Screening for Mutations in the Genes VCP and KIAA0196 in Patients with Frontotemporal Dementia and Amyotrophic Lateral Sclerosis

From the Department of Human Genetics Ruhr-University Bochum Director: Prof. Dr. med. J. T. Epplen

Inaugural-Dissertation for the Attainment of the Doctoral Degree in Medicine at the High Faculty of Medicine of the Ruhr-University Bochum

Presented by Katharina Timmer from Trier 2015

Dean: Prof. Dr. med. Albrecht Bufe Supervisor: Prof. Dr. J.T. Epplen Referee: Prof. Dr. rer. nat. Bernd Eiben

Date of oral examination: 26th of April 2016

Abstract

Amyotrophic Lateral Sclerosis (ALS) and Frontotemporal Dementia (FTD) are neurodegenerative diseases with prevalences of 3.4-5.4/100,000 and 15-22/100,000, respectively. Although overlapping pathogenic mechanisms, possibly due to a shared genetic background, are suspected, the exact causes for both diseases are not yet clear. Several genes have been reported to play a role in the pathogenesis. The most frequently mutated genes comprise SOD1, FUS and TARDPB for ALS and PGRN for FTD. Further, repeat expansions in the c9orf72 gene and mutations in VCP have recently been described as causative for both diseases. VCP plays an integral part in a vast amount of cellular processes, such as autophagy, endoplasmatic reticulum associated degradation (ERAD) and endocytosis, and has been shown to interact with KIAA0196, a member of the WASH complex, involved in cellular trafficking and membrane organization. Muta- tions in the KIAA0196 gene lead to Spastic Paraplegia Type 8 (SPG8).

Given the shared pathogenic background, it was suggested that mutations in VCP or KIAA0196 may result in impaired interaction causing a spectrum of neurodegenerative diseases, including ALS, FTD and SPG8. In this dissertation DNA samples of a cohort of 48 patients with clinically diagnosed FTD and ALS in various stages were therefore investigated for mutations in VCP and KIAA0196. Mutational analysis was performed with denaturing high performance liquid chromatography. Samples showing abnormal peaks were subsequently sequenced using the Sanger method to detect potential mutations. With this approach, no pathogenic mutation was found in any of the 48 samples, suggesting that mutations in these two genes may not be involved in the pathogenesis of ALS/FTD. However, alternative explanations for this result could be that the size of the investigated cohort was too small, especially since mutations in VCP and KIAA0196 have a very low frequency, or that the sensitivity of the used method may not reach 100%. Further investigations carried out in larger cohorts including additional genes of the WASH complex (comprised of F-actin-capping protein subunits alpha and beta, WASH1, FAM21, KIAA1033, KIAA0196, CCDC53) are needed to gain a better insight into the role of this complex for neurodegenerative diseases. Additionally, the application of next-generation sequencing technologies allowing the analysis of several genes or even whole exomes in affected individuals simultaneously is expected to lead to a better understanding of the pathogenic mechanisms of ALS/FTD in the near future.

To Bhuvnaesh

Table of Contents

1 Introduction ...... 8 1.1 Amyotrophic Lateral Sclerosis (ALS) ...... 8 1.1.1 Definition and Epidemiology ...... 8 1.1.2 Symptoms ...... 8 1.1.3 Diagnosis and Therapy ...... 9 1.2 Frontotemporal Dementia (FTD) ...... 11 1.2.1 Definition and Epidemiology ...... 11 1.2.2 Symptoms ...... 11 1.2.3 Diagnosis and Therapy ...... 12 1.3 Inclusion Body Myopathy with early-onset Paget disease with or without Frontotemporal Dementia (IBMPFD) ...... 13 1.3.1 Symptoms ...... 13 1.3.2 Diagnosis and Therapy ...... 14 1.4 Pathogenesis and Mutational Spectrum...... 14 1.5 Valosin-Containing-Protein (VCP) ...... 18 1.5.1 Gene ...... 18 1.5.2 Structure ...... 19 1.5.3 Biological Functions ...... 20 1.5.4 Role of VCP in ERAD ...... 21 1.5.5 Role of VCP in Autophagy ...... 23 1.5.6 Role of VCP in Endocytosis ...... 25 1.5.7 Other Functions of VCP ...... 25 1.5.8 Mutational Spectrum of VCP ...... 26 1.6 KIAA0196 and the WASH Complex ...... 27 1.6.1 Sructure and Localization of the WASH Complex ...... 27 1.6.2 Biological Function of WASH1 and the WASH Complex ...... 28 1.6.3 Gene, Protein Structure and Expression of KIAA0196 ...... 29 1.6.4 Spastic Paraplegia Type 8 ...... 30 1.6.5 Gene, Function and Mutations ...... 31 1.6.6 VCP, KIAA0196 and the WASH Complex ...... 33 2 Objective ...... 34 3 Material and Methods ...... 35 1

3.1 Participants ...... 35 3.2 Reagents ...... 35 3.2.1 Chemicals ...... 35 3.2.2 Solutions ...... 36 3.2.3 Kits ...... 37 3.2.4 Devices ...... 37 3.2.5 Materials ...... 38 3.2.6 Size Standard ...... 38 3.3 DNA ...... 38 3.4 Reamplification ...... 38 3.5 Primer Pairs ...... 39 3.6 Polymerase Chain-Reaction (PCR) ...... 44 3.7 Gelelectrophoresis ...... 48 3.8 Denaturing High Performance Liquid Chromatography (DHPLC) ...... 49 3.8.1 Principles of DHPLC ...... 50 3.8.2 Expected Results of DHPLC ...... 50 3.8.3 Set-up and Conditions of DHPLC ...... 51 3.8.3.1 Establishing the Temperature Gradient ...... 52 3.9 Sanger Sequencing ...... 54 4 Results ...... 55 4.1 rs74999306 (c.714-25T>C), Exon 7 of KIAA0196 ...... 56 4.2 rs10972300 (c.129+47G>A), Exon 2 of VCP ...... 57 4.3 Results for KIAA0196 ...... 58 4.4 Results for VCP ...... 62 5 Discussion ...... 66 5.1 Mutations in VCP and KIAA0196 ...... 66 5.1.1 VCP Mutations in ALS ...... 66 5.1.2 Evidence that Mutations in VCP and KIAA0196 may be involved in ALS/FTD ...... 67 5.1.3 Evidence that Mutations in VCP and KIAA0196 may not be a Cause for ASL/FTD ...... 69 5.1.4 Mixed phenotypes ...... 70 5.2 The Use of DHPLC ...... 70 5.2.1 DHPLC versus Direct Sanger Sequencing, SSCP and Next-Generation Sequencing (NGS) ...... 71

5.2.2 Sensitivity and Specificity...... 71 5.2.3 Comparison of Costs and Time ...... 72 5.2.4 Confounding Factors of DHPLC ...... 74 5.3 Conclusion ...... 75 6 Summary ...... 76 7 Bibliography ...... 77 8 Appendix ...... 90 8.1 International consensus criteria for behavioral variant FTD ...... 90 8.2 Inclusion and exclusion criteria for the diagnosis of PPA ...... 91 8.3 Diagnostic features for three subtypes of PPA ...... 91

List of Abbreviations

ABI Applied Biosystems Incorporated ALS Amyotrophic Lateral Sclerosis ATP Adenosine triphosphate bvFTD Behavioral variant of Frontotemporal Dementia cDNA Complementary deoxyribonucleic acid CK Creatinin kinase DEAZA-NTP 7-Deaza-2´-deoxy-guanosine-5´-triphosphate DN Dystrophic neurites DNA Deoxyribonucleic acid dNTP Deoxynucleotide ddNTP Dideoxynucleotide DHPLC Denaturing High Performance Liquid Chromatography dsDNA Double-stranded deoxyribonucleic acid EDTA Ethylenediaminetetraacetic Acid EEA1 Early-endosome-antigen 1 EMG Electromyogram ERAD Endoplasmic reticulum associated degradation ERC Endoplasmic recycling compartment fALS Familial ALS FTD Frontotemporal Dementia IBMPFD Inclusion Body Myopathy with Paget Disease of the Bone with or without Frontotemporal Dementia KIAA0196 Strumpellin LMN Lower motor neuron M Molar mass MgCl Magnesium chloride µ Micro mMol Millimole mRNA Messenger ribonucleic acid MSP Multisystem Proteinopathy MTOC Microtubule organizing center NCI Neuronal cytoplasmic inclusions NCS Nerve conduction study NII Neuronal intranuclear inclusions

NRD Nonfunction rRNA decay NVC Nerve conduction velocity test PCR Polymerase chain reaction PPA Primary Progressive Aphasia RE Recycling endosomes RNA Ribonucleic acid rRNA Ribosomal ribonucleic acid RNP Rinbonucleoprotein granules sALS Sporadic ALS SG Stress granules SPG Spastic Paraplegia SRH Second region of homology ssDNA Single-stranded deoxyribonucleic acid TBR Tubulin-binding region TDP-43 Transactive-response-DNA-binding-protein 43 kDa TE Tris-EDTA UMN Upper motor neuron UPS Ubiquitin-Proteasome-System TBE Tris-borate/EDTA TEAA Triethylammonium acetate Tris Trishydroxymethylaminomethane VCA Verprolin-connecting-acidic domain VCP Valosin-containing-protein WAHD WASH homology domain WASH comprised of F-actin-capping protein subunits alpha and beta, WASH1, FAM21, KIAA1033, KIAA0196, CCDC53

List of Figures

Figure 1: Localization of VCP on chromosome 19 Figure 2: Primary structure of the VCP protein 19 Figure 3: Quaternary structure of the VCP protein 20 Figure 4: Functions of VCP 21 Figure 5: ERAD pathway 22 Figure 6: Possible role of VCP in UPS/Proteasome pathway 24 Figure 7: Mutational spectrum of VCP 26 Figure 8: Primary structure of the WASH1 protein and the associated 27 WASH-complex Figure 9: Localization of KIAA0196 on chromosome 8 29 Figure 10: Primary structure of KIAA0196 with known mutations 31 Figure 11: The forming of hetero- and homoduplexes by de- and 49 renaturing of the DNA strands Figure 12: Example of mutation detection by DHPLC in a specific gene (ARIX) 51 Figure 13: Melting profile for VCP exon 14: 53 Helical fraction against temperature Figure 14: Melting profile for VCP exon 14: 53 Helical fraction against base position Figure 15: Universal gradient 54 Figure 16: SeqMan alignment and WAVE chromatogram 56 Figure 17: SeqMan alignment and WAVE chromatogram 57

List of Tables

Table 1: El-Escorial-Criteria 1998 (Brooks et al., 2000) 10 Table 2: Genetics of autosomal-dominant ALS and overlap with FTD 14-15 Table 3: Genetics of FTD 15 Table 4: Chemicals 35-36 Table 5: Solutions 36 Table 6: Kits 37 Table 7: Devices 37-38 Table 8: Materials 38 Table 9: Size Standard 38 Table 10: Tailed primer pairs for amplification of the KIAA0196 gene. 40-42 Table 11: Tailed primer pairs for amplification of the VCP gene 42-43 Table 12: PCR protocol for a single sample with GC-Polymerase 44 Table 13: PCR protocol for a single sample with HotStar Mastermix 45 Table 14: PCR program for GC-Polymerase 45 Table 15: PCR program for HotStar Mastermix 46 Table 16: PCR program for VCP Exon 1 46 Table 17: PCR program for KIAA0196 Exon 1 46-47 Table 18: PCR conditions for KIAA0196 47-48 Table 19: PCR conditions for VCP 48 Table 20: PCR program in preparation for the DHPLC 50 Table 21: Detected variants in the gene KIAA0196 (NM_014846.3) 58-61

Table 22: Detected variants in the gene VCP (NM_007126.3) 62-65

Table A1: International consensus criteria for behavioral variant FTD (FTDC) 90-91 Table A2: Inclusion and exclusion criteria for the diagnosis of PPA 91 Table A3: Diagnostic features for three subtypes of PPA 91-93

1 Introduction

1.1 Amyotrophic Lateral Sclerosis (ALS)

1.1.1 Definition and Epidemiology

Amyotrophic lateral sclerosis (ALS) is also known as Charcot disease or Lou Gehrig’s disease and was first described by Charcot in 1869. ALS is a motoneuron disease in- volving the upper and lower motor neurons, resulting in muscular weakness of extremities with bulbar and respiratory involvement and death by respiratory insufficiency usually around five years after diagnosis.

ALS has an incidence of 2.08/100,000 in Europe and 1.80/100,000 in North America (Chiò et al., 2013). The incidence rate for men is generally higher than for women (3.1 and 2.2 per 100,000 person years) (Worms, 2001). The prevalence is reported to be between 5.40/100,000 in Europe and 3.40/100,000 in the United States. The mean age of onset of ALS is at 62 +- 4 years with a range of 54 – 67 years worldwide (Chiò et al., 2013). The mean survival time is two to five years, but 10-20% of patients show a survival time of more than 10 years (Brandt and Diener, 2012). Very rarely a survival time of over 40 years has been described (Grohme et al., 2001).

The majority of ALS cases occur sporadically. About 5-10% of individuals have a family history of ALS termed familial ALS, fALS, with the first symptoms appearing about 10 years earlier than in the sporadic form (Byrne et al., 2011). In some cases a mutation can be found in associated genes (see Table 2).

1.1.2 Symptoms

Degeneration of upper and lower motor neurons causes symptoms of ALS (Kinsley and Siddique, 2015). The oculomotor cranial nerve nucleus and the Onuf’s nucleus, control- ling the sphincter muscles, are generally spared (Brandt and Diener, 2012; Brooks et al., 2000b). The upper motor neuron is situated in the Moto cortex and is connected to the lower motor neuron in the anterior horn of the spinal cord. Together they enable volun- tary motor function, whereby the upper motor neuron sends the information for movement to the lower motor neuron, which directly interacts with the skeletal muscle. Addi- tional information reaches the lower motor neuron through the brain stem. The initial symptom is generally asymmetric weakness of the upper extremities. Progressively more symptoms occur and severity increases over time. An involvement of the auto-

nomic nerve system, liver, pancreas, skin and the gastrointestinal tract have been reported (Brandt and Diener, 2012).

The initial symptom usually consists of a focal atrophy of the limb muscles, usually in the upper extremity (Valadi, 2015), but 20-30% of patients show a bulbar involvement at the time of diagnosis. Muscle weakness progresses and spreads across the skeletal muscles system throughout clinical course. Signs of degeneration of the second motor neuron appear with atrophic paresis, fasciculation, and muscle cramps (Kinsley and Siddique, 2015). The degeneration of the first motor neuron leads to increasing reflexes and cloni as a result of an increased muscle tone, and pyramidal signs. Muscle cramps and fasciculation disappear as the disease progresses. Motor movement of eyes, sensi- bility and function of sphincter muscles stay intact (Brandt and Diener, 2012). Dyspha- gia and dysarthria can be present at time of diagnosis in 20% of the patients (Valadi, 2015). Over time muscle wasting and weight loss can be seen. The disease course is rapidly progressive but is highly variable in individuals. The endpoint of the disease is the involvement of the respiratory system, leading to alveolar hypoventilation and if not treated to CO2 excess and death (Brandt and Diener, 2012).

Cognitive impairment in patients with ALS has been described. Massmann et al. (1996) found 35.6% of investigated ALS patients to be cognitively impaired (Massman et al., 1996). The cognitive dysfunction shows a fronto-temporal pattern and involves verbal and non-verbal fluency and problem solving. Some investigators argue that it is bland and not as progressive as motor symptoms (Brandt and Diener, 2012). But about 5% of patients can be diagnosed with Frontotemporal Dementia (FTD) based on the clinical criteria (Nalbandian et al., 2011). Therefore a clinical link between these two diseases exists which implies a possible pathogenic link (see 1.4).

1.1.3 Diagnosis and Therapy

The diagnosis of ALS is based on clinical features, mainly progressive lower motor neuron degeneration and upper motor neuron degeneration which are detected by clinical examination and electrodiagnostic testing (Kinsley and Siddique, 2015). Other diseases have to be excluded by neurological testing and neuroimaging (Brooks et al., 2000).

The revised El-Escorial criteria of the World Federation of Neurology (WFN) distinguish between four different categories of ALS (see Table 1).

Table 1: El-Escorial-Criteria 1998 (Brooks et al., 2000) ALS: Amyotrophic Lateral Sclerosis; LMN: Lower motor neuron; UMN: Upper motor neuron; EMG: Electromyog- raphy

Category Presence of symptoms Clinically Definite ALS UMN+LMN signs in - bulbar region AND - two spinal regions OR - in three spinal regions Clinically Probable ALS UMN+LMN signs in - two regions AND - UMN signs rostral to LMN signs Clinically Probable ALS – UMN+LMN signs in Laboratory-supported - one region AND - LMN sings in EMG in two regions Clinically Possible ALS UMN+LMN signs in - one region OR UMN signs in two or more regions

Besides clinical examination, an EMG and nerve conduction studies (NCS/NVC) should be performed which typically show active denervation and reinnervation of the muscles. Laboratory tests and radiological examinations and even a muscle biopsy or a lumbar puncture in some cases have to be performed to exclude other diseases (Brandt and Diener, 2012). Genetic testing in individuals with a family history can be performed after genetic counseling. A causal therapy for ALS is not yet available. The therapy comprises pharmaceutical and symptomatic interventions. The only medication known to extend lifespan is riluzole. In a meta-analysis a median prolonged survival for patients treated with 100 mg riluzole of two to three month was reported (Miller et al., 2012) without any serious side effects besides nausea and asthenia. It is recommended to perform liver enzyme tests every month for the first three month. After that, testing should be performed in three month intervals. It has been proposed to avoid riluzole in patients with liver involvement (Miller et al., 2012). Symptoms such as muscle cramps, fasciculations and dysreg- ulation of affect can be treated pharmaceutically (Kinsley and Siddique, 2015). Regular physiotherapy is recommended and therapeutic appliances can be helpful. If dysphagia

is present the implantation of a percutaneous gastro stoma should be considered (Brandt and Diener, 2012). As the disease progresses and the respiratory system becomes affected, alveolar hypoventilation can be treated with non-invasive mask ventilation or even a tracheostoma (Brandt and Diener, 2012).

1.2 Frontotemporal Dementia (FTD)

1.2.1 Definition and Epidemiology

Frontotemporal dementia belongs to the spectrum of cortical dementias along with Alz- heimer’s dementia and is a neurodegenerative disorder developing in midlife or later. 20% of presenile dementias are thought to be FTD Patients with FTD present with changes in personality and social behavior as well as in judgment and speech (Neary et al., 1998; Onyike and Diehl-Schmid, 2013).

The estimated prevalence is 15-22/100,000 and the incidence is 2.7-4.1/100,000 in the age groups 40-69 and 45-64 years (Onyike and Diehl-Schmid, 2013). The exact prevalence and incidence is not known because the disease is expected to be underdiagnosed. FTD can also present as schizophrenia, bipolar affective disorder and major depression in persons under the age of 40 years (Onyike and Diehl-Schmid, 2013). The gender distribution is thought to be equal. Two Italian studies have shown a 2:1 ratio for women in isolated areas but also found a high prevalence of genetic mutations causing FTD (Bernardi et al., 2012; Gilberti et al., 2011).

The median survival time is between 3-14 years, and comorbidities do not seem to impact survival time (Onyike and Diehl-Schmid, 2013).

1.2.2 Symptoms

Two different types of FTD exist, depending on which symptoms are present in the first place. The behavioral phenotype is characterized by a drastic change in conduct and cognition and a frontal and temporal lobar atrophy. Apart from disengagement, emo- tional expression and conduct might still be normal in the beginning. As the disease progresses increasing aggressiveness, indiscretion, and indifference as well as mental rigidity, distractibility, impulsiveness, and stereotyped and obsessive-compulsive behavior patterns occur (Mendez and Perryman, 2002; Onyike and Diehl-Schmid, 2013). The speech phenotype (primary progressive aphasia, PPA) consists of speech impedi- ment with agrammatical speech, semantic errors, problems in comprehension, agnosia and a progressive aphasia (Onyike and Diehl-Schmid, 2013; Rascovsky et al., 2011).

Both types eventually result in progressive dementia, whereby the memory disturbances are not as severe as in Alzheimer’s disease. Around 60% of patients show the behavioral variant, 40% show the speech variant. Along with the behavior and speech impairment, speech and limb apraxia, and motor neuron disease have been reported (Onyike and Diehl-Schmid, 2013).

1.2.3 Diagnosis and Therapy

The first diagnostic criteria for FTD were established by Neary et al. 1998 (Neary et al., 1998) and the first criteria for isolated primary progressive aphasia (PPA) by Mesulam, 2001 (Mesulam, 2001). The revised versions further distinguish between the speech and the behavioral phenotype and were formulated by international consortia (Gorno- Tempini et al., 2011; Rascovsky et al., 2011).

No definitive biomarkers for the diagnosis of the behavioral type of FTD exist. There- fore the diagnosis is mainly based on clinical findings and in some cases genetic testing and radiological findings. The criteria for the behavioral variant include the subtypes possible bvFTD, probable bvFTD, and behavioral variant with definite FTLD pathology and formulate exclusionary criteria for bvFTD (see appendix). These criteria have a greater sensitivity than the criteria of 1998 because of a more flexible structure and the exclusion of restrictive features.

The criteria for the speech phenotype (primary progressive aphasia, PPA) distinguish between three subtypes: nonfluent/agrammatic, semantic and logopenic. Specific radiological findings exist for each subtype and are included in the criteria. Besides, histopathological findings such as ubiquitin/TDP43-positive inclusions, as well as specific genetic information are also included (see appendix).

The consortium formulated general criteria for the diagnosis of PPA based on the criteria by Mesulam, 2001 and for each subtype (see appendix).

Specific criteria for the diagnosis of FTD combined with ALS exist (Strong et al., 2009). These criteria distinguish between four different axes, with the first axis defining different types of motor neuron diseases. The second axis defines the cognitive and behavioral dysfunction; axis three takes in account additional non-motor symptoms and the fourth axis the presence of disease modifiers. These criteria are based on the revised El-Escorial-criteria, possible genetic and neuropathological testing, radiological find-

ings, individual information (age of onset, gender, disease duration, site of disease onset and the Neary-criteria (for further reference see Strong et al., 2009).

A causative therapy does not exist yet. Psychiatric symptoms can be treated with medication, i.e. neuroleptics or serotonin-reuptake-inhibitors (Brandt and Diener, 2012). Be- sides, speech therapy and physical as well as occupational therapy can be employed. In the course of disease a permanent hospitalization is often necessary.

1.3 Inclusion Body Myopathy with early-onset Paget disease with or without Frontotemporal Dementia (IBMPFD)

IBMPFD is a disorder comprising the symptoms of myopathy, osteolytic bone lesions and frontotemporal dementia (FTD). It is inherited in an autosomal-dominant pattern. 90% of patients show a myopathy, 51% Paget disease and 32% symptoms of frontotemporal dementia with a mean onset of 54 years (Weihl et al., 2009).

The prevalence and incidence of the disease is not known. Around 30 families have been studied, but the disease is thought to be underdiagnosed (Kimonis et al., 2011).

