Loss of ARID1A Activates ANXA1, Which Serves As a Predictive

Published OnlineFirst May 12, 2016; DOI: 10.1158/1078-0432.CCR-15-2996

Cancer Therapy: Clinical Clinical Cancer Research Loss of ARID1A Activates ANXA1, which Serves as a Predictive Biomarker for Trastuzumab Resistance Katrien Berns1, Amir Sonnenblick2, Annemiek Gennissen1, Sylvain Brohee 2, E. Marielle Hijmans1, Bastiaan Evers1, Debora Fumagalli2, Christine Desmedt2, Sibylle Loibl3, Carsten Denkert4, Patrick Neven5, Wei Guo6, Fan Zhang6, Theo A. Knijnenburg1, Tjalling Bosse7, Michiel S. van der Heijden1, Sanne Hindriksen1, Wouter Nijkamp1, Lodewyk F.A. Wessels1, Heikki Joensuu8, Gordon B. Mills6, Roderick L. Beijersbergen1, Christos Sotiriou2, and Rene Bernards1

Abstract

Purpose: Despite the substantial progress in the development signaling cascade at different levels. We demonstrate that ARID1A of targeted anticancer drugs, treatment failure due to primary or loss activates annexin A1 (ANXA1) expression, which is required acquired resistance is still a major hurdle in the effective treatment for drug resistance through its activation of AKT. We find that the of most advanced human cancers. Understanding these resistance AKT inhibitor MK2206 restores sensitivity of ARID1A knockdown mechanisms will be instrumental to improve personalized cancer breast cancer cells to both the mTOR kinase inhibitor AZD8055 treatment. and trastuzumab. Consistent with these in vitro data, we find in þ Experimental Design: Genome-wide loss-of-function genetic two independent HER2 breast cancer patient series that high screens were performed to identify genes implicated in resistance ANXA1 expression is associated with resistance to adjuvant tras- þ to HER2/PI3K/mTOR targeting agents in HER2 breast cancer cell tuzumab–based therapy. lines. Expression and adjuvant trastuzumab response data from Conclusions: Our findings provide a rationale for why tumors þ the HER2 breast cancer trials FinHer and Responsify were used to accumulate ARID1A mutations and identify high ANXA1 expres- validate our findings in patient series. sion as a predictive biomarker for trastuzumab-based treatment. Results: We find that reduced ARID1A expression confers Our findings also suggest strategies to treat breast cancers with resistance to several drugs that inhibit the HER2/PI3K/mTOR elevated ANXA1 expression. Clin Cancer Res; 1–11. 2016 AACR.

Introduction tumors. However, therapeutic resistance to anti-HER2 drugs dampens the long-term efficacy of these targeted agents, espe- The HER2-targeting antibody trastuzumab is one of the first cially in patients with advanced disease. Proposed mechanisms examples of personalized cancer therapy where significantly þ of trastuzumab resistance include alterations in the target HER2 improved clinical outcomes are seen in patients with HER2 via cleavage or masking of the receptor, increased ligand pro- duction, signaling from other receptor tyrosine kinases (RTK) within or out of the HER family, or direct downstream pathway 1 Division of Molecular Carcinogenesis, The Netherlands Cancer Insti- activation (1). The common alteration associated with trastu- tute, Amsterdam, the Netherlands. 2Translational Breast Cancer Lab- oratory, Free University of Brussels, Institute Jules Bordet, Brussels, zumab resistance appears to be activation of the PI3K/mTOR Belgium. 3GBG German Breast Group, Neu Isenburg, Germany. 4Insti- signaling cascade. As such, directly targeting the PI3K/mTOR tute of Pathology, Charite Universitatsmedizin€ Berlin, Berlin, Germany. nodes appears as a potential strategy to treat trastuzumab- 5Multidisciplinary Breast Center, KU Leuven, University Hospitals, Leuven, Belgium. 6Department of Systems Biology, The University of refractory disease (2, 3). Texas, MD Anderson Cancer Center, Houston, Texas. 7Department of Subunits of the SWI/SNF chromatin-remodeling complexes Pathology, Leiden University Medical Center, Leiden, the Netherlands. 8 have been implicated as tumor suppressors in human cancer. Department of Oncology, Helsinki University Central Hospital, Hel- ARID1A sinki, Finland. is one of the most commonly mutated SWI/SNF subunit genes. Recurrent inactivating mutations in ARID1A have been Note: Supplementary data for this article are available at Clinical Cancer identified with a high frequency in human cancer (4–11), Research Online (http://clincancerres.aacrjournals.org/). although the mechanisms underlying the selection for loss K. Berns, A. Sonnenblick, C. Sotiriou, and R. Bernards contributed equally to this of ARID1A function in cancer remain largely unknown. The article. SWI/SNF complex regulates the dynamic repositioning of nucleo- Corresponding Author: Rene Bernards, Division of Molecular Carcinogenesis, somes; therefore, the loss of ARID1A could impact a myriad of The Netherlands Cancer Institute, Plesmanlaan 121, Amsterdam 1066 CX, The signaling pathways through deregulated transcription (12). One Netherlands. Phone: 31 20 5121960; Fax: 31 20 5121954; E-mail: [email protected] likely explanation is that loss of ARID1A activates one or more doi: 10.1158/1078-0432.CCR-15-2996 major signaling pathways that confer an advantage to the tumor 2016 American Association for Cancer Research. cells through enhanced proliferation and/or survival. Annexin A1

www.aacrjournals.org OF1

Berns et al.

