK293T, PaTu-T, and MiaPaca-2 cells transfected with hsa-pre-miR-217 or control oligo. Compared to control oligo, miR-217 significantly reduced REST protein levels by

11-fold, 6-fold, and 50-fold, in HEK293T, PaTu-T, and MiaPaca-2 cells respectively

(figure 12E). Finally, our data demonstrates that binding of miR-217 to the 3’ UTR of

REST suppresses REST translation by reducing its mRNA levels (Figure 12D).

A 1K

5’ AUGCAGU Mouse REST 3’UTR 3’

UACGUCA miR-217 miR-217 binding site

120 Negative * miR-217 80

% Luminescence

0 Rest 3' UTR

Figure 12. Regulation of REST by miR-217. (A) Interaction between miR-217 5’ seed sequence and the mouse Rest 3’ UTR as

predicted by TargetScan. (B) Reduced luciferase expression in KPC cells co-

transfected withnegative or pre-mir-217 oligo and vector containing containing the

mouse Rest 3’ UTR downstream of the renilla luciferase gene. Mean ±SD from one

of triplicate experiments. * P < 0.05. Continued 78

Figure 12. Continued

C D

hsa-miR-217 REST 0.016 8e-6

CT CT - ** - 0.012

0.008 4e-6 ** 0.004

Relative Expression 2 Expression Relative 0.000 2 Expression Relative 0

Negative Negative

miR-217 mimmic miR-217 mimmic

miR-217 oligo treatment effect on miR-217 (C) and REST mRNA (D) expression in

HEK293T cells and protein (E) in HEK293T, PaTu T, and Miapaca-2 cells transfected with either miR-217 or control oligo.

3.5.2. Validation of experimental ADM

Pancreatic acinar cells display significant plasticity and will transdifferentiate into ductal- like cells when plated on Matrigel [301] or grown in the presence of growth factors [302].

Primary mouse pancreatic acini were plated on Matrigel and cultured over 4 days. During this culture period, the acini developed an epithelial morphology (cell flattening and development of apical and basal morphology) and formed duct-like structures (figure 15).

Transdifferentiation over the 4 day culture on Matrigel was further confirmed by a dramatic reduction in the protein expression of the acinar marker Amy2a and an increase in the epithelial marker Krt19 (figure 13). Bright field and Hematoxylin and eosin (H&E) staining confirms duct formation (Figure 13 top and middle panel). The gene expression of acinar and epithelial cell markers during the four days of culture was previously determined by qRT-PCR [291]. Reduced mRNA levels of amy2a and Cpa2 and increased Krt19 were confirmed during the four days of culture [291]. Immunofluorescence (IF) was performed to show the cellular localization of the acinar and epithelial markers. IF shows amylase protein level in day 1 and its reduction in day 4 (Figure 13 lower left panel) and the apparent formation of ductal-like cells as demonstrated by Krt19 expression (Figure 13 lower right panel). This confirms changes occur at both, mRNA and protein levels during in vitro

ADM.

Day 1 Day 4

Blue: DAPI Blue: DAPI Green: Amylase Green: Amylase Red: KRT19 Red: KRT19 Figure 13. Representative images of ADM at day one and day four. Top panel, Bright field, middle panel, H&E, and lower panel, immunofluorescence

3.5.3. REST drives acinar to epithelial transdifferentiation

We hypothesize that miR-217 maintains acinar differentiation and that REST accelerates

ADM. To implicate high levels of REST reversing the acinar state, we performed the in vitro ADM experiment using adenovirus infection of Rest or control adenovirus prior to plating on Matrigel. Forced expression of Rest during the transdifferentiation period accelerated the transdifferentiation process as evident by the increase in duct formation and increased expression of the ductal marker Krt19 (figure 14). Rest treatment reduced key acinar digestive gene expression including, Amy2a, Cpa2 and the acinar transcription factors, Ptf1a, Nr5a2, and Rbpjl (figure 14 and 16). We documented the change in morphology by taking bright field images daily during ADM (Figure 15). As shown in figure 15B, Rest treated acini show more duct formation. Control virus expresses green fluorescent protein (GFP) for confirmation of transduction. Rest transduction is confirmed using qPCR (figure 14B).

A Control REST

140 *

120 * 100

80 60

Number Number of ducts 20 0 Day 1 Day 2 Day 3 Day 4

CT Day 4 10

- 8 * 6 4 2 0 -2 -4 -6 -8 -10 * Rest Krt19 Amy2a Cpa2

Expression relative to control, relative 2 Expression

Figure 14. Rest promotes ADM and alters the mRNA level of ADM markers. (A) Number of ducts during the transdifferentiation process for control or Rest

adenovirus treated cells. Mean ±SD from triplicate experiments (B) Rest, Krt19,

Amy2a, and Cpa2 mRNA level was measured in control and Rest treated acini during

experimental ADM. Mean ± SEM from quadruplet replicates. * P < 0.05.

Figure 15. Bright field images for control and Rest treated acini during ADM. Images were taken at 20x magnification.

3.5.4. Rest overexpression reduces key acinar genes

As reviewed in MacDonald, et al., [213] , Roy, et al., [303], and Shih, et al., [304], an intricate hierarchy of transcription factors regulate the development of pancreas from progenitor cells and controls its differentiation. Ptf1a, Nr5a2, and Rbpjl transcription factors orchestrate exocrine acinar cell differentiation [305-309] and later in adult pancreas, their expression becomes more acinar cell specific [310]. Ptf1a forms a complex with

Rbpjl, called PTF1-L which directly activates acinar genes such as digestive enzymes to establish an acinar phenotype [220, 306, 308, 311]. Nr5a2, which is a direct target of Ptf1a cooperates with the PTF1-L complex to transcriptionally activate acinar genes [305]. Not only is Nr5a2 essential for acinar cell differentiation, it also promotes acinar cell expansion

[312, 313].

Gata4, Xbp1, and Atf6 are among the transcription factors essential for secretory and acinar cell differentiation [213, 220, 303, 314-316]. For example, Gata4 is strongly expressed in acinar tissues [317]. In E18.5, pancreas specific deletion of Gata4 resulted in smaller and less mature acini compared to control littermate [318]. Xbp1 null acinar cells exhibited extensive apoptosis [314].

Given the role of these transcription factors in exocrine acinar cells, we wanted to understand the result of Rest enforced expression on developmental acinar transcription factors. Using qPCR, we measured the mRNA level of Ptf1a, Rbpjl, Nr5a2, Gata4, Xbp1, and Atf6 and found a significant reduction in the expression of all of the genes with Rest infection (figure 16).

CT Day 4 20 - 10 *

-10 ** ** ** -20 ** -30 ** -40

-50 **

Atf6 Expression relative to control, 2 Rest Ptf1a Rbpjl Xbp1 Nr5a2 Gata4

Figure 16. Rest represses acinar transcription factors. mRNA levels of developmental acinar transcription factors were measured in

control and Rest treated acini. Mean ± SEM from quadruplet replicates. * P < 0.05.

**P < 0.01.

3.5.5. Ptf1a is repressed by REST

Ptf1a controls exocrine pancreas differentiation, maintenance and functionality (reviewed in [213, 303]). To link Rest to the regulation of Ptf1a, we used UCSC mouse genome browser to search for reported Rest binding sites (figure 17). We found a Rest binding site from two independent studies at ~ 20 kbp upstream of the Ptf1a transcription start sites. In addition to the Rest binding site, there were binding sites (peaks) for CoREST and SIN3A transcription factors, both essential for REST repressive transcription machinery [256, 257,

259, 319]. The reduction of Ptf1a mRNA with Rest enforced expression (figure 16) and 86 the presence of REST and CoREST factors upstream of Ptf1a transcription start site (figure

17) suggests the possibility that Rest directly represses Ptf1a expression.

CH12 COREST_S

CH12 SIN3A_N

MEL COREST_S

MEL SIN3A_N MEL SIN3A_N

Figure 17. Rest binding site at 20 kbp upstream of Ptf1a transcription start site. UCSC Genome Browser on Mouse mm9 was used to search for Rest binding sites upstream of Ptf1a transcription start site. Data shown is from two independent studies, the Stanton

Group at the Genome Institute of Singapore using embryonic stem cells and the laboratory of Barbara Wold, California Institute of Technology using myocytes. CoREST and SIN3A binding sites were found using data generated and analyzed by the labs of Michael Snyder at Stanford University and Sherman Weissman at Yale University.

3.5.6. miR-217/REST regulation of pancreatic ADM

Based upon the data generated herein and previously reported [291] we propose a mechanism (figure 18) during ADM by which reduced levels of miR-217 increases the levels of Rest which suppresses Ptf1a and other acinar genes (figure 16). ADM could also

87 be driven by reduced levels of miR-217 through derepression of the miRNA’s effect on key epithelial genes. For example, HNF1B is a transcription factor present in ductal and centroacinar cells in adult pancreas [320]. Using TargetScan, we identified a highly conserved miR-217 binding site in the 3’ UTR of HNF1B (figure 19A). Luciferase reporter assays in HEK293T cells transfected with pre-miR-217 oligo confirmed the regulation of

HNF1B by miR-217, albeit modestly (figure 19B). The mechanism also suggests how high levels of miR-217 could maintain the acinar state by repressing Sirt1 [161, 321] as well as simultaneously repressing HNF1B and REST (and thus maintains high expression of

Ptf1a).

Acinar genes, Ptf1a TFs ? ADM Rest

miR-217 miR-217 Target genes Sirt1 and KRAS

Figure 18. Proposed mechanism between ptf1a, miR-217 and REST. Proposed mechanism of miR-217 in maintaining acinar cell phenotype through Rest.

A 1K 5’ AUGCAGUA Human HNF1B 3’UTR 3’ UACGUCA miR-217 miR-217 binding site

B 120 Negative pre-mir-217 * 80

% Luminescence

0 HNF1B Figure 19. Regulation of HNF1B by miR-217.

(A) Interaction between miR-217 5’ seed sequence and the human HNF1B 3’

UTR as predicted by TargetScan. (B) Luciferase expression in HEK293T co-

transfected with vector containing the human HNF1B 3’ UTR downstream of the renilla luciferase gene and negative or pre-mir-217 oligo. Mean ±SD from

one of triplicate experiments. * P < 0.05.

3.5.7. Rest overexpression repressed a subset of REST target genes

To explore pathways affected by enforced REST overexpression, we have conducted whole mouse transcriptome analyses using (MTA_2.0). Before analysis, RNA integrity analysis (RIN) was performed on day 4 samples and found to be more than 6.5. We conducted all comparative analysis using day 4 control versus day 4 Rest to investigate the effects of enforced Rest overexpression on in vitro ADM.

First we wanted to confirm enrichment of REST target genes in control treated condition compared to Rest using Broad Institute gene set enrichment analysis (GSEA) software.

Surprisingly we did not get an enrichment when we used approximately 1000 common

REST target genes previously reported in Broad Institute and other investigators [195, 277]

(figure 21). We then looked for the acinar expression of these common REST target genes and determined that many of these genes were not expressed in acinar cells. Thus the lack of enrichment (figure 21) could be due to the fact that many of these REST target genes are not expressed in acini. We applied a filtering criteria (overviewed in figure 20) to select the top acinar expressed REST target genes (referred herein as acinar REST target genes).

The top 150 differentially expressed acinar REST target genes were negatively enriched in the Rest adenovirus treated acini (figure 22). We further filtered to select the top 50 differentially expressed REST target genes (figure 24) and these too were negatively enriched in the Rest infected acini (figure 23). Interestingly, among these genes were Hes1,

Hnf4a, Insr, and Smo which are all related to pancreas development.

Day 4 Control versus Day 4 REST

In vitro ADM, Days 1 & 4 Do GSEA on “typical” REST TG, mostly neurological +/- REST adenovirus Failed, mostly unexpressed genes, expression value ~ 4 in microarray Isolate RNA, RIN Took all “known” REST TG

Expression profile > 73K genes Sort by highest expression in acinar Day 1 Control

Take top 150 REST TG in acini

GSEA

Further sorting for genes with Fold Change ≥1.5 and P-value < 0.05

~50 REST TG in acini

GSEA Figure 20. Overview of experimental design and GSEA data analysis strategy.

Enrichment Score (ES) 0.1671234 Enrichment Score (ES) 0.683655 Normalized Enrichment Score (NES) 1.1699992 Normalized Enrichment Score (NES) 1.2580404 Nominal p-value 0 Nominal p-value 0 FDR q-value 0.10750507 FDR q-value 0.08 FWER p-Value 0 FWER p-Value 0

Figure 21. GSEA for approximately Figure 22. GSEA for the top 150

1000 common REST target genes. acinar expressed REST target genes.

Enrichment Score (ES) 0.8847401 Normalized Enrichment Score (NES) 1.1578892 Nominal p-value 0 FDR q-value 0.10633947 FWER p-Value 0

Figure 23. GSEA for top 50 differentially expressed acinar REST target genes.

Samples D4C D4R Genes

Figure 24. List of top 50 acinar REST target genes.

3.5.8. REST knockdown in cell lines using X5050 small molecule inhibitor

To study the effect of REST inhibition in pancreatic cancer cell lines, first, we measured the levels of REST protein in eight cell lines; one normal-like cell lines, HPNE and six human pancreatic cancer cell lines, Panc-1, Panc- 10.05, MiaPaca-2, BXPC3, PaTu T, and

PaTu S and AR42J rat tumor acinar cells (Figure 25). HPNE is an immortalized normal- like ductal cell line [322-325]. The rest of human pancreatic cancer cell lines were established from PDAC at primary tumor site, the head of the pancreas [326] or from a liver metastasis site [327]. No detectable band was found for REST in the rat AR42J exocrine/acinar tumor cell line which interestingly expressed miR-217 unlike the other human pancreatic cancer cell lines [291]. The varying levels of REST protein in human pancreatic cancer cell lines suggests that other mechanisms can regulate REST expression beside miR-217.

We attempted to inhibit REST in Panc-1 and PaTu-T cell lines as an example of low and high REST expressing cell lines, respectively (Figure 25). Charbord, et al., developed a small molecule inhibitor for REST [328]. X5050 is a benzoimidazole derivative with chemical formula C₁₇H₁₅N₃O₃ (EMD Millipore 506026) which reduced REST protein level. Charbord, et al., have successfully shown the ability of X5050 treatment to rescue the expression of some REST target genes, such as BDNF, SEZ6, SYT4, OGDHL, VGF, and SNAP25. This is the first and only small molecule inhibitor available for REST.

10.05 -

BXPC3

PaTu

MiaPAca

HPDE HPNE

Panc AR42J Panc

RESTREST

B-ActinB-Actin

Figure 25. REST protein levels in pancreatic cancer cell lines.

A 12 h treatment of the previously reported dose of 100 µM [328] showed a dramatic change in morphology (data not shown) occurring in PaTu-T cells. To investigate the effect of X5050 on cell proliferation, we used increasing doses of X5050 for 96 h treatment.

Starting at 10 µM X5050 dose, we noticed decreased proliferation by 50% in both cell lines

(figure 26). To confirm REST reduction, REST protein level was measured using Western blotting at 24, 48, and 72 hours of treatment (figure 27). Approximately 30% reduction in

REST protein level was detected using the 100 µM dose in PaTu-T cells only and not Panc-

1 (figure 27A). Despite the reduction of cell proliferation using as low as 10 µM dose, the protein level of REST was modestly reduced using 100 µM in PaTu-T cells only but did not change using 10 and 25 µM in PaTu-T cells (figure 27B). These data suggests that the significant reduction in cell proliferation is not due to REST inhibition and indicates the presence of off target effect of X5050.

Figure 26. X5050 dose response in 96 hours treatment. Panc-1 and PaTu-T cells were treated with DMSO or X5050 for 96 hours. Proliferation activity was measured using WST-1 reagent.

PaTu-T Panc-1

24 48 72 24 48 72 hours hours hours hours hours hours C Tx C Tx C Tx C Tx C Tx C Tx REST Β-Actin

24 48 24 48 hours hours hours hours C Tx C Tx C Tx C Tx

REST

Β-Actin

10 uM 25 uM

Figure 27. REST protein expression using in X5050 treated cells. REST protein was measured using Western Blotting. (A) PaTu-T and Panc-1 cells were

treated with 100 µM for 24, 48, 72 hours. (B) PaTu-T cells were treated with 10 µM and

25 µM for 24 and 48 hours.

3.6. Discussion

ADM has been described as a precursor to PanIN lesions [229-231], in the presence of pancreatic injury, such as pancreatitis or Kras mutations [242], acinar cells transdifferentiate into ductal-like cells. This transdifferenitation is accompanied by a loss of acinar genes and a gain of ductal markers. Reduction of miR-217 levels in pancreatic cancer and its precursor lesions has been confirmed in many studies [67, 139, 140, 145-

153, 157-161]. As an alternative to studying the early events of miRNAs on PDAC development using transgenic mouse models, we choose to study the processe using an in vitro system of ADM [289-292]. miR-217 was considered as a potential regulator of ADM as it is widely enriched in pancreas [329], more specifically pancreatic acini [133, 184,

298], and its’ expression is reduced during the development of PDAC in both humans [139,

150, 151, 161, 295], mice [296, 297], and during experimental ADM [291].

Previously, our laboratory demonstrated that forced expression of miR-217 during in vitro

ADM maintained higher levels of acinar markers, Amy2a, Cpa2, and Mist1 [291, 330], suggesting its importance in maintaining an acinar phenotype. To better understand a role for miR-217 during ADM, we studied the consequences of overexpressing Rest, a miR-

217 target [291]. Reduced expression of miR-217 during ADM would result in increased

Rest protein levels and thus promote ADM.

We used an experimental ADM model to show that forced expression of Rest increased duct formation and reduced acinar markers while increasing epithelial gene expression

(figure 14). These data suggests that during ADM, increased Rest levels led to loss of acinar

98 genes and gain of ductal ones (figure 14 and 16). One explanation for this behavior is that

Rest represses acinar specific transcription factors such as Ptf1a. In Rest treated acini, we observed a significant reduction of Ptf1a mRNA expression as well as other acinar transcription factors, Rbpjl, Nr5a2, Xbp1, Gata4, and Atf6 (figure 16). To investigate if

Rest targets Ptf1a as a mechanism for promoting ADM, we located a putative Rest binding site 20 kbp upstream of the Ptf1a transcriptional start site (figure 17). Future Chip analysis studies will be performed to confirm if Ptf1a harbors a RE-1 site for Rest binding.

Altogether, our data suggests a mechanism (figure 18), by which Rest transcriptionally represses Ptf1a subsequently promoting the loss of acinar cell identity. In turn, miR-217 maintains acinar phenotype by targeting ductal promoting genes such as HNF1B (figure

19B) and Sirt1 [161, 321] and maintains Ptf1a expression by negatively regulating the repressive transcription factor REST. With the loss of miR-217 during ADM, REST expression is elevated and in turn represses acinar transcriptional regulators such as Ptf1a

[220, 305, 311] promoting the loss of acinar cell identity.

