(SSR) Markers from Paeonia Ostii to Study the Genetic

Scientia Horticulturae 164 (2013) 58–64

Contents lists available at ScienceDirect

Scientia Horticulturae

journal homepage: www.elsevier.com/locate/scihorti

Development of simple sequence repeat (SSR) markers from Paeonia

ostii to study the genetic relationships among tree peonies (Paeoniaceae)

a a,b,∗ a,b a a

Hai-Ping Yu , Fang-Yun Cheng , Yuan Zhong , Chang-Fu Cai , Jing Wu , a

Hu-Liang Cui

College of Landscape Architecture, Beijing Forestry University, Beijing, 100083, PR China

National Flower Engineering Research Center, Beijing, 100083, PR China

a r t i c l e i n f o a b s t r a c t

Article history: The tree peony belongs to section Moutan of Paeonia, known as the ‘King of Flowers’ in China and has

Received 3 March 2013

great ornamental, medicinal and economic value. In this study, 12 novel polymorphic microsatellite

Received in revised form 22 June 2013

markers from Paeonia ostii were developed and characterized by constructing a simple sequence repeat

Accepted 27 June 2013

(SSR)-enriched genomic library. In total, 42 alleles across 48 tree peony accessions were detected, with an

average of 3.5 alleles per locus, the number of effective alleles ranged from 1.4 to 4.7 with an average of 2.4

Keywords:

per locus, the observed and expected heterozygosity per locus ranged from 0.333 to 1.000 (an average of

Tree peony

0.785) and from 0.298 to 0.795 (an average of 0.541), respectively. The polymorphism information content

SSR markers

Polymorphism (PIC) varied from 0.257 to 0.794, with an average of 0.468. Shannon Index was ranged from 0.594 to 1.771

Transferability and the mean value was 0.906. Moreover, these markers can also be ampliﬁed in herbaceous peonies

Genetic relationships Paeonia lactiﬂora and Paeonia veitchii of section Paeon. A neighbor-joining (NJ) tree was constructed

using the proportion of shared alleles coefﬁcient to assess the genetic relationships among species and

cultivars. In the NJ tree, the accessions in the section Paeon spanned the extremes of the dendrogram

and were used as an outgroup. The accessions in the section Moutan primarily grouped into two clusters.

In cluster I, Paeonia rockii and Xibei Group cultivars clustered into one branch, indicating that P. rockii

was the main ancestor of the Xibei cultivars. P. rockii and its cultivars were closely related to Paeonia

decomposita. All Zhongyuan Group cultivars, Paeonia × lemoinei hybrids and P. ostii formed clusterII. P.

ostii grouped with Zhongyuan cultivars, indicating that P. ostii contributed signiﬁcant genetic information

to Zhongyuan cultivars. Zhongyuan cultivars and P. × lemoinei hybrids were divided into groups with

various corresponding bootstrap values. Principal component analysis (PCA) based on gene frequency

further illustrated these genetic relationships. PCA supported the results of the clustering analysis, and it

is easily discernable that cultivars from the same group distributed together, while wild accessions with a

close relationship to cultivars were distributed with the cultivars. The results show that these SSR markers

are very powerful in studying genetic relationships and that they have the ability to cross-amplify in other

Paeoniaceae family members. Furthermore, the new SSR markers will be useful tools in assessing genetic

diversity, detecting quantitative trait loci (QTL) and ﬁnally in facilitating marker-assisted selection (MAS).

1. Introduction species of tree peony are endemic to China, which is also where

the origin and developmental center of the cultivated tree peony

The genus Paeonia is composed of three sections, namely, is located. As a special cultural symbol of peace and happiness,

Moutan, Onaepia and Paeon (Stern, 1946). Plants in section Moutan, prosperity and development above that of many other common

which are divided into the subsections Vaginatae and Delavayanae, plants, the tree peony is respected as the ‘King of Flowers’ in China

are generally called tree peonies or Mudan in Chinese. All the wild and plays an irreplaceable role in ornamental and medicinal uses

(Cheng, 2007). Recently, it was discovered that the tree peony has

such great potential for edible oil production as a new crop that

∗ it has received increasingly more attentions from Chinese govern-

Corresponding author at: Tsinghua East Road, Beijing Forestry University,

ment (Li et al., 2012). Currently, approximately 2000 tree peony

100083, China. Tel.: +86 10 62338027; fax: +86 10 62336063.

E-mail address: [email protected] (F.-Y. Cheng). cultivars are widely cultivated in many countries in Asia, America,

H.-P. Yu et al. / Scientia Horticulturae 164 (2013) 58–64 59

Europe and Australia, all of which genetically originated from infra- found in Table 1. All samples were collected from healthy young

and inter-speciﬁc, inter-subsectional and -sectional hybridization leaves at the end of April. Genomic DNA was extracted from silica

and display a rich diversity (Cheng, 2007). With the development of gel-dried leaves using a DNAsecure Plant Kit (Tiangen Biotech, Bei-

peony breeding and cultivation globally, the issue related to inter- jing, China) and detected on a 1% agarose gel by electrophoresis,

speciﬁc, species and cultivars genetic relationships has been one of the marker is 100 bp Ladder (BioTeke, Beijing, China).

the research focus in Paeonia. Various kinds of molecular markers

such as RAPD (random ampliﬁed polymorphic DNA) (Chen et al., 2.2. Construction of an SSR motif-enriched genomic library

2001), AFLP (ampliﬁed fragment length polymorphism) (Hou et al.,

2006a) and SRAP (sequence-related ampliﬁed polymorphism) (Guo A microsatellite-enriched genomic library was constructed as

et al., 2009) have been conducted to study the genetic relation- described by Glenn and Schable (2005) with some modiﬁcations.