shARID1A#1, GGGGTGAGCTGCAACAAAG; shARID1A#2, Translational Relevance AGTTGAAGTTCTGATGAA; shARID1A#3, GAGAAGTTGTATAG- Therapeutic resistance imposes a significant problem in the CACTA; shARID1A#4, GTGTAGACCCTTTCATGTA; shANXA1, þ targeted treatment of patients with HER2 breast cancer. AGACATTAACAGGGTCTAC. Control infections with shctrl were Understanding the molecular mechanism of anti-HER2 drug performed with a mixture of nonfunctional hairpins. The lenti- resistance will be instrumental to identify patients that fail to viral vector LKO-scrambled was obtained from Addgene (#1864). respond to the therapy upfront and help design more optimal A doxycycline-inducible lentiviral shRNA vector (22) was mod- treatment strategies. We demonstrate here that loss of ARID1A ified as described previously (23) and was used to express the confers resistance to drugs that target the HER2/PI3K/mTOR ANXA1 hairpin (see above) under the control of doxycycline. The pathway in breast cancer through activation of AKT via upre- V5-tagged ANXA1 lentiviral expression vector LX304-ANXA1 was þ gulation of annexin A1 (ANXA1). Analysis of two HER2 obtained from the Broad Institute (Cambridge, MA; clone ID breast cancer patient series demonstrates that low ANXA1 ccsbBroad304_05822). ARID1A knockout cell lines were gener- expression may serve as a predictive marker of good trastuzu- ated with a dual vector doxycycline-inducible CRISPR/Cas9 vector mab response. Our data indicate that patients with high levels system as described previously (24) using the gRNA sequence of ANXA1 may benefit from combining trastuzumab with targeting ARID1A: AGGATGAGTCACGCCTCCAT. agents that target the PI3K/AKT pathway, which warrants further exploration. Quantitative RT-PCR The 7500 Fast Real-Time PCR System from Applied Biosystems was used to measure mRNA levels, which were normalized to the expression of GAPDH. The following primer sequences were used (ANXA1) belongs to the family of calcium/phospholipid–bind- in the SYBR Green Master Mix (Roche): GAPDH_forward, ing proteins and has been implicated in various biologic process- AAGGTGAAGGTCGGAGTCAA; GAPDH_reverse, AATGAAGGG- es, such as calcium signaling, anti-inflammatory effects, receptor GTCATTGATGG; ANXA1_forward, GGCCTGCTTGAGGAATTC- mobilization, cell proliferation, and tumor progression (13, 14). TG; ANXA1_reverse, GAGAAGAATTTCTCTTTAGTTCTTTGC; ARI- In this study, we aimed to identify new modulators of the D1A_forward, TCTTGCCCATCTGATCCATT; ARID1A_reverse, HER2/PI3K/mTOR cascade through functional genetic screens CCAACAAAGGAGCCACCAC. (15–19). We report here an unexpected functional relationship between loss of ARID1A, activation of ANXA1, and resistance to Chromatin immunoprecipitation drugs that act in the HER2/PI3K/mTOR signaling cascade through Chromatin immunoprecipitation (ChIP) assay was performed activation of AKT. Our findings provide a molecular basis for as described previously (25). qRT-PCR of the ANXA1 region was the frequent inactivating ARID1A mutations in human cancer performed with ANXA1_forward, GCCCTCTTTCCACAGGAG- (12, 20). Furthermore, we provide evidence from two clinical TAT; ANXA1_reverse, ACTTTTGGGGAAGAGGCCAT. Control studies that ANXA1 upregulation is associated with poor response primers were located 500 kb downstream of the ANXA1 gene: to trastuzumab in breast cancer. Our findings identify a new control (C4)_forward, TGGTTTGACCAGGACTGGAG; control clinically relevant mechanism of resistance to HER2/PI3K/ (C4)_reverse, CTAGCAACCGGCACCTAACA. For chromatin mTOR–targeting agents and suggest treatment strategies for immunoprecipitation sequencing (ChIP-Seq), sequences were tumors with elevated ANXA1 levels. generated by Illumina HiSeq 2000 genome analyzer and aligned to the Human Reference Genome (assembly hg19; February Materials and Methods 2009). Cell culture reagents The breast cancer cell lines MCF7, BT474, SKBR3, HCC1954, IHC and scoring and ZR75.1 were obtained from the ATCC (www.ATCC.org) and IHC was performed as described previously (26). The slides cultured in DMEM/8% FCS/1% penicillin/streptomycin. MCF7 were counterstained with hematoxylin. Nuclear staining intensity and BT474 were authenticated via STR profiling in July 2014 for ARID1A was scored (pathologist T. Bosse) using a 3-tier (BaseClear B.V.). Stable subclones expressing the ecotropic recep- system: loss of nuclear staining, weakly positive, and strongly tor were generated to allow efficient infection with ecotropic positive. Surrounding stromal cells served as positive internal retroviruses. High-titer retroviruses and lentiviruses were gener- controls. Cytoplasmic ANXA1 staining was also scored using a 3- ated as described previously (http://www.broadinstitute.org/ tier scoring scheme: no or very weak staining, moderate staining, rnai/public/resources/protocols; ref. 21). For colony formation or diffuse or focal strong staining. assays, cells were seeded in 6-well plates and were fixed with 4% formaldehyde and stained with 0.1% crystal violet. Antibodies For Western blotting, primary antibodies against ARID1A shRNA barcode screens (PSG3), actin (C2), ANXA1 (EH17a), pERK1/2 (T202/Y204; Generation of the NKI shRNA library and performance of E4), ERK1/2 (C16), and HSP90 (H-114) were from Santa Cruz barcode screens have been described elsewhere (15, 16). Addi- Biotechnology; pAKT(S473), pAKT(T308), AKT1/2, pMEK1/2 tional details can be found at www.screeninc.nl. (S217/221), and MEK1/2 were from Cell Signaling Technology. For ChIPs, primary antibody against HistoneH3tmK4 (1012) was Plasmids from Abcam and BRG1 (A300-813A) from Bethyl Laboratories. The following RNAi target sequences were used for the retro- For IHC, ANXA1 antibody (713400) was from Invitrogen and viral shRNA vectors: shGFP, GCTGACCCTGAAGTTCATC; monoclonal ARID1A (sc-32761) from Santa Cruz Biotechnology.

