Systematics of Lumbricillus (Clitellata, Enchytraeidae) Using Molecular and Morphological Approaches

Systematics of Lumbricillus (Clitellata, Enchytraeidae) using molecular and morphological approaches

Mårten Eriksson

Degree project for Master of Science (120 credits) in

Systematics and Biodiversity

Degree course in (Systematics and Biodiversity) 60 hec 2015

Department of Biological and Environmental Sciences

University of Gothenburg

Examiner: Bengt Oxelman

Department of Biological and Environmental Sciences

University of Gothenburg Supervisor: Christer Erséus

Department of Biological and Environmental Sciences

University of Gothenburg

Cover illustration: Lumbricillus rutilus, by Mårten Eriksson

Abstract

The enchytraeid genus Lumbricillus comprises about 80 described species, which are up to a few centimeters in length, and inhabits mostly the littoral zone of non-tropical marine environments world-wide. The phylogeny of this genus is poorly studied, but previous work has shown Lumbricillus to be a non-monophyletic group. In this study, the phylogeny of this genus is re- estimated using more than 300 specimens from 24 species (out of which 20 have been identified with nominal names), samples of which have been sequenced for three mitochondrial and four nuclear molecular markers. DNA-barcoding was used together with statistical and coalescent based applications for species delimitation. Gene trees, concatenations and multispecies coalescent based species trees were estimated using Bayesian inference. I found most of the 24 species as well-supported, and two possible cases of cryptic speciation. Furthermore, the estimated phylogenies confirm a non-monophyletic Lumbricillus containing a monophyletic Lumbricillus sensu stricto in which L. semifuscus is clearly excluded. I also found inconclusive evidence suggesting that L. arenarius, L. dubius as well as an unidentified species should be transferred into a new genus, in order to ensure a monophyletic Lumbricillus sensu stricto. Finally, I provide illustrated morphological re-descriptions of all 24 included species.

Key words: Lumbricillus, Enchytraeidae, DNA-barcoding, Species delimitation, Phylogenetic inference, Concatenation, Multispecies coalescent.

Disclaimer: The nomenclatural acts discussed within this work are not intended to have any effect on zoological nomenclature (§8.2, ICZN 1999).

Table of Contents 1. Introduction ...... 1 1.1 From Annelida to Lumbricillus ...... 1 1.2 Theoretical background ...... 4 1.2.1 Species delimitation ...... 4 1.2.2 Phylogenetic inference ...... 5 2. Methods...... 6 2.1 Collection, preservation and preparation of specimens ...... 6 2.2 DNA extraction/amplification/sequencing ...... 7 2.3 Species delimitation ...... 8 2.4 Gene tree estimation ...... 9 2.5 Recombination test ...... 10 2.6 Concatenated phylogenetic analyses ...... 10 2.7 Coalescent based species tree estimation ...... 11 3. Results ...... 12 3.1 DNA sequencing ...... 12 3.2 Species delimitation ...... 12 3.3 Gene tree estimation ...... 15 3.4 Recombination test ...... 16 3.5 Concatenated phylogenetic analyses ...... 16 3.6 Species tree estimation ...... 20 3.7 Taxonomy...... 22 3.7.1 General notes ...... 22 3.7.2 Lumbricillus Ørsted, 1844 ...... 22 Lumbricillus lineatus (Müller, 1774)...... 23 Lumbricillus rutilus Welch, 1914 ...... 25 Lumbricillus sp. E ...... 27 Lumbricillus verrucosus (Claparède 1861) ...... 29 Lumbricillus rivalis (Levinsen, 1883) ...... 31 Lumbricillus sp. G ...... 32

Lumbricillus kaloensis Nielsen & Christensen 1959 ...... 34 Lumbricillus sp. F ...... 36 Lumbricillus pumilio Stephenson, 1932 ...... 37 Lumbricillus rubidus Finogenova & Streltsov, 1978 ...... 39 Lumbricillus fennicus Nurminen, 1964 ...... 41 Lumbricillus cf. helgolandicus sensu Nielsen & Christensen, 1959 ...... 43 Lumbricillus pagenstecheri (Ratzel, 1869) Cryptic species A...... 45 Lumbricillus pagenstecheri (Ratzel, 1869) Cryptic species B...... 47 Lumbricillus pagenstecheri (Ratzel, 1869) Cryptic species C...... 49 Lumbricillus pagenstecheri (Ratzel, 1869) Cryptic species D...... 50 Lumbricillus viridis Stephenson, 1911 ...... 52 Lumbricillus tuba Stephenson 1911 ...... 53 Lumbricillus buelowi Nielsen & Christensen, 1959 ...... 55 Lumbricillus knoellneri Nielsen & Christensen, 1959 ...... 56 Lumbricillus arenarius (Michaelsen, 1889) ...... 58 Lumbricillus sp. H ...... 60 Lumbricillus dubius (Stephenson, 1911) ...... 62 Lumbricillus semifuscus (Claparéde, 1861)...... 64 4. Discussion ...... 66 4.1 Species delimitation ...... 66 4.2 Gene tree estimation ...... 68 4.3 The phylogeny of Lumbricillus ...... 69 4.4 DNA sequencing issues ...... 70 4.5 Taxonomy...... 71 5. Conclusion ...... 71 6. Acknowledgements ...... 72 7. References: ...... 72 8. Supplement ...... I

iii

1. Introduction

1.1 From Annelida to Lumbricillus

The phylum Annelida consists of more than 15 000 species of worms occurring in a wide variety of habitats, from marine and limnic to terrestrial environments. They occupy many different niches and include burrowing decomposers, sessile filter feeders, active predators and bloodsucking parasites. Annelida is traditionally made up of the segmented worms from the two classes Polychaeta (known as bristle worms) and Clitellata (containing earthworms and leeches). However, recent molecular studies have suggested some other un-segmented phyla also to be included within the group (Struck et al., 2007, Struck et al., 2011). Furthermore, Clitellata appears to be a derived monophyletic group within Polychaeta making the latter polyphyletic (Rousett et al., 2007, Struck et al., 2011).

Clitellata has been named after the thickened epidermis which creates a ring-like structure, the clitellum, extending around a specific part of the body when the worms become sexually mature. The clitellum secretes the cocoons into which the eggs are laid. This apomorphic character is shared by all members of the class and is considered important supporting evidence for the monophyly of the group. Furthermore, all sexually reproducing members of Clitellata are hermaphrodites and produce both sperm and eggs (Erséus, 2005). The class was conventionally divided into two subclasses: Oligochaeta and Hirudinea (leeches), but molecular studies have shown that Hirudinea is a monophyletic group within the paraphyletic Oligochaeta (Siddall et al., 2001). Therefore, a more inclusive Oligochaeta, defined as including Hirudinea, can be considered a synonym to Clitellata (Erséus, 2005).

The family Enchytraeidae, which is found within Clitellata but outside Hirudinea, contains some 676-715 taxa depending on whether subspecies are included or not (Schmelz & Collado, 2010a). The family is found mainly in terrestrial soils but occurs also in most habitats. Enchytraeids are usually between 5 and 20 mm long and have both a thick cuticle of collagen as well as solid chaetae (hairs) making them resemble earthworms (Crassiclitellata). A close relationship to earthworms has been supported by some phylogenetic analyses (Siddall et al., 2001, Erséus & Källersjö, 2004) but another study supports the family Propappidae as the sister to Enchytraeidae (Marotta et al., 2008). Thus, the true phylogenetic relationship of Enchytraeidae to other Clitellata remains controversial.

Figure 1. Lumbricillus rutilus. A. Anterior body, seen from above. B. Brain, with the anterior end to the left. C. Chaetal bundle. D. Nephridium. Abbreviations: as=anteseptale, b=brain, nd=nephridial duct, oe=oesophagus, ov=ovaries, pb=penial bulb, pg=pharyngeal glands, ps=postseptale, s=spermatheca, sf=sperm funnel, t=testis & vd=vas deferens. Scale bars: 100 µm.

Several morphological characters are considered important when distinguishing between different enchytraeid species, and the most important ones will be briefly outlined here. The external morphology of the worms considers measurements of body length and width, number of segments, chaetae, and the extent and structure of the clitellum (Figure 1A). The shape and number of chaetae in the dorsal and ventral bundles can be of particular importance when determining species (Figure 1C). Descriptions of the internal morphology usually mention

details regarding the brain (Figure 1B), blood vessels and the esophagus with its appendages. The nephridia are organs that are used to excrete waste products from the body fluids, and their shape can be used to distinguish enchytraeid groups from each other (Dózsa-Farkas, 2010). The nephridium consists of an anterior anteseptale and a posterior postseptale, the latter comprising the nephridial body and the nephridial (efferent) duct (Figure 1D). The reproductive organs are of particular importance and include the testes, which produce sperm that later migrate to the sperm funnels which in turn transports the sperm through the vasa deferentia to the penial bulbs during copulation. Moreover, in some species sperm are stored in distinct seminal vesicles or sacs surrounding the developing spermatozoa. The shape of the penial bulbs and sperm funnels as well as the ratio between length and width of the sperm funnels can be of importance when separating enchytraeid species. The female reproductive organs include the ovaries, maturing and mature eggs and female pores through which the eggs are deposited. The taxonomically most important reproductive characters are in most cases associated with the spermathecae, which are pouch-like organs that receive the sperm during copulation and store them until they are used for fertilization. The spermatheca consists of an ectal pore, an ectal duct, and an ampulla (sometimes connected to the esophagus via an ental duct), and specialized gland cells arranged around the ectal pore and, in some species, along the ectal duct of the spermatheca. The shape of the spermatheca and its gland cells is often species specific (Schmelz & Collado, 2010b).

One of the 30 or so genera within the family Enchytraeidae is Lumbricillus Ørsted, 1844, which contains about 75-80 described species (Nakamura, 2000, Schmelz & Collado, 2010a). This genus is characterized by having only a funnel in the anteseptale part of the nephridia, sperm developed in several large, usually lobed, seminal vesicles (testis sacs) and a crown of glands surrounding the ectal pore of the spermathecae (Schmelz & Collado, 2010b, Nielsen & Christensen, 1959). A morphological study supported a close relationship to the small genus Randidrilus Coates & Erséus, 1985, mostly based on the nephridial anteseptale being composed of a funnel only (Coates, 1989), a character also shared with the genus Grania Southern, 1913, which unfortunately was not included in that study. Molecular data have placed Lumbricillus as closely related to the genus Grania (Erséus et al., 2010). However, in the same study Lumbricillus was proposed to be paraphyletic, with one species (Lumbricillus arenarius) placed as sister to Grania rather than to the remaining Lumbricillus species. Erséus et al. (2010) however, did not include any specimens from the genus Randidrilus and thus the phylogenetic relationships between Lumbricillus and its closest relatives as well as the ones within Lumbricillus remain largely unstudied.

The aim of this study is to further examine the phylogeny of Lumbricillus, using two additional genetic markers as well as several additional species. This will be done by first using DNA barcoding and species delimitation approaches to distinguish the sampled species. Second, the phylogeny of Lumbricillus and its closest relatives will be estimated using concatenated and multispecies coalescent based Bayesian inference. Third and finally, the sampled species will be morphologically examined, identified and re-described.

1.2 Theoretical background

1.2.1 Species delimitation

Species delimitation is a fundamental part of systematics as species are usually the building stones among which phylogenetic relationships are reconstructed. One of the biggest challenges of species delimitation has been the conflicting views on which species concept to be used for defining species. The biological, cohesion and phylogenetic species concepts are just some of many well-supported species concepts, all with their own merits, but few which can be applied to a broad spectrum of organism groups (Harrison, 1998). De Queiroz (2007) proposed a unified species concept where the only criterion for species is that they are “separately evolving metapopulation lineages” for which various criteria of previous species concepts may be used as secondary evidence. In other words, during the process of speciation, the diverging lineages will gradually exhibit differences that are molecular, morphological, behavioral or other, and as these differences arise the two lineages will fulfill more and more of the criteria of the different species concepts. Thus, the species concepts can be used as evidence for species delimitation and the more criteria that are met by the examined organisms the better the support for the species (de Queiroz, 2007). DNA-barcoding is a popular tool for species delimitation where a short and variable DNA sequence (cytochrome c oxidase subunit 1 or COI for animals) is used to find clusters of organisms which can be considered as putative species. The idea is that there will be clusters of specimens showing little genetic distances, clusters of specimens showing a higher degree of distances and a gap of unrepresented distances separating the two. The term “barcoding-gap” is used to describe the missing genetic distances and assumes that all distances below this gap represent intraspecific variation whilst the distances above the gap represent interspecific variation (Kress et al., 2015). However, the use of a single genetic marker for species delimitation has its limits as it does not easily separate intraspecific from interspecific clusters. Furthermore, as COI is a mitochondrial gene it is, with few exceptions, inherited maternally only and thus produces clusters not showing evidence of paternal ancestry. Therefore, preliminary delimitations of individuals into species should be validated using further lines of evidence such as more genetic markers or morphological differences (de Queiroz, 2007).

There are several available softwares for delimiting species, such as the statistical tests

Rosenberg’s PAB and P(Randomly Distinct) implemented in Geneious. Rosenberg’s PAB tests whether the monophyly of the selected group in the gene tree is due to an evolutionary process or

if it is the result of random branching of the tree caused by an insufficient sample size. The test is dependent on both the amount of individuals sampled within a selected group and the amount of individuals sampled outside that group where increased sampling from both categories reduces the probability of monophyly due to random branching (Rosenberg, 2007). Furthermore, gene trees are expected to contain short internal branches between the individuals belonging to the same species and deeper branchings separating the species. P(Randomly Distinct) uses the ratio between the length of the branches within a selected group and the length between selected groups to estimate whether the groups distinctiveness is due to an evolutionary process or because of random coalescent processes (producing deep branching’s). This test cannot be performed for species with only one sampled individual (Rodrigo et al., 2008).

DISSECT (Division of Individuals into Species using Sequences and Epsilon-Collapsed Trees) is a novel method which uses Bayesian inference to co-estimate the species tree and the species delimitation (Jones et al., 2014). Instead of only using the information of one gene at a time, as with the previously mentioned statistical tests, DISSECT combines the information of all included genes, simulating their coalescent histories and estimating the species tree for the included species (more on this under phylogenetic inference below). In short, DISSECT uses a prior distribution on node heights with a high peak close to zero and only if the posterior distribution of a node is significantly separated from this peak the node will be treated as split into two species (Jones et al., 2014).

1.2.2 Phylogenetic inference

In the early days of molecular systematics, phylogenetic studies used single genes with their corresponding gene trees to infer the evolutionary relationships between different species. In other words the gene trees were directly used as species trees (Degnan & Rosenberg, 2009). With the increased availability of genetic markers either the most prevalent gene tree topology or the tree yielded from a concatenation of all DNA sequences has been used as the species tree (Bull et al., 1993, Nylander et al., 2004). A major problem with inferring species trees directly from gene trees is that the genealogies, meaning the histories of inheritance of the genes, can differ from each other and, most importantly, from the species tree. In fact, it has been shown that when the true species tree contains short internal branches the probability that any sampled gene tree has a topology matching that of the species tree is quite low (Pamilo & Nei, 1988). Consequently, using the most common gene tree or concatenating data can lead to erroneous estimation of the species tree (Degnan & Rosenberg, 2006). Incongruence between gene trees can be caused by incomplete lineage sorting, population structure, recombination, hybridization or gene duplication followed by extinction of one of the copies, which can lead to comparison of paralogs rather than orthologs (Degnan & Rosenberg, 2009).

Coalescent theory describes the random process in which lineages merge or coalesce when finding their common ancestor, moving backwards in time. In other words, any two sampled

genes in a population can be traced back in time following their ancestors from which they descended until both lineages meet in an individual known as the common ancestor (Nordborg, 2001). This theory was first described by Kingman (1982) and is based on the Wright-Fisher model which treats each generation as completely separated from the next, with constant population size, where randomly sampled individuals in one generation give rise to the next generation and are instantaneously replaced by the latter. The coalescent is efficient to model because instead of following the history of the entire population backwards in time it only generates the random genealogy of the sampled individuals. The differences between the individuals, caused by mutations, are later added on the genealogy. Generally, simulated coalescent trees have deeper branch lengths further back in time and shorter branch lengths closer to the tips where the probability of any lineages coalescing is higher simply because there are more lineages available to merge with (Nordborg, 2001). Coalescent theory has been implemented when using several genes to estimate the phylogeny in what is known as the multispecies coalescent model. This was first performed by Rannala and Yang (2003) who used the fact that the divergence times between species has to be more recent than the coalescent times for any genes shared between them, assuming no genetic transfer after speciation. The multispecies coalescent model is rapidly becoming a popular way of estimating species trees, population sizes and divergence times (Rannala & Yang, 2003) at the same time as it is able to handle incongruence between the gene trees (Degnan & Rosenberg, 2009). The multispecies coalescent model is consistent with the unified species concept suggested by de Queiroz (2007).

2. Methods

2.1 Collection, preservation and preparation of specimens

The majority of the material used in this study was collected during previous trips mainly throughout Norway and Sweden by Christer Erséus and co-workers, and information on the collection localities etc. can be found in the supplementary table (Table S1). As a part of this project, a collection trip was made to the Southern coast of Norway as well as the Hardanger- and Sognefjord area of Western Norway. Enchytraeid worms were collected in marine, brackish and limnic habitats by decantation of suspended organic material from bottom substrates into a 0.25 mm sieve. Collected worms were picked out by eye or under a dissection microscope and preserved in 80 % ethanol. The anterior ends of the worms were later stained in paracarmine that binds to the nuclei of the cells, making internal structures easier to distinguish under a microscope. Superfluous staining was washed away using acidic ethanol. Thereafter, the stained worms were transferred from 80 % to 96 % and lastly into 99.9 % ethanol for dehydration. The dehydration process was completed by transferring the worms first into a 1:1 mixture of 99.9 % ethanol and xylene and second into pure xylene. The dehydrated worms were mounted in Canada balsam on a microscope slide and compressed under a cover slip. For a more detailed description of the staining and mounting procedures see Erséus (1994). The morphology of the mounted

specimens was examined under a compound microscope and specimens were identified to species using original descriptions in the taxonomic literature.

2.2 DNA extraction/amplification/sequencing

Many sequences used in this analysis were provided by Christer Erséus and co-workers from previous work using several different methods for extraction and sequencing. In total, 310 specimens, excluding outgroups, have been sequenced for at least one of the molecular markers and are included in this study. The following section describes the methods used for new specimens in this study. DNA was extracted from the posterior ends of the worms using the QuickExtract DNA Extraction Solution 1.0 from Epicentre (following instructions from manufacturer). The extracts were later used to amplify the COI mtDNA gene used for preliminary species delimitation and later, based on that delimitation, amplified for 12S and 16S mitochondrial genes as well as the ITS region, 18S, 28S and Histone 3 (H3) from the nuclear genome, using primers and PCR protocols described in Table 1. The PCR products were examined using 1 % agarose gel electrophoresis, and successful products were purified using exonuclease I and FastAP thermosensitive alkaline phosphatase. The purified products were sent to MWG Eurofins Operon in Edersberg, Germany for sequencing using Sanger sequencing. The trace files received from MWG were imported into Geneious 6.1.8 (created by Biomatters; available from http://www.geneious.com/) where the two reads from each specimen were assembled using “de novo assemble” to create contigs. The contigs were examined manually and primer binding regions as well as uncertainties, particularly in the end regions, were deleted before creating consensus sequences. The sequences were aligned using default settings in MAFFT (Katoh et al., 2002), which was implemented within Geneious 6.1.8.

Achaeta bibulba Graefe, 1989, Cernosvitoviella minor Dozsa-Farkas, 1990, Chamaedrilus cognettii (Issel, 1905), Grania crassiducta Coates, 1990, Grania galbina De Wit & Erséus, 2007, Grania ovitheca Erséus, 1977, Grania pusilla Erséus, 1974, Grania variochaeta Erséus & Lasserre, 1976, Henlea ventriculosa (Udekem, 1854), Marionina communis Nielsen & Christensen, 1959 and Mesenchytraeus flavus (Levinsen, 1883) were selected as outgroups based on the phylogeny by Erséus et al. 2010. The results of that phylogeny also suggested a sister relationship between Lumbricillus and Grania, which is why several species of Grania were included in this study.

Some sequences were downloaded from GenBank but most were newly generated for this study as is outlined in Table S1.

Table 1. Primer sequences and PCR programs for the 7 markers used in this study. Sequences for 18S and ITS were obtained from two separate sequencing reactions here denoted A and B. The same primers were used for PCR and sequencing. The primers were based on the following references: 12S, Jamieson et al., 2002; 16S, Palumbi et al., 1991; 18S, Norén & Jondelius, 1999; Erséus et al., 2002; 28S, Dayrat et al., 2001; COI, Folmer et al., 1994; H3, Brown et al., 1999; ITS, White et al., 1990; Källersjö et al., 2005.

Marker Primer sequence PCR program Initial Denaturation Annealing Elongation Cycles Final denaturation elongation 12S 12SE1 (forward) 95˚C 95˚C 45˚C 72˚C 43 72˚C AAAACATGGATTAGATACCCRYCTAT 5 min 40 sec 45 sec 1 min 8 min 12SH (reverse) ACCTACTTTGTTACGACTTATCT 16S 16SAR-L (forward) 95˚C 95˚C 45˚C 72˚C 35 72˚C CGCCTGTTTATCAAAAACAT 5 min 30 sec 30 sec 1 min 8 min 16SBRH (reverse) CCGGTCTGAACTCAGATCACGT 18S (A) TimA (forward) 95˚C 95˚C 54˚C 72˚C 30 72˚C AMCTGGTTGATCCTGCCAG 5 min 30 sec 30 sec 1 min 8 min 1100R (reverse) 30 sec GATCGTCTTCGAACCTCTG 18S (B) 660F (forward) 95˚C 95˚C 54˚C 72˚C 30 72˚C GATCTCGGGTCCAGGCT 5 min 30 sec 30 sec 1 min 8 min TimB (reverse) 30 sec TGATCCATCTGCAGGTTCACCT 28S 28SC1' (forward) 95˚C 95˚C 52˚C 72˚C 35 72˚C ACCCGCTGAATTTAAGCAT 5 min 40 sec 40 sec 1 min 8 min 28SC2 (reverse) TGAACTCTCTCTTCAAAGTTCTTTTC COI LCO1490 (forward) 95˚C 95˚C 45˚C 72˚C 35 72˚C GGTCAACAAATCATAAAGATATTGG 5 min 40 sec 45 sec 1 min 8 min HCO2198 (reverse) TAAACTTCAGGGTGACCAAAAAATCA H3 H3F (forward) 95˚C 95˚C 50˚C 72˚C 35 72˚C ATGGCTCGTACCAAGCAGACVGC 5 min 30 sec 30 sec 1 min 8 min H3R (reverse) 30 sec ATATCCTTRGGCATKATRGTGAC ITS (A) ITS-5 (forward) 95˚C 95˚C 50˚C 72˚C 35 72˚C GGAAGTAAAAGTCGTAACAAGG 5 min 30 sec 30 sec 1 min 8 min 5.8mussR (reverse) 30 sec GATGTCGATGTTCAATGTGTCCTGC ITS (B) 5.8mussF (forward) 95˚C 95˚C 50˚C 72˚C 35 72˚C CGCAGCCAGCTGCGTGAATTAATGT 5 min 30 sec 30 sec 1 min 8 min ITS-4 (reverse) 30 sec TCCTCCGCTTATTGATATGC

2.3 Species delimitation

Sequence alignments of COI, ITS and H3 were used for species delimitation, each alignment representing different numbers of specimens. The alignments were analyzed in MEGA 5.10 (Tamura et al., 2011), first for selection of evolutionary model, using the Bayesian Information Criterion (BIC), second for pairwise distances both with raw distances (p-distance) and distances based on the appropriate evolutionary model. If the selected evolutionary model was not implemented in MEGA, the closest model in terms of number of parameters was chosen. All analyzes in MEGA used partial deletion. A gamma distribution of rates among sites was selected, other parameters were used with default settings. The following evolutionary models were selected for the distance analyses:

COI: Tamura-Nei+Gamma (TN93)

ITS: Tamura 3-parameter+Gamma (T92)

H3: Tamura 3-parameter+Gamma (T92)

For each marker, the pairwise distances were exported, sorted after size and ranked to create a scatterplot in which a potential barcode gap could be distinguished. The distance files were also uploaded to the ABGD (Automatic Barcode Gap Discovery) website (Puillandre et al., 2012) and run using default values except for the following changes: Pmin to 0.01, Pmax to 0.2 and Steps to 20. From the results the initial partition was used to delimit the specimens into molecular operational taxonomic units (MOTUs) (Floyd et al., 2002). As only COI showed a clear barcode gap and was consistent in the number of MOTUs yielded from the ABGD analysis these results were used for initial species hypotheses to be further tested.

