Identification of Important Regulators of Colon Cancer Tumorigenesis by Functional Screening

University of Nebraska Medical Center DigitalCommons@UNMC

Theses & Dissertations Graduate Studies

Spring 5-6-2017

Identification of Important Regulators of Colon Cancer Tumorigenesis By Functional Screening

Haowei Yi University of Nebraska Medical Center

Follow this and additional works at: https://digitalcommons.unmc.edu/etd

Part of the Cancer Biology Commons

Recommended Citation Yi, Haowei, "Identification of Important Regulators of Colon Cancer Tumorigenesis By Functional Screening" (2017). Theses & Dissertations. 192. https://digitalcommons.unmc.edu/etd/192

This Dissertation is brought to you for free and open access by the Graduate Studies at DigitalCommons@UNMC. It has been accepted for inclusion in Theses & Dissertations by an authorized administrator of DigitalCommons@UNMC. For more information, please contact [email protected].

IDENTIFICATION OF IMPORTANT REGULATORS OF COLON CANCER

TUMORIGENESIS BY FUNCTIONAL SCREENING by Haowei Yi

A DISSERTATION

Presented to the Faculty of The University of Nebraska Graduate College in Partial Fulfillment of Requirements for the Degree of Doctor of Philosophy

Genetic, Cell Biology & Anatomy Graduate Program

Under the Supervision of Professor Jenny Wang

University of Nebraska Medical Center Omaha, Nebraska

April, 2017

Supervisory Committee: Andrew Dudley, Ph.D. Jennifer Black, Ph.D. Shantaram Joshi, Ph.D. Xu Luo, Ph.D.

ACKNOWLEDGMENTS

I would like to owe my sincere gratitude to my adviser, Dr. Jenny Wang, for her patience, constant support, encouragement, and scientific guidance throughout my studies. Her continuous support helped me to overcome stressful situations, and to complete this dissertation successfully.

I would also like to thank my committee members, Dr. Michael Brattain, Dr. Runqing Lu,

Dr. Samming Wang, Dr. Jennifer Black, Dr. Xu Luo, Dr. Shantaram Joshi, Dr. Andrew Dudley for their suggestions, thoughtful ideas, and scientific evaluations throughout my study. Their insightful comments and criticisms helped me to enthusiastically focus my research.

I am thankful to my colleague Dr. Liying Geng, for her constant help and constructive advice that helped me to sort out technical difficulties and conceptualize my work. I am also thankful to my pervious lab mates, Dr. Yang Zhang, Dr. Xiaolin Zhou for their support all along.

I would thank Dr. Geoffrey Talmon and Dr. Adrian Black for their kind help on the histology part of my study.

I would like to thank all faculties and staffs in the Department of GCBA for their help on my study in this department.

I especially thank and appreciate my wife, Ting Jia for her love, spiritual support to me. I sincerely thank my parents, for their love, encouragement and support. I also offer my sincere thanks to all my friends, for their help on my work and on my life.

Lastly, I would like to thank my country, China. I am thankful to the China Scholarship

Council for providing financial support to pursue my PhD program.

ABSTRACT

TGFβ signaling is an important regulator in colon cancer. miRNAs regulate TGFβ signaling at multiple levels. In this study, through a functional screening, we identified miR-

487b-3p and miR-656-3p, which modulate TGFβ effect in colon cancer cells. Further studies revealed that GRM3 and VGLUT3 are their respective targets.

GRM3, a Metabotropic glutamate receptor in glutamatergic pathway is significantly upregulated in majority of human colonic adenocarcinomas tested and colon cancer cell lines.

Knockdown of GRM3 expression or inhibition of GRM3 activation in colon cancer cells reduces cell survival and anchorage-independent growth in vitro and inhibits tumor growth in vivo. Mechanistically, GRM3 antagonizes TGFβ-mediated activation of protein kinase A and inhibition of AKT. In addition, TGFβ signaling increases GRM3 protein stability and knockdown of GRM3 enhances TGFβ-mediated tumor suppressor function. Since miR-487b-

3p directly targets GRM3, overexpression of miR-487b-3p mimics the effects of GRM3 knockdown in vitro and in vivo. Expression of miR-487b-3p is decreased in colon adenocarcinomas and inversely correlates with GRM3 expression.

VGLUT3, a vesicular glutamate transporter, is also markedly upregulated in human colonic adenocarcinomas and colon cancer cell lines. Knockdown of VGLUT3 expression in colon cancer cells reduces cell survival and anchorage-independent growth in vitro and inhibits tumor growth in vivo. Mechanistically, VGLUT3 antagonizes TGFβ-mediated suppression of cell survival and clonogenicity by maintaining AKT activation. MiR-656-3p represses

VGLUT3 expression and mimics the effects of VGLUT3 knockdown in vitro and in vivo. iii

Moreover, expression of miR-656-3p is decreased in colon cancer specimens and inversely correlates with VGLUT3 expression.

This is particularly interesting and important from a therapeutic standpoint because numerous glutamatergic signaling inhibitor, many of which have been found unsuitable for treatment of neuropsychiatric disorders for reasons such as inability to readily penetrate blood brain barriers. Since GRM3 and VGLUT3 are upregulated in colon cancer, but rarely expressed in normal peripheral tissues, targeting GRM3 and VGLUT3 with such agents would not likely cause adverse neurological or peripheral side effects, making them attractive and specific molecular targets for colon cancer treatment.