Chronic pancreatitis can promote ADM progression into PanIN lesions [232] and is a common risk factor in PDAC [232, 331, 332]. Recently, Krah, et al., demonstrated that

Ptf1a conditional knockout mice had sustained inflammation post-acute injury accompanied with acinar cell conversion into ductal-like structure which resembled tubular complexes observed in mouse and human chronic pancreatitis [244]. The authors point out that there is no correlative to reduced Ptf1a in human PDAC as Ptf1a does not undergo somatic mutations [244]. In light of this study, we conclude that Rest mediated repression of Ptf1a could be a contributing factor for the progression of ADM lesions during pancreas

99 injury though suppression of Ptf1a. Future in vivo studies needs to be done to better understand the consequences of Rest deletion in the exocrine pancreas, particularly in the presence of chronic pancreatitis.

Acknowledgment

I thank Dr. Jinmai Jiang preformed RNA extraction and qPCR analysis for Rest treated acini as well as qPCR analysis for miR-217 oligo treated HEK293T. Dr. Ana Clara

Azevedo-Pouly for initial optimization of 3D in vitro ADM. Mohamed Badawi cloned the human REST 3’ UTR into a luciferase vector and grew the Rest and control adeno virus.

100

Chapter 4: Characterization of HEK293T-Derived Extracellular Vesicles

4.1. Abstract

Extracellular vesicles (EVs) are small nano-sized lipid vesicles released from all mammalian cells. They contain cytoplasmic cargo such as mRNAs, microRNAs, transfer

RNA (tRNA), and protein. Recent studies showing EVs involvement in cellular communication and transfer of RNA molecules, in particular miRNAs and proteins have gained them widespread attention in studying their biogenesis, role in cell-cell communication, and downstream effects of its cargo transfer in recipient cells. Besides these mechanistic work, there are a number of translational approaches to EVs research including the possibility of their use as therapeutic delivery vehicles [333] or biomarkers of disease.

In this study, we describe a method for scale-up of EVs that may be applied to therapeutic

EVs and assessed their in vitro safety.

4.2. Introduction

Recent studies revealed an integral role of EVs in intercellular communication. The secretion of EVs has been found in both, eukaryotes and prokaryotes, where it appears to

101 be a conserved process throughout evolution [334]. Ongoing studies continue to show that

EVs have a broad spectrum of biological functions. In mammalian cells, EVs contain cytoplasmic content such as proteins, lipids, and RNA molecules such as mRNAs and miRNAs [335, 336]. They are shed by different mechanisms and accordingly have different terminology. EVs shed by direct outward budding from plasma membrane are referred to as microvesicles (MVs) with size ranging from 50 nm – 1000 nm while EVs exocytosed from multivesicular bodies (MVB) upon fusing to plasma membrane are called exosomes with a smaller size range of 30 nm – 100 nm [337-339].

The ability of EVs to protect their cargo from enzymatic degradation in the extracellular environment [340] has been an exciting discovery. This advantage has made them attractive for biomarkers of disease and oligonucleotide/gene delivery agents. In 2011, the use of EVs as targeted natural nanoparticles was successfully shown by Alvarez, et al., group [333]. They engineered EVs to express a CNS targeting moiety, then electroporated

EVs with GAPDH siRNA. Amazingly, they successfully delivered the EVs to the brain and showed a significant reduction in GAPDH protein. This groundbreaking study showed the ability to deliver siRNA to CNS using EVs delivery system. The natural composition and ability for EVs producing cells to be engineered makes them ideal as oligonucleotide and gene delivery agents. Another example of the importance of EVs is their immunostimulatory effects via delivering tumor derived antigens thus, inducing an immune response [341]. Dendritic cell-derived EVs contained major histocompatibility complexes. This phenomenon encouraged three groups to initiate clinical trials for the use of dendritic cells-derived EVs in cancer therapy [342-344].

102

The aim of this chapter is to provide a convenient method for scale-up production of EVs derived from a commonly used human cell line, Human Embryonic Kidney 293T

(HEK293T) cells. HEK293T cells have been well characterized for recombinant protein production and shed a high number of exosomes [345, 346]. Also, HEK293T cells are easily transfected providing a method to generate EVs with desired external targeting moieties [333].

We further investigated EVs safety by performing a series of immunotoxicity studies using the human monocyte cell lines, THP-1 and U937. Monocytes would be the first cells to encounter EVs when injected to blood stream and it is important to investigate the reaction of monocytes when exposed to EVs to confirm the safety prior to their use for therapeutic applications.

4.3. Materials and methods

4.3.1. EVs donor cell line, HEK293T adaptation to suspension cell

HEK293T cell line was purchased from American Type Culture Collection (ATCC® CRL-

11268™). HEK293T cells were cultured as adherent cells in T-flasks using Dulbecco's

Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS). All

FBS supplemented media used in this study was depleted of exogenous exosomes by centrifugation for 18 hours at 100,000 rcf at 4o C.

103

For EVs scale up production, HEK293T cells were adapted from adherent culture to grow in suspension using HEKPlus SFM (ATCC® ACS-4002™) as recommended by the supplier with few alterations. Briefly, cells were cultured in 15 cm tissue culture dishes

(VWR) and gradually adapted to grow in low serum conditions; 3:1

DMEM/10%FBS:HEKPlus for one week (day 1 to day 7). This was followed by a 1:1 ratio of media for one week (day 8 to day 14), and 1:3 ratio for two weeks (day 15 to day 28).

Cells were then transferred to a 0.5 liter spinner flask and cultured in HEKPlus media

o supplemented with 2% FBS at 2E5 cells/ml, at 130 rpm in 37 C and 5% CO2 incubator.

Figure 28 summarizes adaptation process.

Figure 28. Schematic overview for HEK293T adaptation process.

104

4.3.2. EVs isolation

A shown in figure 29. EVs were isolated at 4o C using standard ultracentrifugation protocol

[347]. Four hundred ml of cell culture supernatant was centrifuged at 300 rcf for 10 minutes, transferred to clean tubes, and centrifuged at 2000 rcf for 20 minutes to remove cell debris. The supernatant was transferred to ultracentrifuge tubes (Beckman Coulter

355622) and centrifuged at 10,000 rcf for 30 minutes in a Beckman Coulter Optima™ XE ultracentrifuge using a Type 45 Ti rotor, followed by vacuum filtration using 0.22 um filter

(Millipore). In new ultracentrifuge tubes, filtered supernatant was centrifuged at 110,000 rcf for 75 minutes. The EVs pellet was washed once with sterile PBS and re-pelleted using the same conditions. Finally, the EVs pellet was re-suspended in 0.3-0.5 ml of proper vehicle for downstream application. For in vitro analysis of EVs effect on human monocyte cell lines, EVs were re-suspended in phenol red free RPMI-1640 media supplemented with

10% exosome depleted FBS. EVs were re-suspended in 1X PBS for any of the following applications, protein yield quantification for EVs staining using Pierce BCA protein assay,

Cryo-TEM imaging or Nanosight quantification.

105

300 xg for 10 min

- cells

2000 xg for 10 min

- dead cells

10,000 xg for 30 min

- cell debris

0.22 µm filter

110,000xg for 1.5 hr

EVs pellet

Wash in PBS 110,000xg for 1.5 hr

Evs pellet

Figure 29. EVs standard isolation protocol. Cell culture supernatant is centrifuged to get rid of cells and debris followed by two ultracentrifugation spins to pellet and wash EVs, respectively.

106

4.3.3. EVs characterization

4.3.3.1. Western blotting

Western blotting was performed using manufacturer’s protocol and standard conditions.

The EVs pellet was lysed using 1X RIPA buffer and cocktail inhibitors. Protein quantification was performed using Pierce BCA protein assay. Protein lysates were mixed with 4X non reducing lithium dodecyl sulfate sample loading buffer containing 3% 2- mercaptoethanol. An exception was for anti-CD63 antibody which was run under non- reducing conditions. Twenty 20 µg of total protein was loaded per lane of a SDS-PAGE.

Primary antibodies used include; anti-Calreticulin (Cell Signaling #2891S), anti-GAPDH

(SC-32233), anti-TSG101 antibody (SC-7964), and anti-CD63 (ab68418). Membranes were incubated in secondary antibody for 1 hour and visualized using enhanced chemiluminescence (ECL) detection system (GE Healthcare). GAPDH and histones were used to confirm equal protein loading.

4.3.3.2. Cryo-transmission electron microscopy (Cryo-TEM)

Isolated EVs were re-suspended in 1X PBS buffer solution. To disperse any aggregated

EVs, the sample was sonicated three times for one minute. Sample preparation for Cryo-

TEM was done at the Liquid Crystal Institute at Kent State University, Ohio as described in Gao, M., et al., 2014 [348]. Briefly, 3 µl of suspended EVs sample was mounted on a

107 holey lacey carbon coated grid and flash frozen in liquid ethane using an automated vitrification device, FEI Vitrobot, Mark IV (FEI, Hillsboro, OR) to plunge freeze the sample at room temperature and 100% humidity controlled environment. Immediately, the vitrified sample was stored under liquid nitrogen to avoid ice crystals formation and transferred onto Gatan cryo holder (Model 626.DH) for imaging using FEI Tecnai G2 F20

ST TEM (FEI, Hillsboro, OR). Images were taken under low dose mode for sample protection using a Gatan UltraScan 4K CCD camera.

4.3.3.3. Nanoparticle Tracking Analysis

Nanoparticle Tracking Analysis (NTA) was used to count the number of EVs and size distribution. NTA measure the amount of light scattered by EVs spontaneous Brownian motion. Samples were counted using Malvern Nanosight NS300 at the Analytical

Cytometry Core Facility at The Ohio State University.

4.3.4. EV staining

EVs were stained with PHK67 green fluorescent dye (Sigma-MINI67) according to manufacturer’s protocol with slight modifications. The EVs pellet was diluted to 1 ml using

Diluent C, an iso-osmotic solution which maximizes dye solubility and staining efficiency.

In a separate tube, 4 µl of PKH67 dye was added to 1 ml of Diluent C, mixed, and added immediately to EVs. The tube was incubated at room temperature for 3 minutes with

108 periodic mixing. PKH67 staining was inactivated by addition of 10 ml of 10% FBS supplemented RPMI and incubated for 1 minute. After staining, 25 ml of PBS was added to re-pellet EVs by ultracentrifugation at 110,000 rcf for 75 minutes. The EV pellet was washed twice with PBS and re-suspended in 10% FBS supplemented RPMI without phenol red.

4.3.5. Human monocyte cell lines culture and differentiation

Human monocyte cells lines THP-1 (ATCC® TIB-202™) and U-937 (ATCC® CRL-

1593.2™) were maintained in culture in T75 culture flasks (Nunc™-Thermo Scientific™) following ATCC’s recommendations. U-937 cells were maintained in RPMI 1640 medium supplemented with 10% heat-inactivated FBS (Atlanta Biologicals®), 10 mM HEPES, 2 mM L-glutamine, and 100U penicillin+100 µg streptomycin/ml (Gibco®-Life

Technologies™). THP-1 cells were maintained in media similar to the one used for U-937 cells additionally supplemented with 50 µM 2-mercaptoethanol (Sigma-Aldrich®). Cells were maintained at 37°C in humidified 5% CO2 atmosphere.

Differentiation of monocyte cells towards macrophage-like adherent cells was achieved by treatment with 50 ng/ml of Phorbol 12-myristate 13-acetate [PMA] (Sigma-Aldrich®) for

24 h, followed by 48 h incubation in untreated cell culture media before experimental assays. Harvesting of PMA-treated cells was achieved by either gentle scraping or by treatment with Trypsin/EDTA (Gibco®-Life Technologies™) for 5 to 10 min. For

109 microscopic visualization of adherent cells, round 12mm glass coverslips were placed in the wells of a 24 well-plate before cell plating.

4.3.6. Cells and EV co-incubation

Nine hundred microliters of media containing 5x105 cells were added to each well in a 12- well culture plate (Falcon®- Corning Life Sciences). After 1 h incubation at 37o C, in a 5%

CO2 humidified environment, 100 µl of EVs suspension at either, different concentrations, or positive control treatments, or cell culture media were added to each well. Plates were returned to incubation for 16 to 24 h, according to each assay protocol. When required,

Cytochalasin D (CytoD) (Sigma-Aldrich®) was added to cells one hour previous to addition of EVs, at a final concentration of 10 µM. For experiments carried out in 24-well culture plates, all cell densities and treatment doses were maintained by escalating down all the volumes to half of the volume used in a 12-well plate.

4.3.7. Apoptosis and necrosis assay

After 24 h co-incubation of cells and EVs, cells were harvested, washed 2 times with cold

PBS, and re-suspended in 100 µl of 1X binding buffer (10 mM HEPES, 140 mM NaCl, 2.5 mM CaCL2). Simultaneous staining for apoptosis and necrosis was achieved by addition of 5 µl of FITC Annexin V and 5 µl 7-Amino-Actinomycin [7-AAD] (BD Pharmingen™) per sample. Incubation at RT in the dark or 15 min was followed by addition of 400 µl of

110 binding buffer before flow analysis. Positive controls used to induce apoptosis and necrosis were: 10 mM 5-Fluorouracil [5FU) for 24 h, or 500 nM Staurosporine (Sigma-

Aldrich®) for 24 h, or 75% ethanol for 5 min.

4.3.8. Sample preparation for confocal microscopy imaging

Non-differentiated cells were harvested, washed twice in cold 2% FBS-PBS, and counted by trypan blue exclusion. Samples of 5x104 cells in 200 µl were prepared on a cover slide using a Cytospin centrifuge (Fisher Scientific) for further staining. PMA-differentiated cells attached to glass cover slips were washed twice with 2% FBS-PBS before staining.

Cell membrane and nuclear staining of cells was performed following the manufacturer’s recommendations. Briefly, 150 µl from a 3 µg/ml solution of Wheat Germ Agglutinin

(WGA), Alexa Fluor® Conjugate (Invitrogen®-Life Technologies™) was added to each sample and incubated at 37oC in the dark for 10 min followed by 2 gentle washes with 1X

Hank’s Balanced Salt Solution [HBSS] (Invitrogen®-Life Technologies™). The cover slip was mounted onto the glass slide by adding a drop of ProLong® Diamond Antifade with

DAPI (Life Technologies™). Confocal microscopy images were captured using Olympus

FV1000-Spectral Confocal System under a 40X Oil objective, at the Campus Microscopy and Imaging Facility (CMIF) at The Ohio State University.

111

4.3.9. Flow cytometry and confocal microscopy

Flow cytometry analysis was performed in a BD Accuri™ C6 flow cytometer (BD

Biosciences) acquiring minimum of 10,000 events per sample. Data was analyzed using the BD CFlow® Plus software (BD Biosciences).

4.3.10. Statistical analyses

Monocytes in vitro experiments were done 3 to 4 times for each assay. Data were analyzed by analysis of variance with repeated measures, incorporating observational dependencies across difference doses within the same day of experiments. Holm’s procedures were applied to adjust the multiplicity to control the family wise error rate at 0.05. Data analysis was performed by using SAS 9.3 (SAS, Inc.; Cary, NC). A p-value ≤ 0.05 is considered statistically significant.

4.4. Results

4.4.1. Characterization of HEK293T-derived EVs

To evaluate the purity of the EVs, calreticulin (CALR), was blotted in both cells and EV lysates. CALR is an endoplasmic reticulum and apoptotic body marker. Using twenty µg of protein, CALR absence in EVs lysates indicates the purity of pelleted EVs from

112 endoplasmic reticulum and apoptotic bodies (figure 30 A) [347, 349]. Enrichment of exosomal markers TSG101 and CD63 was present in the EV pellets but not the cell lysates using ten µg of protein (figure 30 B).

Cryo-TEM and Nanoparticle Tracking Analysis were done to study the shape, number, and size distribution of isolated EVs. Figure 30 C shows EVs had a mono-layer membrane

(black arrows) or Bi-layer membrane (white arrow) or small vesicles encapsulated in a bigger parent EV (hollow arrows) with electron dense core. By performing Cryo-TEM, we were able to preserve the native shape of EVs by avoiding any distortion caused by sample dehydration when using normal TEM such as the cup shaped morphology previously described [347]. Figure 30 D shows the concentration and size distribution of EVs had a mean size distribution of 166.5 nm and 97.9 nm (mode) from the Nanoparticle Tracking

Analysis.

113

Figure 30. Extracellular vesicles (EV) characterization. (A) Purity of isolated EV pellets is shown by the absence of calreticulin (CALR) in EV lysates by Western blot (20 mg protein loaded/lane). (B) EV were enriched with multi-vesicular bodies

(MVB) and exosomal markers TSG101 and CD63 as detected by

Western blot (10 mg protein loaded/lane). (C) Cryo-TEM images for

HEK293T-isolated EV. Bar size ¼ 100 nm. EV with double (white arrow) and single (black arrows) membranes were detected. (D)

Particle concentration and size distribution of EV as evaluated using

Nanoparticle Tracking Analysis. EV collected from two different batches (EVs #1 and EVs #2) of the same cell line are shown to demonstrate reproducibility.

114

4.4.2. EVs did not elicit a cytotoxic response in THP-1 or U937 cells

Flow cytometry detection of apoptosis in cells was achieved by Annexin V staining of exposed phosphatidylserine (PS), a hallmark of cell apoptotic process, while staining of nucleic acid with the vital dye 7-AAD revealed cytoplasmic membrane damage indicative of necrosis. Cells positive to Annexin V and negative to 7-AAD indicate an early apoptotic stage, while double staining with Annexin V and 7-AAD indicates a state of late apoptosis.

Necrosis without apoptosis is identified by staining with 7-AAD and not with Annexin V.

Under regular culture conditions, a low fraction of untreated cells exhibited an apopototic phenotype and the percentage of necrotic cells was negligible (figure 31). Cell response to the addition of chemical agents, used as positive control to induce different levels of apoptosis and necrosis was different between the two cell lines (figure 31A). The specific and consistent pattern of apoptotic and necrotic response to 5-FU, Sts and Ethanol observed in each cell line was used as point of reference to assess reproducibility of the assay.

The presence of HEK293T-derived EVs did not induce apoptotic or necrotic changes in

THP-1 or U937 (figure 31 B). Incubation of THP-1 or U937 cells with HEK293T-derived

EVs at concentrations of 2.5, 25, 50, and 100µg/ml for 24 hours did not affect the percentage of cells experiencing apoptosis or necrosis, nor the proportion cells undergoing early versus late apoptosis as compared to untreated cells.

115

Figure 31. Assessment of EV effects on apoptosis and necrosis in THP-1 and U937 cells. Apoptosis and necrosis of untreated or 24 hr treated cells was evaluated by flow cytometry based on the detection of exposed phosphatidylserine (PS) and DNA labeling with the viability stain 7-AAD. (A) Induction of early apoptosis (white bar), late apoptosis (grey bar) and necrosis (black bar) in THP-1 and U937 cells by 5- fluorouracil (5-FU), staurosporine (Sts) and ethanol (ETOH) compared to untreated cells. (B) Detection of early apoptosis, late apoptosis and necrosis in cells exposed to different concentrations of EV compared to untreated cells. Error bars show SEM.

Data representative of at least three experiments.