Estimated gene trees for COI, H3 and ITS (see results) were imported into Geneious and the species hypotheses from ABGD were tested using the species delimitation plug-in (Masters et al., 2011). The hypotheses were evaluated using the results from the Rosenberg’s PAB and the P(Randomly Distinct) statistical tests.

Further species delimitation of the species hypotheses from ABGD was performed in DISSECT using the same settings and priors as in the species tree estimation (see below) with the species tree prior changed into a birth-death process. In the xml-file the ploidy level was changed to allow for hermaphrodites (see species tree estimation below), birthDeathModel was replaced with a birthDeathCollapseModel, and an operator was added for the origin height, according to the supplementary paper (Jones et al., 2014). The ε-parameter, which determines the collapsing node height, used the recommended default value of 0.0001. The mcmc was set to run for 500 million generations sampling every 50 000, thus generating 10 000 trees. The sampled trees were run through SpeciesDelimitationAnalyser using default values and removing the first 1000 trees as burn-in. The results were visualized using the r-script from the supplementary information (Jones et al., 2014).

2.4 Gene tree estimation

FASTA alignments from Geneious were opened in Mesquite v.3.02 (Maddison & Maddison, 2015) and exported in Nexus-format. Gene trees were estimated for each of the seven genes in MrBayes v.3.2.4 (Ronquist et al., 2012) using nst=mixed (the mcmc samples over the entire parameter space of different number of substitution types from 1 to 6 corresponding to different evolutionary models, by doing so the analysis will spend most time using the parameters that best fit the data set which should ensure proper results, the posterior shows the amount of time spent at each evolutionary model (Huelsenbeck et al., 2004)), rates=invgamma (allows rates of variation between sites to vary throughout the dataset sampling from a gamma shaped 9

distribution, a proportion of the sites are set as invariable) and brlenspr=unconstrained:Exp(100) (sets the prior distribution of branch lengths where unconstrained creates an unrooted tree using a non-clock model for the molecular clock, the prior has an exponential shape and the value of 100 creates a distribution which is much narrower than the default and can avoid the problem of overly long branches (Brown et al., 2010)). COI and H3 were partitioned according to codon position and ITS was roughly partitioned into ITS1, 5.8S and ITS2. All partitions were unlinked to allow for different base frequencies, shape of the gamma distribution, proportion of invariable sites and substitution rates. The gene trees were set to run for 10 million generations sampling every 10 000 generations. Consensus trees were summarized with 25 % discarded as burnin. Resulting p-files were examined in Tracer v1.5 (Rambaut & Drummond, 2007) to evaluate convergence and to ensure sufficient burn-in for the trees. Consensus trees were viewed in TreeGraph 2 (Stöver & Müller, 2010) and edited in GIMP 2.8.10.

2.5 Recombination test

FASTA alignments for all genes and concatenations were opened in SplitsTree4 (Huson & Bryant, 2006) which is a program that computes phylogenetic networks and can be used to detect hybridization and recombination. Phi-tests were conducted to search for data heterogeneity which could be due to recombination.

2.6 Concatenated phylogenetic analyses

Three separate concatenated analyses were set to run in MrBayes v.3.2.4 using the combined information of the mitochondrial, nuclear and all genes, respectively.

Mitochondrial: 49 specimens were selected (including outgroups) and concatenated with sequences for 12S, 16S and COI, two exceptions: CE3502 L. rutilus and CE2549 L. rubidus both lacking 12S. The mitochondrial concatenation was partitioned according to gene and COI was further partitioned according to codon position (5 partitions in total).

Nuclear ribosomal: 48 specimens selected (including outgroups) and concatenated with sequences for 18S, ITS and 28S. The nuclear ribosomal concatenation was partitioned according to gene and ITS was further roughly partitioned into ITS1, 5.8S and ITS2 (5 partitions in total).

Total concatenation: 47 specimens were selected (including outgroups) and concatenated with sequences for 12S, 16S, 18S, 28S, COI, H3 and ITS, exceptions: CE3502 L. rutilus and CE2549 L. rubidus both lacking 12S, CE2246 L. sp. G, CE838 C. minor, CE699 G. ovitheca, CE879 L. tuba, CE664 and CE986 both L. lineatus, all lacking H3. The total concatenation was partitioned according to gene, ITS was further roughly partitioned into ITS1, 5.8S and ITS2, COI and H3 were further partitioned according to codon position (13 partitions in total).

For all the concatenations the partitions were unlinked, used nst=mixed and the same settings as the gene tree estimations (see above) except for running 20 million generations with sampling 10

every 20 000 generations (Mitochondrial and Nuclear ribosomal) or 50 million generations with sampling every 50 000 generations (Total concatenation). Consensus trees were summarized with 25 % discarded as burnin. Resulting p-files were examined in Tracer v1.5 to evaluate convergence and to ensure sufficient burn-in for the trees. Consensus trees were viewed in TreeGraph 2 and edited in GIMP 2.8.10.

2.7 Coalescent based species tree estimation

Alignments were prepared with 46 specimens (including outgroups) for the 7 gene markers. The following specimens lacked some of the genes: CE3502 L. rutilus and CE2549 L. rubidus both lacking 12S, CE2248 L. semifuscus lacked 18S, CE2497 L. pagenstecheri A lacked COI, CE2246 L. sp. G, CE664 and CE986 both L. lineatus, all lacking H3. The alignments were imported into BEAUti v1.8.0, part of the BEAST-package (Drummond et al., 2012), where the *BEAST option was selected to allow for species tree estimation under the multispecies coalescence model (Heled & Drummond 2010). The specimens were grouped into 32 species according to the results from the species delimitation, using a prepared traits file. Each gene was kept unlinked for both site, clock and tree model. Default settings and priors were used with the following exceptions: Sites: Each partition was given the substitution model selected by both the model test in MEGA and the results from the reversible model jump in MrBayes. When two different models were favored or tied for best fit the more complex of the two was selected, this in order to avoid underestimation of parameters. The selection was as follows: GTR+G+I for 12S, 16S and COI. TN93+G+I for 18S, 28S, ITS and H3. Base frequencies were estimated. Clocks: The evolutionary rate of COI was set to 1 and the rates of all other genes estimated in relation to this. All clock models were set to lognormal relaxed uncorrelated clocks (this allows different branches to have different evolutionary rates sampling from a lognormal prior distribution, closely related taxa are not assumed to share similar rates). Trees: Yule process was selected for species tree prior and piecewise linear & constant root for population size model. For 12S, 16S and COI genes ploidy type was changed to mitochondrial and all genes were set with UPGMA starting trees. Priors: Clock priors (ucld.mean) were set as uniform ranging from 0 to 2 with an initial value of 1 for 12S, 16S and ITS whilst ranging from 0 to 1 with an initial value of 0.5 for 18S, 28S and H3 (all in relation to the set rate of 1 for COI). This selection treats 18S, 28S and H3 as evolving at a slower rate than COI, whilst 12S, 16S and ITS could be either slower or faster than but no more than twice as fast as COI. Settings based on previous studies on insects (Lin & Danforth, 2004, Danforth et al., 2005) confirmed for oligochaetes (Martinsson & Erséus, 2014). The improper priors for species.popMean and species.yule.birthRate were changed to lognormal distributions with default values. The generated xml-file was edited in a text editor to change the ploidy value from 0.5 to 1 for 12S, 16S and COI as these worms are hermaphrodites and thus have two potential mothers which can contribute the mitochondrial genes to the next generation. The xml-file was run for 500 million generations in BEAST v1.8.1 (Drummond et al., 2012) sampling every 500 000 generations. Resulting log-file was evaluated

in Tracer v1.5, the tree file was run through Treeannotator v1.7.4. (Drummond et al., 2012) removing the initial 10 % as burn-in (determined sufficient after examining the log-file) and later viewed in Figtree v1.4.0. (Rambaut, 2009) and edited in GIMP 2.8.10.

Lumbricillus tuba lacked H3 due to sequencing problems and could thus not be included in the StarBEAST analysis. It was removed from all alignments and the ITS alignment was realigned. The same occurred for the two outgroups CE838 Cernosvitoviella minor and CE699 Grania ovitheca.

3. Results

3.1 DNA sequencing

Sequences were successfully obtained for the majority of the seven genes from all putative species (Table S1). More than 300 sequences were obtained for COI, 80 for ITS, 60 for H3 and about 40 sequences were from each of the remaining four molecular markers. There were some problems with sequencing H3 for L. verrucosus and L. buelowi, where results from the reverse primer H3R were obtained from both, whereas the forward primer H3F produced viable sequences only rarely for L. verrucosus and never for L. buelowi. Furthermore, L. tuba got sequences for H3 but they were not possible to align with the remaining H3 sequences and thus were excluded from the analyses.

3.2 Species delimitation

A global barcode-gap was found for the pairwise distances of COI approximately between 6.5 and 9 % of genetic distance (Figure 2A). ITS showed similar tendencies between 7 and 13 % but without any clear gap (Figure 2C), whereas H3 showed no indications of a barcode gap (Figure 2B). The initial partitions of the ABGD analyses for COI yielded 24 groups when using both p- distances and TN93-distances, presented as species hypotheses in Table 2. The results from the statistical tests, Rosenberg’s PAB and P(Randomly Distinct), in the species delimitation plug-in in Geneious are also presented in Table 2.

Figure 2. Ranked pairwise p-distances for Lumbricillus specimens, the y-axis displaying genetic distance, for A: COI, B: H3 and C: ITS.

Most of the proposed species hypotheses provided by ABGD are supported by the Rosenberg’s

PAB and P(Randomly Distinct) statistical tests (Table 2). The closely related species L. buelowi and L. knoellneri were significantly separated in both COI and ITS as was L. verrucosus, which had previously been synonymized with L. lineatus. Lumbricillus pagenstecheri was significantly separated into four different species. In H3, some species hypotheses were found paraphyletic and thus could not be statistically tested. Species hypotheses for groups with only one sequenced specimen for the gene could not be tested. In these cases P(Randomly Distinct) is unusable and

Rosenberg’s PAB requires the selected group to be very far from its closest relative to get statistical significance.

Table 2. Results from the species delimitation plug-in implemented in Geneious. Species hypotheses yielded from ABGD using genetic distances in COI listed under Species. Results from the statistical tests of the species delimitation plug-in displayed for each of the three genes. Grey shade indicates statistical significance for P(Randomly Distinct) and Rosenberg’s PAB. M stands for monophyly where a grey shade indicates monophyly of the clade in the gene tree, not applicable for species with only a single sampled individual. Single means that only a single sequenced specimen was available for that species hypothesis in that gene, making the P(Randomly Distinct) test unusable. NA means not available as H3 was completely lacking for L. tuba.

Species COI H3 ITS M P Rosenberg’s M P Rosenberg’s M P Rosenberg’s (Randomly PAB (Randomly PAB (Randomly PAB Distinct) Distinct) Distinct) arenarius buelowi dubius fennicus Single Single Single Single cf. helgolandicus kaloensis knoellneri lineatus pagenstecheri A pagenstecheri B pagenstecheri C pagenstecheri D pumilio Single Single Single Single rivalis rubidus rutilus semifuscus tuba NA NA NA verrucosus viridis sp. E sp. F Single Single Single Single sp. G Single Single sp. H Single Single Single Single

The results from the species delimitation using DISSECT are represented in a similarity matrix generated in R (Figure 3). These delimitations yielded the highest support for almost all putative species, including the singletons which had limited or no support in the statistical tests implemented in Geneious. Lumbricillus verrucosus is again found as a separate species from L. lineatus. There were three instances where DISSECT suggested less clear delimitations between the suggested species. First, L. pumilio and L. rubidus appear as the same species in less than one fourth of the estimated 10 000 trees that DISSECT is based on. Second, L. pagenstecheri C and D are found together as a single group in about 10 % of the estimated trees but are separated in the rest. Last, L. buelowi and L. knoellneri are found to be the same species in about 95 % of the estimated trees.

Figure 3. Similarity matrix generated in R using the results from the species delimitation in DISSECT. Darker color indicates similarities between the putative species while black indicates complete similarity, based on the fraction of the estimated trees that separate or merge the putative species.

3.3 Gene tree estimation

All gene trees showed high ESS-values and good convergence. As COI is highly variable it clearly grouped individuals into species and could to some extent be used to determine close relationships between species but otherwise possessed poor resolution for deeper branches in the phylogeny (Figure S1), as such it will not be included when discussing the phylogenetic results of the gene trees. All gene trees support the majority of the Lumbricillus species as one monophyletic group, here referred to as Lumbricillus sensu stricto (Figures S1-S7). This group includes all species except for: L. arenarius, L. dubius, L. sp. H and L. semifuscus. Within Lumbricillus sensu stricto most gene trees place L. buelowi and L. knoellneri as sister to the rest, except in 12S where L. buelowi and L. knoellneri are nested within one of three groups that make 15

up a basal trichotomy of Lumbricillus sensu stricto. (Figure S2), and in H3 where L. viridis and the L. pagenstecheri species complex (including L. pagenstecheri A-D) are sister to the rest (Figure S7). The support for L. buelowi and L. knoellneri as sister to the rest of Lumbricillus sensu stricto is low in all but the 16S tree (Figure S3). All gene trees further contain a group within Lumbricillus sensu stricto containing all the species without distinct ampulla in their spermathecae, namely: L. fennicus, L. kaloensis, L. lineatus, L. pumilio, L. rivalis, L. rubidus, L. rutilus, L. verrucosus, L. sp. E, L. sp. F and L. sp. G. This grouping is usually well supported, except in the 28S tree (Figure S5), and has L. cf. helgolandicus as sister to it in all but the 12S and 16S trees (Figures S2 & S3). Lumbricillus arenarius, L. dubius and L. sp. H, henceforth referred to as the L. arenarius group, are found as a more or less supported monophyletic group in all trees, except for 12S (Figure S2). However, the placement of it in the phylogeny varies: some gene trees place this group as sister to Grania (12S, 18S, 28S and ITS (Figures S2, S4- S6)), whereas others place it as sister to Lumbricillus sensu stricto (16S and H3 (Figures S3 & S7)). Furthermore, these differing topologies are mostly well supported in the respective trees. When the L. arenarius group is placed together with Grania, these together make up the sister of Lumbricillus sensu stricto, but when the L. arenarius group is placed as sister to Lumbricillus sensu stricto, Grania is not found to be the closest outgroup to the two. In the 16S tree Achaeta bibulba was found within Grania, rendering the latter paraphyletic (Figure S3). In all of the gene trees L. semifuscus is found together with the outgroups but no close relationship to either of them is apparent.

3.4 Recombination test

The phi-test did not find statistically significant evidence for recombination in any of the genes or concatenated alignments.

3.5 Concatenated phylogenetic analyses

All of the three concatenated analyses showed high ESS-values and good convergence. Similarly to the gene trees all of the concatenated trees find the Lumbricillus sensu stricto clade (see above) with maximum support (Figures 4-6, red and yellow markings). Within this group L. buelowi and L. knoellneri are always found well supported as sister to the rest. This is followed by another well supported group which is sister to the remaining Lumbricillus sensu stricto, it contains L. tuba, L. viridis and the L. pagenstecheri species complex. In all three concatenations L. viridis is found as sister to the L. pagenstecheri species complex with L. tuba sister to these. As with the gene trees, all three concatenations also find a well-supported clade within Lumbricillus sensu stricto containing all species without distinct ampulla in their spermathecae (Figures 4-6, yellow marking), and L. cf. helgolandicus seems to be the sister to this group, although not well supported in the mitochondrial concatenation (Figure 4). Within the group, lacking distinct spermathecal ampullae, the topology of the phylogeny varies between the different concatenated trees but there are some general patterns: L. fennicus, L. sp. F, L.

kaloensis, L. pumilio and L. rubidus are found as sisters to the rest but the relationships between these species vary and are not well supported, with the exception that L. pumilio and L. rubidus are always well-supported as sister taxa. As sister to all of these species but still within the group without distinct ampulla, there is a group made up of L. sp. G, as sister to the rest, followed by L. rivalis and L. verrucosus (with unclear relationship) which in two trees (Figures 4 & 6) are sister to L. lineatus, L. rutilus and L. sp. E. Lumbricillus lineatus seems to be the sister of L. rutilus with L. sp. E as sister to the two.

Concerning the placement of the L. arenarius species group (Figures 4-6, green marking, also containing L. dubius and L. sp. H) the mitochondrial concatenation supports this group as sister to Lumbricillus sensu stricto (Figure 4), whereas the nuclear ribosomal concatenation supports it as sister to Grania where the two in turn make up the sister of Lumbricillus sensu stricto (Figure 5). Interestingly, the mitochondrial concatenation does not even support Grania as the sister to the L. arenarius species group together with Lumbricillus sensu stricto. The concatenation of all genes supports the grouping of the L. arenarius species group together with Grania where these two in turn make up the sister of Lumbricillus sensu stricto (Figure 6). In all of the concatenated trees, L. semifuscus is found together with the outgroups but further phylogenetic relationships remain inconclusive and poorly supported (Figures 4-6, blue marking).

Figure 4. Concatenated tree of the 12S, 16S and COI, mitochondrial genes, estimated using Bayesian inference. Yellow marks the clade within Lumbricillus sensu stricto with spermathecae without distinct ampulla, red marks Lumbricillus sensu stricto (including the yellow group), green marks the L. arenarius species group and blue marks L. semifuscus. Support values displaying posterior probabilities. Scale shows expected number of changes per site.

Figure 5. Concatenated tree of the 18S, 28S and ITS, nuclear ribosomal genes, estimated using Bayesian inference. Yellow marks the clade within Lumbricillus sensu stricto with spermathecae without distinct ampulla, red marks Lumbricillus sensu stricto (including the yellow group), green marks the L. arenarius species group and blue marks L. semifuscus. Support values displaying posterior probabilities. Scale shows expected number of changes per site.

Figure 6. Concatenated tree of the 12S, 16S, COI, 18S, 28S, ITS and H3 genes, estimated using Bayesian inference. Yellow marks the clade within Lumbricillus sensu stricto with spermathecae without distinct ampulla, red marks Lumbricillus sensu stricto (including the yellow group), green marks the L. arenarius species group and blue marks L. semifuscus. Support values displaying posterior probabilities. Scale shows expected number of changes per site.

3.6 Species tree estimation

The species tree yielded by *BEAST showed high ESS-values and good convergence for most parameters (likelihood included) but only moderate support for the posterior and prior. In this tree, Lumbricillus sensu stricto was once again found with high support (Figure 7, red and yellow markings). As with the concatenation of all genes it seems that L. buelowi and L. knoellneri are sister to the rest followed by L. viridis together with the L. pagenstecheri species complex. These are in turn sister to a group containing L. cf. helgolandicus which is the sister to 20

the well-supported group without distinct spermathecal ampullae (Figure 7, yellow marking). The group that is lacking distinct ampulla in their spermathceae displays the same topology as the tree from the concatenation of all genes but with lower support in general. The sister relationship between L. pumilio and L. rubidus is well-supported as is the one between L. rivalis and L. verrucosus. In contrast to the tree from the concatenation of all genes, the *BEAST species tree places the L. arenarius species group (Figure 7, green marking) as sister to Lumbricillus sensu stricto and Grania as sister to these two (but with poor support). Lumbricillus semifuscus is once again found among the outgroups but any closer placement is not possible given the included outgroups (Figure 7, blue marking).

Figure 7. Species tree based on the 12S, 16S, COI, 18S, 28S, ITS and H3 genes, estimated using Bayesian inference under the multispecies coalescent model in *BEAST. Yellow marks the clade within Lumbricillus sensu stricto with spermathecae without distinct ampulla, red marks Lumbricillus sensu stricto (including the yellow group), green marks the L. arenarius species group and blue marks L. semifuscus. Support values displaying posterior probabilities. Scale shows expected number of changes per site in COI with all other genes relative to it.

3.7 Taxonomy

3.7.1 General notes

All descriptions in this study are based on fixed worms whole-mounted on slides. This means that the interpretation of the morphology can differ from descriptions based on living specimens. Welch (1914) noted that his collected specimens contracted when fixed in alcohol and reduced in size from about 15 to 19 mm, in living specimens, to about 9 to 14 mm, in fixed specimens. Finogenova & Streltsov (1978) noted that the ratio between the length and width of the sperm funnels was similarly reduced in fixed specimens. They reported sperm funnels about 2 to 4 times longer than wide in living specimens reduced to about 1.2-1.5 times longer than wide when the specimens were fixed. Furthermore, both Finogenova & Streltsov (1978) as well as Southern (1909) described the ratio between length and width of the sperm funnels as varying in the living specimens due to contractions. Southern (1909) further questioned the importance of the midventral subneural glands (previously referred to as copulatory glands) for separating species, as these glands seem to vary in size and sometimes in segmental distribution between individuals of the same species.

All specimens in this study are amputated as a number of posterior segments have been used for DNA extraction. Therefore, comparisons of total length and segment number with original descriptions have not been possible. When available, the length of the fifteen first segments as well as the width at the clitellum of the worms has been used to compare the general size of the species.

The origin of the dorsal vessel can be difficult to establish since its volume in each segment is dependent on the peristaltic movement of the blood in the living animal. Thus, depending on the state when the animal was killed and fixed the dorsal vessel may appear to originate in different segments.

All illustrations use the following abbreviations: as=anteseptale, dg=duct glands, e=egg, ed=ectal duct, eg=ectal gland, mu=musculature, nd=nephridial duct, ov=ovaries, pb=penial bulb, ps=postseptale, sa=spermathecal ampulla, sf=sperm funnel, sm=sperm mass, sp=spermathecal pore, t=testis & vd=vas deferens.

