LETTERS

José R. Mediavilla, Liang Chen, 5. Smith TC, Male MJ, Harper AL, Kroeger Anne-Catrin Uhlemann, JS, Tinkler GP, Moritz ED, et al. Methi- cillin-resistant Staphylococcus aureus monacensis as Blake M. Hanson, (MRSA) strain ST398 is present in mid- Marnie Rosenthal, western U.S. swine and swine workers. Cause of Kathryn Stanak, Brian Koll, PLoS ONE. 2009;4:e4258. http://dx.doi. Mediterranean Bettina C. Fries, org/10.1371/journal.pone.0004258 6. Orscheln RC, Hunstad DA, Fritz SA, Spotted Fever–like Donna Armellino, Loughman JA, Mitchell K, Storch EK, et Mary Ellen Schilling, al. Contribution of genetically restricted, Illness, Italy Don Weiss, Tara C. Smith, methicillin-susceptible strains to the on- Franklin D. Lowy, going epidemic of community-acquired To the Editor: , Staphylococcus aureus infections. Clin and Barry N. Kreiswirth the etiologic agent of Mediterrenean Infect Dis. 2009;49:536–42. http://dx.doi. spotted fever (MSF), is transmitted Author affi liations: University of Medicine org/10.1086/600881 and Dentistry of New Jersey, Newark, New 7. Varshney AK, Mediavilla JR, Robiou N, to humans by the brown dog Guh A, Wang X, Gialanella P, et al. Diverse Jersey, USA (J.R. Mediavilla, L. Chen, B.N. (Rhipicephalus sanguineus). MSF is enterotoxin gene profi les among clonal Kreiswirth); Columbia University, New York, endemic to Italy; incidence is highest complexes of Staphylococcus aureus iso- in the south and on the islands of New York, USA (A.-C. Uhlemann, F.D. lates from the Bronx, New York. Appl En- Lowy); University of Iowa, Iowa City, Iowa, viron Microbiol. 2009;75:6839–49. http:// Sardinia and Sicily (1). Recently, the dx.doi.org/10.1128/AEM.00272-09 USA (B.M. Hanson, T.C. Smith); Jersey use of molecular methods has enabled 8. Davies PR, Wagstrom EA, Bender JB. Shore University Medical Center, Neptune, identifi cation of other rickettsiae of Lethal necrotizing caused by the spotted fever group (SFG) from New Jersey, USA (M. Rosenthal); Beth an ST398 Staphylococcus aureus strain. Israel Medical Center, New York (K. Stanak, Emerg Infect Dis. 2011;17:1152–3. http:// in northeastern dx.doi.org/10.3201/eid1706.101394 B. Koll); Albert Einstein College of Medicine, Italy and in other areas of Europe (2– 9. Stegger M, Lindsay JA, Moodley A, Skov Bronx, New York, USA (B.C. Fries); North 6). R. monacensis was identifi ed as an R, Broens EM, Guardabassi L. Rapid PCR etiologic agent of MSF-like illness in Shore University Hospital, Manhasset, New detection of Staphylococcus aureus clonal York, USA (D. Armellino, M.E. Schilling); complex 398 by targeting the restriction- Spain (7). modifi cation system carrying sau1-hsdS1. and New York City Department of Health We report a case of MSF-like J Clin Microbiol. 2011;49:732–4. http:// and Mental Hygiene, New York (D. Weiss) illness in a 28-year-old man from dx.doi.org/10.1128/JCM.01970-10 Sassari in northwestern Sardinia 10. Price LB, Stegger M, Hasman H, Aziz DOI: http://dx.doi.org/10.3201/eid1804.111419 M, Larsen J, Andersen PS, et al. Staphy- who was admitted to the Infectious lococcus aureus CC398: host adaptation Disease Unit of the University of References and emergence of methicillin resistance Sassari Hospital in April 2011. At in livestock. MBio. 2012;3:pii:e00305-11. admission, he reported fever (38.2°C) 1. Smith TC, Pearson N. The emergence of http://dx.doi.org/10.1128/mBio.00305-11 Staphylococcus aureus ST398. Vector and headache of 2 days’ duration. Borne Zoonotic Dis. 2011;11:327–39. Address for correspondence: Barry N. At physical examination, he had a http://dx.doi.org/10.1089/vbz.2010.0072 crusty skin lesion surrounded by 2. Bhat M, Dumortier C, Taylor BS, Miller Kreiswirth, Public Health Research Institute M, Vasquez G, Yunen J, et al. Staphylo- Tuberculosis Center, University of Medicine edema and erythema, which was coccus aureus ST398, New York City and and Dentistry of New Jersey, 225 Warren St, compatible with inoculation eschar, Dominican