Regulation of Contractile-Ring and Spindle-Pole-Body Assembly in Fission Yeast DISSERTATION Presented in Partial Fulfillment Of

Regulation of Contractile-Ring and Spindle-Pole-Body Assembly in Fission Yeast

DISSERTATION

Presented in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy in the Graduate School of The Ohio State University

I-Ju Lee

Graduate Program in Molecular, Cellular and Developmental Biology

The Ohio State University

2013

Dissertation Committee:

Dr. Jian-Qiu Wu, Advisor

Dr. James Hopper

Dr. Gustavo Leone

Dr. Stephen Osmani

I-Ju Lee

2013

Abstract

Cell division requires drastic reorganization of the cytoskeleton. In most eukaryotes, microtubules nucleated from centrosomes form a bipolar spindle for DNA segregation, and an actomyosin contractile ring is assembled during cytokinesis to separate two daughter cells. It is fundamental to understand how centrosomes and the contractile ring are assembled, because extra centrosomes and failure in cytokinesis may result in tetraploidy and aneuploidy that contribute to tumorigenesis. Major components of centrosomes and the contractile ring are conserved from yeast to humans. In this body of work, I used the fission yeast Schizosaccharomyces pombe as a model organism to investigate the assembly of these macromolecular structures.

Cortical structures named cytokinesis nodes are precursors of the contractile ring in fission yeast, and the anillin-like protein Mid1 is required for the assembly of cytokinesis nodes. However, it was unclear how Mid1 scaffolds cytokinesis-node assembly. In this study, I first tested physical interactions between Mid1 and other cytokinesis node proteins by co-immunoprecipitation (co-IP). I found that Mid1 interacts with IQGAP protein Rng2, myosin II essential light chain Cdc4, myosin II heavy chain

Myo2, and F-BAR protein Cdc15. Next, I investigated which Mid1 domains or regions are important for its localization and function by domain analyses. PH domain at the C- terminus of Mid1 binds to lipids weakly and stabilizes Mid1 on the cortex. A previously

ii uncharacterized internal region also regulates cortical localization of Mid1. Mid1 lacking this region exhibits stronger localization to the medial cortex and partially bypasses the requirement of the inhibitory signal at the cell tips. The N-terminal half of Mid1 physically interacts with cytokinesis-node proteins in co-IP. Moreover, the first 100 amino acids (aa) of Mid1 is sufficient to assemble cytokinesis nodes. Together, domain analyses of Mid1 provide a comprehensive understanding of how Mid1 orchestrates division-site specification and contractile-ring assembly.

Although more than 130 cytokinesis proteins have been identified in fission yeast, the list is not complete and many mutants remain to be cloned and characterized. Starting from characterizing a cytokinesis mutant M46, we revealed that the centrin-binding protein Sfi1 regulates both cytokinesis and mitosis in fission yeast. The cytokinesis defects in sfi1-M46 are due to prolonged activity of the septation initiation network

(SIN), while the mitosis defects are due to aberrant assembly of the spindle pole body

(SPB). Previously, it was proposed that Sfi1 level doubles on SPB to initiate SPB assembly in yeast. Here I performed the first temporal analysis of the localization and recruitment of Sfi1 and found that Sfi1 is recruited to SPB gradually throughout the cell cycle, suggesting a revision in the model of SPB assembly. During mitosis, Sfi1-M46 partition is often unequal and it predominantly stays on the old SPB. The lack of inherited

Sfi1 underlies mitosis defects in the next cell cycle, but Sfi1 recruitment in interphase partially rescues Sfi1 level on SPB, suggesting that the half-bridge can undergo de novo assembly.

iii

Dedication

This document is dedicated to Yuan-Pern Lee and Shu-Yuan Fu, for their equal contribution of genetic and environmental factors that made me want to be a scientist.

Acknowledgments

I would like to thank my advisor Dr. Jian-Qiu Wu, for taking me as his second graduate student and for all his guidance along my journey. Not only Dr. Wu is a role model for international students himself, he also provided a terrific environment in which

I learned how to do research. I have benefited greatly from wonderful labmates: Dr.

Damien Laporte inspired me on how to approach and solve scientific questions; Dr.

Valerie Coffman is my best companion in the lab and we frequently shared thoughts on each other’s projects. I also want to thank other current or previous members of the Wu lab, especially Dr. Yanfang Ye, Reshma Davidson, Ning Wang, Yihua Zhu, and Kersey

Schott. I would like to thank my committee: Dr. James Hopper, Dr. Stephen Osmani, and

Dr. Gustavo Leone, for their insightful suggestions on my projects. Tough questions they asked in committee meetings are the best compliment to my work. I also want to thank personnel at the MG office, the MCDB office, and the Pelotonia Fellowship Program for their help throughout the years.

I want to thank my parents for the supports they provided from Taiwan. I am also thankful to the support from friends at OSU, including but not limited to fellow graduate students in biological sciences, the happy badminton club, the TWSA volleyball club, and the Happy Feet Peloton.

Vita

2005...... B.S. Chemistry, National Taiwan University

2007...... M.S. Molecular and Cellular Biology, National Taiwan University

2007 to 2008 ………………………………. Graduate student, Department of Biochemistry, The Ohio State University

2008 to 2013 ...... Graduate Research Associate, Program of Molecular, Cellular, & Developmental Biology, The Ohio State University

Publications

Lee, I-J., N. Wang, W. Hu, K. Schott, J. Bähler, J. Pringle, L.-L. Du, and J.-Q. Wu. 2013. Recruitment and partition of the centrin-binding protein Sfi1 during SPB/centrosome assembly. (submitted)

Guan, R., I-J. Lee, J. Wang, J.-Q. Wu, and Z. Chen. 2013. Structures reveal Mid1 targets to the division plane with analogous mechanism as Anillin. (submitted)

Lee, I-J., V.C. Coffman, and J.-Q. Wu. 2012. Contractile-ring assembly in fission yeast- recent advances and new perspectives. Cytoskeleton. 69:751-763.

Lee, I-J. and J.-Q. Wu. 2012. Characterization of Mid1 domains for targeting and scaffolding in fission yeast cytokinesis. J. Cell Sci. 125:2973-2985.

Ye, Y., I-J. Lee, K.W. Runge, and J.-Q. Wu. 2012. Roles of putative Rho-GEF Gef2 in division-site positioning and contractile-ring function in fission yeast cytokinesis. Mol. Biol. Cell. 23:1181-1195.

Laporte, D., V.C. Coffman, I-J. Lee, and J.-Q. Wu. 2011. Assembly and architecture of precursor nodes during fission yeast cytokinesis. J. Cell Biol. 192:1005-1021.

Yeh, C.-H., H.-J. Yang, I-J. Lee, and Y.-C. Wu. 2010. C. elegans TLK-1 controls cytokinesis by localizing AIR-2/Aurora B to midzone microtubules. Biochem. Biophys. Res. Commun. 400:187-193.

Coffman, V.C., A.H. Nile, I-J. Lee, H. Liu, and J.-Q. Wu. 2009. Roles of formin nodes and myosin motor activity in Mid1p-dependent contractile-ring assembly during fission yeast cytokinesis. Mol. Biol. Cell. 20:5195-5210.

Fields of Study

Major Field: Molecular, Cellular and Developmental Biology

vii

Table of Contents

Abstract ...... ii

Dedication ...... iv

Acknowledgments...... v

Vita ...... vi

Table of Contents ...... viii

List of Tables ...... xiv

List of Figures ...... xv

List of Abbreviations ...... xvii

Chapter 1: Introduction ...... 1

1.1 Contractile-ring assembly ...... 2

1.2 SPB/Centrosome assembly ...... 3

Chapter 2: Physical Interactions between Mid1 and Other Node Proteins ...... 5

2.1 Abstract ...... 5

2.2 Introduction ...... 6

2.3 Materials and methods ...... 8

viii

2.3.1 Strains, growing conditions, genetic, and cellular methods ...... 8

2.3.2 IP and immunoblotting ...... 8

2.4 Results ...... 10

2.4.1 Physical interactions among Mid1 and module I proteins ...... 10

2.4.2 Physical interactions between Mid1 and module II...... 11

2.5 Discussion ...... 11

2.5.1 The anillin Mid1-Cdc4-IQGAP Rng2 module for cytokinesis-node assembly 11

2.5.2 The anillin Mid1 and F-BAR protein Cdc15 module for cytokinesis-node

assembly ...... 12

2.5.3 Contractile-ring assembly in other model systems ...... 12

2.6 Acknowledgement ...... 13

Chapter 3: Characterization of Mid1 Domains for Targeting and Scaffolding in Fission

Yeast Cytokinesis...... 19

3.1 Abstract ...... 19

3.2 Introduction ...... 20

3.3 Materials and methods ...... 22

3.3.1 Strain constructions and yeast methods ...... 22

3.3.2 Microscopy and data analysis ...... 25

3.3.3 FRAP analysis ...... 26

3.3.4 IP and immunoblotting ...... 27

3.3.5 Expression and purification of the PH domains ...... 27

3.3.6 Protein-lipid overlay assay ...... 28

3.4 Results ...... 29

3.4.1 Domain analyses reveal important Mid1 domains for division-site specification

...... 29

3.4.2 The PH domain and the internal region aa(101-400) regulate Mid1 localization

and dynamics ...... 31

3.4.3 Cdr2-independent cortical localization of Mid1 is coordinated by the PH

domain and the internal region ...... 33

3.4.4 The PH domain of Mid1 directly interacts with lipids ...... 34

3.4.5 Mid1[(1-100)-(401-920)] suppresses cytokinesis defects of pom1∆ cells ...... 34

3.4.6 Major physical interactions with node proteins reside in Mid1(1-580) ...... 36

3.4.7 Nodes and contractile-ring assembly are rescued by fusing Mid1 N-terminal

domains to Cdr2 kinase ...... 37

3.5 Discussion ...... 39

3.5.1 The role of the PH domain in different anillins ...... 39

3.5.2 The internal region and the regulation of Mid1 localization ...... 40

3.5.3 Overlapping mechanisms regulating the cortical localization of Mid1 ...... 41

3.5.4 Physical interactions between Mid1 and other cytokinesis proteins ...... 43 x

3.6 Acknowledgements ...... 44

Chapter 4: Contractile-Ring Assembly in Fission Yeast Cytokinesis: Recent Advances and New Perspectives ...... 65

4.1 Abstract ...... 65

4.2 Introduction ...... 66

4.3 Cytokinesis node assembly ...... 67

4.3.1 Cytokinesis nodes and interphase nodes ...... 68

4.3.2 The assembly and architecture of cytokinesis nodes ...... 70

4.4 SCPR model and beyond...... 73

4.4.1 Search ...... 74

4.4.2 Capture...... 77

4.4.3 Pull ...... 78

4.4.4 Release ...... 80

4.4.5 Modification of the model ...... 82

4.4.6 Mid1-independent contractile-ring assembly ...... 84

4.5 Ring maturation and constriction ...... 86

4.6 Conclusions and perspectives ...... 90

4.7 Acknowledgements ...... 91

Chapter 5: Regulation of SPB Assembly and Cytokinesis by the Centrin-Binding Protein

Sfi1 in Fission Yeast ...... 94

5.1 Abstract ...... 94

5.2 Introduction ...... 95

5.3 Materials and methods ...... 98

5.3.1 Strain constructions and yeast methods ...... 98

5.3.2 Microscopy and image analysis ...... 99

5.3.3 Quantification of protein molecules ...... 101

5.3.4 Whole genome sequencing to identify the M46 mutation ...... 102

5.3.5 Electron microscopy ...... 103

5.4 Results ...... 103

5.4.1 A conserved Trp is mutated in the sfi1-M46 mutant ...... 103

5.4.2 Prolonged SIN activity, mitotic defects, and aberrant septation in sfi1-M46

cells ...... 104

5.4.3 Sfi1 is essential for SPB assembly and bipolar-spindle formation ...... 105

5.4.4 Sfi1 localizes to a region between two newly separated SPBs ...... 106

5.4.5 Sfi1 is recruited to SPBs gradually throughout the cell cycle ...... 107

5.4.6 Loss of Sfi1 on the SPB causes mitotic defects...... 108

5.4.7 SPB duplication is affected in sfi1-M46 ...... 109

xii

5.4.8 Sfi1-M46 prefers to stay on the old SPB ...... 110

5.4.9 Recruitment of Sfi1-M46 in interphase prevents mitotic defects caused by

unequal partition of Sfi1-M46 ...... 111

5.4.10 Repressing Sfi1 to ~30% of its endogenous level does not significantly affect

SPB assembly ...... 113

5.4.11 Mutating other conserved Trps revealed that the repeats in Sfi1 are not

identical ...... 113

5.5 Discussion ...... 114

5.5.1 The model of SPB assembly ...... 114

5.5.2 Sfi1 partition and inheritance ...... 115

5.5.3 Half-bridge proteins in S. pombe and S. cerevisiae ...... 117

5.5.4 The regulation of centrosome and SPB assembly ...... 118

5.5.5 Roles of Sfi1 in cytokinesis ...... 119

5.6 Acknowledgement ...... 120

Chapter 6: Conclusion and Future Direction ...... 139

6.1 Mid1, cytokinesis nodes, and contractile-ring assembly...... 139

6.2 Sfi1 and SPB/centrosome assembly ...... 141

References ...... 143

xiii

List of Tables

Table 2.1. S. pombe strains used in this chapter...... 15

Table 3.1. Summary of phenotypes and localizations of Mid1 truncations...... 46

Table 3.2. S. pombe strains used in this chapter...... 47

Table 5.1. S. pombe strains used in this chapter...... 122

xiv

List of Figures

Figure 2.1. The localization hierarchy for cytokinesis-node assembly...... 16

Figure 2.2. Physical interactions among node proteins revealed by co-IP...... 17

Figure 2.3. The interaction between Mid1 and Myo2 does not require actin...... 17

Figure 2.4. Mid1 co-immunoprecipitates with Cdc15...... 18

Figure 3.1. Serial truncations of Mid1 reveal functions of different domains/motifs in division-site specification...... 51

Figure 3.2. Western blotting of mYFP or mECitrine tagged Mid1 truncations...... 52

Figure 3.3. The PH domain and the internal region aa(101-400) affect Mid1 localizations and dynamics...... 54

Figure 3.4. Fluorescence intensity of Mid1[(1-100)-(401-920)] and dynamics of Mid1(1-

800)...... 55

Figure 3.5. Mid1[(1-100)-(401-920)] interacts with Cdr2-mEGFP...... 56

Figure 3.6. The internal region aa(101-400) and the PH domain regulate the localization of Mid1...... 57

Figure 3.7. Mid1 PH domain has overlapping function with the amphipathic helix...... 58

Figure 3.8. Mid1 lacking the internal region aa(101-400) suppresses the cytokinesis defects of pom1∆...... 59

Figure 3.9. mid1 mutants alleviate division-site-specification defects in pom1∆...... 60

Figure 3.10. Localization of Mid1(1-580), Mid1(41-920), and Mid1[(1-40)-(101-920)]. 61

Figure 3.11. The N-terminal half of Mid1 physically interacts with several node proteins for contractile-ring assembly...... 62

Figure 3.12. Mid1(1-100) is sufficient to assemble cytokinesis nodes and the contractile ring...... 64

Figure 4.1. The assembly of cytokinesis nodes and the contractile ring in fission yeast. 92

Figure 4.2. The search, capture, pull, and release mechanism of contractile-ring assembly.

...... 93

Figure 5.1. Mitosis and cytokinesis defects in sfi1-M46 cells...... 125

Figure 5.2. Sfi1 is essential for bipolar spindle formation...... 126

Figure 5.3. Localization of S. pombe Sfi1 to SPBs...... 128

Figure 5.4. Regulation of mitosis and SPB assembly by Sfi1...... 130

Figure 5.5. Sfi1 and Sfi1-M46 are stable on SPB revealed by FRAP...... 131

Figure 5.6. Sfi1-M46 prefers to stay on the old SPB...... 132

Figure 5.7. Unequal partition of Sfi1-M46 underlies the mitotic defects...... 133

Figure 5.8. Sfi1 partition in wt and sfi1-M46 cells...... 134

Figure 5.9. Repressing Sfi1 to ~30% of its endogenous level does not significantly affect mitosis...... 135

Figure 5.10. The repeats in Sfi1 are not identical...... 137

Figure 5.11. Summary of results in this chapter...... 138

xvi

List of Abbreviations aa, amino acids co-IP, co-immunoprecipitation

EM, electron microscopy

FL, full length

FRAP, fluorescence recovery after photobleaching

GEF, guanine exchange factor mECitrine, monomeric enhanced Citrine mEGFP, monomeric enhanced GFP

MT, microtubule

MTOC, microtubule-organizing centers mYFP, monomeric YFP

NES, nuclear export sequences

NLS, nuclear localization sequences

PAA, post-anaphase array

PH, pleckstrin homology

ROI, region of interest

SCPR, search, capture, pull, and release (SCPR)

SHREC, single molecule high resolution co-localization

xvii

SIN, septation initiation network

SPB, spindle pole body tdTomato, tandem tomato

xviii

Chapter 1: Introduction

Cell division is the process by which one mother cell divides into two daughter cells. Crucial for viability, proliferation, and development, the process of cell division must be tightly regulated and precisely executed in cells. The cytoskeleton undergoes two major changes in cell division: microtubules nucleated from centrosomes form the mitotic spindle that directs and ensures proper DNA segregation; the assembly and constriction of an actomyosin contractile ring partitions the daughter cells by cytokinesis.

Both the centrosome and the contractile ring are macromolecular structures composing of many conserved proteins, and a fundamental question in the field of cell biology is how these macromolecular complexes are assembled.

In this body of work, the fission yeast Schizosaccharomyces pombe was used as a model organism to investigate assembly of the contractile ring and SPB, the yeast equivalent of centrosomes. S. pombe has been a powerful system to study the cell division cycle since 1970’s. These cylindrical cells are 7-14 μm in length with a diameter of ~4 μm. Many important discoveries in the regulation of cell division, including the roles of the cyclin-dependent kinase CDK1 and the inhibitory kinase Wee1 at G2/M transition (Mitchison, 1957; Nurse, 1975; Nurse et al., 1976; Nurse and Thuriaux, 1980), were initially made in S. pombe. In the last 15 years or so, the S. pombe field underwent rapid development. The small, fully sequenced genome of S. pombe (Wood et al., 2002)

1 is preferred for genetics. Like the budding yeast S. cerevisiae (Baudin et al., 1993; Wach et al., 1994), highly-efficient homologous recombination in S. pombe has made gene- targeting very easy (Bähler et al., 1998b) and allowed the visualization of fluorescent- tagged proteins expressed under the control of their own promoters. In this study, we took this advantage and utilized confocal light microscopy to quantify and analyze the localization and dynamics of proteins involved in contractile-ring and spindle-pole-body assembly.

1.1 Contractile-ring assembly

S. pombe contractile-ring assembly is at the leading edge of the field of cytokinesis. To date, ~130 cytokinesis proteins are identified in S. pombe (Pollard and

Wu, 2010), and the number is still increasing. Many of these proteins localize to a broad band of cortical nodes at the equator of the cell. These nodes then coalescence to form a contractile ring (Wu et al., 2003, 2006) in a mechanism described as search, capture, pull, and release (Vavylonis et al., 2008). The location of the broad band of nodes determines the position of the contractile ring (Paoletti and Chang, 2000), but how the nodes are assembled, however, was unclear. Thus, it became an important task to systematically unravel the relationship between various cytokinesis proteins. Members of the Wu laboratory coordinated to tackle different aspects of this task, and my research is mainly focused on the anillin-like scaffolding protein Mid1.

Mid1 is required for division-site specification and cytokinesis-node assembly

(Sohrmann et al., 1996; Wu et al., 2003). At least six other node proteins depend on Mid1 for localization to the cell cortex (Wu et al., 2003, 2006), and the localization of Mid1 is 2 under complex regulation of positive and negative signals (Paoletti and Chang, 2000;

Celton-Morizur et al., 2004, 2006; Padte et al., 2006; Almonacid et al., 2009). Therefore, detailed analyses of Mid1 are required to advance our knowledge on contractile-ring assembly. In this study, I tested the physical interactions between Mid1 and other cytokinesis node proteins (Chapter 2), and characterized important domains or motifs in

Mid1 for its localization and function (Chapter 3). I also summarized recent advances and future perspectives on contractile-ring assembly in fission yeast (Chapter 4).

1.2 SPB/Centrosome assembly

In higher eukaryotes, centrosomes are composed of centrioles surrounded by pericentriolar materials. SPBs, the yeast centrosomes, are structurally distinct from centrosomes and do not have centrioles, but the components of SPB and its assembly process are surprisingly similar to those of centrosomes (Hinchcliffe and Sluder, 2001;

Bornens, 2002; Job et al., 2003; Jaspersen and Winey, 2004). Similar to centrosomes in animal cells, S. pombe SPB is cytoplasmic most of the time during the cell cycle, suggesting that SPB assembly can serve as a model system for centrosome assembly.

Nevertheless, SPB assembly in S. pombe remains poorly understood.

Centrosomal structures in various organisms have been studied extensively for decades using electron microscopy (EM) (Gall, 1961; Robbins et al., 1968; McCully and

Robinow, 1971; Byers and Goetsch, 1974; Kuriyama and Borisy, 1981; O'Toole et al.,

1999). To date, EM and cryo-EM are still predominant methods to study the SPB, centrosome, and basal body (Romao et al., 2008; Tallada et al., 2009; Fisch and Dupuis-

Williams, 2011; Tamm et al., 2011; Li et al., 2012). However, limitations of EM argue 3 that alternative tools to investigate SPB/centrosome assembly are required. Specifically, live-imaging of SPB/centrosome assembly will benefit the field significantly, because it is difficult to study dynamic processes using EM. In addition, cells are often synchronized before frozen for EM and may not represent the situation in unsynchronized cells.

In this study, I used live-imaging light microscopy to investigate SPB assembly in fission yeast. Different stages of SPB assembly and spindle formation were described in both S. cerevisiae (Byers and Goetsch, 1974; Adams and Kilmartin, 1999) and S. pombe

(Ding et al., 1997; Uzawa et al., 2004), and an appendage-like structure called the half- bridge was found to be essential for SPB assembly in both yeasts. Based on observations from EM images, it was thought that the duplication of the half-bridge protein Sfi1 marks the initiation of SPB assembly (Jones and Winey, 2006; Li et al., 2006). However, this model remains untested. To fill the gap, I performed live-cell imaging to investigate the recruitment and partition of Sfi1 for the first time in this study, and revealed a surprising nature of SPB assembly in fission yeast cells (Chapter 5).

Chapter 2: Physical Interactions between Mid1 and Other Node Proteins

Derived from Laporte, D., V.C. Coffman, I-J. Lee, and J.-Q. Wu. 2011. Assembly and architecture of precursor nodes during fission yeast cytokinesis. J. Cell Biol. 192:1005- 1021.

2.1 Abstract

The contractile ring is essential for cytokinesis in most fungal and animal cells. In fission yeast, cytokinesis nodes are precursors of the contractile ring and mark the future cleavage site. However, their assembly and architecture have not been well described. To investigate how Mid1 scaffolds cytokinesis-node assembly, I tested physical interactions between Mid1 and other cytokinesis node proteins. Endogenous Mid1 co-IPs with

IQGAP Rng2, myosin II essential light chain Cdc4, and the F-BAR protein Cdc15. In contrast, the interaction between Mid1 and myosin II heavy chain Myo2 is extremely weak. Combining these results with localization dependencies, in vivo dynamics, and architecture of cytokinesis nodes, we propose that nodes are assembled in a hierarchical order with two modules linked by Mid1, the positional marker. Mid1 first recruits Cdc4 and Rng2 to form module I. Rng2 subsequently recruits Myo2 and its regulatory light chain Rlc1. Mid1 then independently recruits Cdc15 to form module II. Both modules recruit the formin Cdc12 to nucleate actin filaments. Taken together, our work defines important steps and molecular players for contractile-ring assembly.

2.2 Introduction

Cytokinesis requires coordination of cleavage-site selection, assembly and constriction of a contractile ring, and targeted membrane fusion to partition a mother cell into two daughter cells (Balasubramanian et al., 2004; Glotzer, 2005; Barr and

Gruneberg, 2007; Pollard and Wu, 2010). In animal cells, the spindle midzone and/or astral microtubules specify where to assemble the contractile ring (Bringmann and

Hyman, 2005; Barr and Gruneberg, 2007). In S. cerevisiae, the division site is determined by the bud-site selection machinery (Balasubramanian et al., 2004). In S. pombe, the anillin-like protein Mid1 provides positional cues for cleavage-site selection (Sohrmann et al., 1996). After the division site is specified, a contractile ring is assembled at the specified site. Contractile rings are essential for force production and for guiding membrane fusion at the cleavage site in most fungi, amoebas, and animal cells (Hales et al., 1999; Pollard and Wu, 2010). However, molecular mechanisms of the coordination between division-site specification and contractile-ring assembly remain elusive.

The fission yeast Schizosaccharomyces pombe is a powerful model for the study of cleavage-site selection and contractile-ring assembly (Mishra and Oliferenko, 2008;

Roberts-Galbraith and Gould, 2008; Bathe and Chang, 2010). In S. pombe, the current model of cytokinesis proposes cytokinesis nodes as precursors of the contractile ring (Wu et al., 2006; Vavylonis et al., 2008). Cytokinesis nodes contain at least seven conserved proteins that assemble independently of actin filaments: Mid1, myosin-II heavy chain

Myo2, essential light chain Cdc4, regulatory light chain Rlc1, formin Cdc12, IQGAP

Rng2, and F-BAR protein Cdc15 (Pollard and Wu, 2010). Except Mid1 and Rlc1, these

6 proteins are essential for contractile-ring assembly and/or maturation. Mid1 was reported to recruit Myo2 to nodes by interacting with the Myo2 tail (Motegi et al., 2004). Myosin-

II is a hexamer composed of Myo2, Cdc4, and Rlc1, which produces force to condense nodes into a contractile ring as well as to constrict the ring (Lord and Pollard, 2004).

Myo2 directly interacts with Cdc4 and Rlc1 through its two IQ domains at the neck region (Motegi et al., 2000; Naqvi et al., 2000), which connects an N-terminal ATPase motor domain and an α-helical tail. Formin Cdc12 nucleates linear actin filaments for the contractile ring (Kovar et al., 2003). IQGAP Rng2 is essential for bundling and arranging actin filaments into the contractile ring (Takaine et al., 2009). Rng2 also interacts with

Cdc4 as revealed by immunoprecipitation (D'Souza et al., 2001), most likely via its multiple IQ domains. F-BAR protein Cdc15 interacts with formin Cdc12 (Carnahan and

Gould, 2003) and is essential for ring maturation and the Mid1-independent ring assembly (Wachtler et al., 2006).

Mid1, the first protein to appear in cytokinesis nodes (Paoletti and Chang, 2000), is essential for division-site specification, as loss of Mid1 results in the loss of cytokinesis nodes and thus randomly-placed contractile rings (Sohrmann et al., 1996). However, it was poorly understood how Mid1 recruits other proteins to form functional cytokinesis nodes and a contractile ring. The relative simplicity of cytokinesis nodes makes them an ideal structure to determine interactions and architecture of these proteins, which will provide insights into the assembly and function of the more complex contractile ring.

After systematically determining localization dependencies of node proteins, their molecular stoichiometry, protein dynamics in vivo, and the node architecture, we

7 proposed two modules through which cytokinesis nodes are assembled hierarchically

(Figure 2.1). Module I consists of Mid1 recruiting Cdc4 and Rng2 that subsequently recruits Myo2 and Rlc1. Cdc4 and Rng2 provide a positive feedback on Mid1 recruitment. Module II assembles independently and consists of Mid1 recruiting Cdc15.

Both modules are involved in recruiting formin Cdc12, which nucleates actin filaments for contractile-ring assembly.

Here I tested the pathway of cytokinesis-node assembly by determining the physical interactions between Mid1 and other cytokinesis node proteins. My results show that Mid1 interacts with Rng2, Cdc4, and Cdc15, and weakly with Myo2, validating the two modules we proposed.

2.3 Materials and methods

2.3.1 Strains, growing conditions, genetic, and cellular methods

Table 2.1 lists the S. pombe strains used in this chapter. All tagged genes are under the control of endogenous promoters and integrated at their native chromosomal loci. Functionalities of newly tagged strains were tested by examining the growth and morphology at different temperatures and by crossing tagged strains with mutations known to have synthetic interactions with mutations in the tagged genes. Cells were grown in exponential phase for 36-48 h before microscopy as described (Wu et al., 2006).

2.3.2 IP and immunoblotting

We immunoprecipitated S. pombe cell lysates using the polyclonal antibody against YFP (Novus Biologicals; NB600-308) from strains expressing tagged proteins under the control of endogenous promoters and integrated at their native chromosomal 8 loci. 30 µl of protein G covalently coupled magnetic Dynabeads (Invitrogen; 100.04D) were washed 3x with 1 ml cold PBS buffer (137 mM NaCl, 2.7 mM KCl,

10 mM Na2HPO4, and 2 mM KH2PO4), and then resuspended in 600 μl PBS. 5 μg YFP antibodies were added to the magnetic Dynabeads and incubated for 1 h at 23°C. The antibody-coupled magnetic beads were then washed 3x with 1 ml PBS and 1x with 1 ml

1% NP-40 buffer (50 mM HEPES pH 7.5, 100 mM NaCl, 1 mM EDTA, 1% NP-40,

50 mM NaF, 20 mM Glycerophosphate, and 0.1 mM Na3VO4).

Thirty mg lyophilized cells (~1.2 x 109 cells) per sample were resuspended in

300 μl IP buffer [1% NP-40 buffer, 1 mM PMSF, 1x protease inhibitor (Roche;

11873580001)]. Under these conditions, ~50% cells were lysed (Liu et al., 2010). After low speed centrifugation (3,000 rpm, 30 s, 4°C), 200 μl supernatant was centrifuged again (13,000 rpm, 10 min, 4°C). 130 μl supernatant was transferred to use as cell lysate.

120 μl lysate was added to the antibody-coupled beads and incubated for 90 min at 4°C.

Beads were washed 5x with 1 ml cold 1% NP-40 buffer. In some cases, a more stringent buffer (1% NP-40 buffer with 200 mM NaCl) was used in washing steps. Then 50 μl 1x sample buffer were added to the beads and boiled for 5 min to elute the proteins.

Reciprocal co-IPs were performed as described above except that monoclonal antibody against myc [Santa Cruz Biotechnology; sc-40 (9E10)] was used.

Immunoblotting was carried out as described (Wu and Pollard, 2005) with the following modifications/additions: 1) the following monoclonal antibodies were used to against: myc (sc-40 (9E10); dilution 1:5,000), YFP (Clontech; 632381; 1:5,000 or

1:2,500), GST (Novus Biologicals; NB600-446; 1:5,000), and actin (C4 against chicken

9 gizzard actin, a kind gift of James Lessard, University of Cincinnati Children’s Hospital;

1:2,000); 2) anti-mouse IgG (Sigma; A4416) was used in 1:10,000 dilution; 3) blots were reacted with SuperSignal Maximum Sensitivity Substrate (Thermo Scientific; 34096) and exposed to KODAK BioMax MR Film (Z350370); 4) to address protein stability, total proteins were extracted using 5% TCA as described (Laporte et al., 2008).

In Lat-A treatment experiments (Figure 2.3), beads after co-IP were washed 3x with 1 ml cold 1% NP-40 buffer and split into two non-adherent tubes. One tube is incubated with 100 μM Lat-A, and the other with equal volume DMSO at room temperature for 5 to 15 min with shaking. Beads were then collected by the magnetic rack. After removing supernatant, beads were washed 1x with 1 ml cold 1% NP-40 buffer. Elution of proteins and western blotting were performed as described above.

2.4 Results

2.4.1 Physical interactions among Mid1 and module I proteins

To further test the node-assembly pathway (Figure 2.1), we investigated some of the key physical interactions among the node proteins. Mid1 co-immunoprecipitated with both Cdc4 and Rng2 (Figure 2.2 A) from lysates of asynchronous cultures. Reciprocal co-IPs confirmed the interactions. In contrast, co-IP between Myo2 and Mid1 was not as efficient even though more Myo2 than Rng2 was present in the lysate (Figure 2.2 A). As a negative control, Mid1 did not co-immunoprecipitate with Rlc1 under the same conditions. Interestingly, Mid1 did not co-immunoprecipitate with Myo2 in extracts from rng2-D5 cells grown at 36°C (Figure 2.2 B). This suggests that the physical interaction between Myo2 and Mid1 depends on Rng2. Indeed, Myo2 co-immunoprecipitated with 10 both Rng2 and Cdc4 (Figure 2.2 C). Actin filaments were not involved in the Myo2-Mid1 and Myo2-Rng2 physical interactions we observed, because we detected no actin after IP

(Figure 2.3).

2.4.2 Physical interactions between Mid1 and module II

Based on the localization hierarchy (Figure 2.1), we proposed that Mid1 directly recruits Cdc15 to cytokinesis nodes. Consistent with this hypothesis, Cdc15 interacted with itself and with Mid1 in yeast two-hybrid assays (Laporte et al., 2011). Moreover, I tested the physical interactions between Mid1 and Cdc15 using S. pombe lysates and found that Mid1 co-immunoprecipitated with Cdc15 (Figure 2.4).

Together, the above results suggest that Mid1 may directly recruit Cdc4/Rng2 and

Cdc15 to cytokinesis nodes; and Rng2/Cdc4 recruits Myo2 or stabilizes the Myo2-Mid1 interaction in nodes. These results validated the two modules proposed for cytokinesis- node assembly.

2.5 Discussion

2.5.1 The anillin Mid1-Cdc4-IQGAP Rng2 module for cytokinesis-node assembly

It was proposed previously that Mid1 interacts with the C-terminal tail of Myo2 in co-IP (Motegi et al., 2004). However, both Mid1 and Myo2 tail were overexpressed in that experiment. Here we report that we did observe a faint band in Myo2-Mid1 IPs when both proteins are expressed at their native levels, which suggests a weak interaction.

However, node localization of Myo2 depends on Rng2, indicating that the interaction is not sufficient for Myo2 localization to nodes without Rng2 (Laporte et al., 2011). On the other hand, Mid1 undoubtedly co-IP with Rng2 and Cdc4. In addition, Rng2 and Myo2 11 physically interact with each other. Taken together, both the localization dependencies and physical interaction suggest that Mid1 interacts with Rng2/Cdc4, which then recruits

Myo2 to nodes or stabilizes the weak interaction between Myo2 and Mid1.

2.5.2 The anillin Mid1 and F-BAR protein Cdc15 module for cytokinesis-node assembly

From Single molecule High Resolution Co-localization (SHREC) (Churchman et al., 2005; Joglekar et al., 2009), we found that the N-terminus of Cdc15 lies very close to

Mid1 (Laporte et al., 2011). Consistently, Mid1 co-IP with Cdc15 (Figure 2.4) and yeast two-hybrid assays (Laporte et al., 2011). Cdc15 also interacts with the plasma membrane

(Takeda et al., 2004), and although Cdc15 is not required for cytokinesis-node and contractile-ring assembly, node condensation into a ring is slower and the ring collapses before constriction without Cdc15 (Wachtler et al., 2006; Hachet and Simanis, 2008).

Whether Cdc15 plays a role in cytokinesis nodes other than recruiting the formain Cdc12 remains to be investigated.

2.5.3 Contractile-ring assembly in other model systems

Most proteins involved in contractile-ring assembly, including the seven node proteins, are conserved during evolution. Stepwise recruitment for ring assembly was described in S. cerevisiae and animal cells (Balasubramanian et al., 2004; Dean et al.,

2005; Glotzer, 2005; Barr and Gruneberg, 2007). Recently, it has been shown that

IQGAP Igq1 recruits myosin II Myo1 to the contractile ring during cytokinesis in S. cerevisiae (Fang et al., 2010). Thus, the localization hierarchy and protein interactions we discovered here may also be conserved in other systems.

Accumulating evidence indicates that anillins function as scaffolding proteins to recruit myosin II, actin filaments, septins, and other proteins for contractile-ring assembly in animal cells (D'Avino, 2009). However, anillins are not essential for cleavage-site selection and contractile-ring formation (Straight et al., 2005). Redundant pathways for ring assembly may also exist in animal cells as suggested in C. elegans embryos

(Maddox et al., 2007). Formin CYK-1 is essential for coalescence of myosin II foci to the cleavage furrow and for cytokinesis in C. elegans (Werner et al., 2007). Although Cdc15- like F-BAR proteins (Spencer et al., 1997) and IQGAP proteins (Nishimura and

Mabuchi, 2003) are present in animals cells and amoebas, their roles in cytokinesis are not well understood. Thus, our study sheds light on how these proteins might interact and cooperate in cytokinesis.

We conclude that cytokinesis nodes, the precursors for the contractile ring, are assembled in a hierarchical order and link the positional cues for the cleavage site to contractile-ring assembly during cytokinesis in fission yeast. Our data provide functional insights and a basis to investigate the contractile-ring assembly in other systems.

2.6 Acknowledgement

We thank Ajit Joglekar and Dimitrios Vavylonis for help with SHREC; Mohan

Balasubramanian, Damien Brunner, Fred Chang, Kathleen Gould, James Hopper, Matthew

Lord, Dannel McCollum, James Moseley, Paul Nurse, Stephen Osmani, Thomas Pollard,

John Pringle, Viesturs Simanis, and Takashi Toda for strains, plasmids, or equipment; and

Stephen Osmani, Arthur Burghes, James Hopper, Susan Burghes, and Aurelie Massoni-

Laporte for critical reading of the manuscript. We also thank anonymous reviewers and 13 members of Wu laboratory for insightful and helpful suggestions and comments. V.C.C. is supported by a predoctoral fellowship from American Heart Association. This work is supported by American Heart Association, Great Rivers Affiliate; Basil O’Connor Starter

Scholar Research Award; and National Institute of Health GM086546 to J.-Q.W.