TABLE OF CONTENTS

ACKNOWLEDGMENTS ...... i

ABSTRACT ...... ii

TABLE OF CONTENTS ...... iv

LIST OF TABLE ...... viii

LIST OF FIGURES ...... ix

LIST OF ABBREVIATIONS ...... xi

CHAPTER 1：INTRODUCTION ...... 1

Colorectal cancer ...... 1

TGFβ and cancer ...... 1

MiRNAs ...... 6

miRNAs and cancer ...... 9

MiRNAs and TGFβ ...... 10

Glutamate and its signaling ...... 11

CHARAPTER 2：MATERIAL AND METHODS ...... 18

Cell lines and reagents ...... 18

Western blot analysis, RT-PCR and Q-PCR assays ...... 18

Apoptosis assays ...... 19

Soft agarose assays ...... 19 v

Plasmids construction and lentiviral infection ...... 19

Luciferase Assays ...... 20

In vivo xenograft model ...... 20

IHC staining of GRM3/VGLUT3 in xenograft tumors and human patient samples ...... 21

TUNEL assay and Ki67 staining ...... 21

In Situ hybridization ...... 22

Transwell assays ...... 22

Statistical analysis ...... 22

CHAPTER 3: MIRNA LIBRARY SCREENING...... 25

CHAPTER 4 ：THE MIR-487B-3P/GRM3/TGFΒ SIGNALING AXIS IS AN IMPORTANT

REGULATOR OF COLON CANCER TUMORIGENESIS ...... 28

INTRODUCTION ...... 28

RESULTS ...... 30

Expression of GRM3 is markedly increased in colon cancer specimens...... 30

GRM3 is critical for tumor growth in vivo...... 33

A GRM3 antagonist mimics GRM3 knockdown in vitro and in vivo...... 39

GRM3 antagonizes TGFβ to regulate cell survival through the PKA/AKT signaling axis. .... 42

MiR-487b-3p regulates GRM3 expression in colon cancer cells...... 46

MiR-487b-3p regulates PKA/AKT activation and mimics GRM3 knockdown effect in colon vi

cancer cells...... 47

MiR-487b-3p inhibits tumor growth in vivo...... 52

Expression of miR-487b-3p is decreased in colon cancer specimens...... 54

DISCUSSION ...... 63

CHAPTER 5：MICRORNA-656-3P/VGLUT3 CROSSTALKS WITH TGFΒ SIGNALING TO

REGULATE COLON CANCER TUMORIGENESIS ...... 66

INTRODUCTION ...... 66

RESULTS ...... 67

Expression of VGLUT3 is significantly increased in colon cancer specimens...... 67

Knockdown of VGLUT3 expression decreases cell survival and clonogenicity of colon cancer

cells and enhances TGFβ effect...... 71

VGLUT3 plays a critical role in tumor growth in vivo...... 74

MiR-656-3p regulates VGLUT3 expression in colon cancer cells...... 76

MiR-656-3p inhibits AKT activation and mediates stress-induced apoptosis and clonogenicity

in colon cancer cells...... 77

MiR-656-3p inhibits tumor growth in vivo...... 82

Expression of miR-656-3p is decreased in colon cancer specimens...... 84

DISCUSSION ...... 91

CHAPTER 6: DISCUSSION AND FUTURE DIRECTIONS ...... 94

miRNAs and TGFβ ...... 94 vii

Regulation of glutamate homeostasis in cancers ...... 94

Glutamate activates multiple pathways through multiple receptors ...... 96

Regulation of GRM3 ...... 96

Other insights of VGLUT3 and GRM3 ...... 97

Pharmacology of glutamate pathway inhibitors in cancer treatment ...... 98

Literature Cited ...... 99

viii

LIST OF TABLE

Table 2.1 Antibodies ...... 23

Table 2.2 Primers ...... 24

Table 3.1 List of increased and decreased miRNAs from screening ...... 27

LIST OF FIGURES

Figure 1.1. Schematic diagram of TGFβ signaling pathway...... 2

Figure 1.2 Biogenesis of miRNAs...... 8

Figure 1.3. iGluR structure and activation...... 14

Figure 1.4 mGluR structure and conformational activation...... 15

Figure 3.1 workflow of miRNAs screening in FET cells using TGFβ...... 27

Figure 4.1. GRM3 expression is elevated significantly in colon cancer specimens...... 31

Figure 4.2. GRM3 expression is upregulated in colon cancer cells...... 34

Figure 4.3. GRM3 mediates tumor growth in vivo...... 37

Figure 4.4. The GRM3 antagonist inhibits tumor growth in vivo...... 40

Figure 4.5. GRM3 antagonizes TGFβ-mediated activation of PKA/AKT...... 44

Figure 4.6. GRM3 is a direct target of miR-487b-3p...... 48

Figure 4.7. MiR-487b-3p mimics the effect of GRM3 knockdown in colon cancer cells...... 51

Figure 4.8. MiR-487b-3p suppresses GRM3 expression and inhibits tumor growth in vivo. . 53

Figure 4.9. Expression of miR-487b-3p is decreased in colon cancer specimens...... 55

Fig. 4.10. miR-487b-5p dose not target GRM3 ...... 57

Fig. 4.11. Comparison of miR-487b-3p expression between normal colon and colon tumor samples ...... 58

Fig. 4.12. GRM4 mRNA expression in HCECs and colon cancer cell lines ...... 59 x

Fig. 4.13. Comparison of percentage of GRM3 positive cells in well-, moderately- and poorly- differentiated colon tumors...... 60