ships among the cultivars and species of tree peonies, but there Total DNA from P. ostii seedlings was digested with RsaI and XmnI

is not still a consistent conclusion because the markers and sam- (New England Biolabs, Beijing, China) and then ligated to a double-

ples employed in these studies are both different and limited. Thus, stranded Super SNX-24 adapter (forward: 5 -GTT TAA GGC CTA

more reliable and efﬁcient molecular markers are heavily needed GCT AGC AGA ATC-3 , reverse: 5 -pGAT TCT GCT AGC TAG GCC TTA

to explore the genetic relationships among tree peonies in a distinct AAC AAA-3 ). The ligated DNA was denatured and hybridized to a

sampling strategy. Simple sequence repeat (SSRs) or microsatellite mixture of the following single-strand biotinylated microsatellite

markers seem to be a suitable alternative technique based on their probes including (AG)12, (AT)12, (CG)12, (GT)12, (ACG)12, (ACT)12,

hyper-variability, co-dominance and high reproducibility and have (CCA)8, (AACT)8, (AAGT)8 and (AGAT)8. Hybridized DNA was cap-

been widely used in genetic studies of different plant species such tured with streptavidin coated paramagnetic beads (Dynal Biotech

as Ziziphus jujuba Mill. (Ma et al., 2011), Rosa hybrid L. (Park et al., Dynabeads M-280 Streptavidin) and collected with a magnetic

2010), Pyrus communis L. (Brini et al., 2008) and Prunus tomentosa particle collecting unit (MPC, Dynal Biotech Dynal MPC-S). The

Thunb. (Zhang et al., 2008). In the tree peony, SSR markers have also enriched DNA was ampliﬁed by PCR and enriched again. The PCR

been used effectively to study genetic diversity (Yuan et al., 2012), reactions had a ﬁnal volume of 25 ␮l containing 1× Power Taq PCR

hybrid origin and cultivar identiﬁcation (Yuan et al., 2010; Zhang MasterMix (BioTeke, Beijing, China), 0.5 ␮M superSNX-24 linker-

et al., 2012). Because there are relatively few SSR markers available forward as a primer and 2 ␮l of enriched DNA fragments. The PCR

◦

for Paeonia, researchers have recently focused on developing addi- program included an initial step at 95 C for 2 min, followed by 25

◦ ◦ ◦

tional markers for various peonies, including Paeonia suffruticosa cycles of 95 C for 20 s, 60 C for 20 s, and 72 C for 1.5 min and a ﬁnal

◦

Andrews (Homolka et al., 2010; Hou et al., 2011a,b; Wang et al., extension at 72 C for 30 min. The PCR products were ligated into

2008; Zhang et al., 2012), Paeonia delavayi Franch. (Zhang et al., pGEM-T easy vector (Promega, Beijing, China), and transferred into

2011) and Paeonia lactiﬂora Pall. (Li et al., 2011; Sun et al., 2011; Top 10 competent Escherichia coli cells (Yuanpinghao Bio, Beijing,

Cheng, 2011). China).

Here, we used Paeonia ostii T. Hong & J. X. Zhang, a distinct

species involved in the origin of P. suffruticosa and many tree peony 2.3. DNA sequencing and SSR primers design

cultivars (Cheng, 2007) and has been widely grown for thousands

of years to harvest roots for the Chinese traditional medicine indus- Positive clones were veriﬁed using PCR ampliﬁcation of the

try and recently to harvest seeds for edible oil production (Li et al., inserts using SP6 and T7 primers, and different sized fragments

2012), to characterize 12 novel polymorphic microsatellite markers were sequenced on ABI 3730xl DNA analyzer (Applied Biosystems,

for tree peonies and their ability to cross-amplify in two herbaceous Foster City, California, USA). Sequences from both strands were

peony species (Paeonia veitchii and four cultivars of P. lactiﬂora). assembled and edited using EditSeq software (DNASTAR, Madison,

Moreover, we tested the validity of the SSR markers in studying WI, USA), and microsatellite loci were identiﬁed using SSRHunter

the genetic relationships among tree peonies. 1.3.0 (Qiang Li, Nanjing Agricultural University, Nanjing, China).

Primers were designed with Primer premier 5.0 (Premier Biosoft

2. Materials and methods International, Palo Alto, California, USA).

2.1. Plant materials and DNA extraction 2.4. Selections of polymorphic primers

One plant from a population of P. ostii seedlings was selected Primer pairs developed in P. ostii were assessed by PCR ampliﬁ-

to develop the SSR primers. A total of 53 accessions, including cation using 8 species and 40 cultivars of section Moutan of Paeonia

8 species and 40 cultivars of tree peonies and 5 accessions of (Table 1). PCR reactions were performed in a ﬁnal volume of 10 ␮l

herbaceous species/cultivars from the Luoyang National Tree Peony containing 1× Power Taq PCR MasterMix (BioTeke, Beijing, China),

Collection (Luoyang, Henan) and the Forestry station of Beijing 0.25 ␮M of each primer and 25 ng genomic DNA. The PCR program

◦

Forestry University (Beijing), were used to analyze the polymor- included an initial step at 94 C for 3 min, followed by 30 cycles

◦

phisms and transferability of the SSR primers and the genetic of 94 C for 30 s, the annealing temperatures given in Table 2 for

◦ ◦

relationships among tree peonies. The tree peony species used in 30 s and 1 min at 72 C, and a ﬁnal extension at 72 C for 10 min.

this study were P. ostii, Paeonia jishanensis, Paeonia decomposita, The products were examined on 2% agarose gels and the marker

Paeonia qiui, P. rockii and P. delavayi var. lutea, all of which belong is pUC19/MspI (ZeXing Biotech, Beijing, China). Ampliﬁed prod-

to subsection Vaginatae except for P. delavayi var. lutea, which ucts that showed band of the expected size were separated on

belongs to subsection Delavayanae. The cultivar accessions used in 6% denaturing polyacrylamide sequencing gels and silver stained.

this study consist of 3 distinct cultivar types, 5 inter-subsectional Polymorphic SSR primers were then selected to test their transfer-

hybrids of Paeonia × lemoinei including ‘Huang Guan’ bred in Japan, ability in P. veitchii and 4 cultivars of P. lactiﬂora in section Paeon of

‘Renown’ and ‘Highnoon’ bred in America and ‘Souvenir de Maxime Paeonia (Table 1).

