Endogenous Retroviral RNA Expression in Humans

Digital Comprehensive Summaries of Uppsala Dissertations from the Faculty of Medicine 274

LIJUAN HU

ACTA UNIVERSITATIS UPSALIENSIS ISSN 1651-6206 UPPSALA ISBN 978-91-554-6967-2 2007 urn:nbn:se:uu:diva-8213 ! " #$ % & ' '(( ()* + $ + + ,$ $ -% + . /0 1$ 2 3 $0

40 '(( 0 3 5 56" 3 0 " 0 ' 70 ) 0 0 8#6 ) !9)9 79:): 9'0

-35/ !; + $ $ 0 1$ 7((( 9 $ $ 2$$ $ + $ 0 1$+ 2 + ,<5 = + $ + $ + 2$$ $ $ $ 2$$ $ 0 8 2 + $ $ $ $ 56" 2 $$ ++ 2 0 . 2 +$ $ 353 35> 2 = 2 = $$ $ + 2$ + 0 3 + 353 2 $$ $ 0 353 35> 56" 2 $$ $ 0 $ 9 9 ++ $ 2 2 ++ 35 0 6 + 35> 2 #?969@ 9 + + $ 2$ 9A $ 0 %$ $$ + 9 ++ A 2 + 0 1$ 2 ++ 0 8 = 35 2 2$ 0 " $ $ ++ 2$$ 35 $ $ $ $ 0 2 $ ++ 2$ + + 35 $ 0

-35/ 353 35> 56" ,<5

! ! " ! #$ $ $ ! ! %&'()*( !

B 4 '((

8##6 : 9:'(: 8#6 ) !9)9 79:): 9' * *** 9!'C -$ *DD 00D E F * *** 9!'C/ To my parents

List of papers

This thesis is based on the following papers, which are referred to in the text by their roman numerals.

I Forsman, A. 1, Yun, Z1., Hu, L., Uzhameckis, D., Jern, P. and Blomberg, J., 2005. Development of broadly targeted human endogenous gammaretroviral pol-based real time PCRs: Quantitation of RNA expression in human tissues. J Virol Methods 129, 16-30.2

II Hu, L., Hornung, D., Kurek, R., Östman, H., Blomberg, J. and Bergqvist, A., 2006. Expression of human endogenous gammaretroviral sequences in endometriosis and ovarian cancer. AIDS Res Hum Retroviruses 22, 551-7.3

III Hu, L., Östman, H., Bergqvist, A. and Blomberg, J. Physiological expression of human endogenous gammaretrovirus-like RNA in female reproductive tissues. (manuscript)

IV Hu, L., Hedborg, F. and Blomberg, J. Selective activation of HERVW RNA expression during culture of a neuroblastoma cell line. (Manuscript)

V Hu, L1., Yun, Z.1, Forsman, A., Dmitrijs U., Jern, P., Yolken,R., Torrey, R.F. and Blomberg, J. Individual pattern of RNA expression of human endogenous gammaretrovirus-like sequences in the human brain. (Manuscript)

VI Muradrasoli, S. 1, Forsman, A. 1, Hu, L., Blikstad, V. and Blomberg, J., 2006. Development of real-time PCRs for detection and quantitation of human MMTV-like (HML) sequences: HML expression in human tissues. J Virol Methods 136, 83-92.4 1These two authors contributed equally, and share the first authorship. Reprints were made with permissions from the publishers. 2 ©2005 Elsevier B.V; 3© 2006 Mary Ann Liebert, Inc; 4©2006 Elsevier B.V.

Contents

Introduction...... 11 Background ...... 11 Retroelements...... 12 Non-LTR retrotransposons ...... 12 Retrotransposons ...... 12 Retroviruses...... 13 Retroviral genome structure ...... 13 Retroviral replication...... 14 Endogenization of retroviruses...... 15 Human endogenous retroviruses...... 15 Retrovirus taxonomy and classification of ERVs ...... 16 Classification of endogenous retroviruses ...... 17 Expression of ERVs? ...... 19 ERV expression in reproductive organs ...... 20 Autoimmune diseases with endogenous retroviruses ...... 21 Neurological diseases and endogenous retrovirus: multiple sclerosis (MS) and schizophrenia...... 22 Association of endogenous retroviruses with cancer or malignancy- associated diseases...... 23 Aims...... 24 General aim ...... 24 Specific aims ...... 24 Materials and Methods...... 25 Materials...... 25 Methods...... 25 Quantitative real-time PCR (QPCR) ...... 25 Reference genes...... 26 Results and discussion ...... 28 I. Development of broadly targeted real time RT-PCRs for gammaretrovirus-like sequences, and application of the PCRs in human tissues (paper I) ...... 28

II. Expression of endogenous gammaretrovirus-like sequences in female reproductive tissues both from healthy donors and patients (papers II and III) ...... 33 III. Selective action of HERVW RNA expression during the culture of a neuroblastoma cell line (paper IV)...... 36 IV. Gammaretroviral expression in brain (paper V) ...... 40 V. Development and application of real time PCRs for detection and quantification of human MMTV-like (HML) sequences in human tissues (paper VI) ...... 41 Conclusions and future prospects ...... 44 Acknowledgements...... 46 References...... 49

Abbreviations

ALV avian leukosis virus BLV bovine leukaemia virus CA capsid protein CNS central nervous system DNA deoxyribonucleic acid env envelope gene enJSRV endogenous jaagsiekte (sheep) retrovirus ERV endogenous retrovirus ERVL endogenous retrovirus L ERVS endogenous retrovirus S gag group specific antigen gene HERV human endogenous retrovirus HERVE human endogenous retrovirus E HERVH human endogenous retrovirus H HERVI/T human endogenous retrovirus I and T HERVW human endogenous retrovirus W HML human mouse mammary tumor virus-like HIV human immunodeficiency virus HTLV human T-cell leukemia virus IN integrase JSRV jaagsiekte (sheep) retrovirus LTR long terminal repeat LINE long interspersed nucleotide element MA matrix protein MLV murine leukaemia virus MMTV mouse mammary tumor virus MS multiple sclerosis MSRV multiple sclerosis associated retrovirus NC nucleocapsid protein ORF open reading frame PBS primer binding site PCR polymerase chain reaction pol polymerase gene pro protease gene SFV3 simian foamy virus 3 RT reverse transcriptase

RELIK rabbit endogenous lentivirus type K SINE short interspersed nucleotide element SLE systemic lupus erythematosis SU surface unit TM transmembrane protein TE transposable retroelement U3 unique 3’-sequence U5 unique 5’-sequence WDSV walleye dermal sarcoma virus XRV exogenous retrovirus

Introduction

Background Retrovirus is a virus with double linear single stranded positive polarity ribonucleic acids (RNA) enclosed in a lipid bilayer envelope. The virus uses the reverse transcriptase (RT) encoded by the virus to convert their RNA into linear double-stranded deoxyribonucleic acid (DNA) and can integrate this DNA into the genome of the host cell (Baltimore, 1970; Temin and Mizutani, 1970). The integrated retroviral DNA resides as a provirus (Baltimore, 1970; Temin, 1964; Temin and Mizutani, 1970). The discovery of RT in 1970 updated the central dogma of molecular biology which was originally proposed in 1958 by Crick (Crick, 1970; Crick, 1958).

Although retroviruses were not named until 1974 (Baltimore, 1975), people were alerted by retroviral diseases much earlier. In 1904, Vallée and Carré provided evidence that equine anemia was infectiously transmitted by a filtrate and we now know that the etiologic agent is a lentivirus. A retrovirus was also discovered from neoplastic diseases in chicken by Ellermann and Bang in 1908 and another was isolated by Rous in 1911 and by Fujinami and Inamoto in 1914 (Medawar, 1997). In 1936, Bittner found that mammary carcinoma in mice was caused by a mammalian retrovirus (Bittner, 1936). After 1960’s many retroviruses that cause neoplastic diseases in mice, cats, cattle and monkeys were identified. Retroviruses causing diseases in humans were also found in early 1980s. The human retrovirus human T-cell leukemia virus (HTLV) causing adult T-cell leukemia was discovered in 1980 by Poiesz and the human immunodeficiency virus (HIV), causing AIDS, was discovered in 1982 by Barre-Sinoussi and Gallo et al (Barre- Sinoussi et al., 1983; Gallo et al., 1984; Poiesz et al., 1980).

Since endogenous retroviruses were discovered in the genomes of birds and mammals after the late 1960s (Aaronson et al., 1969; Bentvelzen et al., 1968; Weiss, 1969; Weiss, 2006), it was suspected for a long time that the human genome might also contain these kinds of sequences (Benveniste and Todaro, 1976; Sherwin and Todaro, 1979). Finally a human endogenous retrovirus (HERV) was discovered in 1981 by Martin et al. and in 1982 by Bonner et al. (Bonner et al., 1982; Martin et al., 1981). Since then, many HERV families have been characterized (Blond et al., 1999; Christensen et

11 al., 2000; Lindeskog et al., 1999; Ono et al., 1986; Shiroma et al., 2001; Tassabehji et al., 1994). Our group also characterized human mouse mammary tumor virus (MMTV)-like (HML) groups, HERVR(ERV3), HERVH and ERV9-like groups using different methods (Andersson et al., 2005; Andersson et al., 1999; Jern et al., 2004; Oja et al., 2005). With the completion of the human genome project and the improvement in biotechnology, systematic investigation of HERV expression in humans has become possible. In this thesis, a set of broadly targeted real time PCRs were developed to study the expression of HERV RNA in cell lines, healthy controls and patients with different diseases, for example, endometriosis, ovarian caner, schizophrenia and bipolar disorder.

Retroelements Retroelements refer to a group of transposable genetic DNA sequences that utilize an intermediate RNA molecule during their replication cycle. These transposable retroelements (TEs) are present in a wide range of organisms from prokaryotes to plants and to animals (Mager and Henthorn, 1984). The retroelements have been divided into two groups based on the presence or absence of long terminal repeats (LTRs): non-LTR retrotransposons and LTR-containing retroelements. The non-LTR transposon group is further classified into long interspersed elements (LINEs) and short interspersed elements (SINEs) on the basis of their coding abilities and length. The LTR- containing group can further be divided into the retrotransposons and the retroviruses.

Non-LTR retrotransposons Non-LTR retrotransposons do not have an LTR. Long interspersed nucleotide elements (LINEs) contain an open reading frame (ORF) and a pol gene with similarities to reverse transcriptase (RT). The major LINE is the L1 group, which presents about 85000 copies in the human genome (Kazazian, 2000; Prak and Kazazian, 2000). Short interspersed nucleotide elements (SINEs) are about 100-300 bp long and lack the coding abilities. One of the most extensively studied SINEs is the Alu elements, which are present in about 1.5 million copies in the human genome (Lander et al., 2001).

Retrotransposons The LTR-containing retrotransposons are usually 6-7 kb in length and present a pol gene as well as a gag gene. Usually the retrotransposons lack an env gene. Thus, retrotransposons are not able to infect new cells without a

12 retroviral env. It was previously thought that no active retrotransposons were found in the human genome (Prak and Kazazian, 2000). However, several identifications of integrational polymorphisms and even retroviruses which are replication competent after minor site-directed “genetic surgery” were recently reported in the human genome (Dewannieux et al., 2006; Lee and Bieniasz, 2007).

Retroviruses Retroviruses are enveloped viruses containing two single-stranded RNA genomes, and they replicate via the DNA intermediate. Retrovirus uses two forms to keep its genetic material, either as viral RNA in viral particles or as a provirus integrated in its host’s DNA. Retroviruses have been isolated from a variety of vertebrate species, including humans, other mammals, reptiles and fish (Barre-Sinoussi et al., 1983; Gallo et al., 1984; Papas et al., 1976; Svet-Moldavsky et al., 1967).

Retroviral genome structure A typical retroviral provirus is about 6-11 kb in size. The structure of an integrated retrovirus (provirus) consists of four internal universal genes, i.e., gag, pro, pol and env, which are flanked by two LTRs (Figure 1).

PBS gag env

U3 R U5 U3 R U5

LTR LTR pro pol

Figure 1. Structure of the retroviral genome. LTR: long terminal repeat, U3: unique 3’ sequence, R: repeat sequence; U5: unique 5’ sequence; PBS: primer binding site; gag: group-specific antigen; pro: protease; pol: RNA-dependent DNA polymerase, env: envelope.

The LTR sequence can be divided into three regions from the 5' to the 3' end, namely U3, R, and U5. Since transcription of genomic RNA begins at the R region of the 5' LTR and ends at the R region of the 3' LTR, the U5 region is unique to the 5' end of the genomic RNA, and the U3 region is unique to the 3' end. Restoration of the structure of the LTRs is achieved during reverse

13 transcription of genomic RNA. The U3 region contains the promoter and a series of regulatory sequences, which may influence the expression of the neighbouring cellular genes (reviewed in Brosius, 1999). A common region called the primer binding site (PBS) is also identified downstream of the 5’ U5 region. The PBS is usually 18-nucleotide long and complementary to the 3’-sequence of the host transfer RNA (tRNA) which is utilized by the viral genome to initiate reverse transcription. The PBS sequence is traditionally used to name and group ERV (Gifford and Tristem, 2003; Tristem, 2000; Urnovitz and Murphy, 1996). For example, members of the HERVH have a PBS complementary to the histidine-tRNA, and members of the HERVE have a PBS with glutamic acid-tRNA. However, a group of HERVs may have several different PBSs (Jern et al., 2004). Therefore, this classification is being abandoned.

The gag stands for group-specific antigen. The gag gene encodes at least three structural proteins in the virion: matrix (MA), capsid (CA) and nucleocapsid (NC). The pol is short for RNA-dependent DNA polymerase. This gene encodes several enzymes, i.e., reverse transcriptase (RT) which transcribes RNA into DNA, RNase H needed during reverse transciption and integrase, which integrates the DNA into the host chromosome. Depending on the species, either gag or pol can encode a protease (pro), a protein that cleaves the initial polyprotein products of retrovirus translation to make functional proteins. The env gene encodes the surface unit (SU) glycoprotein and the transmembrane protein (TM) of the virion. These proteins form a complex that interacts specifically with cellular receptor proteins and mediate virus entry by triggering virus-host cell membrane fusion, thus giving the retrovirus the ability of intercellular transmission.