3.7.2 Lumbricillus Ørsted, 1844

Genus description: Mainly white, yellow or red worms, a few green or black. Living worms ranging from about 5 to 35 mm, fixed worms from 3 to 11 mm. Prostomium hemispherical. Head pore between prostomium and peristomium. Epidermis with transverse rows of gland cells. Chaetae usually sigmoid, sometimes straight, without nodulus. Oesophageal appendages absent. Pharyngeal glands in three pairs, located in IV-VI, usually converging dorsally, sometimes even connected dorsally, usually with ventral lobes, but always without secondary glands. Dorsal 22

vessel originating in segments posterior to clitellum. Nephridia with anteseptale made up of funnel only. Clitellum more or less covering segments XI-XIII, always XII. Testes covered by seminal vesicles, usually in large fan-shaped lobes. Penial bulb round and compact. Midventral subneural glands usually present in XIII-XV, sometimes further back. Spermathecae in V, sometimes extending further back, attached to and usually with its lumen communicating with esophagus, and with glands surrounding ectal pore, sometimes also along ectal duct. Mainly living in the littoral zone of the sea but some also found in limnic and terrestrial habitats.

The species descriptions are presented following the order of the topology of the species tree produced in *BEAST (Figure 7) with the addition of L. tuba at the position indicated by the concatenated analyses (Figure 4-6).

Lumbricillus lineatus (Müller, 1774) Figure 8

Lumbricus lineatus Müller, 1774: p. 29.

Lumbricillus lineatus partim. Nielsen & Christensen, 1959: pp. 100-102. Figs. 109-112.

Description based on 8 mature whole-mounted worms on slides, two of which appear to be of the triploid avesiculate form (Nielsen & Christensen, 1959), collected in Galicia, ES, in Rogaland, Telemark, Hordaland and Finnmark, NO, and in Bohuslän and on Öland, SE. CE1640, CE1694, CE1894, CE12043, CE21688, CE21986, CE22604 & CE22605.

External characters

Orange, red or pink worms. Length (fixed worms) more than 2.2-5.5 mm (amputated specimens), first 15 segments 2.1-2.8 mm long, width at clitellum 0.45-0.75 mm. More than 14-38 segments. Chaetae sigmoid. Lateral bundles with 3-6 chaetae anterior to clitellum, 3-7 chaetae in postclitellar segments. Ventral bundles with 4-8 chaetae anterior to clitellum, 3-7(8) chaetae posteriorly. Each worm’s longest measured chaetae 50-75 µm long, about 3-5 µm wide. Clitellum extending over XII-1/2XIII/XIII. Head pore not observed. Epidermis with transverse rows of gland cells.

Internal characters

Coelomocytes in some specimens numerous, 10-20 µm long, round, oval or spindle-shaped, granulated with distinct nucleus. Paired pharyngeal glands present in IV, V and VI, situated on both sides of esophagus; each pair converging dorsally. Dorsal vessel originating in XIII-XIV. Nephridia not observed. Brain with two narrow nerve extensions anteriorly and with posterior incision.

Male genitalia paired (Figure 8B). Testes originating in XI, extending forwards into X, sometimes IX, creating regular club-shaped lobes typical for Lumbricillus. The two avesiculate triploid forms lacking testes. Sperm funnels in XI, 215-420 µm long, 125-185 µm wide, making 23

them about 1.5-2.5 times longer than wide, funnels tapering towards vasa deferentia. Most of vasa irregularly coiled in XII, 15-20 µm wide. Penial bulbs round, 65-140 µm in diameter. Ovaries in XII. One to six mature eggs present at a time.

Figure 8. Lumbricillus lineatus. A. Spermatheca. B. Other genitalia. Abbreviations under general notes. Scale bars: 100 µm.

Spermathecae (Figure 8A) in V, without distinct ampulla. Ectal duct very short, widening into ampulla. Ampulla with constriction midway dividing two sections, ectal part narrow, ental part wider, connecting with esophagus. Sperm in lumen of ectal part of ampulla, heads of spermatozoa embedded in wall of ental part of ampulla, forming aggregates. Spermathecae 220- 275 µm long, 60-125 µm wide at widest part of ampulla. Gland cells surrounding ectal duct, forming compact mass, glandular body 80-150 µm in diameter at its widest part. Two midventral subneural glands in XIII- XIV, 60-110 µm and 60-95 µm long respectively.

Remarks

The specimens of L. lineatus in this study were smaller than the ones in the re-description by Nielsen and Christensen (1959) and the sperm funnels were shorter in relation to their length. However, the shape of the spermathecae, number of chaetae and segments conferred well with their description. Furthermore, both diploid and triploid forms of the species were observed, as has previously been noted to occur in L. lineatus (Christensen, 1961). The triploid specimens lacked testes and therefore also sperm at their sperm funnels. The life history of these two forms with different ploidy level is of particular interest. The triploid form is dependent on copulation with the triploid form. During the copulation sperm is only transferred from the diploid form to the triploid, as the latter lacks testes. However, the sperm from the diploid form only activates 24

the egg of the triploid, it does not penetrate and fertilize it. Instead, the chromosomes of the triploid form go through a number of divisions and merges to produce new triploid nuclei. As the triploid form cannot produce viable eggs without the activation by the sperm of the diploids the relationship between the two has been described as an obligatory co-existence (Christensen, 1960).

Lumbricillus rutilus Welch, 1914 Figure 1 & 9

Lumbricillus rutilus Welch, 1914: 143-151. Pl. VIII, Fig. 13. Pl. IX, Figs. 14-24.

Description based on 10 mature whole-mounted worms on slides, collected in Västergötland, Blekinge, Öland and Gotland, SE, and in Manchester, UK. CE1887, CE1903, CE2510, CE2937, CE2939, CE3060, CE3061, CE3502, CE3506 & CE9267.

External characters

Orange-reddish. Length (fixed worms) more than 2.7-7.2 mm (amputated specimens), first 15 segments 2.4-4.8 mm long, width at clitellum 0.39-0.65 mm. More than 14-30 segments. Chaetae (Figure 1C) slightly sigmoid. Lateral bundles with 3-6, rarely 2 or 7, chaetae anterior to clitellum, 2-5 chaetae in postclitellar segments. Ventral bundles with 3-9, usually 4-6, chaetae anterior to clitellum, 2-6 chaetae posteriorly. Each worm’s longest measured chaetae 70-105 µm long and about 3-5 µm wide. Clitellum generally extending over XII-1/2XIII, sometimes including all of XIII. Head pore between prostomium and peristomium. Epidermis with transverse rows of gland cells.

Internal characters

Coelomocytes in some specimens numerous, 10-25 µm long, round, oval or spindle-shaped, granulated. Paired pharyngeal glands present in IV, V and VI, situated on both sides of esophagus; each pair converging dorsally. Third pair large, occupying most of VI, sometimes extending into VII. Dorsal vessel originating in XIV. Nephridia (Figure 1D) observed in XV- XXI, about 120-170 µm long. Anteseptale small, consisting of funnel only. Postseptale oval, tapering posteriorly into efferent duct. Brain (Figure 1B) with two narrow nerve extensions anteriorly, slightly widening posteriorly, with posterior incision.

Male genitalia paired (Figure 9B). Testes originating in XI, extending forwards into X, sometimes IX, creating regular club-shaped lobes typical for Lumbricillus. Sperm funnels in XI, 295-395 µm long, 145-225 µm wide making them about 1.5-2.5 times longer than wide, funnels tapering towards vasa deferentia. Most of vasa irregularly coiled in XII, 20-30 µm wide. Penial bulbs round, 110-175 µm in diameter. Ovaries in XII. Two to six mature eggs present at a time.

Figure 9. Lumbricillus rutilus. A. Spermatheca. B. Other genitalia. Abbreviations under general notes. Scale bars: 100 µm.

Spermathecae in (Figure 9A) V, without distinct ampulla. Ectal duct short, with musculature radiating from it, widening into ampulla. Ampulla, after widest part, making sharp bend inwards and entally connecting with esophagus. Sperm evenly embedded in tissue of ectal duct and ampulla, and possibly covered by thin layer of secretion. Spermathecae 215-335 µm long, 70- 115 µm wide at widest part of ampulla. Crown of gland cells surrounding ectal duct, lobed, whole glandular body 110-225 µm in diameter at its widest part. Up to four midventral subneural glands in XIII-XVI, 80-325 µm, 55-200 µm, 60-100 µm and 50 µm long respectively; glands in XIII, XV and XVI not observed in all specimens.

Remarks

Our newly sampled material matches the description of Lumbricillus rutilus well in all characters except the sperm funnel ratio where our specimens had slightly shorter funnels in relation to their width. The material in this study was collected in Sweden and the United Kingdom whereas this species was originally described from a sewage treatment plant in Chicago in the USA. Interestingly, some of our sampled specimens also come from two such plants, one in Sweden and the other in the UK. This species was also collected in littoral and freshwater environments in Sweden, and it is possible that it is an opportunist that thrives in nutrient rich habitats. Another interesting note concerning the specimens found in the treatment plants was their increased size and reduced number of chaetae, compared to the specimens sampled in the sea, possibly a side effect of living in such rich environments.

Lumbricillus sp. E Figure 10

Description based on 4 mature whole-mounted worms on slides, collected in Rogaland, NO, and Skåne, SE. CE1976, CE1979, CE12041 & CE12042.

External characters

Length (fixed worms) more than 2.5-7.8 mm (amputated specimens), first 15 segments 2.5-4.7 mm long, width at clitellum 0.42-0.85 mm. More than 15-27 segments. Chaetae slightly sigmoid. Lateral bundles with (3)4-8(9) chaetae anterior to clitellum, 3-7 chaetae in postclitellar segments. Ventral bundles with 5-10 chaetae anterior to clitellum, 4-9 chaetae posteriorly. Each worm’s longest measured chaetae 60-75 µm long, about 4-5 µm wide. Clitellum extending over XII-XIII. Head pore not observed. Epidermis with transverse rows of gland cells.

Internal characters

Coelomocytes numerous, 20-25 µm long, round, oval or spindle-shaped, granulated. Paired pharyngeal glands present in IV, V and VI, situated on both sides of esophagus; each pair converging dorsally. Dorsal vessel originating in XIII. Nephridia not observed. Brain with two narrow nerve extensions anteriorly and with posterior incision.

Male genitalia paired (Figure 10B). Testes originating in XI, extending forwards into IX, creating regular club-shaped lobes typical for Lumbricillus. Sperm funnels in XI, sometimes extending into X or XII, 360-1300 µm long, 155-235 µm wide, making them about 2-5.5 times longer than wide, funnels tapering towards vasa deferentia. Most of vasa irregularly coiled in XII, 15-30 µm wide. Penial bulbs round, 155-285 µm in diameter. Ovaries in XII. One to ten mature eggs present at a time.

Spermathecae (Figure 10A) in V, without distinct ampulla. Ectal duct opening as a wide pore, indistinguishable from ampulla. Ampulla, with possible constriction midway dividing it into two sections, the inner one of which connecting with esophagus. Sperm following middle of ectal duct, heads of spermatozoa embedded and forming aggregates in inner part of ampulla. Spermathecae 220-410 µm long, 65-160 µm wide at widest part of ampulla. Gland cells surrounding ectal duct, forming compact mass, glandular body 140-325 µm in diameter at its widest part. Up to three midventral subneural glands in XIII- XV, 80-200 µm, 100-250 µm and 115 µm long respectively; glands in XIV and XV not observed in all specimens.

Figure 10. Lumbricillus sp. E. A. Spermatheca. B. Other genitalia. Abbreviations under general notes. Scale bars: 100 µm.

Remarks

The measured lengths of the sperm funnels are probably underestimated due to the difficulty of tracing them through the worms. In general, when the funnels are much longer than wide, they have to fold to fit inside the worm, which makes the length estimation difficult for mounted specimens. In the case of this species, the two Swedish specimens were somewhat smaller than the Norwegian specimens, their funnels are folded and only measurable for about 360 µm. The true length was probably greater than this and the length/width ratio for the sperm funnels closer to 4-6 times longer than wide, as noted for the Norwegian specimens.

The shape of the spermathecae is the most significant character for these specimens with no close resemblance to any other described species. There is at least a superficial similarity to the spermathecae of Lumbricillus lineatus with a midway constriction or bend and sperm aggregated in the ental part of the ampulla. However, unlike L. lineatus, the spermatheca of this possibly new species does not gradually widen from the ectal pore but instead originates from a very wide pore followed by an ectal duct and ampulla of even width throughout.

Lumbricillus verrucosus (Claparède 1861) Figure 11

Pachydrilus verrucosus Claparède, 1861: pp. 82-85. Pl. I. Fig. 1-6.

Lumbricillus lineatus partim Nielsen & Christensen, 1959: pp. 100-102. Figs. 109-112.

Description based on 8 mature whole-mounted worms on slides, collected in Vestfold and Vest- Agder , NO, and Västergötland, SE. CE968, CE21479, CE21486, CE21490, CE21494, CE21811, CE21816 & CE21821.

External characters

White to yellow worms. Length (fixed worms) more than 2.3-5.7 mm (amputated specimens), first 15 segments 2.3-3.4 mm long, width at clitellum 0.42-0.60 mm. More than 18-33 segments. Chaetae slightly sigmoid. Lateral bundles with (2)3-5(6) chaetae anterior to clitellum, 2-4 chaetae in postclitellar segments. Ventral bundles with (2)3-6(7) chaetae anterior to clitellum, (2)3-4(5) chaetae posteriorly. Each worm’s longest measured chaetae 45-60 µm long, about 2.5 µm wide. Clitellum extending over XII-XIII. Head pore between prostomium and peristomium. Epidermis with transverse rows of gland cells.

Internal characters

Coelomocytes in some specimens numerous, 10-25 µm long, round, oval or spindle-shaped, granulated. Paired pharyngeal glands present in IV, V and VI, situated on both sides of esophagus; each pair converging dorsally. Dorsal vessel originating in XIII. Nephridia in XIV- XXV, 3-10 observed per specimen, 75-120 µm long. Anteseptale small, consisting of funnel only. Postseptale oval, tapering posteriorly into efferent duct. Brain twice as long as wide, with two narrow nerve extensions anteriorly and with posterior incision.

Male genitalia paired (Figure 11B). Testes originating in XI, extending forwards into X, sometimes IX, creating regular club-shaped lobes typical for Lumbricillus. Sperm funnels in XI, 230-370 µm long, 125-175 µm wide, making them about 1.5-2.5 times longer than wide, funnels tapering towards vasa deferentia. Most of vasa irregularly coiled in XII, 15-20 µm wide. Penial bulbs round, 105-140 µm in diameter. Ovaries in XII. One to five mature eggs present at a time.

Figure 11. Lumbricillus verrucosus. A. Spermatheca. B. Other genitalia. Abbreviations under general notes. Scale bars: 100 µm.

Spermathecae (Figure 11A) in V, without distinct ampulla. Ectal duct short, widening into ampulla. Ampulla with constriction midway to two thirds of the length, dividing it into two sections, the inner one of which connecting with esophagus. Sperm following middle of ectal duct, heads of spermatozoa embedded in inner part of ampulla, sometimes also in outer part, forming aggregates. Spermathecae 180-300 µm long, 65-110 µm wide at widest part of ampulla. Gland cells surrounding ectal duct, forming compact mass, whole glandular body 95-180 µm in diameter at its widest part. Up to two midventral subneural glands in XIII- XIV, 90-125 µm and 95-125 µm long respectively; glands in XIV not observed in all specimens.

Remarks

Lumbricillus verrucosus was originally described by Claparède (1861) and later synonymized with Lumbricillus lineatus by Nielsen & Christensen (1959) without any explanation. After having examined specimens from the two species in this study we have found that they are indeed very similar when considering the shape of the spermathecae and most other measurements. L. verrucosus was described as being pale yellow, having 3-5 chaetae and a sperm funnel about three times longer than wide whereas L. lineatus is orange-red, have more chaetae and a sperm funnel five times longer than wide. Similarly, our specimens of L. verrucosus were white or yellow and have fewer chaetae and lower sperm funnel ratio in general but there is an overlap in most characters. Furthermore, the spermathecae of L. verrucosus seem to have an ampulla that is slightly longer and larger in the part ectal to the constriction, but the importance of this character remains to be proved. It seems possible that these two species are very difficult to separate morphologically, except by body color, but they are supported as separate species molecularly and avesiculate triploid forms have not been found in L. verrucosus.

Lumbricillus rivalis (Levinsen, 1883) Figure 12

Pachydrilus rivalis Levinsen, 1883: p. 231; Ditlevsen 1904: pp. 430-431.

Lumbricillus rivalis Nielsen & Christensen, 1959: pp. 97-98. Figs. 107-108.

Pachydrilus subterraneus Vejdovsky, 1889: pp. 1-3.

Pachydrilus germanicus Michaelsen, 1886: p. 43.

Lumbricillus evansi Southern, 1909: pp. 151-152. Pl. X. Figs. 10A-F.

Description based on 6 mature whole-mounted worms on slides, collected in Finnmark, NO, and Blekinge, Västergötland, SE. CE1873, CE1874, CE2503, CE22596, CE22600 & CE22602.

External characters

Orange-red worms. Length (fixed worms) more than 3.4-7.6 mm (amputated specimens), first 15 segments 2.6-3.8 mm long, width at clitellum 0.60-0.85 mm. More than 17-44 segments. Chaetae slightly sigmoid. Lateral bundles with 4-8(9) chaetae anterior to clitellum, (3)4-7(8) chaetae in postclitellar segments. Ventral bundles with (4)5-10(11) chaetae anterior to clitellum, (4)5-8(9) chaetae posteriorly. Each worm’s longest measured chaetae 85-105 µm long, about 5 µm wide. Clitellum extending over XII-XIII. Head pore between prostomium and peristomium. Epidermis with transverse rows of gland cells.

Internal characters

Coelomocytes numerous, 15-20 µm long, spindle-shaped, oval, granulated. Paired pharyngeal glands present in IV, V and VI, situated on both sides of esophagus; each pair converging dorsally. Dorsal vessel originating in XIV. Nephridia not observed. Brain with two narrow nerve extensions anteriorly and with posterior incision. About as long as wide.

Male genitalia paired (Figure 12B). Testes originating in XI, extending forwards into X, sometimes IX, creating regular club-shaped lobes typical for Lumbricillus. Sperm funnels in XI, 325-685 µm long, 110-295 µm wide, making them about 1.5-4.5 times longer than wide, funnels tapering towards vasa deferentia. Most of vasa irregularly coiled in XII, 25 µm wide. Penial bulbs round, 105-190 µm in diameter. Ovaries in XII. Two mature eggs present in one specimen.

Figure 12. Lumbricillus rivalis. A. Spermatheca. B. Other genitalia. Abbreviations under general notes. Scale bars: 100 µm.

Spermathecae (Figure 12A) in V, without distinct ampulla. Ectal duct short, gradually widening into ampulla. Ampulla with constriction two thirds of the length, dividing two sections, entally connecting with esophagus. Sperm evenly embedded in ampulla. Spermathecae 250-360 µm long, 85-140 µm wide at widest part of ampulla. Gland cells surrounding ectal duct, lobed, whole glandular body 140-240 µm in diameter at its widest part. Up to three midventral subneural glands in XIII- XV, 90-130 µm, 80-145 µm and 80-90 µm long respectively; glands in XV not observed in all specimens.

Remarks

Lumbricillus rivalis was first briefly described by Levinsen (1883), later augmented by Ditlevsen (1904) and further described by Nielsen & Christensen (1959). My sampled specimens confer well with the more detailed re-descriptions, particularly in the number of chaetae and the shape of the spermathecae. The only differences concerned the size of the specimens, where mine were much smaller than those reported before, and the length/width ratio of the sperm funnels where Nielsen & Christensen described them as being as much as 10 times longer than wide, compared to my observed 4.5 times. These differences could be explained by my examination of fixed instead of live material.

Lumbricillus sp. G Figure 13

Description based on one mature and two immature whole-mounted worms on slides, collected in Troms, NO, and Anglesey and Plymouth, UK. CE2246, CE2661 & CE23373.

External characters

Length (fixed worms) more than 3.3-4.1 mm (amputated specimens), first 15 segments 2-2.8 mm long, width at clitellum 0.42-0.49 mm. More than 17-33 segments. Chaetae slightly sigmoid. Lateral bundles with 2 -5 chaetae anterior to clitellum, 3-6 chaetae in postclitellar segments. Ventral bundles with 3-6 chaetae anterior to clitellum, 3-4 chaetae posteriorly. Each worm’s longest measured chaetae 55-60 µm long, about 5 µm wide. Clitellum extending over XII- 1/2XIII. Head pore between prostomium and peristomium. Epidermis with transverse rows of gland cells.

Internal characters

Coelomocytes numerous, 15-30 µm long, round, oval or spindle-shaped, granulated with distinct nucleus. Paired pharyngeal glands present in IV, V and VI, situated on both sides of esophagus. Dorsal vessel originating in XIII-XV. Nephridia not observed. Brain elongate, further shape unknown.

Male genitalia paired (Figure 13B). Testes originating in XI, extending forwards into IX, creating regular club-shaped lobes typical for Lumbricillus. Sperm funnels in XI, extending backwards into XII, 335-430 µm long, 180 µm wide, making them about 1.9-2.4 times longer than wide, funnels tapering towards vasa deferentia. Most of vasa irregularly coiled in XII, 15µm wide. Penial bulbs pear-shaped, 110 µm in diameter. Ovaries in XII. One mature egg present.

Figure 13. Lumbricillus sp. G. A. Spermatheca. B. Other genitalia. Abbreviations under general notes. Scale bars: 100 µm.

Spermathecae (Figure 13A) in V, without distinct ampulla. Ectal duct short, widening into ampulla. Ampulla with constriction midway, dividing it into two sections, the inner of which connecting with esophagus. No sperm observed. Spermathecae 210 µm long, 80 µm wide at widest part of ampulla. Gland cells surrounding ectal duct, forming compact mass, 105 µm in

diameter at its widest part. Two midventral subneural glands in XIII- XIV, 70 µm and 90 µm long respectively.

Remarks

Unfortunately only one mature specimen was available for this study making it difficult to find a matching description. Furthermore, basing a description of a new species on such limited material is not recommended.

Lumbricillus kaloensis Nielsen & Christensen 1959 Figure 14

Lumbricillus kaloensis Nielsen & Christensen, 1959: p. 100. Figs. 113-114.

Description based on one mature and one immature whole-mounted worm on slides, collected in Bergen, NO, and Västergötland, SE. CE978 & CE5412.

External characters

Orange or transparent worms. Length (fixed worms) more than 2.8-3.6 mm (amputated specimens), first 15 segments 2.5-3.1 mm long, width at clitellum 0.32-0.37 mm. More than 18 segments. Chaetae slightly sigmoid. Lateral bundles with 3-5 chaetae anterior to clitellum, 2-3 chaetae in postclitellar segments. Ventral bundles with 3-6 chaetae anterior to clitellum, 2-5 chaetae posteriorly. Each worm’s longest measured chaetae 50-60 µm long, about 3 µm wide. Clitellum extending over XII-1/2XIII. Head pore between prostomium and peristomium. Epidermis with transverse rows of gland cells.

Internal characters

Coelomocytes numerous, 15µm long, round, oval, granulated. Paired pharyngeal glands present in IV, V and VI, situated on both sides of esophagus; each pair converging dorsally. Dorsal vessel originating in XIII. Nephridia possibly in XIII-XIV. Brain with two narrow nerve extensions anteriorly and with posterior incision.

Male genitalia paired (Figure 14B). Testes originating in XI, extending forwards into IX, in one specimen also extending backwards into XII, creating regular club-shaped lobes typical for Lumbricillus. Sperm funnels in XI, 185 µm long, 155 µm wide, making them slightly longer than wide, funnels tapering towards vasa deferentia. Most of vasa irregularly coiled in XII, 15 µm wide. Penial bulbs round, 80 µm in diameter. Ovaries in XII. No mature eggs observed.