Cornu’ and ‘L’Esperance’ bred in France, 26 cultivars of P. suffruti-

cosa Zhongyuan Group and 9 cultivars of P. rockii Xibei Group. The 2.5. Data analysis

latter two groups originated in China. P. veitchii and the 4 cultivars

of P. lactiﬂora are herbaceous peonies that belong to section Paeon The number of alleles per loci (Na) and the observed and

(Stern, 1946). The information about all these accessions can be expected heterozygosities (Ho and He) were calculated using

60 H.-P. Yu et al. / Scientia Horticulturae 164 (2013) 58–64

Table 1

Origin and ﬂower characteristics of 53 accessions of peony species and cultivars used in this study.

Accession Abbreviation Flower color Flower form Species or cultivar group/provenance

P. delavayi var. lutea lutea Yellow Single Species/Yunnan of China

P. jishanensis jis White Single Species/Shanxi of China

P. decomposita dec Red purple Single Species/Sichuan of China

P. qiui qiu Light pink Single Species/Hubei of China

P. rockii roc White Single Species/Hubei of China

P. ostii 1 ost 1 White Single Species/Henan of China

P. ostii 2 ost 2 White Single Species/Henan of China

P. ostii 3 ost 3 White Single Species/Henan of China

P. lemoinei ‘Renown’ lem 1 Orange red Single Inter-subsectional Hybrids/America

P. × lemoinei ‘Souvenir de Maxime Cornu’ lem 2 Blended color Anemone Inter-subsectional Hybrids/France

P. × lemoinei ‘L’Esperance’ lem 3 Yellow Single Inter-subsectional Hybrids/France

P. × lemoinei ‘Huang Guan’ lem 4 Yellow Chrysanthemum Inter-subsectional Hybrids/Japan

P. × lemoinei ‘Highnoon’ lem 5 Yellow Chrysanthemum Inter-subsectional Hybrids/America

P. suffruticosa ‘Dou LV’ suf 1 Yellowish green Crown Zhongyuan/Luoyang of China

P. suffruticosa ‘Gui Fei Cha Cui’ suf 2 Pinkish red Anemone Zhongyuan/Luoyang of China

P. suffruticosa ‘Fu Gui Man Tang’ suf 3 Red Anemone Zhongyuan/Luoyang of China

P. suffruticosa ‘Lu He Hong’ suf 4 Red Anemone Zhongyuan/Luoyang of China

P. suffruticosa ‘Yao Huang’ suf 5 Yellow Crown Zhongyuan/Luoyang of China

P. suffruticosa ‘Hua Hu Die’ suf 6 Pinkish red Rosa Zhongyuan/Luoyang of China

P. suffruticosa ‘Cai Hui’ suf 7 Red Crown Zhongyuan/Luoyang of China

P. suffruticosa ‘Ni Hong Huan Cai’ suf 8 Magenta Anemone Zhongyuan/Luoyang of China

P. suffruticosa ‘Lan Zi Kui’ suf 9 Pink bluish Crown Zhongyuan/Luoyang of China

P. suffruticosa ‘Ao Shuang’ suf 10 Red Crown Zhongyuan/Luoyang of China

P. suffruticosa ‘Yin Hong Lv Bo’ suf 11 Red Single Zhongyuan/Luoyang of China

P. suffruticosa ‘Hu Hong’ suf 12 Light red Crown Zhongyuan/Luoyang of China

P. suffruticosa ‘Ying Ri Hong’ suf 13 Red Anemone Zhongyuan/Luoyang of China

P. suffruticosa ‘Shan Hu Tai’ suf 14 Light red Crown Zhongyuan/Luoyang of China

P. suffruticosa ‘Shou An Hong’ suf 15 Dark purplish red Crown Zhongyuan/Luoyang of China

P. suffruticosa ‘Wu Long Peng Sheng’ suf 16 Purplish red Rose Zhongyuan/Luoyang of China

P. suffruticosa ‘Jin Pao Hong’ suf 17 Purplish red Rose Zhongyuan/Luoyang of China

P. suffruticosa ‘Er Qiao’ suf 18 Pink and Purplish red Rose Zhongyuan/Luoyang of China

P. suffruticosa ‘Luo Yang Hong’ suf 19 Purplish red Rose Zhongyuan/Luoyang of China

P. suffruticosa ‘Jun Yan Hong’ suf 20 Purple Anemone Zhongyuan/Luoyang of China

P. suffruticosa ‘Lan Bao Shi’ suf 21 Pink bluish Chrysanthemum Zhongyuan/Luoyang of China

P. suffruticosa ‘Zhao Fen’ suf 22 Pink Crown Zhongyuan/Luoyang of China

P. suffruticosa ‘Cong Zhong Xiao’ suf 23 Light red Chrysanthemum Zhongyuan/Luoyang of China

P. suffruticosa ‘San Bian Sai Yu’ suf 24 White Anemone Zhongyuan/Luoyang of China

P. suffruticosa ‘Yu Ji Yan Zhuang’ suf 25 Red Chrysanthemum Zhongyuan/Luoyang of China

P. suffruticosa ‘Cang Zhi Hong’ suf 26 Purplish red Crown Zhongyuan/Luoyang of China

P. rockii ‘Hong Lou Cang Jiao’ roc 1 Red Crown Xibei/Gansu of China

P. rockii ‘Hong Zhuang Su Guo’ roc 2 Pink Crown Xibei/Gansu of China

P. rockii ‘Qing Xin Bai’ roc 3 White Crown Xibei/Gansu of China

P. rockii ‘Gao Yuan Sheng Huo’ roc 4 Purplish red Chrysanthemum Xibei/Gansu of China

P. rockii ‘Lan Zhang Cai Wei’ roc 5 Pink bluish Lotus Xibei/Gansu of China

P. rockii ‘Bing Xin Fen He’ roc 6 Pink Single Xibei/Gansu of China

P. rockii ‘Ye Guang Bei’ roc 7 Reddish black Single Xibei/Gansu of China

P. rockii ‘Han Hai Bing Xin’ roc 8 White Single Xibei/Gansu of China

P. rocki ‘Ming Mou’ roc 9 White Single Xibei/Gansu of China

P. lactiﬂora ‘Tao Hua Fei Xue’ lac 1 Pink Crown Shaoyao/Luoyang of China

P. lactiﬂora ‘Fen Yu Nv’ lac 2 Pink Single Shaoyao/Luoyang of China

P. lactiﬂora ‘Qiao Ling’ lac 3 white Anemone Shaoyao/Luoyang of China

P. lactiﬂora ‘Da Fu Gui’ lac 4 Purple Anemone Shaoyao/Luoyang of China

P. veitchii vei Red purple Single Species/Gansu of China

Due to petal increasing and stamen petaloidy, the ﬂower of tree peony was classiﬁed generally into different forms from Single through Lotus, Chrysanthemum, Rose,