1.3.1 Symptoms

The myopathy consists of progressive weakness especially around the limb girdles, resulting in scapular winging and lordosis. Muscular atrophy can be present (Nalbandian et al., 2011; Weihl et al., 2009). These symptoms lead to an abnormal gait and to problems with climbing stairs (Kimonis et al., 2008). Reflexes are absent but creatinin kinase (CK) is normal to slightly elevated and EMG is normal (Kimonis et al., 2008). Eventually muscle weakness spreads to the respiratory system and the heart, resulting in cardiomyopathy and cardiac and respiratory failure between 40-50 years. The course of the disease is highly variable. The muscle biopsy shows single or multiple rimmed vacuoles with inclusion bodies positive for VCP, ubiquitin and TDP-43 in immunohistochemical analysis (Kimonis et al., 2008).

Paget disease of the bone is characterized by bone deformities and fractures. In IBMPFD patients it appears about 10 years earlier (mean age of onset 41.5 years) then in the general population of Paget disease patients (mean age of onset >50 years) (Kimonis et al., 2008). It has been shown that osteoclastic activity is increased, resulting in a changed bone structure, especially of the skull, vertebrae, and pelvis (Nalbandian et al., 2011).

The clinical course of frontotemporal dementia in IMBPFD patients is similar to the general form of frontotemporal dementia (see above). The mean age of onset is 55 years with a range of 42-62 years (Kimonis et al., 2008).

1.3.2 Diagnosis and Therapy

The diagnosis of IMBPFD is based on neurological assessment, laboratory and radiological findings. In Paget disease of the bone an elevated serum alkaline phosphatase can be found. Radiologic findings include cortical thickening and sclerosis of the bone (Nalbandian et al., 2011). For the diagnosis of FTD specific clinical and pathological criteria exist (see above). There is no causative treatment for IBMPFD. For the treatment of Paget disease bisphosphonates can be administered and for FTD serotonin- reuptake-inhibitors.

1.4 Pathogenesis and Mutational Spectrum

30% of patients with autosomal dominant IBMPFD and 30% of patients with ALS meet criteria of frontotemporal dementia, indicating that these three diseases share a pathogenic background to a certain extent (Lomen-Hoerth et al., 2002; Weihl et al., 2009).

Several genes are reported to cause familial ALS with our without FTD (see Table 2).

Table 2: Genetics of autosomal-dominant ALS and overlap with FTD (adapted from Kinsley and Siddique, 2015; Lattante et al., 2015; Online Mendelian Inheritance in Man, OMIM); *(Johnson et al., 2010); excluded are genes for juvenile ALS

% of Individuals Name Disease Name Protein Name with fALS Gene Symbol Superoxide dis- 20% ALS1 (SOD1) fALS mutase (Cu-Zn) Rare ALS3 (18q21) fALS + FTD Rare ALS4 (TBK1) fALS and/or fALS TBK1 RNA-binding protein Ca. 4% ALS4 (FUS/TLS) fALS + FTD FUS Rare ALS7 (20p13) fALS Vesicle associated Finkel type SMA or membrane protein- Rare ALS8 (VAPB) SMA IV associated protein B/C Rare ALS9 (ANG) fALS Angiogenin TARDBP-related TAR DNA-binding 1-4% ALS10 (TARDBP) amyotrophic lateral protein 43 sclerosis/FTD Polyphophoinositide Rare ALS11 (FIG4) fALS phosphatase Rare ALS12 (OPTN) fALS FIP2 Rare ALS15 (UBQLN2) fALS +/- FTD Ubiquilin-2 Rare ALS18 (PFN1) fALS Profilin-1 Rare ALS17 (CHMP2B) fALS or FTD CHMP2B 14

% of Individuals Name Disease Name Protein Name with fALS Gene Symbol Rare ALS19 (ERBB4) fALS ERBB4 Rare ALS20 (HNRNPA1) fALS or IBMPFD HNRNPA1 Rare ALS21 (MATR3) fALS MATR3 Rare ALS22 (TUBA4) fALS +/- FTD Tubulin C9orf72-related Uncharacterized 23-30% ALS/FTD (c9orf72) FTD/ALS protein c9orf72 Coiled-coil-helix- coiled-coil-helix ALS/FTD CHCHD10-related Rare domain-containing (CHCHD10) ALS/FTD protein 10, mito- chondrial Rare ALS-FTD (17q) Unknown FTDALS3 1-3.5% fALS + FTD p62 (SQSTM1) Transitional endo- 1-2%* ALS (VCP) fALS/FTD/IBMPFD plasmic reticulum ATPase

Apart from this, there are also several genes in which mutations exclusively lead to the phenotype of FTD (see Table 3).

Table 3: Genetics of FTD (Lattante et al., 2015)

% of Individuals Name Disease Name Protein Name with FTD Gene Symbol 20% FTD (PGRN) FTD Progranulin Microtubule- Rare FTD (MAPT) FTD associated protein tau

Of these genes, mutations in the SOD1, FUS and TARDBP genes as well as a hexanucleotide repeat expansions in c9orf72 are the most common causes for autosomal dominant ALS (Da Cruz and Cleveland, 2011; Traynor, 2014). Mutations in the PGRN and the MAPT gene as well as in c9orf72 typically lead to the phenotype of FTD (Lattante et al., 2015; Traynor, 2014). Besides, mutations in several other genes have been described to cause ALS along with FTD, but VCP is a known gene in which mutations lead to IBMPFD, FTD and ALS (Johnson et al., 2010; Watts et al., 2004). Recently, two genes (hnRNPA2B1 and hnRNPA1) have also been found to cause IBMPFD and FTD and in one case ALS (Benatar et al., 2013; Kim et al., 2013a) The phenotype in all reported cases is highly variable and mutations can lead to isolated or mixed forms of the three diseases even within families carrying the same mutation. Because mutations lead to involvement of several different tissues (brain, muscle, bone) but can also cause cardiomyopathy (Hübbers et al., 2007), liver involvement (Guyant-Maréchal et al., 2006), hearing impairment (Djamshidian et al., 2009) and autonomic involvement (Miller et al., 2009), it has been proposed to term the phenotype ‘multisystem proteinopathy’ (‘MSP’) (Benatar et al., 2013). 15

All three diseases have similar ubiquitin/TDP-43 positive inclusion bodies in common (Liscic et al., 2008; Neumann et al., 2006; Weihl et al., 2008) which are thought to be the underlying pathological cause. The pathological variant of TDP-43 in these diseases is ubiquitinated, phosphorylated and forms C-terminal fragments and is highly neuro- toxic in vivo (Neumann et al., 2006b).

The two major subtypes of FTD are FTLD-TDP with TDP-43 inclusions and FTLD-tau with tau-pathology and tau-positive inclusions. Around 50% of FTDs show TDP-43 inclusions and 40% are positive for tau (Ferrari et al., 2011). Besides these two major subtypes several more uncommon forms exist, including FTLD-FUS with FUS-positive inclusions (Mackenzie et al., 2010). The FTLD-TDPs are generally negative for tau-, α- synclein, β-amyloid, neuronal intermediate filaments and expanded polyglutamine anti- bodies but positive for TDP-43 and ubiquitin in immunohistochemical staining (Mac- kenzie et al., 2010; Neumann et al., 2007). Mutations in the MAPT gene lead to FTLD- tau (Mackenzie et al., 2010). The FTLD-TDPs are associated with mutations in different genes and are further classified into types 1 to 4 depending on their histopathological features (Cairns et al., 2007a; Mackenzie et al., 2010). FTLD-TDP type 4 is linked to mutations in the VCP gene (Cairns et al., 2007a, 2007b). This subtype is characterized by numerous neuronal ubiquitinated intranuclear inclusions (NIIs) and relatively few neuronal cytoplasmic inclusions (NCIs) and dystrophic neurites (DNs) positive for TDP-43 as well as frontotemporal neuronal loss and gliosis (Cairns et al., 2007a; Jo- sephs, 2008). These inclusions are mostly present in the motor neurons of the spinal cord, the temporal and the frontal cortex (Neumann et al., 2006b). In IBMPFD in contrast even fewer NCIs and more NIIs as well as DNs than in isolated FTD are evident and TDP-43 positive inclusions are mostly present in the temporal and the frontal and parietal lobe (Forman et al., 2006). The hippocampus also shows few NIIs which are not present in FTD (Forman et al., 2006). In sporadic ALS (sALS) degeneration is mostly present in the upper and lower motor neuron systems with Bunina bodies in anterior horn cells as well as ubiquitin positive TDP-43 NCIs rather than NIIs (Mackenzie et al., 2007), whereas SOD1-related familial ALS cases do not show ubiquitin positive TDP-43 inclusions but Lewy body-like hya- line inclusions (Tan et al., 2007). Familial ALS cases with symptoms of dementia but no known mutation display a pathology similar to sALS, although more NCIs can be found in the motor cortex than in sALS cases (Mackenzie et al., 2007). It has been shown that mutations in the TARDBP gene encoding the protein TDP-43, cause fALS

with TDP-43 inclusions in anterior horn cells of the spinal cord as well as in the limbic system and mutations in this gene can also lead to FTD (Benajiba et al., 2009; Van Deerlin et al., 2008). Nevertheless only 1-4% of ALS patients with TDP-43 inclusions are thought to have a TARDBP mutation (Gitcho et al., 2008; Sreedharan et al., 2008; Van Deerlin et al., 2008). This is emphasized by the finding that cases with ALS and a VCP mutation displayed loss of motor neurons in the spinal cord and also ubiquitin positive TDP-43 inclusions and Bunina bodies analogous to the pathology in sALS and fALS with TARDP mutations (Johnson et al., 2010). Therefore it is likely that sALS and SOD1-negative fALS as well as FTD and IBMPFD share a related pathological mechanism based on ubiquitin/TDP-43 inclusions. TDP-43 is a 43kDa protein associated with RNA processing and transcription repres- sion, consisting of two RNA recognition motifs (RRMs) and a glycine rich C-terminal region (Brady et al., 2011; Ou et al., 1995; Sephton et al., 2011). It is thought to be part of the heterogeneous nuclear ribonucleoprotein (hnRNP) complex mediating mRNA splicing, stability and transport (Krebs and Paisán-Ruiz, 2012; Sephton et al., 2011; Thomas et al., 2013). TDP-43 is able to bind RNA directly and the RNA targets include genes involved in synaptic function, neuronal development and also in neurodegenera- tion for example progranulin (GRN) and tau (MAPT) (Sephton et al., 2011). The mislocalization of the cleaved 25kDa form of TDP-43 from the nucleus to the cytoplasm is believed to be a cause for neurodegenerative diseases, especially ALS and FTD (Brady et al., 2011; Liu et al., 2015; Thomas et al., 2013), but the underlying mechanism is not yet clear. It has been proposed that gain of cytoplasmic TDP-43 results in impaired RNA processing due to loss of nuclear TDP-43; furthermore cytoplasmic TDP-43 could lead to extensive binding of cytoplasmic RNA and therefore to abnormal protein synthesis comprising regular cell function (Thomas et al., 2013). Another possible mechanism is the forming of aggregates leading to toxicity (Thomas et al., 2013). Protein aggregates are oligomeric complexes consisting of damaged proteins which are structured or amorphous (Kopito, 2000). They are commonly insoluble and metabolically stable under physiologic conditions (Kopito, 2000). They can be degraded through UPS or autophagy and likewise it has been shown that the degradation of TDP-43 aggregates is facilitated by both systems (Brady et al., 2011). Since VCP plays a role in autophagy and the UPS (see 1.7.4 and 1.7.5) it has been proposed that the protein might act as a mediator between the two systems leading target substrates to the appropriate degradation pathway (Thomas et al., 2013) and that VCP mutations could disrupt this function. Furthermore it has been shown that mutant VCP causes relocalization of TDP-43 to the

cytoplasm and that both proteins seem to interact, even increasing neurotoxicity and aggregation (Ritson et al., 2010). The WASH complex including KIAA0196 (see 1.6.3) plays a role in endosomal transport and interacts with VCP (see 1.5.6 and 1.7.8) and mutations in KIAA0196 cause spastic paraplegia type 8 (see 1.7.2). It has been suggested that mutations in VCP or indirectly in proteins of the WASH complex such as KI- AA0196 lead to impaired protein degradation, for example TDP-43, because of disruption of either autophagy or proteasomal pathways interlinking the pathogenesis of neurodegenerative diseases (Neumann et al., 2007; Thomas et al., 2013). Therefore the em- phasis of this thesis was laid on VCP and KIAA0196.

1.5 Valosin-Containing-Protein (VCP)

VCP (97-kDa valosin-containing protein) belongs to the family of Type II AAA+ ATPases (ATPases associated with a variety of cellular activities) (Latterich and Patel, 1998). AAA ATPases have either one (type I) or two (type II) AAAmotifs consisting of 230-250 amino acids with a Walker A and Walker B motif and an additional second region of homology (SRH) (Latterich and Patel, 1998). These ATPases bind and hydro- lyze ATP. The energy released by the hydrolysis leads to conformational changes of the ATPases and to a mechanical motion translated into conformational changes of other macromolecules (Bar-Nun and Glickman, 2012). VCP is therefore a protein associated with many cellular functions, such as cell cycle, membrane fusion and ubiquitin- dependent protein degradation (Wang et al., 2004).

1.5.1 Gene

The VCP gene is located on chromosome 9p13.3 (Johnson et al., 2010) and contains 17 exons (see Figure 1). The protein is highly conserved and can be found in yeast (CCDC48), Drosophila (TER94), Xenopus (p97) and archaebacteria (VAT) as well as in plants and mammals (VCP) (Wang et al., 2004). It is expressed in all tissues to a variable extent and also in the brain (Hirabayashi et al., 2001). VCP is a highly abundant protein and was found in HeLa cells with a copy number of 2.7x106 per cell (Zeiler et al., 2012).

Figure 1: Localization of VCP on chromosome 9 1.5.2 Structure

The VCP molecule shows a ring structure composed of six protomers (see Figure 3). Each protomer has two AAA motifs, the D1 domain, enabling VCP to bind nucleotides, and the D2 domain; conducting the majority of hydrolysis (Briggs et al., 2008) (see Figure 2). An N-D1 linker and D1-D2 linker connect the domains. The D1 and D2 domains each also have a Walker A and B motif as well as SRH which supports hydrolysis and substrate binding. Besides the C-terminal tail, VCP contains a mobile N-domain. The N-domain facilitates the recognition and association of cofactors and substrates and its position is influenced by the conformational state of VCP (Briggs et al., 2008; Da- vies et al., 2008; Pye et al., 2006; Stolz et al., 2011).

Figure 2: Primary structure of the VCP protein The ring structure of the molecule is composed of the D1 and D2 domains whereby part of the SRH motif of D1 is located at the adjoining protomer (Stolz et al., 2011). The N- domain surrounds the D1 domain (see Figure 3). As stated above the D2 domain is the major contributor to hydrolysis especially at physiological temperatures (38°C). But the D1 domain displays a higher activity at elevated temperatures with a maximum at 60°C.

It was therefore suggested that the D1 domain mediates heat-induced activity (Song et al., 2003) which further implies that VCP contributes to cellular stress response.

Figure 3: Quaternary structure of the VCP protein It is not yet known how the substrate is handled by the VCP molecule. It has been suggested that the substrate has to pass through the ring structure although studies have shown that substrate interacts mainly with D2 whereas D1 is considered to maintain the interactions between the six protomers (DeLaBarre et al., 2006). Therefore it has been proposed that substrates partially enter the VCP ring at a D2 entry port built up of an arginine double ring (Arg586/Arg599), and either leave it through the entry port or through transient pores between D1 and D2 (DeLaBarre et al., 2006).

The VCP protein is modified after translation by acetylation and phosphorylation. Sev- eral modification sites throughout the protein have been reported. It is assumed that these modifications impact the function of VCP, i.e. regulate the activity of ATP hydrolysis and ATP binding (Mori-Konya et al., 2009).

1.5.3 Biological Functions

VCP plays an integral part in a number of cellular processes (see Figure 4).

Figure 4: Functions of VCP

In order to be directed to several cellular pathways VCP has been found to associate with around 30 different cofactors (Meyer and Weihl, 2014) including the cofactors Ufd1 (ubiquitin fusion degradation 1), Npl4 (nuclear protein localization homolog 4), and NSFL1 cofactor p47 as well as other UBX or UBX-like proteins. These cofactors are either able to bind to the N-terminal region or the C-terminal region and influence the activity of VCP (Meyer et al., 2012). The factors can be roughly divided into two groups, substrate-recruiting factors and substrate-processing factors. Substrate- recruiting factors function as adaptors and are able to bind VCP as well as other ubiquitinated proteins acting as a mediator between VCP and its substrates. They also help VCP localizing to specific cellular sites for example the endoplasmatic reticulum. Sub- strate-processing factors directly impact and change the substrate, for example the E3 ubiquitin ligase in the ERAD pathway (see 1.7.4) (Schuberth and Buchberger, 2008).

1.5.4 Role of VCP in ERAD

As mentioned above (see 1.4), it has been proposed that multisystem proteinopathies such as ALS, FTD and IBMPFD are a result of impaired degradation pathways and therefore a result of accumulation of protein aggregates such as TDP-43. VCP is in-

volved in the endoplasmic reticulum-associated protein degradation (ERAD). During this process misfolded and poorly assembled proteins are transported from the lumen of the ER (retrotransportation) to the cytosol and are ubiquitinated. The ubiquitinated proteins are then degraded by the 25S proteasome (Wang et al., 2004). The initiation of ubiquitination of the substrate at the outer membrane of the ER is performed by the ubiquitin-activating enzyme 1 through binding the ubiquitin protein along with ATP and passing it to the ubiquitin-conjugation enzyme 2 (see Figure 5). This enzyme binds the E3 ubiquitin ligase, which binds the substrate and transfers ubiquitin resulting in an iso- peptide bond between ubiquitin and a lysine residue of the substrate. It is possible to create ubiquitin chains using lysine residues or the N-terminal methionine of the already attached ubiquitin (Behrends and Harper, 2011). VCP is able to bind the ubiquitinated substrate in complex with Ufd1 and Npl4 which serve as adaptors (Meyer et al., 2000). The VCP complex then guides the substrate to the proteasome where it is degraded. Furthermore it has been suggested that VCP is involved in the translocation of misfolded proteins from the ER to the cytosol (Ye et al., 2004).

It has been shown that mutant VCP leads to accumulation of ubiquitinated proteins, which implies that VCP plays a major role in sorting proteins to the UPS system (ubiquitin-proteasome-system) (Dalal et al., 2004) Since TDP-43 is degraded by both systems (Brady et al., 2011) it is possible that mutant VCP fails in guiding accumulated TDP-43 to the UPS.

Figure 5: ERAD pathway

1.5.5 Role of VCP in Autophagy

Besides the contribution to ERAD, VCP plays also a role in autophagy. Whereas the UPS, responsible for ERAD is the major contributor to the degradation of short-lived proteins, macroautophagy (henceforth referred to as autophagy) is a cellular technique for degrading cell organelles, long-lived proteins and protein aggregates. It is assumed that UPS and autophagy are two pathways, which act in a parallel yet independent manner. It is not clear if these pathways interlink but one possibility is the formation of aggresomes (Ju et al., 2008). Aggresomes are pericentriolar inclusion bodies that contain misfolded or aggregated protein. They are formed in response to cellular stress or over- expression of a mutant protein as well as inhibition of proteasomes (Johnston et al., 1998) and are cleared by autophagy. It has been proposed that aggresomes might be a depot storing abnormal proteins until degradation, resulting in a more efficient autophagy process (Kopito, 2000). Polyubiquitinated misfolded proteins coaggregate and build aggrosomal particles which are transported via retrograde transport by the microtubule system to the MTOC (microtubule organizing center) where the particles are merged into an aggresome and cleared by autophagosomes which later fuse with lysosomes (Rodriguez-Gonzalez et al., 2008). The clearance of aggresomes by macroautophagy is termed aggrephagy (Lamark and Johansen, 2012).

Evidence exist, that VCP plays a role in aggrephagy. VCP-depleted cells and cells expressing a VCP molecule carrying an IBMPFD mutation showed an enrichment of autophagosomes, unable to evolve into mature autolysosomes, and autophagosomal degradation was interrupted (Ju et al., 2008). The forming of aggresomes is not only mediated by VCP but also HDAC6, a histone deacetylase, and dynein and depends upon the microtubule system of the cell (Iwata et al., 2005; Johnston et al., 1998). It has been shown that HDAC6 directly interacts with VCP and that an increase of HDAC6 leads to formation of aggresomes whereas an increase of VCP induces UPS degradation. It was therefore proposed that the balance between VCP and HDAC6 decides on whether the protein is directed to the UPS or the aggresomal pathway (Boyault et al., 2006). Based on this hypothesis Ju and Weihl (2010) proposed another model in which VCP acts as a mediator between the UPS and autophagy pathway by recognizing a proteasomal or autophagic protein and directing it to the destined pathway by association with either HDAC6 or Ufd1 and Npl4 (see Figure 6) (Ju and Weihl, 2010). On the other hand VCP might guide the protein based upon the concentration of the cofactors Ufd1/Npl4 and HDAC6 in the cell and therefore leaving it to other cellular mechanisms to decide which

pathway to take under specific circumstances (Dargemont and Ossareh-Nazari, 2012; Ju and Weihl, 2010). This model is emphasized by the finding that mutant VCP proteins show a higher affinity for misfolded proteins and become a trap not allowing degradation in either the UPS or the autophagy pathway which results in an accumulation of undegraded ubiquitinated protein (Ju and Weihl, 2010).

In addition it has been shown that VCP influences autophagosome maturation. Tresse et al. (2010) performed an RNAi-mediated knockdown of VCP/p97 in Mouse embryonic fibroblasts (Tresse et al., 2010). These cells displayed an accumulation of immature autophagosomes and a higher concentration of p67, which is a marker for impaired autophagy. Furthermore they showed that mutant VCP impairs autophagy as well and that the accumulated autophagosomes displayed ubiquitin positive material indicating once more that VCP is associated with the degradation of ubiquitinated proteins (Tresse et al., 2010).

Figure 6: Possible role of VCP in UPS/Proteasome pathway Oxidative stress induces autophagy (Chen et al., 2007) and inhibition of UPS leads to forming of stress granules (SG) (Mazroui et al., 2007). Thus it has been proposed that inhibition of either autophagy or the UPS prompts an increase of oxidative stress species and forming of stress granules. Stress granules are cytoplasmic rinbonucleoprotein granules (RNP) consisting of RNA and RNA binding proteins storing non-translated 24

complexes accumulating under circumstances of stress (Kedersha et al., 2005; Kim et al., 2013a), leading to sequestration of TDP-43 (Thomas et al., 2013) and therefore possibly to multisystem proteinopathies, such as ALS/FTD/IBMPFD.

1.5.6 Role of VCP in Endocytosis

VCP is also thought to play a role in endocytosis. Ramanathan and Ye (2012) showed that VCP associates with endosomes and that depletion of VCP leads to enlarged Early- Endosome-Antigen 1 (EEA1)-containing endosomal structures as well as a higher concentration of oligomerized EEA1 (Ramanathan and Ye, 2012). In addition to that, VCP binds caveolin 1 (CAV1) and facilitates sorting of the ubiquitinated form to endolyso- somes for degradation (Ritz et al., 2011). These findings suggest that VCP is involved in endolysosomal pathways, especially concerning the ubiquitin-dependent membrane sorting at endosomes (see 1.7.8).