Fig. 4.14. miR-487b-3p and knockdown of GRM3 inhibit ERK activation ...... 61

Fig. 4.15. GRM3 has no effect on BMP signaling ...... 62

Figure 5.1. VGLUT3 expression is elevated in colon cancer cells and patient specimens...... 69

Figure 5.2. Knockdown of VGLUT3 sensitizes colon cancer cells to stress-induced apoptosis and enhances TGFβ effect...... 72

Figure 3. VGLUT3 mediates tumor growth of colon cancer cells in vivo...... 74

Figure 5.4. VGLUT3 is a direct target of miR-656-3p...... 78

Figure 5.5. MiR-656-3p mimics the effect of VGLUT3 knockdown in colon cancer cells..... 80

Figure 5.6. MiR-656b-3p suppresses VGLUT3 expression and inhibits tumor growth in vivo.

...... 83

Figure 5.7. Expression of miR-656-3p is decreased in colon cancer specimens...... 85

Figure 5.8. A proposed model of crosstalk between miR-656-3p, VGLUT3 and TGFβ signaling

...... 87

Fig. 5.9. Correlation of VGLUT3 with tumor grade, stages and differation ...... 88

Fig. 5.10. VGLUT3 has no effect on ERK and PKA activation ...... 89

Fig. 5.11. Glutamate secretion was evaluated in the control and VGLUT3 knockdown cells. 90

LIST OF ABBREVIATIONS

AGO Argonaute family

AMPA a-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid

ATD the amino terminal domain

BMP bone morphogenetic protein cAMP cyclic AMP

CRC colorectal cancer

CRD cysteine-rich domain

CTD C-terminal domain

CTGF connective tissue growth factors

DNRII dominant negative TGFβ RII

EAATs excitatory amino acid transporter

EGF epidermal growth factor

GFDS growth factor deprivation stress

GPCRs G-protein-coupled receptors

GRKs GPCR kinases

HCEC immortalized human colon epithelial cells hTERT human tolomerase recerse transcriptase iGluR ionotropic receptors

IP3 inositol 1,4,5-trisphosphate

LBD ligand binding domain xii

mGluR metabotropic receptors miRNAs MicroRNAs

MMPs the matrix metalloproteinase

NMDA N-methyl-D-aspartate

PKA of protein kinase A

PNS peripheral nervous system

Pol II RNA polymerase II

RISC RNA-induced silencing complex

SBE SMAD binding element

SHIP Src homology 2 domain-containing 5’ inositol phosphatase

SNPs polymorphisms

− SXC independent cystine/glutamate exchanger, System xc

TGFβ transforming growth factor beta

TMAs Tissue micro-arrays

TMD transmembrane domains

UTR 3’-untranslated regions

VEGF vascular endothelial growth factor

VGLUTs vesicular glutamate transporters

CHAPTER 1：INTRODUCTION

Colorectal cancer

Colorectal cancer (CRC) is a common and fatal disease. Nearly 150,000 U.S. residents are diagnosed annually with CRC, and approximately one-third of CRC patients die from the disease1. CRC begins as a benign adenomatous polyp, which develops into an advanced adenoma with high grade dysplasia and then progresses to an invasive cancer. Stage I and II tumors which are confined within the wall of the colon are curable by surgery. Combination of surgery and adjuvant chemotherapy can increase 3-year disease free survival for up to 73% of cases of stage III tumor. But stage IV tumors which metastasize to distant sites are usually incurable 2. Therefore, understanding the mechanisms of CRC development and metastasis and identifying novel targets for CRC treatment are of importance and challenge.

TGFβ and cancer

The transforming growth factor-beta (TGFβ) was discovered more than three decades ago and was isolated as a secreted factor from sarcoma virus-infected cells 3 4.TGFβs are 25-kDa cytokines that play a pivotal role during mammalian development and act as a regulator of wound healing, fibrosis, angiogenesis and differentiation of the cells. More than 40 different members have been identified in this family. In mammalian cells, there are three TGFβ isoforms

(TGFβ1, TGFβ2, and TGFβ3), among which TGFβ 1 is the most abundant and universally expressed isoform 5. TGFβ signaling is initiated by TGFβ binding to TGFβ receptor type II

(TGFβRII) which binds and activates TGFβ receptor type I (TGFβRI). Activated TGFβRI subsequently phosphorylates SMAD2 and SMAD3 at the carboxyl terminal serines. Following phosphorylation, SMAD2 and SMAD3 form heteroligomeric complexes with the co-SMAD, 2

SMAD4, and accumulate in the nucleus. SMAD proteins recognize DNA sequence CAGAC, called SMAD binding element (SBE). They also bind to some other GC rich sequences, but the binding for those DNA sequences is weak. SMADs usually associate with other transcriptional cofactors to achieve specific regulation of TGFβ-mediated transcription response (Fig 1.1) 6.

Other members in the TGFβ superfamily, such as bone morphogenetic proteins (BMPs), active their signaling through other R-SMAD proteins (such as SMAD1 ,5 and 8) 7.

Fig 1.1

Figure 1.1. Schematic diagram of TGFβ signaling pathway.

On the cell membrane, TGFβ binds to the receptor II which in turn attracts and phosphorylates TGFβ receptor I. Activated receptor I phosphorylates Smad2/3 which recruit smad4 in the nuclear. In the nucleus, Smad complex bind to the cofactor and regulate target genes engaged in both tumor promotion and tumor repression.