Table 2.1. S. pombe strains used in this chapter. Strain Genotype Source JW909 h+ kanMX6-Prng2-mYFP-4Gly-rng2 ade6-M210 leu1-32 ura4-D18 Wu et al., 2003 JW910-2 h+ kanMX6-Pcdc4-mYFP-4Gly-cdc4 ade6-M210 leu1-32 ura4-D18 Wu et al., 2003 JW1110 h+ kanMX6-Pmyo2-mYFP-myo2 ade6-M210 leu1-32 ura4-D18 Wu and Pollard, 2005 JW1958 h- kanMX6-Prng2-mYFP-4Gly-rng2 ade6-M216 leu1-32 ura4-D18 This study JW2184 h- mid1-6His-13Myc-natMX6 leu1-32 SM902 This study JW2226 h+ kanMX6-Pcdc4-mYFP-4Gly-cdc4 mid1-6His-13Myc-natMX6 leu1- This study 32 SM902 JW2227 h+ kanMX6-Pmyo2-mYFP-myo2 mid1-6His-13Myc-natMX6 ade6- This study M210 leu1-32 ura4-D18 SM902 JW2231 kanMX6-Prng2-mYFP-4Gly-rng2 mid1-6His-13Myc-natMX6 leu1-32 This study SM902 JW2233 kanMX6-Pcdc15-mYFP-4Gly-cdc15 mid1-6His-13Myc-natMX6 leu1- This study 32 ura4-D18 SM902 JW2365 myo2-GST-kanMX6 leu1-32 This study JW2366 kanMX6-Prng2-mYFP-4gly-rng2 myo2-GST-kanMX6 leu1-32 ura4- This study D18 JW2367 myo2-GST-kanMX6 kanMX6-Pcdc4-mYFP-4gly-cdc4 leu1-32 ura4- This study D18 JW2415 cdr2-mEGFP-kanMX6 mid1-6His-13Myc-natMX6 leu1-32 ura4-D18 This study ade6 SM902 JW3285 rng2-D5 kanMX6-Pmyo2-YFP-myo2 mid1-6His-13Myc-natMX6 leu1- This study 32 ade6 ura4-D18 SM902 JM346 h+ cdr2-mEGFP-kanMX6 ade6 leu1-32 ura4-D18 Moseley et al., 2009 MLP583 h- myo2-GST-kanMX6 kanMX6-Pcdc4-mYFP-4Gly-cdc4 leu1-32 Lord and Pollard, 2004 TP150a h- leu1-32 SM902 Takashi Toda, Cancer Research UK, London, UK aSeveral protease genes are deleted in this strain. Strains with SM902 were obtained by crosses with this strain.

Figure 2.1. The localization hierarchy for cytokinesis-node assembly. The complete and partial dependencies of node localization on a specific protein are depicted by solid and dashed lines, respectively. Two modules are colored differently.

Figure 2.2. Physical interactions among node proteins revealed by co-IP. The polyclonal antibody against YFP was used in IP. (A) Mid1 co-immunoprecipitates with Cdc4 and Rng2. The exposure time for Cdc4 and Rng2/Myo2/Mid1 were 5 s and 60 s, respectively. Note that no Mid1 was co-immunoprecipitated in the strain expressing Mid1-13Myc alone (see also Figure 2.4). (B) Mid1 does not co-immunoprecipitate with Myo2 in rng2-D5 strain. WT and rng2-D5 cells were grown for 4 h at 36°C before protein extractions. Three dilutions of cell extracts were used. The upper band is Mid1- Myc, the middle one is mYFP-Myo2, and the lower is a non-specific band used as a loading control. (C) Myo2 co-immunoprecipitates with Cdc4 and Rng2. Due to different concentrations of Cdc4 (4.8 µM) and Rng2 (0.2 µM) in wt cells (Wu and Pollard, 2005), the exposure time to reveal Cdc4 and Rng2 (α-YFP) was 5 s and 30 s, respectively.

Figure 2.3. The interaction between Mid1 and Myo2 does not require actin. The strain mid1-13myc mYFP-myo2 was used. The beads after IP were treated with Lat-A or DMSO for 5 min as described (see 2.3 Materials and Methods). Note that actin is detected before (in lysate) but not after IP regardless of Lat-A treatment. We obtained the same results after treating the beads for 15 min with Lat-A.

Figure 2.4. Mid1 co-immunoprecipitates with Cdc15. The polyclonal antibody against YFP was used in IP. Cdr2 was used as a positive control and a non-specific band was used as a loading control (lower band).

Chapter 3: Characterization of Mid1 Domains for Targeting and Scaffolding in

Fission Yeast Cytokinesis

Derived from Lee, I-J. and J.-Q. Wu. 2012. Characterization of Mid1 domains for targeting and scaffolding in fission yeast cytokinesis. J. Cell Sci. 125:2973-2985.

3.1 Abstract

Division-site selection and contractile-ring assembly are two crucial steps in cytokinesis. In fission yeast, the anillin-like Mid1 specifies the division site at the cell equator by assembling cortical nodes, the precursors of the contractile ring. Thus, Mid1 is essential for linking the positional cues for the cleavage site to contractile-ring formation.

However, how Mid1 domains cooperate to regulate cytokinesis is poorly understood.

Here we unravel the functions of different Mid1 domains/motifs by a series of truncations. The conserved PH domain stabilizes Mid1 in nodes by binding to lipids and is required for Mid1 cortical localization during interphase in the absence of Cdr2 kinase.

Mid1 lacking an internal region that is ~1/3 of the full-length protein has higher nuclear and cortical concentration and suppresses the division-site positioning defects in cells with a deletion of the DYRK kinase Pom1. The N-terminus of Mid1 physically interacts with cytokinesis node proteins. When fused to cortical node protein Cdr2, Mid1(1-100) is sufficient to assemble cytokinesis nodes and the contractile ring. Collectively, our study

19 recognizes domains regulating Mid1 cortical localization and reveals domains sufficient for contractile-ring assembly.

3.2 Introduction

At the final stage of the cell-division cycle, one mother cell is partitioned into two daughter cells by cytokinesis. The mechanism of cytokinesis, utilizing an actomyosin contractile ring, is conserved in amoebas, fungi, and animals (Balasubramanian et al.,

2004; Barr and Gruneberg, 2007). The contractile ring is scaffolded and/or stabilized by a multidomain protein anillin. Identified as an actin-binding and bundling protein in

Drosophila (Miller et al., 1989; Field and Alberts, 1995), anillins are at the hub of the organization and constriction of the cleavage furrow (Oegema et al., 2000; Maddox et al.,

2005; Hickson and O'Farrell, 2008; Piekny and Maddox, 2010). In animal cells, anillins localize to the nucleus in interphase (Field and Alberts, 1995; Oegema et al., 2000;

Straight et al., 2005). During mitosis, anillins interact with GTPase RhoA (Piekny and

Glotzer, 2008) and RacGAP50C (D'Avino et al., 2008; Gregory et al., 2008) and are recruited to the cleavage furrow, where they organize the cytokinetic machinery by interacting with actin filaments, formins, myosin-IIs, septins, and other proteins (Field and Alberts, 1995; Oegema et al., 2000; Kinoshita et al., 2002; Maddox et al., 2005;

Straight et al., 2005; D'Avino et al., 2008; Gregory et al., 2008; Silverman-Gavrila et al.,

2008; Goldbach et al., 2010; Haglund et al., 2010; Piekny and Maddox, 2010; Watanabe et al., 2010). The domains interacting with actin filaments (Field and Alberts, 1995;

Oegema et al., 2000; Kinoshita et al., 2002), myosin-IIs (Straight et al., 2005), and the formin mDia2 (Watanabe et al., 2010) reside in the N-termini of anillins, while the 20

C-terminal PH domain interacts with and recruits septins (Oegema et al., 2000; Kinoshita et al., 2002; Silverman-Gavrila et al., 2008).

The fission yeast Schizosaccharomyces pombe is an excellent model organism to study division-site selection and contractile-ring assembly (Bathe and Chang, 2010;

Laporte et al., 2010; Pollard and Wu, 2010; Goyal et al., 2011). While human and

Drosophila have a single anillin gene with different splicing isoforms, two anillin-related genes, mid1/dmf1 and mid2, encode proteins with non-overlapping functions in S. pombe cytokinesis. Mid2 interacts with and regulates septins starting from late anaphase B, while Mid1 mainly functions at early mitosis (Sohrmann et al., 1996; Berlin et al., 2003;

Tasto et al., 2003). The importance of Mid1 in division-site specification and contractile- ring assembly is well established (Sohrmann et al., 1996; Bähler et al., 1998a; Paoletti and Chang, 2000; Celton-Morizur et al., 2004; Almonacid et al., 2009, 2011). Deletion of mid1 abolishes cytokinesis nodes and results in randomly-positioned contractile rings and septa (Sohrmann et al., 1996; Wu et al., 2006). In interphase, Mid1 localizes to both the nucleus and cortical nodes that are organized by Cdr2 kinase and contain several other proteins including Cdr1 and Wee1 kinases, Blt1, kinesin Klp8, and a putative Rho guanine exchange factor (GEF) Gef2 (Paoletti and Chang, 2000; Almonacid et al., 2009;

Moseley et al., 2009). At the G2/M transition, the Polo kinase Plo1 phosphorylates Mid1 and triggers its further release from the nucleus to cortical nodes at the cell equator

(Bähler et al., 1998a; Almonacid et al., 2011). Mid1 then recruits other proteins to assemble the cytokinesis nodes and contractile ring (Laporte et al., 2011; Padmanabhan et al., 2011).

Significant efforts have been made to identify functional domains/motifs of Mid1.

Two nuclear localization sequences (NLS) and two nuclear export sequences (NES) regulate nuclear shuttling of Mid1, and an amphipathic helix and the adjacent NLS mediate lipid interaction and Mid1 localization on the plasma membrane (Paoletti and

Chang, 2000; Celton-Morizur et al., 2004). However, functions of large portions of Mid1 including the conserved Pleckstrin Homology (PH) domain have never been uncovered.

Two partially overlapping regions of Mid1 are known to interact with the kinase

Cdr2 and Cdc14 family phosphatase Clp1 (Clifford et al., 2008). Although Mid1 is essential for the assembly of cytokinesis nodes (Pollard and Wu, 2010; Laporte et al.,

2011; Padmanabhan et al., 2011), which Mid1 domains interact with other cytokinesis node proteins were largely unknown.

Here we systematically investigate functions of different Mid1 domains. We recognize domains involved in localizing Mid1 and scaffolding cytokinesis-node assembly. The PH domain and the internal region, amino acids (aa) 101-400, regulate

Mid1 localization. The PH domain of Mid1 directly interacts with lipids. The N-terminal

100 aa is sufficient to assemble cytokinesis nodes and the contractile ring with the help of a localizing protein. Taken together, our analyses provide a thorough understanding of cytokinesis regulation by Mid1 in fission yeast.

3.3 Materials and methods

3.3.1 Strain constructions and yeast methods

Table 3.2 lists the S. pombe strains used in this chapter. Standard genetic methods were used (Moreno et al., 1991). All tagged or truncated genes are under the control of 22 endogenous promoters and integrated at their native chromosomal loci unless stated otherwise. PCR-based gene targeting was performed as described (Bähler et al., 1998b).

All constructs were checked by PCR and/or DNA sequencing. mECitrine was made from mYFP (S65G, V68L, Q69K, S72A, T203Y, and A206K) by introducing F64L and

Q69M. The functionalities of the tagged strains expressing FL proteins were validated by normal cell morphology and growth from 23 to 36°C and the lack of negative genetic interactions with pom1∆ or clp1∆.

The C-terminal truncations of Mid1 were generated by transforming wt strain

JW81 with mECitrine-kanMX6 or mYFP-kanMX6 flanked with homologous sequences from the designated position at mid1 locus. The 5’ untranslated region of mid1 (-1108 to -

1 bp upstream of the ATG according to http://old.genedb.org/genedb/pombe/) was cloned and used as Pmid1. mid1(41-920) and mid1(101-920) were generated by transforming the wt strain JW81 with kanMX6-Pmid1-mYFP flanked with homologous sequences from the designated position at mid1 locus. Strains mid1(581-920), mid1(681-920), and mid1(801-920) were generated by making strains carrying ura4+-Purg1-mYFP-(truncated mid1) (Purg1, the urg1 promoter; Watt et al., 2008) and then replacing ura4+-Purg1 with kanMX6-Pmid1.

To construct the internal truncations in plasmids, two primers with their 5’-ends separated by the Mid1 sequences to be deleted were utilized to amplify the pTOPO- mid1(FL) plasmid using iProof DNA polymerase (Bio-Rad, #172-5302). After blunt-end ligations, the resulting plasmids were sequenced. The desired Mid1 fragment was released from the plasmid by digestion with SacI and XhoI and transformed into

23 mid1∆::ura4+-mECitrine-kanMX6 cells (JW2349), which deletes +66 to +2694 bp of mid1 ORF from strain mid1-mECitrine-kanMX6 (JW1790) using the plasmid KS-ura4

(Bähler et al., 1998b). Cells plated onto YE5S were incubated at 25°C for 36–48 h before being selected by 5-FOA resistance.

To fuse cdr2 to mid1 truncations, mid1(1-100)-linker, mid1[(1-100)-(401-580)]- linker and cdr2-mEGFP-kanMX6 were first cloned into the TOPO vector. mid1(1-100)- linker and mid1[(1-100)-(401-580)]-linker were amplified from the genomic DNA of mid1(1-100)-6His-mYFP (JW1303) and mid1[(1-100)-(401-580)]-6His-mECitrine

(JW2704), respectively, using a forward primer starting 25 bp before the ATG of mid1

ORF and a reverse primer complementary to the canonical C-terminal gene targeting linker CGGATCCCCGGGTTAATTAAC (Bähler et al., 1998b). SalI and PmeI sites were added to the reverse primer for further construction. cdr2-mEGFP-kanMX6 was amplified from the genomic DNA of cdr2-mEGFP (JM346) using a forward primer with a SalI site followed by the first 20 bp of cdr2 and a reverse primer

GAATTCGAGCTCGTTTAAAC that is complementary to the C-terminal targeting module of pFA6a and has a PmeI site (Bähler et al., 1998b). cdr2-mEGFP-kanMX6 was then inserted to the 3’-end of the mid1 fragments after SalI and PmeI digestion and ligation. The linker between Mid1 fragments and Cdr2 is RIPGLINVD. mid1(1-100)- linker-cdr2-mEGFP-kanMX6 or mid1[(1-100)-(401-580)]-linker-cdr2-mEGFP-kanMX6 was released from the final plasmid using SpeI and XhoI and transformed into mid1-

6His-13Myc-hphMX6 (JW3206) or mid1[(1-100)-(401-920)]-6His-13Myc-hphMX6

(JW2701), respectively. Transformants that were G418-resistant and hygromycin-

24 sensitive were screened visually. The fusion gene is inserted into the mid1 locus under the control of the endogenous mid1 promoter. The resulting strain was JW3718 and

JW3506.

mid1(Helix*)-mECitrine and mid1(1-800, Helix*)-mECitrine were made from

AP583 (mid1::ura4 + pAP159 Pmid1-mid1(Helix*)-GFP-leu1+). The GFP-leu1+ fragment was first replaced by 13Myc-hphMX6. For making mid1(Helix*)-mECitrine,

13Myc-hphMX6 was replaced by mECitrine-kanMX6. For mid1(1-800, Helix*)- mECitrine, mECitrine-kanMX6 was amplified using the same forward primer used to generate mid1(1-800)-mECitrine so that the PH domain was truncated while replacing

13Myc-hphMX6 with mECitrine-kanMX6.

Latrunculin-A treatment at a concentration of 100 M was performed as described (Coffman et al., 2009). To displace the nucleus by centrifugation, cells at exponential phase was centrifuged at 2,000 × g for 30 s and washed 2x with EMM5S, then incubated with 25 μg/ml MBC or DMSO at 25°C for 10 min. Cells were then transferred to a 1.5 ml microcentrifuge chamber filled with 1 ml of EMM5S agar with 25

μg/ml MBC or DMSO prepared as described (Daga and Chang, 2005), centrifuged at

18,000 × g for 2 min, and incubated in 1 ml EMM5S with 25 μg/ml MBC or DMSO for 1 h at 25°C before imaging.

3.3.2 Microscopy and data analysis

Cells were usually grown in liquid medium at exponential phase for ~48 h at 25°C before microscopy as described (Wu et al., 2006) at 23-24°C unless otherwise stated. mid1∆ cells and truncations with severe cytokinesis defects were grown for 24 to 36 h in

25 liquid medium to prevent adaptation or second-site suppressor(s). Cells were prepared and imaged using the spinning disk confocal microscope as previously described

(Coffman et al., 2009; Laporte et al., 2011). For maximum intensity projections of fluorescence images, a stack spanning 4 μm and spaced at 0.4-1.0 μm was taken, and the projection was generated in UltraVIEW. For single slice fluorescence images shown in figures, 10 consecutive images of the middle focal plane were taken without delay, and the average intensity projection was generated using ImageJ (http://rsb.info.nih.gov/ij/).

Line-scans of cortical fluorescence intensities were generated using ImageJ.

Fluorescence intensity was quantified as described (Coffman et al., 2011; Laporte et al., 2011). For total fluorescence intensity in a cell, the corrected sum intensity projections of stacks were used. For local fluorescence intensity, the corrected average intensity projection of 10 consecutive pictures of the focal plane was used. For the nuclear intensity, a circular region of interest (ROI) with a diameter of 2.6 μm was used.

For the cortical intensity, a rectangular ROI with an area of 1.9-2.5 μm2 was used. To compare the intensities of FL Mid1 and each truncation, the mean intensity of the truncation was normalized to the mean intensity of the FL Mid1 in the same image.

3.3.3 FRAP analysis

FRAP analysis was performed using the photokinesis unit on the UltraVIEW ERS confocal system (Coffman et al., 2009; Laporte et al., 2011). A ROI was selected at sites with Mid1 signal in cortical nodes. Four pre-bleach images were collected, followed by

60 post-bleach images. The interval between images was 20 s. Data analyses were performed as described (Coffman et al., 2009; Laporte et al., 2011).

3.3.4 IP and immunoblotting

IP and immunoblotting were performed as described (Laporte et al., 2011) with the following modifications: (a) 200 mg lyophilized cells were used; (b) anti-Myc antibody (9E10; Santa Cruz Biotechnology, Inc) was used in 1:1,000 dilution. The monoclonal JL-8 antibody against GFP/YFP (Clontech, #632381, 1:5,000 dilution) was used to blot mYFP-Rng2, mYFP-Cdc4, mYFP-Cdc15, and mYFP-Myo2. A polyclonal rabbit anti-GFP antibody (Novus, NB600-308, 1:20,000 dilution) was used to detect

Cdr2-mEGFP. To quantify the level of different truncations in cells, total proteins extracted from ~0.5 mg lyophilized cells were loaded in duplicates on the SDS-PAGE.

Monoclonal antibodies against GFP/YFP (Roche, #11814460001, or JL-8) and tubulin

(TAT1; Woods et al., 1989) were used. The intensities of Mid1 truncations were corrected by levels of tubulins from the same extract and normalized to FL Mid1 with the same tag.

Phosphatase treatment was carried out by splitting one sample into two tubes at the last washing step of IP. After removing supernatant, beads in both tubes were resuspended in 19 μl 1x phosphatase buffer (50 mM HEPES, 100 mM NaCl, 2 mM DTT,

0.01% Brij 35, pH 7.5) with 2 mM MnCl2. One tube is incubated with 1 μl ddH2O (mock treatment), and the other with 1 μl λ phosphatase (NEB, P0753S) at 30°C for 30 min. 5 μl

5x sample buffer was then added to each tube, and samples were boiled for 5 min before loading to SDS-PAGE.

3.3.5 Expression and purification of the PH domains

The encoding sequences of the PH domains of Mid1 [aa(801-920)] and Ksg1

[aa(434-592)] were amplified from genomic DNAs using primers with BamHI and SalI restriction sites and cloned into the TOPO vector and sequenced. After released by

BamHI and SalI, the fragments were cloned into pQE80L to obtain the expression constructs pQE80L-6His-Mid1(801-920) (JQW470) and pQE80L-6His-Ksg1(434-592)

(JQW471).

The PH domains were expressed and purified as described for the purification of

6His-mEGFP (our negative control) and 6His-mYFP using TALON metal affinity resin

(Clontech, #635502; (Wu and Pollard, 2005; Wu et al., 2008) with the following modifications: (a) protein expression was induced with 1 mM IPTG at 20°C for 20 h; (b) the lysates were centrifuged at 107,200 × g for 15 min and then 247,600 × g for 30 min at

4°C and bound to the resin were washed with washing buffer (50 mM Na2PO4, 300 mM

NaCl, 10 mM -mercaptoethanol, and 20 mM imidazole; pH8.0); (c) the fractions with purified proteins were dialyzed into storage buffer (20 mM Tris-HCl, 150 mM NaCl,

0.1% Tween-20, 1 mM NaN3, 1 mM EDTA, 1 mM DTT, pH7.5) at 4°C using the

SnakeSkin dialysis tubing with a cut-off size of 7 kDa (Thermo Scientific, #68700); (d) protein concentrations were determined using the absorbance at 280 nm and extinction coefficients obtained using ProtParam [http://web.expasy.org/protparam/; 21,500 M-1cm-1 for 6His-Mid1(PH) and 25,000 M-1cm-1 for 6His-Ksg1(PH)].

3.3.6 Protein-lipid overlay assay

We used commercial PIP membrane strips (Invitrogen, P23751) to perform the protein-lipid overlay assay as described by the manufacturer. Blocking was performed by

28 immersing the membrane in TBS (20 mM Tris-HCl, 150 mM NaCl) + 3% fatty acid-free

BSA (Sigma, A7030) at room temperature (RT) for 1 h with shaking. The membrane was then incubated with 50 nM purified proteins at 4°C overnight with shaking. After the removal of the protein, the membrane was washed 5 times using TBST (20 mM Tris-

HCl, 150 mM NaCl, 0.1% Tween-20), and immunoblottings were performed using anti-

His antibody (Clontech, #631212, 1:10,000 dilution) in TBS + 3% fatty acid-free BSA.

3.4 Results

3.4.1 Domain analyses reveal important Mid1 domains for division-site specification

Mid1 contains multiple domains/motifs (Figure 3.1 A). We investigated functions of different domains in Mid1 with high resolution by constructing a series of strains expressing truncated mid1 at the native mid1 locus and under the control of mid1 promoter (Figure 3.1 B, left). The expressions of these constructs were verified and quantified by western blotting and localized fluorescent signals (Table 3.1; Figure 3.2).

To assess whether these truncations are sufficient for division-site specification, we quantified the percentage of centered (Figure 3.1 B, middle) and orthogonal septa (Figure

3.1 B, right) in septating cells (Table 3.1).

Consistent with previous reports (Sohrmann et al., 1996; Paoletti and Chang,

2000), <20% septa were centered in mid1Δ while all were centered and orthogonal in wild type (wt) cells (Figure 3.1, B and C). Truncating the conserved PH domain [mid1(1-

800)] did not affect the septum position (Paoletti and Chang, 2000), but we did find

~10% septating cells with tilted septa (P = 0.02 compared to wt; Figure 3.1, B and C). No obvious defects in septum positioning were observed in mid1(1-580), although the 29 percentage of tilted septa increased to 30% (Figure 3.1, B and C). However, further truncations significantly compromised Mid1 function in cytokinesis, as 60-80% septa formed in mid1(1-420), mid1(1-200), and mid1(1-100) cells were misplaced and/or tilted

(Figure 3.1, B and C; Table 3.1).

By contrast, all N-terminal truncations we generated except Mid1(41-920) displayed severe defects in septum positioning and angle (Figure 3.1, B and D; Table

3.1). Cells with centered and orthogonal septa decreased to 40–50% when aa(1-100) was truncated. Thus, aa(41-100) plays an important role in division-site specification.

mid1(581-920) had similar phenotypes as mid1(101-920) cells (P = 0.48 and 0.70 for septum position and angle, respectively; Figure 3.1, B and D; Table 3.1). Because the severe defects observed in mid1(101-920) might mask the functions of other domains in the N-terminal half, we truncated the internal region aa(101-400) to reveal its role.

Neither cell morphology nor septum position of mid1[(1-100)-(401-920)] was distinguishable from wt (Figure 3.1, B and E), suggesting that aa(101-400) is not essential for division-site selection. Even when the internal truncation was combined with

C-terminal truncations, most septa were centered (Figure 3.1, B and E), although the percentage cells with off-centered or tilted septa were higher than the corresponding C- terminal truncations alone (Table 3.1).

Collectively, our results confirm that the N-terminal half of Mid1 is sufficient for division-site specification (Paoletti and Chang, 2000; Celton-Morizur et al., 2004). We find that aa(1-100), especially aa(41-100), are essential for Mid1 functions. Although the

PH domain and the internal region aa(101-400) do not appear to be essential for

30 cytokinesis, it is possible that their functions are masked by redundant pathways. The behavior of truncated Mid1 constructs and how these truncations affect contractile-ring assembly are further analyzed below.

3.4.2 The PH domain and the internal region aa(101-400) regulate Mid1 localization and dynamics

We tagged full length (FL) Mid1 and the truncations at their C-termini with monomeric YFP (mYFP) or monomeric enhanced Citrine (mECitrine; a more photo- and thermal-stable variant of mYFP; (Griesbeck et al., 2001) at the mid1 locus and under the control of mid1 promoter (Table 3.1). These truncations were expressed at a level comparable to the endogenous Mid1(FL) (Figure 3.1 C and 3.2 A; Table 3.1). Mid1(1-

800), Mid1[(1-100)-(401-920)], and Mid1[(1-100)-(401-800)] all localized to the nucleus, cortical nodes, and the contractile ring (Figure 3.3 A). However, their fluorescence intensities at each location were not identical to FL Mid1. To directly compare the global and local protein levels, cells expressing each mECitrine-tagged Mid1 truncation were compared with cells expressing mid1-mECitrine sad1-mCFP in the same image (Figure 3.3, B and C). While the total and nuclear fluorescence intensities were not affected, Mid1(1-800) intensity in nodes was 20% lower than FL Mid1. In contrast, in mid1[(1-100)-(401-920)] the nuclear intensity doubled, and the signal in nodes was 37% higher than FL Mid1, but the cytoplasmic intensity decreased (Figure 3.4 A), resulting in only 28% increase of the total cellular fluorescence intensity. Mid1[(1-100)-(401-800)] retained the strong nuclear signal as Mid1[(1-100)-(401-920)], but had a 14% decreased

31 cortical node signal similar to Mid1(1-800), indicating that the increase of cortical signal in mid1[(1-100)-(401-920)] depends on the PH domain.

The changed intensities in cortical nodes suggest that the PH domain and the internal region aa(101-400) regulate Mid1 localization. We used Fluorescence Recovery

After Photobleaching (FRAP) assays to investigate Mid1 dynamics (Figure 3.3 D). While the recovery halftime in interphase nodes for FL Mid1 was 3.0 ± 1.3 min (Figure 3.3 E, gray) (Laporte et al., 2011), Mid1(1-800) was more dynamic (τ1/2 = 1.6 ± 0.6 min; Figure

3.3 E, left), suggesting that the PH domain stabilizes Mid1 in nodes. Mid1(1-800) was also more dynamic in cytokinesis nodes (Figure 3.4 B). In contrast, the recovery curve of

Mid1[(1-100)-(401-920)] was superimposable to FL Mid1, although the recovery halftime was slightly different (τ1/2 = 3.8 ± 1.4 min; Figure 3.3 E, middle). Mid1[(1-100)-

(401-800)] has a halftime of 1.7 ± 1.1 min (Figure 3.3 E, right), similar to that of Mid1(1-

800) (Figure 3.3 F). Together, these data suggest that the PH domain stabilizes cortical

Mid1.

Nodes are precursors of the contractile ring (Bähler et al., 1998a; Wu et al., 2003,

2006; Coffman et al., 2009). We investigated whether the changes in cortical abundance and node dynamics affect contractile-ring assembly. However, in cells expressing mid1(1-800), mid1[(1-100)-(401-920)], or mid1[(1-100)-(401-800)], cytokinesis nodes condensed into a compact ring with normal kinetics (Figure 3.3, G and H). We conclude that neither the PH domain nor the internal region of Mid1 is essential for contractile-ring assembly from cytokinesis nodes under normal growth conditions.

3.4.3 Cdr2-independent cortical localization of Mid1 is coordinated by the PH domain and the internal region

Because Cdr2 kinase is the major organizer of interphase nodes and it interacts with Mid1, we investigated whether the increase in cortical signals of Mid1[(1-100)-

(401-920)] depends on Cdr2. Like the FL protein, Mid1[(1-100)-(401-920)] co- immunoprecipitated with Cdr2 (Figure 3.5 A). However, the weaker band detected did not suggest a stronger interaction. In addition, the level of Cdr2 tagged with monomeric enhanced GFP (mEGFP) in interphase nodes was not obviously altered in mid1[(1-100)-

(401-920)] (Figure 3.5 B). Thus, we hypothesized that the increase in cortical signals is independent of Cdr2.

To test this hypothesis, we examined the localizations of FL Mid1, Mid1(1-800),

Mid1[(1-100)-(401-920)], and Mid1[(1-100)-(401-800)] in cdr2∆ cells (Figure 3.6, A and

B). Most septa were centered and orthogonal in these double mutants (Figure 3.7 A).

Only 28% cdr2∆ cells expressing FL mid1 had a few node-like structures during interphase, consistent with previous studies (Almonacid et al., 2009; Moseley et al.,

2009). To our surprise, Mid1[(1-100)-(401-920)] was found in a broad band on the cortex in 75% interphase cdr2∆ cells. Like the FL protein in cdr2+ cells (Daga and Chang, 2005;

Celton-Morizur et al., 2006; Almonacid et al., 2009), the cortical distribution of Mid1[(1-

100)-(401-920)] in cdr2∆ followed the misplaced nucleus when MBC-treated cells were centrifuged (Figure 3.6 C).

Interestingly, the cortical localizations of Mid1 and Mid1[(1-100)-(401-920)] in cdr2∆ during interphase were abolished when the PH domain was deleted (Figure 3.6, A

33 and B), suggesting that the PH domain does play a role in Mid1 localization to the plasma membrane.

3.4.4 The PH domain of Mid1 directly interacts with lipids

While a previous study concludes that the PH domain is not required for Mid1 localization and function (Paoletti and Chang, 2000), our results indicates that the PH domain regulates Mid1 localization. The PH domain alone was not sufficient for cortical localization (Table 3.1). A polybasic region aa(681-710) in Mid1 C-terminus (containing an amphipathic helix and an NLS) anchors Mid1 to the cortex (Celton-Morizur et al.,

2004). More mid1(1-800, Helix*) cells exhibited division-site specification defects than mid1(Helix*) (Figure 3.7, B and C), suggesting that the amphipathic helix and PH domain of Mid1 have overlapping functions in Mid1 cortical binding.

Many PH domains bind to lipids directly. We purified bacteria-expressed 6His-

Mid1(PH) (Figure 3.6 D) and tested its binding with lipids spotted on the nitrocellulose membrane. Compared to the positive 6His-Ksg1(PH) (Mitra et al., 2004) and negative

6His-mEGFP controls, we found that 6His-Mid1(PH) interacts with several lipids (Figure

3.6 E). Taken together, our results indicate that Mid1 PH domain plays a role in anchoring Mid1 to the plasma membrane.

3.4.5 Mid1[(1-100)-(401-920)] suppresses cytokinesis defects of pom1∆ cells

When the DYRK kinase pom1 is deleted, Mid1 cortical localization uncouples from the nuclear location, as Mid1 binds to Cdr2 that shifts toward the non-growing tip

(Celton-Morizur et al., 2006; Martin and Berthelot-Grosjean, 2009; Moseley et al., 2009).

In addition, Mid1 localizes to the nucleus less efficiently and misplaced septa are

34 observed at high frequency (Bähler and Pringle, 1998; Celton-Morizur et al., 2006).

Interestingly, the internal truncation mid1[(1-100)-(401-920)] alleviated the pom1∆ defects in division-site specification (Figure 3.8, A-C). When grown on YE5S +

Phloxin B (which accumulates in dead cells) plate, mid1[(1-100)-(401-920)] pom1∆ cells exhibited a lighter color compared to pom1∆ cells expressing FL mid1 (Figure 3.8 A).

Consistently, ~90% centered septa was found in the former compared to ~50% in pom1∆

(P = 6.5 × 10-5), indicating that the defects in septum positioning were suppressed when the internal region aa(101-400) of Mid1 was deleted (Figure 3.8, B and C).

Next we explored molecular mechanisms of the suppression (Figure 3.8 and 3.9).

A strain expressing two copies of FL mid1 both under the mid1 promoter did not suppress pom1∆ (P = 0.19; Figure 3.8, A and C), therefore the suppression was not due to the increase in global Mid1[(1-100)-(401-920)] protein level (Figure 3.3 C and Table 3.1).

Increased Mid1[(1-100)-(401-920)] in nucleus may make nuclear export to the equator dominant over Cdr2-dependent Mid1 mislocalization. This hypothesis was tested using mid1[(1-100)-(401-800)], a mutant with stronger nuclear but not cortical localization during interphase (Figure 3.3 C). Indeed, we observed ~20% less cells with off-centered septa in mid1[(1-100)-(401-800)] pom1∆ than in pom1∆ (P = 8.4 × 10-4; Figure 3.8, A and C), thus the increased nuclear concentration is partially responsible for the suppression in mid1[(1-100)-(401-920)] pom1∆. In addition, Mid1[(1-100)-(401-920)] could bypass the mislocalized Cdr2 in pom1∆ cells via a weaker interaction with Cdr2.

Indeed, although some cdr2∆ pom1∆ cells have morphological defects (data not shown), the rod-shaped cells exhibited milder defects in division-site specification (P = 0.015).

Furthermore, Gef2 is a putative Rho GEF that interacts with Mid1(300-350) ((Ye et al.,

2012) and also shifts toward one cell end in pom1∆ (Figure 3.8 D). Consistently, septum positioning defects in pom1∆ were partially suppressed by gef2∆ (P = 0.002) or mid1(∆300-350) (P = 0.002), and rod-shaped gef2∆ cdr2∆ pom1∆ resembled mid1[(1-

100)-(401-920)] pom1∆ in septum positioning (Figure 3.8 C). Together, we propose that several factors lead to the observed suppression (see 3.5 Discussion) and our results underlined the complexity of the regulation of division-site specification.

Consistent with the suppression, Mid1[(1-100)-(401-920)] spread along the cell side on the cortex in pom1∆ cells instead of localizing to the non-growing half like FL

Mid1 (Figure 3.8, E and F). The band of nodes was broader than that in pom1+ cells

(Figure 3.8 F). This cortical Mid1 was capable of mediating contractile-ring assembly at or near the cell equator (Figure 3.8, E and G).

3.4.6 Major physical interactions with node proteins reside in Mid1(1-580)

The morphology of mid1(1-580) is very similar to that of wt cells (Figure 3.1 C).

Mid1(1-580)-mECitrine localized to the nucleus, cortical nodes, and the contractile ring even during its constriction (Figure 3.10 A). In mid1(1-580), both Mid1(1-580)- mECitrine and Rlc1-tandem Tomato (tdTomato) appeared in fewer nodes (and/or with lower intensity) and condensed into a contractile ring much slower (Figure 3.11, A-D).

Although contractile-ring assembly was slower in mid1(1-580), the ring still initiated from cytokinesis nodes. Thus, we hypothesized that the major interactions required for assembling cytokinesis nodes reside in Mid1(1-580). Mid1 physically interacts with four cytokinesis node proteins: myosin-II essential light chain Cdc4,

IQGAP Rng2, myosin-II heavy chain Myo2, and F-BAR protein Cdc15 (Motegi et al.,

2004; Laporte et al., 2011; Padmanabhan et al., 2011). We therefore tested whether

Mid1(1-580)-Myc interacts with these proteins. Mid1(1-580)-Myc was detected in co- immunoprecipitation (IP) with mYFP-Rng2, mYFP-Cdc4 and mYFP-Cdc15 (Figure

3.11, E and F), suggesting that they interact in vivo. Consistent with its localization to interphase nodes, Mid1(1-580) also co-immunoprecipitated with Cdr2-mEGFP (Figure

3.11, A and F).

Mid1 phosphorylation is cell-cycle regulated and a hyperphosphorylated form is detected during cytokinesis (Sohrmann et al., 1996; Bähler et al., 1998a; Almonacid et al., 2011). When beads after co-IP were treated with λ phosphatase, FL Mid1 underwent a mobility shift on SDS-PAGE, indicating that the hyperphosphorylated Mid1 interacts with cytokinesis node proteins Cdc4, Rng2, Cdc15, and Myo2 (Figure 3.11 G). The slow- migrating forms of Mid1(1-580) co-immunoprecipitated with Rng2 (Figure 3.11 E), suggesting Mid1(1-580) can still be phosphorylated.

3.4.7 Nodes and contractile-ring assembly are rescued by fusing Mid1 N-terminal domains to Cdr2 kinase

Because Mid1(1-580) co-immunoprecipitated with cytokinesis node proteins

(Figure 3.11, E and F) and Mid1(1-100) but not the internal region aa(101-400) is critical for division-site specification (Figure 3.1, 3.3, and 3.10, B-D) (Almonacid et al., 2011), we hypothesized that Mid1[(1-100)-(401-580)] or even Mid1(1-100) is sufficient for cytokinesis-node assembly. However, this hypothesis was difficult to test because neither

Mid1(1-100) nor Mid1[(1-100)-(401-580)] localized to nodes, and the contractile ring

37 assembled from linear structures at random locations in these cells (Figure 3.12, A and

B). Thus, we tested our hypothesis in the presence of a localization signal by fusing Cdr2 to the C-terminus of Mid1[(1-100)-(401-580)] or Mid1(1-100) (Figure 3.12 C). As expected, the fusion proteins localized to cortical nodes (Figure 3.12, F and G).