Figure 14. Lumbricillus kaloensis. A. Spermatheca. B. Other genitalia. Abbreviations under general notes. Scale bars: 100 µm.

Spermathecae (Figure 14A) in V, without distinct ampulla, gradually widening, entally connecting with esophagus. Sperm evenly embedded in ampulla. Spermathecae 290 µm long, 65 µm wide at widest part of ampulla. Gland cells surrounding ectal duct divided into at least three flaps, one flap significantly larger than the other, whole glandular body 120 µm in diameter at its widest part. Two midventral subneural glands in XIII- XIV, 95 µm and 75 µm long respectively.

Remarks

The specimens examined in this study match the original description by Nielsen & Christensen in the majority of the characters. The spermathecae, despite being slightly damaged, exhibited the large asymmetrical ectal gland subdivided into flaps, one of which is clearly larger than the others, which is consistent with the distinguishing character from the original description. The examined worms in this study were smaller than the ones described by Nielsen & Christensen, with slightly fewer chaetae and sperm funnels shorter in relation to their width.

Lumbricillus sp. F Figure 15

Description based on one mature whole-mounted worm on slide, collected in Plymouth, UK. CE2659.

External characters

Length (fixed worm) more than 3.1 mm (amputated specimen), first 15 segments 2.2 mm long, width at clitellum 0.35 mm. More than 21 segments. Chaetae slightly sigmoid. Lateral bundles with 3-5 chaetae anterior to clitellum, 3-4 chaetae in postclitellar segments. Ventral bundles with 3-5 chaetae anterior to clitellum, 2-4 chaetae posteriorly. The worm’s longest measured chaetae 45µm long, about 3 µm wide. Clitellum extending over XII-1/2XIII. Head pore between prostomium and peristomium. Epidermis with transverse rows of gland cells.

Internal characters

Coelomocytes numerous, 15 µm long, round, oval or spindle-shaped, granulated with distinct nucleus. Paired pharyngeal glands present in IV, V and VI, situated on both sides of esophagus. Dorsal vessel originating in XIV. Nephridia not observed. Brain elongate, possibly with posterior incision.

Male genitalia paired (Figure 15B). Testes originating in XI, extending forwards into X, creating regular club-shaped lobes typical for Lumbricillus. Sperm funnels in XI, 175 µm long, 90 µm wide, making them about twice as long as wide. Vasa deferentia not observed. Penial bulbs round, 85 µm in diameter. Ovaries in XII. About two or three mature eggs present.

Figure 15. Lumbricillus sp. F. A. Spermatheca. B. Other genitalia. Abbreviations under general notes. Scale bars: 100 µm.

Spermathecae (Figure 15A) in V, without distinct ampulla. Ectal duct short, widening into ampulla. Ampulla with constriction midway, dividing it into two sections, the inner of which connecting with esophagus. Sperm concentrated in inner part of ampulla, embedded in wall of ampulla. Spermathecae 210 µm long, 80 µm wide at widest part of ampulla. Gland cells surrounding ectal duct, forming compact mass, 110 µm in diameter at its widest part. Possibly one subneural gland in XIV, 50 µm long.

Remarks

Lumbricillus pumilio Stephenson, 1932 Figure 16

Lumbricillus pumilio Stephenson, 1932: pp. 902-904, figs. 1-3; Nielsen & Christensen, 1959: p. 96; Tynen & Nurminen, 1969: pp. 151-153

Lumbricillus pumillio (sic); Erséus, 1976: p. 9

Lumbricillus cf. pumilio; Timm, 2012: p. 164

Description based on 7 mature whole-mounted worms on slides, collected in Wales, UK. CE3346, CE3347, CE3427, CE3428, CE3430, CE3436 & CE3437.

External characters

Short and stout worms. Color of living worms unknown. Length (fixed worms) more than 1.7- 3.2 mm (amputated specimens), first 15 segments 1.3-2.3 mm long, width at clitellum 0.24-0.38 mm. More than 15-23 segments. Chaetae slightly sigmoid. Lateral bundles with 3-6 chaetae anterior to clitellum, 3-5 chaetae in postclitellar segments. Ventral bundles with 3-6, rarely 2 or 7, chaetae anterior to clitellum, 3-6 chaetae, rarely 2, posteriorly. Each worm’s longest measured chaetae 36-48 µm long and about 2.5 µm wide. Clitellum extending over XII-1/2XIII. Head pore not observed. Epidermis with transverse rows of gland cells.

Internal characters

Coelomocytes difficult to identify as such in this species, but small round, oval or spindle-shaped granulated cells about 5-7 µm long were noted in the coelomic cavity. Paired pharyngeal glands present in IV, V and VI, situated on both sides of the esophagus; each pair converging dorsally. Dorsal vessel originating in XII or XIII. Nephridia indistinguishable in most specimens; they appear to be absent in most segments. In one specimen a nephridium, about 43 µm long, was observed in segment IX, but further details unclear. Brain longer than wide, with two narrow nerve extensions anteriorly and a posterior incision creating two hornlike structures.

Male genitalia paired (Figure 16B). Testes originating in XI, extending forwards into X, creating regular club-shaped lobes typical for Lumbricillus. Sperm funnels in XI, 115-190 µm long, 65- 140 µm wide making them about 1.5-2 times longer than wide, funnels tapering towards vasa deferentia. Most of vasa deferentia irregularly coiled in XII together with ovaries, vasa 5-10 µm wide. Penial bulbs round, 55-80 µm in diameter. One or two mature eggs present at a time.

Figure 16. Lumbricillus pumilio. A. Spermatheca. B. Other genitalia. Abbreviations under general notes. Scale bars: 100 µm.

Spermathecae (Figure 16A) without distinct ampulla, occupying most of segment V, ectal duct short, lumen of ampulla usually filled with sperm, ental duct connected to esophagus. Ampulla usually making a sharp bend inwards towards esophagus at about half its length. Spermathecae 100-150 µm long, 30-50 µm wide at widest part of ampulla. Ectal duct surrounded by compact, roundish mass of gland cells; whole glandular body 45-110 µm in diameter at its widest part. One midventral subneural gland in XIV, 60-90 µm long.

Remarks

My measurements of the coelomic corpuscles (5-7 µm long) contradict the original description where they are described as being 20-28 µm. This could either be due to a high degree of variation in this trait or we are comparing non-homologous cell types.

The smaller subneural gland in XV described by Stephenson could not be distinguished, either because of its small size or because it was absent.

Despite a few discrepancies from the original description the small body size of the worms together with the shape of the spermathecae and other reproductive organs supports that the sampled specimens belong to L. pumilio.

Lumbricillus rubidus Finogenova & Streltsov, 1978 Figure 17

Lumbricillus rubidus Finogenova & Streltsov, 1978: pp. 17-23. Fig. 1.

Description based on 7 mature whole-mounted worms on slides, collected in Västergötland and Bohuslän, SE. CE2549, CE2551, CE2553, CE6105, CE6106, CE6107 & CE6108.

External characters

Pale to pinkish worms. Length (fixed worms) more than 2.2-3.9 mm (amputated specimens), first 15 segments 2.0-3.1 mm long, width at clitellum 0.31-0.68 mm. More than 17-23 segments. Chaetae slightly sigmoid. Lateral bundles with 3-7 chaetae anterior to clitellum, 3-6 chaetae in postclitellar segments. Ventral bundles with 3-8 chaetae anterior to clitellum, 3-8 chaetae posteriorly. Each worm’s longest measured chaetae 45-50 µm long and 3-5 µm wide. Clitellum extending over XII-1/2XIII. Head pore not observed. Epidermis with transverse rows of gland cells.

Internal characters

Coelomocytes numerous, 10-20 µm long, round, oval or spindle-shaped. Paired pharyngeal glands present in IV, V and VI, situated on both sides of esophagus; each pair converging dorsally. Dorsal vessel originating in XIII. One nephridium observed in X, pear-shaped, about 80 µm long, narrowing posteriorly. Anteseptale small, consisting of funnel only. Duct originating at mid length. Brain widening posteriorly, but exact shape uncertain.

Male genitalia paired (Figure 17C). Testes originating in XI, extending forwards into X, sometimes IX, creating regular club-shaped lobes typical for Lumbricillus. Sperm funnels in XI, 135-265 µm long, 85-170 µm wide making them about 1.5-2 times longer than wide, funnels tapering towards vasa deferentia. Most of vasa irregularly coiled in XII, and 10-20 µm wide. Penial bulbs round, 70-130 µm in diameter. Ovaries in XII. One to five mature eggs present at a time.

Figure 17. Lumbricillus rubidus. A & B. Spermathecae. C. Other genitalia. Abbreviations under general notes. Scale bars: 100 µm.

Spermathecae (Figure 17A&B) in V, without distinct ampulla. Ectal duct short, about 1/5 of total length of spermatheca, rapidly widening into ampulla. Conspicuous ring of muscle cells encircling duct and connecting it to epidermis. Ampulla making sharp bend inwards and entally connecting with esophagus. Sperm tightly packed in ectal duct, possibly covered by thin layer of secretion, spermatozoan tails occupying outer part of ampulla, heads aggregating into distinct clusters in inner part, and partly embedded in wall, of ampulla. Spermathecae 120-275 µm long, 60-110 µm wide at widest part of ampulla. Gland cells surrounding ectal duct, forming compact body with few lobes, glandular body 60-135 µm in diameter at its widest part. One midventral subneural gland in XIV, 60-150 µm long.

Remarks

The sampled specimens in this study match the original description of L. rubidus by Finogenova & Streltsov (1978) in most characters such as length, number of chaetae and sperm funnel ratio. 40

It seems that our specimens in general possessed larger internal organs, such as sperm funnels, penial bulbs and spermathecae. Nevertheless, the concentration of musculature around the ectal pore of the spermathecae, originally described as a muscular bulb, was found with clear resemblance in our specimens. This ring-like structure of musculature covering the ectal duct of the spermathecae is conspicuous in all specimens. Several separate, radial, muscle bundles connect the duct to the epidermis and may have a function in widening the pore in conjunction with copulation or fertilization of eggs. In one specimen, where one spermatheca was seen from above, the layers of musculature created a circle seemingly dividing the ectal gland in two. A closer examination revealed that the musculature more probably is tightly encircling the gland cells of the ectal gland without dividing them. The muscular bulb, originally described by Finogenova & Streltsov, is probably the same inner part of the ectal gland, separated by the encircling musculature, rather than a compact mass of muscles. Similar structures of musculature encircling the ectal duct of the spermathecae has been seen in most species of Lumbricillus examined in this study but never appearing as conspicuous as in L. rubidus.

Lumbricillus fennicus Nurminen, 1964 Figure 18

Lumbricillus fennicus Nurminen, 1964: pp. 48-51, fig. 2; Graefe & Schmelz, 1999: p. 61

Description based on 4 mature whole-mounted worms on slides, collected in Bohuslän and in Öland, SE. CE2767, CE2768, CE2988 & CE6092.

External characters

Length (fixed worms) more than 1.8-3.5 mm (amputated specimens), first 15 segments 2.0-2.3 mm long, width at clitellum 0.4-0.48 mm. More than 12-23 segments. Chaetae slightly sigmoid. Lateral bundles with 3-5, rarely 2 or 7, chaetae anterior to clitellum, 2-5 chaetae in postclitellar segments. Ventral bundles with 3-7, usually 4-5, chaetae anterior to clitellum, 4-5 chaetae posteriorly. Each worm’s longest measured chaetae 35-50 µm long and about 2.5 µm wide. Clitellum extending over XII-1/2XIII, with granulated and hyaline cells irregularly distributed. Head pore not observed. Epidermis with transverse rows of gland cells.

Internal characters

Coelomocytes numerous, 15-25 µm long, round, oval or spindle-shaped. Paired pharyngeal glands present in IV, V and VI, situated on both sides of esophagus; each pair converging dorsally. Dorsal vessel originating in XIII. Nephridia observed in XIII-XVI about 45 µm long, anteseptale consisting of funnel only, duct originating at mid length of postseptale. Brain with two narrow nerve extensions anteriorly, widening posteriorly, with posterior incision creating two hornlike structures.

Male genitalia paired (Figure 18B). Testes originating in XI, extending forwards into X, sometimes IX, creating regular club-shaped lobes typical for most Lumbricillus. Sperm funnels 41

in XI, 100-125 µm long, 95-110 µm wide making them about 1-1.5 times longer than wide. Funnels lobed rather than cylindrical, and abruptly tapering towards vasa deferentia. Vasa with few irregular coils around ovaries in XII, and about 10 µm wide. Penial bulbs round/pear-shaped 45-50 µm in diameter. Three to four mature eggs present at a time.

Figure 18. Lumbricillus fennicus. A. Spermatheca. B. Other genitalia. Abbreviations under general notes. Scale bars: 100 µm.

Spermathecae (Figure 18A) in V, without distinct ampulla. Ectal duct short, encircled by circular musculature, and rapidly widening into ampulla. Ampulla after maximum width making sharp bend inwards, entally connecting with esophagus. Sperm evenly embedded in wall of ampulla, present but not embedded in ental duct. Spermathecae 170-195 µm long, 45-65 µm wide at widest part of ampulla. Gland cells surrounding ectal duct, forming compact mass, somewhat lobed, whole glandular body 60-75 µm in diameter at its widest part. Midventral subneural glands in XIII, XIV and in one specimen in XV, measuring 45-70 µm, 75-90 µm and 70 µm respectively.

Remarks

The original description for L. fennicus matches the specimens of this study in most characters but there are a few differences. The new, fixed specimens measured 2-3.5 mm in length, but considering that some had been cut directly posterior to the clitellum the total length of the worms probably was between 3-5 mm. This is still considerably smaller than the 8 mm reported by Nurminen (1964), who based his description on living worms. Nurminen further described the clitellum as covering ½ XI-XII while in the specimens of this study, the clitellum extends over XII-1/2XIII. The extension of the clitellum may vary as it develops but the shift in position may be a matter of interpretation, perhaps related to the impressions given by live versus fixed material.

The lobed, as opposed to cylindrical, sperm funnels are so far (in European species) only reported for L. fennicus, and this, together with the matching shape of the spermathecae, allowed confident designation of the specimens to this species despite some incongruence among the characters mentioned above. The interpretation of the lobes of the sperm funnels probably also differs between examining living and fixed specimens. Our Swedish specimens were collected in freshwater habitats, but the sites are possibly subjected to brackish water at times, which probably corresponds to the range of salinity for the original records from the Gulf of Finland.

Lumbricillus cf. helgolandicus sensu Nielsen & Christensen, 1959 (not Michaelsen, 1934) Figure 19

Non Pachydrilus helgolandicus Michaelsen, 1934: pp. 135-141, fig. 1

Lumbricillus helgolandicus von Bülow, 1957: p. 79, plate. 25, figs. 11-12, plate. 29, figs. 5-6; Tynen & Nurminen, 1969: p. 152, fig 1(i)

Lumbricillus cf. helgolandicus Nielsen & Christensen, 1959: pp. 102-103, fig. 115

Description based on 6 mature whole-mounted worms on slides, collected in Västergötland and in Öland, SE. CE975, CE1905, CE1907, CE1915, CE2548 & CE2552.

External characters

Pale, white to pinkish or orange. Length (fixed worms) more than 2.6-3.9 mm (amputated specimens), first 15 segments 2.0-2.9 mm long, width at clitellum 0.3-0.7 mm. More than 18-24 segments. Prostomium hemispherical, sometimes triangular. Chaetae slightly sigmoid. Lateral bundles with 3-6, usually 4-5, chaetae anterior to clitellum, 2-5 chaetae in postclitellar segments. Ventral bundles with 4-7 chaetae anterior to clitellum, 3-6 chaetae posteriorly. Each worm’s longest measured chaetae 50-60 µm long and about 2.5 µm wide. Clitellum extending over XII- 1/2XIII, with granulated and hyaline cells irregularly distributed. Head pore not observed. Epidermis with transverse rows of gland cells.

Internal characters

Coelomocytes numerous, 15-20 µm long, round or oval. Paired pharyngeal glands present in IV, V and VI, situated on both sides of esophagus; each pair converging dorsally, with large ventral lobes. Posteriormost pair sometimes extending into VII. Dorsal vessel originating in either XII or XIII, difficult to distinguish due to presence of mature eggs. One nephridium observed in XIV about 85 µm long, anteseptale consisting of funnel only, duct originating posterioventrally. Brain with two narrow nerve extensions anteriorly, widening posteriorly, possibly with posterior incision.

Male genitalia paired (Figure 19B). Testes originating in XI, extending forwards into X, sometimes IX, creating regular club-shaped lobes typical for Lumbricillus. Sperm funnels in XI, 43

95-205 µm long, 90-160 µm wide making them about 1-1.5 times longer than wide. Funnels cylindrical, abruptly tapering towards vasa deferentia. Vasa with few irregular coils around ovaries in XII, and about 7-10 µm wide. Penial bulbs round/pear-shaped 75-145 µm in diameter. Two to six mature eggs present at a time.

Figure 19. Lumbricillus cf. helgolandicus. A. Spermatheca. B. Other genitalia. Abbreviations under general notes. Scale bars: 100 µm.

Spermathecae (Figure 19A) in V, with ampulla distinctly set apart from ectal duct. Ectal duct wall with long cylindrical cells. Ampulla sub-spherical, thin-walled, entally communicating with esophagus. Sperm following duct to ampulla, in ampulla aggregated into central mass haloed by circle of spermatozoa. Spermathecae 90-160 µm long, 65-115 µm wide at widest part of ampulla. Gland cells surrounding ectal duct, forming compact mass, 100-155 µm in diameter at its widest part. Up to three midventral subneural glands in XIII- XV, 85-90 µm, 90-140 µm and 70-100 µm long respectively; glands in XIII and XIV not observed in all specimens.

Remarks

The new material in this study corresponds well to the description of Lumbricillus cf. helgolandicus by Nielsen & Christensen, 1959. However, they noted several differences in the morphology of their specimens in comparison to the original description by Michaelsen, 1934, the most important being the morphology of the spermathecae and the sperm funnels. The spermathecal ampulla was interpreted by Michaelsen as being filled with an irregular mass of spermatozoa. Von Bülow (1957) redrew the spermathecae as having a distinct circle of spermatozoa which also corresponds to the interpretation by Nielsen & Christensen as well as the specimens in this study.

Michaelsen originally described the sperm funnels as 12 times longer than wide. Nielsen & Christensen, on the other hand, found the funnels to be only 2-3 times longer than wide, which corresponds better to the ratio measured in our material. Von Bülow, 1957, did not comment on the length-width ratio of the funnels. Coates (1981), found it particularly strange that Michaelsen, in his original description, suggested synonymy between his species and L. pagenstecheri sensu Stephensen (non Ratzel), 1922, even though the latter is described as having funnels only 3-5 times longer than wide.

Michaelsen based his description on more than 30 year old material preserved in alcohol but it is not likely that this could explain the long funnels. Specimens from Helgoland would need to be examined, but I regard my new specimens as conspecific to Lumbricillus helgolandicus sensu Nielsen & Christensen. There is of course a possibility that their description treats another species than that seen by Michaelsen, but I would treat his description as uncertain until type material, or new material from the type locality, becomes available.

Lumbricillus pagenstecheri (Ratzel, 1869) Cryptic species A. Figure 20

Enchytraeus pagenstecheri Ratzel, 1869: pp. 587-588. Pl. XLII. Figs. 2, 13, 20b, 21.

Pachydrilus pagenstecheri Vejdovsky, 1877: p. 298; Ditlevsen, 1904: pp. 433-434. Fig. 29. Pl. XVIII, Fig. 6; Knöllner, 1935: p. 436; Cernosvitov, 1937: p. 292.

Lumbricillus pagenstecheri Ude, 1901: p. 9. Table I, Fig. 14; Southern, 1909: p. 153; Stephenson, 1925: pp. 1315-1316; Von Bülow, 1957: pp. 77-78. Table XXV, Figs. 1-7; Nielsen & Christensen, 1959: pp. 104-105. Figs. 117-120; Erséus, 1976: pp. 9-11. Fig. 8.

Lumbricillus henkingi Ude, 1901: pp. 9-10. Table II, Figs. 15-18; Stephenson, 1925: p. 1315.

Lumbricillus ritteri Eisen, 1904: pp. 84-86. Figs. 53-54. Pl. XIII, Figs. 5-9; Nielsen & Christensen, 1959: p. 97; Erséus, 1976: pp. 9-10. Fig. 12.

Lumbricillus aegialites Stephenson, 1922: pp. 1126-1130. Figs. 2-3; Stephenson, 1924: p. 211; Stephenson 1925: p. 1314.

Lumbricillus necrophagus Stephenson, 1922: pp. 1130-1133. Figs. 4-5.

Lumbricillus georgiensis Tynen, 1969: pp. 390-391. Figs. 1-3.

Description based on seven mature whole-mounted worms on slides, collected in Akershus, NO, and in Västergötland and in Öland, SE. CE1896, CE1897, CE1899, CE2497, CE2498, CE2500 & CE20527.

External characters

White to yellow worms. Length (fixed worms) more than 2.8-9.3 mm (amputated specimens), first 15 segments 2.4-4.2 mm long, width at clitellum 0.59-0.75 mm. More than 17-40 segments. Chaetae sigmoid. Lateral bundles with 2-5 chaetae anterior to clitellum, 2-5(6) chaetae in 45

postclitellar segments. Ventral bundles with (2)4-7 chaetae anterior to clitellum, (2)3-6(8) chaetae posteriorly. Each worm’s longest measured chaetae 70-95 µm long, about 5-8 µm wide. Clitellum extending over XII-XIII. Head pore between prostomium and peristomium. Epidermis with transverse rows of gland cells.

Internal characters

Coelomocytes numerous, 15-25 µm long, spindle-shaped, oval, round, granulated with distinct nucleus. Paired pharyngeal glands present in IV, V and VI, situated on both sides of esophagus; two first pairs connected dorsally, third pair with uncertain connection. Dorsal vessel originating in XIII. Nephridia observed in VII-X and XII-XXI, 120-130 µm long, anteseptale funnel only, postseptale oval, tapering into posterior efferent duct. Brain with two narrow nerve extensions anteriorly and with shallow posterior incision.

Male genitalia paired (Figure 20B). Testes originating in XI, extending forwards into X, sometimes IX, creating regular club-shaped lobes typical for Lumbricillus. Sperm funnels in XI, 210-300 µm long, 145-225 µm wide, making them about as long as wide or twice as long as wide, funnels tapering towards vasa deferentia. Most of vasa irregularly coiled in XII, 10-15 µm wide. Penial bulbs round, 135-185 µm in diameter. Ovaries in XII. About two to eight mature eggs present at a time.

Figure 20. Lumbricillus pagenstecheri A. A. Spermatheca. B. Other genitalia. Abbreviations under general notes. Scale bars: 100 µm.

Spermathecae (Figure 20A) in V, with distinct ampulla. Ectal duct narrow, about as long as ampulla, abruptly widening into ampulla. Ampulla round, entally connecting with esophagus. Sperm arranged in circular masses in ampulla. Spermathecae 140-215 µm long, 75-110 µm wide at widest part of ampulla. Two groups of gland cells, one surrounding ectal duct, the other

surrounding ectal pore. Gland cells surrounding ectal pore forming compact mass, slightly lobed, whole glandular body 80-195 µm in diameter at its widest part. Two midventral subneural glands in XIII- XIV, 130 µm and 95 µm long respectively.