TGFβ/SMAD signaling is regulated by multiple mechanisms to maintain tightly controlled

TGFβ response. SMAD7 is the first described inhibitory SMAD which negatively regulates

TGFβ response by preventing access of SMAD2/3 to the kinase domain of receptor I 8,9.SMAD

7 also recruits phosphatases and ubiquitin ligases (smurf1/2) to the active TGFβ receptor I to terminate TGFβ signaling 10. Another inhibitory SMAD, SMAD6, competes with SMAD4 for binding to receptor activated SMAD17.

In addition to mediating the transcription of its target genes, TGFβ can also activate

GTPases (Rac1, Cdc42, RhoA and Ras), MAP kinases (JNK, p38 MAPK and ERK1/ERK2), growth and survival promoting kinases (PI3K, AKT/PKB and mTOR) and tyrosine kinases

(FAK, Src and Abl) in different cell context 11.

In normal condition, TGFβ is released by blood platelets and various stromal components.

TGFβ is frequently present in tumor environment. Tumor infiltrating cells such as leukocytes, macrophages, and bone marrow-derived endothelial, mesenchymal, and myeloid precursor cells can secret TGFβ, tumor cells themselves and tumor stroma cells are sources of TGFβ too

12. In tumors, TGFβ is a potent inducer of growth inhibition at early stages of tumorigenesis.

For example, when the tumor is still benign, TGFβ acts directly on tumor cells to suppress tumor outgrowth by inducing expression of CDK inhibitors p15INK4B and/or p21CIP1. The induction of p15 and p21 by TGFβ is through SMADs and other transcriptional factors like

FoxO forkhead and Sp1 13,14. Suppression of oncogenes like c-Myc and ID family of helix-loop- helix transcription factors (ID1,ID2,ID3) is also observed in many cell types that are growth inhibited by TGFβ 15,16. TGFβ has also been shown to induce apoptosis in epithelium, liver, immune system and tumors 17. In hepatocarcinomas, TGFβ induces apoptosis by increasing the 4

interaction of Daxx protein with TGFβ RII, which further actives JNK and Fas-mediated apoptotic pathways 18. In many types of cells, TGFβ induces pro-apoptotic Bcl-2 family members, Bmf and Bim, which activate Bax and induce apoptosis 19. In some other types of cells, TGFβ suppresses the expression of anti-apoptotic proteins Bcl-XL and Bcl-2 19. In immune cells, TGFβ shows a strong pro-apoptotic effect by inducing expression of Src homology 2 domain-containing 5’ inositol phosphatase (SHIP), which causes cell death of immune cells 20. In colon cancer cells, TGFβ antagonizes the survival pathways through

21 22 downregulation of PI3K-AKT and Bcl-XL . In addition, TGFβ prevents cellular immortalization by regulating the expression of human telomerase reverse transcriptase

(hTERT) in both normal and cancer cells 23.

Mutations in the TGFβ signaling pathway occur in at least half of colorectal cancer, commonly inactivating TGFβ RII, SMAD2, SMAD3 or SMAD4, which leads to its inability to inhibit cell growth and induce apoptosis24-26. Mutations of TGFβ RII lead to the formation of truncated or kinase inactive mutant forms of the receptor 27. Mutations of SMADs are mostly due to deletions, frameshift, nonsense and missense mutations 28. Overexpression of SMAD repressors also contributes to the inhibition of SMAD signaling. For example, SnoN, Ski, and inhibitory SMAD family members SMAD7 have been found to be overexpressed in many different types of cancers 29. Besides the change on TGFβ receptors and SMADs, the alteration of other signaling pathways can also affect TGFβ signaling during tumor progression. For instance, the Ras-Raf-MAPK pathway regulates the activation of SMAD3 by regulating its phosphorylation 30. 5

As tumor progresses, the cytostatic effects of TGFβ are often lost, and instead, TGFβ is shown to stimulate tumor progression by inducing epithelial to mesenchymal transition (EMT), stimulating angiogenesis and immunosuppression 31. In some cancers, TGFβ secretion is correlated with high tumor grade and metastasis 32. As mentioned above, TGFβ secreted by tumor cells and tumor stroma cells has a huge effect on immune system. It inhibits expression and activation of interleukin-2 and its receptors and blocks its stimulation on T cells 33. TGFβ also exerts inhibitory effect on proliferation and differentiation of T lymphocytes, lymphokine- activated killer cells, nature killer cells, neutrophils, macrophages and B cells 34. It has been shown that TGFβ inhibits the expression of tumor cell surface major histocompatibility complex class II antigen in a SMAD3 dependent manner 35. Taken together, TGFβ in the tumor environment helps tumor cells to escape host immunosurveillance and contributes to tumor progression.

Angiogenesis is essential to allow blood vessels to deliver oxygen and nutrients to tumor cells. TGFβ signaling has been shown to be correlated with increased micro vessel density in many types of cancers 36 37.The most common role of TGFβ on angiogenesis is to stimulate the expression of vascular endothelial growth factor(VEGF) and connective tissue growth factors

(CTGF) 38,39. In addition, the matrix metalloproteinase (MMPs) induced by TGFβ allows endothelia cells to be released from the basement and migrate to the tumor site 40. Moreover,

TGFβ represses the expression of angiopoietin-1 to allow the tumor-associated blood vessels to become more permeable 41.

