NF-Κb (P65/Rela) As a Regulator of Tnfα-Mediated ML-1 Cell Differentiation a Mudipalli, Z Li, R Hromchak and a Bloch

Leukemia (2001) 15, 808–813  2001 Nature Publishing Group All rights reserved 0887-6924/01 $15.00 www.nature.com/leu NF-κB (p65/RelA) as a regulator of TNFα-mediated ML-1 cell differentiation A Mudipalli, Z Li, R Hromchak and A Bloch

Department of Molecular Pharmacology and Therapeutics, Roswell Park Cancer Institute, Buffalo, NY 14263, USA

ML-1 human myeloblastic leukemia cells, suspended in serum- ation.13,17–19 In unstimulated cells, NF-κB (Rel A) proteins are depleted medium, proliferate when the insulin-like growth fac- present in the cytoplasm as inactive complexes bound to tor-1 (IGF-1) and transferrin (Tf) are supplied, but differentiate inhibitory IκB proteins.15–20 Several of these, including IκBα, to monocytes when these factors are replaced by the tumor β γ ε κ α necrosis factor-α (TNF-α). Induction of differentiation, but not , , , Bcl-3 and p105 have been fully characterized. I B of proliferation, involved the selective activation of diverse has high affinity for p65 (Rel-A) as well as for p75 (c-Rel), members of the NF-κB family of proteins. In differentiation- preventing the formation of p65 homodimers and of p50/p65, induced cells, NF-κB (p65) was translocated from the cyto- p52/p65 and p75 (c-Rel) heterodimers (21–24). NF-κB activat- κ plasm to the nucleus, whereas NF- B (p75) remained localized ing signals release p65 from its complex with IκB, allowing to the cytoplasm. In contrast, NF-κB (p52) was present in the nuclei of proliferation- as well as of differentiation-induced ML- its translocation to the nucleus. That release is mediated via κ 16,17,20,22–27 1 cells. The differentiation-specific translocation of NF-κB (p65) phosphorylation and degradation of I Bs. from the cytoplasm to the nucleus was mediated by an increase Among the targets for regulation by NF-κB are the tumor in the level of NIK, the NF-κB-inducing kinase which, through suppressor protein p5327,28 and the p53-dependent cyclin phosphorylation of IκB kinase α (Iκkα), causes a decrease in kinase inhibitor p21/Cip1 which, as we reported recently,29 κ α the level of I B , allowing p65 to move from the cytoplasm to function as differentiation-associated inhibitors of PCNA the nucleus. The p52/p65 heterodimer formed in the nucleus, bound specifically to the promoter of the tumor suppressor expression. That inhibition prevents the DNA synthesis protein p53, effecting a 25 to 30-fold increase in the level of required for proliferation-associated G1/S transit, leading to this protein. As we reported previously (Li et al, Cancer Res the uncoupling of growth from differentiation and to the 1998; 58: 4282–4287), that increase led to the decreased expression of the differentiation program. In this communi- expression of proliferating cell nuclear antigen (PCNA) and to cation we report studies on the mechanism by which the p65 the loss of proliferation-associated DNA synthesis. The ensu- (Rel A) and the p52 (NF-κB2) members of the NF-κB family, ing uncoupling of growth from differentiation was followed by the initiation of the monocyte-specific differentiation program. participate in the activation of ML-1 cell differentiation. Leukemia (2001) 15, 808–813. Keywords: NF-κB; p53; PCNA; IGF-1; TNFα; cell proliferation; cell differentiation Materials and methods