To validate that the excess Cdr2 could not restore cytokinesis-node assembly, we constructed a strain expressing cdr2 at the mid1 locus under the control of mid1 promoter besides the native cdr2, while the mid1 ORF was deleted (mid1∆::Pmid1-cdr2). In this strain, no Rlc1 nodes were detected (Figure 3.12 D) and the phenotype was similar to mid1∆ (Figure 3.12 E). By contrast, when Cdr2 was fused to Mid1[(1-100)-(401-580)],

99% of septa were centered and 90% orthogonal (Figure 3.12 E). Furthermore, while mid1(1-100) cells exhibited only 21% centered and 33% orthogonal septa (Figure 3.1 B and 3.12 B; Table 3.1), Mid1(1-100)-Cdr2 rescued the defects (100% centered and 90% orthogonal septa, Figure 3.12 E).

To test whether Mid1[(1-100)-(401-580)]-Cdr2 and Mid1(1-100)-Cdr2 are functionally equivalent to FL Mid1 in cytokinesis-node and contractile-ring assembly, localizations of Rlc1 and Cdc15, proteins representing two modules in cytokinesis-node assembly (Laporte et al., 2011), were investigated. Both Mid1[(1-100)-(401-580)]-Cdr2 and Mid1(1-100)-Cdr2 co-localized with Rlc1 in cortical nodes and the contractile ring before the departure of Mid1[(1-100)-(401-580)]-Cdr2 from the contractile ring (Figure

3.12 F). All the contractile rings were assembled from nodes in these strains (Figure 3.12

H, n = 9 and 15 cells, respectively). The kinetics of contractile-ring assembly (31.8 ± 5.3 and 35.9 ± 6.8 min from Rlc1 node appearance to a compact ring, respectively) was

38 significantly faster than that of mid1∆::Pmid1-cdr2, mid1[(1-100)-(401-580)], and mid1(1-100) cells (Figure 3.12 H; P < 0.05 for each pairwise comparison) although still slower than in FL Mid1 cells (Figure 3.3 H). Interestingly, while Cdc15 co-localized with

Mid1[(1-100)-(401-580)]-Cdr2 in a band of nodes and the contractile ring, it only appeared at the division as a contractile ring in mid1(1-100)-cdr2 (Figure 3.12 G).

Latrunculin-A treatment confirmed the difference in Cdc15 recruitment, as Cdc15 was detected in a broad band of nodes in mid1[(1-100)-(401-580)]-cdr2 cells but absent from nodes in mid1(1-100)-cdr2 cells (Figure 3.12 I).

Collectively, our results suggest that both Mid1[(1-100)-(401-580)] and Mid1(1-

100) are sufficient for contractile-ring assembly by recruiting downstream proteins when they are localized to cortical nodes.

3.5 Discussion

In this chapter, we discovered that the PH domain and the internal region aa(101-

400) regulate the localization of Mid1 on the plasma membrane. In addition, Mid1(1-580) interacts with cytokinesis node proteins and Mid1 (1-100) is sufficient for directing the assembly of a well-positioned contractile ring when localized properly. The findings are summarized in Figure 3.12 J.

3.5.1 The role of the PH domain in different anillins

The PH domain is the most conserved domain of different anillins (D'Avino,

2009; Piekny and Maddox, 2010). It is necessary but not sufficient for localizing human anillin to the cleavage furrow (Oegema et al., 2000; Piekny and Glotzer, 2008). In

Drosophila, it is dispensable for anillin’s furrow localization (D'Avino et al., 2008), but 39 required for recruiting septins (Field et al., 2005). In S. pombe, while it is required for the localization and function of anillin-related Mid2 (Berlin et al., 2003; Tasto et al., 2003), we confirm that the PH domain is not essential for Mid1 localization (Paoletti and Chang,

2000). However, decreased cortical Mid1 localization in mid1(1-800) (Table 3.1; Figure

3.3 C and 3.6 A) and the fast recovery in FRAP analyses suggest that the PH domain stabilizes Mid1 on the cortex (Figure 3.3, E and F).

Although best known for its interaction with phosphoinositides, many PH domains are not sufficient for cortical targeting and showed promiscuous interaction with phosphoinositides (Kavran et al., 1998; Yu et al., 2004). For Mid1 PH domain, the weak interactions in protein-lipid overlay assay are consistent with the lack of cortical localization of Mid1(801-920) (Table 3.1). Mid1 is known to oligomerize (Celton-

Morizur et al., 2004), which may enhance the affinity between the PH domain and the plasma membrane.

3.5.2 The internal region and the regulation of Mid1 localization

Although the biochemical properties of the internal region aa(101-400) of Mid1 are not clear, our data show that it regulates Mid1 localization. Deleting aa(101-400) enhances Mid1 nuclear and cortical localization, and the latter is more obvious in cdr2∆ cells (Figure 3.3 and 3.6). Moreover, in pom1∆ cells, Mid1[(1-100)-(401-920)] localizes to a broad, centered cortical zone and suppresses the cytokinesis defects of pom1∆ by assembling a contractile ring at the cell equator (Figure 3.8). Both increased Mid1 concentration in nucleus and the weaker interactions with Cdr2 or Gef2 could contribute to the suppression of pom1∆ phenotypes (Figure 3.8). The weaker interaction between

Mid1[(1-100)-(401-920)] and Cdr2 (Figure 3.5 A) suggests that either the structure of aa(400-450), the indicated binding site to Cdr2 (Almonacid et al., 2009), is affected in mid1[(1-100)-(401-920)], or the internal region is also involved in the Mid1-Cdr2 interaction. The synthetic defects in septum position in pom1∆ mid1(∆400-450) cells

(Figure 3.8 C and 3.9) might result from the loss of phosphatase Clp1 binding site in

Mid1(∆400-450) (Clifford et al., 2008). Although two PEST domains (Sohrmann et al.,

1996) in the internal region aa(101-400) might mediate proteolysis, the protein level of

Mid1[(1-100)-(401-920)] only increases slightly (Figure 3.3 C; Table 3.1), thus their missing is not likely the main cause of the changes in Mid1[(1-100)-(401-920)] localization.

Because Mid1(FL) only localizes to the non-growing end of pom1∆ cells, it has been speculated from modeling that there is another inhibitor of Mid1 at the growing end

(Celton-Morizur et al., 2006; Padte et al., 2006). However, the existence of such inhibitor has not been confirmed yet. Mid1[(1-100)-(401-920)] can form a centered broad band of nodes spreading toward both ends of pom1∆ cells (Figure 3.8 F), suggesting the inhibition of Mid1 localization at the growing end can also be overcome by the mechanisms discussed above.

3.5.3 Overlapping mechanisms regulating the cortical localization of Mid1

Given that Mid1 is essential for division-site specification, it is not surprising that its localization is regulated by several overlapping mechanisms. Nuclear shuttling regulates the balance between nuclear and cytoplasmic Mid1 (Paoletti and Chang, 2000;

Almonacid et al., 2009, 2011). The cortical ER network limits the lateral diffusion of

Mid1 on the plasma membrane (Zhang et al., 2010). Pom1 kinase inhibits Mid1 from localizing to the non-growing cell end through inhibiting Cdr2 (Celton-Morizur et al.,

2006; Padte et al., 2006; Almonacid et al., 2009; Martin and Berthelot-Grosjean, 2009;

Moseley et al., 2009). With the findings in this chapter, we now have a more thorough understanding of Mid1 localization.

Cdr2 kinase is critical for Mid1 localization to interphase nodes, but it was unknown why deleting cdr2 only partially affected cortical Mid1 localization in interphase (Almonacid et al., 2009; Moseley et al., 2009). Our findings suggest that the

Cdr2-independent cortical targeting of Mid1 in interphase depends on the PH domain

(Figure 3.6). Moreover, the PH domain also affects the localization and dynamics of

Mid1 in the presence of Cdr2 (Figure 3.3) and has overlapping function with the polybasic region aa(681-710) that anchors Mid1 to the cortex (Figure 3.7, B and C). A similar cooperation between a polybasic region and the PH domain was reported in

ARNO, a GEF of ADP-ribosylation factor (Macia et al., 2000).

The Polo kinase Plo1 targets Mid1 to cortical nodes at the G2/M transition

(Bähler et al., 1998a; Almonacid et al., 2011). The regulation by Plo1 in mitosis is independent of the PH and the internal region aa(101-400) of Mid1 (Figure 3.3, G and

H). This is consistent with the recent identifications of the Plo1 binding site (T517) and phosphorylation sites in Mid1 (Almonacid et al., 2011), as these sites are still present in

Mid1[(1-100)-(401-800)].

Together, the balance of these positive and negative regulations on Mid1 ensures the fidelity of division-site selection and contractile-ring assembly in fission yeast cytokinesis.

3.5.4 Physical interactions between Mid1 and other cytokinesis proteins

Besides Cdr2 kinase, Polo kinase Plo1, and phosphatase Clp1, Mid1 is known to physically interact with four cytokinesis node proteins: Rng2, Cdc4, Myo2, and Cdc15

(Motegi et al., 2004; Almonacid et al., 2011; Laporte et al., 2011; Padmanabhan et al.,

2011). We find that Mid1(1-580) physically interacts with Rng2, Cdc4, and Cdc15 and assembles cytokinesis nodes (Figure 3.11). Moreover, when Mid1[(1-100)-(401-580)], a truncation that cannot localize to cortical nodes, is fused to Cdr2, cytokinesis-node and contractile-ring assembly are restored (Figure 3.12). Two modules for cytokinesis-node assembly have been identified in S. pombe (Laporte et al., 2011). Mid1[(1-100)-(401-

580)]-Cdr2 can recruit Rlc1, the most downstream protein in the module I, suggesting

Rng2, Cdc4, and Myo2 are also present; and F-BAR protein Cdc15, the core protein in the module II, providing strong evidence that the interactions mediated by Mid1[(1-100)-

(401-580)] are sufficient to scaffold cytokinesis-node and contractile-ring assembly.

Consistently, Almonacid et al. (2011) recently found that Mid1(1-100) interacts with

Rng2 C-terminus in vitro at high protein concentrations.

Rlc1 co-localizes with Mid1(1-100) at cytokinesis nodes and the contractile ring

(Figure 3.12 F). However, the co-localization between Mid1(1-100) and Cdc15 was mainly detected in the contractile ring but not in cytokinesis nodes (Figure 3.12 G), suggesting a delay in Cdc15 recruitment. The lack of dephosphorylation of Cdc15 by

Clp1 is a possible explanation for the difference since the fusion protein does not have aa(431-481), the Clp1 binding site (Clifford et al., 2008). Indeed, we found that mid1(1-

100)-cdr2 exhibited negative genetic interactions with cdc15-140 and cdc12-112, temperature sensitive mutants that are synthetic with mid1∆(431-481) (Clifford et al.,

2008). However, it remains possible that Mid1(401-580) contributes to the recruitment by physically interacting with Cdc15.

Our co-IP showed that the hyperphosphorylated Mid1 interacts with cytokinesis node proteins, supporting the role of phosphorylation in Mid1’s scaffolding property, as eight Plo1 phosphorylation sites are identified in Mid1 (Almonacid et al., 2011). Whether phosphorylation of Mid1-related anillins in other systems is required for interacting with and recruiting cytokinesis proteins remains unknown.

Taken together, by domain analyses, we demonstrate how different Mid1 domains cooperate to ensure correct positioning of the division site and the timely assembly of the contractile ring. Similar to anillins (see 3.2 Introduction), the N-terminus of Mid1 mainly mediates its scaffolding functions besides its role in Mid1 recruitment, and the C- terminus regulates its localization to the plasma membrane. Thus, the roles of anillins and the anillin-related protein Mid1 in cytokinesis are highly conserved during evolution.

3.6 Acknowledgements

We thank Jürg Bähler, Dannel McCollum, James Moseley, Paul Nurse, Anne Paoletti,

Thomas Pollard, and John Pringle for strains; Anita Hopper, James Hopper, and Stephen

Osmani laboratories for sharing equipment; Yanfang Ye for constructing the mECitrine vector for gene targeting and mECitrine-Gef2 strain. We thank Valerie Coffman, Damien 44

Laporte, and Yanfang Ye for critical reading of the manuscript and members of the Wu laboratory for insightful and helpful suggestions.

Table 3.1. Summary of phenotypes and localizations of Mid1 truncations. % Normal septum in Localizationd Protein septating cells Genotype Strain a level Septum Septum Interphase Cytokinesis Nucleus Ring position b anglec nodes nodes FL (C- JW1790 1.0 100 ± 0 99 ± 1 + + + + tag)e 1-800e JW2601 1.0 ± 0.3 100 ± 1 92 ± 3 + + + + 1-680f JW1299 1.7 ± 0.5 98 ± 2 82 ± 1 - + + + 1-580e JW2603 3.5 ± 1.2 94 ± 2 69 ± 1 + + + +h 1-420f JW1301 7.6 ± 2.0 36 ± 5 43 ± 9 - - - + 1-200f JW1302 2.2 ± 0.5 28 ± 5 35 ± 9 - - - - 1-100f JW1303 3.9 ± 1.4 21 ± 2 33 ± 9 - - - - FL (N- JW1513 1.0 100 ± 0 97 ± 2 + + + + tag)f 41-920f JW1537 1.6 ± 0.1 100 ± 1 88 ± 10 + + + + (1-40)- JW2390 1.8 ± 0.5 55 ± 14 43 ± 7 + - - - (101-920)e JW1514 101-920f 2.6 ± 1.1 49 ± 9 48 ± 7 + - - - -2 581-920f JW1640 0.3 ± 0.2 54 ± 5 51 ± 10 - ndi ndi ndi 681-920f JW1610 (+)g 24 ± 13 39 ± 5 + - - - 801-920f JW1611 1.6 ± 0.3 19 ± 5 34 ± 12 - - - - (1-100)- JW2391 1.8 ± 0.7 100 ± 0 95 ± 2 + + + + (401-920)e (1-100)- JW2702 1.8 ± 0.6 100 ± 0 94 ± 5 + + + + (401-800)e (1-100)- JW2703 0.6 ± 0.3 77 ± 8 63 ± 4 - - - - (401-680)e (1-100)- JW2704 4.2 ± 1.4 85 ± 4 54 ± 11 + - - - (401-580)e mid1∆ JW1604 0 17 ± 3 36 ± 3 - - - - aProtein level: quantified by western blotting (Figure 3.2) and normalized to the level of FL Mid1. The mean and s.d. from 2 to 6 experiments are shown. bDefinition of normal septum position: single septum in the central 20% of the cell. cDefinition of normal septum angle: septum at 90 ± 10° to the long axis of the cell. dLocalization: +, localized; -, not localized; nd, not determined. Interphase and cytokinesis nodes: discrete protein clusters close to the equatorial cortex during interphase and the G2/M transition, respectively. eTagged with mECitrine. fTagged with mYFP. gThe expression of this truncation is confirmed by localized signal. hThis truncation localizes to both the full-size and the constricted ring. iThis truncation localizes all over the cell cortex. 46

Table 3.2. S. pombe strains used in this chapter. Strain Genotype Source JW81 h- ade6-M210 leu1-32 ura4-D18 Wu et al., 2003 JW909 h+ kanMX6-Prng2-mYFP-4gly-rng2 ade6-M210 leu1-32 ura4-D18 Wu et al., 2003 JW910-2 h+ kanMX6-Pcdc4-mYFP-4gly-cdc4 ade6-M210 leu1-32 ura4-D18 Wu et al., 2003 JW1052 h+ kanMX6-Pcdc15-mYFP-cdc15 ade6-M210 leu1-32 ura4-D18 This study JW1089 h- mid1-mYFP-kanMX6 ade6-M210 leu1-32 ura4-D18 Wu and Pollard, 2005 JW1299 h- mid1(1-680)-6His-mYFP-kanMX6 ade6-M210 leu1-32 ura4-D18 This study JW1301 h- mid1(1-420)-6His-mYFP-kanMX6 ade6-M210 leu1-32 ura4-D18 This study JW1302 h- mid1(1-200)-6His-mYFP-kanMX6 ade6-M210 leu1-32 ura4-D18 This study JW1303 h- mid1(1-100)-6His-mYFP-kanMX6 ade6-M210 leu1-32 ura4-D18 This study JW1398-4 h+ rlc1-tdTomato-natMX6 ade6-M210 leu1-32 ura4-D18 This study JW1513 h- kanMX6-Pmid1-mYFP-mid1 ade6-M210 leu1-32 ura4-D18 This study JW1514-2 h- kanMX6-Pmid1-mYFP-mid1(101-920) ade6-M210 leu1-32 ura4- This study D18 JW1537 h- kanMX6-Pmid1-mYFP-mid1(41-920) ade6-M210 leu1-32 ura4- This study D18 JW1554 rlc1-mCherry-natMX6 kanMX6-Pmid1-mYFP-mid1(41-920) ade6- This study M210 leu1-32 ura4-D18 JW1604 h- mid1-2::ura4+ ade6-M210 leu1-32 ura4-D18 This study JW1610 kanMX6-Pmid1-mYFP-mid1(681-920) ade6 leu1-32 ura4-D18 This study JW1611 kanMX6-Pmid1-mYFP-mid1(801-920) ade6 leu1-32 ura4-D18 This study JW1640 h- kanMX6-Pmid1-mYFP-mid1(581-920) ade6-M210 leu1-32 ura4- This study D18 JW1738 h+ rlc1-tdTomato-natMX6 mid1(1-100)-6His-mYFP-kanMX6 ade6- This study M210 leu1-32 ura4-D18 JW1779 rlc1-tdTomato-natMX6 mid1(1-800)-6His-mYFP-kanMX6 sad1- This study mEGFP-kanMX6 ade6-M210 leu1-32 ura4-D18 JW1790 h- mid1-mECitrine-kanMX6 ade6-M210 leu1-32 ura4-D18 Laporte et al., 2011 JW1834 mid1-mECitrine-kanMX6 sad1-mCFP-kanMX6 ade6-M210 leu1-32 Laporte et al., 2011 ura4-D18 JW2160 cdr2::kanMX6 mid1-mECitrine-kanMX6 ade6 leu1-32 ura4-D18 This study JW2178 h+ rlc1-tdTomato-natMX6 sad1-mEGFP-kanMX6 ade6-M210 ura4- This study D18 leu1-32 JW2226 kanMX6-Pcdc4-mYFP-4gly-cdc4 mid1-6His-13Myc-natMX6 leu1-32 Laporte et al., 2011 SM902 JW2227 h+ kanMX6-Pmyo2-mYFP-myo2 mid1-6His-13Myc-natMX6 ade6- Laporte et al., 2011 M210 leu1-32 ura4-D18 SM902 JW2231 kanMX6-Prng2-mYFP-4gly-rng2 mid1-6His-13Myc-natMX6 leu1-32 Laporte et al., 2011 SM902 JW2233 kanMX6-Pcdc15-mYFP-cdc15 mid1-6His-13Myc-natMX6 leu1-32 Laporte et al., 2011 ura4-D18 SM902 JW2345 h- mid1(1-580)-6His-13Myc-hphMX6 leu1-32 SM902 This study JW2349 h- mid1-2::ura4+-mECitrine-kanMX6 ade6-M210 leu1-32 ura4-D18 This study JW2390 h- mid1[(1-40)-(101-920)]-mECitrine-kanMX6 ade6-M210 leu1-32 This study ura4-D18 JW2391 h- mid1[(1-100)-(401-920)]-mECitrine-kanMX6 ade6-M210 leu1-32 This study ura4-D18 JW2425 pom1-1::ura4+ mid1-mECitrine-kanMX6 ade6 leu1-32 ura4-D18 This study

Continued 47

Table 3.2: Continued JW2426 h- pom1-1::ura4+ mid1[(1-100)-(401-920)]-mECitrine-kanMX6 This study ade6 leu1-32 ura4-D18 JW2433 mid1-mECitrine-kanMX6 rlc1-tdTomato-natMX6 ade6-M210 leu1-32 This study ura4-D18 JW2434 mid1[(1-40)-(101-920)]-mECitrine-kanMX6 rlc1-tdTomato-natMX6 This study ade6-M210 leu1-32 ura4-D18 JW2435 mid1[(1-100)-(401-920)]-mECitrine-kanMX6 rlc1-tdTomato-natMX6 This study ade6-M210 leu1-32 ura4-D18 JW2548 kanMX6-Prng2-mYFP-4gly-rng2 mid1(1-580)-6His-13Myc-hphMX6 This study leu1-32 SM902 JW2549 kanMX6-Pcdc15-mYFP-cdc15 mid1(1-580)-6His-13Myc-hphMX6 This study leu1-32 SM902 JW2551 cdr2-mEGFP-kanMX6 mid1(1-580)-6His-13Myc-hphMX6 leu1-32 This study SM902 JW2555 rlc1-tdTomato-natMX6 pom1-1::ura4+ mid1-mECitrine-kanMX6 This study ade6 leu1-32 ura4-D18 JW2596 rlc1-tdTomato-natMX6 pom1-1::ura4+ mid1[(1-100)-(401-920)]- This study mECitrine-kanMX6 ade6 leu1-32 ura4-D18 JW2601 h- mid1(1-800)-6His-mECitrine-kanMX6 ade6-M210 leu1-32 ura4- This study D18 JW2603 h- mid1(1-580)-6His-mECitrine-kanMX6 ade6-M210 leu1-32 ura4- This study D18 JW2625 mid1(1-580)-6His-13Myc-hphMX6 kanMX6-Pcdc4-mYFP-4gly-cdc4 This study leu1-32 SM902 JW2663 pom1-1::ura4+ mid1-mECitrine-kanMX6 ade6 ura4-D18 + pAP146 This study Pmid1-mid1-GFP integrated at leu1+ JW2672 cdr2::kanMX6 mid1[(1-100)-(401-920)]-mECitrine-kanMX6 ade6 This study leu1-32 ura4-D18 JW2673 pom1-1::ura4+ cdr2::kanMX6 ade6 leu1-32 ura4-D18 This study JW2701 h- mid1[(1-100)-(401-920)]-6His-13Myc-hphMX6 ade6-M210 leu1- This study 32 ura4-D18 JW2702 h- mid1[(1-100)-(401-800)]-6His-mECitrine-kanMX6 ade6-M210 This study leu1-32 ura4-D18 JW2703 h- mid1[(1-100)-(401-680)]-6His-mECitrine-kanMX6 ade6-M210 This study leu1-32 ura4-D18 JW2704 h- mid1[(1-100)-(401-580)]-6His-mECitrine-kanMX6 ade6-M210 This study leu1-32 ura4-D18 JW2727 h- mid1[(1-100)-(401-920)]-6His-13Myc-hphMX6 cdr2-mEGFP- This study kanMX6 ade6 leu1-32 ura4-D18 JW2732 h- mid1[(1-100)-(401-800)]-6His-mECitrine-kanMX6 pom1- This study 1::ura4+ ade6 leu1-32 ura4-D18 JW3034 cdr2::kanMX6 mid1[(1-100)-(401-800)]-6His-mECitrine-kanMX6 This study ade6 leu1-32 ura4-D18 JW3097 cdr2::kanMX6 mid1(1-800)-6His-mECitrine-kanMX6 ade6 leu1-32 This study ura4-D18 JW3147 pom1-1::ura4+ mid1(1-800)-6His-mECitrine-kanMX6 ade6 leu1-32 This study ura4-D18 JW3173 mid1[(1-100)-(401-800)]-6His-mECitrine-kanMX6 rlc1-tdTomato- This study natMX6 ade6-M210 leu1-32 ura4-D18 Continued

Table 3.2: Continued JW3175 mid1[(1-100)-(401-580)]-6His-mECitrine-kanMX6 rlc1-tdTomato- This study natMX6 ade6-M210 leu1-32 ura4-D18 JW3206 h- mid1-13Myc-hphMX6 ade6-M210 leu1-32 ura4-D18 This study JW3267 h+ mid1-13Myc-hphMX6 cdr2-mEGFP-kanMX6 ade6 leu1-32 ura4- This study D18 JW3337 mid1(1-580)-6His-mECitrine-kanMX6 rlc1-tdTomato-natMX6 sad1- This study mEGFP-kanMX6 ade6-M210 ura4-D18 leu1-32 JW3338 mid1(1-580)-6His-mECitrine-kanMX6 rlc1-tdTomato-natMX6 ade6- This study M210 ura4-D18 leu1-32 JW3449 h- mid1::Pmid1-cdr2-mEGFP-kanMX6 ade6-M210 leu1-32 ura4- This study D18 JW3471 mid1::Pmid1-cdr2-mEGFP-kanMX6 rlc1-tdtomato-natMX6 sad1- This study mEGFP-kanMX6 ade6-M210 ura4-D18 leu1-32 JW3506 h- mid1[(1-100)-(401-580)]-RIPGLINVD-cdr2-mEGFP-kanMX6 This study ade6-M210 leu1-32 ura4-D18 JW3525 mid1[(1-100)-(401-580)]-RIPGLINVD-cdr2-mEGFP-kanMX6 rlc1- This study tdTomato-natMX6 ade6-M210 ura4-D18 leu1-32 JW3603 cdc15-tdTomato-natMX6 sad1-mCFP-kanMX6 mid1[(1-100)-(401- This study 580)]-RIPGLINVD-cdr2-mEGFP-kanMX6 ade6-M210 leu1-32 ura4- D18 JW3700 h- pom1-1::ura4+ mid1::kanMX4 ade6-M216 leu1-32 ura4-D18 + This study pMA21 [pJK148-Pmid1-mid1(400-450)-4GFP-stopnmt] integrated at leu1+ JW3701 h- pom1-1::ura4+ mid1::kanMX4 ade6-M216 leu1-32 ura4-D18 + This study pMA23 [pJK148-Pmid1-mid1(300-350)-4GFP-stopnmt] integrated at leu1+ JW3718 h- mid1(1-100)-RIPGLINVD-cdr2-mEGFP-kanMX6 ade6-M210 leu1- This study 32 ura4-D18 JW3736 mid1(1-100)-RIPGLINVD-cdr2-mEGFP-kanMX6 rlc1-tdTomato- This study natMX6 ade6-M210 leu1-32 ura4-D18 JW3738 mid1(1-100)-RIPGLINVD-cdr2-mEGFP-kanMX6 cdc15-tdTomato- This study natMX6 sad1-mCFP-kanMX6 ade6-M210 leu1-32 ura4-D18 JW3820 h- mid1::ura4+ ade6-M216 leu1-32 ura4-D18 + Pmid1- This study mid1(Helix*)-mECitrine-kanMX6 integrated at leu1 locus (but not leu1+) JW3825 h- kanMX6-Pgef2-mECitrine-4Gly-gef2 ade6-M216 leu1-32 ura4-D18 Ye et al., 2012 JW3837 h- mid1::ura4+ ade6-M216 leu1-32 ura4-D18 + Pmid1-mid1(1-800, This study Helix*)-mECitrine-kanMX6 integrated at leu1 locus (but not leu1+) JW4039 cdr2::kanMX6 gef2::hphMX6 pom1-1::ura4+ ade6 leu1-32 This study ura4-D18 JW4059 gef2::hphMX6 pom1-1::ura4+ ade6 leu1-32 ura4-D18 This study JW4060 kanMX6-Pgef2-mECitrine-gef2 pom1-1::ura4+ ade6-M216 leu1-32 This study ura4-D18 AP528 h- mid1::ura4+ ade6-M216 leu1-32 ura4-D18 + pAP146 Pmid1- Celton-Morizur et mid1-GFP integrated at leu1+ al., 2004 AP583 h- mid1::ura4+ ade6-M216 leu1-32 ura4-D18 + pAP159 Pmid1- Celton-Morizur et mid1(Helix*)-GFP integrated at leu1+ al., 2004 AP1943 h- mid1::kanMX4 ade6-M216 leu1-32 ura4-D18 + pMA21 Almonacid et al., [pJK148-Pmid1-mid1(400-450)-4GFP-stopnmt] integrated at leu1+ 2009 Continued 49

Table 3.2: Continued AP1977 h- mid1::kanMX4 ade6-M216 leu1-32 ura4-D18 + pMA23 Almonacid et al., [pJK148-Pmid1-mid1(300-350)-4GFP-stopnmt] integrated at leu1+ 2009 JB109 h+ pom1-1::ura4+ ade6-M216 ura4-D18 Bähler and Pringle, 1998 JM346 h+ cdr2-mEGFP-kanMX6 ade6 leu1-32 ura4-D18 Moseley et al., 2009 YDM821 h+ clp1::ura4+ ade6-M216 leu1-32 ura4-D18 Jin et al., 2007

Figure 3.1. Serial truncations of Mid1 reveal functions of different domains/motifs in division-site specification. (A) Schematic representation of Mid1 domains/motifs. Known domains involved in localizing Mid1 or mediating interactions with other proteins are shown in darker gray. The PH domain identified from homology is shown in lighter gray. Numbers indicate the corresponding aa. (B) Quantifications of septum position/angle in septating cells of the truncations made in this study. (Left) Numbers indicate aa present in the schematics of truncations; (middle) a septum within the central 1/5 of the cell is defined as centered/normal (gray), a cell with >1 septa is defined as abnormal; (right) a septum at 90 ± 10° relative to the long axis of the cell is defined as orthogonal/normal (gray). FL Mid1 tagged at either the C- (C-tag; JW1790) or N-terminus (N-tag; JW1513) and mid1∆ (JW1604) are included as controls. For each strain, the mean and s.d. from 3 independent experiments are shown. n > 48 septating cells per strain in each experiment. This panel corresponds to the data and strains in Table 3.1. (C-E) Representative Differential Interference Contrast (DIC) images of cells in a series of C-terminal (C), N-terminal (D), and other (E) truncations as indicated. Bars, 5 μm.

Figure 3.2. Western blotting of mYFP or mECitrine tagged Mid1 truncations. Asterisks between duplicated samples mark the sizes of different truncations. Blottings of anti-tubulin are used as a loading control. Strains used are listed in Table 3.1. (A and B) The expression levels of mECitrine-tagged Mid1 C-terminal (A) and internal (A and B) truncations are shown. The truncations are compared to Mid1-mECitrine (FL) (JW1790; the first two lanes). (C-E) The expression levels of mYFP- tagged Mid1 C-terminal (C) and N-terminal (D and E) truncations are shown. The nonspecific bands near 50 and 70 kDa in (E) are due to using the JL-8 antibody. The C-terminal truncations are compared to Mid1- mYFP (FL) (JW1089; the first two lanes). The N-terminal truncations are compared to mYFP-Mid1(FL) (JW1513; the first two lanes).

Figure 3.3. The PH domain and the internal region aa(101-400) affect Mid1 localizations and dynamics. (A) Localizations of mECitrine-tagged FL Mid1 (JW1790), Mid1(1-800) (JW2601), Mid1[(1-100)-(401- 920)] (JW2391), and Mid1[(1-100)-(401-800)] (JW2702). The average intensity projection of the middle focal plane is shown. Images are taken using the same parameters and inverted. Asterisks indicate the nuclei; arrows, nodes; and arrowheads, contractile rings. (B) Merged image of Mid1-mECitrine (green) and Sad1-mCFP (magenta). Cells expressing Mid1-mECitrine (example with white outlines; JW1790) were imaged together with cells expressing Mid1-mECitrine Sad1-mCFP (orange outlines; JW1834). (C) Quantification of global mean protein levels (gray) and local levels in nodes (blue) and the nucleus (pink) of the strains in (A). The differences of fluorescence intensity between the truncations and the FL Mid1 are plotted. n > 60 cells for each strain. Error bars, s.d. from different images. (D) Illustration of FRAP analysis of Mid1 nodes. Top, a cell marked with two ROIs. Bottom, kymographs showing the change in fluorescence intensity over 15 min in the bleached (green box) and unbleached (yellow box) ROI. Images were collected every 20 s. Arrowhead, the time point of the bleaching. (E and F) Fluorescence recovery curves (E) and recovery rates (F) of strains in (A). Gray, recovery of FL Mid1 (Laporte et al., 2011). Error bars, s.e.m. (F) koff*t is plotted as a function of time to illustrate the differences in recovery rates (slope). (G,H) Rlc1-tdTomato contractile-ring assembly in wt (JW2433), mid1(1-800) (JW1779), mid1[(1-100)- (401-920)] (JW2435), and mid1[(1-100)-(401-800)] (JW3173). (G) Maximum intensity projections are shown. Yellow dashed lines outline the cells. Arrowheads indicate appearance of Rlc1 nodes. The time point just before Rlc1 node appearance is defined as time zero. (H) Scatter plots of the time from Rlc1 node appearance to the formation of a compact ring in mid1(1-800), mid1[(1-100)-(401-920)], and mid1[(1- 100)-(401-800)] (P > 0.3, each compared to FL Mid1). Bars, 5 μm.

Figure 3.3. The PH domain and the internal region aa(101-400) affect Mid1 localizations and dynamics.

Figure 3.4. Fluorescence intensity of Mid1[(1-100)-(401-920)] and dynamics of Mid1(1-800). (A) The nuclear (white), cortical (within the black boxes in the middle), and total fluorescence intensities of Mid1(FL)-mECitrine (JW1834) and Mid1[(1-100)-(401-920)]-mECitrine (JW2391) in the middle focal plane were measured and normalized to the total of Mid1(FL)-mECitrine in the same plane. Cytoplasmic intensity (gray) was obtained by subtracting the nuclear and cortical intensities from the total. Colors in the plot correlates with the location in the cell shown above the plot. (B) The FRAP recovery rate of Mid1(FL) and Mid1(1-800) cytokinesis nodes in cdr2∆ cells (JW2160 and JW3097). koff*t is plotted as a function of time to illustrate the differences in recovery rates (slope).

Figure 3.5. Mid1[(1-100)-(401-920)] interacts with Cdr2-mEGFP. (A) Mid1[(1-100)-(401-920)] co-IP with Cdr2-mEGFP. Antibody against EGFP was used to immunoprecipitate Cdr2-mEGFP, and antibody against Myc was used to detect Mid1. (left) Protein levels before IP. (right) Mid1[(1-100)-(401-920)] co-IP with Cdr2-mEGFP. Co-IP between Cdr2 and FL Mid1 was shown as a positive control (3rd lane). Strains used were (from left to right): JM346, JW3206, JW3267, JW2701, and JW2727. (B) Truncating aa(101-400) does not obviously affect the localization of Cdr2-mEGFP (strains JW3267 and JW2727). Bar, 5 μm.

Figure 3.6. The internal region aa(101-400) and the PH domain regulate the localization of Mid1. (A) Localization of indicated mECitrine-tagged Mid1 constructs in cdr2∆ during interphase (JW2160, JW3097, JW2672, and JW3034). The average of 10 consecutive images of the middle focal plane is shown. Arrowheads indicate cortical localization of Mid1. (B) Quantification of mononucleated cells with cortical signals of strains in (A). Error bars, s.d. from different experiments. n > 36 cells per strain for each experiment. (C) Cortical localization of Mid1[(1-100)-(401-920)]-mECitrine in cdr2∆ cells (JW2672) depends on the nuclear location. Cells were incubated with either MBC or DMSO and centrifuged to move the nuclei (see 3.3 Materials and Methods). Dashed lines span the cortical signal at the cell equator and arrowheads indicate signal at cell tips. Bars, 5 μm. (D) SDS-PAGE of purified 6His-Ksg1(PH) and 6His- Mid1(PH) stained with Coomassie blue. Two eluted fractions for each protein are shown. Expected sizes of the PH domains were indicated on the right. (E) 6His-Mid1(PH) has weak interactions with several lipids. (Left) Protein-lipid overlay assay with 6His-Ksg1(PH), 6His-Mid1(PH), and 6His-mEGFP. (Right) Layout of the PIP strip.

Figure 3.7. Mid1 PH domain has overlapping function with the amphipathic helix. (A) Mid1 PH domain has no obvious overlapping function with Cdr2. Quantifications of septum position/angle in septating cells of the indicated strains (JW2160, JW3097, JW2672, and JW3034). The same criteria as in Fig. 1B are used. For each strain, the mean and s.d. from 3 independent experiments are shown. n > 44 septating cells per strain in each experiment. (B and C) Mid1 PH domain has overlapping function with the amphipathic helix. Strains used are JW3820 and JW3837. (B) DIC images of mid1(Helix*) and mid1(1-800, Helix*) cells. Mid1(Helix*) has mutations in the helix and severely affects Mid1 cortical binding (Celton-Morizur et al., 2004). (C) Quantifications of septum position/angle in septating cells. For each strain, the mean and s.d. from 3 independent experiments are shown. n > 38 septating cells per strain in each experiment. Bar, 5 μm.

Figure 3.8. Mid1 lacking the internal region aa(101-400) suppresses the cytokinesis defects of pom1∆. (A) mid1[(1-100)-(401-920)] pom1∆ cells are healthier (a lighter color) on YE5S + Phloxin B plate. Similar amount of cells from indicated strains were plated and incubated at 30°C for 42 h. (B) DIC images of pom1∆ (JW2425) and pom1∆ mid1[(1-100)-(401-920)] (JW2426) cells. Open arrowheads indicate cell equators and closed arrowheads, misplaced septa. (C) mid1[(1-100)-(401-920)] and other mutants suppress septum-position defects in pom1∆ cells (JW2425, JW2426, JW2663, JW2732, JW3700, JW3701, JW2673, JW4059, and JW4039). The same criteria as in Fig. 1B are used. The vertical dashed lines are for aiding comparisons. For each strain, the mean and s.d. from 3 independent experiments are shown. n > 48 septating cells per strain in each experiment. (D) mECitrine-Gef2 localizes to the equator of wt cells (left, JW3825) but shifts toward one cell end in pom1∆ (right, JW4060). (E) Localization of FL Mid1 and Mid1[(1-100)-(401-920)] in pom1∆ cells (JW2425 and JW2426). The average of 10 consecutive images of the middle focal plane is shown. Arrowheads indicate contractile rings. (F) Cortical nodes in pom1∆ mid1[(1-100)-(401-920)] cells spread farther along the cortex. Cortical Mid1 intensities of 3 representative cells from strains JW1790, JW2391, JW2425, and JW2426 are measured as indicated by the diagram. (G) Contractile-ring assembly in rlc1-tdTomato pom1∆ cells expressing FL mid1 (JW2555) or mid1[(1-100)- (401-920)] (JW2596). Maximum intensity projections are shown. The time point just before the appearance of Rlc1 cytokinesis nodes is defined as time zero. Bars, 5 μm.