1.5.7 Other Functions of VCP

Besides VCP’s contribution to the ERAD, autophagy and endocytosis it has been shown that it also takes part in ribophagy, allowing the targeted degradation of ribosomes (Os- sareh-Nazari et al., 2010), and nonfunctional rRNA decay (NRD) (Fujii et al., 2012) as well as mitophagy, which is another selective autophagy pathway (Kim et al., 2013b). Furthermore VCP plays a role in cell cycle progression (Müller et al., 2007), mediates apoptosis by degradation of apoptotic factors and supports segregation of chromosomes (Meyer et al., 2012).

VCP enables the fusion of membranes of the endoplasmic reticulum (Latterich et al., 1995) and in complex with p47, VCP also mediates Golgi reassembly (Meyer and Weihl, 2014). Hence it has been proposed that VCP plays a general role in membrane fusion processes and organelle maintenance.

1.5.8 Mutational Spectrum of VCP

Figure 7: Mutational spectrum of VCP There are currently 41 known mutations in the gene VCP (see Figure 7). The mutations R159C, R159G, R159H, R155H, R155C, R191Q, A232E have been found in patients with fALS and sALS as well as IBMPFD, whereby R155H is most common (Abramzon et al., 2012; Johnson et al., 2010; Koppers et al., 2012; Kwok et al., 2015; Mehta et al., 2013). The mutations I151V and D592N along with R662C in the D2-region were exclusively found in patients with ALS (Abramzon et al., 2012; Johnson et al., 2010; Kwok et al., 2015), whereas the mutation R191C was found in a patient with symptoms of SPG8 (see 1.6.6). A single base substitution c.-360G>C and a 18bp hexanucleotide expansion c.-221_-220insCTGCCACTGCCACTGCCG in the 5’UTR region were recently described in patients with ALS and predicted to be pathogenic, possibly inter- rupting the 5’regulatory region (Kwok et al., 2015). Most mutations are located between the end of the N- and the D1-region and it is assumed that they do not cause a global loss of function of VCP but impair certain functions of the molecule (Meyer and Weihl, 2014). On the one hand it has been shown that mutations (R155H, R155P, R191Q, A232E) increase ATP hydrolysis leading to a destabilization of the N-D1 domain (Niwa

et al., 2012). On the other hand mutations could impair the association with certain cofactors (Ritz et al., 2011) or the autophagy and UPS pathways (see 1.4).

1.6 KIAA0196 and the WASH Complex

KIAA0196, also called strumpellin, is one of the co-factors in the WASH complex (see Fig 8), a protein complex involved in the nucleation process of actin, serving as an important interface for endosomal trafficking and membrane scission. Mutations in KI- AA0196 cause an autosomal dominant form of spastic paraplegia, a progressive upper- motor neurodegenerative disease.

1.6.1 Sructure and Localization of the WASH Complex

Besides KIAA0196, the WASH complex includes the proteins FAM21, CCDC53, CapZa, CapZb and SWIP (KIAA1031) (Derivery et al., 2009) which are linked to the WAHD1 domain of the core protein WASH1 (WAS protein family homolog 1) by FAM21 (see Figure 8). The WASH1 protein is a nucleation-promoting factor (NPF) and member of the Wiskott-Aldrich-Syndrome Protein family which also includes the NPFs WASP, N-WASP, WAVE/Scar, WHAMM and JMY (Duleh and Welch, 2010).The WASH1 protein consists of an N-terminal region, called WASH Homology Domain (WAHD) with the aforementioned WASH homology domain 1 (WAHD1) and the tubulin-binding region (TBR) which is able to directly bind tubulin (see Figure 8) (Gomez and Billadeau, 2009). This region is followed by a proline stretch and the C-terminal region with a VCA (Verprolin-Connecting- Acidic) element. The VCA element is able to bind actin and Arp2/3 (Rottner et al., 2010). Studies have shown that the depletion of certain members of the WASH complex leads to a reduction of the WASH1 protein itself. Therefore it is assumed that the proteins rely on each other for proper function and for stability of the WASH complex (Derivery et al., 2009).

Figure 8: Primary structure of the WASH1 protein and the associated WASH-complex

WASH1 and therefore the WASH complex was found to be associated with SNX1, a protein positioned at endosomes, implying that WASH itself is localized at endosomes (Harbour et al., 2010). This confirms the findings of Derivery et al. (2009) who found WASH1 to be associated with the protein Rab5, involved with endosomal fusion, and therefore suggested that localization of WASH1 and the WASH complex is restricted to endosomal membranes (Derivery et al., 2009).

1.6.2 Biological Function of WASH1 and the WASH Complex

It has been proposed that WASH1 and the WASH complex play a role in early endosomal membrane dynamics in the recycling pathway (Derivery et al., 2009). Endosomal trafficking enables the internalization of molecules from the extracellular compartment. After internalization molecules reach early endosomes, also called sorting endosomes, and are sorted towards the lysosomal pathway for degradation, the fast or the slow recycling pathway (van Kerkhof et al., 2001). In the slow recycling pathway the proteins are transported to the endocytic recycling compartment (ERC) from the early endosomes with the help of emerging transport tubules and actin (Freeman et al., 2013; Grant and Donaldson, 2009). It is assumed that the ERC in cooperation with the microtubule organizing center (MTOC) sorts the molecules in recycling endosomes (RE) (Grant and Donaldson, 2009) which are transported to the cell surface. It has been suggested that the WASH1 protein and the WASH complex initiate actin synthesis at early endosomes, contributing to a separation of transport tubules from the early endosomes (Derivery et al., 2009). Furthermore it is believed that actin polymerization inititated by the WASH complex along with dynamin 2 is involved in severing emerging transport tubules from the early endosomes (Duleh and Welch, 2010; Freeman et al., 2013). Therefore the WASH complex seems to play a major role in trafficking between early and recycling endosomes.

As mentioned above (see 1.5.5) it is assumed that polyubiquitinated proteins coaggregate and that aggresomal particles are transported via retrograde transport to the MTOC where single aggresomal particles merge into an aggresome which is cleared by autophagy (Rodriguez-Gonzalez et al., 2008). It could be possible that the WASH complex, which is located in close proximity to the MTOC, also plays a role in sorting aggresomal particles at the MTOC. A mutation in members of the WASH complex could lead to impaired clearance of aggresomal particles resulting in sequestration and pathological protein aggregates.

Moreover the WASH complex could influence the UPS and autophagy through enabling endosomal trafficking of receptors and signaling molecules important for these pathways and a mutant WASH complex could therefore directly lead to disruption of protein degradation.

Furthermore the WASH complex, more precisely KIAA0196, interacts with VCP (Clemen et al., 2010). As stated above, VCP is a contributor to aggrephagy, UPS and endosomal sorting. If the function of VCP relied on the WASH complex, an impaired WASH complex could indirectly harm proper functioning of VCP (see 1.6.6) and thus might also be involved in the pathogenesis of ALS/FTD.

1.6.3 Gene, Protein Structure and Expression of KIAA0196

The single copy gene KIAA0196 is located on chromosome 8q24.13, comprises 59.7 kb and consists of 28 exons encoding a protein of 1,159 aminoacids (KIAA0196) (see Fig- ure 9).

Figure 9: Localization of KIAA0196 on chromosome 8 KIAA0196 encompasses an N-terminal-part spanning from aminoacid 1 to 240 with six -helices and two -strand segments. The second domain includes five spectrin repeats with three -helices each, spanning from 241 to 791 (see fig. 4). The structure of the spectrin repeats 1, 3, and 5 is different from the general spectrin repeat structures, because the tryptophan at position 17 of the first -helix is replaced by phenylalanine. The third domain is the C-domain that spans from 792 to 1159. KIAA0196 is expressed in most tissues (heart, lung, liver, kidney pancreas, testis, thymus, small intestine, colon, leukocytes) and in different areas of the brain (Clemen et al., 2010). Furthermore it has been reported to be increased in prostate adenocarcinoma cells (van Duin et al., 2005).

KIAA0196 is expressed in the cytosol and at the endoplasmic reticulum and contains highly conserved areas (Clemen et al. 2010).

1.6.4 Spastic Paraplegia Type 8

Mutations in KIAA01196 cause an autosomal dominant form of spastic paraplegia (SPG), a progressive upper-motor neurodegenerative disease named SPG8. The major feature of SPG is bilateral spastic weakness of the lower extremity and the disease is normally associated with a genetic mutation (Fink, 2013). There are more than 50 types of SPG known with an approximated prevalence of 1.2-9.6 per 100,000 inhabitants (Fink, 2013). Symptoms of the uncomplicated form of SPG are generally less severe. Besides a progressive spasticity of the legs along with mild deterioration of vibration sensation, a hypertonic urinary bladder can occur (Fink, 2014). The complicated form additionally comprises involvement of other systems and therefore symptoms such as seizures, peripheral neuropathy and dementia (Fink, 2013). Patients with SPG8 commonly show symptoms of the uncomplicated form and besides the spasticity have hyperreflexia and extensor plantar responses in the lower extremity (Fink, 2014). Unlike other uncomplicated SPG forms, symptoms in SPG8 are typically more severe and many patients become wheelchair-dependent between the age of 30 and 40 (Hedera et al. 1999; Rocco et al. 2000). The average onset has been reported to be between 18 and 26 years, but individuals with an onset of 22 to 60 years have been described (Hedera et al., 1999; Rocco et al., 2000). Genetic anticipation is not a feature of SPG8 (Rocco et al., 2000). Symptoms are caused by axonal degradation of corticospinal fibers, and a marked spinal cord atrophy in an MRI of an affected individual has been shown (Hedera et al., 1999).

Only recently a novel mutation in KIAA0196 was described as a cause for an autosomal- recessive form of Ritscher-Schinzel/3C-Syndrome (Elliott et al., 2013). The locus of the gene was first described in an affected family in 1999 (Reid et al., 1999) and the gene KIAA0196 was identified in 2007 (Valdmanis et al., 2007). The Ritscher-Schinzel/3C syndrome comprises craniofacial abnormalities (hypertelorism, macrocephaly, downslanting palpebral fissures, low-set ears), congenital heart defects, anal atresia, genital abnormalities, developmental disorder with delayed psychomotor development and brain malformations (“Dandy Walker malformation”, vermis hypoplasia) (Kosaki et al., 1997).

1.6.5 Gene, Function and Mutations

The exact function of KIAA0196 is not yet known. As mentioned above, KIAA0196 features spectrin repeats (see Figure 10). Spectrin repeats consist of three -helices and are involved in the actin-cytoskeletal network and can connect to cell membranes. It has been proposed that spectrin repeats in KIAA0196 interlink with cytoskeletal repeats and take part in protein localization or signal transduction (Valdmanis et al., 2007).

Besides three mutations (c.3335+2T>A; c.3335+4C>A; c.3335+8A>G) that have been discussed to cause Ritscher-Schinzel/3C-Syndrome (Elliott et al., 2013), so far nine mutations causing SPG8 have been described. The mutations G696A (Bot et al., 2013), I226T (Bettencourt et al., 2013), V620A (Jahic et al., 2014), R583S (Ishiura et al., 2014), S591P (Wang et al., 2014), L619F, V626F, N471D (Valdmanis et al., 2007) and g.ex11-15 del (Ishiura et al., 2014) are all in highly conserved areas of the gene.

Figure 10: Primary structure of KIAA0196 with known mutations The breakpoints of the deletion were found in intron 10 and exon 15, deleting exon 10 to 15 in the cDNA. This deletion was predicted to result in a premature stopcodon. Moreover three mutations have been investigated in more detail. L619F and V626F are located in a highly conserved area within an -helix neighboring another -helix, indi-

cating that mutations at this location could impair the stability of the -helix and cause major changes to the protein structure (Valdmanis et al., 2007). Both mutations were studied in a zebrafish model. Knockdown of KIAA0196 in this model led to a curly- tailed phenotype with an enlarged heart cavity and short and deformed axons of motor- neurons (Valdmanis et al., 2007). Clemen et al. (2010) confirmed the knockdown phenotype in zebrafish and noted that the cardiac failure is based on a systolic dysfunction (Clemen et al., 2010). Moreover they showed that a knockdown of KIAA0196 in neu- roblastoma cells led to reduced axonal growth (Clemen et al., 2010). These findings suggest that KIAA0196 is an important factor for neuronal and early embryonic development.

Injection of human wildtype mRNA in knockdown zebrafish rescued the impaired phenotype to a certain degree (Valdmanis et al., 2007). In contrast, introducing the above mentioned mutations by injection of mutated human mRNA into wildtype zebrafish did not lead to an impaired phenotype, suggesting that these mutations do not have a dominant negative effect (Valdmanis et al., 2007). Another mutation, N471, was studied in in vitro wound healing assays. Knockdown of KIAA0196 led to delayed wound healing, but a N471 mutant did not show any impact on wound-closure velocities (Clemen et al. 2010). Therefore Clemen et al. (2010) proposed that mutations in KIAA0196 are corre- lated with loss-of-function of the protein and that the cellular concentration of KI- AA0196 plays a role in the pathogenesis of SPG8 (Clemen et al., 2010). Similarly, a mutation analysis in eight patients with the developmental disorder Ritscher- Schinzel/3C-syndrome in a First Nations cohort in Canada revealed three homozygous mutations in KIAA0196, whereby all parents of the patients were heterozygous carriers for the mutations. The c.3335+2T>A mutation was predicted to cause a splice site change, resulting in skipping of exon 27 and a loss of 29 highly conserved amino acids. Although this region of KIAA0196 has not yet been described further, a western blot analysis of a patient sample showed that the cellular concentration of KIAA0196 was reduced by 60%. This supports the idea that KIAA0196 is involved in cellular and especially neuronal development and a reduction could cause impairment even resulting in severe neurodevelopmental disorders such as Ritscher-Schinzel/3C-syndrome.

KIAA0196 is a member of the WASH complex (see 1.5.3) (Derivery et al., 2009). Freeman et al. (2013) studied the effect of the mutations L619F, V626F, and N471 on the assembly of the WASH complex and its interactions with retromer, another protein complex, in neuronal and HeLa cells, but did not detect any significant changes (Free-

man et al., 2013). KIAA0196 was integrated into the complex and interaction of the WASH complex and cellular distribution was normal (Freeman et al., 2013). In contrast, knockdown of KIAA0196 resulted in delocalization of the WASH1 protein, suggesting that knockdown of KIAA0196 impacts localization of WASH complex components (Harbour et al., 2010). Based on these findings, Freeman et al. (2013) suggested that mutant KIAA0196 might affect the recruitment of an unknown cofactor, which causes impaired function of the complex (Freeman et al., 2013).

The depletion of KIAA0196 leads to increased tubulation, which was also found in cells lacking the WASH1 protein (Harbour et al., 2010). This finding was not confirmed in cells expressing mutant KIAA0196 (Freeman et al. 2013). It was suggested that cells show a co-expression of impaired WASH complexes incorporating mutant KIAA0196 and WASH complexes with wild-type KIAA0196 and that neurons rely on a sufficient number of functioning WASH complexes because of their axonal length (Freeman et al. 2013). Therefore a reduction of functioning WASH complexes based on a mutant KI- AA0196 could explain a neurodegenerative phenotype such as spastic paraplegia (Freeman et al. 2013).

1.6.6 VCP, KIAA0196 and the WASH Complex

In 2010 Clemen et al. reported the finding that VCP associates with KIAA0196, a member of the WASH-complex (Clemen et al., 2010). They showed that KIAA0196 directly interacts with VCP and both proteins were identified at the endoplasmic reticulum and the cytosol and concluded that VCP and the WASH complex might interact in endosomal trafficking and membrane organization (Clemen et al., 2010). This is supported by the finding that VCP as well as WASH play a major role in endocytosis and that depletion of either protein leads to enlarged endosomes (Duleh and Welch, 2010; Ramanathan and Ye, 2012; Tanabe et al., 2011). Besides, VCP was found to directly mediate the transport of proteins to the endolysosomal pathways (Ritz et al., 2011). Taking into account the extensive functions of VCP especially in ERAD, endocytosis and autophagy, it is possible that VCP and WASH facilitate endosomal transport and protein degradation together and that impaired WASH could lead to impaired functioning of VCP, resulting in abnormal cellular transport and protein aggregates.

Bot et al. (2012) reported two brothers with a VCP mutation (R159C) and symptoms of spastic paraplegia as well as Paget’s disease of the bone and lower motor neuron impairment with active denervation in EMG, a sign for ALS (Bot et al., 2012). They pre-

sented with a slow progression of spasticity of the legs over a period of 10 years, where- fore the authors concluded that ALS was unlikely and the EMG-findings could be a sign for co-existing motor neuron involvement (Bot et al., 2012). It has to be noted, that this particular mutation has been found in a patient with IBMPFD (Bersano et al., 2009) and that patients with IBMPFD sometimes show involvement of the peripheral nervous system (Miller et al., 2009). In another family the mutation R191Q caused an isolated ALS phenotype (Johnson et al., 2010). Because of the mixed phenotype with spasticity along with pathological findings typical for ALS in the two reported brothers, it has been proposed that a normal VCP protein is needed for proper functioning of KIAA0196 and that a mutant VCP might indirectly damage endosomal trafficking by impairing the WASH complex (Bot et al., 2012). Clemen et al. (2012) showed that in a VCP haploin- sufficient mouse model the expression of KIAA0196 as well as WASH, SWIP, FAM21C, CapZα1, CapZβ and CCDC53 were upregulated (Clemen et al., 2012). They proposed that VCP and WASH might form a macromolecular complex enabling membrane trafficking and that the different phenotypes associated with mutations in VCP cause changes to this macromolecular complex (Clemen et al., 2012). On the other hand KIAA0196 might act as a mediator or link, facilitating the interaction between VCP and the WASH complex and mutations in KIAA0196 could result in a disruption of this interaction. An impaired VCP-WASH interaction could therefore lead to defects in cellular trafficking and development as well as protein degradation, resulting in protein aggregates and neurodegenerative diseases.

2 Objective

Based on the suspected biological interaction between VCP and KIAA0196 (as a member of the WASH complex) and the somewhat overlapping phenotypes associated with mutations in these genes, this dissertation aimed at evaluating the role of mutations in VCP and KIAA0196 in a specific phenotype, namely FTD with ALS. To reach this aim, a cohort of 48 FTD patients with ALS was screened for mutations in the VCP and KI- AA0196 gene using Denaturing-High-Performance-Liquid-Chromatography (DHPLC). DNA samples showing deviating curves were subsequently sequenced to identify the underlying sequence variation. This analysis should reveal information about the frequency of VCP and KIAA0196 mutations in ALS and FTD and potentially broaden the mutational spectrum. Work was conducted as part of a multi-center collaborative pro-

ject, with other groups evaluating the role of mutations in other genes of the WASH complex (such as WASH1 and others).

3 Material and Methods

3.1 Participants

The 48 DNA samples were obtained from 20 female and 28 male patients who presented at the Department of Experimental Neurology of the University Hospital Ulm between 2001 and 2012. All patients showed a clinically diagnosed FTD. 27 of the patients had a clinically definite ALS, 9 patients had a clinically possible ALS. 4 patients were diagnosed with a clinically probable ALS and 6 had a laboratory supported clinically probable ALS. One patient was diagnosed with an atypical motor neuron disease and one patient showed signs of a motor neuron disease, which could not be further classified. The age of onset was between 28 and 78 years. Death occurred in 25 patients whereby the time between age of onset and death was between 10 months and 153 months and the age at death was between 47 and 80 years. 14 patients showed initially bulbar symptoms and 34 patients showed spinal symptoms at the beginning of disease.

3.2 Reagents

3.2.1 Chemicals

Table 4: Chemicals

Chemical Manufacturer

Agarose Sigma Life Science

Boric acid AppliChem

Bromphenol blue Merck 7-Deaza-2´-deoxy-guanosine-5´- PEQLAB triphosphate; DEAZA-NTP Dexoxiribonukleotidtriphosphate/dNTP: PEQLAB PeqGOLD dNTP Ethylenediaminetetraacetic Acid (EDTA) Merck

Ficoll Type 400 AppliChem

Gene Craft Polyermase Gene Craft

Chemical Manufacturer

Glycerin Carl Roth

Oligonucleotides Metabion

Serva DNA Stain Clear G Serva

Taq DNA Polymerase Gene Craft

Trishydroxymethylaminomethane (Tris) Sigma Life Science

Tween-20 AppliChem

Xylene Cyanole Fluka

3.2.2 Solutions

Bidistilled water was used.

Table 5: Solutions

Composition (Concentration), Manufac- Solutions turer Agarose Agarose in TBE 1x, pH 8.3 (1.0-2.5%) Glycerin 30% BX-Buffer Xylene cyanol 0.25%

Bromphenol blue dNTP-Solution 2 mM dATP, dCTP, d.GTP, dTTP

160 mM (NH4)2SO4 670 mM Tris/HCL (pH 8.8) GC 10x Buffer 0.1% Tween-20 Biotherm

MgCl2-Solution 50 mM MgCl2 TrisCl (not specified) KCl (not specified) 10x PCR Buffer (NH4)2SO4 (not specified) MgCl2 (15mM), pH 8.0 Qiagen 90 mM Tris TBE-Buffer 1x, pH 8.3 90 mM Boric Acid 2mM EDTA Tris 10mM TE-Buffer EDTA 0.2mM Ficoll Type 400 15% XX-Buffer Xylen cyanole 0.25%

3.2.3 Kits

Table 6: Kits

Kit Composition (Concentration) Manufacturer DHPLC:

Buffer A: 5% 2 M TEAA 95% HPLC-H2O

Buffer B: 5% 2 M TEAA 25% Acetonitrile 70% HPLC-H2O Transgenomic

Buffer D (Column-Wash- 75% Acetonitrile Buffer): 25% HPLC-H2O

Buffer C (Syringe-Wash- 8% Acetonitrile Buffer): 92% HPLC-H2O

Sample Buffer (225µl) Reaction Buffer (225µl) Genomi Phi Kit GE Healthcare Enzyme Mix (25µl) Control DNA (Lambda) (20 µl) HotStar Taq DNA Polymerase (5u/µl) 2x PCR Buffer HotStar Mastermix TrisCl (not specified) Qiagen KCl (not specified) (NH4)2SO4 (not specified) MgCl2 (3mM) dNTP (400µMol of each dNTP) 3.2.4 Devices

Table 7: Devices

Device Manufacturer

Biofuge pico Hereaeus

Digital Scale Type 1475 Sartorius

DNA-Sequencer 3500XL ABI (Applied Biosystems Incorporated)

Fusion SL+Fusion Capt Advance Solo4 PEQLAB

Microwave Micromat AEG

Printer P95 Mitsubishi

Device Manufacturer

Power Supply Power Pac 300 BioRad Sequence-Analysis-Program SeqMan II, DNASTAR Vers. 5.03 Thermomix BU B. Braun

Vortex Genie 2 Scientific Industries WAVE® Nucleic Acid Fragment Analysis Transgenomic System 3500 Thermocycler Biometra

3.2.5 Materials

Table 8: Materials

Material Manufacturer

Microtiter plate + lids Thermowell Costar

3.2.6 Size Standard

Table 9: Size Standard

Size Standard Manufacturer pUC Marker; Fragment Length: Thermo Scientific 501, 489, 404, 331, 242, 190, 147, 111, 110, 67, 34, 34, 26

3.3 DNA

The DNA was isolated from peripheral blood samples according to the protocol by Mil- ler et al., 1988.