Polyclonal antibodies to p65 (Rel A), p75 (c-Rel), p50 (NF- Introduction κB1), p52 (NF-κB2), NIK and IκKα, and monoclonal antibodies to IκBα, were purchased from Santa Cruz Biotechnol- The NF-κB family of proteins has been reported1–12 to partici- ogy (Santa Cruz, CA, USA). Molecular weight standards for pate in the regulation of numerous genes involved in diverse SDS-PAGE were obtained from Bio-Rad Labs (Hercules, CA, cellular activities, including cell growth, cell differentiation, USA). Western blotting reagents and γ-32P ATP were supplied immune regulation and stress response. For implementing by NEN (Boston, MA, USA) and polynucleotide kinase (PNK) these functions, the NF-κB proteins are regulated by diverse by New England Biolabs (Boston, MA, USA). The p53 pro- cytokines, including TNF-α and β, interleukin-1α and β, and moter expression vector 0.7 CAT, was kindly provided by Dr the platelet-derived growth factor PDGF.9–14 A variety of other Guillermina Lozano, MD Anderson Cancer Institute (Houston, agents, including lipopolysaccharides (LPS), HIV and Epstein– TX, USA). Barr viruses,1,14–17 reactive oxygen intermediates and UV light, have also been described capable of regulating NF-κB- mediated events.1,14–16 That multiplicity of signals reflects the Cell cultures central role NF-κB plays in coordinating fundamental cellular events.14–16 ML-1 human myeloblastic leukemia cells were maintained in The NF-κB family of proteins comprises at least five mem- RPMI 1640 medium containing 10% heat-inactivated fetal bers, including Rel A (p65), c-Rel (p75), NF-κB2 (p52) and bovine serum (FBS), 100 units/ml of penicillin and 100 µg/ml its precursor p100, as well as NF-κB1 (p50) and its precursor of streptomycin. The cells were maintained in exponential 8,15–17 ° p105. An alternatively spliced form of p65, designated growth at 37 C, in a humidified 5% CO2 atmosphere. When ∆p65, has also been identified.15 All these family members required for assay, cells were removed from these maint- exhibit extensive homology at their amino terminal, covering enance cultures, washed with serum-free RPMI 1640 medium, a stretch of 300 amino acids that contains DNA-binding and and synchronized for 48 h by incubation at 37°C in RPMI nuclear-localization domains.3–6 1640 medium supplemented with 0.05% FBS. This procedure In keeping with this multiplicity of structures, the expression caused more than 85% of the cells to accumulate in G1.30 The and activation of the NF-κB proteins has been reported to be staged cells were washed twice with serum-free RPMI 1640 regulated at multiple levels, including transcription, post- medium, followed by resuspension in RPMI 1640 medium translational processing, splicing and intracellular localiz- containing 0.5% FBS, 40 ng/ml IGF-1 and 0.5 µg/ml transferrin (Tf) for proliferation of the cells, or with 10 units/ml TNF-α for their differentiation to monocytes.31 The 0.5% Correspondence: A Bloch, Fax: (716) 845-8857 serum added to these cultures ensured the viability of the Received 18 July 2000; accepted 24 November 2000 majority of cells during the 72 h incubation period, without NF-κB in cell differentiation A Mudipalli et al 809 significantly affecting their differentiation status. Cell numbers Phosphorylation and immunoprecipitation of IκKα were determined by hemocytometer, and cell viability by trypan blue exclusion. Differentiation was monitored by coun- ML-1 cells, synchronized by serum depletion for 48 h, were ting the number of cells expressing the differentiated mor- washed with serum- free RPMI 1640 medium. Cells (1 × 107 phology, and by determining differentiation-associated per treatment group) were then suspended in 10 ml of phos- markers such as Fc receptors, NitroBlueTetrazolium-reducing phate-free RPMI 1640 medium containing 0.5% dialyzed fetal ability, acid phosphatase activity, phagocytosis and cell calf serum. Cell proliferation was initiated by adding 40 ng/ml adherence.29–33 For example, the level of acid phosphatase IGF-1 + 0.5 µg/ml transferrin, and cell differentiation was activity present in ML-1 cells after 24, 48 and 72 h of incu- induced by adding 10 units/ml of TNF-α. After incubation for bation amounted to 1.0, 0.84 and 0.82 nmol/p-nitrophenol 15 and for 21 h periods, the cells were pelleted, washed with released/107 cells/min in control, to 1.05, 0.91 and 0.78 nmol phosphate-free RPMI 1640 medium, and resuspended in 1 ml released in growth, and to 1.48, 2.04 and 2.l2 nmol/107 cells of phosphate-free medium containing 0.5% dialyzed fetal calf in differentiation. serum, the growth – or differentiation – factors, and 100 µCi of 32P-orthophosphate (3000 Ci/mmol; NEN). Following incubation for 3 h, the cells were collected, washed three times with phosphate-free medium, and the cytosolic extracts pre- Cell extracts pared as described above. Three hundred µl of the extract was precleared with 1 µg of normal rabbit IgG, and immunopreci- Cytoplasmic and nuclear extracts of ML-1 cells were prepared pitates of Iκkα were prepared as follows: precleared extract, as described previously.29,30 Briefly, 2–4 × 107 cells treated containing approximately 106 cpm, was added to 150 µlof with the growth – or differentiation – factors, were washed immunoprecipitation buffer containing 50 mM Tris-HCl, pH twice with ice-cold, serum-free RPMI 1640 medium, followed 7.4, 150 mM NaCl, 0.5% NP-40, 20 mM EDTA, 0.1 mM by suspension in 0.15 ml of nuclear isolation buffer consisting Na3VO4,50mM NaF, 1 mM PMSF, 1 mM benzamidine, 10 µ µ µ of 2 mM MgCl2,5mM K2HPO4, 0.1 mM ethylene diamine g/ml trypsin inhibitor, 20 g/ml leupeptin, 20 g/ml aproti- tetraacetic acid (EDTA), 1 mM phenylmethylsulfonyl fluoride nin and 1.5 µg of affinity purified anti-IκKα antibody. After (PMSF), 20 µg/ml aprotinin, 20 µg/ml leupeptin and 0.1 mM rotating the mixtures for 1 h at 4°C, 30 µl of immobilized