OF2 Clin Cancer Res; 2016 Clinical Cancer Research

ANXA1 Levels Predict Trastuzumab Response in Breast Cancer

Study cohorts according to the essential elements of "reporting recommenda- The FinHer trial is a multicenter phase III randomized adjuvant tions for tumor marker prognostic studies" (33). breast cancer trial that enrolled 1,010 patients (27, 28). A total of þ 232 patients with HER2 breast cancers were further randomized Results to 9 weeks of trastuzumab or no trastuzumab. The Responsify ARID1A loss confers resistance to multiple cancer drugs dataset (as part of FP7 EU consortium; http://www.responsify- þ To identify genes that control the response to the HER2/PI3K/ fp7.eu) is composed of 108 HER2 early-stage breast cancer mTOR–targeting agents in breast cancer, we performed five patients treated with adjuvant trastuzumab provided by the Jules genome-wide shRNA screens in the HER2-amplified cancer cell Bordet Institute (Brussels, Belgium) and the Katholieke Universi- lines BT474, SKBR3, and HCC1954, as summarized in Supple- teit Leuven (Leuven, Belgium). Study participants provided writ- mentary Table S1. We used the previously described barcode ten informed consent to allow further research analyses to be methodology to identify genes whose suppression conferred carried out on their tumor tissue. Both study cohorts have been resistance to cancer drugs (15, 17). We analyzed the data from described in depth recently (29). the independent screens by setting a cut-off value on the hybrid- ization signal (a value higher than 7.5) and ranking the shRNA Gene expression analysis vectors according to their relative enrichment values (M). When Transcriptome sequencing analysis of BT474 and MCF7 cells combining the data from five independent screens we identified, with ARID1A knockdown were performed using RNA sequencing besides the previously established gene PTEN, a knockdown (RNA-Seq). We only considered genes that were more than 1.75- vector targeting the SWI/SNF component ARID1A as a common fold up- or downregulated by two independent shARID1A vectors hit in all genetic screens. This raised the possibility that ARID1A in both cell lines. The protein expression data (RPPA) for the loss modulates the activity of components of the HER2/PI3K/ breast cancer samples were downloaded from the The Cancer mTOR signaling cascade. Indeed, upon validation we found that Genome Atlas (TCGA) website before June 2013. The median two different ARID1A knockdown vectors conferred resistance to expression of ARID1A was used to split each dataset into high- and trastuzumab and to the mTOR inhibitor AZD8055 in BT474 cells low-expression groups. P values within boxplots were determined in long-term colony formation assays (Fig. 1A). To assess the using the Welch two-sample t test. Mutation, mRNA, and protein general validity of this finding, two independent ARID1A knock- expression data for the endometrium tumor samples were also down vectors were introduced in MCF7, a breast cancer cell line obtained from TCGA (downloaded in December 2013). P values that was not used in the primary genetic screens. Again, ARID1A for the data in the boxplots of Supplementary Fig. S3A and S3B depletion resulted in decreased sensitivity to the mTOR inhibitor were derived from one-way ANOVA tests. The FinHer and Respon- AZD8055 (Fig. 1B). We also observed an efficient suppression of sify expression datasets (202 and 93 samples, respectively) were ARID1A protein expression by each of the four independent produced at the J.-C. Heuson Breast Cancer Translational Research shRNA vectors targeting ARID1A (Fig. 1C and D). Laboratory using Affymetrix arrays as described previously (29). To address the underlying mechanism by which ARID1A loss The gene expression data are available at http://www.ncbi.nlm. modulates the response to HER2/PI3K/mTOR–targeting drugs, nih.gov/geo (GEO ID FinHer: GSE65095 and GEO ID Responsify: we first analyzed the major pathways that are downstream or GSE58984). METABRIC expression data (30) were downloaded parallel to these agents, namely PI3K/AKT and MAPK/ERK sig- from the EBI website (datasets EGAD00010000210 and naling cascades. Strikingly, in the breast cancer cell line BT474, we EGAD00010000211). When multiple probes mapped to the observed a predominant effect of ARID1A loss on pAKT activation same Entrez gene identifier, we kept the one with the highest (Fig. 1E) and no clear effects on p-ERK (Supplementary Fig. S1A). variance in the dataset using the genefu package (31). The expres- Moreover, we found that complete knockout of ARID1A in BT474 sion value of ANXA1 was then standardized using the quantile cells by CRISPR/Cas9–mediated gene targeting induced strong normalization approach. The PAM50 subtype was computed induction of pAKT (on both phosphosites Ser473 and Thr308) using the Bioconductor "genefu" package (31). and conferred trastuzumab resistance (Supplementary Fig. S1B and S1C). These results provide independent validation of our Statistical analysis patient outcome results obtained with the shRNA vectors. Consistent with a role for For the outcome analysis, patients were scored according to pAKT in conferring drug resistance, we observed that activation of ANXA1 and dichotomized at the median. The primary outcome the PI3K/AKT cascade by overexpression of a constitutive active for the Responsify dataset is recurrence-free survival and for the mutant of AKT was sufficient to bypass the growth arrest induced FinHer dataset distant disease-free survival, which was defined by by trastuzumab and AZD8055. In contrast, induction of MAPK/ the time interval between the date of randomization and the date ERK signaling by overexpression of the oncogenic mutant of first cancer recurrence outside of the ipsilateral/locoregional V600E BRAF was not sufficient to bypass the effects of the inhibitors region or to death, whichever occurred first. (Fig. 1F). These results suggest that activation of AKT is a critical Patients alive at the last visit without documented evidence of component of the drug resistance phenotypes induced by ARID1A distant metastases were censored. Survival curves were generated suppression. according to the method of Kaplan and Meier, and survival distributions were compared with the use of the log-rank test. Univariable and multivariate models (adjusting for the age of the ARID1A loss activates ANXA1 transcription patients, the tumor size and grade, the ER status, and the lymph As a member of the SWI/SNF chromatin-remodeling complex, node status) were computed with the use of Cox proportional loss of ARID1A may directly impact the transcription machinery. hazards regression. Interaction effects were displayed using forest To gain further mechanistic insight in how ARID1A loss activates plots. Analyses were performed using R statistical suite and AKT, we performed transcriptome sequence analysis (RNA-Seq) Bioconductor genefu package (32). Our data were reported on two ARID1A knockdown cell lines (MCF7 and BT474) to

www.aacrjournals.org Clin Cancer Res; 2016 OF3

Berns et al.

investigate the transcriptional consequence of ARID1A loss (Sup- and B), and also in a third independent breast cancer cell line, plementary Fig. S2A). From the list of genes, we chose ANXA1 for ZR75.1 (Fig. 2C). Furthermore, ANXA1 protein levels were sig- further validation based on the corresponding correlation niﬁcantly increased upon loss of ARID1A expression in these between ARID1A loss and ANXA1 activation found in the TCGA breast cancer cell lines (Fig. 2D and Supplementary Fig. S1B). data (see below). Indeed, we found that ANXA1 RNA expression is Moreover, ChIP experiments with H3tmK4-speciﬁc antibodies inversely correlated with ARID1A levels in both cell lines (Fig. 2A (an activation mark on chromatin) are consistent with an

A shARID1A C shctrl shGFP #1 #2

ctrl BT474

ARID1A Trastuzumab HSP90

AZD8055

B shARID1A D shctrl shGFP #3 #4 MCF7

ctrl ARID1A

AZD8055 HSP90

E F

BT474 BT474 pBp BRAFV600E myr-AKT shctrl shARID1A#1 shARID1A#2 AZD8055 (nmol/L): 0 12.5 25 50 0 12.5 25 50 0 12.5 25 50 ctrl pAKT

AKT Trastuzumab p-S6RP

S6RP MCF7 pBp BRAFV600E myr-AKT

HSP90 ctrl

AZD8055

Figure 1. ARID1A suppression confers drug resistance in breast cancer lines via AKT activation. A and B, the functional phenotypes of nonoverlapping retroviral shARID1A vectors (#1–4) in BT474 (A) and MCF7 (B) cells are indicated by colony formation assay in 1 mg/mL trastuzumab or 10 to 40 nmol/L AZD8055. Cells expressing a mixture of nonfunctional hairpins (shctrl)orshGFP were used as control. The cells were ﬁxed, stained, and photographed after 10 to 21 days. C and D, the level of ARID1A knockdown by each of the shRNAs was measured by Western blot analysis. E, BT474 cells expressing shctrl or shARID1A vectors were grown in the absence or presence of increasing AZD8055 concentrations for 3 hours, and the cell lysates were harvested for Western blot analysis and probed with the indicated antibodies. F, BT474 and MCF7 cells expressing pBp control, pBpBRAFV600E, or pBp-myr-AKT were cultured in the absence or presence of 1 mg/mL trastuzumab or 50 nmol/L AZD8055. The cells were ﬁxed, stained, and photographed after 10 to 21 days.