Figure 3.9. mid1 mutants alleviate division-site-specification defects in pom1∆. Representative DIC images of the cells quantified in Figure 3.8 C. Strains used are JB109, JW2663, JW2732, JW3700, JW3701, JW2673, JW4059, and JW4039. Bar, 5 μm.

Figure 3.10. Localization of Mid1(1-580), Mid1(41-920), and Mid1[(1-40)-(101-920)]. (A) Maximum intensity projection (top) and middle slice (bottom) of Mid1(1-580)-mECitrine cells (JW2603). Open arrowheads indicate full-size contractile rings and closed arrowheads, constricting rings. (B,C) Maximum intensity projections are shown. Asterisks indicate nuclear localization; open arrowheads, cortical nodes; arrows, normal contractile rings; and closed arrowheads, aberrant contractile ring/filaments. (B) Truncating aa(1-40) does not obviously affect Mid1 localization (left; JW1537) or contractile-ring assembly (right; JW1554). (C) Truncating aa(41-100) results in significant defects in Mid1 cortical localization (left; JW2390) and contractile-ring assembly (right; JW2434). (D) Time courses showing localization of Mid1 (JW1790) and Mid1[(1-40)-(101-920)] (JW2390) during mitosis. Only the middle focal plane is shown. Time zero is arbitrary. Cell equators are indicated by arrows. Bar, 5 μm.

Figure 3.11. The N-terminal half of Mid1 physically interacts with several node proteins for contractile-ring assembly. (A) The localization of FL Mid1 (JW1790) and Mid1(1-580) (JW2603) during cytokinesis. Maximum intensity projections are shown. Time zero is arbitrary. (B) Contractile ring of Rlc1-tdTomato assembles from cytokinesis nodes more slowly in mid1(1-580) cells (JW3338) than in wt (JW2433). Maximum intensity projections are shown. Arrowheads, Rlc1 node appearance. The time point just before the appearance of cytokinesis nodes is defined as time zero. Dashed lines outline the cells. Bars, 5 μm. (C) Scatter plots of the time from Rlc1-tdTomato node appearance to the formation of a compact contractile ring. (D) Number of Rlc1-tdTomato nodes in wt (JW2178) and mid1(1-580) (JW3337). (C and D) Asterisks indicate a significant difference (P < 0.05) from wt. (E-G) Physical interactions between Mid1 and node proteins. IP was performed using antibody against YFP (see 3.3 Materials and Methods). (E) Mid1(1-580)-Myc co-IP with mYFP-Rng2 (right; JW909, JW2548, and JW2345). (Left) the presence of mYFP-Rng2 and/or Mid1(1-580)-Myc before IP. (F) Mid1(1-580)-Myc co-IP with mYFP-Cdc4 (left; JW910-2 and JW2625), mYFP-Cdc15 (middle; JW1052 and JW2549), and Cdr2-mEGFP (right; JM346 and JW2551). (G) Mobility shifts of FL Mid1 treated with -phosphatase after IP (JW2233, JW2226, JW2231, and JW2227). The 50 kDa non-specific band is used as a loading control.

Figure 3.12. Mid1(1-100) is sufficient to assemble cytokinesis nodes and the contractile ring. (A and B) Localizations of (A) Mid1[(1-100)-(401-580)] (left; JW2704) and Rlc1 in mid1[(1-100)-(401- 580)] (right; JW3175), and (B) Mid1(1-100) (left; JW1303) and Rlc1 in mid1(1-100) (right; JW1738). Asterisk indicates nuclear localization and closed arrowheads, aberrant contractile ring/filaments. (C) Schematic representation of the fusion proteins. (D) Localization of Rlc1-tdTomato in mid1∆::Pmid1-cdr2- mEGFP (JW3471). Closed arrowheads indicate aberrant contractile ring/filaments. (E) Quantifications of septum position and angle in the indicated strains (JW3449, JW2704, JW3506, JW1303, and JW3718). The same criteria as in Fig. 1B are used. For each strain, the mean and s.d. from 3 independent experiments are shown. n > 50 septating cells per strain in each experiment. (F) Rlc1 nodes and contractile-ring assembly are restored in mid1[(1-100)-(401-580)]-cdr2 (JW3525) and mid1(1-100)-cdr2 (JW3736) cells. Arrows indicate cytokinesis nodes; open arrowheads, condensing nodes; and the closed arrowhead, a compact contractile ring. (G) Cdc15 localizes to nodes in mid1[(1-100)-(401-580)]-cdr2 (JW3603) but not in mid1(1-100)-cdr2 (JW3738) cells. Arrows indicate cytokinesis nodes; closed arrowhead, contractile rings. (H) Fusing Mid1[(1-100)-(401-580)] or Mid1(1-100) to Cdr2 partially rescued the kinetics of contractile- ring assembly. The mean time from Rlc1 signal appearance to the formation of a compact ring is shown (JW3471, JW3175, JW3525, JW1738, and JW3736). P-values in pair-wise comparisons are shown. Error bars, s.d. (I) A broad band of Cdc15 nodes (arrow) was detected in mid1[(1-100)-(401-580)]-cdr2 (JW3603) but not in mid1(1-100)-cdr2 (JW3738) cells upon treatment with 100 M Latrunculin-A. (J) Summary of the findings in this chapter (below the diagram) in the context of what is known about Mid1 (see text for details). Bars, 5 μm.

Figure 3.12. Mid1(1-100) is sufficient to assemble cytokinesis nodes and the contractile ring.

Chapter 4: Contractile-Ring Assembly in Fission Yeast Cytokinesis: Recent

Advances and New Perspectives

Derived from Lee, I-J., V.C. Coffman, and J.-Q. Wu. 2012. Contractile-ring assembly in fission yeast-recent advances and new perspectives. Cytoskeleton. 69:751-763.

4.1 Abstract

The fission yeast Schizosaccharomyces pombe is an excellent model organism to study cytokinesis. Here, we review recent advances on contractile-ring assembly in fission yeast. First, we summarize the assembly of cytokinesis nodes, the precursors of a normal contractile ring. IQGAP Rng2 and myosin essential light chain Cdc4 are recruited by the anillin-like protein Mid1, followed by the addition of other cytokinesis node proteins. Mid1 localization on the plasma membrane is stabilized by interphase node proteins. Second, we discuss proteins and processes that contribute to the search, capture, pull, and release mechanism of contractile-ring assembly. Actin filaments nucleated by formin Cdc12, the motor activity of myosin-II, the stiffness of the actin network, and severing of actin filaments by cofilin all play essential roles in contractile-ring assembly.

Finally, we discuss the Mid1-independent pathway for ring assembly, and the possible mechanisms underlying the ring maturation and constriction. Collectively, we provide an

65 overview of the current understanding of contractile-ring assembly and uncover future directions in studying cytokinesis in fission yeast.

4.2 Introduction

Cytokinesis partitions a mother cell into two daughter cells at the end of each cell cycle. Failure in cytokinesis results in tetraploidy and contributes to tumorigenesis

(Fujiwara et al., 2005; Ganem et al., 2007; Li et al., 2010; Sagona and Stenmark, 2010).

The actomyosin contractile ring in cytokinesis is conserved from fungi to humans

(Pollard and Wu, 2010). Research using the fission yeast Schizosaccharomyces pombe as a model system has provided novel insights into contractile-ring assembly. Briefly, contractile-ring assembly in fission yeast begins when Mid1, the anillin-like protein, recruits other proteins to assemble cytokinesis nodes (Paoletti and Chang, 2000; Wu et al., 2003; Motegi et al., 2004; Laporte et al., 2011; Padmanabhan et al., 2011). The nodes later condense into a compact actomyosin contractile ring through a process that has been described as a Search, Capture, Pull, and Release (SCPR) mechanism, which depends on transient interactions between the myosin-II motors and linear actin filaments (Vavylonis et al., 2008). The contractile ring then matures by recruiting additional components before its constriction (Wu et al., 2003). Although contractile-ring assembly can be described by a seemingly simple model, the mechanisms and regulation underlying each step of the assembly process are complex and involve many proteins. Therefore, contractile-ring assembly in fission yeast has been an active field of research. Recent studies in fission yeast cytokinesis not only shed light on the assembly and architecture of cytokinesis nodes, but also elucidate several proteins’ contributions to the SCPR 66 mechanism. Here, we review our current understanding of contractile-ring assembly, and discuss future perspectives in investigating cytokinesis in fission yeast.

4.3 Cytokinesis node assembly

In fission yeast, the anillin-like protein Mid1 specifies the division site (Chang and Nurse, 1996; Sohrmann et al., 1996; Bähler et al., 1998a; Paoletti and Chang, 2000;

Celton-Morizur et al., 2004; Daga and Chang, 2005; Almonacid et al., 2009). In interphase, Mid1 localizes to both the nucleus and the plasma membrane at the equator of the cell (Sohrmann et al., 1996; Bähler et al., 1998a; Paoletti and Chang, 2000). At the

G2/M transition, Mid1 is mainly concentrated on the medial cortex and joined by several other proteins to form an equatorial band of ~65 cortical punctate structures named cytokinesis nodes that have a Gaussian distribution along the long axis of the cell

(Paoletti and Chang, 2000; Wu et al., 2003, 2006; Vavylonis et al., 2008). These cortical nodes later coalesce into the contractile ring (Bähler et al., 1998a; Wu et al., 2003, 2006), suggesting that these macromolecular cortical complexes (on the cytoplasmic side of the plasma membrane) are precursors of the contractile ring in fission yeast cells (Figure 4.1

A). Proteins in cytokinesis nodes include the anillin-like protein Mid1 (Bähler et al.,

1998a; Paoletti and Chang, 2000), the IQGAP protein Rng2 (Eng et al., 1998), the myosin-II motor (heavy chain Myo2, essential light chain Cdc4, and regulatory light chain Rlc1) (McCollum et al., 1995; Kitayama et al., 1997; May et al., 1997; Naqvi et al.,

1999; Bezanilla et al, 2000; Motegi et al., 2000, 2004; Naqvi et al., 2000), the F-BAR protein Cdc15 (Fankhauser et al., 1995; Carnahan and Gould, 2003), and the formin

Cdc12 (Chang et al., 1997; Wu et al., 2006; Coffman et al., 2009). Their localizations to 67 the nodes are actin-independent (Wu et al., 2003). In mid1∆ cells, equatorial cytokinesis nodes do not form, and cells are severely defective in division-site selection and contractile-ring assembly (Wu et al., 2003, 2006). Mid1 phosphorylation by Polo kinase

Plo1 is crucial for the initiation of cytokinesis-node assembly (Bähler et al., 1998a;

Almonacid et al., 2011; Rincon and Paoletti, 2012).

While Rng2, Cdc4, Myo2, Rlc1, Cdc15, and Cdc12 only co-localize with Mid1 beginning at G2/M, several proteins co-localize with Mid1 on the cortex during most of interphase (Moseley et al., 2009). The interphase cortical structures that contain Mid1 and these proteins are hence named “interphase nodes”, which determine cell size and mitotic entry together with Pom1 kinase (Morrell et al., 2004; Martin and Berthelot-

Grosjean, 2009; Moseley et al., 2009; Hachet et al., 2011). Note that in wild type cells, the different nomenclature simply reflects the difference of node components in regard to cell cycle stage. Here we discuss the connections between interphase and cytokinesis nodes and review recent advances on the assembly of cytokinesis nodes.

4.3.1 Cytokinesis nodes and interphase nodes

Proteins in interphase nodes include three kinases Cdr2 (Breeding et al., 1998;

Kanoh and Russell, 1998; Morrell et al., 2004), Cdr1 (Wu and Russell, 1993, 1997), and

Wee1 (Parker et al., 1991; Wu et al., 1996; Masuda et al., 2011), kinesin-like protein

Klp8, the putative Rho guanine exchange factor (GEF) Gef2, and novel protein Blt1

(Martin and Berthelot-Grosjean, 2009; Moseley et al., 2009). In mitosis, Klp8, Gef2, and

Blt1 persist in cytokinesis nodes, but are not essential for contractile-ring assembly because without interphase nodes, Mid1 can still localize to the medial cortex at the

G2/M transition and assemble cytokinesis nodes independently (Almonacid et al., 2009).

Nevertheless, evidence suggests that interphase node proteins can contribute to the regulation of cytokinesis (Almonacid et al., 2009; Laporte et al., 2011; Ye et al., 2012).

Cdr2, the SAD/GIN4 kinase in fission yeast, is the organizer of interphase nodes and involved in regulating cell size by inhibiting Wee1 kinase (Martin and Berthelot-

Grosjean, 2009; Moseley et al., 2009). Cdr2 is detected in condensing cytokinesis nodes but disappears from the division site shortly after the assembly of a compact contractile ring (Moseley et al., 2009). Interestingly, Mid1, IQGAP Rng2, and F-BAR protein Cdc15 nodes are more dynamic in the absence of Cdr2, indicating that interphase node proteins play a role in stabilizing cytokinesis nodes (Laporte et al., 2011).

Gef2, Blt1, and Klp8 stay in the contractile ring until the end of ring constriction

(Moseley et al., 2009; Ye et al., 2012). While the function of Klp8 remains unknown, strong synthetic genetic interactions in gef2∆ plo1-ts18 cells and quantitative microscopy indicate that Gef2 and Polo kinase Plo1 are required together to regulate Mid1 cortical level in cytokinesis. blt1∆ also shows mild genetic interaction with plo1-ts18, and its involvement in cytokinesis is partially through Gef2 (Ye et al., 2012). The functions of

Gef2 and Blt1 in interphase are not clear yet, although gef2∆ and blt1∆ cells are slightly longer than wild type cells (Moseley et al., 2009; Ye et al., 2012).

It seems surprising that the cell-size sensing machinery and the precursors of the contractile ring are co-localized, but this arrangement could promote timely assembly of the cytokinesis apparatus once a cell is committed to undergo mitosis. Nodes are not the only cortical structure observed in S. pombe. Rga4, the Rho GTPase activating protein

69 that inhibits growth on cell sides, localizes to punctate-like structures on the cortex (Das et al., 2007; Tatebe et al., 2008) that are distinct from nodes (Tatebe et al., 2008).

Eisosomes in fission yeast assemble into filaments on the cortex (Kabeche et al., 2011).

Clustering of the plasma membrane components may be the origin of the distinction between these different structures (Wachtler et al., 2003; Morrell et al., 2004). Whether cross-talks exist between these structures requires further investigation.

4.3.2 The assembly and architecture of cytokinesis nodes

Spindle Pole Bodies (SPB) are the yeast counterparts of animal centrosomes. SPB separation marks the onset of mitosis in fission yeast. All the cytokinesis node proteins except Mid1 arrive at nodes shortly before or around SPB separation (Wu et al., 2003;

Laporte et al., 2011). Recently, several studies have determined the hierarchy of cytokinesis-node assembly using complementary methods (Almonacid et al., 2011;

Laporte et al., 2011; Padmanabhan et al., 2011). First, localization dependencies of cytokinesis proteins at nodes were determined by utilizing temperature-sensitive mutants and germinated spores of null mutants (Figure 4.1 B). Second, the appearance of the proteins at nodes was imaged and quantified with high temporal resolution. Third, their dynamics on nodes were obtained by Fluorescence Recovery After Photobleaching

(FRAP). Fourth, Mid1 phosphorylation and the physical interactions between Mid1 and other cytokinesis proteins were determined. Last but not least, the architecture of nodes was revealed by a modified Single-molecule High REsolution Co-localization (SHREC) technique that breaks the diffraction limit and results in a resolution of tens of nanometers

(Churchman et al., 2005; Joglekar et al., 2009). The architecture of cytokinesis nodes obtained is summarized in Figure 4.1 C.

These studies highlight the importance of the IQGAP protein Rng2 and Cdc4, which are the earliest to appear at nodes (~12 min before SPB separation) after Mid1.

Except Mid1, other cytokinesis node proteins are not required for Rng2 and Cdc4 to localize. However, without functional Rng2 and Cdc4, Myo2 and Rlc1 cannot localize to nodes. Rng2 interacts with Mid1 in co-immunoprecipitation (co-IP) (Laporte et al., 2011;

Padmanabhan et al., 2011), and rng2-M1 (with mutations H1329L and K1366E in the region interacting with Mid1) phenocopies mid1 (Padmanabhan et al., 2011). The C- terminus (aa 1306-1489) of Rng2 interacts with the N-terminus (first 100 aa) of Mid1 in an in vitro binding assay (Almonacid et al., 2011), suggesting that Rng2 is directly recruited by Mid1. The N-terminus (aa 1-100) of Mid1, when targeted to nodes, is sufficient to assemble cytokinesis nodes and the contractile ring (Lee and Wu, 2012).

Cdc4 forms a complex with Mid1 in co-IP, but it is unknown if the interaction is direct or not. Rng2 and Cdc4 interact with each other via the IQ motifs in Rng2 (D'Souza et al.,

2001), and their localizations to cytokinesis nodes are interdependent (Laporte et al.,

2011; Padmanabhan et al., 2011). Taken together, Rng2 and Cdc4 are more upstream in the node-assembly pathway but whether they are recruited as a complex is unknown.

Cdc4 has two recovery rates in FRAP analysis. While the slow recovery resembles that of Rng2, the fast recovery depends on its interaction with the IQ motif of

Myo2 (Naqvi et al., 2000; D'Souza et al., 2001; Laporte et al., 2011). Consistent with the timing of appearance (~10 min before SPB separation) and the localization dependency,

71 the weak interaction between endogenous Myo2 and Mid1 revealed by co-IP depends on functional Rng2 (Laporte et al., 2011). Results from SHREC also suggest that Myo2 is further away from the plasma membrane compared to Mid1 and Rng2, with its motor head pointing into the cytoplasm and C-terminal tail folded. Rlc1, the regulatory light chain of myosin-II, displays the same timing of appearance and dynamics as Myo2, and its localization completely depends on Myo2 (Laporte et al., 2011).

F-BAR protein Cdc15 arrives at nodes ~5 min before SPB separation (Laporte et al., 2011). The dephosphorylation of Cdc15, partly regulated by the Cdc14-family phosphatase Clp1 (Trautmann et al., 2001; Wolfe and Gould, 2004; Wolfe et al., 2006), is crucial for its division-site localization, conformation, and interactions (Wachtler et al.,

2006; Clifford et al., 2008; Roberts-Galbraith et al., 2010). Prematurely dephosphorylated

Cdc15 localizes to cortical nodes and is able to cause medial localization of its interacting partners in interphase (Roberts-Galbraith et al., 2010). Some discrepancy exists regarding the relationship between Mid1, Rng2, and Cdc15 (Figure 4.1 B). Physical interactions are reported between Mid1-Cdc15 (yeast two hybrid and co-IP assays; Laporte et al., 2011),

Mid1-Rng2 (co-IP and in vitro binding assay using purified fragments; Almonacid et al.,

2011; Laporte et al., 2011; Padmanabhan et al., 2011), and Cdc15-Rng2 (TAP-tagging and co-IP; Roberts-Galbraith et al., 2010). On the one hand, Laporte et al. proposed that

Mid1 can recruit Cdc15 to cytokinesis nodes independent of the Rng2-Cdc4 module, because Cdc15 nodes are detected in rng2-D5, rng2-346, rng2∆, cdc4-8, and cdc4∆ mutants (Laporte et al., 2011). On the other hand, Padmanabhan et al. proposed that

Cdc15 is downstream of the Rng2-Cdc4 module because no Cdc15 nodes are detected in

72 the rng2-M1 mutant at the restrictive temperature. It is possible that part of the discrepancy comes from the difference between rng2 mutants (Padmanabhan et al.,

2011). Indeed, the total Mid1 protein level is lower in rng2-M1 but not in rng2-D5 cells

(Laporte et al., 2011; Padmanabhan et al., 2011). Another possibility is that the higher autofluorescence at the GFP channel (compared to the YFP channel) might obscure a weak cortical Cdc15 signal in rng2-M1 (Padmanabhan et al., 2011). Cdc15 levels in the nodes have not been quantified in the cdc4 and rng2 mutants (Laporte et al., 2011), so the possibility remains that both Mid1 and Rng2 are involved in recruiting Cdc15. Further studies are needed to address these different possibilities.

The last known component to join cytokinesis nodes before their condensation is the formin Cdc12, whose interaction with Cdc15 is well-studied (Carnahan and Gould,

2003; Roberts-Galbraith et al., 2010). Surprisingly, it was recently found that in addition to Cdc15, the Rng2-Cdc4 module can also recruit Cdc12 to cytokinesis nodes (Laporte et al., 2011) (Figure 4.1 B). Cdc12 is dispensable for other cytokinesis node proteins to localize (Laporte et al., 2011), although its function to nucleate actin filaments is essential for contractile-ring assembly (Kovar et al., 2003). Soon after Cdc12 appears at the division site, cytokinesis nodes start to condense and the contractile ring assembles in

~10 min in wild type cells at 25C.

4.4 SCPR model and beyond

Since the proposal that the contractile ring in fission yeast cells is assembled from the condensation of a broad band of nodes (Wu et al., 2006), numerical simulations and live-cell imaging of cytokinesis node proteins and actin filaments were integrated to 73 describe the mechanism. Monte Carlo simulations, using parameters obtained in vivo, recapitulate the condensation of nodes via transient connections between actin filaments and neighboring nodes. Vavylonis et al. therefore proposed the SCPR mechanism of contractile-ring assembly: An actin filament nucleated by formin Cdc12 in one node searches the cortex and can be captured by the myosin-II at another node, and the force generated by the myosin-II motor walking on the actin filament pulls the nodes closer before the release of the interaction (Vavylonis et al., 2008). The SCPR model differs from the previously proposed spot/leading cable model for contractile-ring assembly in the numbers of actin-nucleation sites, orientations of actin filaments, and the importance of myosin-II motor activity (Chang et al., 1997; Chang, 1999; Arai and Mabuchi, 2002;

Carnahan and Gould, 2003; Kamasaki et al., 2007; Coffman et al., 2009). Key assumptions and predictions in the SCPR model were tested subsequently in a number of studies (see below). Consistent with the model, many different perturbations of contractile-ring assembly result in discontinuous aggregates (clumps) on the cortex rather than a continuous ring. Meanwhile, in vivo observations have led to the refining of the model (Ojkic et al., 2011). Here we review the process of search, capture, pull, and release, and discuss players that contribute to each step of contractile-ring assembly

(Figure 4.2).

4.4.1 Search

After the nodes have matured by the recruitment of the formin Cdc12, actin polymerization is crucial for the “search” step. Cdc12 is the essential formin that nucleates actin filaments at the division site (Chang et al., 1997; Kovar et al., 2003;

Coffman et al., 2009). Therefore, its activity and localization are critical for contractile- ring assembly. As previous studies suggest that the majority of actin filaments for contractile-ring assembly are nucleated by Cdc12 at the division site (Pelham and Chang,

2002; Coffman et al., 2009), actin filaments nucleated elsewhere in cells are not included in the SCPR simulation. Nevertheless, current data does not exclude the possibility that these filaments could be incorporated into the contractile ring.

The number of actin nucleation sites in the broad band of nodes determines the success and efficiency of contractile-ring assembly. Assuming there are ~65 nodes in each cell, the SCPR model requires that at least 50% of them should contain formins and nucleate 1 to 4 filaments from each node in order for the nodes to condense into a ring in

~10 min. In agreement with the model, 2-4 dimers of Cdc12 localize to >50% of nodes right before the nodes start to condense (Coffman et al., 2009; Laporte et al., 2011). The high nucleation efficiency (~1 filament out of 3 dimers) of purified Cdc12 FH1FH2 domain in vitro (Scott et al., 2011) supports both the SCPR model and the in vivo data

(Coffman et al., 2009; Laporte et al., 2011).

The orientation and elongation rate of each actin filament determines its chance to encounter another node. On the cell cortex, actin filaments are randomly oriented at the beginning of node condensation (Coffman et al., 2009), as applied in the SCPR model.

Further study showed that actin filaments at the division site exhibit an average angle of

8° to the plasma membrane, possibly due to the position and orientation of Cdc12 in nodes, affinity of actin filaments with the plasma membrane, or restriction by the endoplasmic reticulum (Zhang et al., 2010; Laporte et al., 2011). This angle may ensure

75 that the actin filaments can be readily captured (see below). The length of actin filaments is controlled by actin-binding proteins and the processivity of Cdc12. Profilin Cdc3

(Balasubramanian et al., 1994) is required for the rapid elongation of actin filaments by

Cdc12 (Kovar et al., 2003) (Figure 4.2 A). In the presence of profilin, Cdc12 associates with elongating actin filaments processively (Kovar and Pollard, 2004) and competes with capping protein better than other formins (Neidt et al., 2008). Tropomyosin Cdc8

(Balasubramanian et al., 1992) helps the elongation of actin filaments by inhibiting disassembly (Skau et al., 2009). The binding of tropomyosin to actin and thus its localization is regulated by acetylation (Skoumpla et al., 2007; Coulton et al., 2010).

Of note, the regulation of Cdc12 activity remains largely unknown. No Rho

GTPase has been identified to activate Cdc12, although many diaphanous-related formins are regulated in this way. Because cdc12 is an essential gene, domain analyses were performed in the presence of the endogenous protein, adding complexity to the interpretation of the results (Yonetani et al., 2008; Yonetani and Chang, 2010). The formation of interphase rings when a C-terminal Cdc12 truncation is overexpressed in the presence of endogenous Cdc12 is suggestive of some form of inhibition that acts on the long C-terminal tail of Cdc12 (Yonetani and Chang, 2010). A formin damper or inhibitor, such as Smy1 or Bud14 in S. cerevisiae (Chesarone et al., 2009; Chesarone-Cataldo et al.,

2011), has not been found yet in S. pombe. The temperature sensitive mutant cdc12-112 forms many small clumps over the equator consistent with the results of SCPR when actin filaments are too short (Hachet and Simanis, 2008; Ojkic and Vavylonis, 2010).

Because deletion of capping protein rescues the cdc12-112 phenotype, it has been

76 suggested that this formin mutant lacks processivity (Kovar et al., 2005), which would result in shorter actin filaments and make capture events less likely.

4.4.2 Capture

When an actin filament nucleated from a node encounters another node (in the

SCPR model, when the filament comes within the capture radius 100 nm from the centroid of the node), it might be captured by myosin-II (Figure 4.2 B). Tropomyosin

Cdc8 stabilizes actin filaments (Figure 4.2 B) and increases the affinity of myosin-II for actin filaments (Stark et al., 2010). It has been suggested that with the motor head of myosin-II being oriented away from the cortex in stationary nodes, it is more likely to catch the slightly inward-pointing actin filaments (Laporte et al., 2011). Increasing myosin-II concentration speeds up contractile-ring assembly maybe partly by increasing capture events, or by producing more force and thus pulling the nodes together more quickly (Stark et al., 2010).

Other actin-binding proteins in nodes, such as Rng2 (Eng et al., 1998), could also capture actin filaments (Takaine et al., 2009), but the interaction would not result in shortening of the distance between nodes without the myosin-II motor activity. The interaction between Rng2 and actin filaments may generate tension and pull them closer to the myosin motor heads and thus increase the chance of capture by myosin-II. On the other hand, Rng2-actin interaction might interfere with the SCPR mechanism if actin filaments are stabilized but not directed to myosin-II. A Rng2 truncation lacking the actin-binding Calponin Homology Domain would be helpful for further analysis of its function and the importance of its actin-binding activity. Because Rng2 is essential, such

77 a truncation may not be viable, although it would not be expected to affect the node assembly pathway (Laporte et al., 2011).

In the original SCPR model (Vavylonis et al., 2008), actin filaments stop growing once they are captured by neighboring nodes, and the tension-induced switch-off is important for the mechanism. Whether actin filaments stop growing after being captured in vivo remains untested.

4.4.3 Pull

A key assumption in the SCPR model is that the force generated by the myosin-II motor on the captured actin filament pulls the two nodes closer to each other. It predicts that mutants with defective myosin-II motor activity cannot condense the nodes properly.

Indeed, Coffman et al. showed that when myo2-E1, a temperature-sensitive mutant with weakened myosin-II motor activity, is grown at the restrictive temperature, actin filaments are nucleated at the division site and associated with cytokinesis nodes, but node condensation is severely affected (Coffman et al., 2009). Phosphorylation of the regulatory light chain was suggested to regulate myosin-II motor activity (Chew et al.,

1998; Sanders et al., 1999; Loo and Balasubramanian, 2008). Indeed, mutating phosphorylation sites on Rlc1 to alanine results in lower Myo2 motility in vitro and a delay in contractile-ring assembly at higher temperatures in vivo (Loo and

Balasubramanian, 2008; Sladewski et al., 2009) (see below for discussion). The fission yeast UCS protein Rng3 (Wong et al., 2000) activates the motor activity of myosin-II

(Figure 4.2 C) (Lord and Pollard, 2004; Lord et al., 2008). When the temperature- sensitive rng3-65 cells are grown at the restrictive temperature, the movement of nodes is

78 minimal; when the cells are shifted back to the permissive temperature, node condensation is recovered (Coffman et al., 2009). Thus, myosin-II motor activity is essential for node condensation into the contractile ring.

If actin filaments are crosslinked into a network (Figure 4.2 C), then the pulling forces of myosin motors will be distributed to all the other nodes that are connected together through actin filaments. While this could help coordinate node condensation, crosslinking may also bundle actin filaments along unproductive directions. Recent studies highlight the importance of actin-crosslinking proteins in cytokinesis. When semi- flexible actin filaments are crosslinked, the stiffness of the network increases, thus making node condensation more difficult. α-Actinin forms a homodimer via its spectrin repeats and bundles actin filaments (Xu et al., 1998; Djinovic-Carugo et al., 1999). In mammalian cells, the crosslinking by α-actinin is required for structural support of the actin network during cytokinesis, since the depletion of α-actinin results in a sudden collapse of the equatorial cortical network (Mukhina et al., 2007).

Ain1, the α-actinin in S. pombe, also localizes to the contractile ring (Nakano et al., 2001; Wu et al., 2001). Although both deleting and overexpressing ain1 cause delays in contractile-ring assembly, live-cell imaging shows completely opposite behavior of actin filaments and cytokinesis node proteins in these strains (Laporte et al., 2012). In ain1∆, the actin network becomes more dynamic and cytokinesis nodes usually first condense into a clump before a contractile ring is eventually formed. This is likely due to excess net pulling force because of less resistance via crosslinking. When excess Ain1 is present in the cell, the movement of nodes is attenuated and actin filaments form stable

79 linear structures that may or may not assemble into a contractile ring. A balance between myosin pulling force and the damping effect of crosslinkers is reestablished when Myo2 is slightly overexpressed in these cells, which leads to successful contractile-ring assembly (Laporte et al., 2012) These results suggest that the extent of crosslinking is critical for proper contractile-ring assembly. In addition to Ain1, Rng2 has also been shown to bundle actin filaments (Takaine et al., 2009). In contrast, Cdc12 has no bundling activity (Scott et al., 2011). Recent evidence suggests that actin crosslinker fimbrin Fim1 functions as a subsidiary to Ain1 during contractile-ring assembly, although

Ain1 has a more prominent role during node condensation, probably due to the difference in the geometry/distance of the crosslinked actin filaments (Laporte et al., 2012).

4.4.4 Release

Permanent interactions between nodes result in a series of clumps instead of a ring at the equator in the simulations of the SCPR model. Therefore, the release of interactions is critical for contractile-ring assembly. In the SCPR model, the release between two nodes happens with a constant rate (Vavylonis et al., 2008). In vivo, several factors could contribute to the release of the interaction between two nodes (Figure 4.2

D). First, Myosin-II could dissociate from the captured actin filament. Myosin-II is a motor with low duty ratio and <15% of Myo2 is in the strong actin-bound state in vitro

(Stark et al., 2010). Second, actin filaments could be severed by cofilin. Several cofilin mutants that are defective in severing result in clump formation (Nakano and Mabuchi,

2006; Chen and Pollard, 2011). Third, the formin Cdc12 could be displaced from the barbed ends of actin filaments. Although Cdc12 tightly binds barbed ends and competes

80 with capping protein in vitro (Kovar et al., 2005), their relationship in vivo is less clear.

In S. cerevisiae, Bud14 can displace formin Bnr1 from barbed ends that are immediately capped (Chesarone et al., 2009), but an S. pombe homolog to Bud14 is unknown. Lastly, part of the node could dissociate because of its intrinsic dynamics. Several cytokinesis proteins are dynamic in the nodes and recover quickly in FRAP analysis (Coffman et al.,

2009; Laporte et al., 2011), and when Cdc12 or Myo2 in particular dissociates from the node (half times ~30 s), the tension between two nodes may be released. All of these factors could contribute to release during contractile-ring assembly, but their relative contributions are unknown.

The frequency of the release of the interaction appears to be tightly controlled in vivo. One example of the regulation of severing was discovered by comparing the level of fimbrin Fim1 at different locations. Fim1 localizes to both actin patches and the contractile-ring, with a higher concentration in patches. A recent study showed that in fission yeast cells, Fim1 and tropomyosin Cdc8 have antagonistic roles in cytokinesis, and the fimbrin-bound actin filaments are more susceptible to severing by cofilin (Skau and Kovar, 2010) due to the loss of protection by tropomyosin. This result explains why overexpression of Fim1 abolishes contractile-ring assembly (Wu et al., 2001). The binding of Rng2 to the actin filament also protects it from being severed by cofilin in vitro (Takaine et al., 2009).

The unconnected filaments also undergo breakage (Vavylonis et al., 2008).

Recently, it was reported that tension created by the optical tweezer prevents actin filaments from being severed by cofilin (Hayakawa et al., 2011). In the reconstituted

81 system, the lifetime of actin filaments under tension are about twice as long as the relaxed ones (Hayakawa et al., 2011). It is likely that the unconnected filaments in fission yeast cells are also more prone to be severed compared to the connected ones.

In the SCPR model, once an actin filament breaks, another one immediately grows out from the node to start the search again. Although this assumption has not been directly tested yet, the high nucleation efficiency of Cdc12 (Scott et al., 2011) is indicative of a sufficiently short interval between each SCPR cycle.

4.4.5 Modification of the model

While the original minimal SCPR model successfully recapitulates the critical elements of contractile-ring assembly in silico, two modified models were proposed recently to further address additional aspects of the assembly mechanism that we and others have observed in fission yeast cells. First, polarity was applied to the nodes in a modified model that introduces local alignment, a mechanism that allows the nodes to rotate and move around each other when they are closer than 0.4 μm (Ojkic et al., 2011).

It has been shown that Mid1 forms oligomers (Celton-Morizur et al., 2004), and the F-

BAR protein Cdc15 forms filament-like structures when dephosphorylated (Roberts-

Galbraith et al., 2010). Therefore, the inclusion of local alignment in the model addresses protein-protein interactions between different nodes when they are very close to each other. In this modified model, a more homogenous and continuous distribution of nodes is achieved after condensation. Second, in light of the importance of crosslinking proteins and the stiffness of the actin network, a crosslinking parameter was introduced into a modified SCPR model (Laporte et al., 2012). This modification can recapitulate the

82 formation of the clump in ain1∆ cells and the stable meshworks in ain1 overexpressing cells (see 4.4.3 Pull for discussion). In addition, the refined model supports a mechanism of cooperation between myosin-II and actin crosslinkers for successful node condensation.

The SCPR model focuses on early stages of contractile-ring assembly, and the later stages of node condensation are far more difficult to resolve than the initial stage.

For example, while the actin filaments grow at random directions at early stages of contractile-ring assembly (Coffman et al., 2009), it is difficult to test whether this continues at later stages because the actin filaments are too dense at the contractile ring.

Whether the increasing stiffness of the actin network restrains the orientation of nodes and the direction of actin filament elongation at later stages is unknown. The arrangement of F-actin in the contractile ring of wild type cells revealed by myosin S1 decoration and electron microscopy indicates that in a full-sized contractile ring, two semicircular populations of parallel filaments with opposite orientations exist during early anaphase B; in a constricting ring, filaments with opposite orientations are mixed homogenously throughout the ring (Kamasaki et al., 2007). Investigating the orientations of F-actin in cells during late stages of node condensation, just before the formation of a compact ring, will be helpful to compare actin directionality at early versus late stages of node condensation. Although the architecture of the node before condensation indicates that the myosin-II motor head points toward the cytoplasm and does not support the formation of anti-parallel myosin minifilaments, whether a change of node architecture may allow the minifilaments to form at later stages of node condensation remains unclear.

4.4.6 Mid1-independent contractile-ring assembly

In mid1∆ cells, there are no equatorial cytokinesis nodes, and contractile-ring assembly is severely impaired (Sohrmann et al., 1996). However, most mid1∆ cells are viable, indicating the existence of other mechanisms to assemble the essential contractile ring. Some mid1∆ cells can slowly make a randomly-positioned and -oriented ring from linear structures consisting of Rng2, Myo2, Rlc1, Cdc12, actin, and other cytokinesis proteins (Wu et al., 2003; Hachet and Simanis, 2008; Huang et al., 2008; Coffman et al.,

2009). Recent studies suggest that the SIN pathway is involved in contractile-ring assembly in cells lacking functional Mid1 (Hachet and Simanis, 2008; Huang et al., 2008;

Roberts-Galbraith and Gould, 2008; Bathe and Chang, 2010; Johnson et al., 2012).

Hyperactivation of the SIN pathway induces contractile-ring assembly in interphase

(Hachet and Simanis, 2008; Huang et al., 2008). SIN-induced rings assemble from filamentous or linear structures that arise from random positions, resembling rings assembled in mid1∆ cells. When the SCPR mechanism is not compromised, SIN mainly functions in later stages of cytokinesis (see 4.5 Ring maturation and constriction). In SIN mutants, a compact ring can form but cannot mature and constrict before its collapse

(Balasubramanian et al., 1998; Hou et al., 2000; Krapp et al., 2001; Hachet and Simanis,

2008). Although contractile rings can form in mid1-6 and sid2-250 (SIN kinase) single mutants, it cannot form in the double mutants (Hachet and Simanis, 2008), suggesting the existence of parallel and/or sequential pathways for ring assembly in fission yeast. The

Polo kinase Plo1 regulates both pathways and both are important for the formation of a

84 functional contractile ring at the correct division site (Bähler et al., 1998a; Tanaka et al.,

2001; Almonacid et al., 2011).