Republic. Emerg Infect Dis. ICPH W210M, Newark, NJ 07103, USA; on the left calf. He had no rash. 2009;15:285–7. http://dx.doi.org/10.3201/ Laboratory results showed a slight eid1502.080609 email: [email protected] 3. Uhlemann AC, Dumortier C, Hafer C, leukocyte increase, hypocromic and Taylor BS, Sanchez EJ, Rodriguez-Tav- microcytic anemia (hemoglobin 10.6 eras C, et al. Molecular characterization of g/dL [reference range 13.1–17.1 g/ Staphylococcus aureus from outpatients dL], mean corpuscular volume 67.7 in the Caribbean reveals the presence of pandemic clones. Eur J Clin Microbiol In- fL [reference range 81–88 fL], mean fect Dis. 2011; Epub ahead of print. http:// corpuscular hemoglobin concentration dx.doi.org/10.1007/s10096-011-1339-2 29.6 g/dL [reference range 33–35 4. Jiménez JN, Vélez LA, Mediavilla JR, g/dL]), hyperbilirubinemia (total Ocampo AM, Vanegas JM, Rodríguez EA, et al. Livestock-associated methicillin- bilirubin 1.36 mg/dL [reference range susceptible Staphylococcus aureus ST398 0.2–1.3 mg/dL], direct bilirubin 0.49 in woman, Colombia. Emerg Infect Dis. mg/dL [reference range 0.0–0.6 mg/ 2011;17:1970–1. dL]), and erythrocyte sedimentation rate 37 mm/h (reference range 0–25 mm/h). The remaining parameters

702 Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 18, No. 4, April 2012 LETTERS were within reference ranges. A small Rickettsia spp. The whole blood sample cular investigations of ticks could skin sample taken from the inoculation was negative for Rickettsia spp. better clarify the extent of circulation eschar and whole blood were stored These results were confi rmed of SFG rickettsiae in Sardinia. at –30°C. The patient immediately by amplifi cation of the ompA gene Identifi cation of R. monacensis started taking doxycycline 100 mg by using the ompA–F and ompA–R as a cause of MSF-like illness in every 12 hours. Serologic tests primers (9) and by the sequencing of Sardinia expands the list of pathogenic were negative for R. conorii IgM the PCR amplicon. The nucleotide rickettsiae circulating in Italy. It and IgG (ELISA) and positive for sequence analyzed by using the also highlights the need for further SFG Rickettsia spp. IgG on indirect BLAST search tool (www.ncbi.n/m. investigation in humans and vectors immunofl uorescence with a titer of nib.gov/blast) showed 100% identity to understand infection dynamics and 128. After 24 hours of antimicrobial with the R. monacensis isolate N72 improve diagnosis and treatment of this drug therapy, he was afebrile; he was (GenBank accession no. FJ919650.1). potentially life-threatening disease. discharged on day 3. He completed a We identifi ed R. monacensis as cause 7-day course of doxycycline at home of MSF-like illness in the patient This study was supported by a Centro and recovered completely. reported here. Nazionale per il Controllo e la Prevenzione The skin biopsy sample, collected Our results have several clinical delle Malattie Project of the Italian Health in phosphate-buffered saline, and and microbiological implications. Ministry. whole blood were obtained before Although MSF-like illness is highly antimicrobial therapy began and endemic to Sardinia, to our knowledge were subjected to DNA extraction. no pathogens other than R. conorii had Giordano Madeddu, Fabiola Bacterial detection and identifi cation ever been identifi ed. Antibodies against Mancini, Antonello Caddeo, were conducted by using molecular R. monacensis were not detected by Alessandra Ciervo, Sergio methods based on real-time PCR, the R. conorii ELISA commonly used Babudieri, Ivana Maida, Maria classical PCR, and nucleotide in hospital laboratories. In contrast, Laura Fiori, Giovanni Rezza, sequencing (Table). indirect immunofl uorescence, which and Maria Stella Mura A set of primers for gltA gene cannot distinguish between rickettsial Author affi liations: University of Sassari, that encodes the citrate synthase species because of cross-reactivity, was Sassari, Italy (G. Madeddu, A. Caddeo, S. enzyme (8) was used to determine that positive. Therefore, the cocirculation Babudieri, I. Maida, M.L. Fiori, M.S. Mura); the organism belonged to the genus of R. monacensis and, possibly, of and Istituto Superiore di Sanità, Rome, Italy Rickettsia, which includes the SFG other SFG rickettsiae, could lead to (F. Mancini, A. Ciervo, G. Rezza) and group. Each real-time PCR misdiagnosis and therapeutic delay. DOI: http://dx.doi.org/10.3201/eid1804.111583 reaction was performed by QuantiTect Furthermore, in consideration of the SYBR Green PCR kit (QIAGEN, negative result in whole blood, a small References Hilden, Germany) by using 20 ng of skin sample from the eschar might purifi ed DNA. R. conorii and R. typhii improve the diagnostic sensitivity of 1. Ciceroni L, Pinto A, Ciarrocchi S, Ciervo A. were used as positive controls for SFG PCR. Current knowledge of rickettsial diseases in Italy. Ann N Y Acad Sci. 2006;1078: and typhus group, and Anaplasma We did not perform entomologic 143–9. http://dx.doi.org/10.1196/annals. phagocytophilum, hense- studies. However, I. ricinus ticks, 1374.024 lae, , and which are considered vectors of R. 2. Márquez FJ, Muniain MA, Soriguer RC, (Bartonellaceae monacensis, are widely distributed Izquierdo G, Rodríguez-Bano J, Borobio MV. Genotypic identifi cation of an unde- and Coxiellaceae members) served in Italy and have been found in scribed spotted fever group rickettsia in as negative controls. Results were Sardinia, although less often than Ixodes ricinus from southwestern Spain. checked for the specifi c molecular other tick species (10). Moreover, it Am J Trop Med Hyg. 1998;58:570–7. length by electrophoresis on a 3% (wt/ is not excluded that other ticks might 3. Beninati T, Lo N, Noda H, Esposito F, Rizzoli A, Favia G, et al. First detection vol) agarose gel. act as vectors for R. monacensis in of spotted fever group rickettsiae in Ixo- The skin biopsy specimen of the Sardinia, where ticks of the genus des ricinus from Italy. Emerg Infect Dis. inoculation eschar was positive for Rhipicephalus are prominent. Mole- 2002;8:983–6.

Table. Selected inner primers used to amplify rickettsial gltA and ompA genes* Rickettsial groups Gene Primer Nucleotide sequence, 5ƍ o 3ƍ Product size, bp Reference Rickettsiae spotted fever gtlA gltA–F TCGCAAATGTTCACGGTACTTT 74 (8) group plus typhus group gltA–R TCGTGCATTTCTTTCCATTGTG Rickettsiae ompA ompA ompA–F ATGGCGAATATTTCTCCAAAA 632 (9) ompA–R GTTCCGTTAATGGCAGCATCT *gltA, citrate synthase; ompA, outer membrane protein A.

Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 18, No. 4, April 2012 703 LETTERS

4. Simser JA, Palmer AT, Fingerle V, Wilske Leishmania kg) during 1998–2000 (Table). The B, Kurtti TJ, Munderloh UG. Rickettsia same medication was administered for monacensis sp. nov., a spotted fever group Resistance to Rickettsia, from ticks (Ixodes ricinus) col- relapses at 4 mg/kg/d for 5 days, then lected in a European city park. Appl En- Miltefosine 4 mg/kg 1× week for 5 weeks (total viron Microbiol. 2002;68:4559–66. http:// Associated with dose 40 mg/kg) during 2001–2010. dx.doi.org/10.1128/AEM.68.9.4559- Given the adverse effects of AmpB 4566.2002 Genetic Marker 5. Sréter-Lancz Z, Sréter T, Széll Z, Egyed and the availability of oral miltefosine L. Molecular evidence of Rickettsia hel- To the Editor: During 2000– (Impavido; AEterna Zentaris Inc., vetica and R. monacensis infections in 2010, serial Leishmania isolates Quebec City, Quebec, Canada), the Ixodes ricinus from Hungary. Ann Trop latter drug was used for maintenance Med Parasitol. 2005;99:325–30. http:// obtained from an HIV-infected patient dx.doi.org/10.1179/136485905X28027 who was not responding to treatment treatment during 2001–2007 at 50 mg 6. Chmielewski T, Podsiadly E, Karbowiak showed a gradual decrease in in 2×/d. Leishmaniasis was monitored G, Tylewska-Wierzbanowska S. Rickett- vitro miltefosine susceptibility. We by leukocytoconcentration and culture sia spp. in ticks, Poland. Emerg Infect Dis. of blood samples on Novy-Nicolle- 2009;15:486–8. http://dx.doi.org/10.3201/ performed L. donovani miltefosine eid1503.080711 transporter (Ldmt) gene analysis McNeal medium. 