OF4 Clin Cancer Res; 2016 Clinical Cancer Research

ANXA1 Levels Predict Trastuzumab Response in Breast Cancer

A ANXA1 B ANXA1 C ANXA1 3.5 MCF7 2.5 BT474 2.5 ZR75

3 2 2 2.5

2 1.5 1.5

1.5 1 1 1 0.5 0.5 0.5 Relative mRNA expression Relative mRNA expression Relative mRNA expression 0 0 0

D E 25 ChIP HistoneH3tmK4 20

shARID1A 15 – #3 #4 – #1 #3 ARID1A 10 ANXA1 5 loading ANXA1 Enrichment

MCF7 ZR75 0

F ANXA1 RPPA expression G pAKT473 RPPA expression (P = 3.2e-47) (P = 0.00723)

pval = 0.00723 543210 2 1 0 Protein expression Protein expression –1 ARID1A Protein ARID1A Protein ANXA1 Protein ANXA1 Protein high n = 318 low n = 318 high n = 41 low n = 42

Figure 2. ARID1A and ANXA1 expression are inversely correlated. A–C, ANXA1 mRNA expression analysis by qRT-PCR in MCF7 (A), BT474 (B), and ZR75 (C) cells stably expressing shARID1A. Error bars, SD. D, MCF7 and ZR75 cells expressing shctrl or shARID1A vectors were harvested for Western blot analysis and probed with the indicated antibodies. E, MCF7 cell lines that were stably infected with shctrl or two independent shARID1A vectors were subjected to ChIP with histoneH3tmK4 and control antibodies, and qRT-PCR ampliﬁcation was performed with primers located in the ﬁrst intron of the ANXA1 gene and with control primers located 500 kb downstream of the gene (see Materials and Methods). Shown is the fold enrichment over non-immune precipitation and corrected for control primers. F, boxplot of ANXA1 RPPA protein levels for TCGA breast cancer patient tumors divided in ARID1A-high (n ¼ 318) and ARID1A-low (n ¼ 318) tumors. The ARID1A-high/low grouping is based on ARID1A protein expression, median as cutoff. RPPA, reverse-phase protein array. G, boxplot of pAKT473 RPPA protein levels for TCGA HER2þ breast cancer patient tumors divided in ANXA1-high (n ¼ 41) and ANXA1-low (n ¼ 42) tumors. The ANXA1-high/low grouping is based on ANXA1 protein expression, median as cutoff.

www.aacrjournals.org Clin Cancer Res; 2016 OF5

Berns et al.

A shARID1A: C –– ++ Figure 3. shANXA1: –++ – ANXA1 induction is critically required for AKT activation and resistance ARID1A shctrl shARID1A phenotype. A, ANXA1 inhibition p473AKT shctrl shANXA1 shctrl shANXA1 interferes with AKT activation of ARID1A knockdown cells. MCF7 cells p308AKT ctrl expressing shctrl or shARID1A vectors AKT were superinfected with shctrl or MCF7 shANXA1 vectors and selected with ANXA1 AZD hygromycin. Cell lysates were Actin 8055 harvested for Western blot analysis. B, ANXA1 inhibition interferes with AKT activation of ARID1A knockout cells. BT474 Cas9 control cells and a BT474 ARID1A knockout (ko) CRISPR clone B ARID1A ko: –– ++ D were infected with LKO-SCR or inducible ANXA1 hairpins. Hairpin ANXA1 sh : –++ – Cas9 ctrl ARID1A ko expression was induced with ARID1A shctrl shANXA1 shctrl shANXA1 doxycycline, and cells were cultured in the presence of 2 mg/mL trastuzumab p473AKT for 3 days. Cell lysates were harvested ctrl ANXA1 p308AKT for Western blot analysis. C, BT474 inhibition reverses resistance AKT phenotype of ARID1A knockdown trast. cells. MCF7 cells expressing shctrl or ANXA1 shARID1A vectors were superinfected Actin with shctrl or shANXA1 vectors and were cultured in the absence or presence of 50 nmol/L AZD8055. The cells were fixed, stained, and E AZD8055 photographed after 14 days. D, BT474 ctrl MK2206 AZD8055 MK2206 Cas9 control cells and the BT474 ARID1A ko CRISPR clone were infected with LKO-SCR or inducible ANXA1 shctrl hairpins and plated at low density in doxycycline with or without 2 mg/mL MCF7 trastuzumab. The cells were fixed, stained, and photographed after 21 shARID1A days. E, MCF7 cells expressing shctrl or shARID1A vectors were cultured in the absence or presence of 25 nmol/L MK2206, 50 nmol/L AZD8055, or the trast. indicated combination. The cells were F ctrlMK2206 trast. MK2206 fixed, stained, and photographed after 14 days. F, BT474 cells expressing shctrl or shARID1A vectors were ctrl sh cultured in the absence or presence of 10 nmol/L MK2206, 10 mg/mL BT474 trastuzumab (trast.), or the indicated fi shARID1A combination. The cells were xed, stained, and photographed after 21 days.

activation of the ANXA1 promoter as a result of ARID1A loss (Fig. (Fig. 2G). The low percentage of ARID1A mutants present in the 2E). Interestingly, ChIP-Seq experiments performed in parental TCGA breast dataset (4%) precluded the assessment of a corre- MCF7 and a MCF7 ARID1A low subclone generated with CRISPR/ lation between ARID1A mutation status and ANXA1 expression. Cas9 targeting demonstrated an ARID1A-dependent binding of To allow such analysis, we shifted to TCGA endometrium carci- BRG1 to the ANXA1 promoter region, suggesting a direct role for noma patient samples, which harbor a high percentage of ARID1A the SWI/SNF complex in the regulation of ANXA1 expression mutations (35%; ref. 11). Indeed, in a set of 239 endometrium (Supplementary Fig. S2B and S2C). Furthermore, as mentioned tumor samples, we found a significant association between above, in a large panel of TCGA breast cancer patient samples (n ¼ ARID1A (nonsense) mutation and elevated ANXA1 RNA expres- 636), we identified a significant inverse correlation between sion (Supplementary Fig. S3A) or ANXA1 protein expression ARID1A protein levels and ANXA1 protein expression (Fig. 2F). (Supplementary Fig. S3B). In an independent set of endometrium Consistent with our cell line data, we could demonstrate, using cancer samples (n ¼ 44), we further confirmed that loss of ARID1A the TCGA data, that high ANXA1 protein levels correlated with protein correlated with increased ANXA1 protein levels (Supple- þ increased pAKT levels in HER2 breast cancer patient samples mentary Fig. S3C). Moreover, a recent study has shown that

OF6 Clin Cancer Res; 2016 Clinical Cancer Research

ANXA1 Levels Predict Trastuzumab Response in Breast Cancer

RTK Trastuzumab

ANXA1 Figure 4. ARID1A loss activates AKT signaling via ANXA1. ARID1A loss results in PI3K increased ANXA1 transcription. Elevated ANXA1 protein levels at the plasma membrane activate AKT AKT MK2206 signaling. ARID1A-mutant tumors may be more efﬁciently treated when inhibitors targeting AKT signaling are mTOR included in the treatment regimen.