The SIN-induced, Mid1-independent rings are able to constrict more slowly than normal rings (Hachet and Simanis, 2008), allowing completion of cytokinesis in some cells. It may be that without equatorial cytokinesis nodes in mid1∆ cells, the filamentous or linear structures could incorporate and spread the essential ring components and thus make a functional contractile ring (Roberts-Galbraith and Gould, 2008; Bathe and Chang,

2010). However, the molecular mechanism of Mid1-independent ring assembly remains obscure. In addition, it is unknown why SIN-induced rings are less homogenous and constrict slower (Hachet and Simanis, 2008).

Taken together, contractile-ring assembly in wild type fission yeast can be successfully modeled using the SCPR mechanism, and the Mid1-independent ring assembly depends on the SIN pathway. In the SCPR model, each parameter consists of numerous events in the cells and involves many proteins. Contractile-ring assembly requires multiple rounds of search, capture, pull, and release. Therefore, defects in one step might lead to severe consequences. However, many proteins are involved in more than one step in the process. Thus, the in vivo results obtained are not always easy to interpret. In vitro assays have provided many insights, but in vivo analyses with high spatial and temporal resolution are required to distinguish different possibilities. It will be of interest to further test the assumptions and predictions of the SCPR model, and characterize proteins and processes that contribute to each step. In addition, integrating

85 results from both node-dependent and Mid1-independent contractile-ring assembly will be a challenge in the future.

4.5 Ring maturation and constriction

In wild type cells, the condensation of nodes results in a compact ring without lagging nodes at ~10 min after SPB separation. The diameter of the ring stays constant for ~25 min before constriction begins (Wu et al., 2003). During this stage, the contractile ring matures by concentrating many additional proteins to the ring and/or to the division site adjacent to the ring, including additional F-BAR protein Cdc15, capping protein, the unconventional myosin-II heavy chain Myp2 (Bezanilla et al., 1997, 2000; Wu et al.,

2003), Rho GTPases and their regulators (Mutoh et al., 2005; Nakano et al., 2005;

Rincon et al., 2007; Wu et al., 2010; Arasada and Pollard, 2011), Arp2/3 complex and its activators (Carnahan and Gould, 2003; Takeda and Chang, 2005; Wu et al., 2006), septins (Wu et al., 2003; An et al., 2004), and many other proteins (Pollard and Wu,

2010).

Compared to cytokinesis-node and contractile-ring assembly, much less is known about ring maturation and constriction. Nevertheless, many studies indicate that the F-

BAR protein Cdc15 and the SIN pathway play important roles during this stage. The number of Cdc15 molecules in the contractile ring increases 10 fold during ring maturation (Wu and Pollard, 2005). Without functional Cdc15, a compact contractile ring can assemble but falls apart (Fankhauser et al., 1995; Balasubramanian et al., 1998;

Wachtler et al., 2006; Hachet and Simanis, 2008). The regulation of ring integrity is mediated at least partly through the SH3 domain of Cdc15. It interacts with the C2 86 domain protein Fic1 and the paxillin Pxl1, two of the proteins that appear at the division site during ring maturation and are involved in maintaining ring integrity (Ge and

Balasubramanian, 2008; Pinar et al., 2008; Roberts-Galbraith et al., 2009). Imp2, another

F-BAR protein in fission yeast, cooperates with Cdc15 during this process (Roberts-

Galbraith et al., 2009). Failure to maintain ring integrity is also observed in SIN mutants with reduced Cdc15 recruitment to the division site (Hachet and Simanis, 2008).

In most mutants that exhibit a delay in contractile-ring assembly, the initiation of ring constriction is not delayed. For example in myo2-E1 cells, it takes much longer to assemble the contractile ring even at permissive temperature, but once the contractile ring is formed, it only undergoes a very short “dwell time” before constriction begins

(Coffman et al., 2009; Stark et al., 2010). In contrast, in cells with two copies of myo2, the contractile ring assembles prematurely, leaving a prolonged dwell time before ring constriction (Stark et al., 2010). In mid1∆ and mid1 mutants, once the SIN-dependent ring is assembled after a delay, its diameter also starts to decrease immediately (Celton-

Morizur et al., 2004; Hachet and Simanis, 2008; Huang et al., 2008). Together, these results suggest that ring maturation and constriction are tightly controlled and probably regulated through a cell-cycle dependent signal/mechanism. When a delay in ring assembly occurs, the ring may mature while being assembled. The recruitment of additional ring components during ring maturation could assist the defective assembly process in some mutants. For example, the SIN-dependent pathway could recruit additional Cdc15 to complement a defective SCPR mechanism in several mutants

(Hachet and Simanis, 2008), and the arrival of Myp2 may support the eventual ring

87 assembly observed in myo2-E1 mutants. Given that many proteins recruited in ring maturation are necessary for ring constriction, recruitment of these proteins during delayed assembly could allow the contractile ring to constrict at the normal time. Future studies should focus on characterizing the effect of proteins recruited during ring maturation on mutant ring assembly processes.

In addition to the recruitment of more components, several lines of evidence suggest that the ring undergoes reorganization during maturation and constriction. First, the disappearance of Mid1 from the ring at the onset of ring constriction suggests that other proteins take over its role to anchor the contractile ring to the plasma membrane.

The post-anaphase array (PAA) of microtubules and –glucan synthase Bgs1/Cps1 contribute to the anchoring of contractile ring at the equator of the cell (Pardo and Nurse,

2003). Second, different dynamics in FRAP assays may suggest that the organization of cytokinesis nodes, fully assembled rings, and constricting rings are different, although variance exists in how these experiments were performed (Clifford et al., 2008; Yonetani et al., 2008; Coffman et al., 2009; Laporte et al., 2011). The reorganization likely prepares the ring for constriction.

Myosin-II motor activity is required for both the assembly and constriction of the contractile ring. Since the diameter of the contractile ring does not change while the ring matures, it will be interesting to investigate how the myosin-II motor activity is regulated at this time. It is possible that after node condensation into a compact ring, the motor activity is turned off during ring maturation, and activated again for constriction. It has been suggested that Rlc1, phosphorylated by Pak1, inhibits motor activity of Myo2 until

88 ring constriction (Naqvi et al., 2000; Loo and Balasubramanian, 2008). However, an in vitro assay suggested the opposite result (Sladewski et al., 2009). A Pak1 mutant with impaired kinase function accelerates ring constriction when anaphase progression is slowed down in the ase1∆ mutant (Loo and Balasubramanian, 2008), but the same phenotype was not observed with non-phosphorylatable Rlc1 in ase1+ background

(Sladewski et al., 2009). Therefore, whether the myosin-II motor is switched off during ring maturation remains elusive.

Alternatively, the lateral redistribution of ring components along the arc length during ring maturation, as observed in 4D projections of GFP-Cdc15 and Rlc1-GFP (Wu et al., 2006; Hachet and Simanis, 2008), suggests that the myosin motor may remain active at this stage. If so, ring constriction must be prevented by other mechanisms so that the ring diameter remains constant during ring maturation. It has been shown that turgor pressure in fission yeast cells is very high (Minc et al., 2009). It is possible that the force produced by active myosin-II walking on actin filaments is enough to slide actin filaments laterally along the plasma membrane during ring assembly, but not sufficient to overcome the turgor pressure to constrict the ring during ring maturation. It will be enlightening to investigate if septum formation and membrane insertion provide additional forces to overcome the high turgor pressure during ring constriction.

Ring constriction is regulated by the SIN pathway. SIN components localize to

SPBs, but Sid2 kinase and its interacting partner Mob1 (Salimova et al., 2000) also localize to the contractile ring (Sparks et al., 1999; Hou et al., 2000). Sid2 phosphorylation of Clp1 is required for the retention of Clp1 in the cytoplasm, and the

89 mutation of Sid2 phosphorylation sites on Clp1 causes defects in cytokinesis (Chen et al.,

2008). Other Sid2 substrates present in the contractile ring remain to be identified.

Our understanding of ring maturation and constriction is far from complete.

Investigating when and how different proteins are added to the contractile ring will shed light on the process of ring maturation. In addition, it is important to investigate what kind of re-organization takes place while the ring matures. Unlike in S. cerevisiae (Young et al., 2010), the cytokinesis apparatus in S. pombe has not been successfully isolated and purified yet, and its more dynamic nature and bigger diameter make it challenging. In contrast, quantitative live-cell imaging promises to be a powerful tool in determining the concentration and dynamics of ring components. 3D reconstitution or a system that allows the cells to be imaged vertically to overcome the poor z-resolution will be particularly helpful in studying the architecture of the ring and will potentially reveal the change of ring organization during ring constriction.

4.6 Conclusions and perspectives

In this chapter, we have summarized recent advances on contractile-ring assembly in fission yeast. Cytokinesis nodes assemble in a hierarchical order and condense into a compact contractile ring through a process described as the search, capture, pull, and release mechanism. Each step in the mechanism is contributed by a subset of proteins that regulate myosin-II activity and actin dynamics. Although the mechanism is less clear, the compact ring matures by recruiting additional components and undergoes remodeling before and perhaps also during its constriction.

Gaining new information to refine the established model in fission yeast will benefit the field of cytokinesis significantly. Although thoroughly investigating the function and regulation of key players such as the anillin-like Mid1, IQGAP Rng2, myosin-II complex, the F-BAR protein Cdc15, and formin Cdc12 will allow us to further examine and polish the mechanism of contractile-ring assembly, we need to keep in mind that many other proteins are likely involved in this process. In fission yeast, ~250 different proteins localize to the division site (Matsuyama et al., 2006), at least ~130 proteins have been reported to be involved in cytokinesis, and many of them are conserved from yeasts to humans (Pollard and Wu, 2010). It is necessary to analyze the genetic and physical interactions among these proteins systematically and elucidate whether they contribute to contractile-ring assembly.

4.7 Acknowledgements

We thank Dimitrios Vavylonis for critical reading of this manuscript and members of the Wu laboratory for helpful discussions. I-J.L. and V.C.C. are supported by Pelotonia

Graduate Fellowship and Elizabeth Clay Howald Presidential Fellowship, respectively. The work in J.-Q.W. laboratory is supported by The Ohio State University and National Institutes of Health grant R01GM086546.

Figure 4.1. The assembly of cytokinesis nodes and the contractile ring in fission yeast. (A) Contractile-ring assembly and cytokinesis in fission yeast. Interphase nodes are orange. Cytokinesis nodes and the contractile ring are red. Nuclei are blue. Actin filaments are green. (B) The assembly hierarchy of cytokinesis nodes. Hypothetical protein shapes/structures used in (C) are shown close to each protein name. Both the F-BAR protein Cdc15 and the Rng2-Cdc4 module (grey box) could recruit the formin Cdc12. (C) The architecture of a cytokinesis node. Yellow filaments are F-actin nucleated by Cdc12. PM, plasma membrane. (B and C) Modified from Laporte et al. 2011.

Figure 4.2. The search, capture, pull, and release mechanism of contractile-ring assembly. (A-D) Two nodes are pulled closer during the search (A), capture (B), pull (C), and release (D) process. Shaded areas (light blue) indicate the following events: (1) formin Cdc12 nucleates and elongates an actin filament from profilin-bound monomers. (2) A myosin-II motor captures the actin filament. (3) Tropomyosin stabilizes the actin filament. (4) Myosin-II motor activity induced by the UCS protein Rng3 pulls two nodes closer. (5) The crosslinking by α-actinin resists the movement. (6) The actin filament dissociates from myosin-II. (7) The actin filament is severed by cofilin. (8) The actin filament is capped at its barbed end by capping protein. (9) Cdc12 dissociates from the rest of the node.

Chapter 5: Regulation of SPB Assembly and Cytokinesis by the Centrin-Binding

Protein Sfi1 in Fission Yeast

Derived from Lee, I-J., N. Wang, W. Hu, K. Schott, J. Bähler, J. Pringle, L.-L. Du, and J.-Q. Wu. 2013. Recruitment and partition of the centrin-binding protein Sfi1 during SPB/centrosome assembly. (submitted)

5.1 Abstract

Centrosome duplication is crucial for the fidelity of cell division. Conserved from yeast to humans, Sfi1 is a centrin-binding protein proposed to be essential for the initiation of centrosome duplication. However, its recruitment to centrosomal structures has never been fully investigated, and the importance of the conserved tryptophans in its internal repeats remains untested. Here we report that Sfi1 is recruited to the spindle-pole body (SPB) throughout the cell cycle in fission yeast. A Trp-to-Arg mutant (sfi1-M46) forms monopolar spindles like an sfi1∆ mutant and exhibits abnormal septation-initiation- network (SIN) activity during cytokinesis. Although localized to interphase SPBs, Sfi1-

M46 associates preferentially with the old SPB during mitosis. SPB assembly with insufficient Sfi1 often fails, but recruitment during interphase partially restores Sfi1 levels on SPBs, and ~30% of normal Sfi1 is sufficient for SPB assembly. The importance of the tryptophans depends on the location of the repeats in Sfi1. In summary, Sfi1 appears to function on SPBs throughout the cell cycle.

5.2 Introduction

Microtubule-organizing centers (MTOCs) are the sites of microtubule (MT) nucleation in cells and are essential for the formation of the interphase MT cytoskeleton, bipolar mitotic spindles, cilia, and flagella. Centrosomes, basal bodies, and their functional equivalents in fungi, spindle-pole bodies (SPBs), are the principal MTOCs.

Centrosomes and SPBs are also the hubs of signaling pathways regulating cytokinesis

(McCollum and Gould, 2001; Piel et al., 2001; Krapp and Simanis, 2008) and cell-cycle control (Perez-Mongiovi et al., 2000; Doxsey et al., 2005; Hagan, 2008). Due to the importance of the MTOCs, their duplication and maintenance must be tightly controlled

(Nigg and Stearns, 2011), and abnormalities in these structures result in a variety of diseases including brain-development defects, ciliopathies, and cancers (Lingle et al.,

1998; Pihan et al., 1998; Fukasawa, 2007; Basto et al., 2008; Ganem et al., 2009; Nigg and Raff, 2009; Bettencourt-Dias et al., 2011).

Centrins are highly conserved calmodulin-like proteins (Salisbury et al., 1984;

Salisbury, 2007; Miron et al., 2011) that are essential for the assembly and integrity of centrosomes, SPBs, and basal bodies in many organisms (Vallen et al., 1994;

Middendorp et al., 2000; Salisbury et al., 2002; Paoletti et al., 2003; Stemm-Wolf et al.,

2005; Delaval et al., 2011; Dantas et al., 2012; Vonderfecht et al., 2012). As most centrin molecules are not centrosomal (Paoletti et al., 1996), it is not surprising that centrins are also involved in other cellular events including organelle segregation (Selvapandiyan et al., 2007), mRNA transport (Fischer et al., 2004), DNA repair (Araki et al., 2001), and protein degradation (Chen and Madura, 2008).

Various functions of centrins are exerted via different binding partners. Sfi1

(Suppressor of fil1) (Ma et al., 1999) is an important binding partner of centrin. Sfi1 contains multiple internal repeats and each repeat has a conserved Trp (Kilmartin, 2003).

Sfi1-centrin interaction is well characterized in Saccharomyces cerevisiae. Elegant structural analysis showed that in the elongated Sfi1/Cdc31 filament, each Sfi1 repeat binds to one molecule of the centrin Cdc31 (Kilmartin, 2003; Li et al., 2006). Sfi1 co- localizes with Cdc31 to the half-bridge, the electronic-dense region of the nuclear envelope next to the triple-layer core SPB (Byers and Goetsch, 1974; Spang et al., 1993;

Adams and Kilmartin, 2000; Kilmartin, 2003; Jaspersen and Winey, 2004). The elongation of the half-bridge has been proposed to be mediated by the interaction between the C-termini of two Sfi1 molecules and to initiate the assembly of the new SPB in S. cerevisiae (Jones and Winey, 2006; Li et al., 2006). However, how and when half- bridge proteins such as Sfi1 are recruited to the SPBs remain untested. The C-terminus of

Sfi1 plays a role in spindle formation (Anderson et al., 2007), but whether Sfi1 plays additional roles in SPB assembly is poorly understood. Sfi1 or Sfi1-like proteins have been found in all fungal and animal cells that have been examined so far. In addition, the ciliate Tetrahymena thermophila has 13 Sfi1-related proteins that localize asymmetrically on basal bodies (Stemm-Wolf et al., 2013), and in its relative Paramecium tetraurelia, an

Sfi1-like protein mediates centrin-based contractility of the cytoskeletal network

(Gogendeau et al., 2007). Human hPOC5 has three Sfi1-like centrin-binding repeats and is essential for centriole elongation (Azimzadeh et al., 2009). Another human homolog,

96 hSfi1, also localizes to the centrosomes (Kilmartin, 2003). Despite its interaction with human centrin 2 (Martinez-Sanz et al., 2010), the function of hSfi1 remains unclear.

Of the yeast sfi1 or cdc31 mutants identified so far, many arrest with single SPBs and monopolar spindles (Ivanovska and Rose, 2001; Kilmartin, 2003; Paoletti et al.,

2003). Interestingly, some temperature-sensitive mutants arrest in the first mitosis after a shift to restrictive temperature, whereas others can form bipolar spindles in the first mitosis and only arrest in the second cell cycle (Ivanovska and Rose, 2001; Kilmartin,

2003). Although monopolar-spindle formation is the expected final outcome of a failure in SPB duplication, it has been difficult to address the differences between these mutants, which is necessary for further understanding of the functions of centrin and Sfi1. In addition, although the importance for Sfi1 function of the highly conserved Trp in the internal repeats has been presumed (Kilmartin, 2003; Li et al., 2006), the consequences of having any of these sites mutated in vivo remain untested.

Whereas the S. cerevisiae SPB is embedded in the nuclear envelope throughout the mitotic cell cycle (Robinow and Marak, 1966; Byers and Goetsch, 1974), in the fission yeast Schizosaccharomyces pombe, the SPB is only inserted into the nuclear envelope during mitosis (McCully and Robinow, 1971; Tanaka and Kanbe, 1986). In interphase, the S. pombe SPB is very close to the cytoplasmic side of the nuclear envelope, similar to centrosomes in metazoans (Bornens, 1977). Thus, studying proteins involved in SPB assembly in S. pombe should provide valuable insights into centrosome biology. The morphology of the SPB at different cell-cycle stages and the mechanisms of

SPB duplication in S. pombe have been studied extensively using electron microscopy

(EM) (McCully and Robinow, 1971; Ding et al., 1997; Uzawa et al., 2004). SPB duplication in S. pombe was proposed to take place in G1/S (Uzawa et al., 2004).

However, the process of SPB assembly has been little studied in live cells through the cell cycle. S. pombe Sfi1 has 20 internal repeats but shares little homology with S. cerevisiae Sfi1 at the N- and C- termini, and the function of S. pombe Sfi1 besides its localization to the SPBs remains largely unknown (Kilmartin, 2003; Ohta et al., 2012).

Here we describe the first full characterization of Sfi1 in fission yeast. We began with the identification of an sfi1 mutant with cytokinesis phenotypes (sfi1-M46). The mutated residue in Sfi1-M46 is one of the conserved tryptophans. We found that the cytokinesis defects are caused by prolonged SIN activity, and that the unequal partition of

Sfi1-M46 underlies the mutant's defects in mitosis and SPB assembly. Strikingly, Sfi1 is recruited to the SPB throughout the cell cycle including G2 phase, suggesting that the current model of SPB assembly may require modification.

5.3 Materials and methods

5.3.1 Strain constructions and yeast methods

Table 5.1 lists the fission yeast strains used in this chapter. Standard genetic methods were used (Moreno et al., 1991). PCR-based gene targeting was performed as described (Bähler et al., 1998b). All constructs made in this chapter were checked by

PCR and/or DNA sequencing. New mutations in sfi1 were made using a marker- reconstitution mutagenesis described previously (Tang et al., 2011) with some modifications. An sfi1 fragment including sfi1 ORF, 70 bp of 5’ UTR, and 121 bp of

3’UTR was amplified from genomic DNA and cloned into pH5c using BamHI and BglII 98 restriction sites designed on primers. Site-directed mutagenesis was then performed as described previously (Lee and Wu, 2012) using pairs of back-to-back primers with their

5’ end right next to each other. The first nucleotide (5’) of each forward primer contains the T to C mutation that will result in W to R mutation in the encoding Sfi1 protein. Each pair of primers was used to amplify the pH5c-sfi1 plasmid, and ligation of linear PCR products resulting in plasmids with designated mutations: pH5c-sfi1(W210R), pH5c- sfi1(W345R), pH5c-sfi1(W434R), pH5c-sfi1(W573R), and pH5c-sfi1(W763R). The mutated sfi1 fragments were then amplified by PCR and transformed into a strain carrying sfi1-his5C-kan (JW4783). His5+ colonies resulted from marker reconstitution were selected and checked by PCR and sequencing.

To delete sfi1 ORF, a diploid strain carrying h+/h- pcp1-GFP-kan/pcp1-GFP-kan mRFP-atb2/mRFP-atb2 was made as described (Moreno et al., 1991). A fragment of sfi1::natMX6 with 70 bp homologous sequences to 5’ and 3’ UTR of sfi1 was then transformed into the diploid strain. Transformants that grew on YE5S – ade + Nat plate were checked by PCR to confirm the deletion of sfi1.

To stain DNA in live cells, cells were washed into EMM5S and Hoechst 33258 was added at a final concentration of 10 g/ml from a 1 mg/ml stock. After 10 min incubation in the dark at room temperature, cells were collected by centrifugation at

5,000 rpm for 30 s before imaging.

5.3.2 Microscopy and image analysis

Before microscopy, cells were grown in liquid medium at exponential phase for

~48 h at 25°C as described (Wu et al., 2006). Microscopy was performed at 23-24°C

99 unless otherwise stated. To image cells at 36°C, an objective heater (Bioptechs, Butler,

PA) was used and precautions in sample preparation were taken to maintain cells at 36°C

(Laporte et al., 2011). For most experiments, cells were prepared and imaged using the

UltraVIEW ERS spinning disk confocal microscope (Perkin Elmer Life and Analytical

Sciences, Waltham, MA) with a 100×/1.4 NA Plan-Apo objective lens (Nikon, Melville,

NY) as previously described (Coffman et al., 2009; Laporte et al., 2011). Lasers at 488,

514, and 568-nm were used to excite green, yellow, and red fluorescent proteins, respectively. A cooled charge-coupled device camera (ORCA-AG, Hamamatsu,

Bridgewater, NJ) was used with 2 × 2 binning.

Microscopic images in Figures 5.2, C and D, 5.3, B and F, 5.6 E, and 5.7, B and

C, were collected using a 100×/1.4 NA Plan-Apo objective lens on an UltraVIEW Vox

CSUX1 spinning disk confocal microscope (Perkin Elmer Life and Analytical Sciences,

Waltham, MA). Lasers at 440, 488, 515, and 561-nm were used to excite cyan, green, yellow, and red fluorescent proteins, respectively. A back-thinned EMCCD camera

(Hamamatsu C9100-13, Bridgewater, NJ) was used without binning. In experiments that require imaging of the same cells over a long period of time, 2 µl concentrated cells from a liquid culture (OD 0.2-0.5) were placed in a 35 mm dish with glass bottom (Bioptechs,

#0420041500C), and covered with a piece of YE5S agar.

For Tetrad Fluorescence Microscopy, diploid cells were restreaked onto an

SPA5S plate and incubated at 25°C for 1-3 d to induce sporulation. After dissecting tetrads and separating spores on a YE5S plate on a tetrad microscope, cells were incubated at 25°C for 0.5–2 d. Then a piece of YE5S agar with the cells to be imaged was

100 cut out from the plate and inverted onto a 60 mm x 24 mm cover slip (FisherBrand

#22266882). Positions of colonies on the automated stage of the UltraVIEW Vox CSUX1 system were found and saved, and acquisition of multiple XY points at every time point was performed using Volocity software.

Microscopic images shown in Figures 5.1 G, 5.9 D, and 5.10 B were collected using a 100×/1.4 NA Plan-Apo objective lens on a Nikon Eclipse Ti inverted microscope equipped with a Nikon cooled digital camera DS-QI1 and with DIC and DAPI filters.

Images in figures are maximum-intensity projections of z sections spaced at 0.2-0.6 m except where noted. Merged pictures of two channels were generated using UltraVIEW,

Volocity, or ImageJ. The distance between Pcp1 and Sfi1 in Figure 5.3E was defined as

[(Pcp1-Pcp1 distance) – (Sfi1-Sfi1 distance)] /2. The distance between two Pcp1 or Sfi1 peaks was measured from line-scans. The same method was used to calculate the distance between Pcp1 and Sad1.

5.3.3 Quantification of protein molecules

Fluorescence intensity was quantified as described (Wu and Pollard, 2005; Wu et al., 2008; Laporte et al., 2011) with some modifications. For fluorescence intensity on

SPB, the focal plane with the maximum intensity was used since all the quantified proteins are on the same structure, the SPB. The florescence intensity in a 6 x 6 pixel ROI was measured and a concentric 10 x 10 pixel ROI was used to correct the cellular background. We also counted protein molecules using the sum intensity of z sections spaced at 0.4 m for each SPB, and the results are statistically indistinguishable from the numbers we obtained using the best focal plane. To convert fluorescence intensity to

101 number of molecules, cells expressing Sad1-mEGFP or Sad1-tdTomato in early mitosis

(distance between 2 SPBs < 2 m) were used as standards and the mean number of Sad1 on each SPB (n > 20) is set at 500 molecules (Wu and Pollard, 2005).

For interphase or septating cells, cell area (A) was measured and converted to cell length. The 2D shape of a fission yeast cell was assumed to be a rectangle capped by a semi-circle at each end, and that the cell-width and thus the diameter of the circle is 4

m. Therefore, if cell length is Lm, the cell area (A) measured is equal to the area of the rectangle [(L - 4) × 4] plus the area of two semi-circles π × 2 × 2. Therefore, cell area can be converted to cell length using the following equation: L = A/4 – π + 4. For cells with 2 SPBs and no septum (mitotic cells), we used the 3D distance between 2 SPBs as the spindle length.

5.3.4 Whole genome sequencing to identify the M46 mutation

About 109 M46 cells grown on a YES plate were harvested and genomic DNA was extracted using the MasterPure Yeast DNA Purification Kit (Epicentre

Biotechnologies). Genomic DNA was fragmented to the size range of 200-1000 bp by sonication. Fragmented DNA was end repaired and dA-tailed using the NEBNext kit

(NEB), and ligated to pre-annealed adaptor oligos (5'-

ACACTCTTTCCCTACACGACGCTCTTCCGATCTGTAT-3’ and 5'-P-

TACAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG-3’). The ligation products between 300 to 500 bp were size-selected by gel purification and amplified by PCR for

14 cycles using primers 5’-

AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCC

102

GATCT-3’ and 5’-

CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTC

TTCCGATCT-3’. The PCR product was purified with the Illustra GFX kit (GE

Healthcare) and sequenced on an Illumina Hi-Seq 2000 for 49 cycles using the standard sequencing primer. Sequencing read mapping and SNP calling were carried out using

MAQ (Li et al., 2008). Annotation of the SNPs was performed with SnpEff (Cingolani et al., 2012).

5.3.5 Electron microscopy

To synchronize cells at G1/S, strains sfi1+ cdc10-V50 (JW5132) and sfi1-M46 cdc10-V50 (JW5130-3) were cultured at 25°C for 2 d in log phase and shifted to 36°C for

4.5 h. Cell preparations for EM were performed as described previously (Giddings et al.,

2001). Briefly, cells were harvested on Millipore filters and frozen in a Wohlwend

Compact 02 High Pressure Freezer. The cryofixed cells were freeze-substituted in the presence of 2% osmium tetroxide and 0.1% uranyl acetate in acetone, and embedded in

Epon-Araldite epoxy resin. Blocks of embedded cells were serially sectioned at a thickness of 70 nm and post stained with uranyl acetate and lead citrate. Sections were then observed on a Philips CM100 transmission electron microscope (FEI Company,

Hillsboro, OR).

5.4 Results

5.4.1 A conserved Trp is mutated in the sfi1-M46 mutant

To identify potential regulators of cytokinesis, we examined several uncharacterized morphogenetic mutants that were isolated in a previously described 103 screen (Bähler and Pringle, 1998; Bähler et al., 1998a). Wild-type (wt) cells form a single septum perpendicular to the long axis of the cell. In contrast, the M46 mutant exhibited typical cytokinesis defects including long and unseptated cells, cells with multiple and/or aberrant septa, or cell lysis (Figure 5.1 A). To identify the mutation, the genome of M46 was sequenced, and a T to C mutation at the sfi1 locus that changes the conserved Trp in the 9th internal repeat to Arg was found (W434R) (Figure 5.1, B and C). When this mutation was introduced into a wt strain, the same defects were observed, confirming that the phenotypes observed in M46 are due to the W434R mutation in sfi1. Thus, we renamed the mutant sfi1-M46. Because it has never been reported that Sfi1 or Sfi1-like proteins are involved in cytokinesis, we further investigated the functions of Sfi1 and how cytokinesis is affected in sfi1-M46 cells.

5.4.2 Prolonged SIN activity, mitotic defects, and aberrant septation in sfi1-M46 cells

We characterized the cytokinesis defects in sfi1-M46 cells and found that many septating cells had >1 septum (Figure 5.1 D). In addition, although wt cells only form a septum when they are ~14 m in length (Martin and Berthelot-Grosjean, 2009; Moseley et al., 2009), many septating sfi1-M46 cells were shorter than 9 m (Figure 5.1 E). In S. pombe, septum formation is regulated by the SIN pathway (Krapp and Simanis, 2008;

Goyal et al., 2011). We examined SIN activity using a Cdc7-EGFP marker, which only localizes to the SPB with active Spg1 GTPase (Sohrmann et al., 1998; Grallert et al.,

2004). In wt cells, Cdc7 localized to the new SPB during mitosis and began to disappear during contractile-ring constriction (Figure 5.1 F). In contrast, in sfi1-M46 we frequently

104 observed the assembly of an additional contractile ring after the first one constricted or disappeared (Figure 5.1 F), and Cdc7 signal persisted in these cells, suggesting that the cytokinesis defects in sfi1-M46 are due to prolonged SIN activity.

Mitotic defects were observed in several S. cerevisiae sfi1 mutants because of the

Sfi1 role in SPB duplication and spindle formation (Kilmartin, 2003; Anderson et al.,

2007). Similarly, sfi1-M46 cells also had defects in mitosis that appeared to be related to their cytokinesis defects. In 85% of cells with multiple or aberrant septa (n = 76), nuclear

DNA was either located in one of the daughter cell compartments or stuck in the middle of the cell (Figure 5.1 G), similar to what is observed with the cut mutants (Hirano et al.,

1986). Although we cannot rule out the possibility that Sfi1 plays additional roles in regulating cytokinesis, it appears that mitotic defects precede cytokinesis defects in the majority of sfi1-M46 cells, and thus we focused our studies on how Sfi1 regulates mitosis and SPB assembly.

5.4.3 Sfi1 is essential for SPB assembly and bipolar-spindle formation

To confirm the importance of Sfi1 in mitosis and SPB assembly, we observed the phenotypes of sfi1 cells. Pcp1, the homolog of S. cerevisiae core SPB protein Spc110 and human pericentrin (Knop and Schiebel, 1997; Flory et al., 2002), and the -tubulin

Atb2 were tagged with GFP and mRFP to visualize SPBs and spindles, respectively. We generated a diploid strain with pcp1-GFP mRFP-atb2 on both copies of chromosomes and deleted one copy of sfi1 in this strain (sfi1::natMX6/sfi1+ pcp1-GFP/pcp1-GFP mRFP-atb2/mRFP-atb2). When sporulation was induced, only two of the four spores from a tetrad formed visible colonies after tetrad dissection (Figure 5.2 A), confirming

105 that sfi1 is an essential gene as revealed by genome-wide gene deletions (Kim et al.,

2010). Germinated sfi1 cells died as a group of 2-15 cells (Figure 5.2 B). Interestingly, using Tetrad Fluorescence Microscopy, we revealed that all four germinated spores from the same tetrad formed bipolar spindles in their first mitotic division (Figure 5.2 C, n = 9 tetrads). Monopolar spindles were observed in two out of four colonies from the second mitotic division, distinguishing sfi1 cells from wt (Figure 5.2 D, n > 10 tetrads).

Consistent with the fact that many sfi1 colonies grew beyond 2 cells, bipolar spindles were also observed at some second divisions. Our results indicate that Sfi1 is essential for

SPB and bipolar-spindle assembly, although the maternal contribution of Sfi1 is sufficient for successful mitosis at the first cell cycle.

5.4.4 Sfi1 localizes to a region between two newly separated SPBs

To further understand Sfi1 function, we tagged the endogenous Sfi1 with fluorescent proteins at its C-terminus to examine its localization. Strains with tagged Sfi1 displayed no morphological or cell-cycle defects under normal culturing conditions. Sfi1 localized to SPBs (Figure 5.3 A) as expected (Kilmartin, 2003). To determine whether

Sfi1 localizes to a specific region of the SPB, we analyzed the spatial relationship between Sfi1 and Pcp1 in cells with two newly separated SPBs (distance between two

Pcp1 fluorescence peaks is <1 m). Sfi1 localized to the region between two Pcp1 foci

(Figure 5.3, B and C). The distance between the C-terminus of Sfi1 and Pcp1 was ~100 nm (Figure 5.3 E), very close to the length of half-bridge in S. cerevisiae (Li et al., 2006).

In contrast, the peaks between two foci of the SUN domain protein Sad1 (Hagan and

Yanagida, 1995) overlapped with those of Pcp1 in cells at the same stage (Figure 5.3, B, 106

D, and E), suggesting that Sad1 localization is different from that of Sfi1 (see 5.5

Discussion).

As expected, Sfi1 co-localized well with Cdc31, the S. pombe centrin (Figure 5.3

F). The fluorescence intensity of Sfi1 roughly correlated with that of Cdc31 (Figure 5.3

G), although in this strain GFP-Cdc31 is expressed ectopically (Ohta et al., 2012).

Together, we conclude that S. pombe Sfi1 localizes to a region that is similar to the half- bridge in S. cerevisiae. We henceforth call this region the half-bridge, although in S. pombe this structure is not part of the nuclear membrane (Ding et al., 1997), and thus the term half-bridge is defined differently in S. pombe compared to S. cerevisiae.

5.4.5 Sfi1 is recruited to SPBs gradually throughout the cell cycle

Using the fluorescence intensity of Sfi1-mEGFP and known standard Sad1 (Wu and Pollard, 2005), we quantified the numbers of Sfi1 molecules in cells and on SPBs.

On average, a cell had ~2000 Sfi1 molecules (Figure 5.3 H). Sfi1 molecules increased with cell lengths (Figure 5.3 I) while Sfi1 concentration remained constant (Figure 5.3 J).

In S. pombe, SPB duplication was proposed to take place in G1/S (Uzawa et al.,

2004), which is earlier than the separation of two daughter cells after cytokinesis

(Mitchison and Nurse, 1985). If the current model of SPB duplication in budding yeast

(Li et al., 2006) can be applied to S.pombe, the number of Sfi1 molecules on SPBs should double prior to G1/S. We quantified Sfi1 on the SPB in non-synchronous cells throughout the cell cycle using the spindle length (measured using the SPB distance), septum, and cell length as indicators of cell-cycle stages (Figure 5.3 K). 360 ± 80 Sfi1 molecules (n =

23 cells longer than 12 m) were on the SPB before a cell enters mitosis (Figure 5.3 L).

107

Upon entry of mitosis, the two SPBs separated, resulting in two Sfi1 foci, each with 170

± 60 Sfi1 (n = 26 SPBs) when the spindle was short (<5 m). The number of Sfi1 on the

SPB subsequently increased. Surprisingly, we found that septating cells had 220 ± 60

Sfi1 on each SPB, only ~30% more than that in early mitosis. Cells continued to recruit more Sfi1 to the SPB in G2 until it enters the next mitosis (Figure 5.3 L). Collectively,

Sfi1 is recruited to the SPB gradually throughout the cell cycle.

5.4.6 Loss of Sfi1 on the SPB causes mitotic defects

Next we tested whether the mitotic defects in sfi1-M46 cells are related to localization of Sfi1 to the SPB. We tagged Sfi1-M46 at its C-terminus with mEGFP. Sfi1 colocalized with Sad1-tdTomato foci (SPB) in 100% wt cells. However, Sfi1-M46 is defective in localizing to the SPB in a subset of cells (Figure 5.4 A). Interestingly, we found that ~20% sfi1-M46 cells formed monopolar spindles with MTs nucleated from one Pcp1 foci (Figure 5.4 B, asterisk). We then investigated whether the lack of Sfi1-

M46 was related to the inability to form bipolar spindles. Indeed, none of the cells with monopolar spindles had detectable Sfi1-M46 on SPB (Figure 5.4 C).

~80% sfi1-M46 (n = 56) and 100% wt (n = 35) cells formed bipolar spindles

(Figure 5.4 B, arrowheads). In wt cells, the spindle always connected two Sfi1 foci because Sfi1 localized to half-bridge adjacent to both SPBs (Figure 5.4 D). Interestingly, in some sfi1-M46 cells that formed bipolar spindles, only one spindle pole had Sfi1-M46- mEGFP, and usually this focus was quite bright (Figure 5.4 D). In some cells Sfi1-M46 was absent or below our detection limit on both spindle poles. Together, these data suggest that the absence of Sfi1-M46 on SPB causes monopolar spindles, and that even in

108 cells forming bipolar spindles, the distribution of Sfi1-M46 is abnormal. FRAP analysis showed that both Sfi1 and Sfi1-M46 were quite stable on SPBs (Figure 5.5), indicating that the mitotic defects in sfi1-M46 cells are not due to different Sfi1 dynamics.