EMT is an important process that cancer cells use to migrate and invade 42. The role of

TGFβ on EMT has been well characterized. The TGFβ-SMADs canonical pathway 6

transcriptionally activates EMT regulatory factors, such as SNAIL, SLUG, ZEB-2 and TWIST, resulting in the loss of epithelial cell polarity and the increase of migration and invasion 43.

TGFβ induced EMT changes the profile of adhesion molecules and promote cancer cells to detach from their primary site and disseminate throughout the stroma.

TGFβ significantly affects colon cancer biological behaviors. Moderate and well differentiated colon tumors were growth inhibited by TGFβ, while, metastatic colon tumors responded to TGFβ by invasion and proliferation44 . In the well differentiated colon tumors,

TGFβ activates its downstream targets which are important cell cycle checkpoint genes, including p21, p17 and p15 44 . TGFβ also interacts with PI3K-AKT pathways and induce apoptosis in colon cancer cells 21. TGFβ RII mutation is the most common alteration in colon cancers45. Loss of TGFβ RII function grants a growth advantage for cancer cells by cooperating with mutant Kras and Wnt signaling 46. SMAD4 is also a frequently mutated gene in TGFβ pathway. SMAD4 is a key mediator for TGFβ induced antiproliferative response, but TGFβ induced EMT is not dependent on SMAD447. This indicate that loss of SMAD4 function might be an important event during colon cancer progression.

MiRNAs

MicroRNAs (miRNAs) are approximately 19–25 nucleotides long (with an average of 22 nucleotides), noncoding RNA molecules that post-transcriptionally regulate gene expression by binding either to the 3’untranslated regions (3’UTR), 5’untranslated regions (5’UTR) or the coding sequence of protein-encoding mRNAs 48. The region at the 5’ end of miRNAs that spans from nucleotide position 2 to 7 is termed the 'miRNA seed'. It is crucial for target recognition.

The downstream nucleotides of miRNA (particularly nucleotide 8 and less importantly 7

nucleotides 13–16) also contribute to base pairing with the targets 49. miRNAs regulate approximately 30–50% human genes and majority of genetic pathways. miRNA genes are transcribed by RNA polymerase II (Pol II). The long primary transcript has a local hairpin structure where miRNA sequences are embedded. Majority of human miRNAs are encoded by introns of noncoding or coding transcripts, but some miRNAs are encoded by exonic regions.

The transcription of miRNAs is controlled by RNA Pol II associated transcription factors and epigenetic regulators such as P53, MYC and other DNA/RNA binding proteins 50. Following transcription, the primary miRNAs are processed through several steps to become mature miRNAs. The maturation of primary miRNAs is initiated by a nuclear RNase III, called Drosha, which forms a microprocessor with a cofactor DGCR8 and crops the stem–loop to release a small hairpin-shaped RNA of ~65 nucleotides in length (pre-miRNA) 51. Pre-miRNAs are exported to the cytoplasm after processed by Microprocessor. The protein exportin 5 (EXP5; encoded by XPO5) forms a transport complex with GTP-binding nuclear protein RAN•GTP, which exports the pre-miRNA out of the nuclear 52. In the cytoplasm, pre-miRNAs are cleaved by RNase III type endonuclease called Dicer, liberating a small RNA duplex 53. The small RNA duplex is subsequently incorporated into an AGO protein to form an effector complex called

RNA-induced silencing complex (RISC). As a result, the passenger strand is quickly removed and a mature RNA-induced silencing complex is formed 54. MiRNA biogenesis is shown in Fig

1.2. 55

Fig 1.2

Fig 1.2. Biogenesis of miRNAs.

Pri-miRNA are transcribed by RNA polymerase II, and processed to pre-miRNA in the nucleus.

RNA splicing is also a source of pre-miRNAs. Pre-miRNAs are transported into the cytosol, where they are pressed by Dicer to become mature miRNAs and regulate target gene expression.

miRNAs and cancer

A significant number of miRNAs are located at genomic regions linked to cancer56. The first evidence of aberrant miRNA expression in human cancers was described in B-cell chronic lymphocytic leukemia. A chromosomal deletion at the 13q14 locus resulted in the loss or reduction of miR-15 and miR-16 expression，which are inhibitors of oncogenetic protein BCL-

2 57. miRNA expression can be altered through different mechanisms, including chromosomal abnormalities, epigenetic changes, mutations and single nucleotide polymorphisms (SNPs), and defects in the miRNA biogenesis machinery 58. Many miRNAs reside at fragile site of the chromosome where sister chromatin exchange, translocation, deletion, amplification happen very frequently. miR-143 and miR145 has been found to be decreased in B cell chronic lymphocytic leukemias and lung cancers, while miR-19-92, located at chromosome 13q31, is found overexpressed due to chromosomal amplification in those cancers 57,59. In addition, epigenetic changes affect miRNAs expression as well. MiR21, miR-203 and miR-205 were found to be overexpressed in ovarian carcinomas through hypomethylation mechanism 60. On the contrary, decreased miR-124a expression in colon, breast, and lung cancers was attributed to DNA hypermethylation 61.

miRNAs have been demonstrated to function as oncogenes or tumor suppressors 62. The overexpression of miR-155 is associated with several types of lymphomas. Transgenic mice overexpressing miR-155 developed a preleukemic lymphoproliferative disease that progressed to B-cell leukemia and high grade lymphoma 63. Down regulation of some miRNAs might be advantageous for cancer cells. For example, miR-17 was found to be downregulated in breast cancers and ectopic expression of this miRNA reduced cancer cell proliferation 64. 10

In cancers, miRNAs affect cell growth, proliferation, apoptosis, invasion and metastasis by regulating genes in different signaling pathways 65. miR-221/222, miR-17-92 and miR-106-

25 have been reported to target negative cell-cycle regulators and promote cancer cell proliferation 66. miR15a/16 was shown to target cyclin D1, cyclin D3, cyclin E1 and CDK6, and their downregulation increased expression of multiple cell cycle-promoting genes 67.