Na3VO4. An additional 0.15 ml of nuclear buffer, containing protein A was added to each mixture and rotation continued 0.7% Triton-X100 was added, and incubation, on ice, pro- overnight. Immunoprecipitates were collected by centrifug- ceeded for 8 min. After homogenizing the cells with a Dounce ation, washed, suspended in 30 µlof2× sample buffer, tissue grinder, the homogenate was centrifuged at 150 g. The followed by analysis on 10% SDS-PAGE. The dried gels supernatant, designated the cytoplasmic fraction, was ali- were autoradiographed with Kodak X-O mat film. quoted and stored at −80°C. The pellet was washed once with nuclear buffer, and the nuclear extract prepared as detailed previously.29 Briefly, the washed pellet was resuspended in Electrophoretic mobility shift assay buffer containing 20 mM N-2-hydroxyethylpiperazine-N9-2- ethanesulfonic acid (Hepes), pH 7.9, 25% glycerol, 0.42 M Identification of NF-κB proteins capable of binding to the p53

NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM PMSF, 0.5 mM promoter present in the nuclear extracts from ML-1 cells, was dithiothreitol (DTT), 0.1 mM Na3VO4,50mM NaF, 30 mM performed as follows: the p53 promoter fragment spanning pyrophosphate, 20 µg/ml leupeptin and 20 µg/ml aprotinin, nucleotides −326 to +348, including the NF-κB binding site, and the nuclei homogenized using a Kontes dual tissue was isolated from the plasmid 0.7p53 CAT28 by HindIII diges- grinder. After centrifugation of the homogenate at 12000 g, tion. The fragment was labeled with 32P-ATP using T4 polynu- the supernatant, designated the nuclear extract, was frozen cleotide kinase, and the binding reactions carried out by incu- and stored at −80°C. bating 10 µg of nuclear protein with 105 cpm of 32P-labeled p53 promoter fragment in binding buffer consisting of 10 mM Tris-HCl pH 7.5, 1 mM DTT, 50 mM NaCl, 1 mM EDTA, 0.5% (v/v) glycerol and 1.5 µg of poly dI:dC in a final volume of Western blotting 25 µl. Incubation, for 30 min, was carried out at room tem- perature and the samples were electrophoresed on 5% non- The levels of NIK, IκKα,IκBα and of the NF-κB proteins p50, denaturing acrylamide gel for 3 h at 175 V. Specificity of bind- p52, p65 and p75 present in the cells, were assayed by West- ing was confirmed by the addition of 50 × unlabeled probe. ern blotting,29 50 µg of nuclear or 100 µg of cytoplasmic pro- NF-κB (p52/p65) present in the complex was detected by tein being loaded on to 10% discontinuous polyacrylamide incubating the binding reaction mixture with 1.5 µgof SDS gel. After electrophoresis, the proteins were transferred to p52/p65 (NF-κB) polyclonal antibody for 30 min (antibody nitrocellulose membranes, using a trans-blot electrophoretic super shift). transfer cell. The membranes were blocked overnight with 5% milk in phosphate-buffered saline (PBS), followed by incubation with primary antibody for 2 h. After washing once for Effect of sense and antisense phosphorothioate 15 min and three times for 5 min in PBS containing 0.1% oligodeoxynucleotides of NF-κB (p65) on ML-1 cell Tween-20, the membranes were incubated with secondary differentiation and on the relative level of NF-κB antibody for 1 h, washed extensively as described above, (p65) and of p53 expressed incubated for 1 min in Renaissance Western Blot Chemilumi- nescence Reagent (NEN), and autoradiographed with Kodak The sense (59 TCATCTTCCCGGCAGAGCCAG 39)10 and the X-omat AR (Rochester, NY, USA) or Dupont NEN films. The corresponding antisense oligodeoxynucleotides of NF-κB films were scanned by densitometer, and the relative levels (p65) were synthesized by the Roswell Park Cancer Institute determined by reference to controls. Biopolymer facility. One mM stock solutions of these com-