5.4.7 SPB duplication is affected in sfi1-M46

To understand why Sfi1-M46 failed to localize to some SPBs, we further quantified the number of Sfi1 and Sad1 (Figure 5.4, E and F) at different cell-cycle stages. We found sfi1-M46 cells with no Sfi1 or excess Sfi1 on SPB regardless of cell length (Figure 5.4 E). Similar to Sfi1, Sad1 on SPB increased during septation and G2 phase in wt cells (Figure 5.4 F), suggesting that the recruitment of SPB proteins in G2 is not specific to Sfi1. In sfi1-M46 cells, many long cells could not divide and arrested with one SPB. Interestingly, the number of Sad1 on the SPB in these cells was usually close to either 500 or 1,000 molecules (Figure 5.4 F). Given that in wt cells, Sad1 numbers on

SPB double from 500 to 1000 in one cell cycle (Wu and Pollard, 2005), our results suggest that SPB assembly is defective in cells arrested with ~500 Sad1, and that the new

SPB is at least partially assembled in cells that arrested with ~1000 Sad1, although other defects (e.g., spindle formation) may prevent SPBs from separating.

We used EM to visualize the morphology of wt and mutant SPBs. sfi1+ cdc10-

V50 cells arrest with duplicated SPBs connected by the electron-dense bridge (Uzawa et al., 2004). Depending on the angle of sectioning, duplicated SPBs appeared as an extended structure with a clear bridge in one section (Figure 5.4 G) or as an ellipse present in multiple serial sections (Figure 5.4 H). When sfi1-M46 cdc10-V50 cells were synchronized under the same condition, the morphology of the SPB was altered. The

109 elliptical electron density corresponding to the SPB and bridge appeared in fewer sections than in sfi1+ cells even though the size of the ellipses was similar, suggesting that those

SPBs had not duplicated (36%, n = 25; Figure 5.4 I). In addition, bulges on nuclear envelope were frequently observed in sfi1-M46 cdc10-V50 (Figure 5.4 J). The invagination of the nuclear envelope and the deposition of the dark material between the

SPB and the nuclear envelope is a normal part of SPB maturation (Ding et al., 1997;

Uzawa et al., 2004). However, in sfi1-M46 cdc10-V50, dense aggregates were found in the cytoplasm near the SPB (56%, n = 9; Figure 5.4 J). These aberrant structures may include components of the cytoplasmic plaque of the SPB and/or mutant Sfi1-M46 and other components of the bridge. Based on the observed morphology, it was difficult to discern whether the primary defect lies in formation of the half-bridge or represents a failure to initiate assembly of the daughter SPB. Nevertheless, our EM data confirmed that SPB assembly is affected in sfi1-M46 cells.

5.4.8 Sfi1-M46 prefers to stay on the old SPB

The range of Sfi1-M46 molecules on the SPB during mitosis was very wide

(Figure 5.4 E), although the average was similar to that of wt Sfi1 (Figure 5.4 E, 180 ±

170 molecules/SPB, n = 16). However, the range of Sad1 molecules on the SPB in sfi1-

M46 cells during mitosis were indistinguishable from those of wt cells (Figure 5.4 F, 480

± 160 molecules/SPB, n = 16). In wt cells, the differences of Sad1 and Sfi1 between two

SPBs in the same cell were small (Figure 5.6, A-D). In sfi1-M46 cells, while the difference of Sad1 between a pair of SPB is only slightly affected, the amount of Sfi1 can be as different as 100% (Figure 5.6, C and D).

110

Because we often observed Sfi1-M46 on only one SPB during mitosis (Figure 5.4

D), we tested whether it showed any preferences on the new vs. old SPB. We compared the localization of Sad1, Cdc7, and Sfi1 in wt and sfi1-M46 cells. Sad1 was used to confirm the existence of two SPBs in each cell that we analyzed, and Cdc7 marks the new SPB in late anaphase. In wt cells, 30 min after SPB separation, all cells had Cdc7 on one (new) SPB and Sfi1 on both SPBs (Figure 5.6, E and F, type I). In sfi1-M46, 47% cells had Sfi1-M46 only on the old SPB (type II), and 13% had Sfi1-M46 only on the new SPB (type III). Mitosis without visible Sfi1-M46 was occasionally observed, but the percentage was low (4%). We conclude that Sfi1-M46 has a preference to stay on the old

SPB during SPB separation.

5.4.9 Recruitment of Sfi1-M46 in interphase prevents mitotic defects caused by unequal partition of Sfi1-M46

Our findings described above led us to hypothesize that the partition of Sfi1 is critical for SPB assembly and spindle formation in the next cell cycle (Figure 5.7 A). In wt cells, when a pair of SPBs separate, each of them inherits similar amounts of Sfi1, and both are able to duplicate themselves later. In sfi1-M46, however, the unequal partition results in SPBs carrying various amounts of Sfi1. If the amount of Sfi1 on the SPB is not sufficient for new SPB assembly, cells will exhibit defects in the next mitosis. Because of the continuous recruitment of Sfi1 to the SPB in wt cells (Figure 5.3 L), and because the percentage of cells display monopolar spindles (20%) are lower than the percentage of daughter cells without visible Sfi1 signal in mitosis (34% - 37%, calculated from the percentages of cells with 2, 1, or 0 foci of Sfi1 at this stage. See Figures 5.4 D and 5.5

111

F.), we propose that some daughter cells with little Sfi1 to begin with may recruit more

Sfi1 to the SPB in interphase, assemble the new SPB, and form bipolar spindle in the next mitosis.

To test this hypothesis, cells were imaged for two cell cycles. In wt cells after

SPB separation, each daughter cell received an SPB with similar amounts of Sfi1 (Figure

5.8 B), and both formed bipolar spindles in the next cell cycle (Figure 5.7 B). In sfi1-

M46, unequal partition of Sfi1-M46 was observed frequently (Figure 5.7 C and 5.8 C).

Cells that failed to recover Sfi1-M46 in interphase arrested with monopolar spindles

(53%, n = 43; Figure 5.7 C and 5.8 C, i). As predicted, 47% of daughter cells that had no visible Sfi1-M46 signal before cell separation were able to recruit more Sfi1-M46 in interphase and formed bipolar spindles in the next mitosis (Figure 5.7 C and 5.8 C, ii).

The numbers of Sfi1 and Sfi1-M46 foci in two consecutive cell cycles was classified

(Figure 5.7 D), and we found that unequal partition of Sfi1 could happen regardless of the number of Sfi1-M46 foci in the previous cell cycle. Moreover, we confirmed the recruitment of Sfi1 to SPB throughout the cell cycle (Figure 5.3 L) by measuring fluorescence intensities of Sfi1 on SPB over time (Figure 5.7 E). The recruitment of Sfi1 to SPB was faster at a rate of ~2.3 molecules/min during mitosis, and at a slower but steady rate of ~0.6 molecules/min in the rest of the cell cycle.

Collectively, we revealed that a mutation in the conserved Trp of Sfi1 affects its partition during SPB separation and results in mitotic defects in the next cell cycle, but the recruitment of Sfi1 to SPB in interphase can promote SPB assembly and partially prevent the mitotic defects.

112

5.4.10 Repressing Sfi1 to ~30% of its endogenous level does not significantly affect

SPB assembly

Although the amount of Sfi1 was variable in sfi1-M46 cells (Figure 5.4 E), ~80% cells can still formed bipolar spindles at 25°C. We therefore hypothesize that SPB can assemble with a lower amount of Sfi1. To test this hypothesis, we used a P81nmt1- mEGFP-sfi1 strain in which the expression of sfi1 gene was controlled by the repressible

81nmt1 promoter. Under repressing condition, the level of Sfi1 on SPB was ~30% of the endogenous level (Figure 5.9, A and B). Although Sfi1 is essential (Figure 5.2 A) (Kim et al., 2010), P81nmt1-mEGFP-sfi1 cells appeared normal at 25°C, and showed very mild mitosis and cytokinesis defects after 14 h at 36°C (Figure 5.9 D). Surprisingly, the number of Sad1 on SPB in P81nmt1-mEGFP-sfi1 cells was not distinguishable from that of wt cells (Figure 5.9 C), suggesting that ~30% of endogenous Sfi1 is sufficient for the assembly of new SPBs.

5.4.11 Mutating other conserved Trps revealed that the repeats in Sfi1 are not identical

S. pombe Sfi1 has 20 internal repeats with conserved Trp. W434R mutation in sfi1-M46 is in the 9th repeat. To investigate whether the repeats are equally important for

Sfi1 functions, we mutated the conserved Trp in the 1st (W210), 6th (W345), 14th (W573), and 20th (W763) repeats to Arg (Figure 5.10 A). Strains carrying the above mutations were all viable. All of them exhibited mitosis and cytokinesis defects similar to sfi1-M46 but to different extents (Figure 5.10, B and C). At 25°C, the more C-terminal the mutation is, the more severe the phenotype was. However, sfi1(W210R) cells were

113 temperature sensitive (Figure 5.10, B and C). Indeed, when Pcp1 and Atb2 in these mutants were examined, we found that sfi1(W210R) cells formed bipolar spindles at 25°C but monopolar spindles at 36°C (Figure 5.10 D). In contrast, spindle-formation defects of sfi1(W345R), sfi1(W573R), and sfi1(W763R) cells were similar at 25°C and 36°C (Figure

5.10 D). Like Sfi1-M46, the localization of each W to R mutant to the SPB (marked by

Sad1-tdTomato) was defective in a subset of cells (Figure 5.10 E). Interestingly, localized

Sfi1(W763R) were found in many long cells arrested with a single SPB focus (Figure

5.10 E, asterisk), suggesting that defects in sfi1(W763R) cells are not only due to the lack of localized Sfi1(W763R). Together, although all W to R mutants including sfi1-M46 have similar phenotypes, our results suggest that the repeats in Sfi1 are not identical for

Sfi1’s function in SPB assembly and spindle formation.

5.5 Discussion

5.5.1 The model of SPB assembly

SPB assembly includes SPB duplication and SPB maturation (Uzawa et al.,

2004). In S. cerevisiae, the SPB is duplicated by the end of G1 (Byers and Goetsch, 1974,

1975). The bridge between the duplicated SPBs is severed and a short spindle is formed during late S phase (Lim et al., 2009). The current model of SPB duplication in S. cerevisiae was proposed based on EM images and Sfi1 ultrastructure. The length of the

SPB bridge is approximately twice as long as that of the half-bridge right next to an unduplicated SPB. Occasionally, an unduplicated SPB with a full-length bridge was found (Li et al., 2006). Immuno-EM shows that the N-terminus of Sfi1 is close to the edge of core SPBs and the C-terminus close to the edge of the half-bridge. Therefore, it 114 has been proposed that the duplication of half-bridge by the interaction between C- termini of two Sfi1 molecules marks the initiation of new SPB assembly (Jones and

Winey, 2006; Li et al., 2006). This model would suggest that the number of Sfi1 molecules on SPB should double during SPB duplication.

Surprisingly, Sfi1 is recruited to SPBs throughout the cell cycle in S. pombe, with fastest rate during mitosis (Figures 5.3 L, 5.4 E, and 5.7 E). It has been proposed that S. pombe SPB is duplicated at G1/S, because duplicated SPBs were found in cells arrested in G1/S but not in G1 cells (Uzawa et al., 2004). The key difference between our study and Uzawa et al. is that we analyzed unsynchronized cells at single-cell level. Because the number of Sfi1 increases continuously throughout the cell cycle, it is unlikely that new SPB assembly only begins after Sfi1 level doubles on SPB. More likely, we propose that the initiation of SPB assembly takes place with limited amount of Sfi1, and the assembly continues throughout the cell cycle while more Sfi1 are recruited (Figure 5.10

F). Our result is consistent with earlier observations that unduplicated SPB was observed in a number of wt G2 cells (Ding et al., 1997; Hoog et al., 2013). It will be interesting to know how Sfi1 is recruited to SPBs throughout the cell cycle in S. cerevisiae and other organisms. The difference on SPB assembly may also reflect the earlier formation of the spindle in S. cerevisiae (during S phase) than in S. pombe and metazoan cells (early mitosis). Thus, the timing and mechanism of Sfi1 recruitment could be distinct in S. cerevisiae.

5.5.2 Sfi1 partition and inheritance

115

Here we describe a mutant sfi1-M46 that exhibits defects in Sfi1 partition during mitosis, and the unequal partition underlies SPB-assembly and mitotic defects in the next cell cycle (Figures 5.7 A and 5.11). ~50% sfi1-M46 cells that did not inherit obvious

Sfi1-M46 can recover and form bipolar spindle in the next cell cycle. It will be interesting to investigate whether the cell cycle is affected in these cells and what the minimum time required for SPB assembly is. It will not be surprising to find similar defects in other known half-bridge mutants, especially the ones that arrest at the second mitosis at the restrictive temperature (Ivanovska and Rose, 2001; Kilmartin, 2003). The unequal partition in sfi1-M46 resulted from a mutation in the conserved Trp. It is possible that the binding of Cdc31 to the 9th repeat is affected or abolished. Although the loss of one out of

20 Cdc31 binding sites might not make a big difference in Cdc31 recruitment to SPB, the mutation more likely affect the structure of the Cdc31 filament scaffolded by Sfi1. Varied defects in different W to R mutants support this speculation. It will be interesting to investigate whether unequal Sfi1 partition happens in different W to R mutants as well, and whether any age-dependent modifications on SPB contribute to the preference of

Sfi1-M46 to the old SPB.

During SPB separation, the connection between two SPBs must be broken.

Centrosome separation and spindle formation are under the control of CDK and Polo kinase (Lim et al., 1996, 2009; Mayer et al., 1999; Crasta et al., 2008). However, elements on the bridge that response to these signals are unclear, although defects in spindle elongation have been found in some S. cerevisiae sfi1 mutants (Anderson et al.,

2007). In animal cells, two centrosomes are connected by a fibrous linker consisting of

116

Rootletin and C-Nap (Fry et al., 1998; Yang et al., 2002). Severing of the fibrous linker between two centrosomes is triggered by NimA-related kinase Nek2 (Bahe et al., 2005;

Bahmanyar et al., 2008). Fin1, the NimA kinase in S. pombe (Krien et al., 1998), also localizes to SPB (Grallert et al., 2004). Although spindle-formation defects were observed in fin1 mutants (Grallert and Hagan, 2002), whether Fin1 is involved in SPB separation is unknown.

5.5.3 Half-bridge proteins in S. pombe and S. cerevisiae

The half-bridge is the electron-dense region next to the core SPB and is essential for new SPB assembly (Jaspersen and Winey, 2004). In addition to Cdc31 and Sfi1, two transmembrane proteins Kar1 (Rose and Fink, 1987; Spang et al., 1995) and Mps3

(Jaspersen et al., 2002; Nishikawa et al., 2003) also play structural roles in the

S. cerevisiae half-bridge.

No Kar1 homolog has been identified in S. pombe so far. Mps3 contains a C- terminus SUN domain (Jaspersen et al., 2006). S. pombe Sad1 is a founding member of the SUN protein family (Hagan and Yanagida, 1995). Overexpression of Sad1 in S. cerevisiae partially rescued mps3 phenotypes (Jaspersen et al., 2006). Our study shows that Sad1 localizes to a region distinct to Sfi1 (Figure 5.3). Whether Sad1 localizes to the interface of SPB and half-bridge like Mps3 (Jaspersen et al., 2002) requires further investigation using immuno-EM, single-molecule high resolution colocalization

(Churchman et al., 2005; Joglekar et al., 2009), or super resolution microscopy. S. pombe

SPB is not inserted into the nuclear envelope until mitotic entry (McCully and Robinow,

1971; Tanaka and Kanbe, 1986), and how the S. pombe half-bridge interacts with the core

117

SPB remains to be investigated. It will be interesting to test whether Sad1 plays a role in linking SPB to half-bridge or SPB insertion like Mps3 (Araki et al., 2006; Jaspersen et al., 2006; Friederichs et al., 2011).

5.5.4 The regulation of centrosome and SPB assembly

Our study provided new mechanistic insights into SPB assembly in S. pombe.

However, many interesting questions remain to be investigated. The abnormal dark material in EM suggests that Sfi1 likely plays a role in SPB maturation. The keys to further understand SPB assembly lie in protein-protein interactions involving Sfi1 and post-translational modifications of Sfi1. While the tail-to-tail architecture of half-bridge and Sfi1 proposed in S. cerevisiae is appealing (Li et al., 2006), the interaction between

C-termini of two Sfi1 molecules remains to be tested. Unlike the S. cerevisiae half- bridge, no obvious elongation of the S. pombe half-bridge was observed during the cell cycle (Ding et al., 1997). Understanding Sfi1-Sfi1 interaction will likely elucidate the structure of the half-bridge in S. pombe. Whether Sfi1-Cdc31 filaments interact with each other at all, and if they do, in a parallel of anti-parallel manner, requires further investigation. Binding partners of Sfi1 other than Cdc31 are unknown. These protein- protein interactions may also exist in higher eukaryotes, since it has been postulated that

Sfi1 and centrin form the duplication unit that evolved into the cartwheel in centriole duplication (Salisbury, 2007).

Investigating whether half-bridge proteins in S. pombe are under the regulation of kinases will help us understand the mechanism of new SPB assembly. In eukaryotes, the duplication of the SPB or centrosome is regulated by phosphorylation. S. cerevisiae half-

118 bridge proteins are all phosphoproteins (Keck et al., 2011), and Sfi1 is a potential substrate of Cdc14 phosphatase (Bloom et al., 2011). The phosphorylation status of

Cdc31 and Sfi1 in S. pombe, however, is unknown. Purified Cdc31 cannot be phosphorylated by CDK or Polo kinase in vitro (Ohta et al., 2012). Mps1 kinase and

Polo-like kinase Plk4 are important for centrosome duplication (Winey et al., 1991;

Weiss and Winey, 1996; Fisk et al., 2003; Kleylein-Sohn et al., 2007; Peel et al., 2007;

Rodrigues-Martins et al., 2007). Mps1 substrates include centrins (Araki et al., 2010;

Yang et al., 2010). However, whether Mph1 and Plo1, the S. pombe homologs of Mps1 and Polo kinase, are involved in SPB assembly, remains unclear. While Mph1 is required for spindle assembly checkpoint (Ito et al., 2012; Shepperd et al., 2012; Yamagishi et al.,

2012; Zich et al., 2012), the lack of obvious growth defects in mph1 cells suggests that it plays no major roles in SPB assembly (He et al., 1998). Plo1 localizes to the SPB during mitosis (Mulvihill et al., 1999) and regulates mitotic entry and cytokinesis (Bähler et al., 1998a; Mulvihill and Hyams, 2002; MacIver et al., 2003; Almonacid et al., 2011).

Although Plo1 function is related to SPB reorganization in meiosis (Ohta et al., 2012), a direct role of Plo1 in SPB duplication has not been reported.

5.5.5 Roles of Sfi1 in cytokinesis

SPB is the hub of signaling pathways that regulate cytokinesis (Bardin and Amon,

2001; McCollum and Gould, 2001; Pereira and Schiebel, 2001). S. pombe cdc31 mutants have cytokinesis defects similar to sfi1 mutants we described in this chapter (Paoletti et al., 2003). Because the asymmetry of SIN signaling is required for proper mitotic exit, it is not too surprising that defects in SPB assembly or separation results in misregulation of

119

SIN activity and the formation of aberrant or additional septa. Although ~15% sfi1-M46 cells with cytokinesis defects have normal-looking DNA or nuclei (Figure 5.1 G), whether Sfi1 or the half-bridge regulates cytokinesis independent of SPB assembly remains to be investigated. We have not successfully isolated any separation-of-function sfi1 mutants so far. Although Sfi1-M46 prefers the old SPB during mitosis, no obvious correlations were found between the partition of Sfi1 and cytokinesis defects.

In summary, we uncovered the spatial relationship between SPB proteins, characterized Sfi1 recruitments throughout the cell cycle, and revealed the importance of

Sfi1 partition on cell-cycle progression. Together with several previous publications, our study highlights that quantitative live-cell microscopy is essential for studying dynamic processes such as SPB assembly and separation (Yoder et al., 2003; Muller et al., 2005;

Dammermann et al., 2008; Sonnen et al., 2012; Menendez-Benito et al., 2013). Our findings argue that the roles of Sfi1 in centrosome assembly are more complex than current model suggested and further investigation in different model systems is needed to unravel the complexity.

5.6 Acknowledgement

We thank J. Richard McIntosh for advice on electron microscopy; Mohan

Balasubramanian, Viesturs Simanis, Takashi Toda, and Masayuki Yamamoto for sharing strains; Vitaliy Rotenberg, Christina Clarissa, and Courtney Ozzello for technical assistance; members of the Wu laboratory for insightful discussions. We would also like to thank Anne Paoletti for communication of unpublished results. This work is supported by a Pelotonia Graduate Fellowship to I-J.L., National Institutes of Health grants 120

GM086546 to J.-Q.W. and GM31006 to J.R.P., and grants from the Chinese Ministry of

Science and Technology and the Beijing Municipal Government to L.-L.D.

121

Table 5.1. S. pombe strains used in this chapter. Strain Genotype Source JW729 h+ ade6-M210 leu1-32 ura4-D18 Wu et al., 2003 JW3887 h+ sfi1-M46 ade6-M216 leu1-32 ura4-D18 This study JW4361 h- sfi1-mEGFP-kanMX6 ade6-M210 leu1-32 ura4-D18 This study JW4557 sfi1-M46 cdc7-EGFP-kanMX6 rlc1-tdTomato-natMX6 ade6 leu1-32 This study ura4-D18 JW4558 h+ cdc7-EGFP-kanMX6 rlc1-tdTomato-natMX6 ade6 leu1-32 ura4- This study D18 JW4615 h- kanMX6-81nmt1-mEGFP-sfi1 ade6-M210 leu1-32 ura4-D18 This study JW4675 h- sfi1-tdTomato-natMX6 lys1::nmt1-GFP-cdc31-kan ade6 leu1 ura4 This study JW4685 pcp1-GFP-kan sfi1-tdTomato-natMX6 ade6 leu1 ura4 This study JW4783 h+ sfi1-his5C-kanMX6 his5 ade6-M210 leu1-32 ura4 This study JW4827 sad1-tdTomato-natMX6 pcp1-GFP-kan ade6 leu1 ura4 This study JW4829 Patb2-mRFP-atb2 sfi1-mEGFP-kanMX6 ade6-M210 leu1-32 ura4- This study D18 JW4831 Patb2-mRFP-atb2 sfi1-M46-mEGFP-kanMX6 ade6 leu1-32 ura4- This study D18 JW4841 sad1-tdTomato-natMX6 sfi1-mEGFP-kanMX6 ade6-M210 leu1-32 This study ura4-D18 JW4842 sad1-tdTomato-natMX6 sfi1-M46-mEGFP-kanMX6 ade6 leu1-32 This study ura4-D18 JW5088 sad1-tdTomato-natMX6 kanMX6-81nmt1-mEGFP-sfi1 ade6-M210 This study leu1-32 ura4-D18 JW5130-3 cdc10-V50 sfi1-M46-his5+-kanMX6 leu1-32 ura4 This study JW5132 h+ cdc10-V50 ade6-M216 leu1-32 ura4-D18 This study JW5203 sad1-mCFP-kanMX6 cdc7-YFP-kanMX6 sfi1-mCherry-kanMX6 This study ade6-M210 leu1-32 ura4-D18 JW5215 sad1-mCFP-kanMX6 cdc7-YFP-kanMX6 sfi1-M46-mCherry-kanMX6 This study ade6 leu1-32 ura4-D18 JW5285 h- Patb2-mRFP-atb2 pcp1-GFP-kan ade6-M210 leu1 ura4 This study JW5308 h+ sfi1(W210R)-his5+-kanMX6 his5 ade6-M210 leu1-32 ura4 This study JW5309 h+ sfi1(W345R)-his5+-kanMX6 his5 ade6-M210 leu1-32 ura4 This study JW5310 h+ sfi1(W573R)-his5+-kanMX6 his5 ade6-M210 leu1-32 ura4 This study JW5311 h+ sfi1(W763R)-his5+-kanMX6 his5 ade6-M210 leu1-32 ura4 This study JW5364 sfi1::natMX6/sfi1+ Patb2-mRFP-atb2/Patb2-mRFP-atb2 pcp1- This study GFP-kan/pcp1-GFP-kan ade6-M210/ade6-M216 leu1/leu1 ura4/ura4 JW5377 Patb2-mRFP-atb2 pcp1-GFP-kan sfi1-M46 ade6 leu1-32 ura4-D18 This study JW5379 Patb2-mRFP-atb2 pcp1-GFP-kan sfi1(W210R)-his5+-kanMX6 ade6- This study M210 leu1-32 ura4 JW5380 Patb2-mRFP-atb2 pcp1-GFP-kan sfi1(W345R)-his5+-kanMX6 ade6- This study M210 leu1-32 ura4 JW5381 Patb2-mRFP-atb2 pcp1-GFP-kan sfi1(W573R)-his5+-kanMX6 ade6- This study M210 leu1-32 ura4 JW5409 sad1-tdTomato-natMX6 sfi1(W210R)-mEGFP-hphMX6 ade6-M210 This study leu1-32 ura4 JW5410 sad1-tdTomato-natMX6 sfi1(W573R)-mEGFP-hphMX6 ade6-M210 This study leu1-32 ura4 JW5474 sad1-tdTomato-natMX6 sfi1(W763R)-mEGFP-hphMX6 ade6-M210 This study leu1-32 ura4

Continued 122

Table 5.1: Continued JW5475 Patb2-mRFP-atb2 pcp1-GFP-kan sfi1(W763R)-his5+-kanMX6 ade6- This study M210 leu1-32 ura4 JW5527 sad1-tdTomato-natMX6 sfi1(W345R )-mEGFP-hphMX6 ade6-M210 This study leu1-32 ura4 MO1427 h90 Z2-CFP-atb2-nat lys1::nmt1-GFP-cdc31-kan ade6 leu1 ura4 Ohta et al., 2012 MO2127 h90 pcp1-GFP-kan hrs1-CFP-nat cut11-mCherry-hph ade6-M216 Ohta et al., 2012 leu1 ura4 MS1371 h- Patb2-mRFP-atb2 leu1-32 ura4-D18 Sato et al., 2009 MS1381 h- cut11-3mRFP-hphMX6 leu1-32 ura4-D18 Sato et al., 2009 SP622 h- cdc10-V50 ura4-D18 Reymond et al., 1992 YS22 h- ade5∆ ade7∆::ade5+ his5∆ ura4-∆leu1-32 Tang et al., 2011

123

Figure 5.1. Mitosis and cytokinesis defects in sfi1-M46 cells. (A) Differential interference contrast (DIC) images of wt (strain JW729) and sfi1-M46 (JW3887) cells. The various morphological defects are indicated by numbers: (1) multiple septa; (2) aberrant septa; (3) septum in a short cell; (4) cell lysis; (5) lack of septum in an elongated cell. Arrowheads mark septa. (B) Schematic representation of Sfi1 domains. W, the Trp containing repeat. The repeat with a mutated Trp in sfi1-M46 is shown in red. (C) Alignment of one repeat in S. pombe, human, and S. cerevisiae Sfi1. The conserved residues that form a hydrophobic pocket for centrin binding are shaded in gray. Asterisk, the conserved Trp. (D and E) Percentages of septating cells with more than one septum (D) and septating cells shorter than 9 μm (E) in wt (JW729) and sfi1-M46 (JW3887). Cells were grown at 25°C or shifted to 36°C for 4 h before imaging. Means ± SDs from 3 independent experiments are shown. n > 40 septating cells for each experiment. (F) Time courses of localization of Cdc7-EGFP and Rlc1-tdTomato in wt (JW4558) or sfi1- M46 (JW4557) cells. In this and other figures, dashed lines mark cell boundary. (G) Mitotic defects revealed by DNA staining of sfi1-M46 cells. Red box, cells with mitosis and cytokinesis defects. Gray box, cells without apparent mitotic defects but still with abnormal septa. Bars, 5 μm.

124

Figure 5.1. Mitosis and cytokinesis defects in sfi1-M46 cells.

125

Figure 5.2. Sfi1 is essential for bipolar spindle formation. (A) Dissected tetrads from sfi1∆/sfi1+ diploid strain (JW5364) after 7 d on YE5S plate at 25°C. Colonies in each row are from the same tetrad. (B) Cell numbers in sfi1∆ colonies after tetrads were incubated on YE5S plate at 25°C for 12 d. (C and D) Cells expressing both Pcp1-GFP (green) and mRFP-Atb2 (red). (C) The first mitotic division of four germinating spores from a sfi1∆/sfi1+ tetrad imaged with an interval of 10 min. Time zero indicates SPB separation. (D) Monopolar spindle formation in sfi1∆ starting from the second mitotic division. Colonies in the same row are from the same sfi1∆/sfi1+ tetrads, and three tetrads imaged at different times are shown. DIC images of one wt and one sfi1∆ colony in each tetrad are shown. Wt colonies at 2 d had grown bigger than the imaged field and so only the edges were imaged. Arrowheads, monopolar spindles. Bars, 5 μm.

126

Figure 5.3. Localization of S. pombe Sfi1 to SPBs. (A) Localization of Sfi1 and Pcp1 (JW4685). (B) The spatial relationship between Pcp1-GFP and Sfi1- tdTomato (upper panels) or Sad1-tdTomato (lower panels, JW4827) in cells with two newly separated SPBs. The best focal plane is shown. (C and D) Representative line scans of Pcp1 and Sfi1 (C) or Sad1 (D). A line across the brightest points of 2 SPBs was drawn, and the average intensity over 7 neighboring pixels perpendicular to the line was calculated and shown. (E) Distances of Pcp1-Sfi1 and Pcp1-Sad1 peaks (see 5.3 Materials and methods). Each dot represents one cell. (F) Colocalization of Sfi1 and Cdc31 in the best focal plane (JW4675). The insets show magnified SPBs. (G) Correlation between the levels of Sfi1 and Cdc31 on SPBs. (H) Sfi1 molecule number in whole cells (JW4361). (I) Correlation between Sfi1 number and cell length. (J) Correlation between Sfi1 concentration and cell length. (K) S. pombe cell cycle. Red dots, SPBs; blue circles, nuclei; green lines, spindles; purple circles, contractile rings; black, cell wall and septum. (L) Sfi1 number on each SPB at different cell-cycle stages. For septating cells, each half of the cell was measured separately for this and other figures. The means of Sfi1 molecules on each SPB in mitotic, septating, and interphase cells are 170, 220, and 360, respectively (see 5.4 Results) and indicated by horizontal lines. Bars, 5 μm unless otherwise noted.

127

Figure 5.3. Localization of S. pombe Sfi1 to SPBs.

128

Figure 5.4. Regulation of mitosis and SPB assembly by Sfi1. (A) Localization of Sad1 and Sfi1 in wt (JW4841) and sfi1-M46 (JW4842) cells. Percentages of cells with Sfi1 signal on SPB were shown on the right. (B) Some sfi1-M46 cells form monopolar spindles (asterisks). Bipolar spindles are marked by arrowheads (JW5285 and JW5377). (C and D) Localization of Sfi1 in wt (JW4829) and sfi1-M46 (JW4831) cells with spindles marked by Atb2. (C) Sfi1-M46-mEGFP is absent on SPB in cells with monopolar spindles. (D) Sfi1-M46 is not detected at some spindle poles. Percentages of cells with Sfi1-M46 on 2, 1, or 0 SPBs were shown at the bottom. Bars in A-D, 5 μm. (E and F) Numbers of Sfi1 (E) and Sad1 (F) on each SPB in wt (JW4841) and sfi1-M46 (JW4842) cells during the cell cycle. Horizontal lines at 170 and 360 for Sfi1 (E) and 500 and 1000 for Sad1 (F) are added to aid visualization (See 5.3 Results and Figure 5.3 L). (G-J) Electron micrographs of sfi1+ cdc10-V50 (JW5132, G and H) and sfi1-M46 cdc10-V50 (JW5130-3, I and J) cells grown at 36°C for 4.5 h. (H-J) Thin sections spaced at 70 nm of the same cell are shown in each panel. N, nucleus. C, cytoplasm. CP, central plaque. B, the bridge. SPB, spindle pole body. Arrows indicate nuclear envelopes. Black arrowhead, invaginated nuclear envelope. White arrowhead, bulged nuclear envelope. Black asterisks, dark stained material deposited close to invaginated nuclear envelope. White asterisks, dark stained material in the cytoplasm. Bars in G-J, 100 nm.

129

Figure 5.4. Regulation of mitosis and SPB assembly by Sfi1.

130

Figure 5.5. Sfi1 and Sfi1-M46 are stable on SPB revealed by FRAP. (A) Fluorescence recovery curves after photobleaching (at time 0) of Sfi1 and Sfi1-M46. Error bars are SEM. (B) Kymographs of unbleached Sfi1, bleached Sfi1, and bleached Sfi1-M46. Arrowheads, time of photobleaching. Kymographs were not corrected for photobleaching during image acquisition. Bar, 1 μm.

131

Figure 5.6. Sfi1-M46 prefers to stay on the old SPB. (A) Quantification of fluorescence-intensity differences between two SPBs. (B) Examples of Sfi1 and Sad1 fluorescence intensity in wt (JW4841) and sfi1-M46 (JW4842) cells. (C and D) Differences in Sfi1 (C) and Sad1 (D) intensity in wt and sfi1-M46 between two SPBs quantified as in (A). (E, F) Three types of Sfi1 partition in wt and sfi1-M46 (JW5203 and JW5215). Time series were collected with 10-min interval. The first time point with two Sad1-marked SPBs is set as time 0, and the localization of Sfi1 and Cdc7 at t = 30 min is compared. (E) In Type I, Sfi1 localizes to both SPBs; in Type II, Sfi1 only localizes to the SPB that does not have Cdc7 signal; in Type III, Sfi1 only localizes to the SPB that has Cdc7 signal. (F) Quantification of cells that belong to Type I, II, III, or have no obvious Sfi1 signal in mitosis. Bars, 5 μm.

132

Figure 5.7. Unequal partition of Sfi1-M46 underlies the mitotic defects. (A) Illustration of SPB assembly cycle in wt and sfi1-M46. See 5.3 Results for description. (B and C) Time courses of wt (B) or sfi1-M46 (C) cells imaged for two cell-division cycles. Stacks of images were collected every 10 min, and representative images are shown. Arrowheads, bipolar spindles. Asterisks, monopolar spindles. Arrow shows the appearance of Sfi1-M46 in a cell that has no detectable Sfi1 signal on SPB after the previous mitosis. Bars, 5 μm. (D) Quantification of Sfi1 partition in wt and sfi1-M46 cells during two cell cycles. Daughter cells generated from the first mitosis were analyzed separately in the second mitosis. (E) Sfi1 molecules on SPB over time in wt cells. Each gray line represents one SPB. Time zero is the time point when two SPBs separate. Mean molecules (± SEM) of 20 SPBs are plotted in purple (before) and red (after cell separation). JW4829 and JW4831 were used.

133

Figure 5.8. Sfi1 partition in wt and sfi1-M46 cells. (A) Color codes of SPBs at different cell-cycle stages analyzed in (B and C). (B and C) Sfi1 molecules or fluorescence intensity on SPBs in representative wt (B) and sfi1-M46 (C) cells. Cells were followed for two cell cycles. Each line represents one SPB. Time zero is the time point when the first SPB separation occurs. Dashed lines indicate an SPB with undetectable signals at those time points. Asterisk, monopolar spindle formation.

134

Figure 5.9. Repressing Sfi1 to ~30% of its endogenous level does not significantly affect mitosis. (A) Localization of Sfi1 and Sad1 in wt (JW4841) and P81nmt1-mEGFP-sfi1 (JW5088) cells grown in repressing condition (YE5S + thiamine). (B and C) Quantification of Sfi1 (B) and Sad1 (C) on each SPB in wt and P81nmt1-mEGFP-sfi1 cells grown in YE5S + thiamine. (D) DIC and images of DNA stained with Hoechst of P81nmt1-mEGFP-sfi1 cells (JW4615) grown in YE5S + thiamine at 25°C or 14 h at 36°C. Arrowheads mark cells with mitotic defects. Bars, 5 μm.

135

Figure 5.10. The repeats in Sfi1 are not identical. (A) Schematic representation of Sfi1 domains and the positions of Trps (Ws) that are mutated to Arg (R). (B and C) Phenotypes of strains with W to R mutations in sfi1 (JW5308 to JW5311) grown at 25°C and 4 h at 36°C. (B) Mitotic phenotypes of indicated mutants. DIC and DNA stained with Hoechst are shown. Yellow arrowheads, cells with mitosis and/or cytokinesis defects. (C) Cytokinesis defects of indicated mutants. Cells with >1 septum are quantified. SDs from 3 independent experiments are shown. n > 50 septating cells for each experiment. (D) Localizations of Pcp1 and Atb2 in the mutants at indicated temperatures (JW5285, JW5379, JW5380, JW5381, and JW5475). White dashed lines label mitotic cells. White line, a cell without SPB. White arrowheads, bipolar spindles; asterisks, monopolar spindles. (E) Localization of Sad1 and mutated Sfi1 at 25°C (JW4841, JW5409, JW5527, JW5410, and JW5474). Arrowheads, SPBs with Sad1 but not Sfi1. Asterisk, an elongated cell with a single SPB focus containing Sad1 and Sfi1(W763R). Bars, 5 μm. (F) Summary of Sfi1 recruitment and SPB assembly when the SPBs inherit different amounts of Sfi1 from the previous mitosis.

136

Figure 5.10. The repeats in Sfi1 are not identical.

137

Figure 5.11. Summary of results in this chapter.

138

Chapter 6: Conclusion and Future Direction

6.1 Mid1, cytokinesis nodes, and contractile-ring assembly

Mid1, the anillin-like protein in fission yeast, has always been the center of the study of cytokinesis since its discovery in 1996 (Sohrmann et al., 1996). However, how

Mid1 scaffolds other cytokinesis proteins in contractile-ring assembly remained unclear for a long time. In my study during my Ph.D., I revealed that Mid1 physically interacts with at least four other cytokinesis node proteins. In my subsequent study, I further investigated Mid1 domains for targeting and scaffolding and narrowed down the most important region of Mid1 to its N-terminal 100 aa. In 2011 and 2012, six publications from four different laboratories including ours reported complementary data on cytokinesis-node assembly and domain analyses of Mid1 (Almonacid et al., 2011;

Laporte et al., 2011; Padmanabhan et al., 2011; Lee and Wu, 2012; Saha and Pollard,

2012a, 2012b). Thus, our understanding of how Mid1 scaffolds the assembly of cytokinesis nodes and the contractile ring has advanced significantly during my Ph.D.