Retroviral replication A free retroviral particle can infect the host cell by the retroviral SU env glycoprotein binding to a cellular surface specific receptor. This binding event activates the membrane fusion-inducing potential of the TM protein and results in the fusion of the viral and host cell membranes. The viral core particle is uncoated. The viral gag-derived proteins, two full-length genomic RNAs and the reverse transcriptase protein, enter the cytoplasm, where the viral genomic RNA is reversely transcribed into double stranded DNA (dsDNA). The dsDNA migrates into the nucleus. Then the dsDNA is integrated into the chromosomal DNA of the host cell facilitated by the viral enzyme integrase (IN). The integrated retrovirus is called a provirus. The proviral DNA is transcribed to virus-related RNA by using the RNA

14 polymerase in the host cell. Some RNAs form the progeny viral chromosomal RNA and export to the cytoplasm. Some RNAs serve as mRNA. The mRNA is spliced and transported to the cytoplasm where it is translated into structural (gag and env) and enzymatic (pro-pol) proteins. The structural and enzymatic proteins localize inside of the cell membrane. Then two viral genomic RNA copies are co-packaged with the enzymatic pro-pol polyproteins and bud to form an immature viral particle from the cell membrane. After budding the pro-pol polyproteins are cleaved into functional subunits to form a mature retrovirus. The virus is now prepared to initiate a new round of replication. The gammaretrovirususes and betaretroviruses differ with regard to whether the pro gene belongs to the gag or the pol ORF. In the betaretroviruses the pro gene belongs to the gag ORF, and in contrast, it belongs to the pol ORF in the gammaretroviruses (Swanstrom and Wills, 1997).

Endogenization of retroviruses Endogenous retroviruses refer to a group of retroviral elements that are present in their host’s genome. Usually retroviruses infect somatic cells and cannot be transmitted to the host’s offspring. Occasionally germ cells can be infected by exogenous retroviruses that are integrated into a chromosome of a germ cell. If the germ cell survives, the inserted retroviruses can be transmitted from one generation to another as a normal Mendelian gene (Stoye and Coffin, 1985). The integration of proviruses may contribute to the genomic plasticity (Lower et al., 1996), and the proviruses will continue to exist and multiply as long as the cell can afford to maintain these integrated "selfish genes" (Dawkins, 1976; Orgel and Crick, 1980).

Human endogenous retroviruses Approximately 8% of the human genome is derived from retrovirus-like elements (Bock and Stoye, 2000; Lander et al., 2001). If non-LTR retrotransposons are also included, this figure goes up to about 43% (Lander et al., 2001). It is postulated that human endogenous retroviruses (HERVs) may have evolved from germ-line infection of the exogenous retroviruses (XRV) in the remote past of primate evolution and have accumulated numerous deleterious mutations such as stop codons, frame shifts or recombinations between their LTRs (Stoye, 2001). All groups except HERVK(HML-2) have long ceased to proliferate, and no naturally replicating HERVs are described (Lander et al., 2001). Two mechanisms by which HERVs may increase their copy number within the genome are suggested. This is achieved either via intracellular retrotransposition (within

15 germ line cells) or through an extracellular infectious phase (re-infection of the germ line). The two pathways are not mutually exclusive.

Retrovirus taxonomy and classification of ERVs Retroviruses in genomic construction organization can be broadly divided into two groups: simple and complex. Simple retroviruses usually only carry four genes encoding proteins, whereas complex retroviruses code for additional regulatory proteins derived from multiply spliced messages. For example, the deltaretroviral genus has two accessory regulatory genes rex and tax. The gag, pro and pol genes are present in different reading frames. The gag-pro-pol transcript needs two successive frameshifts. To date only one genus, the deltaretroviruses which are complex retroviruses, has not been found to be endogenous in their hosts. The most likely explanation for the lack of endogenisation of certain retroviruses is the degree of interference during embryogenesis and adult life. Viruses with lower host fitness will be selected against, and will not become fixed in the germ line. Complex retroviruses have more regulatory genes, which interfere with the physiology of the host cell. Initially the classification of retroviruses was based on the morphology of the mature virion observed by electron microscopy. Based on microscopic morphology they were classified into 4 types: A-, B-, C- and D-type retroviruses. The current classification attempts are often based on the degree of sequence identity of pol gene. The retroviruses are now classified into seven genera: alpha, beta, delta, epsilon, gamma, lenti and spuma. Examples of viruses included in each of the genera are as follows (Table 1):

Table 1. Retrovirus genera Genus Representative virus Morphological Organisation type Alpharetrovirus Avian leukosis virus (ALV) C-type Simple Betaretovirus Mouse mammary tumour virus B-type and D-type Simple* (MMTV) Gammaretrovirus Murine leukaemia virus (MLV) C-type Simple Deltaretrovirus Bovine leukaemia virus (BLV) C-type like Complex Epsilonretrovirus Walleye dermal sarcoma virus C-type Complex (WDSV) Lentivirus Human immunodeficiency virus (HIV) Cone-shaped core Complex Spumavirus Simian foamy virus 3 (SFV3) C-type like Complex

*except HML2 group

16 Classification of endogenous retroviruses Retroviral pol genes are generally the most conserved sequences among retroviruses (McClure et al., 1988), probably due to its fundamental properties and roles in retroviral replication. The classification of ERVs is difficult due to broad sequence variation and numerous mutations. Therefore a suitable taxonomy is needed. Thus, according to their similarities to mammalian retroviruses, HERVs have alternatively been more loosely classified into three classes (Figure 2) (Lander et al., 2001; Wilkinson et al., 1994): Class I comprises gamma-like retroviruses, formerly known as type C; Class II includes beta-like retroviruses, formerly known as type B/D; Class III consists of elements distantly related to foamy viruses. Each class is further divided into many groups that originated independently from ancient infections of the germ line by different types of exogenous retroviruses, which have been integrated into their chromosomes and then persisted as stable Mendelian factors for multiple generations.

Figure 2. An unrooted pol based neighbour joining (NJ) tree with the seven retrovirual genera and the more loosely defined ERV class definitions. ERVs which were studied in the thesis are indicated by pink color. A very similar tree was published earlier (Jern et al., 2005). In that tree high bootstrap support was found for most branches. Bootstrap analysis was not performed on the above tree.

17 Alpharetroviruses Alpharetroviruses have only been identified in birds. The prototype member of the genus is the avian leukosis virus (ALV), which was the first retrovirus isolated (Medawar, 1997), and has a simple genome organization.

Betaretroviruses Betaretroviruses have been assumed to be detected only from mammals before, but they have recently been detected in chicken (Jern et al., 2004). The prototype member of the genus is the mouse mammary tumour virus (MMTV). The betaretrovirus genus was created by combining two of the former retroviral genera, type B and type D, into a single genus. They belong to the ERV Class II group and are the second biggest ERV group in HERVs. Most of the betaretroviruses have a structure with a simple genome, except the HERVK(HML2) which encodes the accessory proteins Rec or Np9 (Armbruester et al., 2002; Armbruester et al., 2004; Lower et al., 1996; Magin et al., 1999). In humans betaretrovirus-like sequences, also called human MMTV-like (HML) sequences, were classified into 10 groups, i.e., HML1 to 10 (Andersson et al., 1999; Gifford and Tristem, 2003; Johnson and Coffin, 1999; Lavie et al., 2004; Mayer and Meese, 2002; Medstrand et al., 1992; Medstrand and Mager, 1998). Several endogenous betaretroviruses have been found to be active in mouse (MMTV) and sheep (jaagsiekte (sheep) retrovirus (JSRV)) (Fanning et al., 1980; Hynes et al., 1980; Palmarini et al., 2001).

Gammaretroviruses Both exogenous and endogenous gammaretroviruses are ubiquitous in a variety of vertebrate species from mouse, primates/human to birds and reptiles (Jern et al., 2005; Martin et al., 1997). The prototype of this genus is the murine leukaemia virus (MLV). All the members have a simple genomic structure and non-defective viruses do not encode accessory genes, although many replication-defective members are known to encode oncogenes. Gammaretrovirus-like ERVs are a major group which belongs to ERV Class I.

Spuma and spuma-like retroviruses The spumaretroviruses are widespread in mammals. They are a genus of exogenous viruses with complex genomes. These viruses do not have closely related endogenous counterparts, but have distantly related viruses that are widespread in vertebrate genomes, e.g. ERVL and ERVS. Therefore they are called spuma-like retroviruses. The prototype spuma-like retrovirus is the human foamy virus (HFV). The spuma-like retroviruses belong to the ERV Class III.

18 Epsilonretroviruses Epsilonretroviruses are primarily found in fish and amphibians. A recent study showed that a few epsilon-like elements were detected in the human genome (Jern et al., 2005; Martin et al., 1997; Oja et al., 2005). The epsilonretroviruses share their gene structures with gammaretroviruses, thus they are grouped into the same class, i.e., Class I ERVs. However, epsilonretroviruses have a complex genome structure with three additional ORFs, i.e., orfA, orfB and orfC.

Deltaretroviruses and Lentiviruses Both deltaretroviruses and lentiviruses have complex genomes with accessory genes. Previously no endogenous counterparts in these two retroviral genera were found, but recently a rabbit endogenous lentivirus type K (RELIK) was identified in the European rabbit (Oryctolagus cuniculus)(Katzourakis et al., 2007). It has two accessory genes, tat and rev.

Expression of ERVs? Retrotransposons comprise about 43% of the human genome and have been suggested to be selfish DNAs that do not serve relevant host functions (Doolittle and Sapienza, 1980). Some, but not all, of retrotransposons are silenced by DNA methylation in mammalian genomes (Yoder et al., 1997). L1s, Alus and LTRs contain promoters but also enhancers (Henikoff et al., 1997). Through both functions they can govern host functions by modulating the transcription of the cis-linked host genes (Britten, 1996; Medstrand et al., 2001; Moran et al., 1999; Schulte et al., 1996; Strazzullo et al., 1998; Ting et al., 1992). The promoter activity of retroviral LTRs is regulated by transcription factors, which may or may not be tissue-specific. They often bind to the U3 portion of the LTR (Boeke and Stoye, 1997).

Retroviruses offer several potentially useful functional modules to the host. The abundance of retroviral single LTRs has a substantial influence on the expression of many nonretroviral human genes, which include, for example, the tissue specific enhancers, polymerase II promoters, splice donors, and splice acceptors (Feuchter-Murthy et al., 1993; Kato et al., 1987; Ling et al., 2002; Medstrand et al., 2001; Ting et al., 1992). Several cloned HERV enzymes such as protease, dUTPase, reverse transcriptase and integrase have been demonstrated to be functional (Berkhout et al., 1999; Feuchter-Murthy et al., 1993; Harris et al., 1999; Kitamura et al., 1996; Towler et al., 1998). A HERVE element is inserted next to the amylase gene. Through its LTR it regulates the tissue-specific expression of human salivary amylases (Ting et al., 1992). In transient transfection assays, the HERVIP LTR was found to

19 be active particularly in liver and kidney cells (Schon et al., 2001). A HERVK(HML-10) element was found to be involved in tissue-specific expression of the insulin-like growth factor gene INSL4 in human placenta (Bieche et al., 2003). In contrast to the other insulin-like growth factor genes that have homologous counterparts in the mouse, the INSL4 gene appears to be primate-specific.

ERV expression in reproductive organs In animals and human, high expression of ERVs is common in reproductive tissues like seminiferous tubules, vesicula seminales, testes, placenta, ovary, type A spermatogonia and epididymis (Andersson et al., 2005; Cornwall et al., 1992; Crowell and Kiessling, 2007; Dupressoir and Heidmann, 1996; Harris, 1998; Herbst et al., 1996; Kiessling et al., 1989; Yin et al., 1999). HERVK particles have been identified in placenta (Boller et al., 1993; Lower et al., 1993). ERV-3 and MuLV env proteins are detected on the surface of human and mouse oocytes (Nilsson et al., 1999). In the Syrian hamster species a putative full-length type-C retrovirus is present in the uterus (DeHaven et al., 1998). HERVW RNA has been detected in testis (Mi et al., 2000). ERV-3 (also named HERVR) env mRNA is expressed in the testes of the first phases of spermatogenesis but not in Sertoli or Leydig cells (Larsson et al., 1994).

In some cases the expression of ERVs is organ specific. Many studies reported an association between endogenous retrovirus expression and hormones, suggesting a hormone-dependent relationship between ERVs and the mammalian female reproductive tissues. It has been suggested that syncytin-1 may be an essential gene for steroid hormone-induced cell proliferation in endometrial carcinoma (Strick et al., 2006). Syncytin-1 is found to be upregulated in ovarian carcinoma, which might also involve steroid hormone induction (Menendez et al., 2004). Increased HERVK(HML2) expression in cell culture is induced by estrogen and progesterone treatment, suggesting that hormone response elements may exist in the regulatory region of HERVK(HML2) genome (Wang-Johanning et al., 2003b). It has been shown that the HERVK(T47D, HML4) LTR is active in the breast cancer cell line T47D, which produces retroviral particles containing HERVK(T47D, HML4) RNA. This LTR is inducible with estradiol and then progesterone treatments (Seifarth et al., 1998). HERVW expression is activated in placenta (Blond et al., 1999) and HERVR(ERV3) in placenta and sebaceous glands (Andersson et al., 1998). In sheep changes of endogenous JSRV (enJSRV) expression levels in the endometrium during the oestrus cycle and early pregnancy are also found (Spencer et al., 1999).

20 HERVK(HML2) env genes and the enJSRV are induced by steroid hormones (Palmarini et al., 2004; Wang-Johanning et al., 2003b).

The fact that ERV sequences are widespread and especially that reproductive and early embryonic tissues are among the most common and abundant sites of ERV expression suggests that ERVs could be involved in physiological, pathological as well as evolutionary processes (Prudhomme et al., 2005).

Autoimmune diseases with endogenous retroviruses ERV-related diseases have been suspected and discussed for several decades (for a review, see Blomberg et al., 2005). ERVs have been implicated as aetiological agents of autoimmune diseases, due to the structure and sequence similarity between these agents and exogenous retroviruses associated with immune dysregulation as well as the tissue-specific and differentiation-dependent expression of ERVs. In theory, quantitatively or structurally aberrant expression of normally cryptic ERVs, induced by environmental or endogenous factors, could initiate autoimmunity through direct or indirect mechanisms (Nakagawa and Harrison, 1996). ERVs may lead to immune dysregulation as insertional mutagens or cis-regulatory elements of cellular genes involved in immune function. More directly, human ERV gene products themselves are suggested to be immunologically active, which is similar to the superantigen activity in mouse mammary tumour viruses (MMTV) (Posnett and Yarilina, 2001; Sutkowski et al., 2001) and the non-specific immunosuppressive activity in mammalian type C retrovirus env proteins (Mangeney et al., 2001). These mechanisms need further investigation. Alternatively, increased expression of an ERV protein, or expression of a novel ERV protein not expressed in thymus during the development of immune tolerance, may lead to recognition as a neoantigen. Although retrovirus-like particles distinct from those of known exogenous retroviruses and immune responses to ERV proteins have been reported in autoimmune diseases, the role of ERVs in autoimmunity is uncertain.