Anemone, Crown to Globular. The description of ﬂower forms can be referred in Cheng et al. (2005)

POPGENE version 1.31 (Yeh et al., 1999). The discriminatory abil- 3. Results and discussion

ity of the genic SSRs was estimated using cluster analyses to assess

the genetic relationships among species and cultivars. A neighbor- 3.1. Characterization and transferability of SSR primers

joining (NJ) tree was constructed using the proportion of shared

alleles coefﬁcient from the program PowerMarker ver.3.25 (Liu One hundred and ninety-one positive clones were selected

and Muse, 2005). The accessions in section Paeon were used as and sequenced. Eighty-eight (46%) contained SSRs, in which 103

an outgroup in the NJ tree. The NJ tree was constructed using microsatellite loci were identiﬁed. Among the detected sequences,

distance measures. In total, 1000 replicates were used for all 48 were suitable for primer design because they contained sufﬁ-

bootstrap tests. A principal component analysis (PCA) was per- cient sequences (>20 bp) upstream and downstream of the repeats.

formed based on gene frequency using the Multi-Variate Statistical Therefore, 48 pairs of SSR primers were designed to amplify 48

Package (mvsp) ver. 3.1. (Kovach Computing Services, Anglesey, microsatellite loci, 37 of which eventually showed the expected Wales). band.

H.-P. Yu et al. / Scientia Horticulturae 164 (2013) 58–64 61

Table 2

Characteristics of 12 polymorphic microsatellite primers developed for the tree peony.

◦

Primer Sequence (5 –3 ) Repeat Size (bp) Ta ( C) GenBank

Seq1 F: AGCCAGAGCCAGTACAGAG (CAC)5(GCA)3 194 56 JX855795

R: TGGACATAAGGCCACGAT

Seq2 F:GTAGGAGATAGACCGATTGATA (CAC)6 291 56 JX855796

R: GAACTGCTGAGGGCACA

Seq3 F: AGGAGATTGACCGATTGATA (CAC)6 196 56 JX855797

R: CTGTCTGGCATGGAACG

Seq4 F: AACTGCTGAGGGCATAGAG (TGG)4 233 55.5 KC121549

R: CATGATGTTGAGCCACCC

Seq5 F: TGCTGTGGACATAGGGTAA (GGT)5 334 55.5 JX855799

R: CAGGTCGAGGTAGAAGAGTG

Seq6 F: GACCGATTTGACCCTCTA (GA)11 219 52.5 JX855800

R: CTCCCATGTGATGTTGTG

Seq7 F: GCTGCATAATCTACTATTCCA (TCA)3 129 54 KC121550

R: ACATACTGAGGGCGTTGT

Seq8 F: TCCTAGACCCAGAGCACC (GCA)3 229 57 JX855801

R: GATGTCCCTGAGCCAAGT

Sqe9 F: TCACTTCCTAGACCCAGAGC (CAC)5 334 57 JX855802

R: TGCAAGCATCCCACCAT

Sqe10 F: ACCTCCTAGACCCAGAGC (CAC)5 165 57 KC121551

R: GCAACAATCCTGGTAGTGA

Seq11 F: CAATCCGAGTCGTAAGC (TGG)5 162 56 JX855803

R: CACCTCCTAGACCCAGAG

Seq12 F: CGGAAGTTTTCTTTGAC (AG)5 151 48 JX855804

R: ATCCTTTTGTAACTCCTGATT

For each primer pair, forward (F) and reverse (R) sequences (Sequence), repeat motif (Repeat), size of the original fragment (Size), optional annealing temperature (Ta), and

GenBank accession number (GenBank) are given.

Of the 37 primer pairs, 25 were monomorphic and 12 were poly- enrichment library is reportedly near 90% (Butcher et al., 2000).

morphic (Table 2). For the polymorphic loci, a total of 42 alleles The enrichment efﬁciency in this study (46%) was similar to recent

were generated across 48 tree peony accessions, the number of reports for tree peonies (Homolka et al., 2010; Wang et al., 2008)

alleles ranged from 2 to 9 with an average of 3.5 per locus, the but lower than that reported for P. lactiﬂora (70%) (Sun et al., 2011).

number of effective alleles ranged from 1.4 to 4.7 with an average The variation in the efﬁciency of these enrichment libraries may be

of 2.4 per locus and the observed and expected heterozygosity per due to differences in experimental procedures, chemical reagents

locus ranged from 0.333 to 1.000 (an average of 0.785) and from used or the species-speciﬁc samples (Gupta and Varshney, 2000;

0.298 to 0.795 (an average of 0.541), respectively. The polymor- Watcharawongpaiboon and Chunwongse, 2008).

phism information content (PIC) varied from 0.257 to 0.794, with These SSR markers can also cross amplify in P. lactiﬂora and P.

an average of 0.468. Shannon Index was ranged from 0.594 to 1.771 veitchii which is consistent with previous reports for other orna-

and the mean value was 0.906 (Table 3). Furthermore, 11 of the 12 mentals that SSR markers developed for one species could amplify

microsatellite markers (with the exception of seq4) also ampliﬁed the DNA of close relatives, such as Z. jujuba Mill. (Ma et al., 2011),

in P. lactiﬂora (‘Qiao Ling’, ‘Fen Yu Nu’, ‘Da Fu Gui’ and ‘Tao Hua Fei Rosa hybrid L. (Park et al., 2010) and Lagerstroemia indica (Cai et al.,

Xue’) with two to four alleles per locus, and all primers except seq7 2011).

cross-ampliﬁed in P. veitchii.