ARID1A ANXA1 AZD8055

ARID1A mutation correlates with activated AKT signaling in reduction in the rate of recurrence of approximately 50% and endometrium cancer patients (34). Collectively, these data imply improvement in the rate of survival of approximately 30% (27, that ARID1A suppression activates ANXA1 expression, leading to 35–37). One of these studies was a phase III randomized adjuvant AKT activation in multiple cancer subtypes, including breast and breast cancer trial from Finland (FinHER). After receiving che- þ endometrium carcinomas. motherapy, 231 women with HER2 cancer were randomized to receive trastuzumab or no trastuzumab (Supplementary Table S2). Consistent with our cell line data, high ANXA1 gene expres- Elevated ANXA1 is critically required for resistance phenotype sion was associated with no benefit from trastuzumab [Kaplan– We next asked whether ANXA1 upregulation is required for the Meier (KM) log-rank P ¼ 0.785], whereas tumors with low ANXA1 observed resistance phenotypes. To address this, we tested wheth- showed marked benefit from trastuzumab (KM log-rank P ¼ er inhibition of ANXA1 interferes with drug resistance caused by 0.014; Fig. 5A and B). In contrast to high ANXA1 levels, lower ARID1A suppression. First, we observed that suppression of ANXA1 levels were also associated with benefit from trastuzumab ANXA1 expression reduced the increase in AKT activation that in a multivariate analysis corrected for tumor size, patient age, resulted from ARID1A loss (Fig. 3A and B) in both MCF7 and lymph node status, tumor grade, and estrogen receptor status (HR BT474 cell lines. In MCF7 cells, the effect of ANXA1 knockdown for distant recurrence, 0.35; 95% CI, 0.14–0.84; P ¼ 0.019; on AKT activation was primarily seen for the Ser473 phospho- P ¼ 0.02; Fig. 5C). Of note, the FinHer trial provided site on AKT and not for pThr308AKT, whereas in BT474 cells, interaction trastuzumab only for 9 weeks, which is not the current practice of both AKT phosphosites were reduced upon ANXA1 loss (Fig. 3A 1 year. To overcome this limitation, we sought to validate our and B). Next, we found that downregulation of ANXA1 expres- þ findings in the independent HER2 Responsify dataset consisting sion restored the sensitivity of ARID1A knockdown cells to of 108 adjuvant trastuzumab (1 year) and chemotherapy-treated AZD8055 in MCF7 breast cancer cells (Fig. 3C) and to trastu- patient samples (Supplementary Table S3). Here, we again iden- zumab in BT474 cells (Fig. 3D). These results indicate that tified that high ANXA1 expression was significantly associated activation of ANXA1 is a critical component of the drug resis- with worse trastuzumab response (KM log-rank P ¼ 0.046; tance phenotype induced by ARID1A suppression. Of note, Fig. 5D). To evaluate whether prognostic effects could confound exogenous overexpression of ANXA1 in BT474 cells did not the predictive effect of ANXA1, we studied ANXA1 expression in affect either AKT activation status or sensitivity to trastuzumab. þ multiple previously published datasets from HER2 patients This finding indicates that elevated ANXA1 expression is treated only with chemotherapy (38). This analysis revealed that required but probably not sufficient for the resistance pheno- ANXA1 levels do not predict recurrence-free survival in patients types described here (Supplementary Fig. S4). Importantly, we that did not receive trastuzumab (Fig. 5E). To further analyze found that addition of the AKT inhibitor MK2206 restores the possible prognostic effects of ANXA1 levels, we performed a sensitivity of ARID1A knockdown cells to both the mTOR subgroup analysis in the METABRIC dataset comprising around inhibitor AZD8055 in MCF7 cells (Fig. 3E) and trastuzumab 2,000 breast cancer patients. This analysis again revealed that in BT474 cells (Fig. 3F). These findings indicate that inhibition ANXA1 gene expression was not associated with prognosis in any of AKT signaling may be explored as an alternative strategy to subgroup (Supplementary Fig. S5). This supports our conclusion resensitize ANXA1 elevated cells to targeted therapies (Fig. 4). that the effect of ANXA1 is predictive for trastuzumab response and not merely a prognostic factor that predicts outcome inde- ANXA1 levels predict adjuvant trastuzumab response in breast pendent of treatment. cancer On the basis of our cell line data, we sought to assess whether ANXA1 gene expression levels have predictive value in patients Discussion treated with HER2/PI3K/mTOR–targeting agents. In the adjuvant Our data identify ARID1A as a modulator of response to treatment of breast cancer patients, multiple trials showed signif- drugs that target the HER2/PI3K/mTOR pathway. We identified icant benefit of the HER2-targeting agent trastuzumab, with a asignificant inverse correlation between low ARID1A protein

www.aacrjournals.org Clin Cancer Res; 2016 OF7

Berns et al.

Figure 5. Survival plots from two HER2þ breast cancer datasets to assess the effect of ANXA1 expression on trastuzumab response. A, Kaplan–Meier plot of FinHer patients with low ANXA1 divided into trastuzumab treated and untreated. B, Kaplan–Meier plot of FinHer patients with high ANXA1 divided into trastuzumab treated and untreated. C, forest plot of HRs for response to trastuzumab in the HER2 patients of the FinHer trial. HRs were adjusted for classical clinical characteristics (tumor size, patient age, lymph node status, tumor grade, and estrogen receptor status) in the linear Cox regression model. CI, conﬁdence interval. D, Kaplan–Meier plot of all chemotherapy- and trastuzumab-treated Responsify patients divided into ANXA1-high and -low expression. E, Kaplan–Meier plot of HER2þ chemotherapy-treated patients from multiple datasets divided into ANXA1-high and -low expression.

expression and increased ANXA1 expression levels both in demonstrating that PI3K/AKT pathway activation drives resis- cell lines and in a large breast cancer dataset. We demonstrate tance to trastuzumab both in the adjuvant and advanced that loss of ARID1A and subsequent upregulation of ANXA1 clinical setting (17, 39, 40). As such, this work reveals a novel leads to AKT activation, which in turn likely contributes to both and clinically relevant route by which cancer cells activate the breast cancer development and unresponsiveness to targeting oncogenic PI3K/AKT signaling cascade. agents. Indeed, our studies demonstrate that elevated ANXA1 On the basis of the predominant localization of ANXA1 at the levels are critically important for trastuzumab resistance in plasma membrane and the suggested role of ANXA1 in receptor þ HER2 breast cancer cells. Furthermore, high ANXA1 protein mobilization and membrane function (14), we hypothesized that þ levels correlated with increased pAKT in HER2 breast cancer altered ANXA1 expression levels may have an impact on the cell lines and patient samples. Importantly, high ANXA1 levels activity of RTKs that drive the PI3K/AKT signaling cascade. In predicted worse trastuzumab response in two independent addition, the previously reported effects of ANXA1 on TGFb breast cancer patient series, validating our in vitro ﬁndings. The signaling might also contribute to AKT activation via noncanon- data presented here are in agreement with earlier studies ical TGFb signaling (13). Alternatively, ANXA1-mediated effects