Leukemia NF-κB in cell differentiation A Mudipalli et al 810 pounds were prepared by dissolving them in serum-free RPMI approximately 50 additional hours of incubation. No such 1640 medium. Five to 25 µl aliquots of the stock solutions, change occurred in control, (C, σ) or in cultures incubated together with 3 µg of superFect transfection reagent (Qiagen, with the growth factor IGF-1 (G, Π). In fact, under conditions Chatsworth, CA, USA), were then incubated at 37°C for 15 of growth, a small and transient increase in the level of min, followed by dilution with 100 µl of serum-free RPMI NF-κB (p65) was observed. 1640 medium and transfer to 1 ml of cell suspension (6 × 105 As shown in Figure 1b, the amount of NF-κB (p65) that cells/ml). After 2 days of incubation, cell numbers were coun- accumulated in the nucleus of the differentiation-induced ML- ted by hemocytometer, viability assessed by trypan blue 1 cells, was quite similar to the amount of NF-κB (p65) that exclusion and differentiation determined by counting the was lost from the cytoplasm of these cells (Figure 1a), suggest- number of cells displaying differentiated morphology and ing that TNF-α-induced cell maturation involves a shift of NF- expressing increased levels of acid phosphatase activity. The κB (p65) from the cytoplasm to the nucleus. In contrast to this levels of p53 and of NF-κB (p65) present in ML-1 cells result, Figure 1c shows that NF-κB (p52) is present in the untreated (control) or treated with sense or with antisense oli- nuclei of control, of growth- as well as of differentiation- gonucleotides were then assayed by Western blotting as induced cells, but is absent from the cytosolic fraction of these described above. cells (data not shown ). As shown in Figure 1d, NF-κB (p75) differs from this pattern insofar as it accumulates in the cytoplasm of differentiating (η) but not of proliferating (Π)orof Results and discussion control (σ) cells, indicating that its function pertains to cytoplasmic differentiation events. Finally, NF-κB (p50) was not Achieving a balance between tumor cell proliferation and detected in either of these cell compartments. tumor cell differentiation constitutes a potentially useful The molecular events involved in bringing about the TNF- approach for the effective therapy. To achieve this objective α-mediated translocation of NF-κB (p65) from the cytoplasm requires information on the identity of the molecular effectors to the nucleus are delineated in Figure 1e and detailed in Fig- that regulate access on to or exclusion from these two paths. ure 1f–h. They include the expression of NIK,34 the NF-κB- We established previously31,33 that, in serum-free RPMI inducing kinase that catalyses the phosphorylation of Iκkα. 1640 medium, IGF-1 and transferrin stimulate ML-1 cell That activation leads to decreased levels of IκB, allowing the growth, whereas TNF-α initiates ML-1 cell differentiation. This subsequent translocation of p65 (NF-κB) from the cytoplasm selectivity provided us with the opportunity to examine the to the nucleus. As shown in Figure 1f, the level of NIK molecular events leading to the inception of ML-1 cell growth becomes selectively elevated relatively early upon stimulation or differentiation. Figure 1a shows that treatment of ML-1 cells of the cells with the differentiation factor TNF-α, while with the differentiation factor TNF-α resulted in the relatively remaining essentially unchanged in control or in proliferation- rapid and pronounced decrease in the cytoplasmic level of stimulated cells. The selective elevation of NIK in differen- NF-κB (p65) (η). That decline reached its nadir after approxi- tiation (D)- but not in control (C)- or in growth (G)-stimulated mately 20 h of incubation, recovering its starting level after cells is accompanied by the selective phosphorylation of Iκkα