3.4 Reamplification

For DHPLC analysis the original DNA-samples had to be reamplified using the Genomi Phi V2-Kit from GE Healthcare. 1.5 µl of a 10ng/µl DNA solution of each sample was mixed with 13.5µl sample-buffer and heated for 3 minutes at 95°C to denature the dsDNA to ssDNA. The sample was cooled to 4°C to prevent the strands from renaturing. 13.5 µl of reaction buffer and 1.5µl enzyme solution was added and the sample was

incubated for 90 minutes at 30.0°C to synthesize the DNA. After that enzyme was inac- tivated by a 10 minute heat shock at 65°C and 75 µl of TE buffer was added. The samples were then tested by gelelectrophoresis in a 1% gel. The gel shows a single band for each sample with additional smaller fragments underneath. These are caused by break- ing of the long DNA strand during the process of synthesizing.

3.5 Primer Pairs

The primer pairs used for WAVE analysis and potential Sanger sequencing of the DNA samples were designed as intronic primers for the polymerase chain reaction (PCR) to analyze the exons and the adjacent splice sites. For better results tailed primers were used. Primer sequences and amplicon lengths for analysis of the 29 exons of the KI- AA0196 gene and the 17 exons of the VCP gene are listed in tables 10 and 11, resp.

Table 10: Tailed primer pairs for amplification of the KIAA0196 gene. The term F is used for the forward sequence and the term R for the reverse sequence. These primers include an M13-tail.

Primer Primer sequence Fragment length

KIAA0196_5UTREx1_F GTAAAACGACGGCCAGTTCTTGCGTCATCAGCCGTCG 299bp KIAA0196_5UTREx1_R CAGGAAACAGCTATGACGGGCGCGCTCACTCCAT KIAA0196_Ex2_F GTAAAACGACGGCCAGTTTTAGTGAGTTTGGGAGAAAAATGTG 497bp KIAA0196_Ex2_R CAGGAAACAGCTATGACCCAGAGAAAACACGCTTTTGTAGAA KIAA0196_Ex3_F GTAAAACGACGGCCAGTGAAATTGTCACCAACAAGTATGCTTT 329bp KIAA0196_Ex3_R CAGGAAACAGCTATGACCAGAGAGATTTACACGTTGCTATGTG KIAA0196_Ex4_F GTAAAACGACGGCCAGTAGAATGCCTGGCATCCTGC 285bp KIAA0196_Ex4_R CAGGAAACAGCTATGACAAAAAAAGTGATACTATGTTTGATATTCTTGAA KIAA0196_Ex5_F GTAAAACGACGGCCAGTCCTACCTTTTCCTTGAAATCTAAAACTTTT 329bp KIAA0196_Ex5_R CAGGAAACAGCTATGACGGGACATACACTGCATTTTACCG KIAA0196_Ex6_F GTAAAACGACGGCCAGTAATGGAATTCTACTTTATTGGACTTTTCAG 385bp KIAA0196_Ex6_R CAGGAAACAGCTATGACAAAGGAGTAATTAAAGAGGGAAGTGAAAT KIAA0196_Ex7_F GTAAAACGACGGCCAGTAGAGAGTTTAATTTGAGCATGTCTACGT 339bp KIAA0196_Ex7_R CAGGAAACAGCTATGACTGGGTTAAAGGCCAAAAGAATG KIAA0196_Ex8_F GTAAAACGACGGCCAGTTGCCTTCTATAACTTTAGTATTCAACCCT 335bp KIAA0196_Ex8_R CAGGAAACAGCTATGACTCTAAGTGATTATCTTCCAAATTCCTTG KIAA0196_Ex9_F GTAAAACGACGGCCAGTTGAATGTGATTTATTTTCAAGATAAATGACTT 331bp KIAA0196_Ex9_R CAGGAAACAGCTATGACTCCTGATTCTGAGAGTCTTTATGTGG KIAA0196_Ex10_F GTAAAACGACGGCCAGTGCTTATTACTTTTTAAATGGTTAAAATGAAG 365bp KIAA0196_Ex10_R CAGGAAACAGCTATGACGACAGAGCAAGCAATCCTAGTCTTT KIAA0196_Ex11_F GTAAAACGACGGCCAGTGCTGCCTAGTCTGGATTTTTCTCTTA 265bp KIAA0196_Ex11_R CAGGAAACAGCTATGACTGCACACATTCCAAACACACC KIAA0196_Ex12_F GTAAAACGACGGCCAGTTAAATTCAAAGCCACAGCTACAGG 285bp KIAA0196_Ex12_R CAGGAAACAGCTATGACGAACAGACTGCTGGGTGGGT

Primer Primer sequence Fragment length

KIAA0196_Ex13-14_F GTAAAACGACGGCCAGTGTGTGCTTTATTTGAAGTGTTTTCAAG 509bp KIAA0196_Ex13-14_R CAGGAAACAGCTATGACGAATGAGGTATGAATGAAGGCCA KIAA0196_Ex15_F GTAAAACGACGGCCAGTCCCAAATGTTTTGTTGTATGTTACATT 298bp KIAA0196_Ex15_R CAGGAAACAGCTATGACTGTATTTAAAACAGCAGTTATCTGGCA KIAA0196_Ex16 F GTAAAACGACGGCCAGTTTAGGCATCCTAATATTTGTCAGCC 349bp KIAA0196_Ex16 R CAGGAAACAGCTATGACGGTGGTCCCCAGAATATGGC KIAA0196 _Ex17 F GTAAAACGACGGCCAGTGTCTAACAGTGGGCTTTCAGTTGTAC 385bp KIAA0196_Ex17 R CAGGAAACAGCTATGACAATGTCAAACAGCCAGATGATGTC KIAA0196_Ex18 F GTAAAACGACGGCCAGTCCACTGCAGATTCTGAAAGCC 285bp KIAA0196_Ex18 R CAGGAAACAGCTATGACAGTCCATGCTGCAAGCTGG KIAA0196_Ex19 F GTAAAACGACGGCCAGTTCTGGCCTGCTATACTATTTAAAGTCTAGT 394bp KIAA0196_Ex19 R CAGGAAACAGCTATGACTGACATTTCTGAGGTTTGGGATG KIAA0196_Ex20 F GTAAAACGACGGCCAGTTAAAATTATATGGAAAAGGGATAACTAGGTTAT 299bp KIAA0196_Ex20 R CAGGAAACAGCTATGACGGGCCACAGATGCAGATGA KIAA0196_Ex21 F GTAAAACGACGGCCAGTGTCCTGTTGAGTCCTAACATCTCTTTAAG 371bp KIAA0196_Ex21 R CAGGAAACAGCTATGACTGGAAGAAAGGTTAAGTGAGTTCAAA KIAA0196_Ex22-23_F GTAAAACGACGGCCAGTGCATAGCATTTTAGGTAACTGGAGAATT 497bp KIAA0196_Ex22-23_R CAGGAAACAGCTATGACGATTTAATGACAAAAGAAAGAAGAGTAGCTT KIAA0196_Ex24_F GTAAAACGACGGCCAGTCTCCTCACTGTCACTCTGAAATGC 299bp KIAA0196_Ex24_R CAGGAAACAGCTATGACTTAAAAGAGTAAGAACTGAAGAAACTGGG KIAA0196_Ex25_F GTAAAACGACGGCCAGTCAATCACAGGCATGGTTGAGA 385bp KIAA0196_Ex25_R CAGGAAACAGCTATGACTCTGTTACCTGGGCCAAATACC KIAA0196_Ex26_F GTAAAACGACGGCCAGTGAAAGCCAAAGAGCAAATTGAAG 330bp KIAA0196_Ex26_R CAGGAAACAGCTATGACCATAGGCATTCTATACAAAAAGCTATTTAGTTA KIAA0196_Ex27_F GTAAAACGACGGCCAGTGGGCCCCAAACATTTTGAC 385bp KIAA0196_Ex27_R CAGGAAACAGCTATGACTTTCCCATCTCTATTAGGGCGA KIAA0196_Ex28_F GTAAAACGACGGCCAGTTGTTGGTAATTTAGTCTTTCAGGATTCT 285bp KIAA0196_Ex28_R CAGGAAACAGCTATGACCTGATGAATCCAGGGCCACTAT 41

Primer Primer sequence Fragment length KIAA0196_Ex29_F GTAAAACGACGGCCAGTGCTCCAAGGATATCTTTTCTTTTACG 415bp KIAA0196_Ex29_R CAGGAAACAGCTATGACAAATGTGTTCTGCTTTTATCTGATATAAATTG

Table 11: Tailed primer pairs for amplification of the VCP gene. The term F is used for the forward sequence and the term R for the reverse sequence. These primers include an M13-tail.

Primer Primer sequence Fragment length VCP_Ex1_F GTAAAACGACGGCCAGTCGGTGGGAGGAAGCGAGA 362bp VCP_Ex1_R CAGGAAACAGCTATGACGTCCACGGCCCCTCACTC VCP_Ex2_F GTAAAACGACGGCCAGTCTAAGTATGAGTTTTAGAGACTGGCGAG 291bp VCP_Ex2_R CAGGAAACAGCTATGACTGAGAAAAGAAACCTGGGAAAATC VCP_Ex3_F GTAAAACGACGGCCAGTTGCTGCTTACTCCCCGTCAG 319bp VCP_Ex3_R CAGGAAACAGCTATGACTAATGCAGGCTATCTCTGGCC VCP_Ex4_F GTAAAACGACGGCCAGTGACACCCAGTGCTTGGGC 300bp VCP_Ex4_R CAGGAAACAGCTATGACAAAGATGTTCCAAGGTTTATTCCCTA VCP_Ex5_F GTAAAACGACGGCCAGTCTAATGAGCTTGGCATTTTGACC 323bp VCP_Ex5_R CAGGAAACAGCTATGACCCACATGATGCCACACTGAGT VCP_Ex6_F GTAAAACGACGGCCAGTGGAATGATTTAGAGAAACTCAGCTTTTG 288bp VCP_Ex6_R CAGGAAACAGCTATGACCATTGGCACCACTTTAGACTTGATT VCP_Ex7_F GTAAAACGACGGCCAGTCGCTAGTCAAGCCATTTTAGGGT 289bp VCP_Ex7_R CAGGAAACAGCTATGACAAGGATGTGTTCATAAGTGCTCCA VCP_Ex8+9_F GTAAAACGACGGCCAGTATAACTGATTTTTGGGAGGAATTGG 495bp VCP_Ex8+9_R CAGGAAACAGCTATGACGGACCTAAGCAAGGACGGG VCP_Ex10_F GTAAAACGACGGCCAGTGCCTGTCTCTTACCTCTGGACTAGA 317bp VCP_Ex10_R CAGGAAACAGCTATGACCCAGAAATCAAAACCCATCTCC VCP_Ex11-12_F GTAAAACGACGGCCAGTGTCTCTGAGCCTCCTGC 518bp VCP_Ex11-12_R CAGGAAACAGCTATGACTTGACACCCTGAGATCACC VCP_Ex13_F GTAAAACGACGGCCAGTGTTTCTTTCAAAATGTGGAGGTAGC 355bp VCP_Ex13_R CAGGAAACAGCTATGACCTCTATTCCTTGCCCTCAGGC

Primer Primer sequence Fragment length VCP_Ex14_F GTAAAACGACGGCCAGTCACCACGTTTGCCTAGAGACATC 485bp VCP_Ex14_R CAGGAAACAGCTATGACTTGTCCAGAAACTAAAGAGCACTCC VCP_Ex15_F GTAAAACGACGGCCAGTGGTAGCCCAAAGATCTGCGTAT 332bp VCP_Ex15_R CAGGAAACAGCTATGACCTCCAGGGCATGGTGGTG VCP_Ex16-17_F GTAAAACGACGGCCAGTAATCCAGGCTGGGCTTTAACTAG 545bp VCP_Ex16-17_R CAGGAAACAGCTATGACACAAGGTCCAGGCAGGCC

3.6 Polymerase Chain-Reaction (PCR)

The polymerase chain reaction (PCR) is a method to amplify a DNA fragment. For the PCR the DNA template as well as forward and reverse primers, desoxynucleosidtri- phosphates and a polymerase are needed. The polymerase also requires additional cofactors such as MgCl2. The first step is to denature the dsDNA at 95°C to ssDNA. Sub- sequently the primers anneal generally at temperatures around 3°C below the melting temperature of the primers. When the primers have bound to the DNA fragment, the temperature is increased to 72°C, which is the optimum temperature for the polymerase. At the 3´end of the primer new bases are then inserted by the polymerase complementary to the template strand. This is repeated several times to duplicate the DNA strand. For the WAVE analysis the forming of heteroduplexes and homoduplexes is necessary. This is caused by an additional denaturing/renaturing step at 95°C for 3 minutes and 20°C for 30 seconds (see below).

To establish the PCR conditions for the following WAVE analysis, the primer pairs were tested using two different samples of wild type DNA (ES390, ES393). The 10 µl PCR batch included:

Table 12: PCR protocol for a single sample with GC-Polymerase

Reamplified DNA (10ng/ µl) 1.0 µl Buffer 1.0 µl dNTP 1.0 µl F Primer (10pg/ µl) 0.5 µl R Primer (10pg/ µl) 0.5 µl

H2O 5.56 µl

MgCl2 2mMol 0.4 µl Polymerase 0.08 µl Total 10 µl

The Gene Craft Polymerase was used along with ampliTaq Gold dNTPs and the 10x GeneCraft buffer. If the results were not as expected, HotStar Mastermix was used instead.

Table 13: PCR protocol for a single sample with HotStar Mastermix

Reamplified DNA 1.0 µl HotStar Mastermix 5 µl F Primer 0.5 µl R Primer 0.5 µl

H2O 3.0 µl Total 10 µl

The samples were analyzed with the following PCR programs in the Thermocycler (see Tables 14 and 15). The programs are 3-step-PCRs to prevent the formation of byprod- ucts. There are two additional steps in the synthesis cycle for which the annealing temperatures differ from the actual annealing temperature. In the first step the temperature is 6°C higher and in the second step the temperature is 3°C higher than the final annealing temperature. These additional steps are only carried out once. Denaturation usually takes 15 sec except for exon 3 of VCP, where a denaturation period of 45 seconds was needed for each cycle. Additionally for VCP Exon 11-12 HotStar Mastermix was used and a higher annealing temperature of initially 63°C was chosen. VCP exon 1 and KIAA0196 exon 1 were not analyzed with DHPLC because they are GC-rich which affects the conformation. VCP Exon 1 was directly analyzed by Sanger sequencing using HotStar Mastermix and a PCR program with higher annealing temperatures than the regular used PCR programs (see Table 16). KIAA0196 Exon 1 was analyzed using Gene Craft Polymerase with higher denaturing and annealing times as well as a higher annealing temperature (see Table 17).

Table 14: PCR program for GC-Polymerase

Step Temperature Time Denaturation 95°C 3 min

Denaturation 95°C 15 sec (45 sec for VCP Ex 3) Annealing 62°C, 59°C, 56°C 20 sec Elongation 72°C 30 sec Cycles 30 Elongation 72°C 5 Pause 8°C -

Table 15: PCR program for HotStar Mastermix

Step Temperature Time Denaturation 95°C 15 min Denaturation 95°C 15 sec 59°C, 56°C, 53°C Annealing (63°C, 60°C, 57°C for VCP Exon 20 sec 11-12) Elongation 72°C 45 sec Cycles 30 Elongation 72°C 10 Pause 8°C -

Table 16: PCR program for VCP Exon 1

Step Temperature Time

Denaturation 95°C 15 min

Denaturation 95°C 15 sec

Annealing 66°C, 63°C, 60°C 20 sec

Elongation 72°C 40 sec

Cycles 30

Elongation 72°C 3

Pause 8°C -

Table 17: PCR program for KIAA0196 Exon 1

Step Temperature Time

Denaturation 95°C 5 min

Denaturation 95°C 30 sec

Annealing 64°C, 61°C, 58°C 30 sec

Elongation 72°C 30 sec

Cycles 30

Elongation 72°C 5

Pause 8°C -

Tables 18 and 19 summarize which amplicons were amplified using Gene Craft -Polymerase or HotStar Mastermix for the KIAA0196 and VCP genes, resp.

Table 18: PCR conditions for KIAA0196

Primer Fragment Length Reagent

KIAA0196_5UTREx1_F 299bp Gene Craft Polymerase KIAA0196_5UTREx1_R KIAA0196_Ex2_F 497bp Gene Craft Polymerase KIAA0196_Ex2_R KIAA0196_Ex3_F 329bp HotStar Mastermix KIAA0196_Ex3_R KIAA0196_Ex4_F 285bp Gene Craft Polymerase KIAA0196_Ex4_R KIAA0196_Ex5_F 329bp Gene Craft Polymerase KIAA0196_Ex5_R KIAA0196_Ex6_F 385bp Gene Craft Polymerase KIAA0196_Ex6_R KIAA0196_Ex7_F 339bp Gene Craft Polymerase KIAA0196_Ex7_R KIAA0196_Ex8_F 335bp Gene Craft Polymerase KIAA0196_Ex8_R KIAA0196_Ex9_F 331bp Gene Craft Polymerase KIAA0196_Ex9_R KIAA0196_Ex10_F 365bp Gene Craft Polymerase KIAA0196_Ex10_R KIAA0196_Ex11_F 265bp Gene Craft Polymerase KIAA0196_Ex11_R KIAA0196_Ex12_F 285bp Gene Craft Polymerase KIAA0196_Ex12_R KIAA0196_Ex13-14_F 509bp Gene Craft Polymerase KIAA0196_Ex13-14_R KIAA0196_Ex15_F 298bp Gene Craft Polymerase KIAA0196_Ex15_R KIAA0196_Ex16 F 349bp HotStar Mastermix KIAA0196_Ex16 R KIAA0196 _Ex17 F 385bp HotStar Mastermix KIAA0196_Ex17 R KIAA0196_Ex18 F 285bp HotStar Mastermix KIAA0196_Ex18 R KIAA0196_Ex19 F 394bp HotStar Mastermix KIAA0196_Ex19 R KIAA0196_Ex20 F 299bp HotStar Mastermix KIAA0196_Ex20 R KIAA0196_Ex21 F 371bp HotStar Mastermix KIAA0196_Ex21 R KIAA0196_Ex22-23_F 497bp Gene Craft Polymerase KIAA0196_Ex22-23_R KIAA0196_Ex24_F 299bp HotStar Mastermix KIAA0196_Ex24_R

Primer Fragment Length Reagent

KIAA0196_Ex25_F 385bp Gene Craft Polymerase KIAA0196_Ex25_R KIAA0196_Ex26_F 330bp Gene Craft Polymerase KIAA0196_Ex26_R KIAA0196_Ex27_F 385bp Gene Craft Polymerase KIAA0196_Ex27_R KIAA0196_Ex28_F 285bp Gene Craft Polymerase KIAA0196_Ex28_R KIAA0196_Ex29_F 415bp Gene Craft Polymerase KIAA0196_Ex29_R

Table 19: PCR conditions for VCP

Primer Fragment Length Reagent

VCP_Ex1_F 362bp HotStar Mastermix VCP_Ex1_R VCP_Ex2_F 291bp Gene Craft Polymerase VCP_Ex2_R VCP_Ex3_F 319bp Gene Craft Polymerase VCP_Ex3_R VCP_Ex4_F 300bp Gene Craft Polymerase VCP_Ex4_R VCP_Ex5_F 323bp Gene Craft Polymerase VCP_Ex5_R VCP_Ex6_F 288bp Gene Craft Polymerase VCP_Ex6_R VCP_Ex7_F 289bp Gene Craft Polymerase VCP_Ex7_R VCP_Ex8+9_F 495bp Gene Craft Polymerase VCP_Ex8+9_R VCP_Ex10_F 317bp Gene Craft Polymerase VCP_Ex10_R VCP_Ex11-12_F 518bp HotStar Mastermix VCP_Ex11-12_R VCP_Ex13_F 355bp Gene Craft Polymerase VCP_Ex13_R VCP_Ex14_F 485bp Gene Craft Polymerase VCP_Ex14_R VCP_Ex15_F 332bp Gene Craft Polymerase VCP_Ex15_R VCP_Ex16-17_F 545bp HotStar Mastermix VCP_Ex16-17_R

3.7 Gelelectrophoresis

The amplification of DNA samples was tested by gelelectrophoresis. Gelelectrophoresis enables the separation of DNA fragments of different sizes. It consists of a fluent phase, the TBE-buffer and a solid phase, an agarose gel (1-2.5%), which is composed of a 48

three-dimensional grid. 1-8 µl of the samples are mixed with loading dye which contains xylene cyanole and bromphenol blue and are loaded onto the gel. An electric cur- rent of 200V is applied. Since the DNA is charged negatively due to the phosphate groups in its backbone it will move from the negative pole towards the positive pole. The grid allows the separation of the DNA fragments because bigger fragments will move more slowly than smaller fragments, which move against a lower resistance. To make the resulting bands visible 8 µl/100ml Serva DNA Stain was added to the agarose gel. Serva emits green fluorescence when binding to DNA, which can be seen under UV-light.

3.8 Denaturing High Performance Liquid Chromatography (DHPLC)

Denaturing High Performance Liquid Chromatography (DHPLC) is a method to detect sequence variants and mutations in genes. The technique is based on the differentiation between heteroduplexes and homoduplexes in a PCR product of two compatible DNA strands (Xiao and Oefner, 2001). A DNA sample carrying a heterozygous mutation contains wild type DNA as well as mutated DNA in a 1:1 ratio (Kuklin et al., 1997). After denaturation of the DNA, single identical DNA strands anneal to form double-

Figure 11: The forming of hetero- and homoduplexes by de- and renaturing of the DNA strands strands as the temperature decreases. In the presence of a heterozygous mutation the strands of wild type DNA and mutated DNA hybridize which leads to heteroduplexes (see Figure 11). Alongside homoduplexes are formed by the hybridization of two strands of wild type DNA. Since the heteroduplexes are less thermo stabile it is possible to separate them from the homoduplexes by ion-pair reversed-phase liquid chromatography (Kuklin et al., 1997), which is displayed in a chromatogram.

To achieve the forming of hetero- and homoduplexes, an additional denaturing/renaturing-step is added to the PCR program (see Table 20). 49

Table 20: PCR program in preparation for the DHPLC

Denaturation 95°C 3 min

Renaturation 20°C 30 sec

3.8.1 Principles of DHPLC

The stationary phase of the DHPLC consists of a column of poly(styrene- divinylbenzene) particles 2-3 microns in diameter (Xiao and Oefner, 2001). For the mobile phase two types of buffers (A and B) are used which contain triethyl-ammonium acetate (TEAA) and acetonitrile and which are passed through the column along with the DNA. The hydrophobic ethyl groups of the TEAA bind to the stationary column and the positively charged ammonium ion forms a positive surface potential, which enables an electrostatic interaction with the sugar-phosphate backbone of the DNA (Xiao and Oefner, 2001). A constant increase of acetonitrile interferes with the electrostatic interactions between the TEAA and the column and the DNA fragments elute from the column (Xiao and Oefner, 2001). This is influenced by temperature. Single-stranded DNA is retained less than double-stranded DNA because of their reduced negative charge, which reduces the electrostatic interaction of the TEAA and the column. During the analysis the temperature is increased above 50°C which results in a partially denaturation of the DNA. A heteroduplex fragment with a mutation made up of a single base mismatch will start to denature in the region of the mutation at lower temperatures than the homoduplexes (Kuklin et al., 1997) . This leads to a further reduction of the double- stranded part of the heteroduplex fragment (Kuklin et al., 1997) and to a reduced retention of the heteroduplexes. Therefore the heteroduplex fragments appear before the homoduplexes. At a specific temperature and acetonitrile concentration all DNA fragments elute from the column. To achieve the best accuracy, DNA fragments should have a length of 150-700 bp, although it is possible to detect mutations in fragments up to 1.5 kb length (Jin et al., 1995).