Traditional probe-hybridization methods for identifying

3.2. Application of SSR markers in studying genetic relationships

microsatellite loci from digested genomic libraries can be

extremely tedious and inefﬁcient for species with low microsatel-

To understand the genetic relationships among the various

lite frequencies (Zane et al., 2002). The enrichment procedure,

species and cultivars used in this study, a NJ tree was constructed

however, is faster and more cost-effective, and the efﬁciency of the

based on the SSR data (Fig. 1), in which the accessions in section

Paeon or herbaceous peonies (P. lactiﬂora ‘Tao Hua Fei Xue’, ‘Fen Yu

Table 3

Nu’, ‘Qiao Ling’, ‘Da Fu Gui’ and P. veitchii) spanned the extremes of

Results of initial primer screening using 48 accessions including 40 cultivars and 8

the dendrogram and were used as an outgroup. The P. lactiﬂora cul-

species of tree peonies.

tivars ﬁrst formed an independent clade and then grouped together

Primer Na Ne Ho He PIC Shannon Index

with P. veitchii with a 53% bootstrap value.

Seq1 2 1.8 0.636 0.455 0.471 0.642 The accessions in section Moutan or tree peonies grouped mainly

Seq2 4 2.8 1.000 0.644 0.589 1.129

in two clusters. In cluster I, 9 Xibei Group cultivars and P. rockii

Seq3 3 2.5 0.979 0.612 0.523 0.994

species were distributed in 1 subcluster which was consistent with

Seq4 2 2.0 0.957 0.505 0.375 0.692

previous studies indicating that P. rockii was the main ancestor of

Seq5 5 1.4 0.333 0.298 0.257 0.635

Seq6 9 4.7 0.688 0.795 0.794 1.771 Xibei Group cultivars and that they both share the same morpho-

Seq7 3 2.1 0.894 0.526 0.411 0.802 logical characteristics, such as a clear black-purple or purple-red

Seq8 3 2.0 0.792 0.499 0.391 0.753

ﬂare at the base of the petals (Cheng, 2007; Zhou et al., 2003a).

Seq9 2 1.7 0.563 0.409 0.308 0.594

The cultivation of this cultivar group is centralized in the Gansu

Seq10 2 2.0 0.896 0.500 0.373 0.688

Seq11 3 2.7 0.979 0.636 0.549 1.039 province and neighboring provinces of northwest China, which cul-

Seq12 4 2.6 0.708 0.615 0.575 1.122 tivar group is composed of the second largest group of Chinese tree

Mean 3.5 2.4 0.785 0.541 0.468 0.906

peonies after P. suffruticosa Zhongyuan Group (Cheng et al., 2005).

Parameters shown for each pair of primer are the numbers of alleles (Na), the effec- In the branch A, the cultivars ‘Hong Zhuang Su Guo’, ‘Hong Lou

tive numbers of alleles (Ne), observed heterozygosity (Ho), expected heterozygosity

Cang Jiao’, ‘Qing Xin Bai’, ‘Gao Yuan Sheng Huo’ and ‘Lan Zhang Cai

(He), polymorphism information content (PIC) and Shannon Index.

Wei’, which are double or semidouble ﬂower forms, were grouped

62 H.-P. Yu et al. / Scientia Horticulturae 164 (2013) 58–64

together. Meanwhile, all cultivars with the single ﬂower form like

‘Ye Guang Bei’, ‘Bing Xin Fen He’, ‘Han Hai Bin Xin’ and ‘Ming Mou’,

were grouped with species P. rockii together in the branch B. The

ﬂower form of tree peony cultivars has been classiﬁed into vari-

ous types from single through semi-double to double, but actually

except for single ﬂower that is the original form of tree peonies,

other forms were resulted mostly from stamen petaloidy under cul-

tivation condition (Cheng et al., 2005). Our results demonstrated it

effectively, suggesting that there should be some relations between

ﬂower form and genetic information as reported in previous study

(Hou et al., 2006a). In the NJ tree, P. rockii and its cultivar group

were closely related to P. decomposita, which is consistent with

recent DNA sequence analyses (Lin et al., 2004; Zhao et al., 2004)

and molecular markers studies (Sang et al., 1997a,b; Tank and Sang,

2001; Zhao et al., 2008). ClusterII in the NJ tree was composed

of all the cultivar accessions of P. suffruticosa Zhongyuan Group,

P. × lemoinei hybrids and 3 P. ostii samples, which can be explained

based on their known origins and previous relevant studies. The

P. suffruticosa Zhongyuan Group, representing traditional Chinese

tree peonies, contains very complicated cultivars with an exten-

sive distribution in the north of China and all cultivars in this group

belong to subsection Vaginatae of section Moutan of Paeonia and

do not have any genes from subsection Delavayanae. However,

P. lemoinei hybrids, which were propagated in France, US and

Japan, were the result of the hybridization between P. suffruticosa

and P. delavayi (including P. delavayi var. lutea) indicating that the

cultivars of P. × lemoinei are inter-subsectional hybrids of section

Moutan (Cheng, 2007; Wister, 1995). This relationship relating to

their origins was actually reﬂected in the NJ tree. P. × lemoinei ‘High

Noon’ and ‘Huang Guan’ were grouped together with a 64% boot-

strap value, indicating genetic similarity. Originally, ‘Huang Guan’

was released in Japan as a hand-pollinated cross using ‘High Noon’

as the female parent, and the male parent is a cultivar of the P.

suffruticosa Japan Group or Japanese tree peony, which has the

same genetic background as a cultivar of P. suffruticosa Zhongyuan

Group or Chinese tree peony (Cheng, 2007). ‘Souvenir de Maxime

Cornu’ and ‘L’Esperance’ from France are the crossbred offspring of

P. delavayi var. lutea and P. suffruticosa Zhongyuan Group, whereas

‘High Noon’ and ‘Renown’ from America originated from similar

crosses but pollen was collected from P. suffruticosa Japan Group

and then pollinated onto P. delavayi var. lutea and P. delavayi (Cheng,

2007; Wister, 1995). Thus, regardless of where they are released,

these inter-subsectional tree peony hybrids have an intimate and

complicated pedigree with P. suffruticosa cultivars that originated

in China, which could be documented because they grouped in the

same cluster. The inter-subsectional America hybrid ‘Renown’ and

the Zhongyuan Group cultivar ‘Dou Lv’, which is an ancient Chi-

nese cultivar, were clustered together with a 54% bootstrap value.