Figure 1 Kinetics of NF-κB protein expression in proliferation- vs differentiation-induced ML-1 cells. Levels of (a) cytoplasmic p65 (NF-κB), (b) nuclear p65 (NF-κB), (c) nuclear p52 (NF-κB) and (d) cytoplasmic p75 (NF-κB) in untreated (control, σ) ML-1 cells, or in cells induced to growth (Π) with the growth factor IGF-1 + transferrin or to differentiation (η) with the cytokine TNF-α. Protein levels were determined by Western blotting. Western blot insets show the protein peak levels in control (C), growing (G) and differentiating (D) ML-1 cells. (e) Shows the signaling steps involved in the activation of p65 (NF-κB) translocation from the cytoplasm to the nucleus. The level of the NF-κB-inducing kinase NIK is increased only in differentiation but not in growth (f). That increase leads to the phosphorylation of the IκB kinase α (Iκkα) (g, D), resulting in the loss of IκBα (h) and in the translocation of liberated p65 (NF-κB) to the nucleus.

Leukemia NF-κB in cell differentiation A Mudipalli et al 811 expression in growth- vs differentiation-induced ML-1 cells. Applying EMSA to nuclear extracts from control, from proliferation- and from differentiation-induced ML-1 cells, together with a p53 promoter fragment,28 we found that, as shown in Figure 2, a complex consisting of the heterodimer NF-κB (p52/p65) was bound to the p53 promoter DNA present in the nuclear extract from differentiation-induced (D), but not from control (C) or from proliferation (G)-stimulated ML-1 cells. In the presence of unlabeled probe, the complex disappeared, indicating that binding was specific. The complex also disappeared when antibody to NF-κB p52 or/and to NF-κB p65 was added. When the antibodies to NF-κB p65 and/or to NF-κB p52 were added after the binding reaction, a supershifted band was found present in the nuclear extract from differentiation-induced cells, indicating that these proteins are bound Figure 2 Determination by EMSA, of heterodimer p52 (κB)/p65 to the p53 promoter fragment. (NF-κB) binding to the p53 promoter. The p53 promoter fragment To gain additional information on the functional role (NF- spanning nucleotides −326 to +348 labeled with 32P-ATP and T4 poly- κB) p65 and the tumor suppressor protein p53 might play in nucleotide kinase, served as the probe. Binding reactions were carried the regulation of ML-1 cell growth and differentiation, control µ out by incubating 10 g of nuclear protein with the probe, as (Table 1, column 1, lines 1–3) and differentiation-induced described in ‘Materials and methods’. p52/p65 (NF-κB) complexed (column 1, lines 4–6) ML-1 cells were treated with sense and with the p53 promoter only in the nuclear extracts from differentiating κ (D) but not from control (C) or from growing (G) ML-1 cells. The speci- antisense oligodeoxynucleotide fragments of NF- B (p65). As ficity of binding was determined by the use of 50 × unlabeled probe, shown in column 2, lines 1–6 of Table 1, neither the sense and the presence of p52 (NF-κB) and of p65 (NF-κB) in the complex nor the antisense oligodeoxynucleotides exerted a significant was identified by competition with antibodies to these proteins and effect on total cell number. In contrast, they affected the matu- by antibody supershift. The free probe runs a considerable distance ration status of the cells, sense oligonucleotides stimulating from the shifted products and is not shown. (column 3, lines 2 and 5), and antisense oligonucleotides inhibiting (column 3, lines 3 and 6) cell differentiation. This (KD83) in differentation (D)- but not in growth (Figure 1g). signaling activity was reflected in the levels of NF-κB (p65) This difference in phosphorylation was not accompanied by and of p53 that were expressed (columns 4 and 5). The sense a significant difference in the level of Iκkα protein expressed oligonucleotides stimulated (lines 2 and 5), whereas the anti- in growth vs differentiation (data not shown). Phosphorylation sense oligonucleotides inhibited the expression of these two of IκKα in differentiation-stimulated cells, was followed by a proteins, demonstrating that they play a regulatory role in cell decrease in the level of IκBα (Figure 1h), resulting in the liber- growth and cell differentiation. We29 and others,35–41 have ation (Figure 1a) and translocation (Figure 1b) of cytoplasmic shown that p53 is expressed at a high level in the nuclei of NF-κB (p65) to the nucleus. differentiation-induced but not of growth-stimulated ML-1 Given the observation28 that NF-KB (p65) is involved in the cells, and the data shown in column 4 of Table 1 demonstrate activation of the tumor suppressor protein p53, we examined that, in these cells, a parallel exists between the relative level the possible regulatory effect (p65) NF-κB might exert on p53 of NF-κB (p65) (column 4) and the relative level of p53