3.8.2 Expected Results of DHPLC

The elution of the DNA fragments is detected by an UV detector and shown in a chromatogram. As mentioned earlier the temperature should be above 50°C because temperatures of 50°C or below cause insufficient melting of the heteroduplexes which therefore cannot be separated from the homoduplexes. At an adequate temperature two peaks for the homoduplexes and two peaks for the heteroduplexes would be expected

for a sample with a heterozygous mutation in the chromatogram (see Figure 12; (Xiao and Oefner, 2001)). In most cases only one heteroduplex peak will appear because the two peaks will most likely overlap due to minor differences in retention times, which the column cannot detect separately. In a sample which carries more than one mutation more than two heteroduplex peaks can appear because of the formation of intermediates (Xiao and Oefner, 2001). A sample with a homozygous mutation shows one peak because four homoduplexes are formed. To detect the mutation the sample has to be mixed with wild type DNA. If a sample does not contain a mutation it generally shows one or two homoduplex peaks.

Figure 12: Example of mutation detection by DHPLC in a specific gene (ARIX). The analysis in the upper chromatogram shows a single homoduplex peak for the unaffected and the affected individual, whereas for the carrier a homo- and a heteroduplex peak is shown. To distinguish between the wild type and the affected homozygous individuals all samples are mixed with wild type DNA. The affected samples now show two peaks because they contain wild type DNA as well as mutated DNA as seen in the lower chromatogram.

It has to be noted that mixing of wild type and mutated DNA was not performed in this analysis because changes in the analyzed genes act in an autosomal-dominant pattern.

Therefore autosomal-recessive mutations are very unlikely to detect.

3.8.3 Set-up and Conditions of DHPLC

The DHPLC analysis was carried out on the DNA WAVE® system 3500 of the produc- er Transgenomic™, Omaha, NE, USA, equipped with a Transgenomic™ One DNASep® Cartridge. The unit consists of an autosampler with space for two 96-well

trays which is connected to a computer by an interface. The temperature of the autosampler is regulated by the built-in temperature rack. The analysis of one DNA sample is composed of four phases during which the buffer concentrations of the mobile phase change. Buffer A (0,1M TEAA) and Buffer B (0,1M TEAA; 25% acetonitrile) are pumped through the column with a flow velocitiy of 0.9 ml/min. During the loading phase 0.5µl of the sample is injected into the system by an injection needle and passed through the inline filter and the preheat coil by a pump until it reaches the DNASep Cartridge. Meanwhile the buffer B concentration is increased by 5% (1.25% acetonitrile). In the following gradient phase the DNA fragments of the sample are removed by an increased concentration of Buffer B by 2.0% per minute (0.5% acetonitrile). The concentration of acetonitrile, which is needed to elute the DNA fragments, should be reached at half of the gradient. In this phase the concentration of buffer B varies between 48.0% (12.0% acetonitrile) and 69.0% (17.25% acetonitrile). The DNA fragments are detected by the UV-detector and the extinction is measured at 260 nm. In the third cleaning phase the column is cleaned by a constant increase of the buffer B to 100% (25.0% of acetonitrile). All DNA fragments are eluted from the column. A final wash peak in the chromatogram depicts this. The equilibrate phase leads to an equilibra- tion of the stationary phase to the initial conditions. Before and after every injection the system is cleaned by Buffer D containing 75% of acetonitrile and the injection needle is cleaned by Buffer C containing 8% of acetonitrile.

3.8.3.1 Establishing the Temperature Gradient The Wavemaker software included in the Navigator™ software distributed by Transge- nomic™ establishes a theoretical melting curve for each fragment. Based on the sequence of the fragment the software calculates the melting temperatures, which are displayed in a melting profile (see Figure 13). The y-axis shows the helical fraction. At 1.00 helical fraction the DNA fragment is double-stranded, whereas at 0.00 helical fraction the DNA is denatured to single strands. The x-axis shows the temperature. The melting curve shows the range of temperature at which the fragment is eluted from the column. The optimum for the elution is located at the inflection point of the curve. For the analysis a temperature should be selected at which about 75% of the DNA is double- stranded and 25% is single-stranded.

Figure 13: Melting profile for VCP exon 14: helical fraction against temperature The profile shows that the DNA fragment starts to denature at around 58°C and is fully denatured at 70°C.

Up to three temperatures were selected based on the melting profile to further distinguish the melting domains of the fragment. This is shown in a diagram plotting the helical fraction against the base position (see Figure 14). Some fragments contain sections, which denature at differential temperatures; therefore for these fragments more than one temperature should be chosen.

Figure 14: Melting profile for VCP exon 14: helical fraction against base position The diagram shows the melting behavior of VCP exon 14 at 58.5°C, 60.0°C and 61.0°C. The sequence is partially denatured up to about the 240th base position. After this position the temperature should be above 60°C to ensure that the sequence of this domain is also denatured. Based on these diagrams a universal gradient was established by selecting a temperature range testing it on wild type DNA in the next step (see Figure 15). According to the analysis the temperature, which resulted in a homogenous peak, was selected for each fragment. The results of the melting profile are also taken into account when choosing

the temperature. If the melting profile for the fragment called for a second or third temperature these were added respectively.

Figure 15: Universal gradient. WAVE analysis of wild type sample for VCP exon 14 The temperature range for this fragment lies between 58.0°C and 60.5°C. For the final analysis temperatures of 59.0°C and 60.5°C were selected.

Besides the temperatures, the concentrations of Buffer A and B had to be determined. For every fragment the initial concentration of Buffer B is increased by 14% throughout the analysis. Therefore it is sufficient to specify the initial concentration of Buffer B, which is calculated by the Wavemaker Software for each fragment based on the sequence and the applied temperatures.

3.9 Sanger Sequencing

The DNA samples, which showed an abnormal WAVE peak, were sequenced using the Sanger method to detect potential mutations. The PCR product of the DNA sample is transferred to another PCR batch, which contains didesoxynucleotides (ddNTP) in addition to the regular dNTPs in a ratio of 1:100. Sanger sequencing is only possible in one direction; therefore two batches for the forward and reverse primer are necessary. Each of the four added ddNTPs is coupled to a specific fluorophore and is missing the 3´OHend. During PCR analysis the ddNTPs are incorporated into the synthesized strand. Because they are missing the 3´OH end, the polymerase is not able to add nucleotides after the insertion of a ddNTP, which results in chain termination. Because the ddNTPs` concentration is lower than that of the normal dNTPs the resulting fragments

lengths vary. Each fragment includes a specific fluorophore at its end. The samples are separated based on their size by column chromatography. The fluorescence of each fragment is then measured by a detector which results in the DNA sequence. The program SeqMan by DNASTAR was used to analyze the DNA sequences (see Figure 16 and 17).

4 Results

The DNA samples were analyzed by DHPLC using the above-mentioned protocol (see 3.8.3). If the melting curve showed a deviation, the DNA sample was then sequenced by Sanger sequencing to detect any base exchanges. With these methods no pathogenic mutation was identified in either the KIAA0196 or the VCP gene, which could explain the disease phenotype ALS/FTD. Altogether 8 polymorphisms in the VCP gene and 17 polymorphisms in the KIAA0196 gene in heterozygous and in some cases in homozygous manifestation were found (see Tables 21 and 22).

As an example the polymorphisms rs74999306 (c.712-25T>C) in Exon 7 of KIAA0196 and rs10972300 (c.129+47G>A) in Exon 2 of VCP are shown.

4.1 rs74999306 (c.714-25T>C), Exon 7 of KIAA0196

Figure 16: SeqMan alignment and WAVE chromatogram (62.5°C (ts=4.0), 47.8% B-buffer) of sample V1418 and V1055 The polymorphism rs7499306 (c.714-25T>C) in exon 7 of KIAA0196 was found in two samples in heterozygous manifestation. The WAVE chromatogram (see Figure 16) for the sample V1418 (C/T) shows an additional shoulder behind the second peak compared to the wild type sample V1055 (T/T).

4.2 rs10972300 (c.129+47G>A), Exon 2 of VCP

Figure 17: SeqMan alignment and WAVE chromatogram (58.0°C, 54.5% B-buffer) of sample V4148 and V1055

The polymorphism rs10972300 (c.129+47G>A) in exon 2 of VCP was found in 17 samples in heterozygous form and in one sample in homozygous form (see Table 22). The WAVE chromatogram for the heterozygous sample V4148 (G/A) clearly shows a double peak with a higher extinction maximum of the first peak compared to the wild type sample V74 (G/G).

4.3 Results for KIAA0196

Table 21: Detected variants in the KIAA0196 gene (NM_014846.3)

KIAA0196 SNP Samples Zygosity Base Exchange Ami- Frequency in Frequency in NM_014846. noacid Literature cohort 3 Substi- tution Exon 1 None Exon 2 rs16900369 V23, V1418 Heterozygous c.-124-10G>T - T=0.1753/878 T=0,0416/48 Exon 3 rs16900368 V23, V2144, Heterozygous c.187-3C>T - T=0.1751/877 T=0,1458/48 V2145, V2318, V2515, V3519, V3661 Exon 4 rs2384916 V23, V2144, Heterozygous c.333-19A>G - G=0.1739/871 G=0,125/48 V2318, V2515, V2145, V3661 rs2384917 V23, V2144, Heterozygous c.417+11A>G - G=0.1751/877 G=0,125/48 V2318, V2515, V2145, V3661 Exon 5 None Exon 6 rs11278975 V23, V2144, Heterozygous c.711+24_711+33del - 0.1749/877 0,1458/48 V2145, V2318, CTATTAAGAC V2515, V3661, V2115 Exon 7 rs74999306 V1921, V1418 Heterozygous c.712-25T>C - C=0.0046/23 C=0,0416/48 Exon 8 None -

KIAA0196 SNP Samples Zygosity Base Exchange Ami- Frequency in Frequency in NM_014846. noacid Literature cohort 3 Substi- tution Exon 9 rs12546285 V12, V74, Heterozygous rs12546285=c.979-20C>T - T=0.2254/1129 T=0,3541/48 rs10102230 V1245, V1274, Heterozygous rs10102230=c.1150+32A>G G=0.4936/2472 G=0,3541/48 V1295, V1798, V1850, V1921, V2053, V2144, V3194, Exon 9 V3493, V3519, V3836, V4011, V74, V1798 rs10102230 V23, V179, Heterozygous c.1150+32A>G - G=0.4936/2472 G=0,2083/48 V1385, V2318, V2515, V2687, V3661, V4019, V4119, V4405

rs10102230 V76, V152, Homozygous c.1150+32A>G - G=0.4936/2472 G=0,375/48 V267, V1055, V1297, V1418, V1435, V2115, V2128, V2130, V2247, V2312, V2511, V2789, V2861, V3187, V3298, V3521 rs12546285 V2145 Heterozgyous rs12546285=c.979-20C>T - T=0.2254/1129 T=0,0208/48 rs10102230 Homozygous rs10102230=c.1150+32A>G G=0.4936/2472 G=0,0208/48

KIAA0196 SNP Samples Zygosity Base Exchange Ami- Frequency in Frequency in NM_014846. noacid Literature cohort 3 Substi- tution Exon 10 rs55873854 V23, V74, Heterozygous c.1278+62T>A - A=0.2584/1294 A=0,3125/48 V1921, V2144, V2145, V2247, V2318, V3194,

V3493, V3519, V3661, V3836, V4019, V4011, V1798 Exon 11 None Exon 12 None Exon 13+14 rs3765213 V23, V2144, Heterozygous c.1764+12A>G - G=0.1591/797 G=0,125/48 V2145, V2515, V3661, V2318 Exon 15 None Exon 16 rs2303522 V3836, V2144, Heterozygous c.2016+33A>G - G=0.2432/1218 G=0,3333/48 V2145, V12, V3519, V1245, V1274, V1295, V2053, V1921, V1798, V1850, V2515, V3194, V3493, V4011 rs2303523 V2145, V2144, Heterozygous c.2016+46A>C - C=0.0701/351 C=0,1041/48 V12, V1274, V2053

KIAA0196 SNP Samples Zygosity Base Exchange Ami- Frequency in Frequency in NM_014846. noacid Literature cohort 3 Substi- tution Exon 17 rs2303529 V23, V2144, Heterozygous rs2303529=c.2017-72T>A - A=0.1569/786 A=0,125/48 rs2303528 V2145, V2318, Heterozygous rs2303528=c.2017-98C>T T=0.1567/785 T=0,125/48 V2515, V3661 rs72720514 V2861 Heterozygous c.2097+22G>T - T=0.0004/2 T=0,0208/48 Exon 18 None Exon 19 None Exon 20 rs144507279 V2789 Heterozygous c.2422A>G p.Ile80 N/A 0,0208/48 8Val Exon 21 None Exon 22+23 rs11370883 V23, V1055, Homozygous c.2770+18_2770+19insG - -=0.0000/0 0,1666/48 V1245, V4405 Exon 24 None Exon 25 None Exon 26 rs2272682 V23, V1798, Heterozygous c.3181+36A>G - G=0.2045/1024 G=0,2291/48 V3836, V1295, V2144, V2145, V2318, V2515, V3661, V3836 , V4405 Exon 27 rs11542889 V1295, V1798, Heterozygous c.3291G>A p.Ala10 A=0.1368/685 A=0,104/48 V2511, V3836, 97Ala (with likely be- V4405 nign allele) Exon 28 None Exon 29 None

4.4 Results for VCP

Table 22: Detected variants in the VCP gene (NM_007126.3)

VCP SNP Samples Zygosity Base Exchange Aminoacid Frequency in Frequen- NM_007126.3 Substitution Literature cy in Co- hort Exon 1 None Exon 2 rs10972300 V12, V4148, Heterozygous c.129+47G>A - A=0.1703/853 0,3541/48 V3661, V4405, V1435, V76, V267, V2053, V2130, V2318, V2687, V3194, V3493, V3519, V4172, V4148, V3661

rs10972300 V1055 Homozygous c.129+47G>A - A=0.1703/853 0,0283/48 Exon 3 None Exon 4 None Exon 5 None Exon 6 None Exon 7 rs514492 V1297, V1418, Heterozygous c.811+3 G>A - G=0.2989/1497; 0,2916/48 V1435, V2144, A most likely V2511 WT V2247, V3187, V3194, V3298, V3519, V3742, V4148, V4330,

VCP SNP Samples Zygosity Base Exchange Aminoacid Frequency in Frequen- NM_007126.3 Substitution Literature cy in Co- hort V74

rs514492 V2128, V2115, Homozygous c.811+3 G>A - C=0.2989/1497 0,125/48 V2328, V3493, V4011, V4405 Exon 8+9 None Exon 10 rs66889088 V179, V1297, Heterozygous c.1082- - - 0,2708/48 V1418, V1435, 9_1082insTGTGTACTGT V2053, V2247, V2511, V3187, V3194, V3298, V3519, V3742, V4148 rs66889088 V1274, V12, V76, Heterozygous rs66889088=c.1082- - - 0,1458/48 V1921, V2115, 9_1082insTGTGTACTGT G=0.1232/617 rs2074549 V2144, V2515 Heterozygous rs2074549=c.1194+71A>G Exon 11+12 rs562381+ V1055, V4405, Homozygous rs562381=c.1482+52T>C - T=0.3081/1543; 0,625/48 rs2258240 V4019, V3836, Homozygous rs2258240=c.1360-35A>G C most likely V4011, V2145, WT V1245, V74, V76, G=0.2981/1493 V2312, V2318, V2687, V2515, V1921, V3493, V1274, V2115, V1385, V4119, V1798,

VCP SNP Samples Zygosity Base Exchange Aminoacid Frequency in Frequen- NM_007126.3 Substitution Literature cy in Co- hort V152, V3661, V267, V2128, V1295, V12, V3521, V4172, V1850, V2130, V2861, V1245

rs562381 V179 Heterozygous rs562381=c.1482+52T>C - T=0.3081/1543; 0,0283/48 rs2258240 Homozygous rs2258240=c.1360-35A>G C most likely WT G=0.2981/1493 rs562381+ V2053, V1418, Heterozygous rs562381=c.1482+52T>C - T=0.3081/1543; 0,291/48 rs2258240 V2144, V4148, Heterozygous rs2258240=c.1360-35A>G C most likely V2247, V3298, WT V3194, V2511, G=0.2981/1493 V4330, V3187, V1297, V3519, V3742, V1297, V1435 Exon 13 rs684562 V152, V267, Homozygous c.1695+8A>G - G=0.4087/2047 0,3958/48 V1245, V1295, V1850,V2128, V2130, V2145, V2687, V2789, V3521, V3661, V4011, V4019,

VCP SNP Samples Zygosity Base Exchange Aminoacid Frequency in Frequen- NM_007126.3 Substitution Literature cy in Co- hort V4119, V4172, V74, V1798, V3493 rs684562 V12, V179, V1274, Heterozygous c.1695+8A>G - G=0.4087/2047 0,4791/48 V1297, V1385, V1435, V1921, V2053, V2115, V2144, V2247, V2511, V2515, V3187, V3194, V3519, V3836, V4148, V3742, V3298, V1418, V76, V4330 Exon 14 rs14257742 V2515 Heterozygous c.1704A>G p.Glu568Glu G=0.0020/10 0,0283/48 4 Exon 15 None Exon 16+17 None

5 Discussion

ALS and FTD are neurodegenerative diseases associated with cellular protein aggregation. They are considered to be part of a disease continuum also including IBMPFD and SPG, which share a similar pathogenic and genetic background. The genetic relationship between these diseases is based on the finding that mutations in certain genes including VCP lead to ALS, FTD or IBMPFD as well as a mixed phenotype of all three diseases (Bot et al., 2012). Furthermore it has been shown that VCP interacts with KI- AA0196 and indirectly with the WASH complex (Clemen et al., 2010). Since VCP plays a role in autophagy and the ERAD (Meyer et al., 2000b; Ju et al., 2008) and KI- AA0196 as a member of the WASH complex takes part in endosomal trafficking (Clemen et al., 2010; Derivery et al., 2009), a mutated form of either protein could lead to impaired cellular trafficking and autophagy or UPS pathways possibly resulting in protein aggregation and the phenotype of ALS/FTD (Thomas et al., 2013). This dissertation aimed to evaluate the role of mutations in VCP and KIAA0196 in patients with ALS and FTD in order to deepen the understanding of the pathogenic impact of VCP mutations in ALS patients and to illuminate a possible molecular connection between VCP and the WASH complex. DNA samples of patients with clinically diagnosed FTD and a diagnosis of ALS in varying degrees were evaluated by means of DHPLC and Sanger sequencing. With the exception of common SNPs, no pathogenic mutation was found.

5.1 Mutations in VCP and KIAA0196

There are two possible explanations why the genetic screening did not reveal any pathogenic mutation. First, both genes could be involved in the pathogenesis of neurodegenerative diseases such as ALS/FTD, but because the investigated cohort was small no mutation was found. Second, there is a chance that VCP and/or KIAA0196 do not play a role in the pathogenesis of ALS/FTD. The following paragraphs address arguments for both possibilities.

5.1.1 VCP Mutations in ALS

VCP mutations have only recently been described to cause the phenotype of ALS/FTD and the estimated prevalence of VCP mutations in ALS patients is around 1-2% (John- son et al., 2010) The phenotype associated with VCP mutations is highly variable, i.e.

only one third of cases show symptoms of FTD and an even smaller percentage develop ALS (Abramzon et al., 2012). Moreover only 30% of patients with ALS meet criteria of FTD, a disease which often is under diagnosed (Lomen-Hoerth et al., 2002). Our investigated cohort was small and considering the low prevalence of VCP mutations, the chance of finding a mutation was comparatively modest. Taking into account that the combined phenotype of ALS/FTD is also rare, this calls for larger cohorts possibly within the frame of multicenter trials to include a wider range of population groups.

5.1.2 Evidence that Mutations in VCP and KIAA0196 may be involved in ALS/FTD

VCP is a protein ubiquitously expressed in the mammalian cell and plays an important role in cellular processes especially in protein degradation. Only recently mutations in the genes hnRNPA2B1 and hnRNPA1 were found in patients with MSP and ALS who were negative for VCP mutations (Kim et al., 2013a). The proteins hnRNPA2B1 and hnRNPA1 are RNA-binding proteins with a Prionlike Domain (PrLD) harboring the ascertained mutations (Kim et al., 2013a). It was shown that these mutations increase the accumulation and the recruitment of hnRNPA2B1 and hnRNPA1 to stress granules possibly resulting in impaired RNA metabolism (Benatar et al., 2013). As mentioned above (see 1.5.5) VCP plays a role in the autophagy and UPS pathway and is considered to promote the autophagy of stress granules (Buchan et al., 2013), especially since stress granules encompass ubiquitinated proteins, which are cleared by VCP and HDAC6 (Ju et al., 2008). It was proposed that VCP either directly guides stress granules to the autophagy pathway or facilitates the dismantling of the molecules enabling their degradation (Buchan et al., 2013). This is emphasized by the finding that TDP-43, which is also a RNA-binding protein, seems to play an important role in the pathogenesis of neurodegenerative diseases since ubiquitin/TDP-43 inclusions can be found in patients with ALS, FTD and IMPBFD and TDP-43 is also associated with stress granules (Meyer and Weihl, 2014). Furthermore it has been suggested that cellular stress leads to an increase of RNA binding proteins and the forming of stress granules and sequestration (Thomas et al., 2013). As mentioned above this could also lead to an abnormal binding of cytoplasmic RNA, resulting in a gain of protein synthesis comprising regular cell function even further (Thomas et al., 2013). Therefore the phenotypes of ALS/FTD could be a consequence of an impaired degradation of accumulated stress granules and/or sequestration of RNA-binding proteins due to a mutated form of VCP (Benatar et al., 2013; Buchan et al., 2013).

It has been shown that mutations in the proteins p62/SQSTM1 and optineurin also result in FTD and ALS (Rubino et al., 2012; Thomas et al., 2013). Both proteins play a role in autophagy. P62 directs polyubiquitinated proteins to the autophagy pathway and is located in protein aggregates and in close proximity to autophagosomes (Bjørkøy et al., 2005). Furthermore it is activated during cellular stress response (Bjørkøy et al., 2005). Analogous to the function of p62 it has been shown that optineurin serves as an autophagy receptor, sharing the same pathway with p62 enabling autophagy (Wild et al., 2011) and that its mutated form leads to a loss of function and therefore potentially impaired autophagy (Maruyama et al., 2010). This affirms the hypothesis that autophagy plays an important role in protein aggregation diseases and that components of this pathway such as VCP, p62 and optineurin are crucial for protein degradation (Tresse et al., 2010).