Remarks

Our molecular studies supported the delimitation of four different species with the morphology of L. pagenstecheri, here denoted as cryptic species A-D. Particularly the morphology of the spermathecae characterizes this group. There are two groups of gland cells, one creating the typical mass of glands surrounding the ectal pore, as seen in the other species of Lumbricillus, and the other group composed of numerous, rather long, gland cells covering the ectal duct. These two groups of gland cells can be difficult to distinguish from each other, depending on the orientation of the mounted specimens, but they create the impression of a very narrow duct followed by a distinct, almost spherical, thin-walled ampulla. Whilst there seems to be some morphological differences between the four species in this study, such as size and number of chaetae, there are too few sampled specimens to verify that these characters do not overlap.

The species was originally described by Ratzel (1869) from the Rheine River in Germany and has later been re-described by Nielsen & Christensen (1959) as well as others and today include about six synonymized species. There are some differences between these descriptions concerning size, number of segments and number of chaetae and there is a possibility that some of the synonymized species are present in our material. Moreover, there are about fifteen described species from the Pacific with a similar morphology as L. pagenstecheri and a phylogenetic study focused on this part of the genus seems necessary.

Lumbricillus pagenstecheri (Ratzel, 1869) Cryptic species B. Figure 21

Description based on two mature whole-mounted worms on slides, collected in Finnmark, NO. CE22586 & CE22727.

External characters

White worms. Length (fixed worms) more than 9.8-11.1 mm (amputated specimens), first 15 segments 4.3-5.3 mm long, width at clitellum 0.91-1.77 mm. More than 40-60 segments. Chaetae sigmoid. Lateral bundles with 5-6(7) chaetae anterior to clitellum, 3-5 chaetae in postclitellar segments. Ventral bundles with (6)7-8 chaetae anterior to clitellum, 4-6(7) chaetae posteriorly. Each worm’s longest measured chaetae 125-135 µm long, about 8 µm wide. Clitellum extending over XII-XIII. Head pore not observed. Epidermis with transverse rows of gland cells.

Internal characters

Coelomocytes numerous, about 20 µm long, spindle-shaped, oval, round, granulated with distinct nucleus. Paired pharyngeal glands present in IV, V and VI, situated on both sides of 47

esophagus, last pair sometimes extending into VII; all pairs converging dorsally. Dorsal vessel originating in XIV. Nephridia (Figure 21B) observed in XVII-XXIII, about 215 µm long, anteseptale funnel only, postseptale oval, tapering into posterioventral efferent duct. Brain of unknown shape.

Male genitalia paired. Testes originating in XI, extending forwards into IX, creating regular club- shaped lobes typical for Lumbricillus. Sperm funnels in XI, 410-600 µm long, 330-335 µm wide, making them about 1-2 times as long as wide, funnels tapering towards vasa deferentia. Most of vasa irregularly coiled in XII, 20 µm wide. Penial bulbs round, 365-390 µm in diameter. Ovaries in XII. About eight to eighteen mature eggs present at a time.

Figure 21. Lumbricillus pagenstecheri B. A. Spermatheca. B. Nephridia. Abbreviations under general notes. Scale bars: 100 µm.

Spermathecae (Figure 21A) in V, with distinct ampulla. Ectal duct narrow, abruptly widening into round ampulla. Sperm arranged in circular mass in ampulla. Spermathecae 170-265 µm long, 125-225 µm wide at widest part of ampulla. Two groups of gland cells, one surrounding ectal duct, the other surrounding ectal pore. Gland cells surrounding ectal pore forming compact mass, slightly lobed, whole glandular body 260-340 µm in diameter at its widest part. Up to three midventral subneural glands in XIII- XV, 360 µm, 300-370 µm and 270 µm long respectively. Glands in XIII and XV not observed in all specimens.

Remarks

The two specimens examined from this species are the largest in this study, at least considering the body width, and they generally possess more chaetae than the other species of L. pagenstecheri sensu latu.

Lumbricillus pagenstecheri (Ratzel, 1869) Cryptic species C. Figure 22

Description based on two half-mature whole-mounted worms on slides, collected in Galicia, ES, and on Svalbard, NO. CE1699 & CE20718.

External characters

Pinkish, yellow or orange worms. Length (fixed worms) more than 3.0-5.0 mm (amputated specimens), first 15 segments 2.5-2.7 mm long, width at clitellum 0.32-0.74 mm. More than 17- 32 segments. Chaetae sigmoid. Lateral bundles with 3-5 chaetae anterior to clitellum, 2-4 chaetae in postclitellar segments. Ventral bundles with 4-6 chaetae anterior to clitellum, 2-7 chaetae posteriorly. Each worm’s longest measured chaetae 65-75 µm long, about 5 µm wide. Clitellum extending over XII-XIII. Head pore not observed. Epidermis with transverse rows of gland cells.

Internal characters

Coelomocytes numerous, 10 µm long, spindle-shaped, oval, round, granulated with distinct nucleus. Paired pharyngeal glands present in IV, V and VI, situated on both sides of esophagus; all pairs converging dorsally. Dorsal vessel originating in XIII. Nephridia observed in XV-XX, about 95 µm long, anteseptale funnel only, postseptale oval, tapering into posterioventral efferent duct. Brain with two narrow nerve extensions anteriorly and with shallow posterior incision.

Male genetalia paired. Testes originating in XI, extending forwards into X, creating regular club- shaped lobes typical for Lumbricillus. Sperm funnels in XI. Penial bulbs round, about 130 µm in diameter. Ovaries in XII. No mature eggs observed.

Spermathecae (Figure 22) in V, with distinct ampulla. Ectal duct narrow, abruptly widening into round ampulla. Sperm arranged in circular mass in ampulla. Spermathecae 110 µm long, 80 µm wide at widest part of ampulla. Two groups of gland cells, one surrounding ectal duct, the other surrounding ectal pore. Gland cells surrounding ectal pore forming compact mass, slightly lobed, whole glandular body 105 µm in diameter at its widest part. No midventral subneural glands observed.

Remarks

Unfortunately, there were only two specimens sampled from this species availably in this study and neither seemed completely mature, despite the fact that sperm are present in the spermathcae of one of them. Interestingly, one of the specimens was sampled in Spain whilst the other was sampled in Svalbard.

Figure 22. Spermatheca of Lumbricillus pagenstecheri C. Abbreviations under general notes. Scale bars: 100 µm.

Lumbricillus pagenstecheri (Ratzel, 1869) Cryptic species D. Figure 23

Description based on four mature whole-mounted worms on slides, collected in Greenland, GL, and in Finnmark and Nordland, NO. SM191, CE22728, CE22729 & CE23482.

External characters

Length (fixed worms) more than 6.5-10.9 mm (amputated specimens), first 15 segments 2.5-5.0 mm long, width at clitellum 0.60-1.0 mm. More than 35-54 segments. Chaetae sigmoid. Lateral bundles with 3-5 chaetae anterior to clitellum, 2-3(4) chaetae in postclitellar segments. Ventral bundles with 4-6(7) chaetae anterior to clitellum, 2-4 chaetae posteriorly. Each worm’s longest measured chaetae 95-110 µm long, about 5-8 µm wide. Clitellum extending over XII-XIII. Head pore between prostomium and peristomium. Epidermis with transverse rows of gland cells.

Internal characters

Coelomocytes numerous, 10-25 µm long, spindle-shaped, oval, round, granulated with distinct nucleus. Paired pharyngeal glands present in IV, V and VI, situated on both sides of esophagus, last pair sometimes extending into VII; all pairs converging dorsally. Dorsal vessel originating in XIII-XIV. Nephridia observed in XXX-XL, 85 µm long, anteseptale funnel only, postseptale

oval, tapering into posterior efferent duct. Brain with two narrow nerve extensions anteriorly and with shallow posterior incision.

Male genitalia paired. Testes originating in XI, extending forwards into IX, sometimes VI, creating regular club-shaped lobes typical for Lumbricillus. Sperm funnels in XI, 355-445 µm long, 265-285 µm wide, making them 1-2 times as long as wide, funnels tapering towards vasa deferentia. Most of vasa irregularly coiled in XII, 10-15 µm wide. Penial bulbs round, 115-245 µm in diameter. Ovaries in XII. About three to four mature eggs present at a time.

Figure 23. Spermatheca of Lumbricillus pagenstecheri D. Abbreviations under general notes. Scale bars: 100 µm.

Spermathecae (Figure 23) in V, with distinct ampulla. Ectal duct narrow, abruptly widening into round ampulla. Sperm arranged in large circular mass in ampulla. Spermathecae 180-205 µm long, 145-170 µm wide at widest part of ampulla. Two groups of gland cells, one surrounding ectal duct, the other surrounding ectal pore. Gland cells surrounding ectal pore forming compact mass, slightly lobed, whole glandular body 190-250 µm in diameter at its widest part. Up to three midventral subneural glands in XIII- XV, 265 µm, 240-280 µm and 160 µm long respectively. Glands in XIII and XV not observed in all specimens.

Remarks

This species was about as long as L. pagenstecheri B but on average possessed fewer chaetae than any of the other members of L. pagenstecheri sensu latu.

Lumbricillus viridis Stephenson, 1911 Figure 24

Lumbricillus viridis Stephenson, 1911: pp. 46-50. Figs. 6a-b & 7a-c; Nielsen & Christensen, 1959: pp. 103-104. Fig. 116.

Description based on two mature and one half-mature whole-mounted worms on slides, collected in Rogaland and Troms, NO. CE12038, CE12039 & CE23255.

External characters

Green worms. Length (fixed worms) more than 7.9-10.6 mm (amputated specimens), first 15 segments 3.8-6.2 mm long, width at clitellum 0.74-1.05 mm. More than 23-41 segments. Chaetae straight or slightly sigmoid. Lateral bundles with 3-6 chaetae anterior to clitellum, 3-5 chaetae in postclitellar segments. Ventral bundles with 3-6 chaetae anterior to clitellum, 3-5 chaetae posteriorly. Each worm’s longest measured chaetae 70-85 µm long, about 5 µm wide. Clitellum extending over XII-XIII. Head pore between prostomium and peristomium. Epidermis with transverse rows of gland cells.

Internal characters

Coelomocytes numerous, 20-35 µm long, spindle-shaped, oval, round, granulated. Paired pharyngeal glands present in IV, V and VI, situated on both sides of esophagus; each pair converging dorsally. Dorsal vessel originating in XIII. Nephridia not observed. Brain with two narrow nerve extensions anteriorly and posterior incision.

Male genitalia paired (Figure 24B). Testes originating in XI, extending forwards into X, creating regular club-shaped lobes typical for Lumbricillus. Sperm funnels in XI, 620-670 µm long, 320- 350 µm wide, making them about twice as long as wide, funnels tapering towards vasa deferentia. Most of vasa irregularly coiled in XII, 25-30 µm wide. Penial bulbs round, 170-180 µm in diameter. Ovaries in XII. About five mature eggs present at a time.

Spermathecae (Figure 24A) in V, with distinct ampulla. Ectal duct narrow, shorter than ampulla, abruptly widening into ampulla. Ampulla round. Sperm arranged in a compact central sphere in the ampulla as well as embedded in the wall of ampulla, creating a circle around the sphere. Spermathecae 265-320 µm long, 270-310 µm wide at widest part of ampulla. Gland cells surrounding ectal pore, forming compact mass, slightly lobed, whole glandular body 310-325 µm in diameter at its widest part. Possibly with gland cells along the ectal duct. Up to four midventral subneural glands in XIV- XVII, 240-270 µm, 215-245 µm, 190-215 µm and 130 µm long respectively; glands in XVII not observed in all specimens.

Figure 24. Lumbricillus viridis. A. Spermatheca. B. Other genitalia. Abbreviations under general notes. Scale bars: 100 µm.

Remarks

The sampled specimens in this study are smaller than the ones from the original description by Stephenson and the later re-description by Nielsen & Christensen and possess somewhat fewer chaetae. Furthermore, the observed 2 times longer than wide sperm funnels differs greatly from the 7-10 or 6-8 times described by Stephenson and Nielsen & Christensen respectively. Nevertheless, the distinct color of the sampled specimens and the resemblance between their spermathecae and particularly the one described by Nielsen & Christensen confirms these specimens as Lumbricillus viridis.

According to our knowledge, the presence of gland cells along the ectal duct of the spermathecae has not been reported for L. viridis before, possibly because of the difficulty of distinguishing these gland cells from the large ones surrounding the ectal pore. In this study, similar duct glands have only been observed in L. pagenstecheri.

Lumbricillus tuba Stephenson 1911 Figure 25

Lumbricillus tuba Stephenson, 1911: pp. 42-46. Figs 5a-b & Pl. I. figs. 6-8; Nielsen & Christensen, 1959: p. 105. Fig. 131.

Description based on 1 mature whole-mounted worm on slide, collected in Finnmark, NO. CE22614.

External characters

White to grey worm. Length (fixed worm) more than 4.8 mm (amputated specimen), first 15 segments 2.0 mm long, width at clitellum 0.39 mm. More than 39 segments. Chaetae slightly sigmoid. Lateral bundles with 2-3 chaetae anterior to clitellum, 2-3 chaetae in postclitellar 53

segments. Ventral bundles with 3-4 chaetae anterior to clitellum, 2-3 chaetae posteriorly. The worm’s longest measured chaeta 48 µm long, about 3 µm wide. Clitellum extending over XII- 1/2XIII. Head pore not observed. Epidermis with transverse rows of gland cells.

Internal characters

Coelomocytes numerous, 20 µm long, spindle-shaped, oval, round, granulated. Paired pharyngeal glands present in IV, V and VI, situated on both sides of esophagus. Dorsal vessel originating in XII. Nephridia not observed. Brain with two narrow nerve extensions anteriorly, longer than wide, further shape unclear.

Male genitalia paired (Figure 25B). Testes originating in XI, extending forwards into IX, creating regular club-shaped lobes typical for Lumbricillus. Sperm funnels in XI, 120 µm long, 105 µm wide, making them slightly longer than wide, funnels tapering towards vasa deferentia. Most of vasa irregularly coiled in XII, 10 µm wide. Penial bulbs round, 85 µm in diameter. Ovaries in XII. Two mature eggs present.

Figure 25. Lumbricillus tuba. A. Spermatheca. B. Other genitalia. Abbreviations under general notes. Scale bars: 100 µm.

Spermathecae (Figure 25A) in V, with distinct ampulla. Ectal duct as long as ampulla, abruptly widening into oval ampulla. Sperm circularly arranged in ampulla. Spermathecae 120 µm long, 85µm wide at widest part of ampulla. Gland cells surrounding ectal duct, forming compact mass, whole glandular body 75 µm in diameter at its widest part. Three midventral subneural glands in XIII- XV, 85µm, 90 µm and 85 µm long respectively.

Remarks

The observed specimen matches the original description by Stephenson well in most characters such as the shape of the spermatheca and the ratio between length and width of the sperm 54

funnels. The specimen found in this study was smaller and had slightly fewer chaetae than the ones in the original description.

Lumbricillus buelowi Nielsen & Christensen, 1959 Figure 26

Lumbricillus buelowi Nielsen & Christensen, 1959: pp. 106. Figs. 121-124, 129.

Description based on eight mature whole-mounted worms on slides. Collected in Sogn og Fjordane, Troms and Nordland, NO, and Bohuslän, SE. CE5224, CE22293, CE23273, CE23375, CE23376, CE24678, CE24688 & CE24690.

External characters

White to slightly pink or yellow. Length (fixed worms) more than 2.4-5.2 mm (amputated specimens), first 15 segments 1.7-2.4 mm long, width at clitellum 0.28-0.49 mm. More than 21- 32 segments. Chaetae straight or slightly sigmoid. Lateral bundles with 2-3 chaetae anterior to clitellum, 2(3) chaetae in postclitellar segments. Ventral bundles with 2-3(4) chaetae anterior to clitellum, 2(3-4) chaetae posteriorly. Each worm’s longest measured chaetae 30-55 µm long, about 5 µm wide. Clitellum extending over XII-1/2XIII. Head pore between prostomium and peristomium. Epidermis with transverse rows of gland cells.

Internal characters

Coelomocytes numerous, 10-25 µm long, spindle-shaped, oval, round, granulated with distinct nucleus. Paired pharyngeal glands present in IV, V and VI, situated on both sides of esophagus; each pair converging dorsally. Dorsal vessel originating in XIV. Nephridia not observed. Brain with two narrow nerve extensions anteriorly and with posterior incision. Slightly longer than wide.

Male genitalia paired (Figure 26B). Testes originating in XI, extending forwards into X, creating irregular mass without lobes. Sperm funnels in XI, 85-140 µm long, 100-145 µm wide, making them about as long as wide, funnels tapering towards vasa deferentia. Most of vasa irregularly coiled in XII, 5-10 µm wide. Penial bulbs round, 75-110 µm in diameter. In one specimen the bulbs were everted. Ovaries in XII. One to three mature eggs present at a time.

Figure 26. Lumbricillus buelowi. A. Spermatheca. B. Other genitalia. Abbreviations under general notes. Scale bars: 100 µm.

Spermathecae (Figure 26A) in V, with distinct ampulla. Ectal duct narrow, more than twice the length of the ampulla, abruptly widening into ampulla. Ampulla round, entally connecting with esophagus. Sperm in ampulla aggregated into central mass haloed by circle of spermatozoa. Spermathecae 130-160 µm long, 45-65 µm wide at widest part of ampulla. Gland cells surrounding ectal duct, folded, glandular body 40-90 µm in diameter at its widest part. Up to five midventral subneural glands in XIII- XVII, 50-95 µm, 60-120 µm, 60-95 µm, 50-65 µm and 45 µm long respectively; glands in XVI-XVII not observed in all specimens.

Remarks

It is clear that the two forms here identified as L. buelowi and L. knoellneri are closely related (as proved molecularly), and most morphological characters such as the spermathecae, sperm funnels and penial bulb are virtually identical in them. In the material examined here, however, there are some general differences: L. buelowi is on average larger than L. knoellneri as originally noted by Nielsen & Christensen, but there is an overlap between the two. L. buelowi possesses 2-3 chaetae in the lateral bundles anterior of the clitellum while L. knoellneri possesses only 2. Specimens from both species examined in this study were shorter than originally described.

Lumbricillus knoellneri Nielsen & Christensen, 1959 Figure 27

Lumbricillus knoellneri Nielsen & Christensen, 1959: pp. 106-107. Figs. 125-126, 130.

Description based on six mature and two immature whole-mounted worms on slides, collected in Sogn og Fjordane, Svalbard, Finnmark and Troms, NO, and Västergötland, SE. CE980, CE982, CE19369, CE20761, CE20762, CE22615, CE23252 & CE23253.

External characters

White to yellow worms. Length (fixed worms) more than 2.1-3.6 mm (amputated specimens), first 15 segments 1.6-1.9 mm long, width at clitellum 0.20-0.32 mm. More than 16-32 segments. Chaetae straight or slightly sigmoid. Lateral bundles with 2 chaetae anterior to clitellum, 2 chaetae in postclitellar segments. Ventral bundles with 2-3 chaetae anterior to clitellum, 2 chaetae posteriorly. Each worm’s longest measured chaetae 25-50 µm long, about 3 µm wide. Clitellum extending over XII-1/2XIII. Head pore between prostomium and peristomium. Epidermis with transverse rows of gland cells.

Internal characters

Coelomocytes numerous, 10-25 µm long, spindle-shaped, oval, round, granulated with distinct nucleus. Paired pharyngeal glands present in IV, V and VI, situated on both sides of esophagus. Dorsal vessel originating in XIII-XV. Nephridia possibly observed XX-XXII, seemingly with anteseptale funnel ony, postseptale oval, tapering into efferent duct. Brain with two narrow nerve extensions anteriorly and with posterior incision.

Male genitalia paired (Figure 27B). Testes originating in XI, extending forwards into X, creating irregular mass without lobes. Sperm funnels in XI, 100-150 µm long, 70-155 µm wide, making them about as long as wide or 1.5 times longer than wide, funnels tapering towards vasa deferentia. Most of vasa irregularly coiled in XII, 5-10 µm wide. Penial bulbs round, 70-115 µm in diameter. Ovaries in XII. One to two mature eggs present at a time.

Figure 27. Lumbricillus knoellneri. A. Spermatheca. B. Other genitalia. Abbreviations under general notes. Scale bars: 100 µm.

Spermathecae (Figure 27A) in V, with distinct ampulla. Ectal duct more than twice the length of the ampulla, abruptly widening into ampulla. Ampulla round, entally connecting with esophagus. Sperm in ampulla aggregated into central mass haloed by circle of spermatozoa. Spermathecae

145-270 µm long, 45-65 µm wide at widest part of ampulla. Gland cells surrounding ectal duct, divided in several small lobes, whole glandular body 75-100 µm in diameter at its widest part. Up to four midventral subneural glands in XIII- XVI, 50-65 µm, 35-65 µm, 35-65 µm and 35-60 µm long respectively; glands in XVI not observed in all specimens.

Remarks

Lumbricillus knoellneri is described as having only 2 chaetae throughout the body but the newly studied material suggests that the anterioclitellar ventral bundles possess 2-3 chaetae. The number of chaetae per bundle can differ between individuals and increased examined material in this study could explain the difference to the original description. Many of the internal organs of L. knoellneri were as long as or even slightly longer than the ones in L. buelowi. This in combination with a generally smaller size caused the segments of L. knoellneri to appear more contracted. For a further discussion see the remarks section for L. buelowi above.

Lumbricillus arenarius (Michaelsen, 1889) Figure 28

Enchytraeus arenarius Michaelsen, 1889: pp. 12-14. Figs. 5a-d.

Enchytraeoides arenarius Knöllner, 1935: pp. 437-438. Figs. 7-8.

Lumbricillus arenarius Nielsen & Christensen, 1959: pp. 107-108. Figs. 127-128.

Description based on six mature and one half mature whole-mounted worms on slides, collected in Svalbard, Vestfold and Vest-Agder, NO, and Bohuslän, SE. CE1001, CE8474, CE20748, CE20749, CE20750, CE21495 & CE21825.

External characters

White to yellow worms. Length (fixed worms) more than 5.0-8.6 mm (amputated specimens), first 15 segments 3.5-4.0 mm long, width at clitellum 0.31-0.51 mm. More than 19-35 segments. Chaetae straight or slightly sigmoid. Lateral bundles with 2-3 chaetae anterior to clitellum, 2 chaetae in postclitellar segments. Ventral bundles with 2-3(4) chaetae anterior to clitellum, 2-3 chaetae posteriorly. Each worm’s longest measured chaetae 40-70 µm long, about 5 µm wide. Clitellum extending over XII-1/2XIII, in some covering all of XIII. Head pore between prostomium and peristomium. Epidermis with transverse rows of gland cells.

Internal characters

Coelomocytes numerous, 20-50 µm long, spindle-shaped, oval, round, granulated with distinct nucleus, some with distally hooked ends. Paired pharyngeal glands present in IV, V and VI, situated on both sides of esophagus. Dorsal vessel originating in XIII. Nephridia observed in XV-XVI and XX-XXV, 105-145 µm long, anteseptale funnel only, postseptale oval, tapering into efferent duct. Brain with two narrow nerve extensions anteriorly and with posterior incision.