Endogenous retroviruses have been observed in pathological and clinical autoimmune manifestations in human or animals. A link between ERV and autoimmune disease was initially suggested by studies of lupus-prone mice (Yoshiki et al., 1974). Several papers indicate that HERVE RNA is highly expressed in systemic lupus erythematosis (SLE) patients compared to controls (Ogasawara et al., 2003; Ogasawara et al., 2001). Antibodies to retroviral antigens in SLE have been reported in several studies. For example, synthetic peptides based on protein sequences deduced from endogenous viruses like HRES-1, ERV-3, HERVK, HERVE clone 4-1 and consensus sequences of C-type retroviruses are reactive in SLE patients (Blomberg et al., 1994; Herve et al., 2002; Hishikawa et al., 1997; Perl et al.,

21 1995). The dysregulation of antibody maturation in these diseases makes it hard to draw firm conclusions from these data. No conclusive data favouring a retroviral etiology of SLE have been obtained.

ERVs related to diabetes have also been discussed. HERVK18 which is related to HERVK10 (both belong to the HML2 group) may be involved in the pathogenesis of diabetes via a superantigen effect (Conrad et al., 1997; Marguerat et al., 2004). Two sequences, HERVK(HML-6) and HERVK(T47D, HML4), present among the histocompatibility genes, confer an increased risk of juvenile diabetes (Donner et al., 1999; Nakagawa et al., 1997; Seifarth et al., 1995; Yin et al., 1999).

Expression of ERV-9, HERVK and HERVL RNA in synovial fluid cells has been documented (Nakagawa et al., 1997). Type C retrovirus-like particles and human ERV-K10 have been isolated from rheumatoid arthritis (RA) synovial fluid pellets (Muller-Ladner et al., 1998; Stransky et al., 1993). Retrotransposable L1 element is expressed in RA synovial tissues (Neidhart et al., 2000).

Neurological diseases and endogenous retrovirus: multiple sclerosis (MS) and schizophrenia Particles containing reverse transcriptase and retroviral RNA have been associated with MS patients. The HERV RNA, with sequence similarity to ERV-9, belongs to the group HERVW, and was initially termed "Multiple Sclerosis Retrovirus" (MSRV). MSRV was found in the supernatants from cultured leptomeningeal and B cells, cerebrospinal fluid (CSF) and serum from MS patients by a French group in 1997 (Perron et al., 1997). Particle- bound HERVW RNA was detected in half of MS cerebrospinal fluid (CSF) and serum samples. Enhanced expression of HERVW was also found in the hypoxic tissue in MS patients (Antony et al., 2004). In the mean time a Danish group also found HERVH RNA expression in plasma and cultured B cells from MS patients (Christensen et al., 1998). Particle-bound HERVH RNA was found in 24 of 33 MS plasma samples. A caveat for observations of “retrovirus-like” particles is that exosomes which are virus-like particles can be generated by healthy or apoptotic cells (Fang et al., 2007). Retrovirus budding also uses some of the exosome pathways and it may be hard to distinguish them.

A selective increase in HERVW RNA expression is discovered in schizophrenic patients compared to mentally healthy controls (Deb-Rinker et

22 al., 1999). HERVW, ERV-9 and ERV-FRD RNAs have also been detected in particles in CSF of patients with newly debuted schizophrenia (Karlsson et al., 2001; Tuke et al., 1997).

Association of endogenous retroviruses with cancer or malignancy-associated diseases Since the endogenous betaretrovirus MMTV is found to cause the mouse mammary tumours, it has been suggested that the endogenous retroviral genes may contribute to tumorigenesis. Thus the endogenous retrovirus expression in tumors has been investigated. Some ERVs are found highly expressed in certain tumors, especially in reproductive tumors and germ line cell tumors. For example, HERVK(HML-2), HML-4 and HERVK(K10, HML2)-like sequences are detected in a human mammary carcinoma- derived cell line, T47D, as well as in cells and/or particles secreted by them (Ono et al., 1987; Patience et al., 1996; Seifarth et al., 1998). A sequence belonging to HML-6 was highly expressed in the breast cancer tissue of a patient (Yin et al., 1997).

High titers of antibodies binding to several HERVK(HML-2) proteins (env and gag) are detected in active seminomas, i.e., a type of testicular carcinoma (Herbst et al., 1996). HERVK(HML-2) including its viral particles, transcripts and proteins is found to be expressed in teratocarcinoma cell lines and testicular and ovarian germ cell tumours.

An increased expression of HERVK, ERV3 and HERVE env mRNA is found in ovarian epithelial tumors, but not in normal ovarian tissues (Wang- Johanning et al., 2007). High frequency expression of HERV env is also found in prostate carcinoma tissues (19 out of 49) compared to normal controls (one out of 18) (Wang-Johanning et al., 2003a).

23 Aims

General aim The aim of the study was to investigate the expression of endogenous retroviral RNA in humans using broadly targeted RT-QPCRs.

Specific aims 1. Development and application of a set of broadly targeted real-time RT- PCRs to detect endogenous gammaretroviral RNA expression in cell lines, patients and healthy people (Papers I, II, III, IV and V).

2. Development of broadly targeted real-time RT-PCRs to detect endogenous betaretroviral RNA in humans (Paper VI).

3. Characterization of the regulation of HERV expression in different conditions and attempted identification of the possible physiological role(s) of HERV in humans (Papers II, III, IV and V).

24 Materials and Methods

Materials 1. RNA from different tissues of healthy people was purchased (Human Total RNA Master Panel II, catalog number: K4008-1, Clontech, Palo Alto, Ca, USA). 2. A549, COS-1, Namalwa, RD-L and Vero-E6 cell lines, as well as one neuroblastoma cell line, SK-N-DZ, were obtained from the American Type Culture Collection (ATCC). Other two neuroblastoma cell lines, SH-SY5Y and SK-N-AS were kindly provided by Kristine Björnland, National Hospital, Oslo, Norway. 3. Clinical samples were collected from patients suffering from endometriosis, ovarian cancer, schizophrenia, and bipolar disorder as well as healthy donors.

Methods Quantitative real-time PCR (QPCR) Real-time PCR is a technique that can monitor sequence-specific PCR products in real time, when they accumulate during the PCR amplification process. As the PCR products of interest are produced, real-time PCR can detect their accumulation and quantify the number of substrates present in the initial PCR mixture before amplification began by using a sequence with known copies as a standard or reference control.

SYBR Green real-time PCR The principle of SYBR Green real-time PCR is based on the fact that SYBR Green 1 is a non-sequence-specific fluorogenic minor groove DNA-binding dye that intercalates into double-stranded DNA (dsDNA) and does not bind to single-stranded DNA (ssDNA). An increase in fluorescence signal occurs during the elongation step of each PCR cycle when a target sequence is annealed and elongated, and the signal decreases when DNA is denatured.

25 Taqman® real-time PCR The principle of Taqman® real-time PCR is based on the 5’ to 3’ exonuclease activity of Taq DNA polymerase (Holland et al., 1991) and the fluorescence resonance energy transfer (FRET) (Cardullo et al., 1988). An oligonucleotide probe is dual-labelled with a reporter fluorescent dye at the 5’ end and a quencher dye at the 3’ end or internally. When the probe is intact, the reporter and quencher are in proximity to each other resulting in FRET and the fluorescence emission of the reporter dye is absorbed by the quencher dye, leading to a lower fluorescence emission. When a target sequence is present, a 5’ primer and a probe complementarily hybridize to the sequence after denaturation. During the extension step, the 5’ exonuclease activity of the Taq DNA polymerase degrades the probe into small fragments. The reporter dye and the quencher dye are separated. The fluorescence of the reporter dye can thus be detected.

Reference genes It is essentially important for any quantitative gene and transcript detection method to choose a valid reference gene (or housekeeping gene) to normalize the data. Variation in the amount of starting material between samples, and varying degrees of RNA degradation, can cause errors in the quantification of mRNA transcripts. A cellular RNA can be used as an internal reference to normalize other RNA values, to minimize these errors (Karge et al., 1998). The ideal internal standard should be expressed at a constant level among different tissues of an organism, at all stages of development, and also should be unaffected by the experimental treatment (Bustin, 2000). Transcripts from many such reference genes, often referred to as “housekeeping” genes, have been evaluated and used in RT-PCR assays, but none of the proposed ones are ideal (Vandesompele et al., 2002). There are often cell types which over- or underexpress the gene. All uses of reference genes therefore are compromises.

The histone 3.3 gene is evenly expressed in many cell types, regardless of cell cycle stages (Wells and Kedes, 1985; Wu and Bonner, 1981; Wu and Bonner, 1985). Histone 3.3 mRNA has previously been used as a reference in other RNA expression studies (Andersson et al., 2005; Andersson et al., 1999; Medstrand and Blomberg, 1993; Medstrand et al., 1992). Besides histone 3.3 RNA, the RNA of three other widely used housekeeping genes, the glyceraldehyde-3-phosphate dehydrogenase (GAPDH), hypoxanthine phosphoribosyltransferase 1 (HPT1), and ubiquitin C (UBC) (Vandesompele et al., 2002) has also been determined in different cell lines, tissues and clinical samples. We found that histone 3.3 RNA was so far the best candidate which was evenly expressed in most of the samples. Thus, for

26 screening purposes, we chose histone 3.3 as the primary house keeping gene in our experiments. Results based on the histone 3.3 were verified by comparison with other housekeeping transcripts.

27 Results and discussion

I. Development of broadly targeted real time RT-PCRs for gammaretrovirus-like sequences, and application of the PCRs in human tissues (paper I)

Despite several decades of research on human endogenous retroviral sequences, the extent of their expression in normal and diseased tissues is not well characterized. A disease-related expression pattern has been described (Antony et al., 2004; Christensen et al., 1998; Karlsson et al., 2001; Moller-Larsen and Christensen, 1998; Perron et al., 1997; Perron and Seigneurin, 1999; Tuke et al., 1997). However, it has not been clear whether the increased retroviral expression in the cerebrospinal fluid or plasma of patients with central nervous system disease compared to normal controls is due to upregulation of a small number of retroviral loci, a general upregulation of many loci at the same time, or due to spurious particle (exosome) formation from dying cells or a normal, nonviral, pathway of exosome biogenesis (Fang et al., 2007). The large number of such sequences (around 4000 pol-containing retroviral integrations), makes it impractical to measure each of them separately.

Initially the sensitivity of published general non-real-time retroviral primers was assessed (Table 2). It was found that the most sensitive one was a nested system for HERVW which can detect 10 pg of human DNA, corresponding to about 300 target copies per PCR reaction. The most sensitive general retroviral PCRs are the PAN primers (Tuke et al., 1997) which can detect 800 pg of human genomic DNA, corresponding to about 60,000 target copies per reaction, and the MOP2 primers (Seifarth et al., 2000) which can detect 1 ng of human genomic DNA, corresponding to about 1,000,000 target copies per reaction. In principle, the more general the amplification, the more degenerate the primers. The more degenerate the primers, the less sensitive the PCR becomes.

28 Table 2. The sensitivity of the non-real time PCRs used for HERV sequence detection (titration with human DNA)

Sequence (5’ 3’) 2

Type of Target Target Sensitivity* PCR retroviral region group Forward (HS43f): GRCTSTATTAMTTGAARRRCCA Reverse (DS12r): Single HERVW Integrase 100 pg CTAATRRYTTCCTGATGKKTGATA Forward(HWf): TCCTTBRYAGAAAAAGGACTTYRAA Reverse (HWr): Single HERVW Integrase 1 ng AYTTTCAAGKATTCCATTATCACTGA

Outer

Forward (HS43f): GRCTSTATTAMTTGAARRRCCA Reverse (DS12r): CTAATRRYTTCCTGATGKKTGATA Nested HERVW Integrase 10 pg Inner Forward (HWf): TCCTTBRYAGAAAAAGGACTTYRAA Reverse (HWr): AYTTTCAAGKATTCCATTATCACTGA Forward (MOP-1F): GAAGGATCCARAGTNYTDYCHCMRGGH Reverse (MOP-1R): Single Alpha, beta, Reverse 1 ng GAAGGATCCNWDDMKDTYATCMAYRWA delta transriptase Forward (MOP-2F): GAAGGATCCTKKAMMSKVYTRCYHCARGGG Reverse (MOP-2R): Single Gamma, Reverse 1 ng GAAGGATCCMDVHDRBMDKYMAYVYAHKKA exogenous transcriptase Forward (PRO-F): GTKTTIKTIGAYACIGGIKC Single Gamma Protease, 100 ng Reverse (CT): Reverse AGIAGGTCRTCIACRTASTG transcriptase Forward (PRO-F): GTKTTIKTIGAYACIGGIKC Spumaviruses, Protease, 10 ng Reverse (JO): Single gamma Reverse ATIAGIAKRTCRTCIACRTA transcriptase Forward (PRO-F): Alpha, beta, GTKTTIKTIGAYACIGGIKC Single delta, Protease, 10 ng Reverse (EM): lentiviruses Reverse ATIAGIAKRTCRTCCATRTA transcriptase

Outer

Forward (PAN-UO): HIV-1, CTTGGATCCTGGAAAGTGYTRCCMC HTLV-I, Reverse 800 pg Inner Seminested MoMLV, transcriptase Forward (PAN-UI): MPMV, CTTGGATCCAGTGYTRCCMCARGG ERV-9, Reverse (PAN-DI): MSRV CTCAAGCTTCAGSAKGTCATCCAYGTA

footnotes: 1Sensitivity determined by serial dilutions of human DNA in this paper. IUPAC ambiguity codes: Y=CT, R=AG, M=AC, K=GT, S=CG

29 Therefore a set of broadly targeted Taqman® and SYBR Green real time PCRs at the most conserved motifs, i.e., reverse transcriptase (RT) and integrase (IN), in gammaretroviral genomes was developed in this work. For all of the PCRs the sensitivity has reached such a high level that less than 1 copy of human haploid genomic DNA or 1-10 copies of cloned HERVs can be revealed by the PCR reaction, even though in a PCR reaction the degeneracy of primers is up to 1728 (Table 3). Experiments with cloned HERV sequences showed that these methods yielded the desired specificity.

Such a set of general, quantitative and sensitive gamma-HERV Taqman and SYBR Green real time PCRs was used to examine a panel of RNAs from human tissues and body fluids. Histone 3.3 RNA was used as a control to quantify the gamma-HERV RNA expression in these samples. It was found that HERVE expression was the highest in testis, HERVI/T highest in testis and brain, HERVH highest in brain and testis, while HERVW expression

A. HERV-E B. HERV-I/T 0.4 0.5 . 0.4 0.3

0.3 0.2

0.2

0.1 0.1

0.0 0.0 RNA expression relative to histone 3.3 RNA expression relative to histone 3 3

l l e n e y a e d e n s s d s a w m le n e y ta te d le n is s d s a w m l o n e t t n l e ti u n u n o u o lo in e n a n c e t u n u en ro llu ho ol ti n en ta la sc le s m la er e rr ll h o t dn e st la s le es m la er r ar e s id c s g u p e y g t r a e w C es i c o g u p T y g t d b w C te K a ro S T h U d b , t K la r y m S h U A M e , n l ry m T id A M e n in P P r l T id e r in i P P a l o e er i l a a o n e a ll v ta r n ra l iv t yr o C r a li le y o C B a l le h B B a e h B m a e T m S k T S S k S S S

C. HERV-H D. HERV-W 0.5 0.30

0.4 0.25

0.20 0.3

0.15 0.2 0.10 0.1 0.05

0.0 RNA expression relative to histone 3.3

RNA expression relative to histone0.00 3.3

l y a w m le n e e ta te d le n is s d s l n ro lu o lo tin n n ta an sc ee st u an ru a w m le n e ey ta te d le n is s d s re r l h o s id e s l u l e ym l te n o u o lo in n n a n c ee st u n ru d a e w C e ac o g p T h g U e rr ll h o st d e st la s l e m la e A M eb , t K l r Y m S T d dr a e w C e i c o g u p T y g t e r in in P P ar l i M b , t K la r y m S h d U n e a ll v ta ro A re n in P P r l T i o C r a li le y ne e ai ll va ta ro B B m a e h o C r a li e y S k T B a el h S S B m S k T S S Figure 3 A-D. Gamma-like HERV expression in different tissues. Commercial RNA from healthy tissues was reverse-transcribed into cDNA. Taqman® and SYBR Green real time PCR was performed. Levels of HERV RNA were presented relative to the expression of histone 3.3 RNA.