116

4.4.3. PMA-differentiated THP-1 and U937 cells internalize EVs

THP-1 and U937 cells were differentiated with PMA towards a macrophage-like phenotype to induce phenotypic changes that would allow a visualization of internalized fluorescently-labeled EVs by confocal microscopy. As expected, PMA-stimulated cells developed an adherent phenotype with expanded cytoplasm and increased cytoplasm-to- nucleus ratio. Figure 32 A shows confocal microscopy images of intra-cytoplasmic labeled-EVs in both cell lines after 16 h incubation with a low dose of seven µg EVs per ml. Rapid quenching of PKH67 signal limited the capture to cells with a large number of internalized EVs. Detection of PKH67 signal in PMA differentiated cells incubated with labeled EVs was also assessed by flow cytometry (figure 32 B and C). A shift of the entire cell population suggests an efficient uptake of EVs by all the cells in both cell lines.

Treatment of PMA-differentiated cells with Cytochalasin D (CytoD), an inhibitor of actin polymerization, dramatically reduced EVs internalization. By confocal microscopy only few CytoD-treated cells internalized few labeled EVs (data not shown). Similarly, the detection of labeled-EVs fluorescence in CytoD treated THP-1 and U937 cells dropped the fluorescence levels close to the baseline of untreated cells (figure 32 B and C). In summary,

EVs did not induce undesired effects on monocyte cell lines in vitro. We show evidence of

EVs internalization which reduced when cells were treated with a phagocytosis inhibitor, cytoD suggesting phagocytosis is a method of internalization. The safety of EVs supports their use as carriers for therapeutic cargo.

117

Figure 32. Phagocytosis of labeled EV by differentiated THP-1 and U937 cells.

Continued 118

Figure 32. Continued

Adherent, PMA-differentiated cells were incubated for 16 h in the absence or presence of seven µg PKH67-labeled EV/ml. Uptake of EV was detected by confocal microscopy and flow cytometry. (A) Confocal microscopic images of cells with or without PKH67-EV

(green) labeled with the nuclear stain DAPI (blue) and the cell membrane stain WGA-

Alexa Fluor 594 (red) (Scale bar ¼ 20 mm). (B) Overlapped histograms comparing the

PKH67 signal from cells exposed to seven µg of labeled EV (filled grey), cells without EV

(solid line) and cells treated with cytochalasin D (CytoD) prior to incubation with EV

(dotted line). (C) MFI of cells represented in (B).

4.4.4. EVs are internalized in HeLa cell line

After assessing the safety of EVs on human monocyte cell lines, we investigate the fate of

EVs on cancer cell lines. We first confirmed internalization of EVs in HeLa cells. As shown in figure 33, EVs are clearly internalized at higher concentrations by HeLa cells. It appears that the EVs are mostly internalized determined by the punctate staining of the labeled EVs in the photo micrographs

119

0 ng 15 ng

60 ng 150 ng

Figure 33. Phagocytosis of labeled EV by differentiated THP-1 and U937 cells.

120

4.5. Discussion

Several studies within the last five years showed great promise for the use of EVs as potential delivery nanoparticles for therapeutic cargo especially miRNAs (reviewed in

[350]). In this study, we report a method for scale-up of EVs to produce sufficient quantities for the desired therapeutic application. We evaluated the characteristics and purity of the

HEK293T-derived EVs and investigated the safety of EVs in vitro.

We performed immunotoxicity studies to investigate whether EVs altered any basic functions of monocyte cells, such as their phagocytic capacity or caused changes in their apoptosis and necrosis index. Indeed, we found EVs to be safe, monocytes exposed to EVs at increasing doses did not demonstrate any cytotoxic reactions (figure 31). Basic function of monocytes is elimination of infectious bodies, consequently, we investigated if monocytes exposed to EVs had reduced capacity to phagocytize FluoSpheres, fluorescently-labeled 1 µm polystyrene microspheres. As expected, no changes in monocyte phagocytic capacity was detected (data not shown) supporting our initial finding that EVs did not alter basic functions of monocytes. To confirm EVs were internalized, we first treated monocytes with stained EVs for confocal imaging. We found strong green florescence overlapping with the red monocytes cell membrane (data not shown). Due to the high nuclear to cytoplasmic ratio, it was difficult to visualize cytoplasm and confirm cytoplasmic internalization of EVs. To solve this, we differentiated the monocytes to macrophages using PMA. Macrophages had an adherent nature with enlarged cytoplasm.

As anticipated, we observed clear internalization of EVs in the cytoplasm which reduced

121 when macrophages were treated with cytochalasin D, a phagocytosis inhibitor (figure 32) which not only confirm EVs internalization, but also indicates EVs are internalized via an energy dependent phagocytosis mechanism. Next, we wanted to explore if EVs were internalized in cancer cells. We stained EVs and treated HeLa cells with increasing doses for confocal imaging (figure 33).

In summary, we described a novel method to reproducibly generate suspension cultures of

HEK293T cells in low serum media that reduced time, cost, and labor needed to isolate sufficient quantities of EVs. Characterization of EVs derived from adapted HEK293T cells demonstrated its purity by the absence of CALR. Cryo-TEM of EVs shows the presence of 50 nm – 150 nm single or double-layered nanoparticles as reported in previous studies

[351]. This supports the use of adapted HEK293T to isolate EVs for scale-up purposes and is in agreement with previous studies using adapted HEK293 cells in efficient recombinant protein production [346]. We have demonstrated EVs are internalized in monocytes, exhibited no cytotoxic effects nor interfered with their basic functions.

122

Acknowledgement

We thank Dr. Tracey L. Papenfuss and Dr. Lucia E. Rosas at the Department of Veterinary

Biosciences Informatics at The Ohio State University for their immense contribution to this work. Dr. Papenfuss designed the in vitro immunotoxicity assessment experiments which were conducted by Dr. Rosas. We would like to thank Dr. Min Gao at Kent State

University TEM lab for training me on using Cryo-TEM and capturing TEM images, Dr.

Xiaokui (Molly) Mo at the Department of Biomedical Informatics at The Ohio State

University for statistical analysis, Dr. Jeffery Chalmers and Dr. Clayton Deighan for their expertise in NanoSight, Dr. Gaurav Sahay and Kevin Kauffman at Massachusetts Institute of Technology for conducting initial EVs internalization imaging, and Brian Kemmenoe at the Campus Microscopy and Imaging Facility (CMIF) at The Ohio State University for technical assistance in confocal microscopy.

123

Chapter 5: Synopsis and Discussion

Research over the past 20 years has shown miRNAs to play important roles in posttranscriptional regulation of gene expression. miRNAs regulate up to 30% of human protein coding genes [352, 353] and are involved in maintaining homeostasis of biological processes during development, differentiation, proliferation, and apoptosis [352].

Altered miRNA expression has been detected in tumor tissues and cell lines compared to normal tissues (reviewed in [354-356]). For example, the lost expression of miR-205 and miR-200 family in breast cancer allows for increased levels of their target genes such as

ZEB1 and ZEB2 [56, 98-100, 194]. This promotes EMT, a process facilitating tumor metastasis [56]. On the contrary, the up-regulation of miR-21 in several cancers such as gastric [357], breast [175], glioblastoma [358], lung [359], liver [58, 360], and pancreas

[178, 361] results in the reduction of tumor suppressor genes such as PTEN and TIMP1

[362]. In this dissertation, we examined the consequences of the dysregulation of two miRNAs, miR-205 and miR-217 in breast cancer and in the early events of PDAC, respectively.

In chapter two, we identified a novel miR-205 target gene, HMGB3. Loss of miR-205 led to an increase in HMGB3 mRNA and protein resulting in increased proliferation and invasion of triple negative breast cancer (TNBC) cell lines. Further investigations revealed that HMGB3 increased in metastatic breast cancer patients’ tissues (figure 6A). The

124 expression of miR-205 inversely correlated with HNGB3 expression in the same patient cohort (figure 2B). HMGB3 immunohistochemical staining in patients’ tissues showed a widespread presence (figure 6D) in tumor tissue compared to low intensity (figure 6C) in benign tissues. Patients with high levels of HMGB3 had poor survival compared to patients with low HMGB3 levels (figure 6 E). Other studies described an oncogenic role for

HMGB3 in different cancers. HMGB3 overexpression was reported in gastric cancer [363,

364], bladder cancer [365], and esophageal squamous cell carcinoma [366]. Our study reveals a strong inverse correlation between HMGB3 expression and survival outcome. An explanation could be the fact that HMGB3 levels were significantly higher in metastatic tumor specimens compared to primary tumor specimens (figure 6A). Also, miR-205 is barely detected in TNBC (figure 2A), the most aggressive type of breast cancer, suggesting

TNBC could have higher levels of HMGB3. Knocking down HMGB3 increased the protein levels of E-cadherin (figure 8B) and inhibited cell invasion in two TNBC cell lines (figure

5B), suggesting the involvement of HMGB3 in the EMT process. In summary, inhibiting

HMGB3 levels, either by reintroducing miR-205 or directly targeting HMGB3 levels could have a beneficial outcome in breast cancer therapy. In fact, the chromatin modifying agents

5-aza-2'-deoxycytidine (5-aza) and trichostatin A derepressed miR-205 levels and reduced the levels of HMGB3 (figure 9). This mechanism could be a contributing factor to the benefits of the 5-aza-2'-deoxycytidine ongoing clinical trial in advanced breast cancer

(clinicaltrials.gov).

In chapter three, we studied the role of miR-217 mediated REST regulation in experimental

ADM. Interestingly, miR-217 is a pancreas enriched miRNA [329] suggesting it may play

125 an important role during pancreas development. A recent study reported the progressive down regulation of miR-217 as early as 25 weeks in a conditional Kras driven pancreatic cancer mouse model [297] which corroborates several other studies demonstrating the reduction of miR-217 in pancreatitis, PanIN lesions and PDAC [67, 139, 140, 145-153,

157-161, 367]. Since miR-217 is enriched in exocrine acinar cells [133], one mechanism through which miR-217 can contribute to preventing the early stages of PDAC is via maintaining acinar cell identity (maintaining acinar identity would reduce PDAC). During pancreas injury such as chronic pancreatitis, acinar cells transdifferentiate into duct-like cells. Therefore, to study the early events of pancreatic cancer, we chose to study the molecular deregulation that occurs in acinar cells during their transdifferentiation into ductal cells. Studying these early events could provide essential information needed to discover genes contributing to the loss of acinar cell identity and development of ADM.

ADM is believed to progress into PanIN lesions and subsequently, PDAC in the presence of secondary insults, such as chronic inflammation, Kras mutation, and p53 loss [232]

(reviewed in [368]).

We validated miR-217 mediated REST repression at the post-transcriptional level (figure

12D and 12E) confirming prior work in our laboratory [291]. To understand the role of

REST in ADM, we studied the effect of Rest enforced expression on acinar cells in an in vitro ADM assay. We found increased duct formation, increased ductal marker expression

(figure 14), reduced acinar cells markers (figure 14), and reduced expression of acinar transcription factors such as Ptf1a (figure 16). Our findings suggest that Rest plays a role

126 in ADM progression by repressing expression of acinar related transcription factors such as Ptf1a (figure16).

Similar to miR-217, miR-375 is downregulated in pancreatic cancer and suppresses the growth of SW1990 and Panc-1 cell lines [157, 369, 370]. We investigated the levels of miR-375 in ADM to find that it is also downregulated during experimental ADM (figure

34A). Using TargetScan [371], we identified a miR-375 binding site in the REST 3’ UTR.

To confirm the regulation of REST by miR-375, we cloned a miR-375 overexpressing vector. The vector was transfected into HEK293T cells confirming REST regulation by miR-375 using a luciferase reporter assay (figure 34B). Using Western blotting, we show

REST mediated protein reduction by miR-375 overexpression (figure 34C). Collectively, two miRNAs downregulated in pancreatic cancer, miR-217 and miR-375 are also down regulated in experimental ADM and found to regulate REST.

127

A miR-375 8e-5 CT ** Control - ** REST 6e-5

4e-5

2e-5

2 Expression Relative 0 Day 1 Day 4

B miR-375 8e-5 CT ** ControlEmpty - ** RESTPre-mir -375 6e-5

4e-5

2e-5

Relative Expression 2 Expression Relative 0 Day 1 Day 4

Figure 34. miR-375 regulation of REST. (A) miR-375 mature expression levels during experimental ADM. (B)

Luciferase expression in HEK293T cells co-transfected with either

empty or pre-mir-375 expressing vector and the REST 3’ UTR vector

Continued

128

Figure 34. Continued

Empty miR 375 REST

~200 KDa

~150 KDa

B-Actin ~37 KDa

375 expressing vector for 48 hours. Mean ±SD from triplicate experiments. * P < 0.05, **

P < 0.01.

129

In conclusion, the loss of miRNA-217 allowed the upregulation of REST. We observed that Rest overexpression promoted ADM and repressed Ptf1a among other acinar genes and transcription factors. Detecting the dysregulation of miR-217 and perhaps the other family members (i.e. miR-216a and miR-216b) or their targets in this early event could have potential diagnostic value by predicting the occurrence of ADM.

Better understanding of the mechanisms of miR-217 reduction during the early events of pancreatic cancer could have translational implications. Derepression of miR-217 expression during formation of PDAC may reverse ADM converting the cells back to a more acinar state. Epigenetic silencing is one reported mechanism of transcriptional silencing of miRNAs host genes [372]. Previous work determined that the combination of

5-aza [291] and deazaneplanocin A, a global histone methylation inhibitor had no effect on miR-217 expression in DU145 and BT-549 cell lines [373]. One strategy attempted here is

REST inhibition using small molecule drugs. Charbord, et al., developed X5050, a small molecule REST inhibitor [328]. We examined if the drug had any anti-proliferative effects on pancreatic cancer cell lines. While 10 µM X5050 inhibited PaTu-T and Panc-1 cells proliferation approximately 50%, however, lower doses (10 and 25 µM) of X5050 did not reduce REST protein levels, suggesting that the observed reduction in proliferation is not likely due to REST inhibition.

In chapter four, we assessed the in vitro safety of extracellular vesicles (EVs). Among the current methods for miRNA delivery is encapsulating miRNAs in synthetic lipid based nanoparticles, such as liposomes (reviewed in [374]). Although they have the advantage of relative ease of production, they face many hurdles preventing their success as miRNA

130 delivery vehicles. These include accumulation in highly perfused organs (liver, spleen, and kidneys), entrapment in lysosomes and subsequent degradation, non-specificity, and rapid clearance (reviewed in [374, 375]). In light of these disadvantages of nanoparticle delivery,

EVs are begin considered as a possible vehicle for oligonucleotide and gene delivery.

EVs have gained a great deal of attention in the past few years due to their role in intracellular communication and potential therapeutic applications (reviewed in [376,

377]). Previously, EVs were thought to be a mechanism by which cells export nonessential components, such as in the case of transferrin receptor disposal during reticulocyte maturation [339]. It was not until 1990s when researchers found biological importance to

EVs, such as their involvement in intercellular communication [378, 379] and suppression of tumor growth by exosomes shed from tumor peptide-pulsed dendritic cells [379].

Isolation of EVs can be cumbersome and labor intense. To overcome this hurdle, we explain a method for scale-up production of HEK293T-derived EVs. Taking advantage of

HEK293T adaptability from adherent to suspension form reduced the time, cost, and labor needed to isolate sufficient quantities of EVs for in vitro studies. We have confirmed the purity of EVs, characterized their morphology, and assessed their safety for future use as drug or miRNA delivery vehicles. Our future goals focus on generating engineered

HEK293T-derived EVs expressing an external targeting moiety as well as investigating their efficacy in delivering exogenous miRNAs or short hairpin RNA (shRNA).

Engineering EVs with targeting moieties can help deliver therapeutic agents to the intended cells [333]. Being a natural cellular nanoparticle should help evade the immune system

131 clearance. Our overall goal is re-introducing down-regulated miRNAs using EVs as therapeutic carriers.

We propose to engineer targeted EVs isolated from HEK293T cells similar to that described in mouse dendritic cells [333]. As part of this development, we evaluated potential immunotoxicity of HEK293T-derived EVs on two human monocytic cell lines,

THP-1 and U937. We found that EVs did not alter the phagocytic capacities (data not shown) or induce cytotoxicity in recipient cells after confirming their internalization (figure

32). Thus, HEK293T-derived EVs did not alter basic functions of THP-1 or U937 cells, suggesting the safety of EVs use in vitro as therapeutic vehicles.

HEK293T-derived EVs safety is yet to be confirmed in vivo. We intend to use wild type mice to assess any potential undesired side effects for EVs administration, determine its biodistribution, and best method of delivery. Although previous studies reported the use of

EVs in vivo [333, 380], it is reported that biodistribution differs depending on the source of EVs, the route of administration, and whether or not it expresses a targeting moiety

[381].

In summary, we have shown the downregulation of miR-205 and the upregulation of its target gene, HMGB3 had tumor promoting effects. Similarly, we have shown the upregulation of Rest possibly via miR-217 loss in acinar cells promoted duct formation and reduced acinar promoting transcription factors. Both studies emphasize the consequences of miRNA loss and suggest the potential benefit of re-introducing miRNAs or inhibiting their targets using shRNA for gene therapy. miRNA therapeutics is still in its infancy, mainly due to the presence of many hurdles. Among these hurdles is the method of miRNA

132 or shRNA delivery. One possibility to delivery therapeutic miRNAs is to incorporate them into EVs. Thus the data presented in this dissertation could lead to numerous studies in the future including detailing a mechanistic role for HMGB3 in TNBC, development of pancreas specific conditional miR-217 knockout mice and in vivo studies of the safety and efficacy of EV delivery vehicles.

133

References

1. Lee RC, Feinbaum RL, Ambros V: The C. elegans heterochronic gene lin-4

encodes small RNAs with antisense complementarity to lin-14. Cell 1993,

75(5):843-854.

2. Wightman B, Ha I, Ruvkun G: Posttranscriptional regulation of the

heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C.

elegans. Cell 1993, 75(5):855-862.

3. Reinhart BJ, Slack FJ, Basson M, Pasquinelli AE, Bettinger JC, Rougvie AE,

Horvitz HR, Ruvkun G: The 21-nucleotide let-7 RNA regulates developmental

timing in Caenorhabditis elegans. Nature 2000, 403(6772):901-906.

4. Slack FJ, Basson M, Liu Z, Ambros V, Horvitz HR, Ruvkun G: The lin-41 RBCC

gene acts in the C. elegans heterochronic pathway between the let-7 regulatory

RNA and the LIN-29 transcription factor. Mol Cell 2000, 5(4):659-669.

5. Pasquinelli AE, Reinhart BJ, Slack F, Martindale MQ, Kuroda MI, Maller B,

Hayward DC, Ball EE, Degnan B, Müller P et al: Conservation of the sequence

and temporal expression of let-7 heterochronic regulatory RNA. Nature 2000,

408(6808):86-89.

6. Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T: Identification of novel

genes coding for small expressed RNAs. Science 2001, 294(5543):853-858.

134

7. Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP: MicroRNAs in

plants. Genes Dev 2002, 16(13):1616-1626.

8. Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B,

Gaasterland T, Meyer J, Tuschl T: The small RNA profile during Drosophila

melanogaster development. Dev Cell 2003, 5(2):337-350.

9. Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T:

Identification of tissue-specific microRNAs from mouse. Curr Biol 2002,

12(9):735-739.

10. Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G: Numerous microRNPs

in neuronal cells containing novel microRNAs. RNA 2003, 9(2):180-186.

11. Houbaviy HB, Murray MF, Sharp PA: Embryonic stem cell-specific MicroRNAs.

Dev Cell 2003, 5(2):351-358.

12. Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T: New microRNAs

from mouse and human. RNA 2003, 9(2):175-179.

13. Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP: Vertebrate microRNA

genes. Science 2003, 299(5612):1540.

14. Lee RC, Ambros V: An extensive class of small RNAs in Caenorhabditis

elegans. Science 2001, 294(5543):862-864.

15. Lau NC, Lim LP, Weinstein EG, Bartel DP: An abundant class of tiny RNAs

with probable regulatory roles in Caenorhabditis elegans. Science 2001,

294(5543):858-862.

135

16. Fiore R, Siegel G, Schratt G: MicroRNA function in neuronal development,

plasticity and disease. Biochim Biophys Acta 2008, 1779(8):471-478.

17. Almeida MI, Reis RM, Calin GA: MicroRNA history: discovery, recent

applications, and next frontiers. Mutat Res 2011, 717(1-2):1-8.

18. Kim VN, Nam JW: Genomics of microRNA. Trends Genet 2006, 22(3):165-173.

19. Kim YK, Kim VN: Processing of intronic microRNAs. EMBO J 2007, 26(3):775-

783.

20. Lages E, Ipas H, Guttin A, Nesr H, Berger F, Issartel JP: MicroRNAs: molecular

features and role in cancer. Front Biosci (Landmark Ed) 2012, 17:2508-2540.

21. Iorio MV, Croce CM: MicroRNA dysregulation in cancer: diagnostics,

monitoring and therapeutics. A comprehensive review. EMBO molecular

medicine 2012, 4(3):143-159.

22. Lee Y, Kim M, Han J, Yeom KH, Lee S, Baek SH, Kim VN: MicroRNA genes

are transcribed by RNA polymerase II. EMBO J 2004, 23(20):4051-4060.

23. Cai X, Hagedorn CH, Cullen BR: Human microRNAs are processed from

capped, polyadenylated transcripts that can also function as mRNAs. RNA

2004, 10(12):1957-1966.

24. Gregory RI, Yan KP, Amuthan G, Chendrimada T, Doratotaj B, Cooch N,

Shiekhattar R: The Microprocessor complex mediates the genesis of

microRNAs. Nature 2004, 432(7014):235-240.

136

25. Lee Y, Ahn C, Han J, Choi H, Kim J, Yim J, Lee J, Provost P, Rådmark O, Kim S

et al: The nuclear RNase III Drosha initiates microRNA processing. Nature

2003, 425(6956):415-419.

26. Han J, Lee Y, Yeom KH, Nam JW, Heo I, Rhee JK, Sohn SY, Cho Y, Zhang BT,

Kim VN: Molecular basis for the recognition of primary microRNAs by the

Drosha-DGCR8 complex. Cell 2006, 125(5):887-901.

27. Lund E, Güttinger S, Calado A, Dahlberg JE, Kutay U: Nuclear export of

microRNA precursors. Science 2004, 303(5654):95-98.

28. Yi R, Doehle BP, Qin Y, Macara IG, Cullen BR: Overexpression of exportin 5

enhances RNA interference mediated by short hairpin RNAs and microRNAs.

RNA 2005, 11(2):220-226.

29. Gwizdek C, Ossareh-Nazari B, Brownawell AM, Doglio A, Bertrand E, Macara

IG, Dargemont C: Exportin-5 mediates nuclear export of minihelix-containing

RNAs. J Biol Chem 2003, 278(8):5505-5508.

30. Zeng Y, Cullen BR: Structural requirements for pre-microRNA binding and

nuclear export by Exportin 5. Nucleic Acids Res 2004, 32(16):4776-4785.

31. Schmittgen TD: Regulation of microRNA processing in development,

differentiation and cancer. J Cell Mol Med 2008, 12(5B):1811-1819.

32. Zhang H, Kolb FA, Brondani V, Billy E, Filipowicz W: Human Dicer

preferentially cleaves dsRNAs at their termini without a requirement for ATP.

EMBO J 2002, 21(21):5875-5885.

137

33. Zhang H, Kolb FA, Jaskiewicz L, Westhof E, Filipowicz W: Single processing

center models for human Dicer and bacterial RNase III. Cell 2004, 118(1):57-

68.

34. Lewis BP, Shih IH, Jones-Rhoades MW, Bartel DP, Burge CB: Prediction of

mammalian microRNA targets. Cell 2003, 115(7):787-798.

35. Yekta S, Shih IH, Bartel DP: MicroRNA-directed cleavage of HOXB8 mRNA.

Science 2004, 304(5670):594-596.

36. Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP: Prediction of

plant microRNA targets. Cell 2002, 110(4):513-520.

37. Jones-Rhoades MW, Bartel DP, Bartel B: MicroRNAS and their regulatory roles

in plants. Annu Rev Plant Biol 2006, 57:19-53.

38. Calin GA, Dumitru CD, Shimizu M, Bichi R, Zupo S, Noch E, Aldler H, Rattan S,

Keating M, Rai K et al: Frequent deletions and down-regulation of micro- RNA

genes miR15 and miR16 at 13q14 in chronic lymphocytic leukemia.

Proceedings of the National Academy of Sciences of the United States of America

2002, 99(24):15524-15529.

39. Cimmino A, Calin GA, Fabbri M, Iorio MV, Ferracin M, Shimizu M, Wojcik SE,

Aqeilan RI, Zupo S, Dono M et al: miR-15 and miR-16 induce apoptosis by

targeting BCL2. Proc Natl Acad Sci U S A 2005, 102(39):13944-13949.

40. Calin GA, Sevignani C, Dumitru CD, Hyslop T, Noch E, Yendamuri S, Shimizu

M, Rattan S, Bullrich F, Negrini M et al: Human microRNA genes are frequently

located at fragile sites and genomic regions involved in cancers. Proceedings of

138

the National Academy of Sciences of the United States of America 2004,

101(9):2999-3004.

41. He L, Thomson JM, Hemann MT, Hernando-Monge E, Mu D, Goodson S, Powers

S, Cordon-Cardo C, Lowe SW, Hannon GJ et al: A microRNA polycistron as a

potential human oncogene. Nature 2005, 435(7043):828-833.

42. Orellana EA, Kasinski AL: MicroRNAs in Cancer: A Historical Perspective on

the Path from Discovery to Therapy. Cancers (Basel) 2015, 7(3):1388-1405.

43. O'Donnell KA, Wentzel EA, Zeller KI, Dang CV, Mendell JT: c-Myc-regulated

microRNAs modulate E2F1 expression. Nature 2005, 435(7043):839-843.

44. Johnson SM, Grosshans H, Shingara J, Byrom M, Jarvis R, Cheng A, Labourier E,

Reinert KL, Brown D, Slack FJ: RAS is regulated by the let-7 microRNA family.

Cell 2005, 120(5):635-647.

45. Costinean S, Sandhu SK, Pedersen IM, Tili E, Trotta R, Perrotti D, Ciarlariello D,

Neviani P, Harb J, Kauffman LR et al: Src homology 2 domain-containing

inositol-5-phosphatase and CCAAT enhancer-binding protein beta are

targeted by miR-155 in B cells of Emicro-MiR-155 transgenic mice. Blood

2009, 114(7):1374-1382.

46. Medina PP, Nolde M, Slack FJ: OncomiR addiction in an in vivo model of

microRNA-21-induced pre-B-cell lymphoma. Nature 2010, 467(7311):86-90.

47. Thompson RC, Deo M, Turner DL: Analysis of microRNA expression by in situ

hybridization with RNA oligonucleotide probes. Methods 2007, 43(2):153-161.

139

48. Pritchard CC, Cheng HH, Tewari M: MicroRNA profiling: approaches and

considerations. Nat Rev Genet 2012, 13(5):358-369.

49. Yin JQ, Zhao RC, Morris KV: Profiling microRNA expression with

microarrays. Trends Biotechnol 2008, 26(2):70-76.

50. Zhang X, Dong H, Tian Y: Introduction. In: MicroRNA Detection and

Pathological Functions. edn. Berlin, Heidelberg: Springer Berlin Heidelberg;

2015: 1-6.

51. Barbarotto E, Schmittgen TD, Calin GA: MicroRNAs and cancer: profile,

profile, profile. Int J Cancer 2008, 122(5):969-977.

52. Volinia S, Croce CM: Prognostic microRNA/mRNA signature from the

integrated analysis of patients with invasive breast cancer. Proc Natl Acad Sci

U S A 2013, 110(18):7413-7417.

53. Klein U, Lia M, Crespo M, Siegel R, Shen Q, Mo T, Ambesi-Impiombato A,

Califano A, Migliazza A, Bhagat G et al: The DLEU2/miR-15a/16-1 cluster

controls B cell proliferation and its deletion leads to chronic lymphocytic

leukemia. Cancer cell 2010, 17(1):28-40.

54. Boyerinas B, Park SM, Hau A, Murmann AE, Peter ME: The role of let-7 in cell

differentiation and cancer. Endocr Relat Cancer 2010, 17(1):F19-36.

55. Mishra S, Yadav T, Rani V: Exploring miRNA based approaches in cancer

diagnostics and therapeutics. Crit Rev Oncol Hematol 2015.

56. Gregory PA, Bert AG, Paterson EL, Barry SC, Tsykin A, Farshid G, Vadas MA,

Khew-Goodall Y, Goodall GJ: The miR-200 family and miR-205 regulate

140

epithelial to mesenchymal transition by targeting ZEB1 and SIP1. Nature cell

biology 2008, 10(5):593-601.

57. Thangraju M, Jain A: MicroRNAs in Development and Progression of Breast

Cancer. In: MicroRNA in Development and in the Progression of Cancer. edn.

Edited by Singh RS, Rameshwar P. New York, NY: Springer New York; 2014:

117-137.

58. Bao L, Yan Y, Xu C, Ji W, Shen S, Xu G, Zeng Y, Sun B, Qian H, Chen L et al:

MicroRNA-21 suppresses PTEN and hSulf-1 expression and promotes

hepatocellular carcinoma progression through AKT/ERK pathways. Cancer

letters 2013, 337(2):226-236.

59. Chao TF, Xiong HH, Liu W, Chen Y, Zhang JX: MiR-21 mediates the radiation

resistance of glioblastoma cells by regulating PDCD4 and hMSH2. J Huazhong

Univ Sci Technolog Med Sci 2013, 33(4):525-529.

60. Seca H, Lima RT, Lopes-Rodrigues V, Guimaraes JE, Almeida GM, Vasconcelos

MH: Targeting miR-21 induces autophagy and chemosensitivity of leukemia

cells. Curr Drug Targets 2013, 14(10):1135-1143.

61. Jardin F, Figeac M: MicroRNAs in lymphoma, from diagnosis to targeted

therapy. Curr Opin Oncol 2013, 25(5):480-486.

62. Li J, Zhang Y, Zhang W, Jia S, Tian R, Kang Y, Ma Y, Li D: Genetic

heterogeneity of breast cancer metastasis may be related to miR-21 regulation

of TIMP-3 in translation. Int J Surg Oncol 2013, 2013:875078.

141

63. Vicinus B, Rubie C, Stegmaier N, Frick VO, Kölsch K, Kauffels A, Ghadjar P,

Wagner M, Glanemann M: miR-21 and its target gene CCL20 are both highly

overexpressed in the microenvironment of colorectal tumors: significance of

their regulation. Oncol Rep 2013, 30(3):1285-1292.

64. Guancial EA, Bellmunt J, Yeh S, Rosenberg JE, Berman DM: The evolving

understanding of microRNA in bladder cancer. Urol Oncol 2014, 32(1):41.e31-

40.

65. Vang S, Wu HT, Fischer A, Miller DH, MacLaughlan S, Douglass E, Comisar L,

Steinhoff M, Collins C, Smith PJ et al: Identification of ovarian cancer

metastatic miRNAs. PLoS One 2013, 8(3):e58226.

66. Dillhoff M, Liu J, Frankel W, Croce C, Bloomston M: MicroRNA-21 is

overexpressed in pancreatic cancer and a potential predictor of survival. J

Gastrointest Surg 2008, 12(12):2171-2176.

67. Lee EJ, Gusev Y, Jiang J, Nuovo GJ, Lerner MR, Frankel WL, Morgan DL, Postier

RG, Brackett DJ, Schmittgen TD: Expression profiling identifies microRNA

signature in pancreatic cancer. International journal of cancerJournal

international du cancer 2007, 120(5):1046-1054.

68. Park JK, Lee EJ, Esau C, Schmittgen TD: Antisense inhibition of microRNA-21

or -221 arrests cell cycle, induces apoptosis, and sensitizes the effects of

gemcitabine in pancreatic adenocarcinoma. Pancreas 2009, 38(7):e190-199.

142

69. Tu H, Sun H, Lin Y, Ding J, Nan K, Li Z, Shen Q, Wei Y: Oxidative stress

upregulates PDCD4 expression in patients with gastric cancer via miR-21.

Curr Pharm Des 2014, 20(11):1917-1923.

70. Chen Y, Liu W, Chao T, Zhang Y, Yan X, Gong Y, Qiang B, Yuan J, Sun M, Peng

X: MicroRNA-21 down-regulates the expression of tumor suppressor PDCD4

in human glioblastoma cell T98G. Cancer Lett 2008, 272(2):197-205.

71. Shi JS, Zhang J, Li J: [Role of miR-155 in pathogenesis of diffuse large B cell

lymphoma and its possible mechanism]. Zhongguo Shi Yan Xue Ye Xue Za Zhi

2014, 22(3):869-872.

72. Tili E, Croce CM, Michaille JJ: miR-155: on the crosstalk between inflammation

and cancer. Int Rev Immunol 2009, 28(5):264-284.

73. Czyzyk-Krzeska MF, Zhang X: MiR-155 at the heart of oncogenic pathways.

Oncogene 2014, 33(6):677-678.

74. Toss A, Cristofanilli M: Molecular characterization and targeted therapeutic

approaches in breast cancer. Breast Cancer Res 2015, 17:60.

75. Iorio MV, Ferracin M, Liu CG, Veronese A, Spizzo R, Sabbioni S, Magri E,

Pedriali M, Fabbri M, Campiglio M et al: MicroRNA gene expression

deregulation in human breast cancer. Cancer Res 2005, 65(16):7065-7070.

76. Yan LX, Huang XF, Shao Q, Huang MY, Deng L, Wu QL, Zeng YX, Shao JY:

MicroRNA miR-21 overexpression in human breast cancer is associated with

advanced clinical stage, lymph node metastasis and patient poor prognosis.

RNA 2008, 14(11):2348-2360.

143

77. Qian B, Katsaros D, Lu L, Preti M, Durando A, Arisio R, Mu L, Yu H: High miR-

21 expression in breast cancer associated with poor disease-free survival in

early stage disease and high TGF-beta1. Breast Cancer Res Treat 2009,

117(1):131-140.

78. Scott GK, Goga A, Bhaumik D, Berger CE, Sullivan CS, Benz CC: Coordinate

suppression of ERBB2 and ERBB3 by enforced expression of micro-RNA

miR-125a or miR-125b. J Biol Chem 2007, 282(2):1479-1486.

79. Iorio MV, Casalini P, Piovan C, Di Leva G, Merlo A, Triulzi T, Menard S, Croce

CM, Tagliabue E: microRNA-205 regulates HER3 in human breast cancer.

Cancer research 2009, 69(6):2195-2200.

80. Wu H, Zhu S, Mo YY: Suppression of cell growth and invasion by miR-205 in

breast cancer. Cell research 2009, 19(4):439-448.

81. Adams BD, Furneaux H, White BA: The micro-ribonucleic acid (miRNA) miR-

206 targets the human estrogen receptor-alpha (ERalpha) and represses

ERalpha messenger RNA and protein expression in breast cancer cell lines.

Mol Endocrinol 2007, 21(5):1132-1147.

82. Zhao JJ, Lin J, Yang H, Kong W, He L, Ma X, Coppola D, Cheng JQ: MicroRNA-

221/222 negatively regulates estrogen receptor alpha and is associated with

tamoxifen resistance in breast cancer. J Biol Chem 2008, 283(45):31079-31086.

83. Miller TE, Ghoshal K, Ramaswamy B, Roy S, Datta J, Shapiro CL, Jacob S,

Majumder S: MicroRNA-221/222 confers tamoxifen resistance in breast cancer

by targeting p27Kip1. J Biol Chem 2008, 283(44):29897-29903.

144

84. Di Leva G, Gasparini P, Piovan C, Ngankeu A, Garofalo M, Taccioli C, Iorio MV,

Li M, Volinia S, Alder H et al: MicroRNA cluster 221-222 and estrogen receptor

alpha interactions in breast cancer. J Natl Cancer Inst 2010, 102(10):706-721.

85. Garofalo M, Di Leva G, Romano G, Nuovo G, Suh SS, Ngankeu A, Taccioli C,

Pichiorri F, Alder H, Secchiero P et al: miR-221&222 regulate TRAIL resistance

and enhance tumorigenicity through PTEN and TIMP3 downregulation.

Cancer Cell 2009, 16(6):498-509.

86. Derynck R, Akhurst RJ, Balmain A: TGF-beta signaling in tumor suppression

and cancer progression. Nat Genet 2001, 29(2):117-129.

87. Al-Hajj M, Wicha MS, Benito-Hernandez A, Morrison SJ, Clarke MF: Prospective

identification of tumorigenic breast cancer cells. Proc Natl Acad Sci U S A 2003,

100(7):3983-3988.

88. Yu F, Yao H, Zhu P, Zhang X, Pan Q, Gong C, Huang Y, Hu X, Su F, Lieberman

J et al: let-7 regulates self renewal and tumorigenicity of breast cancer cells.

Cell 2007, 131(6):1109-1123.

89. Honma K, Iwao-Koizumi K, Takeshita F, Yamamoto Y, Yoshida T, Nishio K,

Nagahara S, Kato K, Ochiya T: RPN2 gene confers docetaxel resistance in breast

cancer. Nat Med 2008, 14(9):939-948.

90. Takahashi RU, Takeshita F, Honma K, Ono M, Kato K, Ochiya T: Ribophorin II

regulates breast tumor initiation and metastasis through the functional

suppression of GSK3β. Sci Rep 2013, 3:2474.

145

91. Körner C, Keklikoglou I, Bender C, Wörner A, Münstermann E, Wiemann S:

MicroRNA-31 sensitizes human breast cells to apoptosis by direct targeting of

protein kinase C epsilon (PKCepsilon). J Biol Chem 2013, 288(12):8750-8761.

92. Thiery JP, Sleeman JP: Complex networks orchestrate epithelial-mesenchymal

transitions. Nat Rev Mol Cell Biol 2006, 7(2):131-142.

93. Lee JM, Dedhar S, Kalluri R, Thompson EW: The epithelial-mesenchymal

transition: new insights in signaling, development, and disease. J Cell Biol

2006, 172(7):973-981.