There are obvious differences in both the time and way in which

they were released, but they are phenotypically similar in their

thick outer wheel petals, spots at the petal base and late ﬂowering,

indicating the possibility that they share a similar genetic back-

ground. Within clusterII, two French cultivars ‘Souvenir de Maxime

Cornu’ and ‘L’Esperance’ formed a branch with a 56% bootstrap

value. Two famous Chinese cultivars ‘Er Qiao’ and ‘Luo Yang Hong’

were clustered together with a high bootstrap value of 90%, which

is clearly illustrated by their origins, as the two cultivars originated

from the same cross, and ‘Er Qiao’ is derived from a bud sport of

‘Luo Yang Hong’ (Wang, 1997). The strong bootstrap value con-

ﬁrmed a close genetic relationship between these two cultivars and

demonstrated the reliability of this SSR marker system. Likewise,

many cultivars of the Zhongyuan Group were distributed nearby

Fig. 1. Neighbor-joining tree of 53 accessions calculated on PowerMarker ver.3.25

on the dendrogram with strong bootstrap support, indicating their

by means of 12 genic SSR markers. Bootstrap values over 50 were indicated above

close consanguineous relationships. For instance, ‘Yin Hong Lv Bo’

the branch; based on 1000 resamplings of the data set. The information of the

abbreviations represented in the tree can be seen in Table 1. and ‘Hu Hong’, ‘Ying Ri Hong’ and ‘Shan Hu Tai’, with red ﬂowers,

were clustered into one branch with 89% and 94% bootstrap values

H.-P. Yu et al. / Scientia Horticulturae 164 (2013) 58–64 63

Fig. 2. Principal component analysis of 53 accessions based on genic SSR markers. PCA1 and PCA2 indicated the ﬁrst and second principal component, respectively. The

results of the PCA generally agreed on the division of cultivars in Fig. 1.

separately, while red ‘Ni Hong Huan Cai’ and pink bluish ‘Lan Zi other group is composed of P. rockii Xibei Group cultivars, P. rockii

Kui’ were clustered into one branch with 58% bootstrap values. and P. decomposita. The species P. qiui and P. delavayi var. lutea were

Evidently, there is no clear correlation between ﬂower color and barely separated between the above mentioned groups, and acces-

molecular marker analysis in this study. Such the result is consis- sions of the herbaceous peony, P. lactiﬂora cultivars and P. veitchii,

tent both with the study in which 35 tree peony (P. suffruticosa) were distantly related to the tree peony. Thus, the results from the

cultivars were analyzed by RAPD (Chen et al., 2001, 2002) and the PCA analysis conﬁrmed the results of clustering analysis in the NJ

study including14 tree peony (P. suffruticosa) cultivars, a yellow tree, showing very clearly the genetic relationships among the tree

tree peony (P. lutea), a Chinese peony (P. lactiﬂora) cultivar and peony accessions used in this study, which are consistent with pre-

ﬁve interspeciﬁc cultivars based on RAPD analysis (Hosoki et al., vious reports (Hou et al., 2006b; Li, 1998; Meng and Zheng, 2004;

1997), but is different from the result by SRAP analysis using 16 Yuan and Wang, 2002).

tree peony (P. suffruticosa) cultivars (Guo et al., 2009). We felt that

such conﬂicting results are because cultivars as well as makers used 4. Conclusions

in these studies are too few to explore the genetic relationships

between different colors in tree peony cultivars. P. ostii formed a We isolated 12 novel polymorphic microsatellite markers from

monophyletic group with bootstrap values supported at 99% and the tree peony P. ostii that cross-amplify both in other tree peony

was also grouped together with the Zhongyuan Group cultivars, species and cultivars and in the herbaceous peony species P. lac-

which is consistent with previous studies indicating that there was tiﬂora and P. veitchii, indicating that these SSRs may be useful in

a close relationship between P. ostii and P. suffruticosa including future genetic studies of both tree peony and herbaceous peony

cultivars of the Zhongyuan Group (Cheng, 2007, Han et al., 2008; in Paeonia. Moreover, this study conﬁrmed the power of using SSR

Hou et al., 2006a, b; Li, 1998; Meng and Zheng, 2004; Zhao et al., markers in studying the genetic relationships of the tree peony.

2008; Zhou et al., 2003b). Cluster analysis using NJ methods showed that these analyses gen-

In the NJ tree, the species P. delavayi var. lutea of subsection erally supported the division of cultivars and demonstrated that

Delavayanae clustered with subsection Vaginatae, which is incon- these SSR markers are applicable and reliable. The PCA analysis and

sistent with most studies (Stern, 1946; Hong and Pan, 1999; Zhao the cluster analysis using NJ methods revealed similar results. In a

et al., 2008; Zhou et al., 2003b). This inconsistency might be due to tree peony breeding program, SSR markers may serve as a suitable

the limited number of individuals used in this study, which were tool for choosing parents to be used in cross matings and select-

only collected from a single plant of the species P. delavayi var. lutea, ing offspring in early seedling stage. Moreover, these SSR markers

P. rockii, P. jishanensis, P. qiui, P. decomposita. Most bootstrap val- should also be useful for assessing genetic diversity, detecting

ues for the branches indicating cultivar relationships were below quantitative trait loci (QTL), linkages between markers and genes

50% based on NJ clustering analysis, indicating a variance among for important traits and ﬁnally in facilitating marker-assisted selec-

cultivars and the large genetic diversity of the tree peony. tion (MAS).