Table 1 Effect of sense and antisense oligodeoxynucleotides to the p65 subunit of NF-κB on ML-1 cell growth and differentiation, and on the expression of NF-κB (p65) and of the tumor suppressor protein p53

(1) (2) (3) (4) (5) Total cell No. Differentiated Relative level Relative level ± SD (105 cells/ml) cells (% of total) ± SD of NF-κB (p65) ± SD of p53

1 Control (RPMI 1640 + 0.5% FBS) 7.5 ± 0.8 9.2 ± 2.9 1.0 1.0 2. Control + sense oligodeoxynucleotide 6.1 ± 1.0 22.1 ± 2.1 5.2 ± 0.4 5.3 ± 1.5 3. Control + antisense 6.6 ± 0.9 5.5 ± 2.5 1.5 1.3 oligodeoxynucleotide 4. Differentiation-induced with TNF-α 6.2 ± 1.1 91.4 ± 3.8 59.3 ± 4.3 178.2 ± 16.5 5. Differentiation-induced + sense 6.5 ± 1.4 89.7 ± 7.5 58.3 175.5 oligodeoxynucleotide 6. Differentiation-induced + antisense 5.7 ± 1.3 26.8 ± 8.6 13.3 ± 2.2 48.9 ± 9.7 oligodeoxynucleotide

6 × 105 synchronized ML-1 cells, suspended in RPMI 1640 medium containing 0.5% fetal bovine serum or 10 units/ml of the differentiation- inducer TNF-α, were incubated for 2 days at 37°C. Cell numbers were determined by hemocytometer, and the percentage of differentiated cells assessed by counting the number of cells exhibiting the differentiated phenotype and by determining the increase in level of acid phosphatase activity that resulted. The amount of p65 and p53 protein expressed in the cells was measured by Western blotting and by densitometric scanning.