94. Thiery JP: Epithelial-mesenchymal transitions in tumour progression. Nat Rev

Cancer 2002, 2(6):442-454.

95. Wang L, Wang J: MicroRNA-mediated breast cancer metastasis: from primary

site to distant organs. Oncogene 2012, 31(20):2499-2511.

96. Ma L, Young J, Prabhala H, Pan E, Mestdagh P, Muth D, Teruya-Feldstein J,

Reinhardt F, Onder TT, Valastyan S et al: miR-9, a MYC/MYCN-activated

microRNA, regulates E-cadherin and cancer metastasis. Nat Cell Biol 2010,

12(3):247-256.

97. Hurteau GJ, Carlson JA, Spivack SD, Brock GJ: Overexpression of the

microRNA hsa-miR-200c leads to reduced expression of transcription factor 8

and increased expression of E-cadherin. Cancer Res 2007, 67(17):7972-7976.

98. Burk U, Schubert J, Wellner U, Schmalhofer O, Vincan E, Spaderna S, Brabletz T:

A reciprocal repression between ZEB1 and members of the miR-200 family

promotes EMT and invasion in cancer cells. EMBO Rep 2008, 9(6):582-589.

146

99. Park SM, Gaur AB, Lengyel E, Peter ME: The miR-200 family determines the

epithelial phenotype of cancer cells by targeting the E-cadherin repressors

ZEB1 and ZEB2. Genes Dev 2008, 22(7):894-907.

100. Bracken CP, Gregory PA, Kolesnikoff N, Bert AG, Wang J, Shannon MF, Goodall

GJ: A double-negative feedback loop between ZEB1-SIP1 and the microRNA-

200 family regulates epithelial-mesenchymal transition. Cancer Res 2008,

68(19):7846-7854.

101. Takahashi RU, Miyazaki H, Ochiya T: The role of microRNAs in the regulation

of cancer stem cells. Front Genet 2014, 4:295.

102. Takahashi RU, Miyazaki H, Ochiya T: The Roles of MicroRNAs in Breast

Cancer. Cancers (Basel) 2015, 7(2):598-616.

103. Holohan C, Van Schaeybroeck S, Longley DB, Johnston PG: Cancer drug

resistance: an evolving paradigm. Nat Rev Cancer 2013, 13(10):714-726.

104. Liang Z, Wu H, Xia J, Li Y, Zhang Y, Huang K, Wagar N, Yoon Y, Cho HT, Scala

S et al: Involvement of miR-326 in chemotherapy resistance of breast cancer

through modulating expression of multidrug resistance-associated protein 1.

Biochem Pharmacol 2010, 79(6):817-824.

105. Kovalchuk O, Filkowski J, Meservy J, Ilnytskyy Y, Tryndyak VP, Chekhun VF,

Pogribny IP: Involvement of microRNA-451 in resistance of the MCF-7 breast

cancer cells to chemotherapeutic drug doxorubicin. Mol Cancer Ther 2008,

7(7):2152-2159.

147

106. Ma MT, He M, Wang Y, Jiao XY, Zhao L, Bai XF, Yu ZJ, Wu HZ, Sun ML, Song

ZG et al: MiR-487a resensitizes mitoxantrone (MX)-resistant breast cancer

cells (MCF-7/MX) to MX by targeting breast cancer resistance protein

(BCRP/ABCG2). Cancer Lett 2013, 339(1):107-115.

107. le Sage C, Nagel R, Egan DA, Schrier M, Mesman E, Mangiola A, Anile C, Maira

G, Mercatelli N, Ciafrè SA et al: Regulation of the p27(Kip1) tumor suppressor

by miR-221 and miR-222 promotes cancer cell proliferation. EMBO J 2007,

26(15):3699-3708.

108. Ma L, Teruya-Feldstein J, Weinberg RA: Tumour invasion and metastasis

initiated by microRNA-10b in breast cancer. Nature 2007, 449(7163):682-688.

109. Tavazoie SF, Alarcón C, Oskarsson T, Padua D, Wang Q, Bos PD, Gerald WL,

Massagué J: Endogenous human microRNAs that suppress breast cancer

metastasis. Nature 2008, 451(7175):147-152.

110. Rahib L, Smith BD, Aizenberg R, Rosenzweig AB, Fleshman JM, Matrisian LM:

Projecting cancer incidence and deaths to 2030: the unexpected burden of

thyroid, liver, and pancreas cancers in the United States. Cancer research 2014,

74(11):2913-2921.

111. Siegel R, Naishadham D, Jemal A: Cancer statistics, 2013. CA: a cancer journal

for clinicians 2013, 63(1):11-30.

112. Li Y, Sarkar FH: MicroRNA Targeted Therapeutic Approach for Pancreatic

Cancer. Int J Biol Sci 2016, 12(3):326-337.

148

113. Hernandez YG, Lucas AL: MicroRNA in pancreatic ductal adenocarcinoma

and its precursor lesions. World J Gastrointest Oncol 2016, 8(1):18-29.

114. Raimondi S, Lowenfels AB, Morselli-Labate AM, Maisonneuve P, Pezzilli R:

Pancreatic cancer in chronic pancreatitis; aetiology, incidence, and early

detection. Best Pract Res Clin Gastroenterol 2010, 24(3):349-358.

115. Hruban RH, Iacobuzio-Donahue C, Wilentz RE, Goggins M, Kern SE: Molecular

pathology of pancreatic cancer. Cancer journal (Sudbury, Mass) 2001, 7(4):251-

258.

116. Bardeesy N, DePinho RA: Pancreatic cancer biology and genetics. Nat Rev

Cancer 2002, 2(12):897-909.

117. Brosens LA, Hackeng WM, Offerhaus GJ, Hruban RH, Wood LD: Pancreatic

adenocarcinoma pathology: changing "landscape". J Gastrointest Oncol 2015,

6(4):358-374.

118. Schutte M, Hruban RH, Geradts J, Maynard R, Hilgers W, Rabindran SK,

Moskaluk CA, Hahn SA, Schwarte-Waldhoff I, Schmiegel W et al: Abrogation of

the Rb/p16 tumor-suppressive pathway in virtually all pancreatic carcinomas.

Cancer research 1997, 57(15):3126-3130.

119. Feldmann G, Maitra A: Molecular genetics of pancreatic ductal

adenocarcinomas and recent implications for translational efforts. The Journal

of molecular diagnostics : JMD 2008, 10(2):111-122.

149

120. Lynn FC, Skewes-Cox P, Kosaka Y, McManus MT, Harfe BD, German MS:

MicroRNA expression is required for pancreatic islet cell genesis in the mouse.

Diabetes 2007, 56(12):2938-2945.

121. Jacquemin P, Durviaux SM, Jensen J, Godfraind C, Gradwohl G, Guillemot F,

Madsen OD, Carmeliet P, Dewerchin M, Collen D et al: Transcription factor

hepatocyte nuclear factor 6 regulates pancreatic endocrine cell differentiation

and controls expression of the proendocrine gene ngn3. Mol Cell Biol 2000,

20(12):4445-4454.

122. Lee JC, Smith SB, Watada H, Lin J, Scheel D, Wang J, Mirmira RG, German MS:

Regulation of the pancreatic pro-endocrine gene neurogenin3. Diabetes 2001,

50(5):928-936.

123. Morita S, Hara A, Kojima I, Horii T, Kimura M, Kitamura T, Ochiya T, Nakanishi

K, Matoba R, Matsubara K et al: Dicer is required for maintaining adult

pancreas. PLoS One 2009, 4(1):e4212.

124. Morris JP, Greer R, Russ HA, von Figura G, Kim GE, Busch A, Lee J, Hertel KJ,

Kim S, McManus M et al: Dicer regulates differentiation and viability during

mouse pancreatic cancer initiation. PLoS One 2014, 9(5):e95486.

125. Baroukh N, Ravier MA, Loder MK, Hill EV, Bounacer A, Scharfmann R, Rutter

GA, Van Obberghen E: MicroRNA-124a regulates Foxa2 expression and

intracellular signaling in pancreatic beta-cell lines. J Biol Chem 2007,

282(27):19575-19588.

150

126. Joglekar MV, Parekh VS, Mehta S, Bhonde RR, Hardikar AA: MicroRNA

profiling of developing and regenerating pancreas reveal post-transcriptional

regulation of neurogenin3. Dev Biol 2007, 311(2):603-612.

127. Kloosterman WP, Lagendijk AK, Ketting RF, Moulton JD, Plasterk RH: Targeted

inhibition of miRNA maturation with morpholinos reveals a role for miR-375

in pancreatic islet development. PLoS Biol 2007, 5(8):e203.

128. Correa-Medina M, Bravo-Egana V, Rosero S, Ricordi C, Edlund H, Diez J, Pastori

RL: MicroRNA miR-7 is preferentially expressed in endocrine cells of the

developing and adult human pancreas. Gene Expr Patterns 2009, 9(4):193-199.

129. Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S,

Tuschl T, Rajewsky N, Rorsman P et al: A pancreatic islet-specific microRNA

regulates insulin secretion. Nature 2004, 432(7014):226-230.

130. Joglekar MV, Joglekar VM, Hardikar AA: Expression of islet-specific

microRNAs during human pancreatic development. Gene Expr Patterns 2009,

9(2):109-113.

131. El Ouaamari A, Baroukh N, Martens GA, Lebrun P, Pipeleers D, van Obberghen

E: miR-375 targets 3'-phosphoinositide-dependent protein kinase-1 and

regulates glucose-induced biological responses in pancreatic beta-cells.

Diabetes 2008, 57(10):2708-2717.

132. Poy MN, Hausser J, Trajkovski M, Braun M, Collins S, Rorsman P, Zavolan M,

Stoffel M: miR-375 maintains normal pancreatic alpha- and beta-cell mass.

Proc Natl Acad Sci U S A 2009, 106(14):5813-5818.

151

133. Bravo-Egana V, Rosero S, Molano RD, Pileggi A, Ricordi C, Domínguez-Bendala

J, Pastori RL: Quantitative differential expression analysis reveals miR-7 as

major islet microRNA. Biochem Biophys Res Commun 2008, 366(4):922-926.

134. Nieto M, Hevia P, Garcia E, Klein D, Alvarez-Cubela S, Bravo-Egana V, Rosero

S, Damaris Molano R, Vargas N, Ricordi C et al: Antisense miR-7 impairs insulin

expression in developing pancreas and in cultured pancreatic buds. Cell

Transplant 2012, 21(8):1761-1774.

135. Wu KL, Gannon M, Peshavaria M, Offield MF, Henderson E, Ray M, Marks A,

Gamer LW, Wright CV, Stein R: Hepatocyte nuclear factor 3beta is involved in

pancreatic beta-cell-specific transcription of the pdx-1 gene. Mol Cell Biol

1997, 17(10):6002-6013.

136. Lee CS, Sund NJ, Vatamaniuk MZ, Matschinsky FM, Stoffers DA, Kaestner KH:

Foxa2 controls Pdx1 gene expression in pancreatic beta-cells in vivo. Diabetes

2002, 51(8):2546-2551.

137. Jonsson J, Carlsson L, Edlund T, Edlund H: Insulin-promoter-factor 1 is

required for pancreas development in mice. Nature 1994, 371(6498):606-609.

138. Offield MF, Jetton TL, Labosky PA, Ray M, Stein RW, Magnuson MA, Hogan BL,

Wright CV: PDX-1 is required for pancreatic outgrowth and differentiation of

the rostral duodenum. Development 1996, 122(3):983-995.

139. Szafranska AE, Davison TS, John J, Cannon T, Sipos B, Maghnouj A, Labourier

E, Hahn SA: MicroRNA expression alterations are linked to tumorigenesis and

152

non-neoplastic processes in pancreatic ductal adenocarcinoma. Oncogene

2007, 26(30):4442-4452.

140. Xue Y, Abou Tayoun AN, Abo KM, Pipas JM, Gordon SR, Gardner TB, Barth RJ,

Suriawinata AA, Tsongalis GJ: MicroRNAs as diagnostic markers for

pancreatic ductal adenocarcinoma and its precursor, pancreatic

intraepithelial neoplasm. Cancer Genet 2013, 206(6):217-221.

141. Habbe N, Koorstra JB, Mendell JT, Offerhaus GJ, Ryu JK, Feldmann G,

Mullendore ME, Goggins MG, Hong SM, Maitra A: MicroRNA miR-155 is a

biomarker of early pancreatic neoplasia. Cancer Biol Ther 2009, 8(4):340-346.

142. Caponi S, Funel N, Frampton AE, Mosca F, Santarpia L, Van der Velde AG, Jiao

LR, De Lio N, Falcone A, Kazemier G et al: The good, the bad and the ugly: a

tale of miR-101, miR-21 and miR-155 in pancreatic intraductal papillary

mucinous neoplasms. Ann Oncol 2013, 24(3):734-741.

143. Ryu JK, Matthaei H, Dal Molin M, Hong SM, Canto MI, Schulick RD, Wolfgang

C, Goggins MG, Hruban RH, Cope L et al: Elevated microRNA miR-21 levels in

pancreatic cyst fluid are predictive of mucinous precursor lesions of ductal

adenocarcinoma. Pancreatology 2011, 11(3):343-350.

144. Permuth-Wey J, Chen YA, Fisher K, McCarthy S, Qu X, Lloyd MC, Kasprzak A,

Fournier M, Williams VL, Ghia KM et al: A genome-wide investigation of

microRNA expression identifies biologically-meaningful microRNAs that

distinguish between high-risk and low-risk intraductal papillary mucinous

neoplasms of the pancreas. PLoS One 2015, 10(1):e0116869.

153

145. Slater EP, Strauch K, Rospleszcz S, Ramaswamy A, Esposito I, Klöppel G, Matthäi

E, Heeger K, Fendrich V, Langer P et al: MicroRNA-196a and -196b as Potential

Biomarkers for the Early Detection of Familial Pancreatic Cancer. Transl

Oncol 2014, 7(4):464-471.

146. Ryu JK, Hong SM, Karikari CA, Hruban RH, Goggins MG, Maitra A: Aberrant

MicroRNA-155 expression is an early event in the multistep progression of

pancreatic adenocarcinoma. Pancreatology 2010, 10(1):66-73.

147. du Rieu MC, Torrisani J, Selves J, Al Saati T, Souque A, Dufresne M, Tsongalis

GJ, Suriawinata AA, Carrère N, Buscail L et al: MicroRNA-21 is induced early

in pancreatic ductal adenocarcinoma precursor lesions. Clin Chem 2010,

56(4):603-612.

148. Yu J, Li A, Hong SM, Hruban RH, Goggins M: MicroRNA alterations of

pancreatic intraepithelial neoplasias. Clin Cancer Res 2012, 18(4):981-992.

149. Bloomston M, Frankel WL, Petrocca F, Volinia S, Alder H, Hagan JP, Liu CG,

Bhatt D, Taccioli C, Croce CM: MicroRNA expression patterns to differentiate

pancreatic adenocarcinoma from normal pancreas and chronic pancreatitis.

JAMA 2007, 297(17):1901-1908.

150. Schultz NA, Werner J, Willenbrock H, Roslind A, Giese N, Horn T, Wøjdemann

M, Johansen JS: MicroRNA expression profiles associated with pancreatic

adenocarcinoma and ampullary adenocarcinoma. Mod Pathol 2012,

25(12):1609-1622.

154

151. Vychytilova-Faltejskova P, Kiss I, Klusova S, Hlavsa J, Prochazka V, Kala Z,

Mazanec J, Hausnerova J, Kren L, Hermanova M et al: MiR-21, miR-34a, miR-

198 and miR-217 as diagnostic and prognostic biomarkers for chronic

pancreatitis and pancreatic ductal adenocarcinoma. Diagn Pathol 2015, 10:38.

152. Wang J, Chen J, Chang P, LeBlanc A, Li D, Abbruzzesse JL, Frazier ML, Killary

AM, Sen S: MicroRNAs in plasma of pancreatic ductal adenocarcinoma

patients as novel blood-based biomarkers of disease. Cancer Prev Res (Phila)

2009, 2(9):807-813.

153. Ma MZ, Kong X, Weng MZ, Cheng K, Gong W, Quan ZW, Peng CH: Candidate

microRNA biomarkers of pancreatic ductal adenocarcinoma: meta-analysis,

experimental validation and clinical significance. J Exp Clin Cancer Res 2013,

32:71.

154. Nalls D, Tang SN, Rodova M, Srivastava RK, Shankar S: Targeting epigenetic

regulation of miR-34a for treatment of pancreatic cancer by inhibition of

pancreatic cancer stem cells. PLoS One 2011, 6(8):e24099.

155. Wang J, Sen S: MicroRNA functional network in pancreatic cancer: from

biology to biomarkers of disease. J Biosci 2011, 36(3):481-491.

156. Zhao G, Wang B, Liu Y, Zhang JG, Deng SC, Qin Q, Tian K, Li X, Zhu S, Niu Y

et al: miRNA-141, downregulated in pancreatic cancer, inhibits cell

proliferation and invasion by directly targeting MAP4K4. Mol Cancer Ther

2013, 12(11):2569-2580.

155

157. Frampton AE, Giovannetti E, Jamieson NB, Krell J, Gall TM, Stebbing J, Jiao LR,

Castellano L: A microRNA meta-signature for pancreatic ductal

adenocarcinoma. Expert Rev Mol Diagn 2014, 14(3):267-271.

158. Jamieson NB, Morran DC, Morton JP, Ali A, Dickson EJ, Carter CR, Sansom OJ,

Evans TR, McKay CJ, Oien KA: MicroRNA molecular profiles associated with

diagnosis, clinicopathologic criteria, and overall survival in patients with

resectable pancreatic ductal adenocarcinoma. Clinical cancer research : an

official journal of the American Association for Cancer Research 2012, 18(2):534-

545.

159. Greither T, Grochola LF, Udelnow A, Lautenschläger C, Würl P, Taubert H:

Elevated expression of microRNAs 155, 203, 210 and 222 in pancreatic tumors

is associated with poorer survival. Int J Cancer 2010, 126(1):73-80.

160. Zhao WG, Yu SN, Lu ZH, Ma YH, Gu YM, Chen J: The miR-217 microRNA

functions as a potential tumor suppressor in pancreatic ductal

adenocarcinoma by targeting KRAS. Carcinogenesis 2010, 31(10):1726-1733.

161. Deng S, Zhu S, Wang B, Li X, Liu Y, Qin Q, Gong Q, Niu Y, Xiang C, Chen J et

al: Chronic pancreatitis and pancreatic cancer demonstrate active epithelial-

mesenchymal transition profile, regulated by miR-217-SIRT1 pathway.

Cancer Lett 2014, 355(2):184-191.

162. Lodygin D, Tarasov V, Epanchintsev A, Berking C, Knyazeva T, Körner H,

Knyazev P, Diebold J, Hermeking H: Inactivation of miR-34a by aberrant CpG

methylation in multiple types of cancer. Cell Cycle 2008, 7(16):2591-2600.