Relationships among 53 accessions were further illustrated

using a PCA analysis based on gene frequency, which was per- Acknowledgements

formed using the Multi-Variate Statistical Package (mvsp) ver. 3.1

(Fig. 2). In the PCA analysis, the ﬁrst two principal components (PC1

This work was supported by the National Science and Technol-

and PC2) accounted for 31.992 and 20.993% of the total variation,

ogy Support Program of China (2012BAD01B07).

respectively. It is easily discernable that cultivars from the same

group distributed together, and species distributed together with

References

closely related cultivars. There are two distinct groups as illustrated

in Fig. 2. One group is composed of P. suffruticosa Zhongyuan Group

Brini, W., Mars, M., Hormaza, J.I., 2008. Genetic diversity in local Tunisian pears

cultivars, P. × lemoinei hybrids, P. ostii and P. jishanensis and the (Pyrus communis L.) studied with SSR markers. Sci. Hortic. 115, 337–341.

64 H.-P. Yu et al. / Scientia Horticulturae 164 (2013) 58–64

Butcher, P.A., Decroocq, S., Gray, Y., Moran, G.F., 2000. Development, inheritance Park, Y.H., Ahn, S.G., Choi, Y.M., Oh, H.J., Ahn, D.C., Kim, J.G., Kang, J.S., Choi, Y.W.,

and cross-species ampliﬁcation of microsatellite markers from Acacia mangium. Jeong, B.R., 2010. Rose (Rosa hybrida L.) EST-derived microsatellite markers and

Theor. Appl. Genet. 101, 1282–1290. their transferability to strawberry (Fragaria spp.). Sci. Hortic. 125, 733–739.

Cai, M., Pan, H.T., Wang, X.F., He, D., Wang, X.Y., Wang, X.J., Zhang, Q.X., 2011. Devel- Sang, T., Crawford, D., Stuessy, T., 1997a. Chloroplast DNA phylogeny, reticulate

opment of novel microsatellites in Lagerstroemia indica and DNA ﬁngerprinting evolution, and biogeography of Paeonia (Paeoniaceae). Am. J. Bot. 84, 1120.

in Chinese Lagerstroemia cultivars. Sci. Hortic. 131, 88–94. Sang, T., Donoghue, M.J., Zhang, D., 1997b. Evolution of alcohol dehydrogenase genes

Chen, X.M., Zheng, G.S., Zhang, S.W., 2001. RAPD analysis of tree peony cultivars. in peonies (Paeonia): phylogenetic relationships of putative nonhybrid species.

Acta Hortic. Sin. 28 (4), 370–372 (in Chinese). Mol. Biol. Evol. 14, 994–1007.

Chen, X.M., Zheng, G.S., Li, M., 2002. RAPD-PCR analysis of genetic diversity of dif- Stern, F.C., 1946. A Study of the Genus Paeonia. The Royal Hortic. Soc., London, pp.

ferent color 35 tree Paeonia cultivars. J. Agric. Sin. 35 (5), 546–551 (in Chinese). 1–14, 40–42.

Cheng, F.Y., 2007. Advances in the breeding of tree peonies and a cultivar system for Sun, J., Yuan, J., Wang, B., Pan, J., Zhang, D., 2011. Development and characteriza-

the cultivar group. Int. J. Plant Sci. 1 (2), 89–104. tion of 10 microsatellite loci in Paeonia lactiﬂora (Paeoniaceae). Am. J. Bot. 98,

Cheng, F.Y., Li, J.J., Chen, D.Z., Zhang, Z.S., 2005. Chinese ﬂare tree peonies. Chinese e242–e243.

Forestry Publishing House, Beijing, pp. 30–36 (in Chinese). Tank, D.C., Sang, T., 2001. Phylogenetic utility of the Glycerol-3-Phosphate Acyl-

Cheng, Y., 2011. Development of simple sequence repeat (SSR) markers to study transferase gene: evolution and implications in Paeonia (Paeoniaceae). Mol.

diversity in the herbaceous peony (Paeonia lactiﬂora). J. Med. Plants Res. 5 (31), Phylogenet. Evol. 19, 421–429.

6744–6751. Wang, L.Y., 1997. Cultivar group of tree peony and cultural distribution. In: Wang, L.Y.

Glenn, T.C., Schable, N.A., 2005. Isolation microsatellite DNA loci. Methods Enzymol. (Ed.), Pictorial Record of Chinese Tree Peony Varieties. For. Publ. House, Beijing.

395, 202–222. Wang, J.X., Xia, T., Zhang, J.M., Zhou, S.L., 2008. Isolation and characterization of

Guo, D.L., Hou, X.G., Zhang, J., 2009. Sequence-related ampliﬁed polymorphism anal- fourteen microsatellites from a tree peony (Paeonia suffruticosa). Conserv. Genet.

ysis of tree peony (Paeonia suffruticosa Andrews) cultivars with different ﬂower 10, 1029–1031.

colors. J. Hortic. Sci. Biotechnol. 84 (2), 131–136. Watcharawongpaiboon, N., Chunwongse, J., 2008. Development and characteriza-

Gupta, P.K., Varshney, R.K., 2000. The development and use of microsatellite markers tion of microsatellite markers from an enriched genomic library of cucumber

for genetic analysis and plant breeding with emphasis on bread wheat. Euphyt- (Cucumis sativus). Plant Breed. 127, 74–81.

ica 113, 163–185. Wister, J.C., 1995. The Peonies. American Peony Society, Hopkins, MN, pp. 140–173

Han, X.Y., Wang, L.S., Shu, Q.Y., Liu, Z.A., Xu, S.X., Tetsumura, T., 2008. Molecular (2nd printing).

characterization of tree peony germplasm using sequence-related ampliﬁed Yeh, F.C., Yang, R.C., Boyle, T., Ye, Z.H., Mao, J.X., 1999. POPGENE, version 1.32: the

polymorphism markers. Biochem. Genet. 46, 162–179. user friendly software for population genetic analysis. Molecular Biology and

Homolka, A., Berenyi, M., Burg, K., Kopecky, D., Fluch, S., 2010. Microsatellite markers Biotechnology Centre, University of Alberta, Edmonton, AB, Canada.

in the tree peony, Paeonia suffruticosa (Paeoniaceae). Am. J. Bot. 97, e42–e44. Yuan, J.H., Cheng, F.Y., Zhou, S.L., 2010. Hybrid Origin of Paeonia × yananensis

Hong, D.Y., Pan, K.Y., 1999. Taxonomical history and revision of Paeonia sect. Moutan revealed by microsatellite markers, chloroplast gene sequences, and morpho-

(Paeoniaceae). Acta Phytotax. Sin. 37 (4), 351–368. logical characteristics. Int. J. Plant Sci. 171, 409–420.