OF8 Clin Cancer Res; 2016 Clinical Cancer Research

ANXA1 Levels Predict Trastuzumab Response in Breast Cancer

þ on Ca2 /CAMKK signaling could be responsible for activation of that ANXA1 has also other functions besides regulation of the AKT. However, we could not firmly establish a role for ANXA1 in PI3K pathway. any of these scenarios in our breast cancer cell lines, suggesting In summary, we report here an unexpected and new route by that elevated ANXA1 levels may activate AKT via a different route which breast cancer cells activate AKT signaling. Our data imply or through a subtle combination of the above. that patients with ANXA1 high tumors are less responsive to Given the broad range of human tumors in which ARID1A is HER2/PI3K/mTOR–targeting strategies and may benefit from mutated, our observations in breast cancer may be more generally including inhibitors targeting AKT in their treatment regimen. applicable to other cancer types. Indeed, a recent study has shown that ARID1A mutation correlates with activated AKT signaling in Disclosure of Potential Conflicts of Interest endometrium cancer patients (34). Furthermore, we show here M.S. van der Heijden is a consultant/advisory board member for Roche. that ARID1A mutation correlates with increased ANXA1 expres- G.B. Mills reports receiving commercial research grants from Adelson Medical sion in this endometrium dataset. These findings suggest that, Research Foundation, AstraZeneca, Critical Outcome Technologies, Karus Ther- similar to breast cancer, ANXA1-mediated AKT activation upon apeutics, and Nanostring; speakers bureau honoraria from AstraZeneca, Eli Lilly, ARID1A loss may also occur in endometrium cancer. Although ISIS Pharmaceuticals, Novartis, Nuevolution, and Symphogen; has ownership ARID1A interest (including patents) in Catena Pharmaceuticals, Myriad Genetics, PTV mutation frequency in breast cancer appears to be mod- Ventures, and Spindletop Ventures; and is a consultant/advisory board member ARID1A est (some 4%; ref. 6), loss may be caused via other for Adventist Health, AstraZeneca, Blend, Catena Pharmaceuticals, Critical mechanisms, such as promoter hypermethylation and DNA copy Outcome Technologies, HanAl Bio Korea, ImmunoMET, Millennium Pharma- number loss (41–43). However, our data do not rule out the ceuticals, Nuevolution, Precision Medicine, Provista Diagnostics, Signalchem possibility that induction of ANXA1 levels is also caused by Lifesciences, and Symphogen. No potential conflicts of interest were disclosed oncogenic signaling pathways that are independent of ARID1A by the other authors. loss. We did not observe any prognostic value of ANXA1 levels in Authors' Contributions þ breast cancer patients in general and in the HER2 group in Conception and design: K. Berns, A. Sonnenblick, G.B. Mills, R. Bernards particular. Furthermore, we did not observe any effect of ANXA1 Development of methodology: A. Sonnenblick, B. Evers, T. Bosse, W. Nijkamp, þ R.L. Beijersbergen levels on the outcome of HER2 breast cancer patients treated ANXA1 Acquisition of data (provided animals, acquired and managed patients, with chemotherapy only. Therefore, we conclude that provided facilities, etc.): K. Berns, A. Sonnenblick, A. Gennissen, D. Fumagalli, gene expression analysis represents a predictive biomarker for S. Loibl, C. Denkert, P. Neven, T. Bosse, M.S. van der Heijden, S. Hindriksen, adjuvant trastuzumab treatment response. However, a recent W. Nijkamp, H. Joensuu, G.B. Mills, C. Sotiriou study suggested that high ANXA1 protein levels might be asso- Analysis and interpretation of data (e.g., statistical analysis, biostatistics, ciated with worse response to chemotherapy in breast cancer computational analysis): K. Berns, A. Sonnenblick, A. Gennissen, S. Brohee, D. Fumagalli, C. Desmedt, S. Loibl, C. Denkert, W. Guo, F. Zhang, patients (44). A possible explanation for this discrepancy may T.A. Knijnenburg, T. Bosse, L.F.A. Wessels, H. Joensuu, G.B. Mills, R.L. Beijers- lie in the different patient groups analyzed or the different bergen, C. Sotiriou, R. Bernards techniques and cut-off values used to assess ANXA1 levels Writing, review, and/or revision of the manuscript: K. Berns, A. Sonnenblick, (ANXA1 IHC vs. ANXA1 microarray expression in our study). A. Gennissen, S. Brohee, D. Fumagalli, C. Desmedt, S. Loibl, C. Denkert, Further studies are warranted to address this issue. P. Neven, W. Guo, F. Zhang, T.A. Knijnenburg, T. Bosse, M.S. van der Heijden, One could argue that, given the data presented here, measuring L.F.A. Wessels, H. Joensuu, G.B. Mills, C. Sotiriou, R. Bernards Administrative, technical, or material support (i.e., reporting or organizing pAKT levels would suffice as a predictive marker for response to fi data, constructing databases): A. Gennissen, E.M. Hijmans, W. Nijkamp HER2-targeting therapies. However, since our nding in 2007 that Study supervision: K. Berns, A. Sonnenblick, S. Loibl, R. Bernards activation of the PI3K signaling pathway (as defined by PTEN loss and PIK3CA mutation) is predictive for trastuzumab response in Acknowledgments metastatic breast cancer patients, no studies have reported a The authors thank the people from the Genomics Core Facility of the fi signi cant correlation between tumor pAKT levels (as a proposed Netherlands Cancer Institute for their technical support and members of the readout of PI3K pathway activity) and trastuzumab response in Bernards laboratory and Cancer Systems Biology Center for their helpful the clinical setting (45–47). Presumably, reliable pAKT measure- discussions. The authors also thank Wilbert Zwart for his help with the ment in clinical samples is challenging due to technical issues chromatin immunoprecipitation experiments and all the patients and research regarding tissue (lysate) handling. Furthermore, AKT isoforms participants who contributed to the TCGA data portal and the FinHer and Responsify studies. and pAKT localization/compartmentalization may be important factors that are ignored in current measurement techniques. On the basis of current knowledge, we feel that measuring pAKT levels Grant Support in clinical samples will not suffice as a standard for PI3K pathway This work is supported by a Stand Up to Cancer Dream Team Translational Research grant (SU2C-AACR- DT0209). Stand Up To Cancer is a Program of the readout. This conclusion is further exemplified by our own Entertainment Industry Foundation administered by the American Association observation that high ANXA1 levels correlate with high pAKT for Cancer Research. This research was supported by grants from the Dutch levels in the TCGA dataset, but no such correlation could be Cancer Society (KWF NKI2009-4337), the Netherlands Organisation for Sci- demonstrated between ANXA1 and pAKT in the Responsify entific Research (NWO), CCSG grant P30 CA016672, Les Amis de l'Institut Jules dataset (data not shown). Possibly, the unreliable pAKT readouts Bordet, Breast Cancer Research Foundation (BCRF), and the 7th EU Framework in these different platforms preclude demonstrating a hardwired Programme grant 278659. The costs of publication of this article were defrayed in part by the payment of correlation. Nevertheless, high ANXA1 (RNA) levels do predict page charges. This article must therefore be hereby marked advertisement in trastuzumab response in two independent clinical datasets, pre- accordance with 18 U.S.C. Section 1734 solely to indicate this fact. sumably via PI3K pathway activation. Our finding provides a novel tool to preselect patients that are unlikely to respond to Received December 18, 2015; revised March 30, 2016; accepted May 2, 2016; trastuzumab-based treatments. At this point, we cannot exclude published OnlineFirst May 12, 2016.