Male genitalia paired (Figure 28B). Testes originating in XI, extending forwards into X, creating irregular mass, in some specimens with lobes. Sperm funnels in XI, in some specimens extending back into XII, 375-975 µm long, 55-103 µm wide, making them 6-13 times longer than wide, funnels tapering towards vasa deferentia. Most of vasa irregularly coiled in XII, in one specimen extending back into XIV, 5-10 µm wide. Penial bulbs round, 110-140 µm in diameter. Ovaries in XII. One to six mature eggs present at a time.

Figure 28. Lumbricillus arenarius. A. Spermatheca. B. Other genitalia. Abbreviations under general notes. Scale bars: 100 µm.

Spermathecae (Figure 28A) in V. Ectal duct longer than and gradually widening into ampulla. Ampulla oval or round, entally connecting with esophagus. Irregular mass of sperm aggregated in ampulla. Spermathecae 100-255 µm long, 50-115 µm wide at widest part of ampulla. Gland cells surrounding ectal duct, divided into several flaps, whole glandular body 75-135 µm in diameter at its widest part. Up to four midventral subneural glands in XIII- XVI, 75-110 µm, 90- 115 µm, 75-85 µm and 95 µm long respectively; glands in XVI not observed in all specimens.

Remarks

The original description by Michaelsen (1889) was later amended by Knöllner (1935) who redrew the shape of the nephridia and spermathecae, also confirmed by Nielsen & Christensen (1959). The newly examined material in this study resembles the original description in most characters but the spermathecae and nephridia is in agreement with the amended descriptions. Coelomic corpuscles were found with hooked ends which seemed to bind to the internal tissue in a way that is described by Michaelsen. The testis seemed to be either an irregular compact mass or as separate lobes, but it did not confirm with the typically pear-shaped lobes of Lumbricillus sensu stricto.

Lumbricillus sp. H Figure 29

Description based on three half mature whole-mounted worms on slides, collected in Troms and Nordland, NO. CE23136, CE24967 & CE24968.

External characters

White to orange worms. Length (fixed worms) more than 3.8-5.4 mm (amputated specimens), first 15 segments 2.0-2.8 mm long, width at clitellum 0.40-0.42 mm. More than 31-33 segments. Chaetae straight or slightly sigmoid. Lateral bundles with 2-3 chaetae anterior to clitellum, 2 chaetae in postclitellar segments. Ventral bundles with 2-3 chaetae anterior to clitellum, 2 chaetae posteriorly. Each worm’s longest measured chaetae 70-75 µm long, about 5 µm wide. Clitellum extending over XII-1/2XIII. Head pore between prostomium and peristomium. Epidermis with transverse rows of gland cells.

Internal characters

Coelomocytes numerous, 15-20 µm long, spindle-shaped, oval, round, granulated with distinct nucleus. Paired pharyngeal glands present in IV, V and VI, sometimes extending into VII, situated on both sides of esophagus; each pair converging dorsally. Dorsal vessel originating in XIII. Nephridia observed in XIII-XXVIII, 100-145 µm long, anteseptale funnel only, postseptale oval, tapering into efferent duct. Brain with two narrow nerve extensions anteriorly and with posterior incision.

Male genitalia paired. Testes (Figure 29B) originating in XI, extending forwards into X, in one specimen back into XII, creating irregular mass of lobes. Sperm funnels in XI, 145-170 µm long, 45-50 µm wide, making them 3-4 times longer than wide, funnels tapering towards vasa deferentia. Most of vasa irregularly coiled in XII, 10 µm wide. Penial bulbs (Figure 29C) slightly bilobed, 85-120 µm in diameter. Ovaries in XII. No observed mature eggs.

Spermathecae (Figure 29A) in V. Ectal duct long, gradually widening. Ampulla not clearly set of from duct, entally connecting with esophagus. No sperm observed. Spermathecae 125-145 µm long, 25-40 µm wide at widest part. Gland cells surrounding ectal duct, divided into several lobes, whole glandular body 35-65 µm in diameter at its widest part. Two midventral subneural glands in XV- XVI, 45-100 µm, 50-65 µm long respectively.

Figure 29. Lumbricillus sp. H. A. Spermatheca. B. Testis. C. Penial bulb. Abbreviations under general notes. Scale bars: 100 µm.

Remarks

Unfortunately, none of the examined material appeared to be fully mature, as sperm was not observed, either at the sperm funnels or in the spermathecae, and since there were no mature eggs present. This means that the sperm funnels and spermathecae were probably not fully developed. Initial comparisons found similarities with Randidrilus westheidei Kossmagk- Stephan, 1983: similar shape of spermathecae and slightly bilobed penial bulb. However, R. westheidei is described as having fewer chaeta, more segments, smaller unlobed testes and a sperm funnel that is 18-20 times longer than wide, all separating it from L. sp. H. The ratio of the sperm funnel is questionable as the illustration from the same description depicts sperm funnels that are closer to 10 times longer than wide. Nevertheless, these newly studied specimens will for now be considered as belonging to an unknown species, which appears to be closely related to R. westheidei, until fully mature specimens have been collected and examined.

Lumbricillus dubius (Stephenson, 1911) Figure 30

Enchytraeus dubius Stephenson, 1911: pp. 54-58. Figs. 10-12 & Pl.II 12-14;

Lumbricillus dubius Nielsen & Christensen, 1959: p. 96.

Description based on eight mature whole-mounted worms on slides, collected in Finnmark, Troms and Nordland, NO, and Bohuslän, SE. CE5221, CE5223, CE22767, CE23370, CE23371, CE24700, CE24711 & CE24726.

External characters

White to yellow worms. Length (fixed worms) more than 2.1-6.1 mm (amputated specimens), first 15 segments 1.5-2.5 mm long, width at clitellum 0.32-0.55 mm. More than 20-44 segments. Chaetae straight or slightly sigmoid. All observed bundles with two chaetae. Each worm’s longest measured chaetae 50-75 µm long, about 5 µm wide. Clitellum extending over XII- 1/2XIII. Head pore between prostomium and peristomium. Epidermis with transverse rows of gland cells.

Internal characters

Coelomocytes numerous, 15-30 µm long, spindle-shaped, oval, round, granulated with distinct nucleus. Paired pharyngeal glands present in IV, V and VI, situated on both sides of esophagus. Each pair converges dorsally, connection, if present at all, indistinct. Dorsal vessel originating in XIII. Nephridia observed in XVIII-XXI, 50-65 µm long, anteseptale funnel only, postseptale oval, tapering into efferent duct. Brain longer than wide, with two narrow nerve extensions anteriorly and with posterior incision.

Male genitalia paired. Testes (Figure 30B) originating in XI, in some specimens extending forwards into X, creating irregular mass and fragments, fragments spread in XI-XII. Sperm funnels (Figure 30B) in XI, 180-390 µm long, 70-145 µm wide, making them 2.5-4 times longer than wide, funnels tapering towards vasa deferentia. Most of vasa irregularly coiled in XI-XII, 5- 10 µm wide. Penial bulbs (Figure 30C), 110-190 µm in diameter, divided into two bulbs each with an extending horn. Ovaries in XII. One to five mature eggs present at a time.

Figure 30. Lumbricillus dubius. A. Spermatheca. B. Male genitalia. C. Penial bulb. Abbreviations under general notes. Scale bars: 100 µm.

Spermathecae (Figure 30A) in V, without distinct ampulla, gradually widening, entally connecting with esophagus. Sperm completely occupying lumen of duct and ampulla, regularly arranged with spermatozoan heads facing the wall and tails along the duct, forming denser aggregation throughout the center of the spermathecae. 95-205 µm long, 40-100 µm wide at widest part of ampulla. Gland cells surrounding ectal duct, divided into few flaps, whole glandular body 70-120 µm in diameter at its widest part. Up to two midventral subneural glands in XIV- XV, 60-80 µm, 60-65 µm long respectively; glands in XV not observed in all specimens.

Remarks

The newly examined specimens in this study match the description of Lumbricillus dubius by Stephenson well, despite being smaller and having testes that seem more like an irregular mass than made up of branches as observed by Stephenson. The clearly divided penial bulb and the morphology of the spermathecae bear a very close resemblance between the specimens in this study and the original description. Stephenson wrote that no sperm were observed in the spermathecae but his illustrations depicting sections of the same clearly shows the unique distribution of spermatozoa with heads regularly arranged perpendicular to the wall of the

spermathecae. It is possible that he did not recognize them as sperm, simply because of this unusual arrangement.

Lumbricillus dubius has irregularly lobed seminal vesicles and spermathecae that are at least superficially similar to those of L. arenarius. The chaetae are straight to slightly sigmoid and few in number, which further supports the close relationship to L. arenarius, L. sp. H and possibly R. westheidei, see remarks for L. sp. H.

Lumbricillus semifuscus (Claparéde, 1861) Figure 31

Pachydrilus semifuscus Claparéde, 1861: pp. 76-79. Pl. II. Figs. 1-5.

Marionina semifusca Stephenson, 1911: pp. 35-39. Figs. 2-3. Pl. I. Fig. 2.

Lumbricillus semifuscus Nielsen & Christensen, 1959: p. 96.; Erséus, 1976: pp. 8-9. Figs. 5-6.

Description based on five mature and one half mature whole-mounted worms on slides, collected in Nordland, NO, and Anglesey, UK. CE2247, CE2248, CE2249, CE2252, CE23750 & CE24657.

External characters

White, grey to pinkish worms. Length (fixed worms) more than 4.0-7.3 mm (amputated specimens), first 15 segments 2.1-3.4 mm long, width at clitellum 0.54-0.69 mm. More than 22- 45 segments. Chaetae sigmoid or straight. Lateral bundles with 2-5(6) chaetae anterior to clitellum, 2-5(6) chaetae in postclitellar segments. Ventral bundles with 3-6 chaetae anterior to clitellum, 2-5 chaetae posteriorly. Each worm’s longest measured chaetae 85-115 µm long, about 5-8 µm wide. Clitellum extending over XII-1/2XIII, sometimes XIII. Head pore between prostomium and peristomium. Epidermis with transverse rows of gland cells.

Internal characters

Coelomocytes numerous, 10-20 µm long, spindle-shaped, oval, round, granulated with distinct nucleus. Paired pharyngeal glands present in IV, V, VI and VII, situated on both sides of esophagus; each pair converging but not connected dorsally. Possible oesophageal appendages observed in III, connected to pharynx and possibly interacting with pharyngeal glands. Dorsal vessel originating in XIII. Nephridia observed in VI-VIII and XIV and onwards, 65-70 µm long, various shapes, anteseptale with more than funnel, postseptale oval, tapering into terminal efferent duct. Brain with two narrow nerve extensions anteriorly and with posterior incision.

Male genitalia paired (Figure 31B). Testes originating in XI, extending forwards into X, in some specimens extending into IX and XII, creating irregular mass of lobes. Sperm funnels in XI, 125- 160 µm long, 110-145 µm wide, making them 1-1.5 times longer than wide, funnels tapering

towards vasa deferentia. Most of vasa irregularly coiled in XII, 10-15 µm wide. Penial bulbs round, 140-155 µm in diameter. Ovaries in XII. Two to five mature eggs present at a time.

Figure 31. Lumbricillus semifuscus. A. Spermatheca. B. Other genitalia. Abbreviations under general notes. Scale bars: 100 µm.

Spermathecae (Figure 31A) in V, with distinct ampulla. Ectal duct twice as long as ampulla, abruptly widening into ampulla. Ampulla round, entally connecting with esophagus. Irregular mass of sperm in ampulla. Spermathecae 240-270 µm long, 60-110 µm wide at widest part. Gland cells surrounding ectal duct, forming compact mass, 50-105 µm in diameter at its widest part. Possibly two midventral subneural glands in XIV- XV, 40-100 µm, 70-85 µm long respectively, although these could have been misinterpretations of the ganglia themselves.

Remarks

Lumbricillus semifuscus was first described by Claparéde in 1861, then amended and regarded as Marionina by Stephenson (1911), transferred to Lumbricillus by Nielsen & Christensen (1959) and further commented by Erséus (1976). The shape of the spermathecae of the newly studied material agrees with all of the above mentioned descriptions, and the very long and thin-walled duct with a distinctly set off ampulla is only somewhat similar to L. buelowi and L. knoellneri. The newly examined specimens are smaller than the ones described by Stephenson and possess fewer chaetae which are more in agreement with the comments by Erséus. The occurrence of four pairs of pharyngeal glands, extending as far back as VII, has not been observed in any other Lumbricillus species. Neither has a nephridium with the anteseptale made up of more than just a funnel, and the presence of some kind of oesophaegal appendages. The testes lack the typical

lobed seminal vesicles of Lumbricillus sensu stricto, and it has previously been noted that this species should probably be classified in another genus (Kossmagk-Stephan, 1983).

4. Discussion

This is the most extensive study of the genus Lumbricillus, considering the amount of included specimens, species and genetic markers, up to date. Previous studies, mostly based on morphology, has had a tendency to lump and synonymizing species, ignoring the observed variation. Nielsen & Christensen (1959) provided a well needed revision of the genus, but in their revision several species are synonymized without any discussion or explanation. The large amount of data used in this study has provided me with the unique possibility of resolving the phylogeny and species delimitation of this group. The use of DNA barcoding has been a valuable tool to get a preliminary clustering of the species which facilitated the delimitation of species, phylogenetic inference and morphological examination.

4.1 Species delimitation

In order to handle the more than 300 sequenced Lumbricillus specimens in this study, the COI barcoding proved invaluable. The barcodes grouped the included specimens into distinct clusters which were also delimited as different putative species by the use of a barcode-gap in ABGD. The outcome provided me with a grouping into putative species which I could use as hypothesis to be tested for other genes. The vast majority of the included specimens were clearly separated with distances of more than 10 % in COI. Furthermore, the fact that the ITS gene tree showed the same groupings discards the risk of the putative species representing only maternal lineages as an effect of sampling the mitochondrial genome. Moreover, the gene trees of the other five mitochondrial and nuclear markers agreed with these clusters or at least did not support other groupings. Whenever, the other gene trees did not show the same clusters as observed in COI and ITS, this was usually because the genes were too conservative and did not contain any genetic differences between the closely related species.

Regarding the support from the species delimitation it was clear that all species, except some with only a single sampled individual, were supported by at least one of the two statistical tests

(Rosenberg’s PAB and P(Randomly Distinct)) in Geneious for COI and ITS. Furthermore, DISSECT, which used the information of all 7 genetic markers, gave full support for the delimitation of all but six of the included Lumbricillus species. Among these six species, L. pagenstecheri C & D were separated in about 90 % of the sampled trees from the DISSECT analysis and supported as different species for both COI and ITS in the statistical tests, despite having only a few sampled individuals. Lumbricillus pumilio and L. rubidus were separated in about 75 % of the sampled trees but were not well supported as distinct species in the statistical tests, possibly because of the limited sample of individuals. Lastly, L. buelowi and L. knoellneri were found as the same species in 95 % of the sampled trees from the DISSECT analysis, in

opposition to the well-supported distinctiveness of the statistical tests for both COI and ITS. The delimitation of L. buelowi and L. knoellneri had been of particular interest from the start of this project after they were found to have a genetic difference of only about 6 % in the COI gene tree. These species were initially described by Nielsen & Christensen (1959) as being identical in most characters, except for size and number of chaetae, morphological differences also confirmed in this study. However, as the delimitation performed by DISSECT was only based on one sampled individual from each of these two putative species, because the included individuals required all 7 genetic markers, this could explain the failure to distinguish between these two species. Furthermore, the use of a too high ε-parameter in DISSECT is described as making the distinction of recently diverged species difficult and using the default value of 0.0001 was probably inappropriate in this case (Jones et al. 2014).

All in all, the Rosenberg’s PAB and P(Randomly Distinct) statistical tests and the coalescent based analysis DISSECT agreed in the majority of the species delimitations and further seemed to complement each other. On one hand, DISSECT could support the delimitation of not only the well sampled species but, as it was able to incorporate the information of all 7 genetic markers under the multispecies coalescent model, i.e., also the ones with only one or a few sampled individuals. On the other hand, the statistical tests could utilize a larger set of sampled individuals per species, as they did not require that each individual was sampled for all three genes, and thus was able to separate very similar species such as L. buelowi and L. knoellneri. I find that there is enough evidence to support all the 24 sampled species of Lumbricillus in this study, but recommend further sampling for L. pumilio and L. rubidus. Lumbricillus buelowi and L. knoellneri are supported as different species by both morphology and partly by molecular data and the uncertainties with the delimitation is probably due to a recent divergence between the species. The L. pagenstecheri species complex seems to be separated into four supported species.

The delimitation of species based on genetic data is dependent on both the number of individuals sampled per species and the number of different genetic markers used. In this study I chose to use one mitochondrial (COI) and two genetic markers (ITS and H3) for statistical testing but it seems, from the results of the species delimitation tests in Geneious, that H3 might be too conservative to be used for species delimitation. The results from Geneious similarly showed that most of the putative species with few sampled individuals did not yield statistical significance in the implemented tests. Ideally, more than three specimens from each putative species should have been sampled for the statistical tests to have sufficient data. As of now, non-significance in the statistical tests, for the putative species with only a few sampled individuals, may as well be attributed to a lack of data as actually not being significantly distinct from their closest relatives. Unfortunately, for some of the putative species included in this study we had only found one or a few individuals during our sampling and thus could not add more sequences. Furthermore, the preliminary results from the COI gene tree was used to determine which groups that would need

more extensive sampling, based on the genetic similarity, which is why for example L. buelowi and L. knoellneri were represented by many individuals.

The problems with sequencing H3 propose some interesting clues for the phylogenetic relationship particularly for the close relationship between L. buelowi and L. knoellneri. The species delimitation of these two groups were of special interest from the start and thus they were extensively sampled for COI, ITS and H3. The fact that only H3R (the reverse primer) yielded usable sequences for L. buelowi, but that both primers worked for L. knoellneri, suggests that there is a difference in the sequence of the primer binding site between these two groups. While this meant that there was no good gene tree to be statistically tested for H3, it can still be used as part of the evidence in separating these two groups.

4.2 Gene tree estimation

The gene trees showed similar topologies concerning the general groupings but with a lot of, mostly poorly supported, incongruences within such groups. The only major incongruence between all the gene trees regards the placement of the L. arenarius species group (also containing L. dubius and L. sp H) where 16S and H3 support this group as sister to Lumbricillus sensu stricto, whereas 12S, 18S, 28S and ITS support a sister relationship with Grania instead. We expected 18S, 28S and ITS to show the same pattern as they are all nuclear ribosomal genes with a linked inheritance. Strangely, the same pattern was not observed between 12S and 16S which are both ribosomal genes of the mitochondrial genome and thus should share the same evolutionary history. Here it should be noted that in the 16S gene tree (Figure S3), Grania was found paraphyletic as it included Achaeta bibulba. A closer look at the alignment for this gene showed no clear resemblance between the Grania species and Achaeta bibulba, or any suggestions of a misalignment. The 16S gene tree shows Achaeta bibulba with by far the longest branch length and it is possible that its placement within Grania was simply due to random chance produced by long branch attraction. The 16S gene tree should be re-estimated without Achaeta bibulba to determine if its exclusion would change its topology to resemble that of the 12S tree.

Incongruence among gene trees is well known and the cases reported in this thesis could be explained by incomplete lineage sorting, perhaps due to a rapid diversification between the Lumbricillus sensu latu species. Other sources for incongruence include recombination, hybridization and gene duplication. We did not find any support for recombination within or between the included genes based on the networks and statistical tests calculated in SplitsTree 4. Furthermore, there were no clear cases where the position of a species alternated between two different well-supported sister relationships, something we would have expected for species of hybrid origin. This does not prove that there are no hybrid species present within Lumbricillus sensu latu, but additional individuals and genes are required to discover such patterns. Finally, there has not been any recent studies regarding the ploidy level of the species within

Lumbricillus sensu latu, since Christensen (1961) reported polyploidy in only one (L. lineatus, see remarks section under Taxonomy) out of ten included species. Interestingly, we have found no clear distinction of diploid from triploid specimens of L. lineatus in our gene trees, despite Christensen’s observation of no genetic exchange during copulation. If there is truly no genetic flow between these two groups we would have expected to see a distinction in at least the mitochondrial genes. Perhaps the fact that the triploid form is dependent on receiving sperm from the diploid form to activate, without penetrating, the egg somehow limits it from becoming too genetically separated from the diploid form. In any case, the intriguing life history of L. lineatus deserves a study on its own.

4.3 The phylogeny of Lumbricillus

The trees from this study have provided new insights in the phylogeny of Lumbricillus. Most noteworthy is the fact that it is a non-monophyletic genus with a critical need for revision (as previously argued by Kossmagk-Stephan, 1983 and Erséus et al., 2010). First, the results support a monophyletic Lumbricillus sensu stricto group containing the type species L. lineatus allowing this part of the genus to retain its name. Second, the three species of the L. arenarius species group (also L. dubius and L. sp. H) are inconclusively found as either sister to Lumbricillus sensu stricto (mitochondrial concatenation and *BEAST) or to Grania (nuclear ribosomal concatenation and concatenation of all genes). The fact that the mitochondrial concatenation supports the L. arenarius species group being sister to Lumbricillus sensu stricto and that Grania is not the sister to these two, but is placed closer to the root, could be related to the previously mentioned problem with the 16S gene tree. If Achaeta bibulba is erroneously grouped with the Grania species as an effect of long branch attraction, this could influence the mitochondrial concatenation, forcing Grania closer to the root and Achaeta bibulba, instead of close to Lumbricillus as seen in the 12S gene tree. Similarly, the effect on the *BEAST tree could also be to force Grania closer to the root, in order to be able to explain the coalescent history of the 16S gene.

This study clearly supports the monophyly of both Lumbricillus sensu stricto and the L. arenarius species group. If the results had been conclusive in placing the L. arenarius group as sister to Lumbricillus sensu stricto, then L. arenarius, L. dubius and L. sp. H could have remained in the genus. In this case, separating the two groups into separate genera would not be inappropriate, given the supported monophyly of the groups, but keeping them together in the same genus could be inappropriate, as the true sister group to the L. arenarius species group remains inconclusive. As for now, the true relationship between these three groups (Lumbricillus sensu stricto, Grania and the L. arenarius species group) should be treated as a polytomy. The reason for this uncertain phylogeny originates in the incongruence of the gene trees, possibly due to incomplete lineage sorting remaining from a rapid diversification between these three groups. Further sampling of genes could provide the true answer.

This study has also confirmed that L. semifuscus is not a member of Lumbricillus sensu stricto, supported genetically and morphologically, but none of the included outgroups seems to be closely related to this species and a more thorough sampling of outgroups is required to find out where this species truly belongs.

The phylogeny within Lumbricillus sensu stricto provides interesting insights related to the morphology of the included species, where there is a paraphyletic group of species with distinct ampulla of their spermathecae and a well-supported monophyletic group of species without distinct ampulla. Furthermore, L. buelowi and L. knoellneri are found to be sister to the rest of Lumbricillus sensu stricto and these species have testes which lack the fan-shaped arrangement of lobes of the seminal vesicles which are typical for the rest of the included species. This could indicate that unlobed seminal vesicles were the ancestral state of the genus, also supported by the fact that the closest outgroups share this character, and that the characteristically lobed seminal vesicles is a derived state found in a monophyletic group of species within Lumbricillus sensu stricto. This unfortunately makes defining the genus using morphological characters much harder and placement of other species not studied in this thesis difficult. Previously described species that lack the characteristic lobed seminal vesicles cannot simply be placed outside Lumbricillus sensu stricto as they could be closely related to L. buelowi and L. knoellneri. An alternative solution would be to further divide the genus into a more exclusive Lumbricillus sensu stricto without L. buelowi and L. knoellneri which would instead make up another genus, supported by the monophyly of both groups. However, conclusions about such a division and about the still uncertain topology within Lumbricillus sensu stricto, more specifically within the group of species without distinct ampulla of their spermathecae, could be premature as the phylogeny is likely to change even more as more species are added. It should be kept in mind that only 24 out of 80 described have been included so far, and there are probably still many undescribed species of this group to discover.