30 was especially high in placenta (Figure 3). In body fluids (such as plasma and saliva) only a few samples contained a weak HERV signal. But in these cases signals were also frequently found in the RT- and reference gene histone 3.3. Thus they were probably derived either from contamination with residual DNA after DNase treatment, or RNA-containing nonviral particles.

F. General G. General 10 2

4 1

0 Nepeso eaiet itn 3.3 relative to histone RNAexpression Nepeso eaiet itn 3.3 relative to histone RNAexpression

0 e n e s m l o ne ey l i us us nal row lu o l ti nta tate and c een r e n e a e d le n is s d s e l h o dn e s l est m nal ow um ol lo in c e u u dr ar e C i us pl T y e r l o t tat e st an er A M K lac S Ute ar t eb n, w intes P Pr o Th id gland dr C es Ki dne y os Spl Te U ll o A ebel n,wh int lacentPr yglanmus Thym id gl Cer a r i l P ar al o one Brai hyr ne M a iv B m Salivary g T o Ce l et S keletal m B Br mal a el S S S k Thyr S H. HERV-H integrase I.Histone 3.3 signal 10000

3 100

n 80

o 60

v i

t 40 1000 Average of histone signal

n 20

s e

r 0

Copies of histone 3. 3 RNA per PCR reaction A 100 N al w le a e le is s o on ine nt nd c en t ru w m le n e ta te d le is s s R ney tat a s e and o o a u en llum st d es mus r lu o l tin en t sc er dr e Col te i os gl pl T hy gl Ute ar el h Co dn ey s gl an u est ymu gl and A n K r y mu S d w es Ki ac ro y m Spl een T h Ut Place P T oi Adre nal M reb nt Pl P l T d eMarr lli var al ai n, li ar ta n Cereb li et on e Ce r al v e Brain, who ma a el hy r B el Bo S k T B Sali k Thyroi S S Sm S

Figure 3 F-I. Gamma-like HERV expression in different tissues. Commercial RNA from healthy tissues was reverse-transcribed into cDNA. Taqman® and SYBR Green real time PCR was performed. Levels of HERV RNA were presented relative to the expression of histone 3.3 RNA

31 Table 3. Primer, Probe, Broadness and Sensitivity of the newly developed gammaretroviral PCRs. A negative result is shown as “-“

Tar- Detection limit (number of copies per PCR reaction) Working Primer/probe sequences 5’-3’ c. Reporter was always at 5´end. Dege- Targeted geted * concentrtion Quencher position is marked with neracy viruses viral (nM) Human region genomic HERVE HERVI HERVT HERVH HERVW PERVd DNA fw: CTTGGACCCRGCTTCCCMA 4 500 A rev: CCAAHAAMAGRTCRTCHAYRTACTGRA 576 1000 HERVE RT <=1 1-10 - - - - - * probe: TTCAAGAACT CCCCCACCATCTTTGGGGAGGC 1 200 fw: ACTYRGYTACCYCARGGTTTWA 64 500 HERVI, - B rev: CCAAHAAMAGRTCRTCHAYRTACTGRA 576 1000 RT <=1 - 1-10 1-10 - - - * T probe: AYTCCCCCACCCT TTTTGGGGAAGCCCTC 2 200 fw: TGGACTGTGCTGCCGCAA 1 200 C rev: GAAGSTCATCAATATATTGAATAAGGTGAGA 2 200 HERVH RT <=1 - - - 1-10 - - * probe: TTCAGGGACAGCCCT CGTTACTTCAGCCAAGCTC 1 300 fw: ACMTGGAYKRTYTTRCCCCAA 64 500 D rev: GTAAATCATCCACMTAYYGAAGGAYMA 32 500 HERVW RT <=1 - - - - 1-10 - * probe: TYAGGGATAGCCCYCAT CTRTTTGGYCAGGCA 16 300 fw: ACMTGGAYIRTBYTRCCICA 96 1000 HERVH, -W, - E rev: AIIARHARRTCATCHAYRTAYTGIAD 1728 1000 RT ~1 - - - 105 a 105 a 105 a ADP, TTYAGGGAT*AGCCCYMAYCTGTTTGGT probe: 16 100 ERV9 144 fw: AYCCHRYIGTICCIAACCCBTAYA 1000 all F RT <=1 - 10 1 1 - 1 gamma rev: AAMCCYTGGGGYARNMNVGTCCA 1536 3000 fw: ATCCAGCKGTCCCBAACCCKTAYA 24 600 all G RT 10 a 105 103-104 103 - - 103 rev: AACCCTTGGGGCAGCMNRGTCCA 16 600 gamma fw: TTAGAACCTCTCATTTCCTTTCCATC 1 200 H rev: CTTGATGTGTAGGGAAGGGAGG 1 200 HERVH IN <=1 - - - 1 - - * probe: CTTCTCAGT GTTCCATCTGCTATTCTACTACCCCTCAG 1 100 a, Lower starting amount of target sequence was not tested. b, nd=not done. c, IUPAC ambiguity codes. Y=CT, R=AG, M=AC, K=GT, S=CG, H=ACT, W=AT, N=AGCTd, PERV-A amplimer DNA kindly provided by Drs Peter Schmidt and Göran Andersson.

32 II. Expression of endogenous gammaretrovirus-like sequences in female reproductive tissues both from healthy donors and patients (papers II and III)

Elevated expression of HERVs has been observed in reproductive tissues. High expression of retroviruses in reproductive tissues increases the risk of viral transmission to the germ line cells, and the virus is more likely to endogenize in the human genomic “safe haven” for retroviral persistence. The human genome contains over 4000 ERV proviruses. The majority cluster with the genus gammaretrovirus. In paper II the broadly targeted gamma retrovirus-like QPCRs (in paper I) were used to examine 6 samples from endometrium, 14 samples from endometriotic tissues, 10 samples each

Figure 4. HERVE expression in endometriotic tissue, normal endometrium, ovarian cancer and benign ovarian tissue. Samples were processed and data were analysed as in Figure 3. Shown are the levels of HERVE RNA expression relative to that of histone 3.3 and other HERVs in the tissues as indicated.

33 from benign ovary and ovarian cancer, as well as 9 serum samples from endometriosis patients and 10 from healthy controls. The four gammartrovirus-like HERVs, namely HERVE, HERVW, HERVI/T and HERVH, were broadly expressed in those four different tissues (Figure 4). HERVE and HERVW had high expression in endometriotic tissues. HERVW exhibited the highest expression, while HERVE demonstrated the second highest in ovarian cancer samples. In contrast, the expression of HERVE was the highest and HERVW was the second highest in the normal ovarian tissue.

Low expression of HERVE and HERVW was detected in a few serum samples, although some of them had signals from histone 3.3. It could be that such cellular RNA was from decaying cells or a small amount of HERVE RNA packaged into retroviral or exosome particles present.

In paper III, more samples from endometriosis patients and controls were further collected. These samples included endometrium, ovarian tissue, as well as peritoneal fluid, plasma and peripheral blood mononuclear cells (PBMC). The four gammaretrovirus-like HERVs were also broadly expressed at different levels in the endometrium and ovarian tissues. HERVW was expressed most strongly and HERVE was the second highest

a. b. 1000

100 1

0,1

0,01 Ratio of HERV-E RNA vs Histone 3.3

Ratio of HERV-I.T0,01 RNA vs Histone 3.3 RNA 0,001 Endometrium Endometrium Ovarian Ovarian tissue Endometrium Endometrium Ovarian Ovarian tissue from from control tissue from from control from from control tissue from from control endometriosis patients endometriosis patients endometriosis patients endometriosis patients c. d. 10 1

0,1 1

0,01 0,1 Ratio of HERV-H RNA vs Histone 3.3 0,001 Ratio of0,01 HERV-W RNA vs Histone 3.3 RNA

Endometrium Endometrium Ovarian Ovarian tissue Endometrium Endometrium Ovarian Ovarian tissue from from control tissue from from control from from control tissue from from control endometriosis patients endometriosis patients endometriosis patients endometriosis patients Figure 5. Gamma-like HERV expression in normal endometrium and ovarian tissue. Samples were processed and data were analysed as in Figure 3.

34 RNA expression of HERVs in PBMC

1000 control patients 100

0,1 Ratio of HERVs RNA vs Histone 3.3 Histone vs RNA HERVs of Ratio

0,01 HERV-E HERV-I.T HERV-H HERV-W

Figure 6. The expression of HERVs in peripheral blood mononuclear cells (PBMC). RNA was isolated from PBMC from endometriosis patients and controls and reverse-transcribed into cDNA. Real-time PCR was performed. Samples were processed and data were analysed as in Figure 3.

in endometrial tissues compared to the other HERVs. HERVE had the highest expression and HERVW was the second highest in ovarian tissues compared to the other HERVs, which has confirmed the observation in paper II (Figure 5). PBMC demonstrated the highest expression of HERVW (Figure 6). At this stage it is difficult to determine if HERVE plays a pathogenetic role in endometriosis or is just a bystander in the disease. No difference was observed between the endometriosis patients and the healthy controls. As before, weak signals were detected in the body fluids, plasma, peritoneal fluid and cervix secretion by these four HERV QPCRs. No significant difference was found between the endometriosis patients and controls (Kruskal-Wallis One Way analysis, P>0.05).

QPCR products from three endometriotic samples and one normal endometrial sample with the highest HERVE signal were sequenced and their similarity to human genomic sequences in the hg16 database assembly was searched. According to RetroTector© (Sperber et al, 2007) analysis, these sequences are unusually complete compared to other HERV and HERVE loci (Table 4). Two had an ORF in the protease and one in the gag

35 or pro gene. A third one was nearly open in gag. These data support that certain genetic loci are highly transcriptionally active in some endometriotic tissues.

Table 4. Characteristics of amplimers of endometriosis and endometrium Sample Amplimer Sequence Hits Chr Start of retroviral chain Results from RetroTector (hg15)

Gene ERV ORF structure group(s) 570610, CTTGGACCCGGCTTCCCCAAGGGTT ChrX 54663866 gag pro pol HERVE like Nearly endometrum CAAGAACTCCCCCACCATCTTCGGG ERV3 like in gag GAGGCATTGGCTCGAGACCTCCAG AAGTTTCCCACCAGAGACCTAGGCT GCGTGTTGCTCCAGTACGTAGACGA CCTTTTGTTGG 551129, CTTGGACCCGGCTTCCCCAAGGGTT Chr13 40936820 gag pro pol HERVE like pro endometriosis CAAGAACTCCCCCACCATCTTCGGG env ERV3 like GAGGCATTGGCTCGAGACCTCCAG AAGTTTCCTGCTAAAGACCTAGGCT GCGTCTTGCTCCAGTACGTAGACGA CCTGTTTTTGG 5, TTCTTGGACCCGGCTTCCCCAAGGG Chr11 67869373 gag pro pol HERVE like pro endometriosis TTCAAGAACTCCCCCACCATCTTCG env GGGAGGCATTGGCTCNAGACCTCC ChrY 21962399 gag pro pol HERVE like gag AGAAGTTTCCCACCAGAGTAGGCTG env ERV3 like CGTGTTGCTCCCATGACGACCTTTT TGGAA 60A, TTCTTGGACCCGGCTTCCCCAAGGG Chr6 123005080 gag pro pol HERVE like pro endometriosis TTCAAGAACTCCCCTACTATCTTCA env GGGAGGCCCTGNCTCGAGACCTGC AAAAGTTTCCTGCTAAAGACTAGGC Chr1 19626419 gag pro pol HERVE like TGCGTCTTGCTCCAGTACTANACGA CCTTTTATTGGAA Chr6 123005541 gag pro pol HERVE like pro env ChrX 15280713 gag pro pol HERVE like env ERV3 like

III. Selective action of HERVW RNA expression during the culture of a neuroblastoma cell line (paper IV) The long interaction between endogenous retroviruses (ERVs) and their host sometimes leads to acquisition of the physiological functions of ERVs. Recently, it has been demonstrated that the ERV sequences are activated in hypoxic regions within plaques of the central nervous system (CNS) caused by MS (Antony et al., 2004). We were therefore interested in utilizing our well established model for tumor hypoxia to study whether hypoxia may play a role in the ERV activation within the nervous system, as represented by neuroblastoma cell lines.

36 40 HERV - E/His 3.3

35 HERV - I.T/His 3.3 HERV - H/His 3 .3 30 HERV - W/His 3.3

10 Expression of HERVs 5

-5

-10

xi h o 8 m x r -ox 6h -o e e -ox 12h no 0.1% 48h re-ox 4h r r e re-ox 2d re-ox 3d Z Z Z Z Z Z D DZ re-ox 2h D D D DZ re-ox 1d D D DZ DZ r time serial

Figure 7. Expression of HERV RNA during reoxygenation of the SK-N-DZ cell line. Samples were processed and data were analysed as in Figure 3.