As mentioned above, VCP facilitates the transport of ubiquitinated components to the UPS pathway (see 1.5.4). Weihl et al. (2006) reported that a mutant form of VCP leads to an impaired degradation of a CFTR mutant in the UPS pathway (Weihl et al., 2006), whereas other authors could not find a link between mutations in VCP and a defective ERAD pathway (Tresse et al., 2010). Therefore it is not yet known if an excess of ERAD substrates due to a mutation in VCP is a result of a damaged ERAD or autophagy pathway, especially since inhibition of the UPS degradation leads to an increase of oxidative stress and the forming of stress granules (Bjørkøy et al., 2005; Mazroui et al., 2007), which are degraded through autophagy.

It has been proposed that mutant VCP impairs its association with its cofactors (Ritz et al., 2011) and VCP interacts with the WASH complex through KIAA0196, possibly playing a role in endosomal trafficking and membrane organization (Clemen et al., 2010). Mutations in VCP therefore might result in a defective association of VCP with the WASH complex and indirectly impair the function of WASH and KIAA0196.

On the other hand, mutations in KIAA0196 lead to the phenotype of SPG8, an upper- motor neurodegenerative disease and the Ritscher-Schinzel/3C-Syndrome (Elliott et al., 2013; Valdmanis et al., 2007). It has been shown that a knockdown of KIAA0196 impacts the localization of WASH complex components such as WASH1 (Harbour et al., 2010), leading to the assumption that KIAA0196 might be responsible for the recruitment of a cofactor in order for the complex to assemble and function in a proper manner (Freeman et al., 2013). This underpins the notion that VCP and KIAA0196 rely on each other in order to facilitate endosomal trafficking along with the WASH complex (Bot et

al., 2012) and that a mutation in either protein lead to defects in cellular trafficking, development and protein degradation.

Taking into account the above mentioned facts, it is very likely that mutations in VCP or KIAA0196 could lead to neurodegenerative diseases such as ALS/FTD. The reason why we did not find any mutation is probably attributed to the low prevalence of mutations and our small cohort.

5.1.3 Evidence that Mutations in VCP and KIAA0196 may not be a Cause for ASL/FTD

On the contrary it is possible that mutations in KIAA0196 do not lead to the phenotype of ALS/FTD. Until now, no mutation in KIAA0196 has been reported to cause ALS/FTD but the phenotype of SPG exclusively. The major symptom of SPG is progressive spastic weakness of the legs accompanied by hyperreflexia in the lower extremities (Fink, 2014). Furthermore an impairment of vibration sensation as well as autonomic symptoms and very occasionally peripheral neuropathy and dementia is present (Fink, 2013). In ALS muscle weakness is mainly present predominantly in the upper extremities and in the later course of disease in the lower extremities along with atrophy, muscle cramps, dysarthria and dysphagia (Brandt and Diener, 2012; Kinsley and Siddique, 2015; Valadi, 2015). Although the muscle tone can be increased, muscle weakness is the major symptom, setting the ALS symptomatology apart from SPG (Brandt and Diener, 2012).

It is conceivable that a mutated form of KIAA0196 might act independent from VCP and impairs cellular function in terms of neuronal growth and motoneuron formation rather than playing a role in protein aggregation and degradation (Clemen et al., 2010; Valdmanis et al., 2007), although KIAA0196 has been found in protein aggregates of patients with IBMPFD (Clemen et al., 2010). Moreover it could be possible that a mutated form of KIAA0196 does not affect the interaction with VCP and the WASH complex, particularly because the binding between mutant KIAA0196 and VCP is still intact (Clemen et al., 2010). If KIAA0196 does not play a role in the pathogenesis of ALS/FTD, it could be likely that mutated forms of other members of the WASH complex impair the association between WASH and VCP, but this calls for further investigation.

5.1.4 Mixed phenotypes

In 2012 Bot et al. reported two brothers who presented with gait impairment as well as Paget’s disease of bone with an age of onset of 54 and 57 years (Bot et al., 2012). Mo- lecular genetic studies revealed a mutation in VCP (R159C) (Bot et al., 2012). The symptoms common for ALS or FTD such as dysarthria, dysphagia and changes in behavior or cognition were not present but spasticity of the lower extremities with increased muscle tone and hyperreflexia, characteristic for SPG (Bot et al., 2012). An EMG in both brothers showed involvement of the lower motor neurons with denervation in two regions, which are a sign for ALS, but taking into account the progression of disease for over 10 years, a diagnosis of ALS seemed rather unlikely (Bot et al., 2012). It has to be noted that this mutation has been reported before in a patient with IBMPFD (Bersano et al., 2009). This is in line with the hypothesis that IBMPFD, SPG, ALS and FTD are part of a disease continuum linked by a similar pathogenic background. Muta- tions in the c9orf72 hexanucleotide repeat have been described as a major genetic cause for ALS and FTD and is present in about 8% of sporadic cases of both diseases (Traynor, 2014). But it seems probable that other genes such as KIAA0196 and VCP also interlink the pathogenesis of motor neuron diseases on a molecular level and that they share a functional relationship on the basis of a macromolecular complex such as the WASH complex (Clemen et al., 2012) (see 1.6.6). Therefore it might be worth considering to broaden the diagnostic criteria for the individual diseases and to apply molecular genetic testing on a larger scale including genes of a wider spectrum of neurodegenerative diseases to patients with suspected ALS/FTD or SPG and IBMPFD. Moreover in order to gain a deeper insight into the relationship between KIAA0196, VCP and other members of the WASH complex, further investigation of the molecular relationship and the underlying pathogenic mechanisms are needed.

5.2 The Use of DHPLC

DHPLC is a highly efficient screening method for detecting mutations but nevertheless it is possible that mutations might have been overlooked. In the following chapter the sensitivity and specificity as well as the efficiency of time and costs of the DHPLC are discussed and compared to several other widely used methods such as Sanger- sequencing, SSCP (single strand conformation polymorphism) and NGS (Next- Generation-Sequencing).

5.2.1 DHPLC versus Direct Sanger Sequencing, SSCP and Next- Generation Sequencing (NGS)

DHPLC has long been in use as a pre-sequencing method because it is cheaper and less time consuming than direct Sanger Sequencing, which is considered to be the “Gold Standard” for mutation detection. DHPLC enables fast screening of samples in regard to sequence deviations depicted in a chromatogram. Instead of sequencing all samples, only samples showing an abnormal extinction curve compared to wildtype samples, have to be sequenced. Besides standard screening methods such as DHPLC and also SSCP (single strand conformation polymorphism), lately Next-Generation-Sequencing (NGS) has become an alternative in mutation detection, allowing fast and direct analysis of genes simultaneously. The SSCP-method is based on conformational changes of de- naturized single stranded DNA carrying a mutation, which are analyzed by electrophoresis. If a mutation is present, the affected DNA single-strands show different migration patterns due to their conformational change compared to a control sample (Orita et al., 1989). NGS on the other hand enables the analysis of multiple genes and even genomes by building a cDNA library which is sequenced at high coverage and compared to the reference genome of the species (de Magalhães et al., 2010). Besides whole-genome- sequencing, whole-exome sequencing and panel-sequencing are possible, allowing the analysis of a defined set of genes simultaneously.

5.2.2 Sensitivity and Specificity

Specificity and particularly sensitivity are important factors especially of pre- sequencing methods. The DHPLC has a reported sensitivity of 92.5-100% (Balogh et al., 2004; Kurzawski et al., 2012; Takashima et al., 2001; Yamanoshita et al., 2005; Yu et al., 2005), although false positive results are likely and are most often due to the accumulation of degradation products, non-specific DNA amplification and mutations as a result of the PCR (Breton et al., 2006). Nevertheless the sensitivity is high compared to SSCP with a sensitivity of 80-90% (Balogh et al., 2004; Yamanoshita et al., 2005). Only when using fluorescent-SSCP, the sensitivity can be increased to 95% (Balogh et al., 2004), but DHPLC can be carried out automatically in short time without using gels and once the analysis conditions are set up, the method needs very little maintenance (Yamanoshita et al., 2005). As mentioned above, Sanger-sequencing is considered the “Gold Standard”, because each sample is sequenced and analyzed individually (Grada and Weinbrecht, 2013). Therefore the expected sensitivity is 100%. But this procedure requires more effort and “errors from non-variant sequence background and low signal

to noise ratio can occur” (Yu et al., 2005). Compared to NGS the sensitivity of DHPLC is lower. One publication reported a sensitivity of 67.9% for DHPLC when compared to NGS with a sensitivity of 100% (D’Argenio et al., 2015). In this case NGS allowed the identification of variants not detected by DHPLC (D’Argenio et al., 2015).

The specificity of DHPLC lies between 85-100% and for SSCP at 97% (Balogh et al., 2004; Yamanoshita et al., 2005). For Sanger-sequencing the expected specificity is 100%. The specificity of NGS is around 100% since it is able to detect low level mutations compared to conventional methods (D’Argenio et al., 2015; Kantorova et al., 2014).

Because of its high sensitivity and specificity, DHPLC was used for mutation detection for this dissertation. The analyzed samples that showed a deviation in the chromatogram, also showed a base exchange in Sanger sequencing, therefore no false positive samples were detected. As expected the detected homozygous variants showed melting curves similar to those of the wildtype samples because our samples were not mixed with wildtype control samples (see below). On the other hand none of the predicted wildtype samples, which were sequenced as control samples, showed a base exchange.

Nevertheless it is possible that mutations were overlooked in the analysis, because not all of the samples were sequenced. Besides, mutations in other not investigated genes could be causal. Therefore the application of NGS should be considered in the future because it allows the simultaneous screening of several suspected genes or whole- exomes while ensuring a high sensitivity and specificity.

Furthermore since autosomal dominant disorders were investigated, samples were not mixed with wild type controls because the detection of homozygous mutations was highly unlikely. However as a result, it could be possible that homozygous variants were not detected.

5.2.3 Comparison of Costs and Time

Regarding the costs, DHPLC is considered to be a reasonable method. The initial acquisition costs are high; the most costly factors are the column and the buffers. But the costs for reagents are about 5 times lower than for Sanger sequencing when taking into consideration the number of analyzed samples (Takashima et al., 2001). In this dissertation the saving of costs was reduced because exon 1 of both genes had to be directly sequenced since exon 1 is very GC-rich which affects the conformation. Moreover

DHPLC analysis had to be repeated in several exons of the genes due to the low quality of the chromatograms. The reason for this could be that the DNA samples were amplified using an amplification kit instead of analyzing the DNA samples directly. Besides, the more expensive but more robust HotStar-Taq was used for 11 of the analyzed exons, and the melting profile for several exons called for a second or third analysis temperature, additional factors resulting in higher costs.

NGS is more cost effective than DHPLC when comparing the costs for the analysis, which are between $0.13-10 per million base pairs for NGS and $2500 per million base pairs for Sanger sequencing (Liu et al., 2012). But the acquisition costs of the platform are about 5 to 7 times higher than those of a DNA sequencer (Liu et al., 2012). Because of its overall costs and time effectiveness as well as its high sensitivity and specificity the use of NGS for mutation detection will most likely supersede conventional screening methods, especially when platforms become less costly in the future.

DHPLC is one of the fastest conventional semi-automatic pre-screening methods available. When compared to direct Sanger sequencing, it is about 10-fold faster (Takashima et al., 2001). This is because in DHPLC the PCR product of a sample can directly be analyzed, whereas in Sanger sequencing two PCR products are required per sample, one for the forward primer and another one for the reverse primer. Therefore the number of samples is doubled in Sanger sequencing compared to DHPLC. Furthermore the DHPLC method allows the analysis of up to 196 samples in one run whereby conventional sequencing carried out using an ABI 3500 machine enables the analysis of just 92 samples at a time.

Only the application of NGS is faster than DHPLC. Screening of BRCA1 and BRCA2 for mutations in 70 patients with NGS was around 10 times faster than with DHPLC (10 days vs. 3 month) (D’Argenio et al., 2015). This is due to the to the high speed of analysis, the high output data per run that lies between 0.7-600 Gb (Liu et al., 2012) depending on the platform and the fact that several genes can be analyzed at the same time. Moreover if a mutation is suspected based on a deviation in the chromatogram, DHPLC calls for additional Sanger sequencing of the sample to detect the mutation, which low- ers the time saved.

Overall, DHPLC was used in this dissertation because it is faster and the costs are lower compared to Sanger sequencing.

5.2.4 Confounding Factors of DHPLC

DHPLC calls for optimized conditions and controlled confounding factors in order to achieve the best possible results and to maintain a high sensitivity and specificity. It has been reported that false positive or false negative results are mostly due to differences in experimental procedures (Takashima et al., 2001). Changes in oven temperatures or in the conditions of the buffers as well as in the column can impact results (Takashima et al., 2001; Yu et al., 2005). Therefore an appropriate placement and regular inspections of the machine and reagents are obligate. Furthermore the input sample quality and therefore specific and efficient PCR amplification as well as the amount of PCR product play an important role (Takashima et al., 2001; Yu et al., 2005). This relies on technical requirements and the experience of the researcher.

It has been suggested that positive and negative DNA controls should be included for each amplicon (Breton et al., 2006). Since the prevalence of mutation rates in the investigated genes VCP and KIAA0196 are very low this was not possible in this dissertation. It is conceivable that this led to slight differences in elution profiles during the analysis.

Another factor that has to be considered is that samples were not pooled with wild type samples. As mentioned above (see 3.8.2), homozygous mutations are normally not seen in DHPLC chromatograms without the addition of wild type DNA. Although it is very unlikely to detect homozygous pathogenic mutations since ALS and FTD are autosomal dominant disorders, a modest possibility exists, that an autosomal dominant mutation or variant was missed.

Furthermore, another confounding factor may be in-vitro replication slippage. To determine the optimal melting temperature for each fragment, the Navigator software distributed by Transgenomic™ was used. This program suggests the temperature for an amplicon while taking into account individual temperatures for single melting domains. This enabled the selection of up to three temperatures in order to cover all possible melting domains for each fragment. It was furthermore necessary to establish a universal gradient (see Figure 15) with wild type DNA because the actual practical melting temperature can differ from the calculated theoretical temperature. This can be due to changes in oven or column calibration, contaminated PCR products or primer dimers. Although the final temperatures for analysis were chosen carefully, it is still possible that for certain amplicons the optimal temperature was not matched and mutations might have been overlooked. It therefore has been proposed that more than one algo-

rithm should be used to determine the optimal temperature for each amplicon (Yu et al., 2005).

Sequences, containing small repetitive elements, show slippage, leading to an increase or decrease of repetitions. Slippage occurs when the polymerase reaches a repetitive element. The polymerase dissolves from the template strand, resulting in a detachment of the template strand from the synthesized strand (Viguera et al., 2001). The synthesized strand then reconnects to another repetitive section of the template strand and the polymerase reassembles and continues the synthesis (Viguera et al., 2001). During this process the polymerase usually retracts several bases, leading to an insertion of base pairs and a disruption of the correct pairing of mother and daughter strand. These insertions are removed by repairing enzymes of the cell under in-vivo conditions. Since in in-vitro experiments the cellular repairing enzymes are missing, theses insertions can lead to defective amplificates. This especially plays a role in Sanger sequencing because oftentimes only the forward or the reverse sequence can be analyzed since the sequences do not align properly due to the slippage. In DHPLC the insertions lead to a broad- ened peak in the chromatogram, but because the melting curves still are similar to each other, it is possible to analyze samples with repetitive motifs even easier than with Sanger sequencing.

In this dissertation slippage was carefully avoided by choosing appropriate primer pairs, located in intronic areas without repetitive sequences.

Overall DHPLC is a method highly efficient and accurate under optimized conditions. Therefore it appears unlikely that the lack of mutations detected in this dissertation is mainly due to methodological issues.

5.3 Conclusion

In this dissertation the genes VCP and KIAA0196 in patients with FTD and clinical signs of ALS were evaluated by use of DHPLC and Sanger sequencing but no pathogenic mutations were found. This might be due to the small cohort or the method which was used. Another possibility is that other genes of the WASH complex are involved in the pathogenesis of ALS/FTD. These genes are investigated by other research groups right now and might yield expedient results. As mentioned above, the application of NGS might be reasonable, especially when considering the wide spectrum of neurodegenerative diseases and the genes which are involved in the pathogenesis. With this technique all suspected genes could be analyzed at once or new genes could be discov-

ered by whole-exome sequencing. Nevertheless factors such as ethical questions regarding incidental findings and the vast amount of ascertained data requiring bioinformatic knowledge of the investigators have to be considered (Davey, 2014; Liu et al., 2012).

6 Summary

FTD (Frontotemporal Dementia) and ALS (Amyotrophic Lateral Sclerosis) are rare neurodegenerative diseases, and their pathogenesis has yet to be fully elucidated. Lately mutations in VCP, which are known to cause inclusion body myopathy with early-onset Paget disease with or without Frontotemporal Dementia (IBMPFD), have been described as a cause for ALS and FTD. It has been shown that VCP interacts with KI- AA0196, a protein whose mutated form leads to Spastic Paraplegia Type 8 (SPG8) which is a member of the WASH complex. It is believed that the WASH complex plays an integral role in cellular trafficking and membrane organization and that mutations in VCP or KIAA0196 might disrupt the interaction with and the composition of the WASH complex. This could be an underlying cause for a spectrum of neurodegenerative diseases such as ALS, FTD, IBMPFD and SPG8. In this dissertation the DNA samples of a cohort of 48 patients with clinically diagnosed FTD and symptoms of motor neuron disease in varying stages were investigated for mutations in VCP and KIAA0196. The exonic and accompanying intronic sections of the genes were analyzed by Denaturing High Performance Liquid Chromatography (DHPLC). If a mutation was suspected based on the chromatogram, the sample was sequenced employing Sanger sequencing. With this strategy, several common variants were found in both genes, but no pathogenic mutation. Possible reasons for this result are that the investigated cohort was small and the prevalence of VCP and KIAA0196 mutations is generally low. Nevertheless it is still conceivable, that mutations either in KIAA0196 or even in other members of the WASH complex lead to impaired interaction with VCP or that a mutated form of VCP hinders correct interaction with the WASH complex, which could be causes for neurodegenerative diseases. Further investigations in larger cohorts and analysis of additional genes of the WASH complex are needed to gain a better insight into these complex pathogenic mechanisms.

7 Bibliography

Abramzon, Y., Johnson, J.O., Scholz, S.W., Taylor, J.P., Brunetti, M., Calvo, A., Man- drioli, J., Benatar, M., Mora, G., Restagno, G., et al. (2012). Valosin-containing protein mutations in sporadic amyotrophic lateral sclerosis. Neurobiol Aging 33, 2231.e1– e2231.e6.

Balogh, K., Patócs, A., Majnik, J., Rácz, K., and Hunyady, L. (2004). Genetic screening methods for the detection of mutations responsible for multiple endocrine neoplasia type 1. Molecular Genetics and Metabolism 83, 74–81.

Bar-Nun, S., and Glickman, M.H. (2012). Proteasomal AAA-ATPases: Structure and function. Biochimica et Biophysica Acta (BBA) - Molecular Cell Research 1823, 67– 82.

Behrends, C., and Harper, J.W. (2011). Constructing and decoding unconventional ubiquitin chains. Nat Struct Mol Biol 18, 520–528.

Benajiba, L., Le Ber, I., Camuzat, A., Lacoste, M., Thomas-Anterion, C., Couratier, P., Legallic, S., Salachas, F., Hannequin, D., Decousus, M., et al. (2009). TARDBP mutations in motoneuron disease with frontotemporal lobar degeneration. Ann Neurol. 65, 470–473.

Benatar, M., Wuu, J., Fernandez, C., Weihl, C.C., Katzen, H., Steele, J., Oskarsson, B., and Taylor, J.P. (2013). Motor neuron involvement in multisystem proteinopathy. Neu- rology 80, 1874–1880.

Bernardi, L., Frangipane, F., Smirne, N., Colao, R., Puccio, G., Curcio, S.A.M., Mira- belli, M., Maletta, R., Anfossi, M., Gallo, M., et al. (2012). Epidemiology and genetics of frontotemporal dementia: a door-to-door survey in Southern Italy. Neurobiology of Aging 33, 2948.e1–e2948.e10.

Bersano, A., Del Bo, R., Lamperti, C., Ghezzi, S., Fagiolari, G., Fortunato, F., Ballabio, E., Moggio, M., Candelise, L., Galimberti, D., et al. (2009). Inclusion body myopathy and frontotemporal dementia caused by a novel VCP mutation. Neurobiology of Aging 30, 752–758.

Bettencourt, C., Morris, H.R., Singleton, A.B., Hardy, J., and Houlden, H. (2013). Ex- ome sequencing expands the mutational spectrum of SPG8 in a family with spasticity responsive to l-DOPA treatment. J Neurol 260, 2414–2416.

Bjørkøy, G., Lamark, T., Brech, A., Outzen, H., Perander, M., Øvervatn, A., Stenmark, H., and Johansen, T. (2005). p62/SQSTM1 forms protein aggregates degraded by autophagy and has a protective effect on huntingtin-induced cell death. J Cell Biol 171, 603–614.

Bot, S.T. de, Schelhaas, H.J., Kamsteeg, E.-J., and Warrenburg, B.P.C. van de (2012). Hereditary spastic paraplegia caused by a mutation in the VCP gene. Brain 135, e223– e223.

Bot, S.T. de, Vermeer, S., Buijsman, W., Heister, A., Voorendt, M., Verrips, A., Schef- fer, H., Kremer, H.P.H., Warrenburg, B.P.C. van de, and Kamsteeg, E.-J. (2013). Pure

adult-onset Spastic Paraplegia caused by a novel mutation in the KIAA0196 (SPG8) gene. J Neurol 260, 1765–1769.

Boyault, C., Gilquin, B., Zhang, Y., Rybin, V., Garman, E., Meyer-Klaucke, W., Mat- thias, P., Müller, C.W., and Khochbin, S. (2006). HDAC6–p97/VCP controlled polyubiquitin chain turnover. EMBO J 25, 3357–3366.

Brady, O.A., Meng, P., Zheng, Y., Mao, Y., and Hu, F. (2011). Regulation of TDP-43 aggregation by phosphorylation andp62/SQSTM1. Journal of Neurochemistry 116, 248–259.

Brandt, T., and Diener, H.C. (2012). Therapie und Verlauf neurologischer Erkrankun- gen (Stuttgart: Kohlhammer).

Breton, J., Lechevrel, M., and Sichel, F. (2006). Specificity of TP53 mutation screening methods in cancerous tissues. Int. J. Cancer 118, 254–255.

Briggs, L.C., Baldwin, G.S., Miyata, N., Kondo, H., Zhang, X., and Freemont, P.S. (2008). Analysis of Nucleotide Binding to P97 Reveals the Properties of a Tandem AAA Hexameric ATPase. J. Biol. Chem. 283, 13745–13752.

Brooks, B.R., Miller, R.G., Swash, M., Munsat, T.L., and World Federation of Neurol- ogy Research Group on Motor Neuron Diseases (2000). El Escorial revisited: revised criteria for the diagnosis of amyotrophic lateral sclerosis. Amyotroph. Lateral Scler. Other Motor Neuron Disord. 1, 293–299.

Buchan, J.R., Kolaitis, R.-M., Taylor, J.P., and Parker, R. (2013). Eukaryotic stress granules are cleared by autophagy and Cdc48/VCP function. Cell 153, 1461–1474.