4.4 DNA sequencing issues

The H3 sequences of L. tuba were not possible to align with the remaining Lumbricillus species and it is unlikely that a relatively conservative gene such as H3 should be so completely different when the other genes sequenced from L. tuba were not. This problem could be explained by contamination or perhaps sequencing of non-homologous genes from L. tuba, possibly a paralogous H3 gene. The lack of this gene unfortunately made inclusion of L. tuba in the *BEAST species tree estimation impossible. Regarding the placement of L. tuba in the phylogeny, all three concatenated trees supported the inclusion of L. tuba in the clade containing L. viridis and the four species of L. pagenstecheri A-D, more specifically as sister to all of these species within that clade.

4.5 Taxonomy

As briefly outlined under The phylogeny of Lumbricillus above, the morphological examination of the species delimited in this study has provided several observed patterns congruent with the estimated phylogeny. The L. arenarius species group, including L. dubius and L. sp. H have been supported as a monophyletic group outside of Lumbricillus sensu stricto. All of these species have irregularly lobed seminal vesicles in their testes and the spermathecae of L. arenarius and L. dubius are somewhat similar, with no clear distinction between the ectal duct and the ampulla. Similarly, both L. dubius and L. sp. H have bilobed penial bulbs, where the bulbs of L. dubius possesses unique horn-like extensions. If these species are separated into their own genus I would support the transfer of Randidrilus westheidei to this genus too as it clearly shares more similarities with these species than with the ones in its current genus.

In general, it seems that all but the largest, or widest, specimens of Lumbricillus sensu latu were suitable to be mounted in Canada balsam, as most of the morphological characters were easy to examine. However, this method requires the examination of several specimens per species as the orientation in which the specimen is preserved determines which of the organs that will be visible. I found some organs such as the nephridia to be particularly difficult to distinguish as they do not stain as clearly as most other internal structures and are therefore easily lost in all the color observed from surrounding structures. The benefits of examining whole-mounted material over, e.g., serial sections is that alternating the focus in the microscope of the observed material allows for a three-dimensional interpretation of the morphology of the specimen. On the other hand, the detailed histology is not discernable in whole-mounted material, e.g., will not reveal whether or not the lumen of the spermathecae communicates with the esophagus. I have also observed that almost all of the identified species examined in this study were smaller than reported in the original descriptions, and their sperm funnels were generally shorter in relation to their length than expected. These differences could possibly be attributed to the comparison of live versus fixed material and the contraction of the worms when they are fixed in alcohol, as previously described by Finogenova & Streltsov (1978). An interesting future possibility would be to examine how certain morphological characters change by measuring sampled worms before and after fixation in alcohol.

5. Conclusion

In this thesis I have studied 24 species of Lumbricillus sensu lato, most of which are delimited as good species with high support. The estimated phylogenies between these species suggest that Lumbricillus sensu lato is a non-monophyletic group, containing a monophyletic Lumbricillus sensu stricto, but which requires a revision and its proper delimitation. Lumbricillus semifuscus should be excluded from the genus as it is clearly not related to it, however, no clear match to any included outgroup was found, and thus the placement of this species remains unknown. We found a discrepancy between the phylogenies as to the placement of L. arenarius, L. dubius and 71

L. sp. H which together make up a monophyletic group that sometimes is sister to the remaining Lumbricillus species and sometimes sister to Grania. Transferring these species to a new genus is recommended and further molecular markers are needed to find the true relationship between these groups. Finally, 20 of the 24 included species have been identified, using original descriptions, reinstating the previously synonymized species L. verrucosus and providing all species with re-descriptions.

6. Acknowledgements

First, I would like to thank my supervisor Christer Erséus for his patience, support and invaluable knowledge of Clitellates. I would also like to thank Svante Martinsson for his help regarding the phylogenetic inference and accompanying software’s used as well as always being there for discussions. To my dear classmates Tobias Hofmann and Sanna Persson who helped me through these two years. To Bernard Pfeil and Yingkui Liu for their valuable advice. A huge thanks to my beloved Matilda for taking care of me after late workdays and putting up with my ramblings about worm genitalia. Last but not least, I would like to thank all my friends at the University of Gothenburg for support and great company.

7. References:

Brown, J.M., Hedtke, S.M., Lemmon, A.R. & Lemmon, E.M. (2010) When trees grow too long: investigating the causes of highly inaccurate Bayesian branch-length estimates. Systematic Biology. 59(2), 145-161.

Brown, S., Rouse, G., Hutchings, P. & Colgan, D. (1999) Assessing the usefulness of histone H3, U2 snRNA and 28S rDNA in analyses of polychaete relationships. Australian Journal of Zoology. 47: 499–516.

Bull, J.J., Huelsenbeck, J.P., Cunningham, C.W., Swofford, D.L. & Waddell, P.J. (1993) Partitioning and combining data in phylogenetic analysis. Systematic Biology. 42: 384–397. von Bülow, T. (1957) Systematisch-autökologische Studien an eulitoralen Oligochaeten der Kimbrischen Halbinsel. Kieler Meeresforschungen. 13: 69-116

Černosvitov, L. (1937). System der Enchytraeiden. Bulletin de l'Association Russe pour les Recherches Scientifiques à Prague. 5: 263-295.

Christensen, B. (1960) A comparative cytological investigation of the reproductive cycle of an amphimictic diploid and a parthenogenetic triploid form of Lumbricillus lineatus (O.F.M.)(Oligochaeta, Enchytraeidae). Chromosoma. 11(1): 365-379.

Christensen, B. (1961) Studies on cyto-taxonomy and reproduction in the Enchytraeidae. Hereditas. 47(3‐4): 387-450. 72

Claparède E (1861) Recherches anatomiques sur les Annelides, Turbellariés, Opalines et Gregarines observéesdans les Hébrides. Mémoires de la Société de Physique et d'Histoire Naturelle de Genève 16: 71-164

Coates, K. (1981) New species of Lumbricillus (Oligochaeta, Enchytraeidae) from littoral habitats of British Columbia. Canadian Journal of Zoology. 59(7): 1302-1311.

Coates, K. A. (1989) Phylogeny and origins of Enchytraeidae. Hydrobiologia. 180(1): 17-33.

Coates, K.A. (1990) Marine Enchytraeidae (Oligochaeta, Annelida) of the Albany area, Western Australia. In: Wells FE, Walker DI, Kirkman H, Lethbridge R (eds) Proceedings of the Third International Marine Biological Workshop: The Marine Flora and Fauna of Albany, Western Australia. Western Australia Museum, Perth: 13-41.

Danforth, B.N., Lin, C.P. & Fang, J. (2005) How do insect nuclear ribosomal genes compare to protein‐coding genes in phylogenetic utility and nucleotide substitution patterns?. Systematic Entomology. 30(4): 549-562.

Dayrat, B., Tillier, A., Lecointre, G., & Tillier, S. (2001) New clades of euthyneuran gastropods (Mollusca) from 28S rRNA sequences. Molecular phylogenetics and evolution. 19(2): 225-235.

Degnan, J.H. & Rosenberg, N.A. (2006) Discordance of species trees with their most likely gene trees. PLoS Genet. 2: 762-768.

Degnan, J.H. & Rosenberg, N.A. (2009) Gene tree discordance, phylogenetic inference and the multispecies coalescent. Trends in Ecology and Evolution. 24(6): 332-340.

De Queiroz, K. (2007) Species concepts and species delimitation. Systematic biology. 56(6): 879-886.

De Wit, P. & Erséus, C. (2007) Seven new species of Grania (Annelida: Clitellata: Enchytraeidae) from New Caledonia, South Pacific Ocean. Zootaxa. 1426: 27-50.

Ditlevsen, A. (1904) Studien an Oligochaeten. Zeitschrift für wissenschaftliche Zoologie. 77: 398-480.

Dózsa-Farkas, K. (1990) New enchytraeid species from sphagnum-bogs in Hungary (Oligochaeta: Enchytraeidae). Acta Zoologica Hungarica 36: 265-274.

Dózsa-Farkas, K. (2010) Significance of using nephridia in the taxonomy of family Enchytraeidae: (Annelida: Oligochaeta). Zoology in the Middle East. 51(sup2): 41-53.

Drummond, A.J., Suchard, M.A., Xie, D. & Rambaut, A. (2012) Bayesian phylogenetics with BEAUti and the BEAST 1.7. Molecular Biology and Evolution. 29: 1969-1973

Eisen, G. (1904) Enchytraeidae of the west coast of North America. In Harriman Alaska expedition series. Vol. XII. Annelids. Smithsonian Institution, New York: 1-166.

Elmhirst, R. & Stephenson, J. (1926) On Lumbricillus scoticus n. sp. Journal of the Marine Biological Association of the United Kingdom (New Series). 14(2): 469-473

Erséus, C. (1974) Grania pusilla sp. n. (Oligochaeta, Enchytraeidae) from the West coasts of Norway and Sweden with some taxonomic notes on the genus Grania. Sarsia. 56: 87-94.

Erséus, C. (1976) Littoral Oligochaeta (Annelida) from Eyjafjörôur, North Coast of Iceland. Zoologica Scripta. 5: 5-11

Erséus, C. (1977) Marine Oligochaeta from the Koster Area, west coast of Sweden, with descriptions of two new enchytraeid species. Zoologica Scripta. 6: 293-298.

Erséus, C. (1994) The Oligochaeta. In J. A. Blake & B. Hilbig (Eds.). Taxonomic Atlas of the Benthic Fauna of the Santa Maria Basin and Western Santa Barbara Channel Volume 4 Oligochaeta and Polychaeta: Phyllodocida (Phyllodocidae to Paralacydoniidae) pp. 5-38. Santa Barbara, CA: Santa Barbara Museum of Natural History.

Erseus, C. (2005) Phylogeny of oligochaetous Clitellata. Hydrobiologia. 535(1): 357-372.

Erséus, C., Källersjö, M., Ekman, M., & Hovmöller, R. (2002) 18S rDNA phylogeny of the Tubificidae (Clitellata) and its constituent taxa: dismissal of the Naididae. Molecular phylogenetics and evolution. 22(3): 414-422.

Erséus, C. & Källersjö, M. (2004) 18S rDNA phylogeny of Clitellata (Annelida). Zoologica Scripta. 33(2): 187-196.

Erséus, C. & Lasserre, P. (1976) Taxonomic status and geographic variation of the marine enchytraeid genus Grania Southern (Oligochaeta). Zoologica Scripta. 5: 121-132.

Erséus, C., Rota, E., Matamoros, L. & De Wit, P. (2010) Molecular phylogeny of Enchytraeidae (Annelida, Clitellata). Molecular Phylogenetics and Evolution. 57(2), 849-858.

Finogenova NP, Streltsov VE (1978) Two new species of oligochaetes of the genus Lumbricillus from the east Murman littoral. Biologiya Morya 1: 17-23

Folmer, O., Black, M., Hoeh, W., Lutz, R., & Vrijenhoek, R. (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular marine biology and biotechnology. 3(5): 294-299.

GIMP 2.8.10. GNU Image Manipulation Program. http://www.gimp.org/

Graefe, U. (1989) Systematische Untersuchungen an der Gattung Achaeta (Enchytraeidae, Clitellata) 2. Beschreibung von vier neuen Arten. Mitteilungen aus den Hamburgischen Zoologischen Museum und Institut. Germany: Hamburg. 86, 127-131.

Graefe, U. & Schmelz, R.M. (1999) Indicator values, strategy types and life forms of terrestrial Enchytraeidae and other microannelids. Newsletter on Enchytraeidae. 6: 59–67

Harrison, R.G. (1998) Linking evolutionary pattern and process. Endless Forms: 19-31.

Heled, J. & Drummond, A.J. (2010) Bayesian inference of species trees from multilocus data. Molecular Biology and Evolution. 27(3): 570–580

Huelsenbeck, J.P., Larget, B. & Alfaro, M.E. (2004) Bayesian phylogenetic model selection using reversible jump Markov chain Monte Carlo. Molecular Biology and Evolution. 21: 1123– 1133.

Huson, D.H. & Bryant, D. (2006) Application of Phylogenetic Networks in Evolutionary Studies. Molecular Biology and Evolution. 23(2): 254-267.

Issel, R. (1905) Oligocheti inferiori della fauna italica. Zoologische Jahrbücher. Abteilung für Anatomie und Ontogenie der Tiere, Jena 22: 451-476.

Jamieson B.G.M., Tillier S., Tillier A., Justine J.-L., Ling E., James S., McDonald K. & Hugall A.F. (2002) Phylogeny of the Megascolecidae and Crassiclitellata (Annelida, Oligochaeta): combined versus partitioned analysis using nuclear (28S) and mitochondrial (12S, 16S) rDNA. Zoosystema. 24(4): 707-734.

Jones, G., Aydin, Z., & Oxelman, B. (2014). DISSECT: an assignment-free Bayesian discovery method for species delimitation under the multispecies coalescent. Bioinformatics, btu770.

Katoh, K., Misawa, K., Kuma, K.I. & Miyata, T. (2002) MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic acids research, 30(14): 3059-3066.

Kingman, J.F.C. (1982) The coalescent. Stochastic processes and their applications. 13: 235- 248.

Knöllner, F.H. (1935) Ökologische und Systematische Untersuchungen über Litorale und Marine Oligochäten der Kieler Bucht. Zoologische Jahrbücher. Abteilung für Systematik, Geographie und Biologie der Tier. 66: 425-563.

Kossmagk-Stephan, K.J. (1983) Marine Oligochaeta from a sandy beach of the island of Sylt (North Sea) with description of four new enchytraeid species. Akademie der Wissenschaften und der Literatur. Mikrofauna des Meeresbodens. 89: 1-28. 75

Kress, W.J., García-Robledo, C., Uriarte, M. & Erickson, D.L. (2015) DNA barcodes for ecology, evolution, and conservation. Trends in ecology & evolution. 30(1): 25-35.

Källersjö, M., Von Proschwitz, T., Lundberg, S., Eldenäs, P., & Erséus, C. (2005) Evaluation of ITS rDNA as a complement to mitochondrial gene sequences for phylogenetic studies in freshwater mussels: an example using Unionidae from north‐western Europe. Zoologica Scripta. 34(4): 415-424.

Levinsen, G.M.R. (1883) Systematisk-geografisk Oversigt over de nordiske Annulata, Gephyrea, Chaetognathi og Balanoglossi. II. Videnskabelige Meddelelser fra den Naturhistoriske Forening i Kjøbenhavn for Aaret 1883: 92-350.

Lin, C.P. & Danforth, B.N. (2004) How do insect nuclear and mitochondrial gene substitution patterns differ? Insights from Bayesian analyses of combined datasets. Molecular phylogenetics and evolution. 30(3): 686-702.

Maddison, W.P. & Maddison, D.R. (2015) Mesquite: a modular system for evolutionary analysis. Version 3.02 http://mesquiteproject.org

Marotta, R., Ferraguti, M., Erséus, C. & Gustavsson, L.M. (2008) Combined‐data phylogenetics and character evolution of Clitellata (Annelida) using 18S rDNA and morphology. Zoological Journal of the Linnean Society. 154(1): 1-26.

Martinsson, S. & Erséus, C. (2014) Cryptic diversity in the well-studied terrestrial worm Cognettia sphagnetorum (Clitellata: Enchytraeidae). Pedobiologia. 57(1): 27-35.

Masters, B.C., Fan, V. & Ross, H.A. (2011) Species delimitation–a geneious plugin for the exploration of species boundaries. Molecular Ecology Resources. 11(1): 154-157.

Michaelsen, W. (1886) Untersuchungen uber Enchytraeus möbii Mich. und andere enchytraeiden. Lipsius & Tischer, Kiel, 52 pp.

Michaelsen, W. (1889) Oligochaeten des Naturhistorischen Museums in Hamburg. Jahrbuch der Hamburgischen Wissenschaftlichen Anstalten. 6: 1-17.

Michaelsen, W. (1934) Ein neuer Strand-Enchyträide von Helgoland. Zoologischer Anzeiger. 108: 135-141

Müller, O.F. (1774) Vermiun terrestrium et fluviatilum. Havniae.

Nakamura, Y. (2000) Checklist of enchytraeides (Oligochaeta: Enchytraeidae) of the world. Miscellaneous Publication of the Tohoku National Agricultural Experiment Station (Japan). 24: 29-104.

Nieslen, C.O. & Christensen, B. (1959) The Enchytraeidae Critical Revision and Taxonomy of European Species. Natura Jutlandica. 8-9: 1-160

Nordborg, M. (2001) Coalescent theory. In Handbook of Statistical Genetics (Balding, D.J. et al., eds). Pp. 179-212, Wiley.

Norén, M., & Jondelius, U. (1999) Phylogeny of the Prolecithophora (Platyhelminthes) inferred from 18S rDNA sequences. Cladistics. 15(2): 103-112.

Nurminen, M. (1964) Lumbricillus fennicus sp.n. and some other Enchytraeids (Oligochaeta) from Finland. Annales Zoologici Fennici. 1: 48-51

Nylander, J.A.A., Ronquist, F., Huelsenbeck J.P. & Nieves-Aldrey. J.L. (2004) Bayesian phylogenetic analysis of combined data. Systematic Biology. 53: 47–67.

Palumbi, S.R., Martin, A., Romano, S., McMillan, W.O., Stice, L., & Grabowski, G. (1991) The Simple Fool’s Guide to PCR, Version 2.0. Departement of Zoology, University of Hawaii, Honolulu.

Pamilo, P. & Nei, M. (1988) Relationships between gene trees and species trees. Molecular Biology and Evolution. 5: 568–583.

Puillandre, N., Lambert, A., Brouillet, S. & Achaz, G. (2012) ABGD, Automatic Barcode Gap Discovery for primary species delimitation. Molecular Ecology. 21, 1864–1877.

Rambaut, A. (2009) FigTree v1. 4: Tree figure drawing tool. Available from http://tree.bio.ed.ac.uk/software/figtree/

Rambaut, A. & Drummond, A.J. Available from http://beast.bio.ed.ac.uk/Tracer 2007. Tracer v1.5.

Rannala, B. & Yang, Z. (2003) Bayes Estimation of Species Divergence Times and Ancestral Population Sizes Using DNA Sequences From Multiple Loci. Genetics. 164: 1645–1656.

Rodrigo, A., Bertels, F., Heled, J., Noder, R., Shearman, H. & Tsai, P. (2008) The perils of plenty: what are we going to do with all these genes?. Philosophical Transactions of the Royal Society B: Biological Sciences. 363(1512): 3893-3902.

Ronquist, F., Teslenko, M., van der Mark, P., Ayres, D.L., Darling, A., Höhna, S. & Huelsenbeck, J.P. (2012) MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic biology. 61(3): 539-542.

Rosenberg, N.A. (2007) Statistical tests for taxonomic distinctiveness from observations of monophyly. Evolution. 61(2): 317-323.

Rousset, V., Pleijel, F., Rouse, G.W., Erséus, C. & Siddall, M.E. (2007) A molecular phylogeny of annelids. Cladistics. 23(1): 41-63.

Schmelz, R.M., & Collado, R. (2010a) An updated checklist of currently accepted species of Enchytraeidae (Oligochaeta, Annelida). Newsletter on Enchytraeidae. 12: 67-87.

Schmelz, R.M., & Collado, R. (2010b) A guide to European terrestrial and freshwater species of Enchytraeidae (Oligochaeta). Soil organisms. 82(1): 1-176.

Siddall, M.E., Apakupakul, K., Burreson, E.M., Coates, K.A., Erséus, C., Gelder, S.R., Källersjö, M. & Trapido-Rosenthal, H. (2001) Validating Livanow: molecular data agree that leeches, branchiobdellidans, and Acanthobdella peledina form a monophyletic group of oligochaetes. Molecular phylogenetics and evolution. 21(3): 346-351.

Southern, R. (1909) Contributions towards a monograph of the British and Irish Oligochaeta. Proceedings of the Royal Irish Academy. 27, Section B: 119-182.

Southern, R. (1913) Clare Island survey part 48: Oligochaeta. Proceedings of the Royal Irish Academy. 31: 1-48.

Stephenson, J. (1911) On some littoral Oligochaeta of the clyde. Transactions of the Royal Society of Edinburgh. 48: 31-65.

Stephenson, J. (1922) The Oligochaeta of the Oxford University Spitsbergen Expedition. Proceedings of the Zoological Society of London. 92(4): 1109-1138.

Stephenson, J. (1924) On some Oligochaete worms from Spitsbergen. Results of the Merton College expedition to Spitsbergen. The Annals and Magazine of Natural History, including Zoology, Botany and Geology. London. 13: 210-216.

Stephenson, J. (1925, December). 49. The Oligochæta of Spitsbergen and Bear Island; Some Additions and a Summary. In Proceedings of the Zoological Society of London (Vol. 95, No. 4, pp. 1293-1322). Blackwell Publishing Ltd.

Stephenson, J. (1932) Oligochaeta from Australia, North Carolina, and other parts of the world. Proceedings of the Zoological Society of London 1932: 899-941

Struck, T.H., Paul, C., Hill, N., Hartmann, S., Hösel, C., Kube, M., Lieb, B., Meyer, A., Tiedemann, R., Purschke, G. & Bleidorn, C. (2011) Phylogenomic analyses unravel annelid evolution. Nature. 471(7336): 95-98.

Struck, T.H., Schult, N., Kusen, T., Hickman, E., Bleidorn, C., McHugh, D. & Halanych, K.M. (2007) Annelid phylogeny and the status of Sipuncula and Echiura. BMC Evolutionary Biology. 7(1): 57. 78

Stöver, B.C. & Müller, K.F. (2010) TreeGraph 2: combining and visualizing evidence from different phylogenetic analyses. BMC bioinformatics. 11(1): 7.

Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M. & Kumar, S. (2011) MEGA5: Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Molecular Biology and Evolution. 28: 2731-2739.

Timm, T. (2012) Estonian Enchytraeidae 4. Sublittoral Enchytraeidae (Annelida, Oligochaeta) in the eastern Baltic Sea. Estonian Journal of Ecology 2012,61, 3: 157-172

Tynen, M. J. (1969) New Enchytraeidae (Oligochaeta) from the east coast of Vancouver Island. Canadian Journal of Zoology, 47(3), 387-393.

Tynen, M.J. & Nurminen, M. (1969) A key to the European littoral Enchytraeidae (Oligochaeta). Annales Zoologici Fennici. 6: 150-155

Ude, H. (1901) Die arktischen Enchytraeiden und Lumbriciden sowie die geograpische verbreitung dieser familien. Fauna Arctica. Jena. 2: 1-34. d'Udekem, J. (1854) Description d'une nouvelle espèce d'Enchytraeus. Bulletins de l'Académie Royale des Sciences, des Lettres et des Beaux-Arts de Belgique. Bruxelles. 21: 853-864.