100 control 48h control 72h 5-Azacytidine 48h 5-Azacytidine 48h+24h

HERV RNA expression vs Histone 3.3 0

0 W(RT)/His W(IN)/His E/His I.T/His H/His

Figure 8. Expression of HERVW after 5-azacytidine treatment. Samples were processed and data were analysed as in Figure 3.

co e

n x Control y t 2

R o

2 5-Azacytidine treatment

l h

e 7

o c

2 N

x c c o C Reoxygenation 1

o h c

y o

c n

2 n n 1

8 o

n o t

r t 4

c t

2 r n r

nt o Reoxygenation 2

o o t

h r C

n l

R r

l o r

7 l

t 9 o

N l o o

R e r 2

o 2 9

n 6h

e l Sequences from RetroTector©

o l

C 9

o x l h 6 9 h

x R 7 t

y e y 2 h 6 R o

1 5

1 o 1

1 1

h h h

x 6 l

8 4 e 3 7

8 4

h y

6 o 1 2

1 h 1

8 x

0 0 h

h 1 y 1

1 4 1

1 1

2 1

c R 3 2

on e 8 1 h 1 o h

tro x 2

l7 y C h 5 co 2h 1 8 N 7 2 1 ntr 7 8h a 7 h 4 ol7 h z a 2 0 c 2h 4 13 2 z a7 h 2 8h ont A z 72 1 5 rol7 2 5 Aza y 1 2h 3 y 55A ox 8h 9 h 6 x Re xy1 h 1 1 8 o eo 2 xy e R za7 eo R 5A R

R eo R xy eox 2 2 y2 2 h Reoxy2 h CC 2h C 768 Reoxy2 2h CC 4321 y2 2h C Reox 2hh C xy2 2 eo 2 5 5 0 R xy C 1 o N C e h C9 R 2h 2 h 2 2 C y2 y x x 2 h o o y 2 e e x R R o 2 e y R x o 9 e 6 h R 1 8 h y1 8 4 x 1 1 o 1 y e h x h R 2 7 o 2 7 1 e l7 a 2h R o za7 8 tr Az 2h 1 n 5Aza7 o 5A c 5Aza72h 12

o p 2 1 8h 5 oxy 3 Re 0 1 11 oxy1 8h 1 Re 0 3 3 72h 10 1 Control 8 Reoxy2 2h NC 1 5 2 Reoxy2 Reo 2h NC 13 YHE xy2 2 r RVW h NC 21 h LIKE 5 C Chr Aza72h E H 6 841 29 K ERV 06 I WLIK 246 HER L ECh 57 VWLIKE r12 88 6 po Chr7 917 W 1897 HERVW 05739 98 V H 5 59 LIKEC 0 po ERVWLIK 9 po HER hr1 41874 HERRVWLIKEChr EChr6 144 VWLIK 052 601 po E 12 132246001 761 p 377326 79 HHE EChr3 H 8 po E RV 1434 RVWWLIK Reo 39356 HERVWLIKEChr14 5657865627 591 po po LIK ECh xy2 2 508 po r3 136933540 6 o H ECh r4 111 h NC HERVWLIKECh 84 605 p H ERV r14 5982 29 0 237403 o H ER H WL 2069 98 91 IKEChr1 po 56 p E VWER IKE 457 8 po ERVWL 624 89 8 po RV L VW Chr 7 78 H 53 52 H W IK L 3 1 00143 467 o 66 H HE LIK EC IKE 180 po 4 14 r18 p 6 E E R E h C 17 Chr Ch 32 55 o H R V C r1 hr 49 IKE KE 7 9 o p R H W hr 1 4 22 VWL WLI po 67 56 p 3 E V E H L 3 86 115 86 HER RV 5570 86 8 2 3 V R W R E IK 74 77 36 4 p HE

E 5 63 3 1 6 6 HERVWLIKEChr15 64845447648 po R E 7 2 1 o H 9 5 8 o W 3 4 71 2 00 1 5 p 4 o V L H V VWCh 2 14 7 680 52 4 3 p o W I W W r 35 6 7 4 4 1 r 2 4 0 p H K L 2 0 6 50

1 0 2 h 7 3 o L E H 1 hr 8 r C 6 3 8 R L H L I 8 1 0 C 6 h 5 p E E R E I K 2 7 6 p KE 4 C E 9 o 5 4 9 I H L IK E K E 7 2 p o V I r1 E K 7 3 p 0 3 5 3 K I C V R R E 1 p o WL h K I 7 2 5 R K E C 4 o V C I L 7 6 5 8 H E W V V C h 9

W h R L 2 4 E C

E E W 4 H r 1 H IK W V 1 7 0 8 7 V R E r W W h 2 6 2 3 5 E L h r

L V 1 H 1 0 6 C 1

R r 1 o p 2 5 0 E C r W R E h 2 L W V I L L 5 V 1 8 0 6 E 7 9 o R C 4 4 p 8 K I 4

R H 4 E I 7 H 0 h K

0 I 4 r 6 R H h K 8 5 E E p 3 W E 6 2 1 h 7 K 8 E

H 4 5 0 V L E 1 4 0 p K r R r 2

I 7 5 o 1 1 7 C C 6 o

3 2 V E 5 3 C 3 L r 8 3 6 E I L C 0 2 h 3 p W 2 h 7 h 9 E 4 3 2 K

7 7 V R 3 W W po 0 8 I 5 9 r h 5 r 1

C 2 K 3 6 o o Ch 1 0 3 K V E I 2 6 1 E 5 6 r 1 2 9 5 5 5 1 7 p W L V 9 2

R L 9 7 p 8 0 5 L 2 E IK 6 8 E 9 1 1 4 7 40 I C 5 L r W X 5 7 1 W H 7 1 1 2 5

0 K H 9 8 1 p L r

h 1 r 4 I C 2 1 5 6 3 5 1 o V 4 2

W r h 1 0 8 K h E 5 4 C 10 5 0 4 7 3 0 I 4 4 V R h r E L h 5 9 7 5

E C 9 K r R 5 5 3 p h 7 8 E 8

R E C 8 2 7 7 o oo 6 I 8 K C r 3 I 06 E 1 7 4 2 K 3 V 5 p 6

E H C E 6 5 E C

L p 0 9 o H 3 6 9 p p 0 7 K 6 2 3 W K E 8 h 6 E H 5 6 I C 4

W I 60 4 2 8 3 1 H o 6 5 h 4 0 r 5 4 6 V L 4 L K 7 6 7 0 C E 6 L 8

I 6 1 5 4 4

h E 2 o 7 7 3 r 2 R 6 1 6 I 6

W 4 o 1 7 2 W L X 2 3 R K 7

6 6 5 h R p

E p r 1 4

2 1 H 1 6 V p 8 8 8 5 6 3 p

4 V 2 V E o

0 5 H r W 5 1 V

R o 7

6 1 4 5 1 8 R 7 2 E 4 p 1 6 0 C r 0 7 2 4 W W p

E r V 6 r p 9

1 3 2 5 E 3 7 3 1 o h o h R 4 H h 6 5 1 6 H H R h 5

6 r 1 L 6 9 3 4

H 2 r 1 5 L r C

C E 7 5 4 p 1 E 1 h V E I

1 2 0 6 C 8 5 1 I

E 5 4 h 8 0 K K 2 o R H 9 0 R 1

6 7 W 7 5 3 E 2 C 5 E KE K 5 3 6 6 r C E 5 I 0 r 9 0 V V 7 2 0 C

K E 3 2 5 0 8 8 L h h 5 9 C 8 3 I 0 E L W H

5 h 0 1 W 3 9 p 6 7 WLI 7 2 4 K 1 L C 2 I h W C I K 9 E r 7

8 1 5 K 5 L 0 3 I 1 V 7 8 o L r 0 V E E L 8 p R I

9 3 W 6 5 p 2 R L E 2 6 1 K 2

R 4 o I V 8 K K 6 K o E 6 I V I 6 3 2 9

2 E

W C 0 5 r 5 7 E 1 r W 5 H W 4 6 L L 0 E 3

7 2 R V h 2 5 C H r h h C 8 2 8

3 V L 9 9 0 h E 3 h 0 r W r 6 R C p W C 4 I

4 h 6 1 R r K

C h V H p 2 6

o p E E p 3 8 V E r E

E C E o 3 7 0 p

1 4 R o R K K H K 2 C o I 0 1 E 2 2 I E I H 1 6 E r 7 h L L K 1 6 L 6 8 I H h r H 5 9 1 3 L 4 4 W C W 3 W 8 2 0 V 4 7 W E V 1 0 p V 9 6 R V 8 6 2 o K R 1 p 3 E I R 8 6 R 9 o E 6 E 9 H E L 6 7

H 2 7 2 H 2 H W 0 1 6 5 V 6 3 8 6 p

R 0 o 5 p E 4 o p 1 H o p o 0.02

Figure 9. Cluster of HERVW RT portion. Sequences were aligned by Clustalx. The tree is a neighbour-joining tree based on the pairwise similarities produced by ClustalX . The tree is based on differences in a few informative sites. Therefore the detailed branch pattern cannot reliably display differences between sequences.

38 The levels of RNA of four human gamma ERVs (HERVE, I/T, H and W) in three different human neuroblastoma cell lines (SH-SY5Y, SK-N-DZ and SK-N-AS) and other cell lines, A549, COS-1, Namalwa, RD-L and Vero-E6, were studied using the well established gamma retroviral QPCRs (paper I). During the recovery from hypoxia a pronounced and selective activation of RNA expression of HERVW, but not of HERVE, I/T, H and three housekeeping genes (histone 3.3, HPRT1 and UBC), was found in the neuroblastoma cell lines, with the most pronounced expression in SK-N-DZ (Figure 7). In the SK-N-DZ cell line, the expression of HERVs after different chemical treatments was also examined. The HERVW expression was also found to be selectively upregulated with 5-azacytidine, a demethylating agent (Figure 8). HERVW loci thus seem especially responsive to hypoxia followed by re-oxygenation and demethylation. The products of HERVW QPCR reaction with higher expression of HERVW were sequenced and aligned with the HERVW-like retroviral sequences in

a. b.

20 5

4 15

3 10

5 1

0 0 HERVE RNA expression vs his 3.3 RNA HERVI/T RNA expression vs his 3.3 RNA

l l 4 0 7 1 06 94 34 20 97 52 57 37 81 e e 106 19 134 22 197 152 15 137 18 el 1 1 1 2 1 1 1 1 1 an n n p e epa su u suepa tis tiss s al ormal orm rmal ti n o dn w e ld n Ol N O c. d.

20 60

50 15 40

10 30

20 5

0 0 HERVW(IN) RNA expression vs his 3.3 RNA HERVW(RT) RNA expression vs his 3.3 RNA

4 4 7 2 7 7 1 6 4 0 2 7 1 9 3 5 8 ne l nel 0 3 2 5 3 8 nel 106 1 1 220 19 1 15 13 1 a 1 19 4 1 2 19 7 1 15 7 1 1 p pa pa ue ue e s s su tis s ltis l lti a a a rm no rm no rm d w wno Ol e Ne N Figure 10a-d. Expression of HERVE, I/T and W RNA in different individuals. samples were processed and data were analysed as in Figure 3. The number 194, 134 and 220 were bipolar disorder patients; the 106, 152 and 137 were control subjects and the 197, 157 and 181 were schizophrenia patients.

39 e. f. 5 80 4

40 3

2 20

0 0 HERV(IN) RNA expression vs his 3.3 RNA HERVH(RT) RNA expression vs his 3.3 RNA

6 4 0 2 7 7 1 l l l 9 5 3 8 e 6 0 7 2 7 7 e l 10 1 134 22 197 15 1 1 1 an 2 9 5 3 e p 10 194 134 2 1 15 1 1 181 e pa n su sue pane epan s s u ue l ti l ti tiss a a al altiss rm m o rm n nor orm d n no l w d O Ne l O New g.

2,0

1,5

1,0 ressionvshis3.3RNA p

0,5 RNA ex g a g 0,0 HERVH

106 194 134 220 197 152 157 137 181

Figure 10e-f. Expression of HERVH RNA in different individuals by QPCRs targeting different domains. Samples were processed and data were analysed as in Figure 3. The numbers 194, 134 and 220 were bipolar disorder patients; the 106, 152 and 137 were control subjects and 197, 157 and 181 were schizophrenia patients. the human genome (Figure 9). They were clustered into two groups. One is similar to HERVW-like retroviral elements in chromosome Y and the other group is most similar to the HERVW locus on chromosome 7q21.2, which encodes the syncytin (also called syncytin-1) (Bonnaud et al., 2005) protein in the placenta and other tissues. The observations indicate that a neuroblastoma cell culture system is interesting for studies on regulation of HERVW expression.

IV. Gammaretroviral expression in brain (paper V) HERVs and other retrotransposons are important evolutionary forces. The rapid and recent evolutionary expansion of higher mental function in homo sapiens since their divergence from the chimpanzee should have required substantial genetic modification. Primate genomes are complex, and their

40 relatively long generation times make point mutation an improbable sole evolutionary mechanism behind this rapid transition and reshuffling of genetic material in a short time. A role for endogenous retroviruses in the pathogenesis of schizophrenia has been postulated. A high level of RNA expression of HERVs in brain has been reported in schizophrenia and multiple sclerosis. Therefore we used the gammaretroviral QPCR (paper I) to study the degree of gammaretrovirus-like HERV RNA expression in thirteen different sites from nine brains suffering from schizophrenia, bipolar disorder as well as from controls. We found that gammaretroviruses were expressed in all the sites of brain which were tested (Figure 10). No differences were found among patients and controls. Rather, certain individuals among the nine subjects had a high HERVH and HERVW expression in most brain areas analyzed.

V. Development and application of real time PCRs for detection and quantification of human MMTV-like (HML) sequences in human tissues (paper VI)

According to a recent bioinformatical analysis the human genome (version hg15, April 2003) contains 826 betaretrovirus-like copies (Blomberg J et al). Some members of this group have intact open reading frames for gag, pol or env genes. Therefore they are considered to possess a great potential for biological activity. A high expression of some betaretrovirus-like sequences has been documented in breast cancer, testicular carcinoma and malignant melanoma (Buscher et al., 2006; Buscher et al., 2005; Herbst et al., 1996; Yin et al., 1997). But the roles of these elements in those diseases remain unclear.

Attempts to associate HERVs with disease are rather difficult, due to their ubiquity and abundant expression. One potential approach to establish an association is gene expression analysis in healthy and diseased tissue with quantitative real time PCR.

Broadly targeted QPCRs of HML1-7 Taqman real time PCR based on the RT or IN domains of pol gene were developed. When results from parallel analyses with RT and IN primer/probe systems were taken together (Table 5), 1-1000 plasmid copies per reaction for each of the HML1-7 clones were detected. HML1, HML3 and HML5 clones produced no signal in the RT QPCR. The HML7 clone did not give a signal by the IN QPCR.

41 These QPCRs were used to examine the RNA expression in the same panel of human tissues. The expression ratios of betaretrovirus-like RNA to the histone 3.3 were high in the whole brain, adrenal glands, testis, kidney, cerebellum and fetal liver by using the RT system (Figure 11). Using the IN system, the betaretroviral RNA expression in the same tissues was about 3-to 8-fold less, but with similar proportions as the RT system. We detected a preferential expression in placenta, testis and brain with the HML6 RT and IN methods. However, the number of RNA equivalents was considerably lower than those obtained with RT and IN QPCRs, which suggests that HML6 expression constitutes a minor portion of the betaretrovirus-like expression in brain and testis.

Table 5. Sensitivity and detection limits of betaretrovirus-like PCRs with plasmids containing betaretrovirus-like pol genes.