Furthermore, the accumulated data on miRNA expression in tumors demonstrate that miRNAs are promising candidates for prognostic and/or diagnostic markers. It has been shown that the miR-222, miR-106a, and miR-17-92 cluster is associated with the degree of differentiation of hepatocellular carcinomas 68. High miR-21 expression was present in colon adenomas and in tumors with more advanced TNM staging 69. Another study showed that high level of MiR-92a was associated with decreased survival in patients with small-cell lung cancer

70. And the expression of MiR-210 was found to be associated with poor clinical outcome of breast cancer.71

MiRNAs and TGFβ

miRNAs and the TGFβ pathway are tightly interacted with each other. Transcription of primary miRNAs can be dynamically regulated in response to stimulation of many growth factors including TGFβ 72. TGFβ promotes miRNA processing by regulating miRNA DROSHA microprocessor complex in a SMAD-depend manner 73.

Upon TGFβ treatment, alterations in expression of numerous miRNAs have been reported in different types of cells. Expression of the miR-200 family (miR-200a, miR-200b, miR-200c, miR-141 and miR-429) and miR-205 was markedly downregulated upon TGFβ treatment. In addition, TGFβ suppresses expression of many other miRNAs, miR-145, Let-7d, miR-155, 11

miR-34, miR-27b, miR-29. On the contrary, there are quite a few miRNAs whose expression is upregulated by TGFβ, for example, miR-21, miR-142, miR-146, miR17/92, etc. 74.

The TGFβ pathway is regulated by miRNAs at multiple levels. Expression of most, if not all, members of the canonical TGFβ signaling pathway may be influenced by miRNAs. The miR-23b cluster (including miR-23b, miR-27b and miR-24-1) suppress TGFβ signaling by downregulating expression of SMAD3, SMAD4, and SMAD5 75. In the heart, downregulation of miR-133 and miR-590 enhances TGFβ signaling through TGFβ RI and RII 76. In the liver, miR-21 enhances TGFβ signaling by targeting the negative regulator SMAD7 77. While miR-

26a was found to target SMAD1, miR-141 and miR-200a directly inhibit TGFβ RII expression in rat proximal tubular epithelial cells 78,79.

miRNAs can also downregulate TGFβ target genes, which ultimately affects the outcome of TGFβ effect. The miR-106b/25 cluster (miR-106b, miR-93 and miR-25) was reported to interfere with the tumor suppression effect of TGFβ by targeting the cell cycle inhibitor p21Waf1/Cip1 and the pro-apoptotic protein BCL2L11 (BIM) in gastric cancer 80. BIM is also targeted by miR-17/92 in B cells 81.

Glutamate and its signaling

Glutamate is a nonessential amino acid, a major bioenergetic substrate for proliferating in normal and neoplastic cells. In the nervous system, glutamate is one of the key neurotransmitters and it participates in several physiological processes such as learning, memory, behavior and long-term potentiation and synaptic plasticity 82,83. Glutamate has been shown to regulate proliferation, migration and survival of neuronal progenitors and immature neurons during development of nervous system 84-86. Moreover, its function in regulating cell 12

proliferation and migration has also been described in human brain, breast, lung and colon cancer cell lines 87. Recent studies have demonstrated that human cancer cells release high level of glutamate 88, which triggers invasive tumor growth 89. Serum glutamate level was found correlated with Gleason Score in prostate cancer patients 90. An analysis of freshly frozen human samples also demonstrated that glutamate level was strikingly increased in chronic pancreatitis and pancreatic ductal adenocarcinoma tissues compared to normal pancreatic tissue

91.

Glutamate is stored in synaptic vesicles and released upon stimulation 92. In mammals, glutamatergic system is maintained by a group of glutamate transporters, which include two super families: the excitatory amino acid transporter (EAATs) located at the plasma membrane and the vesicular glutamate transporters (VGLUTs) located at the membrane of synaptic vesicles. The family of VGLUTs is comprised of three highly homologous proteins VGLUT1-

3. They transport glutamate from cytoplasm into the vesicles to be released 93. Expression of

VGLUTs is mostly complementary with limited overlap. VGLUT1 and VGLUT2 are mainly expressed in glutamatergic neurons 94 whereas VGLUT3, encoded by SLC17A8 gene, is present in a limited number of glutamatergic neurons in multiple brain regions and in a population of symmetrical synapses 95. VGLUT3 is the only vesicular glutamate transporter detected in the dendrites of striatal neurons 96. In addition to CNS, VGLUTs can be found in peripheral nervous system (PNS) and in the glutamate-secreting non-neuronal cells of different organs, such as the pineal gland, islets of Langerhans, intestine and stomach, bone and testes 97-100.

Glutamate signaling is initiated when glutamate binds to different type of receptors.