7. Jado I, Oteo JA, Aldámiz M, Gil H, Escu- to identify an association between When signs of biological and dero R, Ibarra V, et al. Rickettsia mona- miltefosine resistance of reference clinical relapse appeared, bone censis and human disease, Spain. Emerg marrow was aspirated for parasite Infect Dis. 2007;13:1405–7. L. donovani lines and variability in 8. Paris DH, Blacksell SD, Stenos J, Graves miltefosine response of L. infantum detection. After culture of the aspirate SR, Unsworth NB, Phetsouvanh R, et isolates. A new single-nucleotide and isoenzyme determination, the al. Real-time multiplex PCR assay for polymorphism (SNP), L832F, was strain was identifi ed as L. infantum, detection and differentiation of rickett- zymodeme MON-24. Eleven relapses siae and orientiae. Trans R Soc Trop Med identifi ed, which might be a marker of Hyg. 2008;102:186–93. http://dx.doi.org/ miltefosine resistance in leishmaniasis. were documented; all were confi rmed 10.1016/j.trstmh.2007.11.001 The patient, a 46-year-old by positive direct examination of bone 9. Zhang L, Jin J, Fu X, Raoult D, Fournier woman, had lived in France since marrow or blood, but cultures of only PE. Genetic differentiation of Chinese iso- 7 samples yielded positive results lates of by partial ompA 1994 but regularly returned to Algeria, gene sequencing and multispacer typing. her country of birth. HIV-1 infection (Table). J Clin Microbiol. 2006;44:2465–7. http:// was diagnosed in 1991. Antiretroviral The susceptibility of 4 dx.doi.org/10.1128/JCM.02272-05 cryopreserved isolates (S , S , therapy was initiated in 1993, leading 1 3 10. Di Todaro N, Piazza C, Otranto D, S , and S ; Table) to AmpB and Giangaspero A. Ticks infesting domestic to undetectable viral load and a 4 6 animals in Italy: current acarological stud- CD4+ T-cell count of 185 cells/mm3 to miltefosine was studied in the ies carried out in Sardinia and Basilicata (reference >450/mm3). Concurrent in vitro promastigote and axenic regions. Parassitologia. 1999;41(Suppl 1): amastigote form by determining the 39–40. conditions were thoracic herpes zoster in 1996, hairy leukoplakia of concentrations inhibiting parasite growth by 50% (1,2). The 50% Address for correspondence: Giordano tongue, oropharyngeal candidiasis, inhibitory concentration (IC ) Madeddu, Dipartimento di Medicina Clinica, and chronic renal failure of unknown 50 was determined in parallel for the Sperimentale e Oncologica, Università degli cause since 2000. following reference L. donovani Studi di Sassari, Via de Nicola 1, 07100 Sassari, Visceral leishmaniasis was lines: a wild-type L. donovani LV9 Italy; email: [email protected] diagnosed in 1998 by culture of a bone marrow smear, which showed (MHOM/ET/67/HU3) line (LV9 intracellular amastigotes. Use of WT), a wild-type L. donovani DD8 meglumine antimonate (Glucantime; (MHOM/IN/80/DD8) line (DD8 WT), Sanofi , Paris, France), a drug of choice a laboratory miltefosine-resistant for the treatment of leishmaniasis, line obtained from LV9 WT (LV9 was contraindicated because of miltefosine-R, resistant to 90 μmol/L pancreatitis in the patient and in miltefosine), and the laboratory AmB- vitro isolate susceptibility variation; resistant line obtained from DD8 WT therefore, induction therapy consisted (DD8 AmB-R, resistant to 1.4 μmol/L of liposomal amphotericin B (AmpB AmB) on promastigote and axenic [AmBisome; Astellas Pharma US, amastigote forms (3,4). Deerfi eld, IL, USA]) at a dose of 3 mg/ The AmB susceptibility of the kg/d for 5 consecutive days, then 1× isolates did not change notably over time; IC values ranged from 0.09 week for 5 weeks (total dose 30 mg/ 50

704 Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 18, No. 4, April 2012