Leukemia NF-κB in cell differentiation A Mudipalli et al 812 (column 5) that is expressed. By binding to the p53 pro- 15 Perkins ND, Schmid RM, Duckett CS, Leung K, Rice NR, Nabel moter,29 NF-κB (p65) causes the overexpression of p53, lead- GJ. Distinct combinations of NF-kappa B subunits determine the ing to the repression of the PCNA promoter,15–17 resulting in specificity of transcriptional activation. Proc Natl Acad Sci USA 1992; 89: 1529–1533. the inhibition of proliferation-associated DNA synthesis. That 16 Beauparlant P, Hiscott J. Biological and biochemical inhibitors of inhibition is envisioned to contribute to G1/S arrest, uncoup- the NF-kappaB/Rel proteins and cytokine synthesis. Cytokine ling of growth from differentiation and to initiation of the dif- Growth Factor Rev 1996; 7: 175–190. ferentiation program. The data presented in this paper thus 17 Kaufman PA, Weinberg JB, Greene WC. Nuclear expression of the delineate a mechanistic basis for the molecular events 50 and 65 KD Rel-related subunits of nuclear factor-kappa B is involved in tumor cell development, such events providing an differentially regulated in human monocytic cells. J Clin Invest 1992; 90: 121–129. opportunity for designing approaches useful for therapeutic 18 Whiteside ST, Epinat JC, Rice NR, Israel A. I Kappa B epsilon, a intervention. novel member of the IkappaB family, control, RelA and c-Rel NF- kappaB activity. EMBO J 1997; 16: 1413–1426. 19 Henkel, TJ, Machleidt TA, Alkalay I, Kronke M, Ben-Neriah Y, κ α Acknowledgements Baeuerle PA. Rapid proteolysis of I B is necessary for activation of transcription factor NF-κB. Nature (Lond.) 1993; 365: 182–185. 20 DiDonato JA, Mercurio F, Karin M. Phosphorylation of I kappa B This study was aided by grant CA-36241 from the National alpha precedes but is not sufficient for its dissociation from NF- Cancer Institute, DHHS, and by a grant from the Roswell Park kappaB. Mol Cell Biol 1995; 15: 1302–1311. Alliance Foundation. We are grateful to Asahi Chemical Co., 21 Thompson JE, Phillips RJ, Erdjument-Bromage EH, Tempst P, κ α Tokyo, Japan for supplying TNFα. We also thank Dr Guillerm- Ghosh S. I B regulates the persistent response in a biphasic acti- ina Lozano of the MD Anderson Cancer Institute, Houston,TX vation of NF-kappaB. Cell 1995; 80: 573–582. 22 Liou HC, Sha WC, Scott ML, Baltimore D. Sequential induction for providing the p53 CAT construct. of NF-Kappa B/Rel family proteins during B-cell terminal differentiation. Mol Cell Biol 1994; 14: 5349–5359. 23 Baeuerle PA, Baltimore D. IκB: a specific inhibitor of the NF-κB References transcription factor. Science 1988; 242: 540–546. 24 Beg AA, Baldwin AS. The κB proteins. multifuctional regulators of Rel/NF-κB transcription factors. Genes Dev 1993; 7: 2064–2070. 1 Liou HC, Baltimore D. Regulation of the NF-kappa B/Rel transcrip- 25 Venkataraman L, Wang W, Sen R. Differential regulation of c-Rel tion factor and I kappa B inhibitor system. Curr Opin Cell Biol translocation in activated B and T cells. J Immunol 1996; 157: 1993; 5: 477–487. 1149–1155. 2 Baldwin AS Jr. The NF-kappa B and Ikappa B proteins: new dis- 26 Browning DD, Pan ZK, Prossnitz ER, Ye RD. Cell type and devel- coveries and insights. Annu Rev Immunol 1996; 14: 649–683. opmental stage-specific activation of NF-Kappa B by F-Met-Leu- 3 May MJ, Ghosh S. Rel/NF-kappa B and IkappaB proteins: an over- Phe in myeloid cells. J Biol Chem 1997; 272: 7995–8001. view. Semin Cancer Biol 1997; 8: 63–73. 4 Muller JM, Rupec RA, Baeuerle PA. Study of gene regulation by 27 Lewin SR, Lambert P, Deacon NJ, Mills J, Crowe SM. Constitutive NF-κB and AP-1 in response to reactive oxygen intermediates. expression of p50 homodimer in freshly isolated human mono- Methods 1997; 11: 301–312. cytes decreases with in vitro and in vivo differentiation: a possible 5 Siebenlist U. NF-κB/IκB proteins. Their role in cell growth, differ- mechanism influencing human immunodeficiency virus repli- entiation and development. Biochim Biophys Acta 1997; 1332: cation in monocytes and mature macrophages. J Virol 1997; 71: 2114–2119. R7–R13. κ 6 Albrecht H, Tschopp J, Jongeneel CV. Bcl-2 protects from oxidat- 28 Wu H, Lozano G. NF- B activation of p53. J Biol Chem 1994; ive damage and apoptotic cell death without interfering with acti- 269: 20067–20074. vation of NF-κB by TNF. FEBS Lett 1994; 351: 45–48. 