156

163. Vogt M, Munding J, Grüner M, Liffers ST, Verdoodt B, Hauk J, Steinstraesser L,

Tannapfel A, Hermeking H: Frequent concomitant inactivation of miR-34a and

miR-34b/c by CpG methylation in colorectal, pancreatic, mammary, ovarian,

urothelial, and renal cell carcinomas and soft tissue sarcomas. Virchows Arch

2011, 458(3):313-322.

164. Chang TC, Wentzel EA, Kent OA, Ramachandran K, Mullendore M, Lee KH,

Feldmann G, Yamakuchi M, Ferlito M, Lowenstein CJ et al: Transactivation of

miR-34a by p53 broadly influences gene expression and promotes apoptosis.

Molecular cell 2007, 26(5):745-752.

165. He L, He X, Lowe SW, Hannon GJ: microRNAs join the p53 network--another

piece in the tumour-suppression puzzle. Nat Rev Cancer 2007, 7(11):819-822.

166. Kent OA, Mullendore M, Wentzel EA, López-Romero P, Tan AC, Alvarez H, West

K, Ochs MF, Hidalgo M, Arking DE et al: A resource for analysis of microRNA

expression and function in pancreatic ductal adenocarcinoma cells. Cancer

Biol Ther 2009, 8(21):2013-2024.

167. Lahdaoui F, Delpu Y, Vincent A, Renaud F, Messager M, Duchêne B, Leteurtre E,

Mariette C, Torrisani J, Jonckheere N et al: miR-219-1-3p is a negative regulator

of the mucin MUC4 expression and is a tumor suppressor in pancreatic cancer.

Oncogene 2015, 34(6):780-788.

168. Jonckheere N, Van Seuningen I: The membrane-bound mucins: From cell

signalling to transcriptional regulation and expression in epithelial cancers.

Biochimie 2010, 92(1):1-11.

157

169. Jonckheere N, Skrypek N, Merlin J, Dessein AF, Dumont P, Leteurtre E, Harris A,

Desseyn JL, Susini C, Frénois F et al: The mucin MUC4 and its membrane

partner ErbB2 regulate biological properties of human CAPAN-2 pancreatic

cancer cells via different signalling pathways. PLoS One 2012, 7(2):e32232.

170. Skrypek N, Duchêne B, Hebbar M, Leteurtre E, van Seuningen I, Jonckheere N:

The MUC4 mucin mediates gemcitabine resistance of human pancreatic

cancer cells via the Concentrative Nucleoside Transporter family. Oncogene

2013, 32(13):1714-1723.

171. Swartz MJ, Batra SK, Varshney GC, Hollingsworth MA, Yeo CJ, Cameron JL,

Wilentz RE, Hruban RH, Argani P: MUC4 expression increases progressively in

pancreatic intraepithelial neoplasia. Am J Clin Pathol 2002, 117(5):791-796.

172. Srivastava SK, Bhardwaj A, Singh S, Arora S, Wang B, Grizzle WE, Singh AP:

MicroRNA-150 directly targets MUC4 and suppresses growth and malignant

behavior of pancreatic cancer cells. Carcinogenesis 2011, 32(12):1832-1839.

173. Ribas J, Ni X, Haffner M, Wentzel EA, Salmasi AH, Chowdhury WH, Kudrolli

TA, Yegnasubramanian S, Luo J, Rodriguez R et al: miR-21: an androgen

receptor-regulated microRNA that promotes hormone-dependent and

hormone-independent prostate cancer growth. Cancer Res 2009, 69(18):7165-

7169.

174. Seike M, Goto A, Okano T, Bowman ED, Schetter AJ, Horikawa I, Mathe EA, Jen

J, Yang P, Sugimura H et al: MiR-21 is an EGFR-regulated anti-apoptotic factor

158

in lung cancer in never-smokers. Proc Natl Acad Sci U S A 2009, 106(29):12085-

12090.

175. Si ML, Zhu S, Wu H, Lu Z, Wu F, Mo YY: miR-21-mediated tumor growth.

Oncogene 2007, 26(19):2799-2803.

176. Roscigno G, Quintavalle C, Donnarumma E, Puoti I, Diaz-Lagares A, Iaboni M,

Fiore D, Russo V, Todaro M, Romano G et al: MiR-221 promotes stemness of

breast cancer cells by targeting DNMT3b. Oncotarget 2015, 7(1):580-592.

177. Gironella M, Seux M, Xie MJ, Cano C, Tomasini R, Gommeaux J, Garcia S,

Nowak J, Yeung ML, Jeang KT et al: Tumor protein 53-induced nuclear protein

1 expression is repressed by miR-155, and its restoration inhibits pancreatic

tumor development. Proc Natl Acad Sci U S A 2007, 104(41):16170-16175.

178. Moriyama T, Ohuchida K, Mizumoto K, Yu J, Sato N, Nabae T, Takahata S, Toma

H, Nagai E, Tanaka M: MicroRNA-21 modulates biological functions of

pancreatic cancer cells including their proliferation, invasion, and

chemoresistance. Mol Cancer Ther 2009, 8(5):1067-1074.

179. Basu A, Alder H, Khiyami A, Leahy P, Croce CM, Haldar S: MicroRNA-375 and

MicroRNA-221: Potential Noncoding RNAs Associated with Antiproliferative

Activity of Benzyl Isothiocyanate in Pancreatic Cancer. Genes Cancer 2011,

2(2):108-119.

180. Chen C, Frierson HF, Jr., Haggerty PF, Theodorescu D, Gregory CW, Dong JT:

An 800-kb region of deletion at 13q14 in human prostate and other

carcinomas. Genomics 2001, 77(3):135-144.

159

181. Siegel RL, Miller KD, Jemal A: Cancer statistics, 2016. CA Cancer J Clin 2016,

66(1):7-30.

182. Bouchalova K, Kharaishvili G, Bouchal J, Vrbkova J, Megova M, Hlobilkova A:

Triple negative breast cancer - BCL2 in prognosis and prediction. Review.

Curr Drug Targets 2014, 15(12):1166-1175.

183. Rodriguez-Pinilla SM, Sarrio D, Honrado E, Hardisson D, Calero F, Benitez J,

Palacios J: Prognostic significance of basal-like phenotype and fascin

expression in node-negative invasive breast carcinomas. Clinical cancer

research : an official journal of the American Association for Cancer Research

2006, 12(5):1533-1539.

184. Liang Y, Ridzon D, Wong L, Chen C: Characterization of microRNA expression

profiles in normal human tissues. BMC genomics 2007, 8:166.

185. Chung TK, Cheung TH, Huen NY, Wong KW, Lo KW, Yim SF, Siu NS, Wong

YM, Tsang PT, Pang MW et al: Dysregulated microRNAs and their predicted

targets associated with endometrioid endometrial adenocarcinoma in Hong

Kong women. International journal of cancerJournal international du cancer

2009, 124(6):1358-1365.

186. Lebanony D, Benjamin H, Gilad S, Ezagouri M, Dov A, Ashkenazi K, Gefen N,

Izraeli S, Rechavi G, Pass H et al: Diagnostic assay based on hsa-miR-205

expression distinguishes squamous from nonsquamous non-small-cell lung

carcinoma. Journal of clinical oncology : official journal of the American Society

of Clinical Oncology 2009, 27(12):2030-2037.

160

187. Markou A, Tsaroucha EG, Kaklamanis L, Fotinou M, Georgoulias V, Lianidou ES:

Prognostic value of mature microRNA-21 and microRNA-205 overexpression

in non-small cell lung cancer by quantitative real-time RT-PCR. Clinical

chemistry 2008, 54(10):1696-1704.

188. Yanaihara N, Caplen N, Bowman E, Seike M, Kumamoto K, Yi M, Stephens RM,

Okamoto A, Yokota J, Tanaka T et al: Unique microRNA molecular profiles in

lung cancer diagnosis and prognosis. Cancer cell 2006, 9(3):189-198.

189. Hulf T, Sibbritt T, Wiklund ED, Bert S, Strbenac D, Statham AL, Robinson MD,

Clark SJ: Discovery pipeline for epigenetically deregulated miRNAs in cancer:

integration of primary miRNA transcription. BMC genomics 2011, 12:54-2164-

2112-2154.

190. Dar AA, Majid S, de Semir D, Nosrati M, Bezrookove V, Kashani-Sabet M:

miRNA-205 suppresses melanoma cell proliferation and induces senescence

via regulation of E2F1 protein. The Journal of biological chemistry 2011,

286(19):16606-16614.

191. Philippidou D, Schmitt M, Moser D, Margue C, Nazarov PV, Muller A, Vallar L,

Nashan D, Behrmann I, Kreis S: Signatures of microRNAs and selected

microRNA target genes in human melanoma. Cancer research 2010,

70(10):4163-4173.

192. Xu Y, Brenn T, Brown ER, Doherty V, Melton DW: Differential expression of

microRNAs during melanoma progression: miR-200c, miR-205 and miR-211

161

are downregulated in melanoma and act as tumour suppressors. British journal

of cancer 2012, 106(3):553-561.

193. Greene SB, Herschkowitz JI, Rosen JM: The ups and downs of miR-205:

identifying the roles of miR-205 in mammary gland development and breast

cancer. RNA biology 2010, 7(3):300-304.

194. Wu H, Mo YY: Targeting miR-205 in breast cancer. Expert opinion on

therapeutic targets 2009, 13(12):1439-1448.

195. Wagoner MP, Gunsalus KT, Schoenike B, Richardson AL, Friedl A, Roopra A:

The transcription factor REST is lost in aggressive breast cancer. PLoS

genetics 2010, 6(6):e1000979.

196. Livak KJ, Schmittgen TD: Analysis of relative gene expression data using real-

time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods (San

Diego, Calif) 2001, 25(4):402-408.

197. Madhavan S, Gusev Y, Harris M, Tanenbaum DM, Gauba R, Bhuvaneshwar K,

Shinohara A, Rosso K, Carabet LA, Song L et al: G-DOC: a systems medicine

platform for personalized oncology. Neoplasia (New York, NY) 2011, 13(9):771-

783.

198. Gentleman RC, Carey VJ, Bates DM, Bolstad B, Dettling M, Dudoit S, Ellis B,

Gautier L, Ge Y, Gentry J et al: Bioconductor: open software development for

computational biology and bioinformatics. Genome biology 2004, 5(10):R80.

199. Loi S, Haibe-Kains B, Desmedt C, Wirapati P, Lallemand F, Tutt AM, Gillet C,

Ellis P, Ryder K, Reid JF et al: Predicting prognosis using molecular profiling

162

in estrogen receptor-positive breast cancer treated with tamoxifen. BMC

genomics 2008, 9:239-2164-2169-2239.

200. Mantel N: Evaluation of survival data and two new rank order statistics arising

in its consideration. Cancer chemotherapy reportsPart 1 1966, 50(3):163-170.

201. Radojicic J, Zaravinos A, Vrekoussis T, Kafousi M, Spandidos DA, Stathopoulos

EN: MicroRNA expression analysis in triple-negative (ER, PR and Her2/neu)

breast cancer. Cell cycle (Georgetown, Tex) 2011, 10(3):507-517.

202. Savad S, Mehdipour P, Miryounesi M, Shirkoohi R, Fereidooni F, Mansouri F,

Modarressi MH: Expression analysis of MiR-21, MiR-205, and MiR-342 in

breast cancer in Iran. Asian Pacific journal of cancer prevention : APJCP 2012,

13(3):873-877.

203. Lehmann BD, Bauer JA, Chen X, Sanders ME, Chakravarthy AB, Shyr Y,

Pietenpol JA: Identification of human triple-negative breast cancer subtypes

and preclinical models for selection of targeted therapies. The Journal of

clinical investigation 2011, 121(7):2750-2767.

204. Hulf T, Sibbritt T, Wiklund ED, Patterson K, Song JZ, Stirzaker C, Qu W, Nair S,

Horvath LG, Armstrong NJ et al: Epigenetic-induced repression of microRNA-

205 is associated with MED1 activation and a poorer prognosis in localized

prostate cancer. Oncogene 2013, 32(23):2891-2899.

205. Lange SS, Vasquez KM: HMGB1: the jack-of-all-trades protein is a master

DNA repair mechanic. Molecular carcinogenesis 2009, 48(7):571-580.

163

206. Grosschedl R, Giese K, Pagel J: HMG domain proteins: architectural elements

in the assembly of nucleoprotein structures. Trends in genetics : TIG 1994,

10(3):94-100.

207. Ellerman JE, Brown CK, de Vera M, Zeh HJ, Billiar T, Rubartelli A, Lotze MT:

Masquerader: high mobility group box-1 and cancer. Clinical cancer research

: an official journal of the American Association for Cancer Research 2007,

13(10):2836-2848.

208. Nemeth MJ, Curtis DJ, Kirby MR, Garrett-Beal LJ, Seidel NE, Cline AP, Bodine

DM: Hmgb3: an HMG-box family member expressed in primitive

hematopoietic cells that inhibits myeloid and B-cell differentiation. Blood 2003,

102(4):1298-1306.

209. Maciotta S, Meregalli M, Cassinelli L, Parolini D, Farini A, Fraro GD, Gandolfi F,

Forcato M, Ferrari S, Gabellini D et al: Hmgb3 is regulated by microRNA-206

during muscle regeneration. PloS one 2012, 7(8):e43464.

210. Ben-Porath I, Thomson MW, Carey VJ, Ge R, Bell GW, Regev A, Weinberg RA:

An embryonic stem cell-like gene expression signature in poorly differentiated

aggressive human tumors. Nature genetics 2008, 40(5):499-507.

211. Jennings RE, Berry AA, Strutt JP, Gerrard DT, Hanley NA: Human pancreas

development. Development 2015, 142(18):3126-3137.

212. Longnecker D: Anatomy and Histology of the Pancrea. The Pancreapedia:

Exocrine Pancreas Knowledge Base 2014, DOI: 10.3998/panc.2014.3.

164

213. MacDonald RJ, Swift GH, Real FX: Transcriptional control of acinar

development and homeostasis. Prog Mol Biol Transl Sci 2010, 97:1-40.

214. Gittes GK: Developmental biology of the pancreas: a comprehensive review.

Dev Biol 2009, 326(1):4-35.

215. Reichert M, Blume K, Kleger A, Hartmann D, von Figura G: Developmental

Pathways Direct Pancreatic Cancer Initiation from Its Cellular Origin. Stem

Cells Int 2016, 2016:9298535.

216. Gu G, Dubauskaite J, Melton DA: Direct evidence for the pancreatic lineage:

NGN3+ cells are islet progenitors and are distinct from duct progenitors.

Development 2002, 129(10):2447-2457.

217. Pan FC, Wright C: Pancreas organogenesis: from bud to plexus to gland. Dev

Dyn 2011, 240(3):530-565.

218. Kawaguchi Y, Cooper B, Gannon M, Ray M, MacDonald RJ, Wright CV: The role

of the transcriptional regulator Ptf1a in converting intestinal to pancreatic

progenitors. Nat Genet 2002, 32(1):128-134.

219. Gao T, McKenna B, Li C, Reichert M, Nguyen J, Singh T, Yang C, Pannikar A,

Doliba N, Zhang T et al: Pdx1 maintains β cell identity and function by

repressing an α cell program. Cell Metab 2014, 19(2):259-271.

220. Masui T, Swift GH, Hale MA, Meredith DM, Johnson JE, Macdonald RJ:

Transcriptional autoregulation controls pancreatic Ptf1a expression during

development and adulthood. Mol Cell Biol 2008, 28(17):5458-5468.

165

221. Dong PD, Provost E, Leach SD, Stainier DY: Graded levels of Ptf1a differentially

regulate endocrine and exocrine fates in the developing pancreas. Genes Dev

2008, 22(11):1445-1450.

222. Parsa I, Longnecker DS, Scarpelli DG, Pour P, Reddy JK, Lefkowitz M: Ductal

metaplasia of human exocrine pancreas and its association with carcinoma.

Cancer Res 1985, 45(3):1285-1290.

223. Wagner M, Lührs H, Klöppel G, Adler G, Schmid RM: Malignant transformation

of duct-like cells originating from acini in transforming growth factor

transgenic mice. Gastroenterology 1998, 115(5):1254-1262.

224. Hruban RH, Adsay NV, Albores-Saavedra J, Anver MR, Biankin AV, Boivin GP,

Furth EE, Furukawa T, Klein A, Klimstra DS et al: Pathology of genetically

engineered mouse models of pancreatic exocrine cancer: consensus report and

recommendations. Cancer research 2006, 66(1):95-106.

225. Means AL, Meszoely IM, Suzuki K, Miyamoto Y, Rustgi AK, Coffey RJ, Jr.,

Wright CV, Stoffers DA, Leach SD: Pancreatic epithelial plasticity mediated by

acinar cell transdifferentiation and generation of nestin-positive

intermediates. Development (Cambridge, England) 2005, 132(16):3767-3776.

226. Sandgren EP, Luetteke NC, Palmiter RD, Brinster RL, Lee DC: Overexpression

of TGF alpha in transgenic mice: induction of epithelial hyperplasia,

pancreatic metaplasia, and carcinoma of the breast. Cell 1990, 61(6):1121-

1135.

166

227. Jhappan C, Stahle C, Harkins RN, Fausto N, Smith GH, Merlino GT: TGF alpha

overexpression in transgenic mice induces liver neoplasia and abnormal

development of the mammary gland and pancreas. Cell 1990, 61(6):1137-1146.

228. Westphalen CB, Olive KP: Genetically engineered mouse models of pancreatic

cancer. Cancer journal (Sudbury, Mass) 2012, 18(6):502-510.

229. Kopp JL, von Figura G, Mayes E, Liu FF, Dubois CL, Morris JP, Pan FC, Akiyama

H, Wright CV, Jensen K et al: Identification of Sox9-dependent acinar-to-ductal

reprogramming as the principal mechanism for initiation of pancreatic ductal

adenocarcinoma. Cancer Cell 2012, 22(6):737-750.

230. De La OJP, Emerson LL, Goodman JL, Froebe SC, Illum BE, Curtis AB, Murtaugh

LC: Notch and Kras reprogram pancreatic acinar cells to ductal intraepithelial

neoplasia. Proceedings of the National Academy of Sciences of the United States

of America 2008, 105(48):18907-18912.

231. Habbe N, Shi G, Meguid RA, Fendrich V, Esni F, Chen H, Feldmann G, Stoffers

DA, Konieczny SF, Leach SD et al: Spontaneous induction of murine pancreatic

intraepithelial neoplasia (mPanIN) by acinar cell targeting of oncogenic Kras

in adult mice. Proceedings of the National Academy of Sciences of the United

States of America 2008, 105(48):18913-18918.

232. Guerra C, Schuhmacher AJ, Canamero M, Grippo PJ, Verdaguer L, Perez-Gallego

L, Dubus P, Sandgren EP, Barbacid M: Chronic pancreatitis is essential for

induction of pancreatic ductal adenocarcinoma by K-Ras oncogenes in adult

mice. Cancer cell 2007, 11(3):291-302.

167

233. Liou GY, Doppler H, Braun UB, Panayiotou R, Scotti Buzhardt M, Radisky DC,

Crawford HC, Fields AP, Murray NR, Wang QJ et al: Protein kinase D1 drives

pancreatic acinar cell reprogramming and progression to intraepithelial

neoplasia. Nature communications 2015, 6:6200.