Glutamate receptors are divided into two groups, ionotropic glutamate receptors (iGluR) and 13

metabotropic glutamate receptors (mGluR) 101. iGluRs are quaternary ligand-gate ion channels that allow cation influx upon glutamate binding101. Based on structural similarities iGluRs are classified into three groups, N-methyl-D-aspartate (NMDA) receptor, a-amino-3-hydroxy-5- methyl-4-isoxazolepropionic acid (AMPA) receptor, and kainate receptor subfamilies. mGluRs belong to the superfamiliy of G-protein coupled receptors, they are classified into three

subgroups. mGluR1 and mGluR5, coupled to the phospholipase C through Gq G-protein, belong to group I; group II consists of mGluR2 and mGluR3, whereas group III comprises of mGluR4, mGluR6, mGluR7 and mGluR8, both of which are negatively coupled to adenylate

102 cyclase through Gi G-protein .

iGluRs have four conserved domains, including the extracellular amino-terminal (ATD), ligand-binding (LBD), transmembrane (TMD), and intracellular carboxy-terminal (CTD) domains. Glutamate or agonist binds to the LBD, resulting in a conformational change of the

TMD, which forms a channel in the membrane and allows calcium to pass into the cells (Fig

1.3)103.

Fig 1.3

Figure 2.3. iGluR structure and activation.

iGluRs share the same basic structure: the N terminus (N), the amino terminal domain

(ATD), the ligand binding domain (LBD), the four transmembrane domains (TMD; numbered

1-4) and the C-terminal domain (CTD). Panel A shows the resting conformation of iGluR. The entire protein consists 4 subunits, two of them can create a channel through the plasma membrane. When glutamates bind to LBD (Panel B), a conformational change in TMD domain

1 causes opening of the channel where Ca2+ passes into the cell by diffusion.

All mGluRs share a basic structure which includes a large extracellular ATD at the N- terminus, a cysteine-rich domain (CRD), a seven alpha-helical TMD and an intracellular CTD.

GluRs function when dimerized at the CRD domain, with two glutamate molecules binding to the ATD (Fig 1.4) 103.

Fig 1.4

Figure 1.4 mGluR structure and conformational activation.

mGluR family members share the same basic structure: the N terminus (N), the amino terminal domain (ATD), the cysteine rich domain (CRD), the seven transmembrane domains

(TMD; numbered) and the C-terminal domain (CTD). Panel A shows the resting conformation of mGluR1a. Cysteine residues in the CRD aid in dimerization, as indicated by the S-S bond.

When glutamate bind to ATD domain (Panel B), a conformational change in the ATD causes activation of bound G proteins. 16

Group I mGluRs couple to Gq/G11 and activate phospholipase Cβ, resulting in the hydrolysis of phosphotinositides and generation of inositol 1,4,5-trisphosphate (IP3) and diacyl-glycerol. This classical pathway leads to calcium mobilization and activation of protein kinase C (PKC) 104. recently, it is been recognized that this receptor can activate many other protein kinase pathways such as casein kinase 1, cyclindependent protein kinase 5, Jun kinase, components of the mitogen-activated protein kinase/extracellular receptor kinase (MAPK/ERK) and the mammalian target of rapamycin (MTOR)/p70 S6 kinase pathway 105-109. Group II and

group III receptors are coupled with Gi/0 which inhibits adenylyl cyclase. In addition, they have been shown to activate MAPK and PI3K-AKT pathways 107.

In recent years, many studies have shown that mGluRs are the predominant mediators of glutamatergic signaling in cancers 103. Function of mGluRs in cancer progression is first studied in tumors of central nervous system 110. Many evidences have also shown that mGluRs are involved in other types of cancers 111-114. Both group I and II mGluRs have been implicated to play a role in glioma. Inhibiting mGluR1 inhibits U87 glioma cell growth and induces apoptosis both in vitro and in vivo by mitigating the activation of the PI3K/Akt/mTOR pathway 115.

Another study showed that an mGluR2/3 antagonist suppressed glioma cell growth and removal of the antagonist restored cell growth 113. In addition, mGluRs are also studied in other non- neuronal cancers. Chen group found that the aberrant expression of mGluR1 is the driving force of melanomagenesis in transgenic mouse models, and mGluR1 mediated activation of the

MAPK and PI3K/AKT pathways is critical in melanoma pathogenesis 116. An exon capture sequencing of GPCRs study showed that in malignant melanoma specimens, somatic mutations of mGluR3 (GRM3) (E767K, S610L,G571E and E870K) can regulate the phosphorylation of 17

MEK1/2 and induce micro metastasis of melanoma 117. In colorectal cancer, mGluR4 has been found to be correlated with 5-Fu resistance and poor prognosis 118. The increasing evidence is showing that glutamate signaling could be a potential target for cancer treatment.

CHARAPTER 2：MATERIAL AND METHODS

Cell lines and reagents

The immortalized human colon epithelial cells (HCEC) were provided by Dr. Jerry

Shay119. The human colon cancer HCT116, RKO, FET, CBS, HCT116b and GEO cells were cultured in McCoy’s 5A medium (Sigma) with 10 ng/ml epidermal growth factor (EGF), 20

µg/ml insulin, and 4 µg/ml transferrin 120. When subjected to GFDS, cells were cultured in medium without EGF, insulin and transferrin. Cells were maintained at 37oC in a humidified

incubator with 5% CO2 and checked periodically for mycoplasma contamination. TGFβ and

LY341495 were obtained from R&D Systems. The miR-656-3p and miR-487b-3p inhibitor were obtained from and Qiagen Inc. respectively. Antibody information is included in

Supplemental Table 2.1.