29 Li Z-R, Hromchak R, Mudipalli A, Bloch A. Tumor suppressor pro- 7 Kabrun N, Enrietto PJ. The Rel family of proteins in oncogenesis teins as regulators of cell differentiation. Cancer Res 1998; 58: and differentiation. Semin Cancer Biol 1994; 5: 103–112. 4282–4287. 8 Inuzuka M, Ishikawa H, Kumar S, Gelinas C, Ito Y. The viral and 30 Li Z-R, Hromchak R, Bloch A. Differential expression of proteins cellular Rel oncoproteins induce the differentiation of p19 embry- regulating cell cycle progression in growth vs differentiation. onal carcinoma cells. Oncogene 1994; 9: 133–140. Biochim Biophys Acta 1997; 1356: 149–159. 9 Perona R, Montaner S, Saniger L, Sanchez-Perez I, Bravo R, Lacal 31 Ishikura H, Hori K, Bloch A. Differential biological effects resulting JC. Activation of the nuclear factor-κB by Rho, CDC-42 and Rac- from bimodal binding of recombinant human tumor necrosis fac- 1 proteins. Genes Dev 1997; 11: 403–475. tor to myeloid leukemia cells. Blood 1989; 73: 419–424. 10 Sokoloski JA, Sartorelli AC, Rosen CA, Narayanan R. Antisense 32 Sakagami H, Ozer H, Minowada J, Takeda K, Bloch A. Differen- oligonucleotides to the p65 subunit of NF-κB block CD11b tiation-associated changes in human non-T, non-B leukemia cell expression and alter adhesion properties of differentiated HL-60 lines after treatment with 12-O-teradecanoylphorbol 13-acetate. granulocytes. Blood 1993; 82: 625–632. Leukemia Res 1984; 8: 187–195. 11 Dokter WH, Tuyt L, Sierdsema SJ, Esselink MT, Vellenga E. The 33 Fujii Y, Takuma T, Bloch A. A regulatory role for tumor necrosis spontaneous expression of interleukine-1B and interleukin-6 is factor (TNF) in ML-1 human myeloblastic leukemia cell matu- associated with spontaneous expression of AP-1 and NF-κB tran- ration. Leukemia Res 1990; 14: 941–947. scription factors in acute myeloblastic leukemia cells. Leukemia 34 Stancovski I, Baltimore D. NF-κB activation: the IκB kinase 1995; 9: 425–432. revealed? Cell 1997; 91: 299–302. 12 Conti L, Hiscott J, Papacchini M, Roulston A, Wainberg MA, 35 Shaulsky G, Goldfinger N, Peled A, Rotter V. Involvement of wild Belardell F, Gessani S. Induction of Rel A (p65) and I kappa B type p53 in pre-B-cell differentiation in vitro. Proc Natl Acad Sci alpha subunit expression during differentiation of human periph- USA 1991; 88: 8982–8986. eral blood monocytes to macrophages. Cell Growth Differ 1997; 36 Kastan MB, Radin AI, Kuerbitz SJ, Onyekwere O, Wolkow CA, 8: 435–442. Civin CI, Stone KD, Woo T, Ravindranath Y, Craig RW. Levels of 13 Satriano J, Schlondorff D. Activation and attenuation of transcrip- p53 protein increase with maturation in human hematopoietic tion factor NF-κB in mouse glomerular mesangial cells in response cells. Cancer Res 1991; 51: 4279–4286. to tumor necrosis factor–alpha, immunoglobulin G, and adenos- 37 Feinstein E, Gale RP, Reed J, Canaani E. Expression of the normal ine 39:59 cyclic monophosphate. Evidence for involvement of p53 gene induces differentiation of K562 cells. Oncogene 1992; reactive oxygen species. J Clin Invest 1994; 94: 1629–1636. 7: 1853–1857. 14 Olashaw NE, Kowalik TF, Huang ES, Pledger WJ. Induction of NF- 38 Banerjee D, Lenz HJ, Schnieders B, Manno DJ, Ju JF, Spears CP, kappa B-like activity by platelet-derived growth factor in mouse Hochhauser D, Danenberg K, Danenberg P, Bertino JR. Cell fibroblasts. Mol Biol Cell 1992; 3: 1131–1139. Growth Differ 1995; 6: 1405–1413.

Leukemia NF-κB in cell differentiation A Mudipalli et al 813 39 Ehinger M, Nilsson E, Persson A-M, Olsson I, Gullberg U. Involve- roxycholecalciferol in leukemic U-937 cells. Blood 1996; 87: ment of the tumor suppressor gene p53 in tumor necrosis factor- 1064–1074. induced differentiation of the leukemic cell line K562. Cell 41 Soddu S, Blandino G, Citro G, Scardigli R, Piaggio G, Ferber A, Growth Differ 1995; 6: 9–17. Calabretta B, Scacchi A. Wild-type p53 gene expression induces 40 Ehinger M, Bergh G, Olofsson T, Baldetorp B, Olsson I, Gullberg, granulocytic differentiation of HL-60 cells. Blood 1994; 83: U. Expression of the p53 tumor suppressor gene induces differen- 2230–2237. tiation and promotes induction of differentiation by 1,25-dihyd-

Leukemia