234. Elsässer HP, Adler G, Kern HF: Time course and cellular source of pancreatic

regeneration following acute pancreatitis in the rat. Pancreas 1986, 1(5):421-

429.

235. Willemer S, Elsässer HP, Kern HF, Adler G: Tubular complexes in cerulein- and

oleic acid-induced pancreatitis in rats: glycoconjugate pattern,

immunocytochemical, and ultrastructural findings. Pancreas 1987, 2(6):669-

675.

236. Fendrich V, Esni F, Garay MV, Feldmann G, Habbe N, Jensen JN, Dor Y, Stoffers

D, Jensen J, Leach SD et al: Hedgehog signaling is required for effective

regeneration of exocrine pancreas. Gastroenterology 2008, 135(2):621-631.

237. Brembeck FH, Schreiber FS, Deramaudt TB, Craig L, Rhoades B, Swain G, Grippo

P, Stoffers DA, Silberg DG, Rustgi AK: The mutant K-ras oncogene causes

pancreatic periductal lymphocytic infiltration and gastric mucous neck cell

hyperplasia in transgenic mice. Cancer research 2003, 63(9):2005-2009.

238. Tuveson DA, Zhu L, Gopinathan A, Willis NA, Kachatrian L, Grochow R, Pin CL,

Mitin NY, Taparowsky EJ, Gimotty PA et al: Mist1-KrasG12D knock-in mice

develop mixed differentiation metastatic exocrine pancreatic carcinoma and

hepatocellular carcinoma. Cancer research 2006, 66(1):242-247.

168

239. Ji B, Tsou L, Wang H, Gaiser S, Chang DZ, Daniluk J, Bi Y, Grote T, Longnecker

DS, Logsdon CD: Ras activity levels control the development of pancreatic

diseases. Gastroenterology 2009, 137(3):1072-1082, 1082.e1071-1076.

240. Grippo PJ, Nowlin PS, Demeure MJ, Longnecker DS, Sandgren EP: Preinvasive

pancreatic neoplasia of ductal phenotype induced by acinar cell targeting of

mutant Kras in transgenic mice. Cancer research 2003, 63(9):2016-2019.

241. Jensen JN, Cameron E, Garay MV, Starkey TW, Gianani R, Jensen J:

Recapitulation of elements of embryonic development in adult mouse

pancreatic regeneration. Gastroenterology 2005, 128(3):728-741.

242. Morris JP, Cano DA, Sekine S, Wang SC, Hebrok M: Beta-catenin blocks Kras-

dependent reprogramming of acini into pancreatic cancer precursor lesions in

mice. J Clin Invest 2010, 120(2):508-520.

243. Ray KC, Bell KM, Yan J, Gu G, Chung CH, Washington MK, Means AL:

Epithelial tissues have varying degrees of susceptibility to Kras(G12D)-

initiated tumorigenesis in a mouse model. PLoS One 2011, 6(2):e16786.

244. Krah NM, De La O JP, Swift GH, Hoang CQ, Willet SG, Chen Pan F, Cash GM,

Bronner MP, Wright CV, MacDonald RJ et al: The acinar differentiation

determinant PTF1A inhibits initiation of pancreatic ductal adenocarcinoma.

Elife 2015, 4.

245. Chong JA, Tapia-Ramírez J, Kim S, Toledo-Aral JJ, Zheng Y, Boutros MC,

Altshuller YM, Frohman MA, Kraner SD, Mandel G: REST: a mammalian

169

silencer protein that restricts sodium channel gene expression to neurons. Cell

1995, 80(6):949-957.

246. Schoenherr CJ, Anderson DJ: The neuron-restrictive silencer factor (NRSF): a

coordinate repressor of multiple neuron-specific genes. Science 1995,

267(5202):1360-1363.

247. Scholl T, Stevens MB, Mahanta S, Strominger JL: A zinc finger protein that

represses transcription of the human MHC class II gene, DPA. J Immunol 1996,

156(4):1448-1457.

248. Schoenherr CJ, Anderson DJ: Silencing is golden: negative regulation in the

control of neuronal gene transcription. Curr Opin Neurobiol 1995, 5(5):566-571.

249. Roopra A, Qazi R, Schoenike B, Daley TJ, Morrison JF: Localized domains of

G9a-mediated histone methylation are required for silencing of neuronal

genes. Mol Cell 2004, 14(6):727-738.

250. Schoenherr CJ, Paquette AJ, Anderson DJ: Identification of potential target

genes for the neuron-restrictive silencer factor. Proc Natl Acad Sci U S A 1996,

93(18):9881-9886.

251. Valouev A, Johnson DS, Sundquist A, Medina C, Anton E, Batzoglou S, Myers

RM, Sidow A: Genome-wide analysis of transcription factor binding sites

based on ChIP-Seq data. Nat Methods 2008, 5(9):829-834.

252. Tapia-Ramírez J, Eggen BJ, Peral-Rubio MJ, Toledo-Aral JJ, Mandel G: A single

zinc finger motif in the silencing factor REST represses the neural-specific

170

type II sodium channel promoter. Proc Natl Acad Sci U S A 1997, 94(4):1177-

1182.

253. Andrés ME, Burger C, Peral-Rubio MJ, Battaglioli E, Anderson ME, Grimes J,

Dallman J, Ballas N, Mandel G: CoREST: a functional corepressor required for

regulation of neural-specific gene expression. Proc Natl Acad Sci U S A 1999,

96(17):9873-9878.

254. Lunyak VV, Burgess R, Prefontaine GG, Nelson C, Sze SH, Chenoweth J,

Schwartz P, Pevzner PA, Glass C, Mandel G et al: Corepressor-dependent

silencing of chromosomal regions encoding neuronal genes. Science 2002,

298(5599):1747-1752.

255. Shi Y, Sawada J, Sui G, Affar eB, Whetstine JR, Lan F, Ogawa H, Luke MP,

Nakatani Y: Coordinated histone modifications mediated by a CtBP co-

repressor complex. Nature 2003, 422(6933):735-738.

256. Ballas N, Battaglioli E, Atouf F, Andres ME, Chenoweth J, Anderson ME, Burger

C, Moniwa M, Davie JR, Bowers WJ et al: Regulation of neuronal traits by a

novel transcriptional complex. Neuron 2001, 31(3):353-365.

257. Huang Y, Myers SJ, Dingledine R: Transcriptional repression by REST:

recruitment of Sin3A and histone deacetylase to neuronal genes. Nat Neurosci

1999, 2(10):867-872.

258. Grimes JA, Nielsen SJ, Battaglioli E, Miska EA, Speh JC, Berry DL, Atouf F,

Holdener BC, Mandel G, Kouzarides T: The co-repressor mSin3A is a functional

171

component of the REST-CoREST repressor complex. J Biol Chem 2000,

275(13):9461-9467.

259. Roopra A, Sharling L, Wood IC, Briggs T, Bachfischer U, Paquette AJ, Buckley

NJ: Transcriptional repression by neuron-restrictive silencer factor is

mediated via the Sin3-histone deacetylase complex. Mol Cell Biol 2000,

20(6):2147-2157.

260. Abrajano JJ, Qureshi IA, Gokhan S, Zheng D, Bergman A, Mehler MF: REST and

CoREST modulate neuronal subtype specification, maturation and

maintenance. PLoS One 2009, 4(12):e7936.

261. Palm K, Metsis M, Timmusk T: Neuron-specific splicing of zinc finger

transcription factor REST/NRSF/XBR is frequent in neuroblastomas and

conserved in human, mouse and rat. Brain Res Mol Brain Res 1999, 72(1):30-

39.

262. Palm K, Belluardo N, Metsis M, Timmusk T: Neuronal expression of zinc finger

transcription factor REST/NRSF/XBR gene. J Neurosci 1998, 18(4):1280-1296.

263. Ooi L, Wood IC: Chromatin crosstalk in development and disease: lessons from

REST. Nat Rev Genet 2007, 8(7):544-554.

264. Ballas N, Mandel G: The many faces of REST oversee epigenetic programming

of neuronal genes. Curr Opin Neurobiol 2005, 15(5):500-506.

265. Song Z, Zhao D, Zhao H, Yang L: NRSF: an angel or a devil in neurogenesis

and neurological diseases. J Mol Neurosci 2015, 56(1):131-144.

172

266. Kamal MM, Sathyan P, Singh SK, Zinn PO, Marisetty AL, Liang S, Gumin J, El-

Mesallamy HO, Suki D, Colman H et al: REST regulates oncogenic properties

of glioblastoma stem cells. Stem Cells 2012, 30(3):405-414.

267. Singh A, Rokes C, Gireud M, Fletcher S, Baumgartner J, Fuller G, Stewart J, Zage

P, Gopalakrishnan V: Retinoic acid induces REST degradation and neuronal

differentiation by modulating the expression of SCF(β-TRCP) in

neuroblastoma cells. Cancer 2011, 117(22):5189-5202.

268. Fuller GN, Su X, Price RE, Cohen ZR, Lang FF, Sawaya R, Majumder S: Many

human medulloblastoma tumors overexpress repressor element-1 silencing

transcription (REST)/neuron-restrictive silencer factor, which can be

functionally countered by REST-VP16. Mol Cancer Ther 2005, 4(3):343-349.

269. Tomasoni R, Negrini S, Fiordaliso S, Klajn A, Tkatch T, Mondino A, Meldolesi J,

D'Alessandro R: A signaling loop of REST, TSC2 and β-catenin governs

proliferation and function of PC12 neural cells. J Cell Sci 2011, 124(Pt

18):3174-3186.

270. Hatano Y, Yamada Y, Hata K, Phutthaphadoong S, Aoki H, Hara A: Genetic

ablation of a candidate tumor suppressor gene, Rest, does not promote mouse

colon carcinogenesis. Cancer Sci 2011, 102(9):1659-1664.

271. Lv H, Pan G, Zheng G, Wu X, Ren H, Liu Y, Wen J: Expression and functions of

the repressor element 1 (RE-1)-silencing transcription factor (REST) in breast

cancer. J Cell Biochem 2010, 110(4):968-974.

173

272. Coulson JM, Edgson JL, Woll PJ, Quinn JP: A splice variant of the neuron-

restrictive silencer factor repressor is expressed in small cell lung cancer: a

potential role in derepression of neuroendocrine genes and a useful clinical

marker. Cancer Res 2000, 60(7):1840-1844.

273. Kreisler A, Strissel PL, Strick R, Neumann SB, Schumacher U, Becker CM:

Regulation of the NRSF/REST gene by methylation and CREB affects the

cellular phenotype of small-cell lung cancer. Oncogene 2010, 29(43):5828-5838.

274. Thiel G, Ekici M, Rössler OG: RE-1 silencing transcription factor (REST): a

regulator of neuronal development and neuronal/endocrine function. Cell

Tissue Res 2015, 359(1):99-109.

275. Negrini S, Prada I, D'Alessandro R, Meldolesi J: REST: an oncogene or a tumor

suppressor? Trends Cell Biol 2013, 23(6):289-295.

276. Bruce AW, Donaldson IJ, Wood IC, Yerbury SA, Sadowski MI, Chapman M,

Göttgens B, Buckley NJ: Genome-wide analysis of repressor element 1 silencing

transcription factor/neuron-restrictive silencing factor (REST/NRSF) target

genes. Proc Natl Acad Sci U S A 2004, 101(28):10458-10463.

277. Johnson DS, Mortazavi A, Myers RM, Wold B: Genome-wide mapping of in vivo

protein-DNA interactions. Science 2007, 316(5830):1497-1502.

278. Bruce AW, López-Contreras AJ, Flicek P, Down TA, Dhami P, Dillon SC, Koch

CM, Langford CF, Dunham I, Andrews RM et al: Functional diversity for REST

(NRSF) is defined by in vivo binding affinity hierarchies at the DNA sequence

level. Genome Res 2009, 19(6):994-1005.

174

279. Otto SJ, McCorkle SR, Hover J, Conaco C, Han JJ, Impey S, Yochum GS, Dunn

JJ, Goodman RH, Mandel G: A new binding motif for the transcriptional

repressor REST uncovers large gene networks devoted to neuronal functions.

J Neurosci 2007, 27(25):6729-6739.

280. Belyaev ND, Wood IC, Bruce AW, Street M, Trinh JB, Buckley NJ: Distinct RE-

1 silencing transcription factor-containing complexes interact with different

target genes. J Biol Chem 2004, 279(1):556-561.

281. Liu Z, Liu M, Niu G, Cheng Y, Fei J: Genome-wide identification of target genes

repressed by the zinc finger transcription factor REST/NRSF in the HEK 293

cell line. Acta Biochim Biophys Sin (Shanghai) 2009, 41(12):1008-1017.

282. Atouf F, Czernichow P, Scharfmann R: Expression of neuronal traits in

pancreatic beta cells. Implication of neuron-restrictive silencing

factor/repressor element silencing transcription factor, a neuron-restrictive

silencer. J Biol Chem 1997, 272(3):1929-1934.

283. Kemp DM, Lin JC, Habener JF: Regulation of Pax4 paired homeodomain gene

by neuron-restrictive silencer factor. J Biol Chem 2003, 278(37):35057-35062.

284. Mortazavi A, Leeper Thompson EC, Garcia ST, Myers RM, Wold B: Comparative

genomics modeling of the NRSF/REST repressor network: from single

conserved sites to genome-wide repertoire. Genome research 2006, 16(10):1208-

1221.

285. Li B, Wang S, Liu H, Liu D, Zhang J, Zhang B, Yao H, Lv Y, Wang R, Chen L et

al: Neuronal restrictive silencing factor silencing induces human amniotic

175

fluid-derived stem cells differentiation into insulin-producing cells. Stem Cells

Dev 2011, 20(7):1223-1231.

286. Li HT, Jiang FX, Shi P, Zhang T, Liu XY, Lin XW, Pang XN: In vitro

reprogramming of rat bone marrow-derived mesenchymal stem cells into

insulin-producing cells by genetically manipulating negative and positive

regulators. Biochem Biophys Res Commun 2012, 420(4):793-798.

287. Martin D, Kim YH, Sever D, Mao CA, Haefliger JA, Grapin-Botton A: REST

represses a subset of the pancreatic endocrine differentiation program. Dev

Biol 2015, 405(2):316-327.

288. van Arensbergen J, García-Hurtado J, Moran I, Maestro MA, Xu X, Van de

Casteele M, Skoudy AL, Palassini M, Heimberg H, Ferrer J: Derepression of

Polycomb targets during pancreatic organogenesis allows insulin-producing

beta-cells to adopt a neural gene activity program. Genome Res 2010,

20(6):722-732.

289. Gout J, Pommier RM, Vincent DF, Kaniewski B, Martel S, Valcourt U, Bartholin

L: Isolation and culture of mouse primary pancreatic acinar cells. Journal of

visualized experiments : JoVE 2013, (78). doi(78):10.3791/50514.

290. Sawey ET, Johnson JA, Crawford HC: Matrix metalloproteinase 7 controls

pancreatic acinar cell transdifferentiation by activating the Notch signaling

pathway. Proceedings of the National Academy of Sciences of the United States of

America 2007, 104(49):19327-19332.

176

291. Azevedo-Pouly AC: Biological functions of microRNA-216 and microRNA-217

during the development of pancreatic cancer. Electronic Thesis or Dissertation

Ohio State University 2013.

292. Zhang Y, Morris JP, Yan W, Schofield HK, Gurney A, Simeone DM, Millar SE,

Hoey T, Hebrok M, Pasca di Magliano M: Canonical wnt signaling is required

for pancreatic carcinogenesis. Cancer Res 2013, 73(15):4909-4922.

293. Pinto MP, Jacobsen BM, Horwitz KB: An immunohistochemical method to

study breast cancer cell subpopulations and their growth regulation by

hormones in three-dimensional cultures. Frontiers in endocrinology 2011, 2:15.

294. Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA,

Paulovich A, Pomeroy SL, Golub TR, Lander ES et al: Gene set enrichment

analysis: a knowledge-based approach for interpreting genome-wide

expression profiles. Proc Natl Acad Sci U S A 2005, 102(43):15545-15550.

295. Szafranska AE, Doleshal M, Edmunds HS, Gordon S, Luttges J, Munding JB, Barth

RJ, Jr., Gutmann EJ, Suriawinata AA, Marc Pipas J et al: Analysis of microRNAs

in pancreatic fine-needle aspirates can classify benign and malignant tissues.

Clinical chemistry 2008, 54(10):1716-1724.

296. Ali S, Banerjee S, Logna F, Bao B, Philip PA, Korc M, Sarkar FH: Inactivation of

Ink4a/Arf leads to deregulated expression of miRNAs in K-Ras transgenic

mouse model of pancreatic cancer. J Cell Physiol 2012, 227(10):3373-3380.

297. Rachagani S, Macha MA, Menning MS, Dey P, Pai P, Smith LM, Mo YY, Batra

SK: Changes in microRNA (miRNA) expression during pancreatic cancer

177

development and progression in a genetically engineered KrasG12D;Pdx1-Cre

mouse (KC) model. Oncotarget 2015, 6(37):40295-40309.

298. Wienholds E, Kloosterman WP, Miska E, Alvarez-Saavedra E, Berezikov E, de

Bruijn E, Horvitz HR, Kauppinen S, Plasterk RH: MicroRNA expression in

zebrafish embryonic development. Science 2005, 309(5732):310-311.

299. Deng M, Tang H, Zhou Y, Zhou M, Xiong W, Zheng Y, Ye Q, Zeng X, Liao Q,

Guo X et al: miR-216b suppresses tumor growth and invasion by targeting

KRAS in nasopharyngeal carcinoma. Journal of cell science 2011, 124(Pt

17):2997-3005.

300. Harris DM, Flannigan KL, Go VL, Wu SV: Regulation of cholecystokinin-

mediated amylase secretion by leptin in rat pancreatic acinar tumor cell line

AR42J. Pancreas 1999, 19(3):224-230.

301. Arias AE, Bendayan M: Differentiation of pancreatic acinar cells into duct-like

cells in vitro. Lab Invest 1993, 69(5):518-530.

302. Benitz S, Regel I, Reinhard T, Popp A, Schäffer I, Raulefs S, Kong B, Esposito I,

Michalski CW, Kleeff J: Polycomb repressor complex 1 promotes gene silencing

through H2AK119 mono-ubiquitination in acinar-to-ductal metaplasia and

pancreatic cancer cells. Oncotarget 2015.

303. Roy N, Hebrok M: Regulation of Cellular Identity in Cancer. Dev Cell 2015,

35(6):674-684.

304. Shih HP, Wang A, Sander M: Pancreas organogenesis: from lineage

determination to morphogenesis. Annu Rev Cell Dev Biol 2013, 29:81-105.

178

305. Holmstrom SR, Deering T, Swift GH, Poelwijk FJ, Mangelsdorf DJ, Kliewer SA,

MacDonald RJ: LRH-1 and PTF1-L coregulate an exocrine pancreas-specific

transcriptional network for digestive function. Genes Dev 2011, 25(16):1674-

1679.