www.aacrjournals.org Clin Cancer Res; 2016 OF9

Berns et al.

References 1. Arteaga CL, Sliwkowski MX, Osborne CK, Perez EA, Puglisi F, Gianni L. lentivirus in transgenic rats. Proc Natl Acad Sci U S A 2008;105: Treatment of HER2-positive breast cancer: current status and future 18507–12. perspectives. Nat Rev Clin Oncol 2012;9:16–32. 23. Gad H, Koolmeister T, Jemth AS, Eshtad S, Jacques SA, Strom CE, et al. 2. Garcia-Garcia C, Ibrahim YH, Serra V, Calvo MT, Guzman M, Grueso J, et al. MTH1 inhibition eradicates cancer by preventing sanitation of the dNTP Dual mTORC1/2 and HER2 blockade results in antitumor activity in pool. Nature 2014;508:215–21. preclinical models of breast cancer resistant to anti-HER2 therapy. Clin 24. Prahallad A, Heynen GJJE, Germano G, Willems SM, Evers B, Vecchione L, Cancer Res 2012;18:2603–12. et al. PTPN11 is a central node in intrinsic and acquired resistance to 3. O'Brien NA, McDonald K, Tong L, von Euw E, Kalous O, Conklin D, et al. targeted cancer drugs. Cell Rep 2015;12:1978–85. Targeting PI3K/mTOR overcomes resistance to HER2-targeted therapy inde- 25. Schmidt D, Wilson MD, Spyrou C, Brown GD, Hadfield J, Odom DT. ChIP- pendent of feedback activation of AKT. Clin Cancer Res 2014;20:3507–20. seq: using high-throughput sequencing to discover protein-DNA interac- 4. Wiegand KC, Lee AF, Al-Agha OM, Chow C, Kalloger SE, Scott DW, et al. tions. Methods 2009;48:240–8. Loss of BAF250a (ARID1A) is frequent in high-grade endometrial carci- 26. Bosse T, ter Haar NT, Seeber LM, v Diest PJ, Hes FJ, Vasen HF, et al. Loss of nomas. J Pathol 2011;224:328–33. ARID1A expression and its relationship with PI3K-Akt pathway alterations, 5. Wiegand KC, Shah SP, Al-Agha OM, Zhao Y, Tse K, Zeng T, et al. ARID1A TP53 and microsatellite instability in endometrial cancer. Mod Pathol mutations in endometriosis-associated ovarian carcinomas. N Engl J Med 2013;26:1525–35. 2010;363:1532–43. 27. Joensuu H, Bono P, Kataja V, Alanko T, Kokko R, Asola R, et al. Fluorouracil, 6. Jones S, Li M, Parsons DW, Zhang X, Wesseling J, Kristel P, et al. Somatic epirubicin, and cyclophosphamide with either docetaxel or vinorelbine, mutations in the chromatin remodeling gene ARID1A occur in several with or without trastuzumab, as adjuvant treatments of breast cancer: final tumor types. Hum Mut 2012;33:100–3. results of the FinHer Trial. J Clin Oncol 2009;27:5685–92. 7. Jones S, Wang TL, Shih Ie M, Mao TL, Nakayama K, Roden R, et al. Frequent 28. Joensuu H, Kellokumpu-Lehtinen PL, Bono P, Alanko T, Kataja V, Asola R, mutations of chromatin remodeling gene ARID1A in ovarian clear cell et al. Adjuvant docetaxel or vinorelbine with or without trastuzumab for carcinoma. Science 2010;330:228–31. breast cancer. N Engl J Med 2006;354:809–20. 8. Guichard C, Amaddeo G, Imbeaud S, Ladeiro Y, Pelletier L, Maad IB, et al. 29. Sonnenblick A, Brohee S, Fumagalli D, Vincent D, Venet D, Ignatiadis M, Integrated analysis of somatic mutations and focal copy-number changes et al. Constitutive phosphorylated STAT3-associated gene signature is identifies key genes and pathways in hepatocellular carcinoma. Nat Genet predictive for trastuzumab resistance in primary HER2-positive breast 2012;44:694–8. cancer. BMC Med 2015;13:177. 9. Fujimoto A, Totoki Y, Abe T, Boroevich KA, Hosoda F, Nguyen HH, et al. 30. Curtis C, Shah SP, Chin SF, Turashvili G, Rueda OM, Dunning MJ, et al. The Whole-genome sequencing of liver cancers identifies etiological influences genomic and transcriptomic architecture of 2,000 breast tumours reveals on mutation patterns and recurrent mutations in chromatin regulators. Nat novel subgroups. Nature 2012;486:346–52. Genet 2012;44:760–4. 31. Benjamin H-K, Markus S, Gianluca B, Christos S, John Q. genefu: relevant 10. Zang ZJ, Cutcutache I, Poon SL, Zhang SL, McPherson JR, Tao J, et al. Exome functions for gene expression analysis, especially in breast cancer. R package sequencing of gastric adenocarcinoma identifies recurrent somatic muta- version 1.12.0. [Internet]. 2013. Available from: http://compbio.dfci.har- tions in cell adhesion and chromatin remodeling genes. Nat Genet vard.edu. 2012;44:570–4. 32. Therneau TM, Grambsch PM. Modeling survival data: extending the Cox 11. Kandoth C, Schultz N, Cherniack AD, Akbani R, Liu Y, Shen H, et al. model. New York, NY: Springer; 2000. Integrated genomic characterization of endometrial carcinoma. Nature 33. McShane LM, Altman DG, Sauerbrei W, Taube SE, Gion M, Clark GM. 2013;497:67–73. REporting recommendations for tumor MARKer prognostic studies 12. Wilson BG, Roberts CW. SWI/SNF nucleosome remodellers and cancer. (REMARK). Breast Cancer Res Treat 2006;100:229–35. Nat Rev Cancer 2011;11:481–92. 34. Liang H, Cheung LW, Li J, Ju Z, Yu S, Stemke-Hale K, et al. Whole-exome 13. de Graauw M, van Miltenburg MH, Schmidt MK, Pont C, Lalai R, Karto- sequencing combined with functional genomics reveals novel candidate pawiro J, et al. Annexin A1 regulates TGF-beta signaling and promotes driver cancer genes in endometrial cancer. Genome Res 2012;22:2120–9. metastasis formation of basal-like breast cancer cells. Proc Natl Acad Sci 35. Romond EH, Perez EA, Bryant J, Suman VJ, Geyer CE Jr, Davidson NE, et al. U S A 2010;107:6340–5. Trastuzumab plus adjuvant chemotherapy for operable HER2-positive 14. Guo C, Liu S, Sun MZ. Potential role of Anxa1 in cancer. Future Oncol breast cancer. N Engl J Med 2005;353:1673–84. 2013;9:1773–93. 36. Piccart-Gebhart MJ, Procter M, Leyland-Jones B, Goldhirsch A, Untch M, 15. Berns K, Hijmans EM, Mullenders J, Brummelkamp TR, Velds A, Heimerikx Smith I, et al. Trastuzumab after adjuvant chemotherapy in HER2-positive M, et al. A large-scale RNAi screen in human cells identifies new compo- breast cancer. N Engl J Med 2005;353:1659–72. nents of the p53 pathway. Nature 2004;428:431–7. 37. Slamon D, Eiermann W, Robert N, Pienkowski T, Martin M, Press M, et al. 16. Brummelkamp TR, Fabius AW, Mullenders J, Madiredjo M, Velds A, Ker- Adjuvant trastuzumab in HER2-positive breast cancer. N Engl J Med khoven RM, et al. An shRNA barcode screen provides insight into cancer cell 2011;365:1273–83. vulnerability to MDM2 inhibitors. Nat Chem Biol 2006;2:202–6. 38. Haibe-Kains B, Desmedt C, Loi S, Culhane AC, Bontempi G, Quackenbush 17. Berns K, Horlings HM, Hennessy BT, Madiredjo M, Hijmans EM, Beelen K, J, et al. A three-gene model to robustly identify breast cancer molecular et al. A functional genetic approach identifies the PI3K pathway as a major subtypes. J Natl Cancer Inst 2012;104:311–25. determinant of trastuzumab resistance in breast cancer. Cancer Cell 39. Majewski IJ, Nuciforo P, Mittempergher L, Bosma AJ, Eidtmann H, Holmes 2007;12:395–402. E, et al. PIK3CA mutations are associated with decreased benefitto 18. Holzel M, Huang S, Koster J, Ora I, Lakeman A, Caron H, et al. NF1 is a neoadjuvant human epidermal growth factor receptor 2-targeted therapies tumor suppressor in neuroblastoma that determines retinoic acid response in breast cancer. J Clin Oncol 2015;33:1334–9. and disease outcome. Cell 2010;142:218–29. 40. Jensen JD, Knoop A, Laenkholm AV, Grauslund M, Jensen MB, Santoni- 19. Huang S, Holzel M, Knijnenburg T, Schlicker A, Roepman P, McDermott U, Rugiu E, et al. PIK3CA mutations, PTEN, and pHER2 expression and impact et al. MED12 controls the response to multiple cancer drugs through on outcome in HER2-positive early-stage breast cancer patients treated with regulation of TGF-beta receptor signaling. Cell 2012;151:937–50. adjuvant chemotherapy and trastuzumab. Ann Oncol 2012;23:2034–42. 20. Kadoch C, Hargreaves DC, Hodges C, Elias L, Ho L, Ranish J, et al. 41. Mamo A, Cavallone L, Tuzmen S, Chabot C, Ferrario C, Hassan S, et al. An Proteomic and bioinformatic analysis of mammalian SWI/SNF complexes integrated genomic approach identifies ARID1A as a candidate tumor- identifies extensive roles in human malignancy. Nat Genet 2013;45: suppressor gene in breast cancer. Oncogene 2012;31:2090–100. 592–601. 42. Cornen S, Adelaide J, Bertucci F, Finetti P, Guille A, Birnbaum DJ, et al. 21. Berns K, Hijmans EM, Koh E, Daley GQ, Bernards R. A genetic screen to Mutations and deletions of ARID1A in breast tumors. Oncogene identify genes that rescue the slow growth phenotype of c-myc null 2012;31:4255–6. fibroblasts. Oncogene 2000;19:3330–4. 43. Zhang X, Sun Q, Shan M, Niu M, Liu T, Xia B, et al. Promoter hypermethyla- 22. Herold MJ, van den Brandt J, Seibler J, Reichardt HM. Inducible and tion of ARID1A gene is responsible for its low mRNA expression in many reversible gene silencing by stable integration of an shRNA-encoding invasive breast cancers. PLoS One 2013;8:e53931.