Recently, the characterization of interphase node proteins has uncovered the link between the cell-size control machinery and contractile-ring assembly. Indeed, many interphase node proteins interact with Mid1 (see Chapter 4) (Almonacid et al., 2009;

Martin and Berthelot-Grosjean, 2009; Moseley et al., 2009; Guzman-Vendrell et al.,

2013). In this study, I showed that Mid1 becomes more dynamic on the cortex in the 139 absence of Cdr2 kinase. In addition, I found that an internal region aa(101-400) regulates cortical targeting of Mid1, and this finding contributed to the discovery that aa(300-350) of Mid1 interact with the putative RhoGEF Gef2, one of the interphase node proteins (Ye et al., 2012). Therefore, although interphase nodes are dispensable for cytokinesis-node assembly, they play a role in regulating the localization and/or dynamics of Mid1 on the cortex. Future work is required to decipher the spatial relationship between different interphase proteins and Mid1.

Complex regulation of Mid1 localization is required to ensure proper specification of the division site. After characterizing different domains in Mid1 and analyzing their importance, an interesting next step is to investigate the mechanisms regulating Mid1 localization from the structural point of view. While it might be difficult to solve the structure of the whole Mid1 protein, our domain analyses suggested that solving the structure of Mid1 N-terminus will reveal important characteristics for its scaffolding function, and solving the structure of Mid1 C-terminus will likely reveal important residues or mechanisms for its cortical localization. We are in collaboration with Dr.

Zhucheng Chen at Tsinghua University, China, to address the importance of Mid1 dimerization in membrane-binding.

Although the sequence conservation between Mid1 and anillin is limited, their functional and structural similarities suggest that Mid1 in fission yeast can serve as a model system for studying anillins in animal cells. Validated microarray data showed that anillin is overexpressed in numerous types of tumors and cancers (Hall et al., 2005;

Suzuki et al., 2005; Olakowski et al., 2009) and the extent of overexpression is related to

140 the malignancy (Hall et al., 2005). However, whether anillin overexpression plays a causal role or is axillary in tumorigenesis remains a mystery. Intriguingly, although nuclear anillin expression was associated with poor survival in lung cancer (Suzuki et al.,

2005) and breast cancer (Damasco et al., 2011; O’Leary et al., 2013), renal cell carcinoma patients with cytoplasmic expression of anillin were found to have better prognosis (Ronkainen et al., 2011). In S. pombe, highly overexpressed Mid1 resulted in cytokinesis failure and shape change (Paoletti and Chang, 2000). On the other hand, mid1∆ cells, characteristic of their randomly-positioned septa, cytokinesis failure, and poor growth, often pick up spontaneous suppressors and exhibit improved growth after being cultured for more than 48 hours. Addressing how cells are affected when Mid1 level changes globally or locally will provide a pivotal basis for further analysis of consequences of having excess anillin in cancer cells.

6.2 Sfi1 and SPB/centrosome assembly

Here we uncovered the spatial relationship between SPB proteins, characterized the recruitment of SPB proteins throughout the cell cycle, and revealed the importance of

Sfi1 segregation using primarily live-imaging and quantitative light microscopy. This and other recent studies show that live-imaging light microscopy is promising in studying the dynamics, protein-protein interactions, and the organization of SPB and centrosome

(Yoder et al., 2003; Muller et al., 2005; Sonnen et al., 2012; Menendez-Benito et al.,

2013). More studies using light microscopy and fluorescent tags will likely bring more mechanistic insights on SPB and centrosome duplication in the near future.

141

Before this study, it was thought that S. pombe SPB is duplicated at G1/S (Uzawa et al., 2004). Here we show that the level of Sfi1 and Sad1 are not doubled until much later in the cell cycle. Based on the interphase recruitment of Sfi1, we proposed that SPB assembly starts with limited amount of Sfi1 and continues later in the cell cycle. This conclusion will change the way we think of SPB assembly. An important next step will be to define different steps in SPB assembly by analyzing the temporal recruitment of different SPB proteins. After a temporal pathway has been established, the difference between wt and sfi1 mutants can be investigated and mechanistic insights on the function of Sfi1 can be further assessed.

Our study also sheds light on the role of the conserved tryptophans and the importance of the integrity of the centrin-Sfi1 complex or filaments. Abnormalities in half-bridge partition were never described previously in yeasts, and it was surprising that a point mutation in Sfi1 can change its partition drastically. The mechanism governing

Sfi1 partition and SPB separation is unknown and requires investigation in the future.

What kind of age-dependent regulation resulted in predominant localization of Sfi1-M46 on the old SPB is also intriguing.

The observation that interphase recruitment of Sfi1 can partially rescue abnormal inheritance suggests that half-bridge can undergo de novo assembly. Investigating the interactions between half-bridge proteins and the core SPB will likely reveal mechanisms for half-bridge assembly. This study lays the ground for future studies of Sfi1 in centriole duplication during centrosome assembly.

142

References

Adams, I.R., and J.V. Kilmartin. 1999. Localization of core spindle pole body (SPB) components during SPB duplication in Saccharomyces cerevisiae. J. Cell Biol. 145:809-823.

Adams, I.R., and J.V. Kilmartin. 2000. Spindle pole body duplication: a model for centrosome duplication? Trends Cell Biol. 10:329-335.

Almonacid, M., S. Celton-Morizur, J.L. Jakubowski, F. Dingli, D. Loew, A. Mayeux, J.S. Chen, K.L. Gould, D.M. Clifford, and A. Paoletti. 2011. Temporal control of contractile ring assembly by Plo1 regulation of myosin II recruitment by Mid1/anillin. Curr. Biol. 21:473-479.

Almonacid, M., J.B. Moseley, J. Janvore, A. Mayeux, V. Fraisier, P. Nurse, and A. Paoletti. 2009. Spatial control of cytokinesis by Cdr2 kinase and Mid1/anillin nuclear export. Curr. Biol. 19:961-966.

An, H., J.L. Morrell, J.L. Jennings, A.J. Link, and K.L. Gould. 2004. Requirements of fission yeast septins for complex formation, localization, and function. Mol. Biol. Cell. 15:5551-5564.

Anderson, V.E., J. Prudden, S. Prochnik, T.H. Giddings, Jr., and K.G. Hardwick. 2007. Novel sfi1 alleles uncover additional functions for Sfi1p in bipolar spindle assembly and function. Mo.l Biol. Cell. 18:2047-2056.

Arai, R., and I. Mabuchi. 2002. F-actin ring formation and the role of F-actin cables in the fission yeast Schizosaccharomyces pombe. J. Cell Sci. 115:887-898.

Araki, M., C. Masutani, M. Takemura, A. Uchida, K. Sugasawa, J. Kondoh, Y. Ohkuma, and F. Hanaoka. 2001. Centrosome protein centrin 2/caltractin 1 is part of the xeroderma pigmentosum group C complex that initiates global genome nucleotide excision repair. J. Biol. Chem. 276:18665-18672.

Araki, Y., L. Gombos, S.P. Migueleti, L. Sivashanmugam, C. Antony, and E. Schiebel. 2010. N-terminal regions of Mps1 kinase determine functional bifurcation. J. Cell Biol. 189:41-56.

143

Araki, Y., C.K. Lau, H. Maekawa, S.L. Jaspersen, T.H. Giddings, Jr., E. Schiebel, and M. Winey. 2006. The Saccharomyces cerevisiae spindle pole body (SPB) component Nbp1p is required for SPB membrane insertion and interacts with the integral membrane proteins Ndc1p and Mps2p. Mol. Biol. Cell. 17:1959-1970.

Arasada, R., and T.D. Pollard. 2011. Distinct roles for F-BAR proteins Cdc15p and Bzz1p in actin polymerization at sites of endocytosis in fission yeast. Curr. Biol. 21:1450-1459.

Azimzadeh, J., P. Hergert, A. Delouvee, U. Euteneuer, E. Formstecher, A. Khodjakov, and M. Bornens. 2009. hPOC5 is a centrin-binding protein required for assembly of full-length centrioles. J. Cell Biol. 185:101-114.

Bahe, S., Y.D. Stierhof, C.J. Wilkinson, F. Leiss, and E.A. Nigg. 2005. Rootletin forms centriole-associated filaments and functions in centrosome cohesion. J. Cell Biol. 171:27-33.

Bähler, J., and J.R. Pringle. 1998. Pom1p, a fission yeast protein kinase that provides positional information for both polarized growth and cytokinesis. Genes Dev. 12:1356-1370.

Bähler, J., A.B. Steever, S. Wheatley, Y.L. Wang, J.R. Pringle, K.L. Gould, and D. McCollum. 1998a. Role of polo kinase and Mid1p in determining the site of cell division in fission yeast. J. Cell Biol. 143:1603-1616.

Bähler, J., J.-Q. Wu, M.S. Longtine, N.G. Shah, A. McKenzie, III, A.B. Steever, A. Wach, P. Philippsen, and J.R. Pringle. 1998b. Heterologous modules for efficient and versatile PCR-based gene targeting in Schizosaccharomyces pombe. Yeast. 14:943-951.

Bahmanyar, S., D.D. Kaplan, J.G. Deluca, T.H. Giddings, Jr., E.T. O'Toole, M. Winey, E.D. Salmon, P.J. Casey, W.J. Nelson, and A.I. Barth. 2008. β-Catenin is a Nek2 substrate involved in centrosome separation. Genes Dev. 22:91-105.

Balasubramanian, M.K., E. Bi, and M. Glotzer. 2004. Comparative analysis of cytokinesis in budding yeast, fission yeast and animal cells. Curr. Biol. 14:R806- R818.

Balasubramanian, M.K., D.M. Helfman, and S.M. Hemmingsen. 1992. A new tropomyosin essential for cytokinesis in the fission yeast S. pombe. Nature. 360:84-87.

Balasubramanian, M.K., B.R. Hirani, J.D. Burke, and K.L. Gould. 1994. The Schizosaccharomyces pombe cdc3+ gene encodes a profilin essential for cytokinesis. J. Cell Biol. 125:1289-1301. 144

Balasubramanian, M.K., D. McCollum, L. Chang, K.C. Wong, N.I. Naqvi, X. He, S. Sazer, and K.L. Gould. 1998. Isolation and characterization of new fission yeast cytokinesis mutants. Genetics. 149:1265-1275.

Bardin, A.J., and A. Amon. 2001. MEN and SIN: what's the difference? Nat. Rev. Mol. Cell Biol. 2:815-826.

Barr, F.A., and U. Gruneberg. 2007. Cytokinesis: placing and making the final cut. Cell. 131:847-860.

Basto, R., K. Brunk, T. Vinadogrova, N. Peel, A. Franz, A. Khodjakov, and J.W. Raff. 2008. Centrosome amplification can initiate tumorigenesis in flies. Cell. 133:1032-1042.

Bathe, M., and F. Chang. 2010. Cytokinesis and the contractile ring in fission yeast: towards a systems-level understanding. Trends Microbiol. 18:38-45.

Baudin, A., O. Ozier-Kalogeropoulos, A. Denouel, F. Lacroute, and C. Cullin. 1993. A simple and efficient method for direct gene deletion in Saccharomyces cerevisiae. Nucleic Acids Res. 21:3329-3330.

Berlin, A., A. Paoletti, and F. Chang. 2003. Mid2p stabilizes septin rings during cytokinesis in fission yeast. J. Cell Biol. 160:1083-1092.

Bettencourt-Dias, M., F. Hildebrandt, D. Pellman, G. Woods, and S.A. Godinho. 2011. Centrosomes and cilia in human disease. Trends Genet. 27:307-315.Bezanilla, M., S.L. Forsburg, and T.D. Pollard. 1997. Identification of a second myosin-II in Schizosaccharomyces pombe: Myp2p is conditionally required for cytokinesis. Mol. Biol. Cell. 8:2693-2705. Bezanilla, M., J.M. Wilson, and T.D. Pollard. 2000. Fission yeast myosin-II isoforms assemble into contractile rings at distinct times during mitosis. Curr. Biol. 10:397- 400.

Bloom, J., I.M. Cristea, A.L. Procko, V. Lubkov, B.T. Chait, M. Snyder, and F.R. Cross. 2011. Global analysis of Cdc14 phosphatase reveals diverse roles in mitotic processes. J. Biol. Chem. 286:5434-5445.

Bornens, M. 1977. Is the centriole bound to the nuclear membrane? Nature. 270:80-82.

Bornens, M. 2002. Centrosome composition and microtubule anchoring mechanisms. Curr. Opin. Cell Biol. 14:25-34.

Breeding, C.S., J. Hudson, M.K. Balasubramanian, S.M. Hemmingsen, P.G. Young, and + K.L. Gould. 1998. The cdr2 gene encodes a regulator of G2/M progression and cytokinesis in Schizosaccharomyces pombe. Mol. Biol. Cell. 9:3399-3415.

145

Bringmann, H., and A.A. Hyman. 2005. A cytokinesis furrow is positioned by two consecutive signals. Nature. 436:731-734.

Byers, B., and L. Goetsch. 1974. Duplication of spindle plaques and integration of the yeast cell cycle. Cold Spring Harb. Symp.Quant. Biol. 38:123-131.

Byers, B., and L. Goetsch. 1975. Behavior of spindles and spindle plaques in the cell cycle and conjugation of Saccharomyces cerevisiae. J. Bacteriol. 124:511-523.

Carnahan, R.H., and K.L. Gould. 2003. The PCH family protein, Cdc15p, recruits two F- actin nucleation pathways to coordinate cytokinetic actin ring formation in Schizosaccharomyces pombe. J. Cell Biol. 162:851-862.

Celton-Morizur, S., N. Bordes, V. Fraisier, P.T. Tran, and A. Paoletti. 2004. C-terminal anchoring of mid1p to membranes stabilizes cytokinetic ring position in early mitosis in fission yeast. Mol. Cell. Biol. 24:10621-10635.

Celton-Morizur, S., V. Racine, J.B. Sibarita, and A. Paoletti. 2006. Pom1 kinase links division plane position to cell polarity by regulating Mid1p cortical distribution. J. Cell Sci. 119:4710-4718.

Chang, F. 1999. Movement of a cytokinesis factor cdc12p to the site of cell division. Curr. Biol. 9:849-852.

Chang, F., D. Drubin, and P. Nurse. 1997. cdc12p, a protein required for cytokinesis in fission yeast, is a component of the cell division ring and interacts with profilin. J. Cell Biol. 137:169-182.

Chang, F., and P. Nurse. 1996. How fission yeast fission in the middle. Cell. 84:191-194.

Chen, C.T., A. Feoktistova, J.S. Chen, Y.S. Shim, D.M. Clifford, K.L. Gould, and D. McCollum. 2008. The SIN kinase Sid2 regulates cytoplasmic retention of the S. pombe Cdc14-like phosphatase Clp1. Curr. Biol. 18:1594-1599.

Chen, L., and K. Madura. 2008. Centrin/Cdc31 is a novel regulator of protein degradation. Mol. Cell. Biol. 28:1829-1840.

Chen, Q., and T.D. Pollard. 2011. Actin filament severing by cofilin is more important for assembly than constriction of the cytokinetic contractile ring. J. Cell Biol. 195:485-498.

Chesarone-Cataldo, M., C. Guerin, J.H. Yu, R. Wedlich-Soldner, L. Blanchoin, and B.L. Goode. 2011. The myosin passenger protein Smy1 controls actin cable structure and dynamics by acting as a formin damper. Dev. Cell. 21:217-230.

146

Chesarone, M., C.J. Gould, J.B. Moseley, and B.L. Goode. 2009. Displacement of formins from growing barbed ends by bud14 is critical for actin cable architecture and function. Dev. Cell. 16:292-302.

Chew, T.L., R.A. Masaracchia, Z.M. Goeckeler, and R.B. Wysolmerski. 1998. Phosphorylation of non-muscle myosin II regulatory light chain by p21-activated kinase (γ-PAK). J. Muscle Res. Cell Motil. 19:839-854.

Churchman, L.S., Z. Okten, R.S. Rock, J.F. Dawson, and J.A. Spudich. 2005. Single molecule high-resolution colocalization of Cy3 and Cy5 attached to macromolecules measures intramolecular distances through time. Proc. Natl. Acad. Sci. USA. 102:1419-1423.

Cingolani, P., A. Platts, L. Wang, M. Coon, T. Nguyen, L. Wang, S.J. Land, X. Lu, and D.M. Ruden. 2012. A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of Drosophila melanogaster strain w1118; iso-2; iso-3. Fly. 6:80-92.

Clifford, D.M., B.A. Wolfe, R.H. Roberts-Galbraith, W.H. McDonald, J.R. Yates, III, and K.L. Gould. 2008. The Clp1/Cdc14 phosphatase contributes to the robustness of cytokinesis by association with anillin-related Mid1. J. Cell Biol. 181:79-88.

Coffman, V.C., P. Wu, M.R. Parthun, and J.-Q. Wu. 2011. CENP-A exceeds microtubule attachment sites in centromere clusters of both budding and fission yeast. J. Cell Biol. 195:563-572.

Coulton, A.T., D.A. East, A. Galinska-Rakoczy, W. Lehman, and D.P. Mulvihill. 2010. The recruitment of acetylated and unacetylated tropomyosin to distinct actin polymers permits the discrete regulation of specific myosins in fission yeast. J. Cell Sci. 123:3235-3243.

Crasta, K., H.H. Lim, T.H. Giddings, Jr., M. Winey, and U. Surana. 2008. Inactivation of Cdh1 by synergistic action of Cdk1 and polo kinase is necessary for proper assembly of the mitotic spindle. Nat. Cell Biol. 10:665-675.

D'Avino, P.P. 2009. How to scaffold the contractile ring for a safe cytokinesis - lessons from Anillin-related proteins. J. Cell Sci. 122:1071-1079.

D'Avino, P.P., T. Takeda, L. Capalbo, W. Zhang, K.S. Lilley, E.D. Laue, and D.M. Glover. 2008. Interaction between Anillin and RacGAP50C connects the

147

actomyosin contractile ring with spindle microtubules at the cell division site. J. Cell Sci. 121:1151-1158.

D'Souza, V.M., N.I. Naqvi, H. Wang, and M.K. Balasubramanian. 2001. Interactions of Cdc4p, a myosin light chain, with IQ-domain containing proteins in Schizosaccharomyces pombe. Cell Struct. Funct. 26:555-565.

Daga, R.R., and F. Chang. 2005. Dynamic positioning of the fission yeast cell division plane. Proc. Natl. Acad. Sci. USA. 102:8228-8232.

Damasco, C., A. Lembo, M.P. Somma, M. Gatti, F. Di Cunto, and P. Provero. 2011. A signature inferred from Drosophila mitotic genes predicts survival of breast cancer patients. PLoS One. 6:e14737.

Dammermann, A., P.S. Maddox, A. Desai, and K. Oegema. 2008. SAS-4 is recruited to a dynamic structure in newly forming centrioles that is stabilized by the γ-tubulin- mediated addition of centriolar microtubules. J. Cell Biol. 180:771-785.

Dantas, T.J., O.M. Daly, and C.G. Morrison. 2012. Such small hands: the roles of centrins/caltractins in the centriole and in genome maintenance. Cell. Mol. Life Sci.. 69:2979-2997.

Das, M., D.J. Wiley, S. Medina, H.A. Vincent, M. Larrea, A. Oriolo, and F. Verde. 2007. Regulation of cell diameter, For3p localization, and cell symmetry by fission yeast Rho-GAP Rga4p. Mol. Biol. Cell. 18:2090-2101.

Dean, S.O., S.L. Rogers, N. Stuurman, R.D. Vale, and J.A. Spudich. 2005. Distinct pathways control recruitment and maintenance of myosin II at the cleavage furrow during cytokinesis. Proc. Natl. Acad. Sci. USA. 102:13473-13478.

Delaval, B., L. Covassin, N.D. Lawson, and S. Doxsey. 2011. Centrin depletion causes cyst formation and other ciliopathy-related phenotypes in zebrafish. Cell Cycle. 10:3964-3972.

Ding, R., R.R. West, D.M. Morphew, B.R. Oakley, and J.R. McIntosh. 1997. The spindle pole body of Schizosaccharomyces pombe enters and leaves the nuclear envelope as the cell cycle proceeds. Mol. Biol. Cell. 8:1461-1479.

Djinovic-Carugo, K., P. Young, M. Gautel, and M. Saraste. 1999. Structure of the α- actinin rod: molecular basis for cross-linking of actin filaments. Cell. 98:537-546.

Doxsey, S., D. McCollum, and W. Theurkauf. 2005. Centrosomes in cellular regulation. Annu. Rev. Cell Dev. Biol. 21:411-434.

148

Eng, K., N.I. Naqvi, K.C. Wong, and M.K. Balasubramanian. 1998. Rng2p, a protein required for cytokinesis in fission yeast, is a component of the actomyosin ring and the spindle pole body. Curr. Biol. 8:611-621.

Fang, X., J. Luo, R. Nishihama, C. Wloka, C. Dravis, M. Travaglia, M. Iwase, E.A. Vallen, and E. Bi. 2010. Biphasic targeting and cleavage furrow ingression directed by the tail of a myosin II. J. Cell Biol. 191:1333-1350.

Fankhauser, C., A. Reymond, L. Cerutti, S. Utzig, K. Hofmann, and V. Simanis. 1995. The S. pombe cdc15 gene is a key element in the reorganization of F- actin at mitosis. Cell. 82:435-444.

Field, C.M., and B.M. Alberts. 1995. Anillin, a contractile ring protein that cycles from the nucleus to the cell cortex. J. Cell Biol. 131:165-178.

Field, C.M., M. Coughlin, S. Doberstein, T. Marty, and W. Sullivan. 2005. Characterization of anillin mutants reveals essential roles in septin localization and plasma membrane integrity. Development. 132:2849-2860.

Fisch, C., and P. Dupuis-Williams. 2011. Ultrastructure of cilia and flagella - back to the future! Biol. Cell. 103:249-270.

Fischer, T., S. Rodriguez-Navarro, G. Pereira, A. Racz, E. Schiebel, and E. Hurt. 2004. Yeast centrin Cdc31 is linked to the nuclear mRNA export machinery. Nat. Cell Biol. 6:840-848.

Fisk, H.A., C.P. Mattison, and M. Winey. 2003. Human Mps1 protein kinase is required for centrosome duplication and normal mitotic progression. Proc. Natl. Acad. Sci. USA. 100:14875-14880.

Flory, M.R., M. Morphew, J.D. Joseph, A.R. Means, and T.N. Davis. 2002. Pcp1p, an Spc110p-related calmodulin target at the centrosome of the fission yeast Schizosaccharomyces pombe. Cell Growth Differ.. 13:47-58.

Friederichs, J.M., S. Ghosh, C.J. Smoyer, S. McCroskey, B.D. Miller, K.J. Weaver, K.M. Delventhal, J. Unruh, B.D. Slaughter, and S.L. Jaspersen. 2011. The SUN protein Mps3 is required for spindle pole body insertion into the nuclear membrane and nuclear envelope homeostasis. PLoS Genetics. 7:e1002365.

Fry, A.M., T. Mayor, P. Meraldi, Y.D. Stierhof, K. Tanaka, and E.A. Nigg. 1998. C- Nap1, a novel centrosomal coiled-coil protein and candidate substrate of the cell cycle-regulated protein kinase Nek2. J. Cell Biol. 141:1563-1574.

149

Fujiwara, T., M. Bandi, M. Nitta, E.V. Ivanova, R.T. Bronson, and D. Pellman. 2005. Cytokinesis failure generating tetraploids promotes tumorigenesis in p53-null cells. Nature. 437:1043-1047.

Fukasawa, K. 2007. Oncogenes and tumour suppressors take on centrosomes. Nat. Rev. Cancer. 7:911-924.

Gall, J.G. 1961. Centriole replication. A study of spermatogenesis in the snail Viviparus. J.Biophys. Biochem. Cytol. 10:163-193.Ganem, N.J., S.A. Godinho, and D. Pellman. 2009. A mechanism linking extra centrosomes to chromosomal instability. Nature. 460:278-282.

Ganem, N.J., Z. Storchova, and D. Pellman. 2007. Tetraploidy, aneuploidy and cancer. Curr. Opin. Genet. Dev. 17:157-162.

Ge, W., and M.K. Balasubramanian. 2008. Pxl1p, a paxillin-related protein, stabilizes the actomyosin ring during cytokinesis in fission yeast. Mol. Biol. Cell. 19:1680- 1692.

Giddings, T.H., Jr., E.T. O'Toole, M. Morphew, D.N. Mastronarde, J.R. McIntosh, and M. Winey. 2001. Using rapid freeze and freeze-substitution for the preparation of yeast cells for electron microscopy and three-dimensional analysis. Methods Cell Biol. 67:27-42.

Glotzer, M. 2005. The molecular requirements for cytokinesis. Science. 307:1735-1739.

Gogendeau, D., J. Beisson, N.G. de Loubresse, J.P. Le Caer, F. Ruiz, J. Cohen, L. Sperling, F. Koll, and C. Klotz. 2007. An Sfi1p-like centrin-binding protein mediates centrin-based Ca2+ -dependent contractility in Paramecium tetraurelia. Eukaryot. Cell. 6:1992-2000.

Goldbach, P., R. Wong, N. Beise, R. Sarpal, W.S. Trimble, and J.A. Brill. 2010. Stabilization of the actomyosin ring enables spermatocyte cytokinesis in Drosophila. Mol. Biol. Cell. 21:1482-1493.

Goyal, A., M. Takaine, V. Simanis, and K. Nakano. 2011. Dividing the spoils of growth and the cell cycle: The fission yeast as a model for the study of cytokinesis. Cytoskeleton (Hoboken). 68:69-88.

Grallert, A., and I.M. Hagan. 2002. Schizosaccharomyces pombe NIMA-related kinase, Fin1, regulates spindle formation and an affinity of Polo for the SPB. EMBO J. 21:3096-3107.

Grallert, A., A. Krapp, S. Bagley, V. Simanis, and I.M. Hagan. 2004. Recruitment of NIMA kinase shows that maturation of the S. pombe spindle-pole body occurs

150

over consecutive cell cycles and reveals a role for NIMA in modulating SIN activity. Genes Dev. 18:1007-1021.

Gregory, S.L., S. Ebrahimi, J. Milverton, W.M. Jones, A. Bejsovec, and R. Saint. 2008. Cell division requires a direct link between microtubule-bound RacGAP and anillin in the contractile ring. Curr. Biol. 18:25-29.

Griesbeck, O., G.S. Baird, R.E. Campbell, D.A. Zacharias, and R.Y. Tsien. 2001. Reducing the environmental sensitivity of yellow fluorescent protein. Mechanism and applications. J. Biol. Chem. 276:29188-29194.

Guzman-Vendrell, M., S. Baldissard, M. Almonacid, A. Mayeux, A. Paoletti, and J.B. Moseley. 2013. Blt1 and Mid1 provide overlapping membrane anchors to position the division plane in fission yeast. Mol. Cell. Biol. 33:418-428.

Hachet, O., M. Berthelot-Grosjean, K. Kokkoris, V. Vincenzetti, J. Moosbrugger, and S.G. Martin. 2011. A phosphorylation cycle shapes gradients of the DYRK family kinase Pom1 at the plasma membrane. Cell. 145:1116-1128.

Hachet, O., and V. Simanis. 2008. Mid1p/anillin and the septation initiation network orchestrate contractile ring assembly for cytokinesis. Genes Dev. 22:3205-3216.

Hagan, I., and M. Yanagida. 1995. The product of the spindle formation gene sad1+ associates with the fission yeast spindle pole body and is essential for viability. J. Cell Biol. 129:1033-1047.

Hagan, I.M. 2008. The spindle pole body plays a key role in controlling mitotic commitment in the fission yeast Schizosaccharomyces pombe. Biochem. Soc. Trans. 36:1097-1101.

Haglund, K., I.P. Nezis, D. Lemus, C. Grabbe, J. Wesche, K. Liestol, I. Dikic, R. Palmer, and H. Stenmark. 2010. Cindr interacts with anillin to control cytokinesis in Drosophila melanogaster. Curr. Biol. 20:944-950.

Hales, K.G., E. Bi, J.-Q. Wu, J.C. Adam, I.C. Yu, and J.R. Pringle. 1999. Cytokinesis: an emerging unified theory for eukaryotes? Curr. Opin. Cell Biol. 11:717-725.

Hall, P.A., C.B. Todd, P.L. Hyland, S.S. McDade, H. Grabsch, M. Dattani, K.J. Hillan, and S.E. Russell. 2005. The septin-binding protein anillin is overexpressed in diverse human tumors. Clin. Cancer Res. 11:6780-6786.

Hayakawa, K., H. Tatsumi, and M. Sokabe. 2011. Actin filaments function as a tension sensor by tension-dependent binding of cofilin to the filament. J. Cell Biol. 195:721-727.

151

He, X., M.H. Jones, M. Winey, and S. Sazer. 1998. Mph1, a member of the Mps1-like family of dual specificity protein kinases, is required for the spindle checkpoint in S. pombe. J. Cell Sci. 111:1635-1647.

Hickson, G.R., and P.H. O'Farrell. 2008. Anillin: a pivotal organizer of the cytokinetic machinery. Biochem. Soc. Trans. 36:439-441.

Hinchcliffe, E.H., and G. Sluder. 2001. "It takes two to tango": understanding how centrosome duplication is regulated throughout the cell cycle. Genes Dev. 15:1167-1181.

Hirano, T., S. Funahashi, T. Uemura, and M. Yanagida. 1986. Isolation and characterization of Schizosaccharomyces pombe cutmutants that block nuclear division but not cytokinesis. EMBO J. 5:2973-2979.

Hoog, J.L., S.M. Huisman, D. Brunner, and C. Antony. 2013. Electron tomography reveals novel microtubule lattice and microtubule organizing centre defects in +TIP mutants. PLoS One. 8:e61698.

Hou, M.C., J. Salek, and D. McCollum. 2000. Mob1p interacts with the Sid2p kinase and is required for cytokinesis in fission yeast. Curr. Biol. 10:619-622.

Huang, Y., H. Yan, and M.K. Balasubramanian. 2008. Assembly of normal actomyosin rings in the absence of Mid1p and cortical nodes in fission yeast. J. Cell Biol. 183:979-988.

Ito, D., Y. Saito, and T. Matsumoto. 2012. Centromere-tethered Mps1 pombe homolog (Mph1) kinase is a sufficient marker for recruitment of the spindle checkpoint protein Bub1, but not Mad1. Proc. Natl. Acad. Sci. USA. 109:209-214.

Ivanovska, I., and M.D. Rose. 2001. Fine structure analysis of the yeast centrin, Cdc31p, identifies residues specific for cell morphology and spindle pole body duplication. Genetics. 157:503-518.

Jaspersen, S.L., T.H. Giddings, Jr., and M. Winey. 2002. Mps3p is a novel component of the yeast spindle pole body that interacts with the yeast centrin homologue Cdc31p. J. Cell Biol. 159:945-956.

Jaspersen, S.L., A.E. Martin, G. Glazko, T.H. Giddings, Jr., G. Morgan, A. Mushegian, and M. Winey. 2006. The Sad1-UNC-84 homology domain in Mps3 interacts with Mps2 to connect the spindle pole body with the nuclear envelope. J. Cell Biol. 174:665-675.

Jaspersen, S.L., and M. Winey. 2004. The budding yeast spindle pole body: structure, duplication, and function. Annu. Rev.Cell Dev. Biol. 20:1-28.

152

Jin, Q.W., S. Ray, S.H. Choi, and D. McCollum. 2007. The nucleolar Net1/Cfi1-related protein Dnt1 antagonizes the septation initiation network in fission yeast. Mol. Biol. Cell. 18:2924-2934.

Job, D., O. Valiron, and B. Oakley. 2003. Microtubule nucleation. Curr. Opin. Cell Biol. 15:111-117.

Joglekar, A.P., K. Bloom, and E.D. Salmon. 2009. In vivo protein architecture of the eukaryotic kinetochore with nanometer scale accuracy. Curr. Biol. 19:694-699.

Johnson, A.E., D. McCollum, and K.L. Gould. 2012. Polar opposites: Fine-tuning cytokinesis through SIN asymmetry. Cytoskeleton (Hoboken). 69:686-699.

Jones, M.H., and M. Winey. 2006. Centrosome duplication: is asymmetry the clue? Curr. Biol. 16:R808-R810.

Kabeche, R., S. Baldissard, J. Hammond, L. Howard, and J.B. Moseley. 2011. The filament-forming protein Pil1 assembles linear eisosomes in fission yeast. Mol. Biol. Cell. 22:4059-4067.

Kamasaki, T., M. Osumi, and I. Mabuchi. 2007. Three-dimensional arrangement of F- actin in the contractile ring of fission yeast. J. Cell Biol. 178:765-771.

Kanoh, J., and P. Russell. 1998. The protein kinase Cdr2, related to Nim1/Cdr1 mitotic inducer, regulates the onset of mitosis in fission yeast. Mol. Biol. Cell. 9:3321- 3334.

Kavran, J.M., D.E. Klein, A. Lee, M. Falasca, S.J. Isakoff, E.Y. Skolnik, and M.A. Lemmon. 1998. Specificity and promiscuity in phosphoinositide binding by pleckstrin homology domains. J. Biol. Chem. 273:30497-30508.

Keck, J.M., M.H. Jones, C.C. Wong, J. Binkley, D. Chen, S.L. Jaspersen, E.P. Holinger, T. Xu, M. Niepel, M.P. Rout, J. Vogel, A. Sidow, J.R. Yates, III, and M. Winey. 2011. A cell cycle phosphoproteome of the yeast centrosome. Science. 332:1557- 1561.

Kilmartin, J.V. 2003. Sfi1p has conserved centrin-binding sites and an essential function in budding yeast spindle pole body duplication. J. Cell Biol. 162:1211-1221.

Kim, D.U., J. Hayles, D. Kim, V. Wood, H.O. Park, M. Won, H.S. Yoo, T. Duhig, M. Nam, G. Palmer, et al. 2010. Analysis of a genome-wide set of gene deletions in the fission yeast Schizosaccharomyces pombe. Nat. Biotechnol. 28:617-623.

Kinoshita, M., C.M. Field, M.L. Coughlin, A.F. Straight, and T.J. Mitchison. 2002. Self- and actin-templated assembly of mammalian septins. Dev. Cell. 3:791-802.

153

Kitayama, C., A. Sugimoto, and M. Yamamoto. 1997. Type II myosin heavy chain encoded by the myo2 gene composes the contractile ring during cytokinesis in Schizosaccharomyces pombe. J. Cell Biol. 137:1309-1319.

Kleylein-Sohn, J., J. Westendorf, M. Le Clech, R. Habedanck, Y.D. Stierhof, and E.A. Nigg. 2007. Plk4-induced centriole biogenesis in human cells. Dev. Cell. 13:190- 202.

Knop, M., and E. Schiebel. 1997. Spc98p and Spc97p of the yeast gamma-tubulin complex mediate binding to the spindle pole body via their interaction with Spc110p. EMBO J. 16:6985-6995.

Kovar, D.R., J.R. Kuhn, A.L. Tichy, and T.D. Pollard. 2003. The fission yeast cytokinesis formin Cdc12p is a barbed end actin filament capping protein gated by profilin. J. Cell Biol. 161:875-887.

Kovar, D.R., and T.D. Pollard. 2004. Insertional assembly of actin filament barbed ends in association with formins produces piconewton forces. Proc. Natl. Acad. Sci. USA. 101:14725-14730.

Kovar, D.R., J.-Q. Wu, and T.D. Pollard. 2005. Profilin-mediated competition between capping protein and formin Cdc12p during cytokinesis in fission yeast. Mol. Biol. Cell. 16:2313-2324.

Krapp, A., S. Schmidt, E. Cano, and V. Simanis. 2001. S. pombe cdc11p, together with sid4p, provides an anchor for septation initiation network proteins on the spindle pole body. Curr. Biol. 11:1559-1568.

Krapp, A., and V. Simanis. 2008. An overview of the fission yeast septation initiation network (SIN). Biochem. Soc. Trans. 36:411-415.

Krien, M.J., S.J. Bugg, M. Palatsides, G. Asouline, M. Morimyo, and M.J. O'Connell. 1998. A NIMA homologue promotes chromatin condensation in fission yeast. J. Cell Sci. 111:967-976.

Kuriyama, R., and G.G. Borisy. 1981. Centriole cycle in Chinese hamster ovary cells as determined by whole-mount electron microscopy. J. Cell Biol. 91:814-821.

Laporte, D., V.C. Coffman, I-J. Lee, and J.-Q. Wu. 2011. Assembly and architecture of precursor nodes during fission yeast cytokinesis. J. Cell Biol. 192:1005-1021.

Laporte, D., N. Ojkic, D. Vavylonis, and J.-Q. Wu. 2012. α-Actinin and fimbrin cooperate with myosin II to organize actomyosin bundles during contractile-ring assembly. Mol. Biol. Cell. 23:3094-3110.

154

Laporte, D., B. Salin, B. Daignan-Fornier, and I. Sagot. 2008. Reversible cytoplasmic localization of the proteasome in quiescent yeast cells. J. Cell Biol. 181:737-745.

Laporte, D., R. Zhao, and J.-Q. Wu. 2010. Mechanisms of contractile-ring assembly in fission yeast and beyond. Semin. Cell Dev. Biol. 21:892-898.

Lee, I-J., and J.-Q. Wu. 2012. Characterization of Mid1 domains for targeting and scaffolding in fission yeast cytokinesis. J. Cell Sci. 125:2973-2985.

Li, H., J. Ruan, and R. Durbin. 2008. Mapping short DNA sequencing reads and calling variants using mapping quality scores. Genome Res. 18:1851-1858.

Li, J., J. Wang, H. Jiao, J. Liao, and X. Xu. 2010. Cytokinesis and cancer: Polo loves ROCK'n' Rho(A). J. Genet. Genomics. 37:159-172.

Li, S., J.J. Fernandez, W.F. Marshall, and D.A. Agard. 2012. Three-dimensional structure of basal body triplet revealed by electron cryo-tomography. EMBO J. 31:552-562.