Byrne, S., Walsh, C., Lynch, C., Bede, P., Elamin, M., Kenna, K., McLaughlin, R., and Hardiman, O. (2011). Rate of familial amyotrophic lateral sclerosis: a systematic review and meta-analysis. J Neurol Neurosurg Psychiatry 82, 623–627.

Cairns, N.J., Neumann, M., Bigio, E.H., Holm, I.E., Troost, D., Hatanpaa, K.J., Foong, C., White III, C.L., Schneider, J.A., Kretzschmar, H.A., et al. (2007a). TDP-43 in Fa- milial and Sporadic Frontotemporal Lobar Degeneration with Ubiquitin Inclusions. The American Journal of Pathology 171, 227–240.

Cairns, N.J., Bigio, E.H., Mackenzie, I.R.A., Neumann, M., Lee, V.M.-Y., Hatanpaa, K.J., Iii, C.L.W., Schneider, J.A., Grinberg, L.T., Halliday, G., et al. (2007b). Neuro- pathologic diagnostic and nosologic criteria for frontotemporal lobar degeneration: consensus of the Consortium for Frontotemporal Lobar Degeneration. Acta Neuropathol 114, 5–22.

Chen, Y., McMillan-Ward, E., Kong, J., Israels, S.J., and Gibson, S.B. (2007). Oxida- tive stress induces autophagic cell death independent of apoptosis in transformed and cancer cells. Cell Death Differ 15, 171–182.

Chiò, A., Logroscino, G., Traynor, B.J., Collins, J., Simeone, J.C., Goldstein, L.A., and White, L.A. (2013). Global Epidemiology of Amyotrophic Lateral Sclerosis: A System- atic Review of the Published Literature. Neuroepidemiology 41, 118–130.

Clemen, C.S., Tangavelou, K., Strucksberg, K.-H., Just, S., Gaertner, L., Regus-Leidig, H., Stumpf, M., Reimann, J., Coras, R., and Morgan, R.O. (2010). Strumpellin is a nov-

el valosin-containing protein binding partner linking hereditary spastic paraplegia to protein aggregation diseases. Brain 133, 2920–2941.

Clemen, C.S., Eichinger, L., and Schröder, R. (2012). Reply: Hereditary spastic paraplegia caused by a mutation in the VCP gene VCP: A Jack of all trades in neuro- and myodegeneration? Brain aws202.

Da Cruz, S., and Cleveland, D.W. (2011). Understanding the role of TDP-43 and FUS/TLS in ALS and beyond. Curr Opin Neurobiol 21, 904–919.

Dalal, S., Rosser, M.F.N., Cyr, D.M., and Hanson, P.I. (2004). Distinct Roles for the AAA ATPases NSF and p97 in the Secretory Pathway. Mol. Biol. Cell 15, 637–648.

Dargemont, C., and Ossareh-Nazari, B. (2012). Cdc48/p97, a key actor in the interplay between autophagy and ubiquitin/proteasome catabolic pathways. Biochimica et Bio- physica Acta (BBA) - Molecular Cell Research 1823, 138–144.

D’Argenio, V., Esposito, M.V., Telese, A., Precone, V., Starnone, F., Nunziato, M., Cantiello, P., Iorio, M., Evangelista, E., D’Aiuto, M., et al. (2015). The molecular analysis of BRCA1 and BRCA2: Next-generation sequencing supersedes conventional ap- proaches. Clinica Chimica Acta 446, 221–225.

Davey, S. (2014). Next generation sequencing: considering the ethics. Int J Immunoge- net 41, 457–462.

Davies, J.M., Brunger, A.T., and Weis, W.I. (2008). Improved Structures of Full-Length p97, an AAA ATPase: Implications for Mechanisms of Nucleotide-Dependent Confor- mational Change. Structure 16, 715–726.

DeLaBarre, B., Christianson, J.C., Kopito, R.R., and Brunger, A.T. (2006). Central Pore Residues Mediate the p97/VCP Activity Required for ERAD. Molecular Cell 22, 451– 462.

Derivery, E., Sousa, C., Gautier, J.J., Lombard, B., Loew, D., and Gautreau, A. (2009). The Arp2/3 Activator WASH Controls the Fission of Endosomes through a Large Mul- tiprotein Complex. Developmental Cell 17, 712–723.

Djamshidian, A., Schaefer, J., Haubenberger, D., Stogmann, E., Zimprich, F., Auff, E., and Zimprich, A. (2009). A novel mutation in the VCP gene (G157R) in a German family with inclusion-body myopathy with Paget disease of bone and frontotemporal dementia. Muscle Nerve 39, 389–391. van Duin, M., van Marion, R., Vissers, K., Watson, J.E.V., van Weerden, W.M., Schrö- der, F.H., Hop, W.C.J., van der Kwast, T.H., Collins, C., and van Dekken, H. (2005). High-resolution array comparative genomic hybridization of chromosome arm 8q: Evaluation of genetic progression markers for prostate cancer. Genes Chromosom. Can- cer 44, 438–449.

Duleh, S.N., and Welch, M.D. (2010). WASH and the Arp2/3 complex regulate endosome shape and trafficking. Cytoskeleton 67, 193–206.

Elliott, A.M., Simard, L.R., Coghlan, G., Chudley, A.E., Chodirker, B.N., Greenberg, C.R., Burch, T., Ly, V., Hatch, G.M., and Zelinski, T. (2013). A novel mutation in KI-

AA0196: identification of a gene involved in Ritscher–Schinzel/3C syndrome in a First Nations cohort. J Med Genet 50, 819–822.

Ferrari, R., Kapogiannis, D., Huey, E.D., and Momeni, P. (2011). FTD and ALS: a tale of two diseases. Curr Alzheimer Res 8, 273–294.

Fink, J.K. (2013). Hereditary spastic paraplegia: clinico-pathologic features and emerging molecular mechanisms. Acta Neuropathol 126, 307–328.

Fink, J.K. (2014). Hereditary Spastic Paraplegia Overview. In GeneReviews(®), R.A. Pagon, M.P. Adam, H.H. Ardinger, S.E. Wallace, A. Amemiya, L.J. Bean, T.D. Bird, C.-T. Fong, H.C. Mefford, R.J. Smith, et al., eds. (Seattle (WA): University of Wash- ington, Seattle),.

Forman, M.S., Mackenzie, I.R., Cairns, N.J., Swanson, E., Boyer, P.J., Drachman, D.A., Jhaveri, B.S., Karlawish, J.H., Pestronk, A., Smith, T.W., et al. (2006). Novel ubiquitin neuropathology in frontotemporal dementia with valosin-containing protein gene mutations. Journal of Neuropathology & Experimental Neurology 65, 571–581.

Freeman, C., Seaman, M.N.J., and Reid, E. (2013). The hereditary spastic paraplegia protein strumpellin: Characterisation in neurons and of the effect of disease mutations on WASH complex assembly and function. Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease 1832, 160–173.

Fujii, K., Kitabatake, M., Sakata, T., and Ohno, M. (2012). 40S subunit dissociation and proteasome‐dependent RNA degradation in nonfunctional 25S rRNA decay. The EM- BO Journal 31, 2579–2589.

Gilberti, N., Turla, M., Alberici, A., Bertasi, V., Civelli, P., Archetti, S., Padovani, A., and Borroni, B. (2011). Prevalence of frontotemporal lobar degeneration in an isolated population: the Vallecamonica study. Neurol Sci 33, 899–904.

Gitcho, M.A., Baloh, R.H., Chakraverty, S., Mayo, K., Norton, J.B., Levitch, D., Hatanpaa, K.J., White, C.L., Bigio, E.H., Caselli, R., et al. (2008). TDP-43 A315T mutation in familial motor neuron disease. Ann Neurol. 63, 535–538.

Gomez, T.S., and Billadeau, D.D. (2009). A FAM21-Containing WASH Complex Reg- ulates Retromer-Dependent Sorting. Developmental Cell 17, 699–711.

Gorno-Tempini, M.L., Hillis, A.E., Weintraub, S., Kertesz, A., Mendez, M., Cappa, S.F., Ogar, J.M., Rohrer, J.D., Black, S., Boeve, B.F., et al. (2011). Classification of primary progressive aphasia and its variants. Neurology 76, 1006–1014.

Grada, A., and Weinbrecht, K. (2013). Next-Generation Sequencing: Methodology and Application. J Invest Dermatol 133, e11.

Grant, B.D., and Donaldson, J.G. (2009). Pathways and mechanisms of endocytic recycling. Nat Rev Mol Cell Biol 10, 597–608.

Grohme, K., v. Maravic, M., Gasser, T., and Borasio, G.D. (2001). A case of amyotrophic lateral sclerosis with a very slow progression over 44 years. Neuromuscular Disorders 11, 414–416.

Guyant-Maréchal, L., Laquerrière, A., Duyckaerts, C., Dumanchin, C., Bou, J., Dugny, F., Le Ber, I., Frébourg, T., Hannequin, D., and Campion, D. (2006). Valosin- containing protein gene mutations: clinical and neuropathologic features. Neurology 67, 644–651.

Harbour, M.E., Breusegem, S.Y.A., Antrobus, R., Freeman, C., Reid, E., and Seaman, M.N.J. (2010). The cargo-selective retromer complex is a recruiting hub for protein complexes that regulate endosomal tubule dynamics. J Cell Sci 123, 3703–3717.

Hedera, P., DiMauro, S., Bonilla, E., Wald, J., Eldevik, O.P., and Fink, J.K. (1999). Phenotypic analysis of autosomal dominant hereditary spastic paraplegia linked to chromosome 8q. Neurology 53, 44–44.

Hirabayashi, M., Inoue, K., Tanaka, K., Nakadate, K., Ohsawa, Y., Kamei, Y., Popiel, A.H., Sinohara, A., Iwamatsu, A., Kimura, Y., et al. (2001). VCP/p97 in abnormal protein aggregates, cytoplasmic vacuoles, and cell death, phenotypes relevant to neuro- degeneration. , Published Online: 18 September 2001; | doi:10.1038/sj.cdd.4400907 8.

Hübbers, C.U., Clemen, C.S., Kesper, K., Böddrich, A., Hofmann, A., Kämäräinen, O., Tolksdorf, K., Stumpf, M., Reichelt, J., Roth, U., et al. (2007). Pathological conse- quences of VCP mutations on human striated muscle. Brain 130, 381–393.

Ishiura, H., Takahashi, Y., Hayashi, T., Saito, K., Furuya, H., Watanabe, M., Murata, M., Suzuki, M., Sugiura, A., Sawai, S., et al. (2014). Molecular epidemiology and clinical spectrum of hereditary spastic paraplegia in the Japanese population based on com- prehensive mutational analyses. J Hum Genet 59, 163–172.

Iwata, A., Riley, B.E., Johnston, J.A., and Kopito, R.R. (2005). HDAC6 and Microtu- bules Are Required for Autophagic Degradation of Aggregated Huntingtin. J. Biol. Chem. 280, 40282–40292.

Jahic, A., Kreuz, F., Zacher, P., Fiedler, J., Bier, A., Reif, S., Rieger, M., Krüger, S., Beetz, C., and Plaschke, J. (2014). A novel strumpellin mutation and potential pitfalls in the molecular diagnosis of hereditary spastic paraplegia type SPG8. Journal of the Neu- rological Sciences 347, 372–374.

Jin, L., Underhill, P.A., Oefner, P.J., and Cavalli-Sforza, L.L. (1995). Systematic search for polymorphisms in the human genome using denaturing high-performance liquid chromatography (DHPLC). Am J Hum Genet 57, A234–A299.

Johnson, J.O., Mandrioli, J., Benatar, M., Abramzon, Y., Van Deerlin, V.M., Trojan- owski, J.Q., Gibbs, J.R., Brunetti, M., Gronka, S., Wuu, J., et al. (2010). Exome Se- quencing Reveals VCP Mutations as a Cause of Familial ALS. Neuron 68, 857–864.

Johnston, J.A., Ward, C.L., and Kopito, R.R. (1998). Aggresomes: A Cellular Response to Misfolded Proteins. J Cell Biol 143, 1883–1898.

Josephs, K.A. (2008). Frontotemporal dementia and related disorders: Deciphering the enigma. Ann Neurol. 64, 4–14.

Ju, J.-S., and Weihl, C.C. (2010). Inclusion body myopathy, Paget’s disease of the bone and fronto-temporal dementia: a disorder of autophagy. Hum. Mol. Genet. 19, R38– R45.

Ju, J.-S., Miller, S.E., Hanson, P.I., and Weihl, C.C. (2008). Impaired Protein Aggregate Handling and Clearance Underlie the Pathogenesis of p97/VCP-associated Disease. J. Biol. Chem. 283, 30289–30299.

Kantorova, B., Malcikova, J., Smardova, J., Pavlova, S., Trbusek, M., Tom, N., Plevo- va, K., Tichy, B., Truong, S., Diviskova, E., et al. (2014). TP53 mutation analysis in chronic lymphocytic leukemia: comparison of different detection methods. Tumor Biol. 36, 3371–3380.

Kedersha, N., Stoecklin, G., Ayodele, M., Yacono, P., Lykke-Andersen, J., Fritzler, M.J., Scheuner, D., Kaufman, R.J., Golan, D.E., and Anderson, P. (2005). Stress granules and processing bodies are dynamically linked sites of mRNP remodeling. J Cell Biol 169, 871–884. van Kerkhof, P., dos Santos, C.M.A., Sachse, M., Klumperman, J., Bu, G., and Strous, G.J. (2001). Proteasome Inhibitors Block a Late Step in Lysosomal Transport of Se- lected Membrane but not Soluble Proteins. Mol Biol Cell 12, 2556–2566.

Kim, H.J., Kim, N.C., Wang, Y.-D., Scarborough, E.A., Moore, J., Diaz, Z., MacLea, K.S., Freibaum, B., Li, S., Molliex, A., et al. (2013a). Mutations in prion-like domains in hnRNPA2B1 and hnRNPA1 cause multisystem proteinopathy and ALS. Nature 495, 467–473.

Kim, N.C., Tresse, E., Kolaitis, R.-M., Molliex, A., Thomas, R.E., Alami, N.H., Wang, B., Joshi, A., Smith, R.B., Ritson, G.P., et al. (2013b). VCP Is Essential for Mitochon- drial Quality Control by PINK1/Parkin and this Function Is Impaired by VCP Muta- tions. Neuron 78, 65–80.

Kimonis, V., Donkervoort, S., and Watts, G. (2011). Inclusion Body Myopathy with Paget Disease of Bone and/or Frontotemporal Dementia. In GeneReviews(®), R.A. Pa- gon, M.P. Adam, H.H. Ardinger, S.E. Wallace, A. Amemiya, L.J. Bean, T.D. Bird, C.R. Dolan, C.-T. Fong, R.J. Smith, et al., eds. (Seattle (WA): University of Washington, Seattle),.

Kimonis, V.E., Fulchiero, E., Vesa, J., and Watts, G. (2008). VCP disease associated with myopathy, Paget disease of bone and frontotemporal dementia: Review of a unique disorder. Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease 1782, 744–748.

Kinsley, L., and Siddique, T. (2015). Amyotrophic Lateral Sclerosis Overview. In Ge- neReviews(®), R.A. Pagon, M.P. Adam, H.H. Ardinger, S.E. Wallace, A. Amemiya, L.J. Bean, T.D. Bird, C.R. Dolan, C.-T. Fong, R.J. Smith, et al., eds. (Seattle (WA): University of Washington, Seattle),.

Kopito, R.R. (2000). Aggresomes, inclusion bodies and protein aggregation. Trends in Cell Biology 10, 524–530.

Koppers, M., van Blitterswijk, M.M., Vlam, L., Rowicka, P.A., van Vught, P.W.J., Groen, E.J.N., Spliet, W.G.M., Engelen-Lee, J., Schelhaas, H.J., de Visser, M., et al. (2012). VCP mutations in familial and sporadic amyotrophic lateral sclerosis. Neurobi- ology of Aging 33, 837.e7–e837.e13.

Kosaki, K., Curry, C.J., Roeder, E., and Jones, K.L. (1997). Ritscher-Schinzel (3C) syndrome: Documentation of the phenotype. Am. J. Med. Genet. 68, 421–427.

Krebs, C.E., and Paisán-Ruiz, C. (2012). The Use of Next-Generation Sequencing in Movement Disorders. Frontiers in Genetics 3.

Kuklin, A., Munson, K., Gjerde, D., Haefele, R., and Taylor, P. (1997). Detection of single-nucleotide polymorphisms with the WAVETM DNA fragment analysis system. Genetic Testing 1, 201–206.

Kurzawski, G., Dymerska, D., Serrano-Fernández, P., Trubicka, J., Masojć, B., Jaku- bowska, A., and Scott, R.J. (2012). DNA and RNA analyses in detection of genetic pre- disposition to cancer. Hered Cancer Clin Pract 10, 17.

Kwok, C.T., Wang, H.-Y., Morris, A.G., Smith, B., Shaw, C., and de Belleroche, J. (2015). VCP mutations are not a major cause of familial amyotrophic lateral sclerosis in the UK. Journal of the Neurological Sciences 349, 209–213.

Lamark, T., and Johansen, T. (2012). Aggrephagy: Selective Disposal of Protein Ag- gregates by Macroautophagy. International Journal of Cell Biology 2012, e736905.

Lattante, S., Ciura, S., Rouleau, G.A., and Kabashi, E. (2015). Defining the genetic connection linking amyotrophic lateral sclerosis (ALS) with frontotemporal dementia (FTD). Trends in Genetics 31, 263–273.

Latterich, M., and Patel, S. (1998). The AAA team: related ATPases with diverse functions. Trends in Cell Biology 8, 65–71.

Latterich, M., Fröhlich, K.-U., and Schekman, R. (1995). Membrane fusion and the cell cycle: Cdc48p participates in the fusion of ER membranes. Cell 82, 885–893.

Liscic, R.M., Grinberg, L.T., Zidar, J., Gitcho, M.A., and Cairns, N.J. (2008). ALS and FTLD: two faces of TDP-43 proteinopathy. European Journal of Neurology 15, 772– 780.

Liu, L., Li, Y., Li, S., Hu, N., He, Y., Pong, R., Lin, D., Lu, L., and Law, M. (2012). Comparison of Next-Generation Sequencing Systems. J Biomed Biotechnol 2012.

Liu, Y.-J., Ju, T.-C., Chen, H.-M., Jang, Y.-S., Lee, L.-M., Lai, H.-L., Tai, H.-C., Fang, J.-M., Lin, Y.-L., Tu, P.-H., et al. (2015). Activation of AMP-activated protein kinase α1 mediates mislocalization of TDP-43 in amyotrophic lateral sclerosis. Hum. Mol. Genet. 24, 787–801.

Lomen-Hoerth, C., Anderson, T., and Miller, B. (2002). The overlap of amyotrophic lateral sclerosis and frontotemporal dementia. Neurology 59, 1077–1079.

Mackenzie, I.R.A., Bigio, E.H., Ince, P.G., Geser, F., Neumann, M., Cairns, N.J., Kwong, L.K., Forman, M.S., Ravits, J., Stewart, H., et al. (2007). Pathological TDP-43 distinguishes sporadic amyotrophic lateral sclerosis from amyotrophic lateral sclerosis with SOD1 mutations. Ann Neurol. 61, 427–434.

Mackenzie, I.R.A., Neumann, M., Bigio, E.H., Cairns, N.J., Alafuzoff, I., Kril, J., Ko- vacs, G.G., Ghetti, B., Halliday, G., Holm, I.E., et al. (2010). Nomenclature and nosolo- gy for neuropathologic subtypes of frontotemporal lobar degeneration: an update. Acta Neuropathol 119, 1–4.

de Magalhães, J.P., Finch, C.E., and Janssens, G. (2010). Next-generation sequencing in aging research: emerging applications, problems, pitfalls and possible solutions. Ageing Res Rev 9, 315–323.

Maruyama, H., Morino, H., Ito, H., Izumi, Y., Kato, H., Watanabe, Y., Kinoshita, Y., Kamada, M., Nodera, H., Suzuki, H., et al. (2010). Mutations of optineurin in amyotrophic lateral sclerosis. Nature 465, 223–226.

Massman, P.J., Sims, J., Cooke, N., Haverkamp, L.J., Appel, V., and Appel, S.H. (1996). Prevalence and correlates of neuropsychological deficits in amyotrophic lateral sclerosis. J Neurol Neurosurg Psychiatry 61, 450–455.

Mazroui, R., Marco, S.D., Kaufman, R.J., and Gallouzi, I.-E. (2007). Inhibition of the Ubiquitin-Proteasome System Induces Stress Granule Formation. Mol. Biol. Cell 18, 2603–2618.

Mehta, S.G., Khare, M., Ramani, R., Watts, G.D.J., Simon, M., Osann, K.E., Don- kervoort, S., Dec, E., Nalbandian, A., Platt, J., et al. (2013). Genotype-Phenotype studies of VCP-associated Inclusion Body Myopathy with Paget Disease of Bone and/or Frontotemporal Dementia. Clin Genet 83, 422–431.

Mendez, M.F., and Perryman, K.M. (2002). Neuropsychiatric features of frontotemporal dementia: evaluation of consensus criteria and review. The Journal of Neuropsychiatry and Clinical Neurosciences 14, 424–429.

Mesulam, M.M. (2001). Primary progressive aphasia. Ann. Neurol. 49, 425–432.

Meyer, H., and Weihl, C.C. (2014). The VCP/p97 system at a glance: connecting cellular function to disease pathogenesis. J Cell Sci 127, 3877–3883.

Meyer, H., Bug, M., and Bremer, S. (2012). Emerging functions of the VCP/p97 AAA- ATPase in the ubiquitin system. Nat Cell Biol 14, 117–123.

Meyer, H.H., Shorter, J.G., Seemann, J., Pappin, D., and Warren, G. (2000). A complex of mammalian Ufd1 and Npl4 links the AAA-ATPase, p97, to ubiquitin and nuclear transport pathways. EMBO J 19, 2181–2192.

Miller, R.G., Mitchell, J.D., and Moore, D.H. (2012). Riluzole for amyotrophic lateral sclerosis (ALS)/motor neuron disease (MND). In Cochrane Database of Systematic Re- views, (John Wiley & Sons, Ltd),.

Miller, S.A., Dykes, D.D., and Polesky, H.F. (1988). A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 16, 1215.

Miller, T.D., Jackson, A.P., Barresi, R., Smart, C.M., Eugenicos, M., Summers, D., Clegg, S., Straub, V., and Stone, J. (2009). Inclusion body myopathy with Paget disease and frontotemporal dementia (IBMPFD): clinical features including sphincter disturbance in a large pedigree. J Neurol Neurosurg Psychiatry 80, 583–584.

Mori-Konya, C., Kato, N., Maeda, R., Yasuda, K., Higashimae, N., Noguchi, M., Koike, M., Kimura, Y., Ohizumi, H., Hori, S., et al. (2009). p97/valosin-containing protein (VCP) is highly modulated by phosphorylation and acetylation. Genes to Cells 14, 483–497.

Müller, J.M.M., Deinhardt, K., Rosewell, I., Warren, G., and Shima, D.T. (2007). Tar- geted deletion of p97 (VCP/CDC48) in mouse results in early embryonic lethality. Bio- chemical and Biophysical Research Communications 354, 459–465.

Nakano, M., Yamada, K., Fain, J., Sener, E.C., Selleck, C.J., Awad, A.H., Zwaan, J., Mullaney, P.B., Bosley, T.M., and Engle, E.C. (2001). Homozygous mutations in ARIX (PHOX2A) result in congenital fibrosis of the extraocular muscles type 2. Nature Ge- netics 29, 315–320.