Hosoki, T., Kimura, D., Hasegawa, R., Nagasako, T., Nishimoto, K., Ohta, K., Sugiyama, Yuan, J.H., Cheng, F.Y., Zhou, S.L., 2012. Genetic structure of the tree peony (Paeonia

M., Haruki, K., 1997. Comparative study of Chinese tree peony cultivars by ran- rockii) and the Qinling Mountains as a geographic barrier driving the fragmen-

dom ampliﬁed polymorphic DNA (RAPD) analysis. Sci. Hortic. 70 (1), 67–72. tation of a large population. PLoS ONE 7, e34955.

Hou, X.G., Guo, D.L., Cheng, S.P., Zhang, J.Y., 2011a. Development of thirty new Yuan, T., Wang, L.Y., 2002. Discussion on the origination of Chinese tree peony

polymorphic microsatellite primers for Paeonia suffruticosa. Biol. Plant. 55, cultivars according to pollen grain morphology. J. Beijing For. Univ. 24 (1),

708–710. 5–11.

Hou, X.G., Guo, D.L., Wang, J., 2011b. Development and characterization of EST-SSR Zane, L., Bargelloni, L., Patarnello, T., 2002. Strategies for microsatellite isolation: a

markers in Paeonia suffruticosa (Paeoniaceae). Am. J. Bot. 98, e303–e305. review. Mol. Ecol. 11, 1–16.

Hou, X.G., Yin, W.L., Li, J.J., Wang, H.F., 2006a. AFLP analysis of genetic diversity of 30 Zhang, J.J., Shu, Q.Y., Liu, Z.A., Ren, H.X., Wang, L.S., De Keyser, E., 2012. Two EST-

tree peony (Paeonia suffruticosa Andr.) cultivars. J. Agric. Sin. 39 (8), 1709–1715 derived marker systems for cultivar identiﬁcation in tree peony. Plant Cell Rep.

(in Chinese). 31, 299–310.

Hou, X.G., Yin, W.L., Li, J.J., Wang, H.F., 2006b. Phylogenetic relationship of dwarf tree Zhang, J.M., Liu, J., Sun, H.L., Yu, J., Wang, J.X., Zhou, S.L., 2011. Nuclear and chloroplast

peony cultivars by AFLP analysis. J. Beijing For. Univ. 28 (5), 73–77. SSR markers in Paeonia delavayi (Paeoniaceae) and cross-species ampliﬁcation

Li, J.J., 1998. Studies on the origin of Chinese Mudan (tree peony). J. Beijing For. Univ. in P. ludlowii. Am. J. Bot. 98, e346–e348.

20 (2), 22–26. Zhang, Q.J., Yan, G.J., Dai, H.Y., Zhang, X.Z., Li, C.M., Zhang, Z.H., 2008. Characterization

Li, K., Zhou, N., Li, H.Y., 2012. Composition and function research of peony ﬂowers of tomentosa cherry (Prunus tomentosa Thunb.) genotypes using SSR markers

and peony seeds. Food Res. Dev. 33 (3), 228–230. and morphological traits. Sci. Hortic. 118, 39–47.

Li, L., Cheng, F.Y., Zhang, Q.X., 2011. Microsatellite markers for the Chinese herba- Zhao, X., Zhou, Z.Q., Lin, Q.B., Pan, K.Y., Hong, D.Y., 2004. Molecular evidence for

ceous peony Paeonia lactiﬂora (Paeoniaceae). Am. J. Bot. 98, e16–e18. the interspeciﬁc relationships in Paeonia sect. Moutan: PCR-RFLP and sequence

Lin, Q.B., Zhou, Z.Q., Zhao, X., Pan, K.Y., Hong, D.Y., 2004. Interspeciﬁc relationships analysis of glycerol-3-phosphate acyltransferase (GPAT) gene. Acta Phytotaxo-

among the wild species of Paeonia Sect. Moutan DC. based on DNA sequences of nomica Sin. 42 (3), 236–244.

Adh gene family. Acta Hortic. Sin. 31 (5), 627–632. Zhao, X., Zhou, Z.Q., Lin, Q.B., Pan, K.Y., Li, M.Y., 2008. Phylogenetic analysis of Paeonia

Liu, K., Muse, S.V., 2005. PowerMarker: an integrated analysis environment for sect. Moutan (Paeoniaceae) based on multiple DNA fragments and morphologi-

genetic marker analysis. Bioinformatics 21 (9), 2128–2129. cal data. J. Syst. Evol. 46 (4), 563–572.

Ma, Q.H., Wang, G.X., Liang, L.S., 2011. Development and characterization of SSR Zhou, Z.Q., Pan, K.Y., Hong, D.Y., 2003a. Advances in studies on relationships among

markers in Chinese jujube (Ziziphus jujuba Mill.) and its related species. Sci. wild tree peony species and the origin of cultivated tree peonies. Acta Hortic.

Hortic. 129, 597–602. Sin. 30, 751–757.

Meng, L., Zheng, G.S., 2004. Phylogenetic relationship analysis among Chinese wild Zhou, Z.Q., Pan, K.Y., Hong, D.Y., 2003b. Phylogenetic analyses of Paeonia section

species and cultivars of Paeonia sect. Moutan using RAPD markers. Sci. Silvae Sin. Moutan (tree peonies, Paeoniaceae) based on morphological data. Acta Phyto-

40 (5), 110–115. taxonomica Sin. 41 (5), 436–446.