OF10 Clin Cancer Res; 2016 Clinical Cancer Research

ANXA1 Levels Predict Trastuzumab Response in Breast Cancer

44. Sobral-Leite M, Wesseling J, Smit VT, Nevanlinna H, van Miltenburg 46. Baselga J, Cortes J, Im SA, Clark E, Ross G, Kiermaier A, et al. Biomarker MH, Sanders J, et al. Annexin A1 expression in a pooled breast cancer analyses in CLEOPATRA: a phase III, placebo-controlled study of series: association with tumor subtypes and prognosis. BMC Med pertuzumab in human epidermal growth factor receptor 2-positive, 2015;13:156. ﬁrst-line metastatic breast cancer. J Clin Oncol 2014;32:3753–61. 45. Esteva FJ, Guo H, Zhang S, Santa-Maria C, Stone S, Lanchbury JS, et al. 47. Sueta A, Yamamoto Y, Yamamoto-Ibusuki M, Hayashi M, Takeshita T, PTEN, PIK3CA, p-AKT, and p-p70S6K status: association with trastuzumab Yamamoto S, et al. An integrative analysis of PIK3CA mutation, PTEN, and response and survival in patients with HER2-positive metastatic breast INPP4B expression in terms of trastuzumab efﬁcacy in HER2-positive cancer. Am J Pathol 2010;177:1647–56. breast cancer. PLoS One 2014;9:e116054.

www.aacrjournals.org Clin Cancer Res; 2016 OF11

Loss of ARID1A Activates ANXA1, which Serves as a Predictive Biomarker for Trastuzumab Resistance

Katrien Berns, Amir Sonnenblick, Annemiek Gennissen, et al.

Clin Cancer Res Published OnlineFirst May 12, 2016.

Updated version Access the most recent version of this article at: doi:10.1158/1078-0432.CCR-15-2996

Supplementary Access the most recent supplemental material at: Material http://clincancerres.aacrjournals.org/content/suppl/2016/05/12/1078-0432.CCR-15-2996.DC1

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://clincancerres.aacrjournals.org/content/early/2016/09/22/1078-0432.CCR-15-2996. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.