Nalbandian, A., Donkervoort, S., Dec, E., Badadani, M., Katheria, V., Rana, P., Ngu- yen, C., Mukherjee, J., Caiozzo, V., Martin, B., et al. (2011). The Multiple Faces of Valosin-Containing Protein-Associated Diseases: Inclusion Body Myopathy with Pa- get’s Disease of Bone, Frontotemporal Dementia, and Amyotrophic Lateral Sclerosis. J Mol Neurosci 45, 522–531.

Neary, D., Snowden, J.S., Gustafson, L., Passant, U., Stuss, D., Black, S., Freedman, M., Kertesz, A., Robert, P.H., Albert, M., et al. (1998). Frontotemporal lobar degeneration A consensus on clinical diagnostic criteria. Neurology 51, 1546–1554.

Neumann, M., Sampathu, D.M., Kwong, L.K., Truax, A.C., Micsenyi, M.C., Chou, T.T., Bruce, J., Schuck, T., Grossman, M., Clark, C.M., et al. (2006). Ubiquitinated TDP-43 in Frontotemporal Lobar Degeneration and Amyotrophic Lateral Sclerosis. Science 314, 130–133.

Neumann, M., Mackenzie, I.R., Cairns, N.J., Boyer, P.J., Markesbery, W.R., Smith, C.D., Taylor, J.P., Kretzschmar, H.A., Kimonis, V.E., and Forman, M.S. (2007). TDP- 43 in the ubiquitin pathology of frontotemporal dementia with VCP gene mutations. Journal of Neuropathology & Experimental Neurology 66, 152–157.

Niwa, H., Ewens, C.A., Tsang, C., Yeung, H.O., Zhang, X., and Freemont, P.S. (2012). The Role of the N-Domain in the ATPase Activity of the Mammalian AAA ATPase p97/VCP. J. Biol. Chem. 287, 8561–8570.

Onyike, C.U., and Diehl-Schmid, J. (2013). The Epidemiology of Frontotemporal De- mentia. Int Rev Psychiatry 25, 130–137.

Orita, M., Iwahana, H., Kanazawa, H., Hayashi, K., and Sekiya, T. (1989). Detection of polymorphisms of human DNA by gel electrophoresis as single-strand conformation polymorphisms. Proceedings of the National Academy of Sciences 86, 2766–2770.

Ossareh‐Nazari, B., Bonizec, M., Cohen, M., Dokudovskaya, S., Delalande, F., Schaeffer, C., Dorsselaer, A.V., and Dargemont, C. (2010). Cdc48 and Ufd3, new part- ners of the ubiquitin protease Ubp3, are required for ribophagy. EMBO Reports 11, 548–554.

Ou, S.H., Wu, F., Harrich, D., García-Martínez, L.F., and Gaynor, R.B. (1995). Cloning and characterization of a novel cellular protein, TDP-43, that binds to human immuno- deficiency virus type 1 TAR DNA sequence motifs. J. Virol. 69, 3584–3596.

Premstaller, A., and Oefner, P.J. (2002). Denaturing HPLC of nucleic acids. Lc Gc Eu- rope 15, 410.

Pye, V.E., Dreveny, I., Briggs, L.C., Sands, C., Beuron, F., Zhang, X., and Freemont, P.S. (2006). Going through the motions: The ATPase cycle of p97. Journal of Structural Biology 156, 12–28.

Ramanathan, H.N., and Ye, Y. (2012). The p97 ATPase associates with EEA1 to regulate the size of early endosomes. Cell Res 22, 346–359.

Rascovsky, K., Hodges, J.R., Knopman, D., Mendez, M.F., Kramer, J.H., Neuhaus, J., Swieten, J.C. van, Seelaar, H., Dopper, E.G.P., Onyike, C.U., et al. (2011). Sensitivity of revised diagnostic criteria for the behavioural variant of frontotemporal dementia. Brain 134, 2456–2477.

Ritson, G.P., Custer, S.K., Freibaum, B.D., Guinto, J.B., Geffel, D., Moore, J., Tang, W., Winton, M.J., Neumann, M., Trojanowski, J.Q., et al. (2010). TDP-43 Mediates Degeneration in a Novel Drosophila Model of Disease Caused by Mutations in VCP/p97. Journal of Neuroscience 30, 7729–7739.

Ritz, D., Vuk, M., Kirchner, P., Bug, M., Schütz, S., Hayer, A., Bremer, S., Lusk, C., Baloh, R.H., Lee, H., et al. (2011). Endolysosomal sorting of ubiquitylated caveolin-1 is regulated by VCP and UBXD1 and impaired by VCP disease mutations. Nat Cell Biol 13, 1116–1123.

Rocco, P., Vainzof, M., Froehner, S. c., Peters, M. f., Marie, S. k. n., Passos-Bueno, M. r., and Zatz, M. (2000). Brazilian family with pure autosomal dominant spastic paraplegia maps to 8q: Analysis of muscle beta 1 syntrophin. Am. J. Med. Genet. 92, 122–127.

Rodriguez-Gonzalez, A., Lin, T., Ikeda, A.K., Simms-Waldrip, T., Fu, C., and Sakamo- to, K.M. (2008). Role of the Aggresome Pathway in Cancer: Targeting Histone Deacetylase 6–Dependent Protein Degradation. Cancer Res 68, 2557–2560.

Rottner, K., Hänisch, J., and Campellone, K.G. (2010). WASH, WHAMM and JMY: regulation of Arp2/3 complex and beyond. Trends in Cell Biology 20, 650–661.

Rubino, E., Rainero, I., Chiò, A., Rogaeva, E., Galimberti, D., Fenoglio, P., Grinberg, Y., Isaia, G., Calvo, A., Gentile, S., et al. (2012). SQSTM1 mutations in frontotemporal lobar degeneration and amyotrophic lateral sclerosis. Neurology 79, 1556–1562.

Schuberth, C., and Buchberger, A. (2008). UBX domain proteins: major regulators of the AAA ATPase Cdc48/p97. Cell. Mol. Life Sci. 65, 2360–2371.

Seaman, M.N.J., Gautreau, A., and Billadeau, D.D. (2013). Retromer-mediated endosomal protein sorting: all WASHed up! Trends in Cell Biology 23, 522–528.

Sephton, C.F., Cenik, C., Kucukural, A., Dammer, E.B., Cenik, B., Han, Y., Dewey, C.M., Roth, F.P., Herz, J., Peng, J., et al. (2011). Identification of Neuronal RNA Tar- gets of TDP-43-containing Ribonucleoprotein Complexes. J. Biol. Chem. 286, 1204– 1215.

Song, C., Wang, Q., and Li, C.-C.H. (2003). ATPase Activity of p97-Valosin- containing Protein (VCP) D2 mediates the major enzme activity, and D1 contributes to the heat-induced activity. J. Biol. Chem. 278, 3648–3655.

Sreedharan, J., Blair, I.P., Tripathi, V.B., Hu, X., Vance, C., Rogelj, B., Ackerley, S., Durnall, J.C., Williams, K.L., Buratti, E., et al. (2008). TDP-43 Mutations in Familial and Sporadic Amyotrophic Lateral Sclerosis. Science 319, 1668–1672.

Stolz, A., Hilt, W., Buchberger, A., and Wolf, D.H. (2011). Cdc48: a power machine in protein degradation. Trends in Biochemical Sciences 36, 515–523.

Strong, M.J., Grace, G.M., Freedman, M., Lomen-Hoerth, C., Woolley, S., Goldstein, L.H., Murphy, J., Shoesmith, C., Rosenfeld, J., Leigh, P.N., et al. (2009). Consensus criteria for the diagnosis of frontotemporal cognitive and behavioural syndromes in amyotrophic lateral sclerosis. Amyotroph Lateral Scler 10, 131–146.

Takashima, H., Boerkoel, C.F., and Lupski, J.R. (2001). Screening for mutations in a genetically heterogeneous disorder: DHPLC versus DNA sequence for mutation detection in multiple genes causing Charcot-Marie-Tooth neuropathy. Genet Med 3, 335– 342.

Tan, C.-F., Eguchi, H., Tagawa, A., Onodera, O., Iwasaki, T., Tsujino, A., Nishizawa, M., Kakita, A., and Takahashi, H. (2007). TDP-43 immunoreactivity in neuronal inclusions in familial amyotrophic lateral sclerosis with or without SOD1 gene mutation. Acta Neuropathol 113, 535–542.

Tanabe, K., Ohashi, E., Henmi, Y., and Takei, K. (2011). Receptor sorting and actin dynamics at early endosomes. Commun Integr Biol 4, 742–744.

Thomas, M., Alegre-Abarrategui, J., and Wade-Martins, R. (2013). RNA dysfunction and aggrephagy at the centre of an amyotrophic lateral sclerosis/frontotemporal dementia disease continuum. Brain 136, 1345–1360.

Traynor, B. (2014). Insights into the ALS-FTD continuum from the study of C9orf72. Alzheimer’s & Dementia: The Journal of the Alzheimer’s Association 10, P156–P157.

Tresse, E., Salomons, F.A., Vesa, J., Bott, L.C., Kimonis, V., Yao, T.-P., Dantuma, N.P., and Taylor, J.P. (2010). VCP/p97 is essential for maturation of ubiquitin- containing autophagosomes and this function is impaired by mutations that cause IBMPFD. Autophagy 6, 217–227.

Valadi, N. (2015). Evaluation and Management of Amyotrophic Lateral Sclerosis. Pri- mary Care: Clinics in Office Practice 42, 177–187.

Valdmanis, P.N., Meijer, I.A., Reynolds, A., Lei, A., MacLeod, P., Schlesinger, D., Zatz, M., Reid, E., Dion, P.A., Drapeau, P., et al. (2007). Mutations in the KIAA0196 Gene at the SPG8 Locus Cause Hereditary Spastic Paraplegia. The American Journal of Human Genetics 80, 152–161.

Van Deerlin, V.M., Leverenz, J.B., Bekris, L.M., Bird, T.D., Yuan, W., Elman, L.B., Clay, D., Wood, E.M., Chen-Plotkin, A.S., Martinez-Lage, M., et al. (2008). TARDBP mutations in amyotrophic lateral sclerosis with TDP-43 neuropathology: a genetic and histopathological analysis. The Lancet Neurology 7, 409–416.

Viguera, E., Canceill, D., and Ehrlich, S.D. (2001). Replication slippage involves DNA polymerase pausing and dissociation. EMBO J 20, 2587–2595.

Wang, Q., Song, C., and Li, C.-C.H. (2004). Molecular perspectives on p97–VCP: pro- gress in understanding its structure and diverse biological functions. Journal of Struc- tural Biology 146, 44–57.

Wang, X., Yang, Y., Wang, X., Li, C., and Jia, J. (2014). A novel KIAA0196 (SPG8) mutation in a Chinese family with spastic paraplegia. Chin. Med. J. 127, 1987–1989.

Watts, G.D.J., Wymer, J., Kovach, M.J., Mehta, S.G., Mumm, S., Darvish, D., Pestronk, A., Whyte, M.P., and Kimonis, V.E. (2004). Inclusion body myopathy associated with Paget disease of bone and frontotemporal dementia is caused by mutant valosin- containing protein. Nat Genet 36, 377–381.

Weihl, C.C., Dalal, S., Pestronk, A., and Hanson, P.I. (2006). Inclusion body myopathy- associated mutations in p97/VCP impair endoplasmic reticulum-associated degradation. Hum. Mol. Genet. 15, 189–199.

Weihl, C.C., Temiz, P., Miller, S.E., Watts, G., Smith, C., Forman, M., Hanson, P.I., Kimonis, V., and Pestronk, A. (2008). TDP-43 accumulation in IBM muscle suggests a common pathogenic mechanism with Frontotemporal dementia. J Neurol Neurosurg Psychiatry 79, 1186–1189.

Weihl, C.C., Pestronk, A., and Kimonis, V.E. (2009). Valosin-containing protein disease: Inclusion body myopathy with Paget’s disease of the bone and fronto-temporal dementia. Neuromuscular Disorders 19, 308–315.

Wild, P., Farhan, H., McEwan, D.G., Wagner, S., Rogov, V.V., Brady, N.R., Richter, B., Korac, J., Waidmann, O., Choudhary, C., et al. (2011). Phosphorylation of the Au- tophagy Receptor Optineurin Restricts Salmonella Growth. Science 333, 228–233.

Worms, P.M. (2001). The epidemiology of motor neuron diseases: a review of recent studies. Journal of the Neurological Sciences 191, 3–9.

Xiao, W., and Oefner, P.J. (2001). Denaturing high-performance liquid chromatography: A review. Hum. Mutat. 17, 439–474.

Yamanaka, K., Sasagawa, Y., and Ogura, T. (2012). Recent advances in p97/VCP/Cdc48 cellular functions. Biochimica et Biophysica Acta (BBA) - Molecular Cell Research 1823, 130–137.

Yamanoshita, O., Kubota, T., Hou, J., Ping, Y.-M., Zhang, X.-L., Li, X.-P., Li, S.-S., Li, X.-X., Zhu, D.-C., Fukushima, Y., et al. (2005). DHPLC is superior to SSCP in screening p53 mutations in esophageal cancer tissues. Int. J. Cancer 114, 74–79.

Ye, Y., Shibata, Y., Yun, C., Ron, D., and Rapoport, T.A. (2004). A membrane protein complex mediates retro-translocation from the ER lumen into the cytosol. Nature 429, 841–847.

Yu, B., Sawyer, N.A., Caramins, M., Yuan, Z.G., Saunderson, R.B., Pamphlett, R., Richmond, D.R., Jeremy, R.W., and Trent, R.J. (2005). Denaturing high performance liquid chromatography: high throughput mutation screening in familial hypertrophic cardiomyopathy and SNP genotyping in motor neurone disease. J Clin Pathol 58, 479– 485.

Zeiler, M., Straube, W.L., Lundberg, E., Uhlen, M., and Mann, M. (2012). A Protein Epitope Signature Tag (PrEST) Library Allows SILAC-based Absolute Quantification and Multiplexed Determination of Protein Copy Numbers in Cell Lines. Mol Cell Pro- teomics 11, O111.009613.

8 Appendix

8.1 International consensus criteria for behavioral variant FTD

Table A1: International consensus criteria for behavioral variant FTD (FTDC) (Rascovsky et al., 2011) * one of the following symptoms of the category must be present; * ‘early’ refers to symptom presentation within the first 3 years; FTD: Frontotemporal dementia

1. Neurodegenerative disease The following symptom must be present to meet criteria for bvFTD A. Shows progressive deterioration of behavior and/or cognition by observation of history (as provided by a knowledgeable informant) 2. Possible bvFTD Three of the following behavioral/cognitive symptoms (A-F) must be present to meet criteria. A. Early** behavioral disinhibition* A.1. Socially inappropriate behavior A.2. Loss of manners or decorum A.3. Impulsive, rash or careless actions B. Early apathia or inertia* B.1. Apathy B.2. Inertia C. Early loss of sympathy or empathy* C.1. Diminished response to other people’s needs and feelings C.2. Diminished social interest, interrelatedness or personal warmth D. Early perseverative, stereotyped or compulsive/ritualistic behavior* D.1. Simple repetitive movements D.2. Complex, compulsive or ritualistic behavior D.3. Stereotypy of speech E. Hyperorality and dietary changes* E.1. Altered food preferences E.2. Binge eating, increased consumption of alcohol or cigarettes E.3. Oral exploration or consumption of inedible objects F. Neuropsychological profile: executive/generation deficits with relative sparing of memory and visuospatial functions* F.1. Deficits in executive tasks F.2. Relative sparing or episodic memory F.3. Relative sparing of visuospatial skills 3. Probable bvFTD All of the following symptoms (A-C) must be present to meet criteria. A. Meets criteria for possible bvFTD B. Exhibits significant functional decline (by caregiver report or as evidenced by Clincal Dementia Rating Scale or Functional Activities Questionnaire scores) C. Imaging results consistent with bvFTD* C.1. Frontal and/or anterior temporal atrophy on MRI or CT C.2. Frontal and/or anterior temporal hypoperfusion or hypometabolism on PET or SPECT 4. Behavioral variant FTD Criterion A and either criterion B or C must be present to meet

with definite FTLD Patholo-criteria. gy A. Meets criteria for possible or probable bvFTD B. Histopathological evidence of FTLD on biopsy or at post- mortem C. Presence of a known pathogenic mutation 5. Exclusionary criteria for Criteria A and B must be anwered negatively for any bvFTD di- bvFTD agnosis. Criterion C can be positive for possible bvFTD must be negative for probable bvFTD. A. Pattern of deficits is better accounted for by other non- degenerative nervous system or medical disorders B. Behavioral disturbances is better accounted for by a psychiatric diagnosis C. Biomarkers strongly indicative of Alzheimer’s disease or other neurodegenerative process 8.2 Inclusion and exclusion criteria for the diagnosis of PPA

Table A2: Inclusion and exclusion criteria for the diagnosis of PPA (Gorno-Tempini et al., 2011) PPA: primary progressive aphasia

Inclusion and exclusion Inclusion: criteria 1-3 must be answered positively criteria for the diagnosis of diagnosis of PPA based 1. Most prominent clinical feature is difficulty with language on criteria by Mesulam, 2. 2. These deficits are principal cause of impaired daily living 2001 activities

3. Aphasia should be the most prominent deficit at symptom onset and for the initial phases of the disease

Exclusion: criteria 1-4 must be answered negatively for the PPA diagnosis

1. Pattern of deficits is better accounted for by other nongegen- erative nervous system or medical disorders

2. Cognitive disturbance is better accounted for by a psychiatric diagnosis

3. Prominent initial episodic memory, visual memory, and visuoperceptual impairments

4. Prominent, initial behavioral disturbance

8.3 Diagnostic features for three subtypes of PPA

Table A3: Diagnostic features for three subtypes of PPA (Gorno-Tempini et al., 2011) PPA: primary progressive aphasia

Diagnostic features for the I. Clinical diagnosis of nonfluent/agrammatic variant nonfluent/agrammatic PPA variant PPA At least one of the following core features must be present: 1. Agrammatism in language production 2. Effortful, halting speech with inconsistent speech sound errors and distortions (apraxia of

speech) At least 2 of 3 of the following other features must be present: 1. Impaired comprehension of syntactically complex sentences 2. Spared single-word comprehension 3. Spared object knowledge II. Imaging-supported nonfluent/agrammatic variant diagnosis Both of the following criteria must be present: 1. Clinical diagnosis of nonfluent /agrammatic variant PPA 2. Imaging must show one or more of the following results: a. Predominant left posterior fronto- insular atrophy on MRI or b. Predominant left posterior fronto- insular hypoperfusion of hypometabolism on SPECT or PET III. Nonfluent/agrammatic variant PPA with definite pathology Clinical diagnosis (criterion 1 below) and either criterion 2 or 3 must be present: 1. Clinical diagnosis of nonfluent/agrammatic variant PPA 2. Histophathologic evidence of a specific neurodegenerative pathology (e.g. FTLD-tau, FTLD- TDP, AD, other) 3. Presence of a known pathogenic mutation Diagnostic criteria for the I. Clinical diagnosis of semantic variant PPA semantic variant PPA Both of the following core features must be present: 1. Impaired confrontation naming 2. Impaired single-word comprehension At least 3 of the following other diagnostic features must be present: 1. Impaired object knowledge, particularly for low-frequency or low-familiarity items 2. Surface dyslexia or dysgraphia 3. Spared repetition 4. Spared speech production (grammar and motor speech II. Imaging-supported semantic variant PPA diagnosis Both of the following criteria must be present: 1. Clinical diagnosis of semantic variant PPA 2. Imaging must show one or more of the following results: a. Predominant anterior temporal lobe atrophy b. Predominant anterior temporal hypoperfusion or hypometabolism on SPECT or PET III. Semantic variant PPA with definite pathology Clinical diagnosis (criterion 1 below) and either criterion 2 or 3 must be present: 1. Clinical diagnosis of semantic variant PPA 2. Histopathologic evidence of a specific neurodegenerative pathology (e.g. FTLD-tau, FTLD-

TDP, AD, other 3. Presence of a known pathogenic mutation Diagnostic criteria for I. Clinical diagnosis of logopenic variant PPA logopenic variant PPA Both of the following core features must be present: 1. Impaired single-word retrieval in spontaneous speech and naming 2. Impaired repetition of sentences and phrases At least 3 of the following other diagnostic features must be present: 1. Speech (phonologic) errors in spontaneous speech and naming 2. Spared single-word comprehension and object knowledge 3. Spared motor speech 4. Absence of frank agrammatism II. Imaging-supported logopenic variant diagnosis Both criteria must be present: 1. Clinical diagnosis of logopenic variant PPA 2. Imaging must show one or more of the following results: a. Predominant left posterior perisyl- vian or parietal lobe atrophy on MRI b. Predominant left posterior perisyl- vanian or parietal hypoperfusion or hypometabolism on SPECT or PET III. Logpenic variant PPA with definite pathology Clinical diagnosis (criterion 1 below) and either criterion 2 or 3 must be present: 1. Clinical diagnosis of logpenic variant PPA 2. Histopathologic evidence of a specific neurodegenerative pathology (e.g. FTLD-tau, FTLD- TDP, AD, other Presence of a known pathogenic mutation

Acknowledgments

I would like to express my gratitude to the following people without whom the comple- tion of this dissertation would not have been possible:

 Prof. Dr. med. Jörg T. Epplen for providing the research topic as well as the necessary facilities for the research and the support.  Dr. med. Sabine Hoffjan and Dr. rer. nat. Gabriele Dekomien for the supervision and continuous encouragement.  Prof. Dr. rer. nat. Christoph Clemen from the Department of Biochemistry of the University of Cologne and Prof. Dr. med. Jochen Weishaupt from the De- partment of Neurology of the University of Ulm for providing the samples and the clinical data.  Natascha Wirkus, Manuela Scholz and Yvonne Klenk for the commitment and the support in the laboratory.  All Faculty members of the Department for Human Genetics at Ruhr-University Bochum for their help and support.  My husband Bhuvnaesh for his confidence in me and his constant love, inspira- tion and encouragement. Thank you for always being there for me.

Resume

Personal Information Name: Katharina Timmer Birthday January 6th 1984 Birthplace: Trier Nationality: German

School Education 1990-1994 Kaland-Schule, Lübeck, Germany 1994-2000 Oberschule zum Dom, Lübeck, Germany 2000-2001 Student-Exchange-Year, Stayton High School, Oregon, U.S.A. 2001-2004 Carl-Jacob-Burckhardt-Gymnasium, Lübeck, Germany

University Education

2004-2007 Preclinical study of medicine at the University of Lübeck, Germany 2007 Part one of the National Medical Licensing Exam (1. Abschnitt der Ärztlichen Prüfung) 2007-2011 Clinical study of medicine at the Martin-Luther-University of Halle/Saale, Germany 2011-2012 Clinical Internship at the Martin-Luther-University of Halle/Saale, Germany 2012 Part two of the National Medical Licensing Exam (2. Abschnitt der Ärztlichen Prüfung)

Work Experience since 2012 Assistant MD for Genetic Counselling at the Department for Human Genetics, Prof. Dr. J.T. Epplen, Ruhr-University, Bochum