Detection limit Amplification Detection limit Amplification (number of HML efficiency (number of HML Efficiency plasmid DNA copies) plasmid DNA copies) RT PCR IN PCR HML1 - - 100 0.76 HML2 100 0.70 10 0.70 HML3 - - 1 0.71 HML4 1 0.85 1000 0.70 HML5 - - 1000 0.70 HML6 10 0.81 1 0.47 HML7 10 0.74 - - -: No amplification.

42 HML expression in different tissues

Uterus Trachea RT/histone 3.3 IN/histone 3.3 Thyroid gland Thymus Testis Spleen Skeletal muscle Salivary gland prostate Placenta Liver Kidney Fetal liver Fetal brain Brain, whole Brain, cerebell Bone marrow Adrenal glands

0 100 200 300 400 500 600 700 General beta RT or IN QPCR equivalents/ histone 3.3 equivalents

HML6 expression in different tissues

Uterus Trachea RT/histone 3.3 again Thyroid gland IN/histone 3.3 again Thymus Testis Spleen Skeletal muscle Salivary gland prostate Placenta Liver Kidney Fetal liver Fetal brain Brain, whole Brain, cerebell Bone marrow Adrenal glands

0 2 4 6 8 10 12 14 HML6 RT or IN equivalents / histone 3.3 equivalents

Figure 11. Expression of Beta HERVs in different tissues. Commercial RNA from healthy tissues was reverse-transcribed into cDNA. Samples were processed and data were analysed as in Figure 2.

43 Conclusions and future prospects

This study focused on the development and application of a set of sensitive, quantitative, broadly targeted and rapid QPCRs. The methods were developed to investigate the expression of HERV RNA in both healthy people and patients as well as in different cell lines (Figure 12). The conclusions are:

1. A set of broadly targeted gammaretroviral and betaretroviral real time PCRs were set up, which made the systematic investigation of HERV expression possible. 2. HERVs were ubiquitously expressed in different tissues and cell lines, but often with different patterns. 3. Expression of HERVs was high in brain and reproductive tissues. 4. HERVE and HERVW were highly expressed in female reproductive tissues, including endometrium and ovary. 5. Enhanced expression of HERVE was found in the endometriotic tissue compared to endometrium. 6. No different HERV expression patterns were found in a small number of schizophrenia, bipolar disorder patients and controls, although the expression pattern was individual specific, as previously reported by us from other tissues.

HERVs are part of our genome. Although research in this field has been ongoing for several decades, the roles of HERVs are not completely known. Development of techniques both in microbiology and bioinformatics has let us understand better the roles of HERVs in our body. A number of hypotheses were proposed regarding the roles they may play. A HERVW env protein, termed syncytin1, and enJSRV env protein have been confirmed to be functional in human and sheep placenta morphogenesis, respectively. HERV LTRs have been reported as functioning as regulators, promoters or enhancers, for other genes. For many years, HERVs were considered nonfunctional, often transcriptionally silent, genetic "junk". In contrast, in this study, HERVs have been found ubiquitously expressed, especially highly in brain and reproductive tissues (Figure 12). Retrotransposons have been suggested to be involved in the evolution of human brain. A detailed investigation regarding the activities and functions of HERV in the brain may shed light on the mechanisms of human brain evolution. The high

44 expression of HERVs in reproductive tissues may indicate these organs as a reservoir for exogenous retroviruses awaiting endogenisation into the germ cell line. Further details explaining how and why different expression patterns of HERVs exist in different tissues and under different conditions should be investigated in the future, which may unravel the mysteries of the life, function, and roles of these viruses both physiologically and pathologically.

1000 10 A

N 100 1 R 3 . 10 0.1

vs His 3 1 A

N 0.01

R 0.1 VE

R 0.001 0.01 HE HERVI.T RNA vs His 3.3 RNA

0.001 0.0001 s s s s s s e e s es e e e es s e e e u u e ne lin u e n n lin s in lin li su l tis iss ll l ll ll ll lin ll issue is l lin l lines ll li l t e e e ce ce l t t el l e cell li cel in c Z intiss c Z ma ra DZ D ma ra tive er D DZ or B ma c - - or B c h ma c - toma o -N -N u t to N rn other c s o s -N- - last K K od a K K la b pr bl the ob nS inS e nS O Reproductive tissuesr uro o Other n R ro io u e e t einS e n nati in eu a in N e Neuroblastoman ce ia g ytid ia en tid x y c g cy x a ox xy a ypo o z p z -a eo a H Re 5 Hy R 5- 10 100

1 10

0.1 1

0.01 0.1

0.001 0.01 HERVH RNA vs His 3.3 RNA HERVW RNA vs His 3.3 RNA

0.0001 0.001 s s s s s e s s s e e e ne n e e in in ue u ine i li sues ues sues in in line l l s l lll ll s ss l l l l l tiss issue ll line ll e e i l l ell l et e c c e cel cel in tis v Z in t ive tis ti ra er cel ra c er cell lines -DZ D ormal ti B h ma c ma c orma B u th oma c N N- n t o to N-DZ n d o t stoma ce - - oduct o st - -N-DZ r ro s K K K e a la blas th ep bl epr b o nS nS O R o robla nS Ot her R ro r u tion SK ei u eu e e eur atio ine i N n na din N n n id a e ti yt yge c oxi ox yp ypoxia e za azacy H a H Reoxyg 5- R 5-

Figure 12. HERV RNA expression in humans. The RNA expression of the four gammaretroviral groups in samples from various sources as indicated was plotted against that of histone 3.3. Other normal tissues: adrenal, bone marrow, colon, small intestine, heart, kidney, liver, lung, salivary gland, skeletal muscle, spleen, thymus, thyroid gland, trachea and uterus; reproductive tissues: normal endometrium, endometriotic tissue, ovarian cancer, benign ovary, placenta, prostate and testis; other cell lines: A549, COS-1, Namalwa, RD-L and Vero-E6; neuroblastoma cell lines: SH-SY5Y, SK-N-DZ and SK-N-AS.

45 Acknowledgements

This work was carried out at the Section of Clinical Virology, the Department of Medical Sciences, Uppsala University Academic Hospital.

I would like to express my sincere gratitude to:

Prof Jonas Blomberg, my supervisor, for introducing me to the fascinating field of endogenous retroviruses, being patient in supervising my project work and sharing his great scientific knowledge, which is certainly not restricted to retroviruses.

Prof Göran Friman, my co-supervisor, for his involvement in my PhD programme.

Dr Martha J Garret, for accepting me as a master’s student in the International Public Health Programme in Uppsala Universtiy, which totally changed my life!

Dr Ted Greiner, for introducing me to Prof Jonas Blomberg.

My collaborators Agneta, Helen, Daniela, Fredrik, Raffael, Robert and R Fuller, for their contribution to my research work.

My former and present colleagues (in order of acquaintance), Amal, Amarinder, Anna Forsman, Dmitrijs, Maura, Nahala, Göran, Sutan, Vidar, Tova, Anna Toth-Matyi, Shamam, Guma, Farid, Neil, Magnus, Christina and Johan. We not only collaborate in research, but also are interested in broad topics ranging from family life to international news making headlines during our lunch and coffee time. Especially my Chinese colleague, co- author and friend, Zhihong, for sharing with me her excellent lab experiences in the first year of my PhD which made it easier for me to be familiar with the new project more quickly. Patric Jern, for offering helpful suggestions about thesis writing. And all project students for bringing fresh air into the group.

Eva, Helena and Birgitta, for excellent secretarial assistance.

46 Hugo and Enrique, for excellent computer support.

All members of the Uppsala University Hospital Clinical Virology, Hygiene, Clinical Bacteriology and the Bacteriology Research groups, for the friendly work environment, and for the Friday “fika” with the bacteriology researchers. Especially Calle and Markus, for their help with the sequencing reaction.

All the patients and healthy volunteers who provided samples for my study.

My former colleagues and friends in China, especially Prof for teaching me the basics in research; Prof for introducing me to the fantastic field of virology; Dr , and ,fortheir encouragements and supports. , , , , , and , for their continued friendship when I was in a remote place. Their mails and greetings always cheer me up!

All my friends in Uppsala, for their love and friendship. Especially Zou Xiang, for all his help in my work and life; Jingxiong, for always encouraging me whenever I was feeling blue; Han Fei & Xiurong, Mingxing & Yuling, William Jiang & Dr Zhang, Chen Chiwan & Mrs Chen, Guo Xiaoli & Luosen, Zhang Shouting & Zhang Jing, for their hospitality in dinners, parties and helpful advice on living in Sweden; David Bingham and Maibritt Lundin-Bingham, for being a good role model of Christians whom I can learn from, and for cultivating my Christian faith; Dr Olle Eriksson, for valuable help on the ward; Elisabeth for the friendship established in the master’s programme; and Yin Hong, for helpful discussions and encouragement. , and , for valuable help in my house move and much fun together.

Due to space limitation, though, I cannot mention all the names of the brothers and sisters in the Chinese Bible Study Group in Uppsala who attended our congregation in the past 6 years, I would like to say to all of you a big “thank you” for giving me a big and warm family in a remote place far away from my home town in China. All the happy times that we had together, sharing of gospels, praying together, as well as winter dinner parties, summer BBQs, singing, excursions … will never fade away from my memory.

Last but not least, my father and my mother , for their never ending love, trust and encouragement. Wherever I am and whatever I am doing, they always stand behind me. I would also like to thank my brother , my sister-in-law , my cute nephew , my sister and

47 brother-in-law as well as my other relatives in China, for their love and for their taking good care of my parents when I am so far away in Sweden.

48 References

Aaronson, S.A., Hartley, J.W. and Todaro, G.J., 1969. Mouse leukemia virus: "spontaneous" release by mouse embryo cells after long-term in vitro cultivation. Proc Natl Acad Sci U S A 64, 87-94. Andersson, A.C., Svensson, A.C., Rolny, C., Andersson, G. and Larsson, E., 1998. Expression of human endogenous retrovirus ERV3 (HERV-R) mRNA in normal and neoplastic tissues. Int J Oncol 12, 309-13. Andersson, A.C., Yun, Z., Sperber, G.O., Larsson, E. and Blomberg, J., 2005. ERV3 and related sequences in humans: structure and RNA expression. J Virol 79, 9270-84. Andersson, M.L., Lindeskog, M., Medstrand, P., Westley, B., May, F. and Blomberg, J., 1999. Diversity of human endogenous retrovirus class II-like sequences. J Gen Virol 80 (Pt 1), 255-60. Antony, J.M., van Marle, G., Opii, W., Butterfield, D.A., Mallet, F., Yong, V.W., Wallace, J.L., Deacon, R.M., Warren, K. and Power, C., 2004. Human endogenous retrovirus glycoprotein-mediated induction of redox reactants causes oligodendrocyte death and demyelination. Nat Neurosci 7, 1088-95. Armbruester, V., Sauter, M., Krautkraemer, E., Meese, E., Kleiman, A., Best, B., Roemer, K. and Mueller-Lantzsch, N., 2002. A novel gene from the human endogenous retrovirus K expressed in transformed cells. Clin Cancer Res 8, 1800-7. Armbruester, V., Sauter, M., Roemer, K., Best, B., Hahn, S., Nty, A., Schmid, A., Philipp, S., Mueller, A. and Mueller-Lantzsch, N., 2004. Np9 protein of human endogenous retrovirus K interacts with ligand of numb protein X. J Virol 78, 10310-9. Baltimore, D., 1970. RNA-dependent DNA polymerase in virions of RNA tumour viruses. Nature 226, 1209-11. Baltimore, D., 1975. Tumor viruses: 1974. Cold Spring Harbor Symp Quant Biol, 1187-1200. Barre-Sinoussi, F., Chermann, J.C., Rey, F., Nugeyre, M.T., Chamaret, S., Gruest, J., Dauguet, C., Axler-Blin, C., Vezinet-Brun, F., Rouzioux, C., Rozenbaum, W. and Montagnier, L., 1983. Isolation of a T-lymphotropic retrovirus from a patient at risk for acquired immune deficiency syndrome (AIDS). Science 220, 868-71. Bentvelzen, P., Timmermans, A., Daams, J.H. and van der Gugten, A., 1968. Genetic transmission of mammary tumor inciting viruses in mice; possible implications for murine leukemia. Bibl Haematol 30, 101-3. Benveniste, R.E. and Todaro, G.J., 1976. Evolution of type C viral genes: evidence for an Asian origin of man. Nature 261, 101-8.

49 Berkhout, B., Jebbink, M. and Zsiros, J., 1999. Identification of an active reverse transcriptase enzyme encoded by a human endogenous HERV-K retrovirus. J Virol 73, 2365-75. Bieche, I., Laurent, A., Laurendeau, I., Duret, L., Giovangrandi, Y., Frendo, J.L., Olivi, M., Fausser, J.L., Evain-Brion, D. and Vidaud, M., 2003. Placenta- specific INSL4 expression is mediated by a human endogenous retrovirus element. Biol Reprod 68, 1422-9. Bittner, J.J., 1936. Some possible effects of nursing on the mammary gland tumor incidence in mice. Science 84, 162. Blomberg, J., Nived, O., Pipkorn, R., Bengtsson, A., Erlinge, D. and Sturfelt, G., 1994. Increased antiretroviral antibody reactivity in sera from a defined population of patients with systemic lupus erythematosus. Correlation with autoantibodies and clinical manifestations. Arthritis Rheum 37, 57-66. Blomberg, J., Ushameckis, D. and Jern, P. 2005. Evolutionary aspects of human endogenous retroviruses and disease. In: S. E (Ed), Retroviruses and Primate evolution, Landes Bioscience, Austin, Texas, pp. 204-238. Blond, J.L., Beseme, F., Duret, L., Bouton, O., Bedin, F., Perron, H., Mandrand, B. and Mallet, F., 1999. Molecular characterization and placental expression of HERV-W, a new human endogenous retrovirus family. J Virol 73, 1175- 85. Bock, M. and Stoye, J.P., 2000. Endogenous retroviruses and the human germline. Curr Opin Genet Dev 10, 651-5. Boeke, J.D. and Stoye, J.P. 1997. Retrotransposons, Endogenous Retroviruses, and the Evolution of Retroelements. In: J.M. Coffin, S.H. Hugbes and H.E. Varmus (Eds), Retroviruses, Cold Spring Harbror Laboratory Press, New York, pp. 343-437. Boller, K., Konig, H., Sauter, M., Mueller-Lantzsch, N., Lower, R., Lower, J. and Kurth, R., 1993. Evidence that HERV-K is the endogenous retrovirus sequence that codes for the human teratocarcinoma-derived retrovirus HTDV. Virology 196, 349-53. Bonnaud, B., Beliaeff, J., Bouton, O., Oriol, G., Duret, L. and Mallet, F., 2005. Natural history of the ERVWE1 endogenous retroviral locus. Retrovirology 2, 57. Bonner, T.I., O'Connell, C. and Cohen, M., 1982. Cloned endogenous retroviral sequences from human DNA. Proc Natl Acad Sci U S A 79, 4709-13. Britten, R.J., 1996. DNA sequence insertion and evolutionary variation in gene regulation. Proc Natl Acad Sci U S A 93, 9374-7. Brosius, J., 1999. RNAs from all categories generate retrosequences that may be exapted as novel genes or regulatory elements. Gene 238, 115-34. Buscher, K., Hahn, S., Hofmann, M., Trefzer, U., Ozel, M., Sterry, W., Lower, J., Lower, R., Kurth, R. and Denner, J., 2006. Expression of the human endogenous retrovirus-K transmembrane envelope, Rec and Np9 proteins in melanomas and melanoma cell lines. Melanoma Res 16, 223-34. Buscher, K., Trefzer, U., Hofmann, M., Sterry, W., Kurth, R. and Denner, J., 2005. Expression of human endogenous retrovirus K in melanomas and melanoma cell lines. Cancer Res 65, 4172-80.