Vejdovsky, F. (1877). Zur Anatomie und Systematik der Enchytraeiden. Sitzungsberichte der Königlichen Böhmischen Gesellschaft der Wissenschaften in Prag, 1877, 294-304.

Vejdovsky, F. (1889) Note sur Pachydrilus subterraneus n. sp. Rev. biol. du Nord de la France. 1(4): 1-3

Welch, P.S. (1914) Studies on the Enchytraeidae of North America. Bulletin of the Illinois State Laboratory of Natural History, Urbana. 10: 123-211.

White, T.J., Bruns, T., Lee, S.J.W.T., & Taylor, J.W. (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR protocols: a guide to methods and applications. 18: 315-322.

Ørsted, A.S. (1844) De regionibus marinis. København.

Figure S1. COI gene tree, estimated using Bayesian inference. Support values showing posterior probabilities. Scale bar showing expected number of changes per site.

Figure S2. 12S gene tree, estimated using Bayesian inference. Support values showing posterior probabilities. Scale bar showing expected number of changes per site.

Figure S3. 16S gene tree, estimated using Bayesian inference. Support values showing posterior probabilities. Scale bar showing expected number of changes per site.

III

Figure S4. 18S gene tree, estimated using Bayesian inference. Support values showing posterior probabilities. Scale bar showing expected number of changes per site.

Figure S5. 28S gene tree, estimated using Bayesian inference. Support values showing posterior probabilities. Scale bar showing expected number of changes per site.

Figure S6. ITS gene tree, estimated using Bayesian inference. Support values showing posterior probabilities. Scale bar showing expected number of changes per site.

Figure S7. H3 gene tree, estimated using Bayesian inference. Support values showing posterior probabilities. Scale bar showing expected number of changes per site. VII

Table S1. Specimens, collection locality and DNA sequences analyzed in this study. GenBank accession numbers are displayed for published sequences. XXXX indicates sequences used in this study that are yet to be published. Species ID Collection locality Genbank Accession No. Voucher No. *=topotype

COI 12S 16S 18S 28S ITS H3 Achaeta bibulba CE1206 ? GU902031 GU901672 GU901767 GU901854 GU901938 XXXX XXXX - Cernosvitoviella minor CE838 ? GU902043 GU901687 GU901780 GU901865 GU901951 XXXX - - Chamaedrilus cognettii CE1042 ? GU902044 GU901688 GU901781 GU901866 GU901952 KF672508 KF672469 SMNH 108410 Grania crassiducta CE573 ? GU902184 GU902117 GU902130 GU902144 GU902157 GU902170 XXXX ? Grania galbina CE258 ? GU902078 GU901724 GU901816 GU901901 GU901987 GU902172 XXXX SMNH 108218* Grania ovitheca CE699 ? GU473675 GU902120 GU902134 GU902148 GU90216 GU473685 - ? Grania pusilla CE698 ? GU473676 GU902122 GU902136 GU902150 GU902163 GU473684 XXXX ? Grania variochaeta CE547 ? GU473681 XXXX XXXX XXXX XXXX GU473683 XXXX ? Henlea ventriculosa CE1021 ? GU902085 GU901734 GU901825 GU901910 GU901996 XXXX XXXX SMNH 108422 Marionina communis CE811 ? GU902098 GU901748 GU901839 GU901923 GU902011 XXXX XXXX - Mesenchytraeus flavus CE847 ? GU902100 GU901752 GU901843 GU901926 GU902015 KF672545 XXXX - Lumbricillus arenarius CE959 SE, Amundön XXXX arenarius CE962 SE, Amundön GU902086 GU901736 GU901826 GU901911 GU901998 XXXX XXXX arenarius CE1001 SE, Kristineberg XXXX XXXX XXXX XXXX arenarius CE3304 SE, Tjärnö XXXX arenarius CE8474 NO, Svalbard XXXX arenarius CE20720 NO, Svalbard XXXX XXXX XXXX arenarius CE20721 NO, Svalbard XXXX arenarius CE20748 NO, Svalbard XXXX arenarius CE20749 NO, Svalbard XXXX arenarius CE20750 NO, Svalbard XXXX arenarius CE20751 NO, Svalbard XXXX arenarius CE20758 NO, Svalbard XXXX arenarius CE20763 NO, Svalbard XXXX arenarius CE20764 NO, Svalbard XXXX arenarius CE24578 NO, Lofoten XXXX arenarius CE24579 NO, Lofoten XXXX arenarius CE24580 NO, Lofoten XXXX arenarius CE24586 NO, Lofoten XXXX arenarius CE24587 NO, Lofoten XXXX arenarius CE25064 NO, Gildeskål XXXX arenarius CE25099 NO, Gildeskål XXXX arenarius CE25110 NO, Gildeskål XXXX buelowi CE891 SE, Öddö GU902087 GU901735 GU901827 GU901912 GU901999 XXXX XXXX buelowi CE5224 SE, Tjärnö XXXX XXXX XXXX buelowi CE22771 NO, Mageröya XXXX XXXX XXXX buelowi CE22293 NO, Neröyfjorden XXXX XXXX XXXX buelowi CE23577 NO, Tjeldsundet XXXX buelowi CE23273 NO, Tromsö XXXX XXXX XXXX buelowi CE23375 NO, Tromsö XXXX

VIII

Species ID Collection locality COI 12S 16S 18S 28S ITS H3 Voucher No. buelowi CE23376 NO, Tromsö XXXX buelowi CE24671 NO, Lofoten XXXX buelowi CE24672 NO, Lofoten XXXX buelowi CE24673 NO, Lofoten XXXX buelowi CE24678 NO, Lofoten XXXX buelowi CE24680 NO, Lofoten XXXX buelowi CE24687 NO, Lofoten XXXX buelowi CE24688 NO, Lofoten XXXX buelowi CE24689 NO, Lofoten XXXX buelowi CE24690 NO, Lofoten XXXX dubius CE5221 SE, Tjärnö XXXX XXXX XXXX XXXX XXXX XXXX XXXX dubius CE5223 SE, Tjärnö XXXX XXXX dubius CE22757 NO, Mageröya XXXX dubius CE22767 NO, Mageröya XXXX XXXX XXXX dubius CE23370 NO, Tromsö XXXX XXXX XXXX XXXX XXXX XXXX XXXX dubius CE23371 NO, Tromsö XXXX dubius CE23756 NO, Bognäs XXXX dubius CE24700 NO, Lofoten XXXX dubius CE24711 NO, Lofoten XXXX dubius CE24726 NO, Lofoten XXXX dubius LM275 UK, Plymouth XXXX fennicus CE2767 SE, Öland XXXX XXXX XXXX XXXX XXXX XXXX XXXX fennicus CE2768 SE, Öland XXXX fennicus CE2988 SE, Öland XXXX fennicus CE6092 SE, Färlev XXXX cf. helgolandicus CE673 SE, Gotland XXXX XXXX XXXX XXXX XXXX XXXX XXXX cf. helgolandicus CE975 SE, Sillvik XXXX XXXX XXXX cf. helgolandicus CE1907 SE, Öland XXXX XXXX cf. helgolandicus CE1915 SE, Öland XXXX XXXX XXXX XXXX XXXX XXXX XXXX cf. helgolandicus CE1905 SE, Öland XXXX XXXX cf. helgolandicus CE2548 SE, Saltholmen XXXX XXXX XXXX XXXX cf. helgolandicus CE2552 SE, Saltholmen XXXX cf. helgolandicus CE19321 NO, Luster Nes XXXX cf. helgolandicus CE19327 NO, Luster Nes XXXX cf. helgolandicus CE19328 NO, Luster Nes XXXX cf. helgolandicus CE19333 NO, Luster Nes XXXX cf. helgolandicus CE19334 NO, Luster Nes XXXX cf. helgolandicus CE20768 NO, Svalbard XXXX cf. helgolandicus CE21485 NO, Larvik XXXX cf. helgolandicus CE21489 NO, Larvik XXXX cf. helgolandicus CE22769 NO, Mageröya XXXX cf. helgolandicus CE21987 NO, Nedrehus XXXX cf. helgolandicus CE21990 NO, Nedrehus XXXX cf. helgolandicus CE22042 NO, Nedrehus XXXX cf. helgolandicus CE22268 NO, Neröyfjorden XXXX cf. helgolandicus CE22269 NO, Neröyfjorden XXXX cf. helgolandicus CE22270 NO, Neröyfjorden XXXX IX

Species ID Collection locality COI 12S 16S 18S 28S ITS H3 Voucher No. cf. helgolandicus CE22693 NO, Porsanger XXXX cf. helgolandicus CE25060 NO, Gildeskål XXXX cf. helgolandicus CE25061 NO, Gildeskål XXXX cf. helgolandicus CE25062 NO, Gildeskål XXXX kaloensis CE977 SE, Sillvik GU902088 GU901737 GU901828 GU901913 GU902000 XXXX XXXX kaloensis CE978 SE, Sillvik XXXX XXXX XXXX kaloensis CE5412 NO, Bergen XXXX kaloensis CE5414 NO, Bergen XXXX kaloensis CE24658 NO, Lofoten XXXX kaloensis CE24663 NO, Lofoten XXXX kaloensis CE24667 NO, Lofoten XXXX kaloensis CE24670 NO, Lofoten XXXX kaloensis CE24958 NO, Gildeskål XXXX kaloensis CE24959 NO, Gildeskål XXXX kaloensis CE24982 NO, Gildeskål XXXX kaloensis CE24983 NO, Gildeskål XXXX kaloensis CE24986 NO, Gildeskål XXXX kaloensis CE24988 NO, Gildeskål XXXX kaloensis CE24993 NO, Gildeskål XXXX kaloensis CE24994 NO, Gildeskål XXXX kaloensis CE24996 NO, Gildeskål XXXX kaloensis CE24997 NO, Gildeskål XXXX kaloensis CE25000 NO, Gildeskål XXXX kaloensis CE25030 NO, Gildeskål XXXX knoellneri CE980 SE, Hinholmskilen XXXX XXXX XXXX XXXX XXXX XXXX XXXX knoellneri CE982 SE, Hinholmskilen XXXX XXXX XXXX XXXX knoellneri CE19369 NO, Nes XXXX XXXX XXXX knoellneri CE20761 NO, Svalbard XXXX XXXX XXXX knoellneri CE20762 NO, Svalbard XXXX knoellneri CE20765 NO, Svalbard XXXX knoellneri CE22615 NO, Porsanger XXXX XXXX XXXX knoellneri CE22616 NO, Porsanger XXXX knoellneri CE23252 NO, Tromsö XXXX XXXX XXXX knoellneri CE23253 NO, Tromsö XXXX lineatus CE601 SE, Tjurkö XXXX XXXX XXXX XXXX XXXX XXXX XXXX lineatus CE664 SE, Eksta XXXX XXXX XXXX XXXX XXXX XXXX lineatus CE670 SE, Gotland XXXX XXXX XXXX lineatus CE963 SE, Amundön XXXX lineatus CE976 SE, Sillvik XXXX lineatus CE983 SE, Hinholmskilen GU902089 GU901738 GU901829 GU901914 GU902001 XXXX XXXX lineatus CE984 SE, Hinholmskilen XXXX lineatus CE986 SE, Gottskär XXXX XXXX XXXX XXXX XXXX XXXX lineatus CE989 SE, Gottskär XXXX lineatus CE1639 SE, Tjärnö XXXX XXXX XXXX XXXX XXXX XXXX XXXX lineatus CE1640 SE, Tjärnö XXXX XXXX lineatus CE1644 SE, Tjärnö XXXX lineatus CE1694 ES, Galicia XXXX XXXX XXXX XXXX XXXX XXXX XXXX X

Species ID Collection locality COI 12S 16S 18S 28S ITS H3 Voucher No. lineatus CE1860 SE, Hovs Hallar XXXX lineatus CE1862 SE, Aspö XXXX XXXX lineatus CE1863 SE, Aspö XXXX XXXX lineatus CE1868 SE, Norje XXXX XXXX XXXX lineatus CE1875 SE, Torhamn XXXX XXXX lineatus CE1880 SE, Aspö XXXX lineatus CE1894 SE, Skärlöv XXXX XXXX lineatus CE1900 SE, Skärlöv XXXX XXXX XXXX lineatus CE1911 SE, Öland XXXX XXXX XXXX XXXX lineatus CE1912 SE, Öland XXXX XXXX lineatus CE1914 SE, Öland XXXX lineatus CE2509 SE, St Förö XXXX XXXX XXXX lineatus CE2511 SE, St Förö XXXX lineatus CE2513 SE, St Förö XXXX lineatus CE2790 SE, Öland XXXX XXXX XXXX lineatus CE3306 SE, Tjärnö XXXX lineatus CE3307 SE, Tjärnö XXXX lineatus CE5409 NO, Bergen XXXX XXXX lineatus CE5410 NO, Bergen XXXX lineatus CE5413 NO, Bergen XXXX lineatus CE5434 NO, Bergen XXXX lineatus CE5447 NO, Bergen XXXX XXXX lineatus CE12043 NO, Sola XXXX lineatus CE12044 NO, Sola XXXX lineatus CE12045 NO, Sola XXXX lineatus CE12046 NO, Sola XXXX lineatus CE18430 NL, Texel XXXX XXXX lineatus CE19299 NO, Luster Nes XXXX lineatus CE19303 NO, Luster Nes XXXX lineatus CE21688 NO, Kragerö XXXX lineatus CE21815 NO, Lyngdal XXXX lineatus CE21828 NO, Lyngdal XXXX lineatus CE21986 NO, Nedrehus XXXX lineatus CE22694 NO, Porsanger XXXX lineatus CE22604 NO, Porsanger XXXX lineatus CE22605 NO, Porsanger XXXX lineatus CE22606 NO, Porsanger XXXX lineatus CE23262 NO, Tromsö XXXX lineatus CE23263 NO, Tromsö XXXX lineatus CE23267 NO, Tromsö XXXX lineatus CE23154 NO, Rotsundselv XXXX lineatus CE24969 NO, Gildeskål XXXX lineatus CE24970 NO, Gildeskål XXXX lineatus CE24975 NO, Gildeskål XXXX lineatus CE24981 NO, Gildeskål XXXX lineatus LM222 SE, Öland XXXX lineatus LM292 SE, Falkenberg XXXX XI

Species ID Collection locality COI 12S 16S 18S 28S ITS H3 Voucher No. lineatus LM304 SE, Hovs Hallar XXXX lineatus LM306 SE, Hovs Hallar XXXX pagenstecheri A CE1896 SE, Öland XXXX XXXX XXXX XXXX XXXX XXXX XXXX pagenstecheri A CE1897 SE, Öland XXXX XXXX XXXX pagenstecheri A CE1899 SE, Öland XXXX XXXX pagenstecheri A CE2497 SE, St Förö XXXX XXXX XXXX XXXX XXXX XXXX pagenstecheri A CE2498 SE, St Förö XXXX pagenstecheri A CE2500 SE, St Förö XXXX pagenstecheri B CE22727 NO, Porsanger XXXX XXXX XXXX pagenstecheri B CE22586 NO, Porsanger XXXX XXXX XXXX XXXX XXXX XXXX XXXX pagenstecheri C CE1699 ES, Galicia XXXX XXXX XXXX XXXX pagenstecheri C CE20718 NO, Svalbard XXXX XXXX XXXX XXXX XXXX XXXX XXXX pagenstecheri D CE22728 NO, Porsanger XXXX XXXX XXXX XXXX XXXX XXXX XXXX pagenstecheri D CE22729 NO, Porsanger XXXX XXXX XXXX pagenstecheri D CE23482 NO, Bjerkvik XXXX XXXX XXXX pagenstecheri D SM140 GL, Disko XXXX pagenstecheri D SM191 GL, Disko XXXX pumilio CE3346 UK, Cardiff XXXX pumilio CE3347 UK, Cardiff XXXX XXXX XXXX XXXX XXXX XXXX XXXX pumilio CE3427 UK, Cardiff XXXX pumilio CE3428 UK, Cardiff XXXX pumilio CE3430 UK, Cardiff XXXX pumilio CE3436 UK, Cardiff XXXX pumilio CE3437 UK, Cardiff XXXX rivalis CE658 SE, Eksta GU902090 GU901739 GU901830 GU901915 GU902002 XXXX XXXX rivalis CE668 SE, Gotland XXXX XXXX rivalis CE890 SE, Öddö XXXX XXXX XXXX XXXX XXXX XXXX XXXX rivalis CE1873 SE, Norje XXXX rivalis CE1874 SE, Torhamn XXXX XXXX XXXX XXXX rivalis CE2502 SE, St Förö XXXX XXXX XXXX rivalis CE2503 SE, St Förö XXXX rivalis CE2506 SE, St Förö XXXX rivalis CE2523 SE, St Förö XXXX XXXX rivalis CE2784 SE, Öland XXXX XXXX rivalis CE22595 NO, Porsanger XXXX rivalis CE22596 NO, Porsanger XXXX rivalis CE22600 NO, Porsanger XXXX rivalis CE22602 NO, Porsanger XXXX rivalis CE23129 NO, Rotsundselv XXXX rivalis CE23130 NO, Rotsundselv XXXX rivalis CE23132 NO, Rotsundselv XXXX rivalis CE23247 NO, Tromsö XXXX rivalis SM146 UK, Derby XXXX rivalis SM190 ? XXXX rubidus CE2549 SE, Saltholmen XXXX XXXX XXXX XXXX XXXX XXXX rubidus CE2551 SE, Saltholmen XXXX rubidus CE2553 SE, Saltholmen XXXX XII

Species ID Collection locality COI 12S 16S 18S 28S ITS H3 Voucher No. rubidus CE6060 SE, Färlev XXXX XXXX XXXX XXXX XXXX XXXX XXXX rubidus CE6061 SE, Färlev XXXX rubidus CE6105 SE, Färlev XXXX rubidus CE6106 SE, Färlev XXXX rubidus CE6107 SE, Färlev XXXX rubidus CE6108 SE, Färlev XXXX rubidus LM207 SE, Hovs Hallar XXXX rutilus CE600 SE, Tjurkö XXXX XXXX XXXX XXXX XXXX XXXX XXXX rutilus CE661 SE, Eksta XXXX XXXX XXXX XXXX XXXX XXXX XXXX rutilus CE1869 SE, Norje XXXX XXXX rutilus CE1887 SE, Torhamn XXXX XXXX rutilus CE1903 SE, Öland XXXX XXXX rutilus CE1949 SE, Höganäs XXXX XXXX XXXX rutilus CE2510 SE, St Förö XXXX rutilus CE2524 SE, St Förö XXXX XXXX XXXX rutilus CE2800 SE, Öland XXXX XXXX XXXX rutilus CE2801 SE, Öland XXXX rutilus CE2936 SE, Öland XXXX rutilus CE2937 SE, Öland XXXX rutilus CE2938 SE, Öland XXXX rutilus CE2939 SE, Öland XXXX rutilus CE2940 SE, Öland XXXX rutilus CE3060 SE, Ryaverket XXXX XXXX rutilus CE3061 SE, Ryaverket XXXX XXXX XXXX XXXX rutilus CE3502 UK, Manchester XXXX XXXX XXXX XXXX XXXX XXXX rutilus CE3506 UK, Manchester XXXX rutilus CE3508 UK, Manchester XXXX rutilus CE3510 UK, Manchester XXXX rutilus CE9267 SE, Gotland XXXX rutilus CE19052 SE, Gotland XXXX rutilus CE21629 NO, Larvik XXXX rutilus CE21632 NO, Larvik XXXX rutilus CE21636 NO, Larvik XXXX rutilus CE21808 NO, Lyngdal XXXX semifuscus CE2247 UK, Anglesey XXXX semifuscus CE2248 UK, Anglesey XXXX XXXX XXXX XXXX XXXX XXXX semifuscus CE2249 UK, Anglesey XXXX semifuscus CE2250 UK, Anglesey XXXX semifuscus CE2252 UK, Anglesey XXXX semifuscus CE23750 NO, Bognäs XXXX XXXX XXXX XXXX XXXX XXXX XXXX semifuscus CE23751 NO, Bognäs XXXX semifuscus CE23752 NO, Bognäs XXXX semifuscus CE23753 NO, Bognäs XXXX semifuscus CE24657 NO, Lofoten XXXX tuba CE879 SE, Strömstad GU902091 GU901740 GU901831 GU901916 GU902003 XXXX tuba CE22064 NO, Nedrehus XXXX tuba CE22614 NO, Porsanger XXXX XXXX XXXX XXXX XXXX XXXX XIII

Species ID Collection locality COI 12S 16S 18S 28S ITS H3 Voucher No. tuba CE22353 NO, Årdalstangen XXXX tuba CE23485 NO, Bjerkvik XXXX XXXX tuba CE22772 NO, Nordkapp XXXX tuba CE22354 NO, Årdalstangen XXXX verrucosus CE968 SE, Lilleby XXXX XXXX XXXX XXXX XXXX XXXX XXXX verrucosus CE6135 SE, Ingalsröd XXXX XXXX verrucosus CE9845 SE, Strömsvattnet XXXX XXXX verrucosus CE10236 SE, Strömstad XXXX verrucosus CE10238 SE, Strömstad XXXX verrucosus CE21479 NO, Larvik XXXX verrucosus CE21486 NO, Larvik XXXX verrucosus CE21490 NO, Larvik XXXX verrucosus CE21494 NO, Larvik XXXX verrucosus CE21500 NO, Larvik XXXX verrucosus CE21811 NO, Lyngdal XXXX verrucosus CE21816 NO, Lyngdal XXXX verrucosus CE21821 NO, Lyngdal XXXX verrucosus CE21822 NO, Lyngdal XXXX verrucosus CE22701 NO, Porsanger XXXX XXXX XXXX verrucosus CE23757 NO, Bognäs XXXX verrucosus CE23758 NO, Bognäs XXXX verrucosus CE24576 NO, Lofoten XXXX verrucosus CE24577 NO, Lofoten XXXX viridis CE12037 NO, Sola XXXX XXXX XXXX XXXX viridis CE12038 NO, Sola XXXX viridis CE12039 NO, Sola XXXX viridis CE12040 NO, Sola XXXX viridis CE13584 FR, Roscoff XXXX XXXX XXXX viridis CE13590 FR, Roscoff XXXX viridis CE23254 NO, Tromsö XXXX XXXX XXXX XXXX XXXX XXXX XXXX viridis CE23255 NO, Tromsö XXXX viridis CE23260 NO, Tromsö XXXX sp. E CE1976 SE, Mölle XXXX XXXX XXXX XXXX XXXX XXXX XXXX sp. E CE1979 SE, Mölle XXXX XXXX sp. E CE12041 NO, Sola XXXX XXXX XXXX sp. E CE12042 NO, Sola XXXX sp. F CE2659 UK, Plymouth XXXX XXXX XXXX XXXX XXXX XXXX XXXX sp. F LM282 UK, Plymouth XXXX sp. G CE2661 UK, Plymouth XXXX XXXX XXXX XXXX XXXX XXXX XXXX sp. G CE2246 UK, Angleysey XXXX XXXX XXXX XXXX XXXX XXXX sp. G CE23373 NO, Tromsö XXXX sp. H CE19301 NO, Luster Nes XXXX sp. H CE19302 NO, Luster Nes XXXX sp. H CE23136 NO, Rotsundselv XXXX XXXX XXXX XXXX XXXX XXXX XXXX sp. H CE23181 NO, Rotsundselv XXXX sp. H CE24967 NO, Gildeskål XXXX sp. H CE24968 NO, Gildeskål XXXX

XIV