Li, S., A.M. Sandercock, P. Conduit, C.V. Robinson, R.L. Williams, and J.V. Kilmartin. 2006. Structural role of Sfi1p-centrin filaments in budding yeast spindle pole body duplication. J. Cell Biol. 173:867-877.

Lim, H.H., P.Y. Goh, and U. Surana. 1996. Spindle pole body separation in Saccharomyces cerevisiae requires dephosphorylation of the tyrosine 19 residue of Cdc28. Mol. Cell. Biol. 16:6385-6397.

Lim, H.H., T. Zhang, and U. Surana. 2009. Regulation of centrosome separation in yeast and vertebrates: common threads. Trends Cell Biol. 19:325-333.

Lingle, W.L., W.H. Lutz, J.N. Ingle, N.J. Maihle, and J.L. Salisbury. 1998. Centrosome hypertrophy in human breast tumors: implications for genomic stability and cell polarity. Proc. Natl. Acad. Sci. USA. 95:2950-2955.

Liu, H.L., A.H. Osmani, L. Ukil, S. Son, S. Markossian, K.F. Shen, M. Govindaraghavan, A. Varadaraj, S.B. Hashmi, C.P. De Souza, and S.A. Osmani. 2010. Single-step affinity purification for fungal proteomics. Eukaryot. Cell. 9:831-833.

Loo, T.H., and M. Balasubramanian. 2008. Schizosaccharomyces pombe Pak-related protein, Pak1p/Orb2p, phosphorylates myosin regulatory light chain to inhibit cytokinesis. J. Cell Biol. 183:785-793.

Lord, M., and T.D. Pollard. 2004. UCS protein Rng3p activates actin filament gliding by fission yeast myosin-II. J. Cell Biol. 167:315-325.

155

Lord, M., T.E. Sladewski, and T.D. Pollard. 2008. Yeast UCS proteins promote actomyosin interactions and limit myosin turnover in cells. Proc. Natl. Acad. Sci. USA. 105:8014-8019.

Ma, P., J. Winderickx, D. Nauwelaers, F. Dumortier, A. De Doncker, J.M. Thevelein, and P. Van Dijck. 1999. Deletion of SFI1, a novel suppressor of partial Ras-cAMP pathway deficiency in the yeast Saccharomyces cerevisiae, causes G2 arrest. Yeast. 15:1097-1109.

Macia, E., S. Paris, and M. Chabre. 2000. Binding of the PH and polybasic C-terminal domains of ARNO to phosphoinositides and to acidic lipids. Biochemistry. 39:5893-5901.

MacIver, F.H., K. Tanaka, A.M. Robertson, and I.M. Hagan. 2003. Physical and functional interactions between polo kinase and the spindle pole component Cut12 regulate mitotic commitment in S. pombe. Genes Dev. 17:1507-1523.

Maddox, A.S., B. Habermann, A. Desai, and K. Oegema. 2005. Distinct roles for two C. elegans anillins in the gonad and early embryo. Development. 132:2837-2848.

Maddox, A.S., L. Lewellyn, A. Desai, and K. Oegema. 2007. Anillin and the septins promote asymmetric ingression of the cytokinetic furrow. Dev. Cell. 12:827-835.

Martin, S.G., and M. Berthelot-Grosjean. 2009. Polar gradients of the DYRK-family kinase Pom1 couple cell length with the cell cycle. Nature. 459:852-856.

Martinez-Sanz, J., F. Kateb, L. Assairi, Y. Blouquit, G. Bodenhausen, D. Abergel, L. Mouawad, and C.T. Craescu. 2010. Structure, dynamics and thermodynamics of the human centrin 2/hSfi1 complex. J. Mol. Biol. 395:191-204.

Masuda, H., C.S. Fong, C. Ohtsuki, T. Haraguchi, and Y. Hiraoka. 2011. Spatiotemporal regulations of Wee1 at the G2/M transition. Mol. Biol. Cell. 22:555-569.

Matsuyama, A., R. Arai, Y. Yashiroda, A. Shirai, A. Kamata, S. Sekido, Y. Kobayashi, A. Hashimoto, M. Hamamoto, Y. Hiraoka, et al. 2006. ORFeome cloning and global analysis of protein localization in the fission yeast Schizosaccharomyces pombe. Nat. Biotechnol. 24:841-847.

May, K.M., F.Z. Watts, N. Jones, and J.S. Hyams. 1997. Type II myosin involved in cytokinesis in the fission yeast, Schizosaccharomyces pombe. Cell Motil. Cytoskel. 38:385-396.

Mayer, T.U., T.M. Kapoor, S.J. Haggarty, R.W. King, S.L. Schreiber, and T.J. Mitchison. 1999. Small molecule inhibitor of mitotic spindle bipolarity identified in a phenotype-based screen. Science. 286:971-974.

156

McCollum, D., M.K. Balasubramanian, L.E. Pelcher, S.M. Hemmingsen, and K.L. Gould. 1995. Schizosaccharomyces pombe cdc4+ gene encodes a novel EF-hand protein essential for cytokinesis. J. Cell Biol. 130:651-660.

McCollum, D., and K.L. Gould. 2001. Timing is everything: regulation of mitotic exit and cytokinesis by the MEN and SIN. Trends Cell Biol. 11:89-95.

McCully, E.K., and C.F. Robinow. 1971. Mitosis in the fission yeast Schizosaccharomyces pombe: a comparative study with light and electron microscopy. J. Cell Sci. 9:475-507.

Menendez-Benito, V., S.J. van Deventer, V. Jimenez-Garcia, M. Roy-Luzarraga, F. van Leeuwen, and J. Neefjes. 2013. Spatiotemporal analysis of organelle and macromolecular complex inheritance. Proc. Natl. Acad. Sci. USA. 110:175-180.

Middendorp, S., T. Kuntziger, Y. Abraham, S. Holmes, N. Bordes, M. Paintrand, A. Paoletti, and M. Bornens. 2000. A role for centrin 3 in centrosome reproduction. J. Cell Biol. 148:405-416.

Miller, K.G., C.M. Field, and B.M. Alberts. 1989. Actin–binding proteins from Drosophila embryos: a complex network of interacting proteins detected by F– actin affinity chromatography. J. Cell Biol. 109:2963-2975.

Minc, N., A. Boudaoud, and F. Chang. 2009. Mechanical forces of fission yeast growth. Curr. Biol. 19:1096-1101.

Miron, S., D. Durand, C. Chilom, J. Perez, and C.T. Craescu. 2011. Binding of calcium, magnesium, and target peptides to Cdc31, the centrin of yeast Saccharomyces cerevisiae. Biochemistry. 50:6409-6422.

Mishra, M., and S. Oliferenko. 2008. Cytokinesis: catch and drag. Curr. Biol. 18:R247- R250.

Mitchison, J.M. 1957. The growth of single cells. I. Schizosaccharomyces pombe. Exp.Cell Res. 13:244-262.

Mitchison, J.M., and P. Nurse. 1985. Growth in cell length in the fission yeast Schizosaccharomyces pombe. J. Cell Sci. 75:357-376.

Mitra, P., Y. Zhang, L.E. Rameh, M.P. Ivshina, D. McCollum, J.J. Nunnari, G.M. Hendricks, M.L. Kerr, S.J. Field, L.C. Cantley, and A.H. Ross. 2004. A novel phosphatidylinositol(3,4,5)P3 pathway in fission yeast. J. Cell Biol. 166:205-211.

Moreno, S., A. Klar, and P. Nurse. 1991. Molecular genetic analysis of fission yeast Schizosaccharomyces pombe. Methods Enzymol. 194:795-823.

157

Morrell, J.L., C.B. Nichols, and K.L. Gould. 2004. The GIN4 family kinase, Cdr2p, acts independently of septins in fission yeast. J. Cell Sci. 117:5293-5302.

Moseley, J.B., A. Mayeux, A. Paoletti, and P. Nurse. 2009. A spatial gradient coordinates cell size and mitotic entry in fission yeast. Nature. 459:857-860.

Motegi, F., M. Mishra, M.K. Balasubramanian, and I. Mabuchi. 2004. Myosin-II reorganization during mitosis is controlled temporally by its dephosphorylation and spatially by Mid1 in fission yeast. J. Cell Biol. 165:685-695.

Motegi, F., K. Nakano, and I. Mabuchi. 2000. Molecular mechanism of myosin-II assembly at the division site in Schizosaccharomyces pombe. J. Cell Sci. 113:1813-1825.

Mukhina, S., Y.L. Wang, and M. Murata-Hori. 2007. α-actinin is required for tightly regulated remodeling of the actin cortical network during cytokinesis. Dev. Cell. 13:554-565.

Muller, E.G., B.E. Snydsman, I. Novik, D.W. Hailey, D.R. Gestaut, C.A. Niemann, E.T. O'Toole, T.H. Giddings, Jr., B.A. Sundin, and T.N. Davis. 2005. The organization of the core proteins of the yeast spindle pole body. Mol. Biol. Cell. 16:3341-3352.

Mulvihill, D.P., and J.S. Hyams. 2002. Cytokinetic actomyosin ring formation and septation in fission yeast are dependent on the full recruitment of the polo-like kinase Plo1 to the spindle pole body and a functional spindle assembly checkpoint. J. Cell Sci. 115:3575-3586.

Mulvihill, D.P., J. Petersen, H. Ohkura, D.M. Glover, and I.M. Hagan. 1999. Plo1 kinase recruitment to the spindle pole body and its role in cell division in Schizosaccharomyces pombe. Mol. Biol. Cell. 10:2771-2785.

Mutoh, T., K. Nakano, and I. Mabuchi. 2005. Rho1-GEFs Rgf1 and Rgf2 are involved in formation of cell wall and septum, while Rgf3 is involved in cytokinesis in fission yeast. Genes Cells. 10:1189-1202.

Nakano, K., R. Arai, and I. Mabuchi. 2005. Small GTPase Rho5 is a functional homologue of Rho1, which controls cell shape and septation in fission yeast. Febs. Lett. 579:5181-5186.

Nakano, K., and I. Mabuchi. 2006. Actin-depolymerizing protein Adf1 is required for formation and maintenance of the contractile ring during cytokinesis in fission yeast. Mol. Biol. Cell. 17:1933-1945.

Nakano, K., K. Satoh, A. Morimatsu, M. Ohnuma, and I. Mabuchi. 2001. Interactions among a fimbrin, a capping protein, and an actin-depolymerizing factor in

158

organization of the fission yeast actin cytoskeleton. Mol. Biol. Cell. 12:3515- 3526.

Naqvi, N.I., K. Eng, K.L. Gould, and M.K. Balasubramanian. 1999. Evidence for F-actin- dependent and -independent mechanisms involved in assembly and stability of the medial actomyosin ring in fission yeast. EMBO J. 18:854-862.

Naqvi, N.I., K.C. Wong, X. Tang, and M.K. Balasubramanian. 2000. Type II myosin regulatory light chain relieves auto-inhibition of myosin-heavy-chain function. Nat. Cell Biol. 2:855-858.

Neidt, E.M., C.T. Skau, and D.R. Kovar. 2008. The cytokinesis formins from the nematode worm and fission yeast differentially mediate actin filament assembly. J. Biol. Chem. 283:23872-23883.

Nigg, E.A., and J.W. Raff. 2009. Centrioles, centrosomes, and cilia in health and disease. Cell. 139:663-678.

Nigg, E.A., and T. Stearns. 2011. The centrosome cycle: Centriole biogenesis, duplication and inherent asymmetries. Nat. Cell Biol. 13:1154-1160.

Nishikawa, S., Y. Terazawa, T. Nakayama, A. Hirata, T. Makio, and T. Endo. 2003. Nep98p is a component of the yeast spindle pole body and essential for nuclear division and fusion. J. Biol. Chem. 278:9938-9943.

Nishimura, Y., and I. Mabuchi. 2003. An IQGAP-like protein is involved in actin assembly together with Cdc42 in the sea urchin egg. Cell Motil. Cytoskeleton. 56:207-218.

Nurse, P. 1975. Genetic control of cell size at cell division in yeast. Nature. 256:547-551.

Nurse, P., and P. Thuriaux. 1980. Regulatory genes controlling mitosis in the fission yeast Schizosaccharomyces pombe. Genetics. 96:627-637.

Nurse, P., P. Thuriaux, and K. Nasmyth. 1976. Genetic control of the cell division cycle in the fission yeast Schizosaccharomyces pombe. Mol. Gen. Genet. 146:167-178.

O'Toole, E.T., M. Winey, and J.R. McIntosh. 1999. High-voltage electron tomography of spindle pole bodies and early mitotic spindles in the yeast Saccharomyces cerevisiae. Mol. Biol. Cell. 10:2017-2031.

Oegema, K., M.S. Savoian, T.J. Mitchison, and C.M. Field. 2000. Functional analysis of a human homologue of the Drosophila actin binding protein anillin suggests a role in cytokinesis. J. Cell Biol. 150:539-552.

159

Ohta, M., M. Sato, and M. Yamamoto. 2012. Spindle pole body components are reorganized during fission yeast meiosis. Mol. Biol. Cell. 23:1799-1811.

Ojkic, N., and D. Vavylonis. 2010. Kinetics of myosin node aggregation into a contractile ring. Phys. Rev. Lett. 105:048102.

Ojkic, N., J.-Q. Wu, and D. Vavylonis. 2011. Model of myosin node aggregation into a contractile ring: the effect of local alignment. J. Phys. Condens. Matter. 23:374103.

Olakowski, M., T. Tyszkiewicz, M. Jarzab, R. Krol, M. Oczko-Wojciechowska, M. Kowalska, M. Kowal, G.M. Gala, M. Kajor, D. Lange, et al. 2009. NBL1 and anillin (ANLN) genes over-expression in pancreatic carcinoma. Folia. Histochem. Cytobiol. 47:249-255.

O'Leary, P.C., S.A. Penny, R.T. Dolan, C.M. Kelly, S.F. Madden, E. Rexhepaj, D.J. Brennan, A.H. McCann, F. Ponten, M. Uhlen, et al. 2013. Systematic antibody generation and validation via tissue microarray technology leading to identification of a novel protein prognostic panel in breast cancer. BMC Cancer. 13:175.

Padmanabhan, A., K. Bakka, M. Sevugan, N.I. Naqvi, V. D'Souza, X. Tang, M. Mishra, and M.K. Balasubramanian. 2011. IQGAP-related Rng2p organizes cortical nodes and ensures position of cell division in fission yeast. Curr. Biol. 21:467-472.

Padte, N.N., S.G. Martin, M. Howard, and F. Chang. 2006. The cell-end factor pom1p inhibits mid1p in specification of the cell division plane in fission yeast. Curr. Biol. 16:2480-2487.

Paoletti, A., N. Bordes, R. Haddad, C.L. Schwartz, F. Chang, and M. Bornens. 2003. Fission yeast cdc31p is a component of the half-bridge and controls SPB duplication. Mol. Biol. Cell. 14:2793-2808.

Paoletti, A., and F. Chang. 2000. Analysis of mid1p, a protein required for placement of the cell division site, reveals a link between the nucleus and the cell surface in fission yeast. Mol. Biol. Cell. 11:2757-2773.

Paoletti, A., M. Moudjou, M. Paintrand, J.L. Salisbury, and M. Bornens. 1996. Most of centrin in animal cells is not centrosome-associated and centrosomal centrin is confined to the distal lumen of centrioles. J. Cell Sci. 109:3089-3102.

Pardo, M., and P. Nurse. 2003. Equatorial retention of the contractile actin ring by microtubules during cytokinesis. Science. 300:1569-1574.

160

Parker, L.L., S. Atherton-Fessler, M.S. Lee, S. Ogg, J.L. Falk, K.I. Swenson, and H. Piwnica-Worms. 1991. Cyclin promotes the tyrosine phosphorylation of p34cdc2 in a wee1+ dependent manner. EMBO J. 10:1255-1263.

Peel, N., N.R. Stevens, R. Basto, and J.W. Raff. 2007. Overexpressing centriole- replication proteins in vivo induces centriole overduplication and de novo formation. Curr. Biol. 17:834-843.

Pelham, R.J., and F. Chang. 2002. Actin dynamics in the contractile ring during cytokinesis in fission yeast. Nature. 419:82-86.

Pereira, G., and E. Schiebel. 2001. The role of the yeast spindle pole body and the mammalian centrosome in regulating late mitotic events. Curr. Opin. Cell Biol. 13:762-769.

Perez-Mongiovi, D., C. Beckhelling, P. Chang, C.C. Ford, and E. Houliston. 2000. Nuclei and microtubule asters stimulate maturation/M phase promoting factor (MPF) activation in Xenopus eggs and egg cytoplasmic extracts. J. Cell Biol. 150:963-974.

Piekny, A.J., and M. Glotzer. 2008. Anillin is a scaffold protein that links RhoA, actin, and myosin during cytokinesis. Curr. Biol. 18:30-36.

Piekny, A.J., and A.S. Maddox. 2010. The myriad roles of Anillin during cytokinesis. Semin. Cell Dev. Biol. 21:881-891.

Piel, M., J. Nordberg, U. Euteneuer, and M. Bornens. 2001. Centrosome-dependent exit of cytokinesis in animal cells. Science. 291:1550-1553.

Pihan, G.A., A. Purohit, J. Wallace, H. Knecht, B. Woda, P. Quesenberry, and S.J. Doxsey. 1998. Centrosome defects and genetic instability in malignant tumors. Cancer Res. 58:3974-3985.

Pinar, M., P.M. Coll, S.A. Rincon, and P. Perez. 2008. Schizosaccharomyces pombe Pxl1 is a paxillin homologue that modulates Rho1 activity and participates in cytokinesis. Mol. Biol. Cell. 19:1727-1738.

Pollard, T.D., and J.-Q. Wu. 2010. Understanding cytokinesis: lessons from fission yeast. Nat. Rev. Mol. Cell Biol. 11:149-155.

Reymond, A., S. Schmidt, and V. Simanis. 1992. Mutations in the cdc10 start gene of Schizosaccharomyces pombe implicate the region of homology between cdc10 and SWI6 as important for p85cdc10 function. Mol. Gen. Genet. 234:449-456.

Rincon, S., P.M. Coll, and P. Perez. 2007. Spatial regulation of Cdc42 during cytokinesis. Cell Cycle. 6:1687-1691. 161

Rincon, S.A., and A. Paoletti. 2012. Mid1/anillin and the spatial regulation of cytokinesis in fission yeast. Cytoskeleton (Hoboken). 69:764-777.

Robbins, E., G. Jentzsch, and A. Micali. 1968. The centriole cycle in synchronized HeLa cells. J. Cell Biol. 36:329-339.

Roberts-Galbraith, R.H., J.S. Chen, J. Wang, and K.L. Gould. 2009. The SH3 domains of two PCH family members cooperate in assembly of the Schizosaccharomyces pombe contractile ring. J. Cell Biol. 184:113-127.

Roberts-Galbraith, R.H., and K.L. Gould. 2008. Stepping into the ring: the SIN takes on contractile ring assembly. Genes Dev. 22:3082-3088.

Roberts-Galbraith, R.H., M.D. Ohi, B.A. Ballif, J.S. Chen, I. McLeod, W.H. McDonald, S.P. Gygi, J.R. Yates, III, and K.L. Gould. 2010. Dephosphorylation of F-BAR protein Cdc15 modulates its conformation and stimulates its scaffolding activity at the cell division site. Mol. Cell. 39:86-99.

Robinow, C.F., and J. Marak. 1966. A fiber apparatus in the nucleus of the yeast cell. J. Cell Biol. 29:129-151.

Rodrigues-Martins, A., M. Riparbelli, G. Callaini, D.M. Glover, and M. Bettencourt- Dias. 2007. Revisiting the role of the mother centriole in centriole biogenesis. Science. 316:1046-1050.

Romao, M., K. Tanaka, J.B. Sibarita, N.T. Ly-Hartig, T.U. Tanaka, and C. Antony. 2008. Three-dimensional electron microscopy analysis of ndc10-1 mutant reveals an aberrant organization of the mitotic spindle and spindle pole body defects in Saccharomyces cerevisiae. J. Struct. Biol. 163:18-28.

Ronkainen, H., P. Hirvikoski, S. Kauppila, and M.H. Vaarala. 2011. Anillin expression is a marker of favourable prognosis in patients with renal cell carcinoma. Oncology Reports. 25:129-133.

Rose, M.D., and G.R. Fink. 1987. KAR1, a gene required for function of both intranuclear and extranuclear microtubules in yeast. Cell. 48:1047-1060.

Sagona, A.P., and H. Stenmark. 2010. Cytokinesis and cancer. Febs. Lett. 584:2652- 2661.

Saha, S., and T.D. Pollard. 2012a. Anillin-related protein Mid1p coordinates the assembly of the cytokinetic contractile ring in fission yeast. Mol. Biol. Cell. 23:3982-3992.

162

Saha, S., and T.D. Pollard. 2012b. Characterization of structural and functional domains of the anillin-related protein Mid1p that contribute to cytokinesis in fission yeast. Mol. Biol. Cell. 23:3993-4007.

Salimova, E., M. Sohrmann, N. Fournier, and V. Simanis. 2000. The S. pombe orthologue of the S. cerevisiae mob1 gene is essential and functions in signalling the onset of septum formation. J. Cell Sci. 113:1695-1704.

Salisbury, J.L. 2007. A mechanistic view on the evolutionary origin for centrin-based control of centriole duplication. J. Cell Physiol. 213:420-428.

Salisbury, J.L., A. Baron, B. Surek, and M. Melkonian. 1984. Striated flagellar roots: isolation and partial characterization of a calcium-modulated contractile organelle. J. Cell Biol. 99:962-970.

Salisbury, J.L., K.M. Suino, R. Busby, and M. Springett. 2002. Centrin-2 is required for centriole duplication in mammalian cells. Curr. Biol. 12:1287-1292.

Sanders, L.C., F. Matsumura, G.M. Bokoch, and P. de Lanerolle. 1999. Inhibition of myosin light chain kinase by p21-activated kinase. Science. 283:2083-2085.

Sato, M., M. Toya, and T. Toda. 2009. Visualization of fluorescence-tagged proteins in fission yeast: the analysis of mitotic spindle dynamics using GFP-tubulin under the native promoter. Methods Mol. Biol. 545:185-203.

Scott, B.J., E.M. Neidt, and D.R. Kovar. 2011. The functionally distinct fission yeast formins have specific actin-assembly properties. Mol Biol Cell. 22:3826-3839.

Selvapandiyan, A., P. Kumar, J.C. Morris, J.L. Salisbury, C.C. Wang, and H.L. Nakhasi. 2007. Centrin1 is required for organelle segregation and cytokinesis in Trypanosoma brucei. Mol. Biol. Cell. 18:3290-3301.

Shepperd, L.A., J.C. Meadows, A.M. Sochaj, T.C. Lancaster, J. Zou, G.J. Buttrick, J. Rappsilber, K.G. Hardwick, and J.B. Millar. 2012. Phosphodependent recruitment of Bub1 and Bub3 to Spc7/KNL1 by Mph1 kinase maintains the spindle checkpoint. Curr. Biol. 22:891-899.

Silverman-Gavrila, R.V., K.G. Hales, and A. Wilde. 2008. Anillin-mediated targeting of peanut to pseudocleavage furrows is regulated by the GTPase Ran. Mol. Biol. Cell. 19:3735-3744.

Skau, C.T., and D.R. Kovar. 2010. Fimbrin and tropomyosin competition regulates endocytosis and cytokinesis kinetics in fission yeast. Curr. Biol. 20:1415-1422.

Skau, C.T., E.M. Neidt, and D.R. Kovar. 2009. Role of tropomyosin in formin-mediated contractile ring assembly in fission yeast. Mol. Biol. Cell. 20:2160-2173. 163

Skoumpla, K., A.T. Coulton, W. Lehman, M.A. Geeves, and D.P. Mulvihill. 2007. Acetylation regulates tropomyosin function in the fission yeast Schizosaccharomyces pombe. J. Cell Sci. 120:1635-1645.

Sladewski, T.E., M.J. Previs, and M. Lord. 2009. Regulation of fission yeast myosin-II function and contractile ring dynamics by regulatory light-chain and heavy-chain phosphorylation. Mol. Biol. Cell. 20:3941-3952.

Sohrmann, M., C. Fankhauser, C. Brodbeck, and V. Simanis. 1996. The dmf1/mid1 gene is essential for correct positioning of the division septum in fission yeast. Genes Dev. 10:2707-2719.

Sohrmann, M., S. Schmidt, I. Hagan, and V. Simanis. 1998. Asymmetric segregation on spindle poles of the Schizosaccharomyces pombe septum-inducing protein kinase Cdc7p. Genes Dev. 12:84-94.

Sonnen, K.F., L. Schermelleh, H. Leonhardt, and E.A. Nigg. 2012. 3D-structured illumination microscopy provides novel insight into architecture of human centrosomes. Biology Open. 1:965-976.

Spang, A., I. Courtney, U. Fackler, M. Matzner, and E. Schiebel. 1993. The calcium- binding protein cell division cycle 31 of Saccharomyces cerevisiae is a component of the half bridge of the spindle pole body. J. Cell Biol. 123:405-416.

Spang, A., I. Courtney, K. Grein, M. Matzner, and E. Schiebel. 1995. The Cdc31p- binding protein Kar1p is a component of the half bridge of the yeast spindle pole body. J. Cell Biol. 128:863-877.

Sparks, C.A., M. Morphew, and D. McCollum. 1999. Sid2p, a spindle pole body kinase that regulates the onset of cytokinesis. J. Cell Biol. 146:777-790.

Spencer, S., D. Dowbenko, J. Cheng, W. Li, J. Brush, S. Utzig, V. Simanis, and L.A. Lasky. 1997. PSTPIP: A tyrosine phosphorylated cleavage furrow-associated protein that is a substrate for a PEST tyrosine phosphatase. J. Cell Biol. 138:845- 860.

Stark, B.C., T.E. Sladewski, L.W. Pollard, and M. Lord. 2010. Tropomyosin and myosin- II cellular levels promote actomyosin ring assembly in fission yeast. Mol. Biol. Cell. 21:989-1000.

Stemm-Wolf, A.J., J.B. Meehl, and M. Winey. 2013. Sfr13 is a member of a large family of asymmetrically localized Sfi1-repeat proteins and is important for basal body separation and stability in Tetrahymena thermophila. J. Cell Sci. 126:1659-1671.

164

Stemm-Wolf, A.J., G. Morgan, T.H. Giddings, Jr., E.A. White, R. Marchione, H.B. McDonald, and M. Winey. 2005. Basal body duplication and maintenance require one member of the Tetrahymena thermophila centrin gene family. Mol. Biol. Cell. 16:3606-3619.

Straight, A.F., C.M. Field, and T.J. Mitchison. 2005. Anillin binds nonmuscle myosin II and regulates the contractile ring. Mol. Biol. Cell. 16:193-201.

Suzuki, C., Y. Daigo, N. Ishikawa, T. Kato, S. Hayama, T. Ito, E. Tsuchiya, and Y. Nakamura. 2005. ANLN plays a critical role in human lung carcinogenesis through the activation of RHOA and by involvement in the phosphoinositide 3- kinase/AKT pathway. Cancer Res. 65:11314-11325.

Takaine, M., O. Numata, and K. Nakano. 2009. Fission yeast IQGAP arranges actin filaments into the cytokinetic contractile ring. EMBO J. 28:3117-3131.

Takeda, T., and F. Chang. 2005. Role of fission yeast myosin I in organization of sterol- rich membrane domains. Curr. Biol. 15:1331-1336.

Takeda, T., T. Kawate, and F. Chang. 2004. Organization of a sterol-rich membrane domain by cdc15p during cytokinesis in fission yeast. Nat. Cell Biol. 6:1142- 1144.

Tallada, V.A., K. Tanaka, M. Yanagida, and I.M. Hagan. 2009. The S. pombe mitotic regulator Cut12 promotes spindle pole body activation and integration into the nuclear envelope. J. Cell Biol. 185:875-888.

Tamm, T., A. Grallert, E.P. Grossman, I. Alvarez-Tabares, F.E. Stevens, and I.M. Hagan. 2011. Brr6 drives the Schizosaccharomyces pombe spindle pole body nuclear envelope insertion/extrusion cycle. J. Cell Biol. 195:467-484.

Tanaka, K., and T. Kanbe. 1986. Mitosis in the fission yeast Schizosaccharomyces pombe as revealed by freeze-substitution electron microscopy. J. Cell Sci. 80:253-268.

Tanaka, K., J. Petersen, F. MacIver, D.P. Mulvihill, D.M. Glover, and I.M. Hagan. 2001. The role of Plo1 kinase in mitotic commitment and septation in Schizosaccharomyces pombe. EMBO J. 20:1259-1270.

Tang, X., J. Huang, A. Padmanabhan, K. Bakka, Y. Bao, B.Y. Tan, W.Z. Cande, and M.K. Balasubramanian. 2011. Marker reconstitution mutagenesis: a simple and efficient reverse genetic approach. Yeast. 28:205-212.

Tasto, J.J., J.L. Morrell, and K.L. Gould. 2003. An anillin homologue, Mid2p, acts during fission yeast cytokinesis to organize the septin ring and promote cell separation. J. Cell Biol. 160:1093-1103.

165

Tatebe, H., K. Nakano, R. Maximo, and K. Shiozaki. 2008. Pom1 DYRK regulates localization of the Rga4 GAP to ensure bipolar activation of Cdc42 in fission yeast. Curr. Biol. 18:322-330.

Trautmann, S., B.A. Wolfe, P. Jorgensen, M. Tyers, K.L. Gould, and D. McCollum. 2001. Fission yeast Clp1p phosphatase regulates G2/M transition and coordination of cytokinesis with cell cycle progression. Curr. Biol. 11:931-940.

Uzawa, S., F. Li, Y. Jin, K.L. McDonald, M.B. Braunfeld, D.A. Agard, and W.Z. Cande. 2004. Spindle pole body duplication in fission yeast occurs at the G1/S boundary but maturation is blocked until exit from S by an event downstream of cdc10+. Mol. Biol. Cell. 15:5219-5230.

Vallen, E.A., W. Ho, M. Winey, and M.D. Rose. 1994. Genetic interactions between CDC31 and KAR1, two genes required for duplication of the microtubule organizing center in Saccharomyces cerevisiae. Genetics. 137:407-422.

Vavylonis, D., J.-Q. Wu, S. Hao, B. O'Shaughnessy, and T.D. Pollard. 2008. Assembly mechanism of the contractile ring for cytokinesis by fission yeast. Science. 319:97-100.

Vonderfecht, T., M.W. Cookson, T.H. Giddings, Jr., C. Clarissa, and M. Winey. 2012. The two human centrin homologues have similar but distinct functions at Tetrahymena basal bodies. Mol. Biol. Cell. 23:4766-4777.

Wach, A., A. Brachat, R. Pohlmann, and P. Philippsen. 1994. New heterologous modules for classical or PCR-based gene disruptions in Saccharomyces cerevisiae. Yeast. 10:1793-1808.

Wachtler, V., Y. Huang, J. Karagiannis, and M.K. Balasubramanian. 2006. Cell cycle- dependent roles for the FCH-domain protein Cdc15p in formation of the actomyosin ring in Schizosaccharomyces pombe. Mol. Biol. Cell. 17:3254-3266.

Wachtler, V., S. Rajagopalan, and M.K. Balasubramanian. 2003. Sterol-rich plasma membrane domains in the fission yeast Schizosaccharomyces pombe. J. Cell Sci. 116:867-874.

Watanabe, S., K. Okawa, T. Miki, S. Sakamoto, T. Morinaga, K. Segawa, T. Arakawa, M. Kinoshita, T. Ishizaki, and S. Narumiya. 2010. Rho and anillin-dependent control of mDia2 localization and function in cytokinesis. Mol. Biol. Cell. 21:3193-3204.

Watt, S., J. Mata, L. Lopez-Maury, S. Marguerat, G. Burns, and J. Bähler. 2008. urg1: a uracil-regulatable promoter system for fission yeast with short induction and repression times. PLoS One. 3:e1428. 166

Weiss, E., and M. Winey. 1996. The Saccharomyces cerevisiae spindle pole body duplication gene MPS1 is part of a mitotic checkpoint. J Cell Biol. 132:111-123.

Werner, M., E. Munro, and M. Glotzer. 2007. Astral signals spatially bias cortical myosin recruitment to break symmetry and promote cytokinesis. Curr. Biol. 17:1286- 1297.

Winey, M., L. Goetsch, P. Baum, and B. Byers. 1991. MPS1 and MPS2: novel yeast genes defining distinct steps of spindle pole body duplication. J. Cell Biol. 114:745-754.

Wolfe, B.A., and K.L. Gould. 2004. Fission yeast Clp1p phosphatase affects G2/M transition and mitotic exit through Cdc25p inactivation. EMBO J. 23:919-929.

Wolfe, B.A., W.H. McDonald, J.R. Yates, III, and K.L. Gould. 2006. Phospho-regulation of the Cdc14/Clp1 phosphatase delays late mitotic events in S. pombe. Dev. Cell. 11:423-430.

Wong, K.C.Y., N.I. Naqvi, Y. Lino, M. Yamamoto, and M.K. Balasubramanian. 2000. Fission yeast rng3p: an UCS-domain protein that mediates myosin II assembly during cytokinesis. J. Cell Sci. 113:2421-2432.

Wood, V., R. Gwilliam, M.A. Rajandream, M. Lyne, R. Lyne, A. Stewart, J. Sgouros, N. Peat, J. Hayles, S. Baker, et al. 2002. The genome sequence of Schizosaccharomyces pombe. Nature. 415:871-880.

Wu, J.-Q., and T.D. Pollard. 2005. Counting cytokinesis proteins globally and locally in fission yeast. Science. 310:310-314.

Wu, J.-Q., J. Bähler, and J.R. Pringle. 2001. Roles of a fimbrin and an α-actinin-like protein in fission yeast cell polarization and cytokinesis. Mol. Biol. Cell. 12:1061- 1077.

Wu, J.-Q., J.R. Kuhn, D.R. Kovar, and T.D. Pollard. 2003. Spatial and temporal pathway for assembly and constriction of the contractile ring in fission yeast cytokinesis. Dev. Cell. 5:723-734.

Wu, J.-Q., C. McCormick, and T.D. Pollard. 2008. Counting proteins in living cells by quantitative fuorescence microscopy with internal standards. Methods Cell Biol. 89:253-273.

Wu, J.-Q., V. Sirotkin, D.R. Kovar, M. Lord, C.C. Beltzner, J.R. Kuhn, and T.D. Pollard. 2006. Assembly of the cytokinetic contractile ring from a broad band of nodes in fission yeast. J. Cell Biol. 174:391-402.

167

Wu, J.-Q., Y. Ye, N. Wang, T.D. Pollard, and J.R. Pringle. 2010. Cooperation between the septins and the actomyosin ring and role of a cell-integrity pathway during cell division in fission yeast. Genetics. 186:897-915.

Wu, L., and P. Russell. 1993. Nim1 kinase promotes mitosis by inactivating Wee1 tyrosine kinase. Nature. 363:738-741.

Wu, L., and P. Russell. 1997. Roles of Wee1 and Nim1 protein kinases in regulating the switch from mitotic division to sexual development in Schizosaccharomyces pombe. Mol. Cell. Biol. 17:10-17.

Wu, L., K. Shiozaki, R. Aligue, and P. Russell. 1996. Spatial organization of the Nim1- Wee1-Cdc2 mitotic control network in Schizosaccharomyces pombe. Mol. Biol. Cell. 7:1749-1758.

Xu, J., D. Wirtz, and T.D. Pollard. 1998. Dynamic cross-linking by α-actinin determines the mechanical properties of actin filament networks. J. Biol. Chem. 273:9570- 9576.

Yamagishi, Y., C.H. Yang, Y. Tanno, and Y. Watanabe. 2012. MPS1/Mph1 phosphorylates the kinetochore protein KNL1/Spc7 to recruit SAC components. Nat. Cell Biol. 14:746-752.

Yang, C.H., C. Kasbek, S. Majumder, A.M. Yusof, and H.A. Fisk. 2010. Mps1 phosphorylation sites regulate the function of centrin 2 in centriole assembly. Mol. Biol. Cell. 21:4361-4372.

Yang, J., X. Liu, G. Yue, M. Adamian, O. Bulgakov, and T. Li. 2002. Rootletin, a novel coiled-coil protein, is a structural component of the ciliary rootlet. J. Cell Biol. 159:431-440.

Yoder, T.J., C.G. Pearson, K. Bloom, and T.N. Davis. 2003. The Saccharomyces cerevisiae spindle pole body is a dynamic structure. Mol. Biol. Cell. 14:3494- 3505.

Yonetani, A., and F. Chang. 2010. Regulation of cytokinesis by the formin cdc12p. Curr. Biol. 20:561-566.

Yonetani, A., R.J. Lustig, J.B. Moseley, T. Takeda, B.L. Goode, and F. Chang. 2008. Regulation and targeting of the fission yeast formin cdc12p in cytokinesis. Mol. Biol. Cell. 19:2208-2219.

168

Young, B.A., C. Buser, and D.G. Drubin. 2010. Isolation and partial purification of the Saccharomyces cerevisiae cytokinetic apparatus. Cytoskeleton (Hoboken). 67:13- 22.

Yu, J.W., J.M. Mendrola, A. Audhya, S. Singh, D. Keleti, D.B. DeWald, D. Murray, S.D. Emr, and M.A. Lemmon. 2004. Genome-wide analysis of membrane targeting by S. cerevisiae pleckstrin homology domains. Mol. Cell. 13:677-688.

Zhang, D., A. Vjestica, and S. Oliferenko. 2010. The cortical ER network limits the permissive zone for actomyosin ring assembly. Curr. Biol. 20:1029-1034.

Zich, J., A.M. Sochaj, H.M. Syred, L. Milne, A.G. Cook, H. Ohkura, J. Rappsilber, and K.G. Hardwick. 2012. Kinase activity of fission yeast Mph1 is required for Mad2 and Mad3 to stably bind the anaphase promoting complex. Curr. Biol. 22:296- 301.

169