50 Bustin, S.A., 2000. Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J Mol Endocrinol 25, 169- 93. Cardullo, R.A., Agrawal, S., Flores, C., Zamecnik, P.C. and Wolf, D.E., 1988. Detection of nucleic acid hybridization by nonradiative fluorescence resonance energy transfer. Proc Natl Acad Sci U S A 85, 8790-4. Christensen, T., Dissing Sorensen, P., Riemann, H., Hansen, H.J. and Moller- Larsen, A., 1998. Expression of sequence variants of endogenous retrovirus RGH in particle form in multiple sclerosis. Lancet 352, 1033. Christensen, T., Dissing Sorensen, P., Riemann, H., Hansen, H.J., Munch, M., Haahr, S. and Moller-Larsen, A., 2000. Molecular characterization of HERV-H variants associated with multiple sclerosis. Acta Neurol Scand 101, 229-38. Conrad, B., Weissmahr, R.N., Boni, J., Arcari, R., Schupbach, J. and Mach, B., 1997. A human endogenous retroviral superantigen as candidate autoimmune gene in type I diabetes. Cell 90, 303-13. Cornwall, G.A., Orgebin-Crist, M.C. and Hann, S.R., 1992. Expression of an endogenous murine leukemia virus-related proviral sequence is androgen regulated and primarily restricted to the epididymis/vas deferens and oviduct/uterus. Biol Reprod 47, 665-75. Crick, F., 1970. Central dogma of molecular biology. Nature 227, 561-3. Crick, F.H., 1958. On protein synthesis. Symp Soc Exp Biol 12, 138-63. Crowell, R.C. and Kiessling, A.A., 2007. Endogenous retrovirus expression in testis and epididymis. Biochem Soc Trans 35, 629-33. Dawkins, R., 1976. The selfish Gene. Oxford University Press, Oxford. Deb-Rinker, P., Klempan, T.A., O'Reilly, R.L., Torrey, E.F. and Singh, S.M., 1999. Molecular characterization of a MSRV-like sequence identified by RDA from monozygotic twin pairs discordant for schizophrenia. Genomics 61, 133-44. DeHaven, J.E., Schwartz, D.A., Dahm, M.W., Hazard, E.S., 3rd, Trifiletti, R., Lacy, E.R. and Norris, J.S., 1998. Novel retroviral sequences are expressed in the epididymis and uterus of Syrian hamsters. J Gen Virol 79 (Pt 11), 2687-94. Dewannieux, M., Harper, F., Richaud, A., Letzelter, C., Ribet, D., Pierron, G. and Heidmann, T., 2006. Identification of an infectious progenitor for the multiple-copy HERV-K human endogenous retroelements. Genome Res 16, 1548-56. Donner, H., Tonjes, R.R., Van der Auwera, B., Siegmund, T., Braun, J., Weets, I., Herwig, J., Kurth, R., Usadel, K.H. and Badenhoop, K., 1999. The presence or absence of a retroviral long terminal repeat influences the genetic risk for type 1 diabetes conferred by human leukocyte antigen DQ haplotypes. Belgian Diabetes Registry. J Clin Endocrinol Metab 84, 1404-8. Doolittle, W.F. and Sapienza, C., 1980. Selfish genes, the phenotype paradigm and genome evolution. Nature 284, 601-3. Dupressoir, A. and Heidmann, T., 1996. Germ line-specific expression of intracisternal A-particle retrotransposons in transgenic mice. Mol Cell Biol 16, 4495-503.

51 Fang, Y., Wu, N., Gan, X., Yan, W., Morrell, J.C. and Gould, S.J., 2007. Higher- order oligomerization targets plasma membrane proteins and HIV gag to exosomes. PLoS Biol 5, e158. Fanning, T.G., Puma, J.P. and Cardiff, R.D., 1980. Identification and partial characterization of an endogenous form of mouse mammary tumor virus that is transcribed into the virion-associated RNA genome. Nucleic Acids Res 8, 5715-23. Feuchter-Murthy, A.E., Freeman, J.D. and Mager, D.L., 1993. Splicing of a human endogenous retrovirus to a novel phospholipase A2 related gene. Nucleic Acids Res 21, 135-43. Gallo, R.C., Salahuddin, S.Z., Popovic, M., Shearer, G.M., Kaplan, M., Haynes, B.F., Palker, T.J., Redfield, R., Oleske, J., Safai, B. and et al., 1984. Frequent detection and isolation of cytopathic retroviruses (HTLV-III) from patients with AIDS and at risk for AIDS. Science 224, 500-3. Gifford, R. and Tristem, M., 2003. The evolution, distribution and diversity of endogenous retroviruses. Virus Genes 26, 291-315. Harris, J.M., McIntosh, E.M. and Muscat, G.E., 1999. Structure/function analysis of a dUTPase: catalytic mechanism of a potential chemotherapeutic target. J Mol Biol 288, 275-87. Harris, J.R., 1998. Placebtal endogenous retrovirus (ERV): structural, fucnctional, and evolutionary significance. BioEssays 20, 307-316. Henikoff, S., Greene, E.A., Pietrokovski, S., Bork, P., Attwood, T.K. and Hood, L., 1997. Gene families: the taxonomy of protein paralogs and chimeras. Science 278, 609-14. Herbst, H., Sauter, M. and Mueller-Lantzsch, N., 1996. Expression of human endogenous retrovirus K elements in germ cell and trophoblastic tumors. Am J Pathol 149, 1727-35. Herve, C.A., Lugli, E.B., Brand, A., Griffiths, D.J. and Venables, P.J., 2002. Autoantibodies to human endogenous retrovirus-K are frequently detected in health and disease and react with multiple epitopes. Clin Exp Immunol 128, 75-82. Hishikawa, T., Ogasawara, H., Kaneko, H., Shirasawa, T., Matsuura, Y., Sekigawa, I., Takasaki, Y., Hashimoto, H., Hirose, S., Handa, S., Nagasawa, R. and Maruyama, N., 1997. Detection of antibodies to a recombinant gag protein derived from human endogenous retrovirus clone 4-1 in autoimmune diseases. Viral Immunol 10, 137-47. Holland, P.M., Abramson, R.D., Watson, R. and Gelfand, D.H., 1991. Detection of specific polymerase chain reaction product by utilizing the 5'----3' exonuclease activity of Thermus aquaticus DNA polymerase. Proc Natl Acad Sci U S A 88, 7276-80. Hynes, N.E., Groner, B., Diggelmann, H., Van Nie, R. and Michalides, R., 1980. Genomic location of mouse mammary tumor virus proviral DNA in normal mouse tissue and in mammary tumors. Cold Spring Harb Symp Quant Biol 44 Pt 2, 1161-8. Jern, P., Sperber, G.O. and Blomberg, J., 2004. Definition and variation of human endogenous retrovirus H. Virology 327, 93-110.

52 Jern, P., Sperber, G.O. and Blomberg, J., 2005. Use of endogenous retroviral sequences (ERVs) and structural markers for retroviral phylogenetic inference and taxonomy. Retrovirology 2, 50. Johnson, W.E. and Coffin, J.M., 1999. Constructing primate phylogenies from ancient retrovirus sequences. Proc Natl Acad Sci U S A 96, 10254-60. Karge, W.H., 3rd, Schaefer, E.J. and Ordovas, J.M., 1998. Quantification of mRNA by polymerase chain reaction (PCR) using an internal standard and a nonradioactive detection method. Methods Mol Biol 110, 43-61. Karlsson, H., Bachmann, S., Schroder, J., McArthur, J., Torrey, E.F. and Yolken, R.H., 2001. Retroviral RNA identified in the cerebrospinal fluids and brains of individuals with schizophrenia. Proc Natl Acad Sci U S A 98, 4634-9. Kato, N., Pfeifer-Ohlsson, S., Kato, M., Larsson, E., Rydnert, J., Ohlsson, R. and Cohen, M., 1987. Tissue-specific expression of human provirus ERV3 mRNA in human placenta: two of the three ERV3 mRNAs contain human cellular sequences. J Virol 61, 2182-91. Katzourakis, A., Tristem, M., Pybus, O.G. and Gifford, R.J., 2007. Discovery and analysis of the first endogenous lentivirus. Proc Natl Acad Sci U S A 104, 6261-5. Kazazian, H.H., Jr., 2000. Genetics. L1 retrotransposons shape the mammalian genome. Science 289, 1152-3. Kiessling, A.A., Crowell, R. and Fox, C., 1989. Epididymis is a principal site of retrovirus expression in the mouse. Proc Natl Acad Sci U S A 86, 5109-13. Kitamura, Y., Ayukawa, T., Ishikawa, T., Kanda, T. and Yoshiike, K., 1996. Human endogenous retrovirus K10 encodes a functional integrase. J Virol 70, 3302-6. Lander, E.S., Linton, L.M., Birren, B., Nusbaum, C., Zody, M.C. and al., e., 2001. Initial sequencing and analysis of the human genome. Nature 409, 860-921. Larsson, E., Andersson, A.C. and Nilsson, B.O., 1994. Expression of an endogenous retrovirus (ERV3 HERV-R) in human reproductive and embryonic tissues-- evidence for a function for envelope gene products. Ups J Med Sci 99, 113- 20. Lavie, L., Maldener, E., Brouha, B., Meese, E.U. and Mayer, J., 2004. The human L1 promoter: variable transcription initiation sites and a major impact of upstream flanking sequence on promoter activity. Genome Res 14, 2253- 60. Lee, Y.N. and Bieniasz, P.D., 2007. Reconstitution of an infectious human endogenous retrovirus. PLoS Pathog 3, e10. Lindeskog, M., Mager, D.L. and Blomberg, J., 1999. Isolation of a human endogenous retroviral HERV-H element with an open env reading frame. Virology 258, 441-50. Ling, J., Pi, W., Bollag, R., Zeng, S., Keskintepe, M., Saliman, H., Krantz, S., Whitney, B. and Tuan, D., 2002. The solitary long terminal repeats of ERV-9 endogenous retrovirus are conserved during primate evolution and possess enhancer activities in embryonic and hematopoietic cells. J Virol 76, 2410-23.

53 Lower, R., Boller, K., Hasenmaier, B., Korbmacher, C., Muller-Lantzsch, N., Lower, J. and Kurth, R., 1993. Identification of human endogenous retroviruses with complex mRNA expression and particle formation. Proc Natl Acad Sci U S A 90, 4480-4. Lower, R., Lower, J. and Kurth, R., 1996. The viruses in all of us: characteristics and biological significance of human endogenous retrovirus sequences. Proc Natl Acad Sci U S A 93, 5177-84. Mager, D.L. and Henthorn, P.S., 1984. Identification of a retrovirus-like repetitive element in human DNA. Proc Natl Acad Sci U S A 81, 7510-4. Magin, C., Lower, R. and Lower, J., 1999. cORF and RcRE, the Rev/Rex and RRE/RxRE homologues of the human endogenous retrovirus family HTDV/HERV-K. J Virol 73, 9496-507. Mangeney, M., de Parseval, N., Thomas, G. and Heidmann, T., 2001. The full- length envelope of an HERV-H human endogenous retrovirus has immunosuppressive properties. J Gen Virol 82, 2515-8. Marguerat, S., Wang, W.Y., Todd, J.A. and Conrad, B., 2004. Association of human endogenous retrovirus K-18 polymorphisms with type 1 diabetes. Diabetes 53, 852-4. Martin, J., Herniou, E., Cook, J., Waugh O'Neill, R. and Tristem, M., 1997. Human endogenous retrovirus type I-related viruses have an apparently widespread distribution within vertebrates. J Virol 71, 437-43. Martin, M.A., Bryan, T., Rasheed, S. and Khan, A.S., 1981. Identification and cloning of endogenous retroviral sequences present in human DNA. Proc Natl Acad Sci U S A 78, 4892-6. Mayer, J. and Meese, E.U., 2002. The human endogenous retrovirus family HERV- K(HML-3). Genomics 80, 331-43. McClure, M.A., Johnson, M.S., Feng, D.F. and Doolittle, R.F., 1988. Sequence comparisons of retroviral proteins: relative rates of change and general phylogeny. Proc Natl Acad Sci U S A 85, 2469-73. Medawar, P.B. 1997. Historical Introduction to the General Peoperties of Retroviruses. In: J.M. Coffin, S.H. Hugbes and H.E. Varmus (Eds), Retroviruses, Cold Spring Harbror Laboratory Press, New York, pp. 1-25. Medstrand, P. and Blomberg, J., 1993. Characterization of novel reverse transcriptase encoding human endogenous retroviral sequences similar to type A and type B retroviruses: differential transcription in normal human tissues. J Virol 67, 6778-87. Medstrand, P., Landry, J.R. and Mager, D.L., 2001. Long terminal repeats are used as alternative promoters for the endothelin B receptor and apolipoprotein C-I genes in humans. J Biol Chem 276, 1896-903. Medstrand, P., Lindeskog, M. and Blomberg, J., 1992. Expression of human endogenous retroviral sequences in peripheral blood mononuclear cells of healthy individuals. J Gen Virol 73 (Pt 9), 2463-6. Medstrand, P. and Mager, D.L., 1998. Human-specific integrations of the HERV-K endogenous retrovirus family. J Virol 72, 9782-7. Menendez, L., Benigno, B.B. and McDonald, J.F., 2004. L1 and HERV-W retrotransposons are hypomethylated in human ovarian carcinomas. Mol Cancer 3, 12.