306. Masui T, Long Q, Beres TM, Magnuson MA, MacDonald RJ: Early pancreatic

development requires the vertebrate Suppressor of Hairless (RBPJ) in the

PTF1 bHLH complex. Genes Dev 2007, 21(20):2629-2643.

307. Krapp A, Knöfler M, Frutiger S, Hughes GJ, Hagenbüchle O, Wellauer PK: The

p48 DNA-binding subunit of transcription factor PTF1 is a new exocrine

pancreas-specific basic helix-loop-helix protein. EMBO J 1996, 15(16):4317-

4329.

308. Rose SD, Swift GH, Peyton MJ, Hammer RE, MacDonald RJ: The role of PTF1-

P48 in pancreatic acinar gene expression. J Biol Chem 2001, 276(47):44018-

44026.

309. Zhou Q, Law AC, Rajagopal J, Anderson WJ, Gray PA, Melton DA: A multipotent

progenitor domain guides pancreatic organogenesis. Dev Cell 2007, 13(1):103-

114.

310. Delaspre F, Massumi M, Salido M, Soria B, Ravassard P, Savatier P, Skoudy A:

Directed pancreatic acinar differentiation of mouse embryonic stem cells via

embryonic signalling molecules and exocrine transcription factors. PLoS One

2013, 8(1):e54243.

179

311. Masui T, Swift GH, Deering T, Shen C, Coats WS, Long Q, Elsässer HP, Magnuson

MA, MacDonald RJ: Replacement of Rbpj with Rbpjl in the PTF1 complex

controls the final maturation of pancreatic acinar cells. Gastroenterology 2010,

139(1):270-280.

312. Benod C, Vinogradova MV, Jouravel N, Kim GE, Fletterick RJ, Sablin EP:

Nuclear receptor liver receptor homologue 1 (LRH-1) regulates pancreatic

cancer cell growth and proliferation. Proc Natl Acad Sci U S A 2011,

108(41):16927-16931.

313. Botrugno OA, Fayard E, Annicotte JS, Haby C, Brennan T, Wendling O, Tanaka

T, Kodama T, Thomas W, Auwerx J et al: Synergy between LRH-1 and beta-

catenin induces G1 cyclin-mediated cell proliferation. Mol Cell 2004,

15(4):499-509.

314. Hess DA, Humphrey SE, Ishibashi J, Damsz B, Lee AH, Glimcher LH, Konieczny

SF: Extensive pancreas regeneration following acinar-specific disruption of

Xbp1 in mice. Gastroenterology 2011, 141(4):1463-1472.

315. von Figura G, Morris JP, Wright CV, Hebrok M: Nr5a2 maintains acinar cell

differentiation and constrains oncogenic Kras-mediated pancreatic neoplastic

initiation. Gut 2014, 63(4):656-664.

316. Hale MA, Swift GH, Hoang CQ, Deering TG, Masui T, Lee YK, Xue J, MacDonald

RJ: The nuclear hormone receptor family member NR5A2 controls aspects of

multipotent progenitor cell formation and acinar differentiation during

pancreatic organogenesis. Development 2014, 141(16):3123-3133.

180

317. Ketola I, Otonkoski T, Pulkkinen MA, Niemi H, Palgi J, Jacobsen CM, Wilson DB,

Heikinheimo M: Transcription factor GATA-6 is expressed in the endocrine

and GATA-4 in the exocrine pancreas. Mol Cell Endocrinol 2004, 226(1-2):51-

57.

318. Xuan S, Borok MJ, Decker KJ, Battle MA, Duncan SA, Hale MA, Macdonald RJ,

Sussel L: Pancreas-specific deletion of mouse Gata4 and Gata6 causes

pancreatic agenesis. J Clin Invest 2012, 122(10):3516-3528.

319. Johnson R, Teh CH, Kunarso G, Wong KY, Srinivasan G, Cooper ML, Volta M,

Chan SS, Lipovich L, Pollard SM et al: REST regulates distinct transcriptional

networks in embryonic and neural stem cells. PLoS Biol 2008, 6(10):e256.

320. Kopp JL, Dubois CL, Hao E, Thorel F, Herrera PL, Sander M: Progenitor cell

domains in the developing and adult pancreas. Cell Cycle 2011, 10(12):1921-

1927.

321. Wauters E, Sanchez-Arévalo Lobo VJ, Pinho AV, Mawson A, Herranz D, Wu J,

Cowley MJ, Colvin EK, Njicop EN, Sutherland RL et al: Sirtuin-1 regulates

acinar-to-ductal metaplasia and supports cancer cell viability in pancreatic

cancer. Cancer Res 2013, 73(7):2357-2367.

322. Furukawa T, Duguid WP, Rosenberg L, Viallet J, Galloway DA, Tsao MS: Long-

term culture and immortalization of epithelial cells from normal adult human

pancreatic ducts transfected by the E6E7 gene of human papilloma virus 16.

The American journal of pathology 1996, 148(6):1763-1770.

181

323. Lee KM, Nguyen C, Ulrich AB, Pour PM, Ouellette MM: Immortalization with

telomerase of the Nestin-positive cells of the human pancreas. Biochemical and

biophysical research communications 2003, 301(4):1038-1044.

324. Lee KM, Choi KH, Ouellette MM: Use of exogenous hTERT to immortalize

primary human cells. Cytotechnology 2004, 45(1-2):33-38.

325. Ouyang H, Mou L, Luk C, Liu N, Karaskova J, Squire J, Tsao MS: Immortal

human pancreatic duct epithelial cell lines with near normal genotype and

phenotype. The American journal of pathology 2000, 157(5):1623-1631.

326. Deer EL, Gonzalez-Hernandez J, Coursen JD, Shea JE, Ngatia J, Scaife CL, Firpo

MA, Mulvihill SJ: Phenotype and genotype of pancreatic cancer cell lines.

Pancreas 2010, 39(4):425-435.

327. Elsasser HP, Lehr U, Agricola B, Kern HF: Establishment and characterisation

of two cell lines with different grade of differentiation derived from one

primary human pancreatic adenocarcinoma. Virchows ArchivB, Cell pathology

including molecular pathology 1992, 61(5):295-306.

328. Charbord J, Poydenot P, Bonnefond C, Feyeux M, Casagrande F, Brinon B,

Francelle L, Aurégan G, Guillermier M, Cailleret M et al: High throughput

screening for inhibitors of REST in neural derivatives of human embryonic

stem cells reveals a chemical compound that promotes expression of neuronal

genes. Stem Cells 2013, 31(9):1816-1828.

182

329. Minami K, Uehara T, Morikawa Y, Omura K, Kanki M, Horinouchi A, Ono A,

Yamada H, Ohno Y, Urushidani T: miRNA expression atlas in male rat. 2013,

Scientific Data 1(Article number 140005).

330. Azevedo-Pouly AC, Jiang J, Sutaria D, Schmittgen TD: Regulation of

NRSF/REST by miR-217; Implications during pancreatic acinar ductal trans-

differentiation. AACR 104th Annual Meeting 2013 2013.

331. Bartsch DK, Gress TM, Langer P: Familial pancreatic cancer--current

knowledge. Nat Rev Gastroenterol Hepatol 2012, 9(8):445-453.

332. Becker AE, Hernandez YG, Frucht H, Lucas AL: Pancreatic ductal

adenocarcinoma: risk factors, screening, and early detection. World journal of

gastroenterology : WJG 2014, 20(32):11182-11198.

333. Alvarez-Erviti L, Seow Y, Yin H, Betts C, Lakhal S, Wood MJ: Delivery of siRNA

to the mouse brain by systemic injection of targeted exosomes. Nature

biotechnology 2011, 29(4):341-345.

334. Raposo G, Stoorvogel W: Extracellular vesicles: exosomes, microvesicles, and

friends. J Cell Biol 2013, 200(4):373-383.

335. Valadi H, Ekstrom K, Bossios A, Sjostrand M, Lee JJ, Lotvall JO: Exosome-

mediated transfer of mRNAs and microRNAs is a novel mechanism of genetic

exchange between cells. Nature cell biology 2007, 9(6):654-659.

336. Ratajczak J, Miekus K, Kucia M, Zhang J, Reca R, Dvorak P, Ratajczak MZ:

Embryonic stem cell-derived microvesicles reprogram hematopoietic

183

progenitors: evidence for horizontal transfer of mRNA and protein delivery.

Leukemia 2006, 20(5):847-856.

337. Gyorgy B, Hung ME, Breakefield XO, Leonard JN: Therapeutic applications of

extracellular vesicles: clinical promise and open questions. Annu Rev

Pharmacol Toxicol 2015, 55:439-464.

338. Colombo M, Raposo G, Thery C: Biogenesis, secretion, and intercellular

interactions of exosomes and other extracellular vesicles. Annu Rev Cell Dev

Biol 2014, 30:255-289.

339. Johnstone RM, Adam M, Hammond JR, Orr L, Turbide C: Vesicle formation

during reticulocyte maturation. Association of plasma membrane activities

with released vesicles (exosomes). J Biol Chem 1987, 262(19):9412-9420.

340. Mulcahy LA, Pink RC, Carter DR: Routes and mechanisms of extracellular

vesicle uptake. J Extracell Vesicles 2014, 3.

341. Wahlgren J, De L Karlson T, Brisslert M, Vaziri Sani F, Telemo E, Sunnerhagen

P, Valadi H: Plasma exosomes can deliver exogenous short interfering RNA to

monocytes and lymphocytes. Nucleic acids research 2012, 40(17):e130.

342. Morse MA, Garst J, Osada T, Khan S, Hobeika A, Clay TM, Valente N, Shreeniwas

R, Sutton MA, Delcayre A et al: A phase I study of dexosome immunotherapy

in patients with advanced non-small cell lung cancer. Journal of translational

medicine 2005, 3(1):9.

343. Escudier B, Dorval T, Chaput N, Andre F, Caby MP, Novault S, Flament C,

Leboulaire C, Borg C, Amigorena S et al: Vaccination of metastatic melanoma

184

patients with autologous dendritic cell (DC) derived-exosomes: results of

thefirst phase I clinical trial. Journal of translational medicine 2005, 3(1):10.

344. Dai S, Wei D, Wu Z, Zhou X, Wei X, Huang H, Li G: Phase I clinical trial of

autologous ascites-derived exosomes combined with GM-CSF for colorectal

cancer. Molecular therapy : the journal of the American Society of Gene Therapy

2008, 16(4):782-790.

345. Yeo RW, Lai RC, Zhang B, Tan SS, Yin Y, Teh BJ, Lim SK: Mesenchymal stem

cell: an efficient mass producer of exosomes for drug delivery. Adv Drug Deliv

Rev 2013, 65(3):336-341.

346. Durocher Y, Perret S, Kamen A: High-level and high-throughput recombinant

protein production by transient transfection of suspension-growing human

293-EBNA1 cells. Nucleic Acids Res 2002, 30(2):E9.

347. Thery C, Amigorena S, Raposo G, Clayton A: Isolation and characterization of

exosomes from cell culture supernatants and biological fluids. Curr Protoc Cell

Biol 2006, Chapter 3:Unit 3 22.

348. Gao M, Kim YK, Zhang C, Borshch V, Zhou S, Park HS, Jakli A, Lavrentovich

OD, Tamba MG, Kohlmeier A et al: Direct observation of liquid crystals using

cryo-TEM: specimen preparation and low-dose imaging. Microsc Res Tech

2014, 77(10):754-772.

349. Van Deun J, Mestdagh P, Sormunen R, Cocquyt V, Vermaelen K, Vandesompele

J, Bracke M, De Wever O, Hendrix A: The impact of disparate isolation methods

185

for extracellular vesicles on downstream RNA profiling. J Extracell Vesicles

2014, 3.

350. Batrakova EV, Kim MS: Using exosomes, naturally-equipped nanocarriers, for

drug delivery. J Control Release 2015.

351. Tickner JA, Urquhart AJ, Stephenson SA, Richard DJ, O'Byrne KJ: Functions and

therapeutic roles of exosomes in cancer. Front Oncol 2014, 4:127.

352. Sassen S, Miska EA, Caldas C: MicroRNA: implications for cancer. Virchows

Arch 2008, 452(1):1-10.

353. Lewis BP, Burge CB, Bartel DP: Conserved seed pairing, often flanked by

adenosines, indicates that thousands of human genes are microRNA targets.

Cell 2005, 120(1):15-20.

354. Lu J, Getz G, Miska EA, Alvarez-Saavedra E, Lamb J, Peck D, Sweet-Cordero A,

Ebert BL, Mak RH, Ferrando AA et al: MicroRNA expression profiles classify

human cancers. Nature 2005, 435(7043):834-838.

355. Calin GA, Croce CM: MicroRNA signatures in human cancers. Nature

reviewsCancer 2006, 6(11):857-866.

356. Gaur A, Jewell DA, Liang Y, Ridzon D, Moore JH, Chen C, Ambros VR, Israel

MA: Characterization of microRNA expression levels and their biological

correlates in human cancer cell lines. Cancer Res 2007, 67(6):2456-2468.

357. Yang SM, Huang C, Li XF, Yu MZ, He Y, Li J: miR-21 confers cisplatin

resistance in gastric cancer cells by regulating PTEN. Toxicology 2013,

306:162-168.

186

358. Yang CH, Yue J, Pfeffer SR, Fan M, Paulus E, Hosni-Ahmed A, Sims M, Qayyum

S, Davidoff AM, Handorf CR et al: MicroRNA-21 promotes glioblastoma

tumorigenesis by down-regulating insulin-like growth factor-binding protein-

3 (IGFBP3). The Journal of biological chemistry 2014, 289(36):25079-25087.

359. Lan H, Lin CY, Yuan HY, Xiong B: Overexpression of miR-21 promotes

proliferation and reduces apoptosis in non-small cell lung cancer. Zhonghua

zhong liu za zhi [Chinese journal of oncology] 2011, 33(10):742-746.

360. Chen M, Liu Y, Varley P, Chang Y, He XX, Huang H, Tang D, Lotze MT, Lin J,

Tsung A: High-Mobility Group Box 1 Promotes Hepatocellular Carcinoma

Progression through miR-21-Mediated Matrix Metalloproteinase Activity.

Cancer research 2015, 75(8):1645-1656.

361. Sicard F, Gayral M, Lulka H, Buscail L, Cordelier P: Targeting miR-21 for the

therapy of pancreatic cancer. Mol Ther 2013, 21(5):986-994.

362. Zhu S, Wu H, Wu F, Nie D, Sheng S, Mo YY: MicroRNA-21 targets tumor

suppressor genes in invasion and metastasis. Cell research 2008, 18(3):350-359.

363. Gong Y, Cao Y, Song L, Zhou J, Wang C, Wu B: HMGB3 characterization in

gastric cancer. Genet Mol Res 2013, 12(4):6032-6039.

364. Chen X, Zhao G, Wang F, Gao F, Luo H, Wang Y, Du Y, Xue C, Dong Z, Song G:

Upregulation of miR-513b inhibits cell proliferation, migration, and promotes

apoptosis by targeting high mobility group-box 3 protein in gastric cancer.

Tumour Biol 2014, 35(11):11081-11089.

187

365. Li M, Cai Y, Zhao H, Xu Z, Sun Q, Luo M, Gu L, Meng M, Han X, Sun H:

Overexpression of HMGB3 protein promotes cell proliferation, migration and

is associated with poor prognosis in urinary bladder cancer patients. Tumour

Biol 2015, 36(6):4785-4792.

366. Gao J, Zou Z, Zhang H, Lin Z, Zhang Y, Luo X, Liu C, Xie J, Cai C: Increased

expression of HMGB3: a novel independent prognostic marker of worse

outcome in patients with esophageal squamous cell carcinoma. Int J Clin Exp

Pathol 2015, 8(1):345-352.

367. !!! INVALID CITATION !!! .

368. Hezel AF, Kimmelman AC, Stanger BZ, Bardeesy N, Depinho RA: Genetics and

biology of pancreatic ductal adenocarcinoma. Genes Dev 2006, 20(10):1218-

1249.

369. Zhou J, Song S, Cen J, Zhu D, Li D, Zhang Z: MicroRNA-375 is downregulated

in pancreatic cancer and inhibits cell proliferation in vitro. Oncol Res 2012,

20(5-6):197-203.

370. Zhou J, Song S, He S, Zhu X, Zhang Y, Yi B, Zhang B, Qin G, Li D: MicroRNA-

375 targets PDK1 in pancreatic carcinoma and suppresses cell growth through

the Akt signaling pathway. Int J Mol Med 2014, 33(4):950-956.

371. Agarwal V, Bell GW, Nam JW, Bartel DP: Predicting effective microRNA target

sites in mammalian mRNAs. Elife 2015, 4.

372. Sato F, Tsuchiya S, Meltzer SJ, Shimizu K: MicroRNAs and epigenetics. FEBS J

2011, 278(10):1598-1609.

188

373. Cao Q, Mani RS, Ateeq B, Dhanasekaran SM, Asangani IA, Prensner JR, Kim JH,

Brenner JC, Jing X, Cao X et al: Coordinated regulation of polycomb group

complexes through microRNAs in cancer. Cancer Cell 2011, 20(2):187-199.

374. Zhang Y, Wang Z, Gemeinhart RA: Progress in microRNA delivery. Journal of

controlled release : official journal of the Controlled Release Society 2013,

172(3):962-974.

375. Scholz C, Wagner E: Therapeutic plasmid DNA versus siRNA delivery:

common and different tasks for synthetic carriers. Journal of controlled release

: official journal of the Controlled Release Society 2012, 161(2):554-565.

376. Yáñez-Mó M, Siljander PR, Andreu Z, Zavec AB, Borràs FE, Buzas EI, Buzas K,

Casal E, Cappello F, Carvalho J et al: Biological properties of extracellular

vesicles and their physiological functions. J Extracell Vesicles 2015, 4:27066.

377. El Andaloussi S, Mager I, Breakefield XO, Wood MJ: Extracellular vesicles:

biology and emerging therapeutic opportunities. Nature reviewsDrug discovery

2013, 12(5):347-357.

378. Raposo G, Nijman HW, Stoorvogel W, Liejendekker R, Harding CV, Melief CJ,

Geuze HJ: B lymphocytes secrete antigen-presenting vesicles. The Journal of

experimental medicine 1996, 183(3):1161-1172.

379. Zitvogel L, Regnault A, Lozier A, Wolfers J, Flament C, Tenza D, Ricciardi-

Castagnoli P, Raposo G, Amigorena S: Eradication of established murine

tumors using a novel cell-free vaccine: dendritic cell-derived exosomes. Nature

medicine 1998, 4(5):594-600.

189

380. Ohno S, Takanashi M, Sudo K, Ueda S, Ishikawa A, Matsuyama N, Fujita K,

Mizutani T, Ohgi T, Ochiya T et al: Systemically injected exosomes targeted to

EGFR deliver antitumor microRNA to breast cancer cells. Mol Ther 2013,

21(1):185-191.

381. Wiklander OP, Nordin JZ, O'Loughlin A, Gustafsson Y, Corso G, Mäger I, Vader

P, Lee Y, Sork H, Seow Y et al: Extracellular vesicle in vivo biodistribution is

determined by cell source, route of administration and targeting. J Extracell

Vesicles 2015, 4:26316.

190