54 Mi, S., Lee, X., Li, X., G.M., V., Finnerty, H., Racie, L., LaVallie, E., Tang, X., Edouard, P., Howes, S., Kerth Jr, J.C. and McCoy, J.M., 2000. Syncytin is a captive retrovrial envelope protein involved in human placental morphogenesis. Nature 403, 785-789. Moller-Larsen, A. and Christensen, T., 1998. Isolation of a retrovirus from multiple sclerosis patients in self-generated Iodixanol gradients. J Virol Methods 73, 151-61. Moran, J.V., DeBerardinis, R.J. and Kazazian, H.H., Jr., 1999. Exon shuffling by L1 retrotransposition. Science 283, 1530-4. Muller-Ladner, U., Gay, R.E. and Gay, S., 1998. Retroviral sequences in rheumatoid arthritis synovium. Int Rev Immunol 17, 273-90. Nakagawa, K., Brusic, V., McColl, G. and Harrison, L.C., 1997. Direct evidence for the expression of multiple endogenous retroviruses in the synovial compartment in rheumatoid arthritis. Arthritis Rheum 40, 627-38. Nakagawa, K. and Harrison, L.C., 1996. The potential roles of endogenous retroviruses in autoimmunity. Immunol Rev 152, 193-236. Neidhart, M., Rethage, J., Kuchen, S., Kunzler, P., Crowl, R.M., Billingham, M.E., Gay, R.E. and Gay, S., 2000. Retrotransposable L1 elements expressed in rheumatoid arthritis synovial tissue: association with genomic DNA hypomethylation and influence on gene expression. Arthritis Rheum 43, 2634-47. Nilsson, B.O., Jin, M., Andersson, A.C., Sundstrom, P. and Larsson, E., 1999. Expression of envelope proteins of endogeneous C-type retrovirus on the surface of mouse and human oocytes at fertilization. Virus Genes 18, 115- 20. Ogasawara, H., Okada, M., Kaneko, H., Hishikawa, T., Sekigawa, I. and Hashimoto, H., 2003. Possible role of DNA hypomethylation in the induction of SLE: relationship to the transcription of human endogenous retroviruses. Clin Exp Rheumatol 21, 733-8. Ogasawara, H., Okada, M., Kaneko, H., Hishikawa, T., Sekigawa, I., Iida, N., Maruyama, N., Yamamoto, N. and Hashimoto, H., 2001. Quantitative comparison of human endogenous retrovirus mRNA between SLE and rheumatoid arthritis. Lupus 10, 517-8. Oja, M., Sperber, G.O., Blomberg, J. and Kaski, S., 2005. Self-organizing map- based discovery and visualization of human endogenous retroviral sequence groups. Int J Neural Syst 15, 163-79. Ono, M., Kawakami, M. and Ushikubo, H., 1987. Stimulation of expression of the human endogenous retrovirus genome by female steroid hormones in human breast cancer cell line T47D. J Virol 61, 2059-62. Ono, M., Yasunaga, T., Miyata, T. and Ushikubo, H., 1986. Nucleotide sequence of human endogenous retrovirus genome related to the mouse mammary tumor virus genome. J Virol 60, 589-98. Orgel, L.E. and Crick, F.H., 1980. Selfish DNA: the ultimate parasite. Nature 284, 604-7. Palmarini, M., Gray, C.A., Carpenter, K., Fan, H., Bazer, F.W. and Spencer, T.E., 2001. Expression of endogenous betaretroviruses in the ovine uterus:

55 effects of neonatal age, estrous cycle, pregnancy, and progesterone. J Virol 75, 11319-27. Palmarini, M., Mura, M. and Spencer, T.E., 2004. Endogenous betaretroviruses of sheep: teaching new lessons in retroviral interference and adaptation. J Gen Virol 85, 1-13. Papas, T.S., Dahlberg, J.E. and Sonstegard, R.A., 1976. Type C virus in lymphosarcoma in northern pike (Esox lucius). Nature 261, 506-8. Patience, C., Simpson, G.R., Colletta, A.A., Welch, H.M., Weiss, R.A. and Boyd, M.T., 1996. Human endogenous retrovirus expression and reverse transcriptase activity in the T47D mammary carcinoma cell line. J Virol 70, 2654-7. Perl, A., Colombo, E., Dai, H., Agarwal, R., Mark, K.A., Banki, K., Poiesz, B.J., Phillips, P.E., Hoch, S.O., Reveille, J.D. and et al., 1995. Antibody reactivity to the HRES-1 endogenous retroviral element identifies a subset of patients with systemic lupus erythematosus and overlap syndromes. Correlation with antinuclear antibodies and HLA class II alleles. Arthritis Rheum 38, 1660-71. Perron, H., Garson, J.A., Bedin, F., Beseme, F., Paranhos-Baccala, G., Komurian- Pradel, F., Mallet, F., Tuke, P.W., Voisset, C., Blond, J.L., Lalande, B., Seigneurin, J.M. and Mandrand, B., 1997. Molecular identification of a novel retrovirus repeatedly isolated from patients with multiple sclerosis. The Collaborative Research Group on Multiple Sclerosis. Proc Natl Acad Sci U S A 94, 7583-8. Perron, H. and Seigneurin, J.M., 1999. Human retroviral sequences associated with extracellular particles in autoimmune diseases: epiphenomenon or possible role in aetiopathogenesis? Microbes Infect 1, 309-22. Poiesz, B.J., Ruscetti, F.W., Gazdar, A.F., Bunn, P.A., Minna, J.D. and Gallo, R.C., 1980. Detection and isolation of type C retrovirus particles from fresh and cultured lymphocytes of a patient with cutaneous T-cell lymphoma. Proc Natl Acad Sci U S A 77, 7415-9. Posnett, D.N. and Yarilina, A.A., 2001. Sleeping with the enemy--endogenous superantigens in humans. Immunity 15, 503-6. Prak, E.T. and Kazazian, H.H., Jr., 2000. Mobile elements and the human genome. Nat Rev Genet 1, 134-44. Prudhomme, S., Bonnaud, B. and Mallet, F., 2005. Endogenous retroviruses and animal reproduction. Cytogenet Genome Res 110, 353-64. Schon, U., Seifarth, W., Baust, C., Hohenadl, C., Erfle, V. and Leib-Mosch, C., 2001. Cell type-specific expression and promoter activity of human endogenous retroviral long terminal repeats. Virology 279, 280-91. Schulte, A.M., Lai, S., Kurtz, A., Czubayko, F., Riegel, A.T. and Wellstein, A., 1996. Human trophoblast and choriocarcinoma expression of the growth factor pleiotrophin attributable to germ-line insertion of an endogenous retrovirus. Proc Natl Acad Sci U S A 93, 14759-64. Seifarth, W., Baust, C., Murr, A., Skladny, H., Krieg-Schneider, F., Blusch, J., Werner, T., Hehlmann, R. and Leib-Mosch, C., 1998. Proviral structure, chromosomal location, and expression of HERV-K-T47D, a novel human endogenous retrovirus derived from T47D particles. J Virol 72, 8384-91.

56 Seifarth, W., Krause, U., Hohenadl, C., Baust, C., Hehlmann, R. and Leib-Mosch, C., 2000. Rapid identification of all known retroviral reverse transcriptase sequences with a novel versatile detection assay. AIDS Res Hum Retroviruses 16, 721-9. Seifarth, W., Skladny, H., Krieg-Schneider, F., Reichert, A., Hehlmann, R. and Leib-Mosch, C., 1995. Retrovirus-like particles released from the human breast cancer cell line T47-D display type B- and C-related endogenous retroviral sequences. J Virol 69, 6408-16. Sherwin, S.A. and Todaro, G.J., 1979. A new endogenous primate type C virus isolated from the Old World monkey Colobus polykomos. Proc Natl Acad Sci U S A 76, 5041-5. Shiroma, T., Sugimoto, J., Oda, T., Jinno, Y. and Kanaya, F., 2001. Search for active endogenous retroviruses: identification and characterization of a HERV-E gene that is expressed in the pancreas and thyroid. J Hum Genet 46, 619-25. Spencer, T.E., Gray, A., Johnson, G.A., Taylor, K.M., Gertler, A., Gootwine, E., Ott, T.L. and Bazer, F.W., 1999. Effects of recombinant ovine interferon tau, placental lactogen, and growth hormone on the ovine uterus. Biol Reprod 61, 1409-18. Stoye, J.P., 2001. Endogenous retroviruses: still active after all these years? Curr Biol 11, R914-6. Stoye, J.P. and Coffin, J.M., 1985. In molecular biology of tumor viruses. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. Stransky, G., Vernon, J., Aicher, W.K., Moreland, L.W., Gay, R.E. and Gay, S., 1993. Virus-like particles in synovial fluids from patients with rheumatoid arthritis. Br J Rheumatol 32, 1044-8. Strazzullo, M., Parisi, T., Di Cristofano, A., Rocchi, M. and La Mantia, G., 1998. Characterization and genomic mapping of chimeric ERV9 endogenous retroviruses-host gene transcripts. Gene 206, 77-83. Strick, R., Ackermann, S., Langbein, M., Swiatek, J., Schubert, S.W., Hashemolhosseini, S., Koscheck, T., Fasching, P.A., Schild, R.L., Beckmann, M.W. and Strissel, P.L., 2006. Proliferation and cell-cell fusion of endometrial carcinoma are induced by the human endogenous retroviral Syncytin-1 and regulated by TGF-beta. J Mol Med. Sutkowski, N., Conrad, B., Thorley-Lawson, D.A. and Huber, B.T., 2001. Epstein- Barr virus transactivates the human endogenous retrovirus HERV-K18 that encodes a superantigen. Immunity 15, 579-89. Swanstrom, R. and Wills, J.W. 1997. Synthesis, Assembly, and Processing of Viral Proteins. In: J.M. Coffin, S.H. Hugbes and H.E. Varmus (Eds), Retroviruses, Cold Spring Harbror Laboratory Press, New York, pp. 263- 334. Svet-Moldavsky, G.J., Trubcheninova, L. and Ravkina, L.I., 1967. Pathogenicity of the chicken sarcoma virus (Schmidt-Ruppin) for amphibians and reptiles. Nature 214, 300-2. Tassabehji, M., Strachan, T., Anderson, M., Campbell, R.D., Collier, S. and Lako, M., 1994. Identification of a novel family of human endogenous

57 retroviruses and characterization of one family member, HERV-K(C4), located in the complement C4 gene cluster. Nucleic Acids Res 22, 5211-7. Temin, H.M., 1964. Nature of the Provirus of Raus Sarcoma. Natl. Cancer Inst. Monogr., 557-570. Temin, H.M. and Mizutani, S., 1970. RNA-dependent DNA polymerase in virions of Rous sarcoma virus. Nature 226, 1211-3. Ting, C.N., Rosenberg, M.P., Snow, C.M., Samuelson, L.C. and Meisler, M.H., 1992. Endogenous retroviral sequences are required for tissue-specific expression of a human salivary amylase gene. Genes Dev 6, 1457-65. Towler, E.M., Gulnik, S.V., Bhat, T.N., Xie, D., Gustschina, E., Sumpter, T.R., Robertson, N., Jones, C., Sauter, M., Mueller-Lantzsch, N., Debouck, C. and Erickson, J.W., 1998. Functional characterization of the protease of human endogenous retrovirus, K10: can it complement HIV-1 protease? Biochemistry 37, 17137-44. Tristem, M., 2000. Identification and characterization of novel human endogenous retrovirus families by phylogenetic screening of the human genome mapping project database. J Virol 74, 3715-30. Tuke, P.W., Perron, H., Bedin, F., Beseme, F. and Garson, J.A., 1997. Development of a pan-retrovirus detection system for multiple sclerosis studies. Acta Neurol Scand Suppl 169, 16-21. Urnovitz, H.B. and Murphy, W.H., 1996. Human endogenous retroviruses: nature, occurrence, and clinical implications in human disease. Clin Microbiol Rev 9, 72-99. Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe, A. and Speleman, F., 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol 3, RESEARCH0034. Wang-Johanning, F., Frost, A.R., Jian, B., Azerou, R., Lu, D.W., Chen, D.T. and Johanning, G.L., 2003a. Detecting the expression of human endogenous retrovirus E envelope transcripts in human prostate adenocarcinoma. Cancer 98, 187-97. Wang-Johanning, F., Frost, A.R., Jian, B., Epp, L., Lu, D.W. and Johanning, G.L., 2003b. Quantitation of HERV-K env gene expression and splicing in human breast cancer. Oncogene 22, 1528-35. Wang-Johanning, F., Liu, J., Rycaj, K., Huang, M., Tsai, K., Rosen, D.G., Chen, D.T., Lu, D.W., Barnhart, K.F. and Johanning, G.L., 2007. Expression of multiple human endogenous retrovirus surface envelope proteins in ovarian cancer. Int J Cancer 120, 81-90. Weiss, R., 1969. The host range of Bryan strain Rous sarcoma virus synthesized in the absence of helper virus. J Gen Virol, 511-528. Weiss, R.A., 2006. The discovery of endogenous retroviruses. Retrovirology 3, 67. Wells, D. and Kedes, L., 1985. Structure of a human histone cDNA: evidence that basally expressed histone genes have intervening sequences and encode polyadenylylated mRNAs. Proc Natl Acad Sci U S A 82, 2834-8. Wilkinson, D.A., Mager, D.L. and Leong, J.C. 1994. Endogenous human retroviruses. In: J. Levy (Ed), In the Retroviridea, Plenum Press, New York, pp. 465-535.

58 Wu, R.S. and Bonner, W.M., 1981. Separation of basal histone synthesis from S- phase histone synthesis in dividing cells. Cell 27, 321-30. Wu, R.S. and Bonner, W.M., 1985. Mechanism for differential sensitivity of the chromosome and growth cycles of mammalian cells to the rate of protein synthesis. Mol Cell Biol 5, 2959-66. Yin, H., Medstrand, P., Andersson, M.L., Borg, A., Olsson, H. and Blomberg, J., 1997. Transcription of human endogenous retroviral sequences related to mouse mammary tumor virus in human breast and placenta: similar pattern in most malignant and nonmalignant breast tissues. AIDS Res Hum Retroviruses 13, 507-16. Yin, H., Medstrand, P., Kristofferson, A., Dietrich, U., Aman, P. and Blomberg, J., 1999. Characterization of human MMTV-like (HML) elements similar to a sequence that was highly expressed in a human breast cancer: further definition of the HML-6 group. Virology 256, 22-35. Yoder, J.A., Walsh, C.P. and Bestor, T.H., 1997. Cytosine methylation and the ecology of intragenomic parasites. Trends Genet 13, 335-40. Yoshiki, T., Mellors, R.C., Strand, M. and August, J.T., 1974. The viral envelope glycoprotein of murine leukemia virus and the pathogenesis of immune complex glomerulonephritis of New Zealand mice. J Exp Med 140, 1011- 27.

59 Acta Universitatis Upsaliensis Digital Comprehensive Summaries of Uppsala Dissertations from the Faculty of Medicine 274

Editor: The Dean of the Faculty of Medicine

A doctoral dissertation from the Faculty of Medicine, Uppsala University, is usually a summary of a number of papers. A few copies of the complete dissertation are kept at major Swedish research libraries, while the summary alone is distributed internationally through the series Digital Comprehensive Summaries of Uppsala Dissertations from the Faculty of Medicine. (Prior to January, 2005, the series was published under the title “Comprehensive Summaries of Uppsala Dissertations from the Faculty of Medicine”.)

ACTA UNIVERSITATIS UPSALIENSIS Distribution: publications.uu.se UPPSALA urn:nbn:se:uu:diva-8213 2007