Western blot analysis, RT-PCR and Q-PCR assays

Whole cell lysates were prepared in RIPA buffer (1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 150 mM NaCl, 10 mM Tris–HCl, pH 7.5, 5 mM EDTA and a protease inhibitor cocktail from Sigma-Aldrich). Equivalent amounts of protein were separated by SDS–

PAGE and transferred to a PVDF membrane (Millipore). Proteins were detected using an enhanced chemiluminescence system (Amersham Biosciences).

Expression of miR-656-3p and miR-487b-3p were determined by miScript primer assays and miScript SYBR® Green PCR Kit from Qiagen Inc. RNU6-2 was used as an endogenous reference gene.

Q-PCR analysis of GRM3 mRNA was performed using SYBR Green qPCR Mastermixes

(Qiagen). The primer sequences are GCACCTCAACAGGTTCAGTGT-F and 19

TGGTGGAGTCGAGGACTTCC-R.

Expression of VGLUT1-3 and GRM2-4 mRNA was determined by RT-PCR analysis. The primer sequences are included in Table 2.2.

Apoptosis assays

Apoptosis was detected using a DNA fragmentation ELISA kit (Roche). DNA fragmentation ELISA assays were performed according to manufacturer’s protocol. Briefly, cells were seeded in 96-well plates and subjected to growth factor deprivation stress (GFDS) or treated with TGFβ. The cells were stained with MTT to determine cell numbers or lysed for the ELISA assays to determine apoptosis. The relative apoptosis was determined by dividing

ELISA values by MTT values of each sample.

Soft agarose assays

Cells were seeded in culture medium containing low melting point agarose (Thermo

Scientific) at a density of 3,000 cells per well in 6-well plates. Two weeks later, colonies were stained with 1% iodonitrotetrazolium violet (Sigma-Aldrich). Visible colonies were counted.

Plasmids construction and lentiviral infection

The miR-656 and miR-487b precursor-expressing lentiviral vector, pCDH-CMV, was from

SBI. ShRNAs targeting GRM3 or VGLUT3 were cloned into FSIPPW lentiviral vector. The targeting sequences of VGLUT3 are VGLUT3 sh2 5-GCTGTAGGATTTAGTGGCTTCGCTA-

3, VGLUT3 sh3 5-CCCAGAATTGTGAAGTCCAGAAGAA-3. pCDF1-VGLUT3 was purchased from Harvard plasmid, provided by David E Root group. Clone: HsCD00421938,

PMID 21706014. The targeting sequences of GRM3 was described previously 117 : sh1, 5-

CAGAACATGGAAATAACCATT-3and sh2, 5- GCCTGTTTCCTATTAACGAAA-3 20

SMAD2 shRNA and SMAD3 shRNA are 5-GCACTTGCTCTGAAATTTG-3 and 5-

GGATTGAGCTGCACCTTGAATG-3 respectively. PKACα shRNA was described previously121 . pCDF1-GRM3 WT was a gift from Yardena Samuels (Addgene #31798).

293 packaging cells were co-transfected with pPackH1 packaging plasmid mix (SBI) and the lentiviral vectors using Fugene HD (Promega). Viruses were harvested 48 hours later and used to infect target cells.

Luciferase Assays

The predicted miR-656-3p recognition sites in the 3’UTR of VGLUT3 and corresponding mutated sequences were synthesized and cloned into psiCHECK™-2 (Promega) downstream of Renilla reporter gene. The predicted miR-487b-3p recognition sites in the 3’UTR of GRM3 was synthesized and cloned in the same vector. The reporter was transfected into cells and luciferase activity was measured 48 hrs later using Dual-Luciferase Reporter Assay (Promega).

Values were normalized with firefly luciferase activity.

In vivo xenograft model

Animal experiments were approved by University of Nebraska Medical Center (UNMC)

Institutional Animal Care and Use Committee. CBS cells (4 x 106) expressing a control vector, miR-487b precursor, a scrambled shRNA or GRM3 shRNAs and HCT116 cells (2 x 106) expressing a control vector, miR-656 precursor, a scrambled shRNA or VGLUT3 shRNAs were injected into the flank of 4-6 week old male athymic nude mice on both sides (Harlan

Laboratories). There were 8 mice and 16 tumors in each experimental group. Tumor volumes

(V) were calculated by the formula V = W2 × L × 0.5, where W represents the largest tumor diameter and L represents the next largest tumor diameter. Upon termination of the experiments, 21

tumors were dissected out and photographed on the same scale.

IHC staining of GRM3/VGLUT3 in xenograft tumors and human patient samples

Human sample study was performed with the approval of Institutional Review Board.

TMAs consisting of triplicates of 1 mm cores of colon adenocarcinomas and adjacent normal tissues of patients treated at UNMC in 2008 and 2009 were obtained from tissue core.

IHC staining was performed in paraffin slides using Novolink™ Min Polymer Detection

System (Leica) following manufacture’s instruction. Briefly, slides were subjected to antigen retrieval using Novocastra Epitope Retrieval Solutions, pH6, followed by incubation with an anti-VGLUT3 or anti-GRM3 antibody overnight at 4 °C. Slides were developed with DAB after incubation with Novolink polymer. Finally, slides were counterstained with hematoxylin.

The slides were scanned with IScan Coreo (Ventana Medical Systems, Inc). The staining intensity of epithelial cells was quantified with Imagescope Software (Aperio Technologies,

Inc.).

TUNEL assay and Ki67 staining

Formalin-fixed paraffin embedded (FFPE) tissue blocks of xenograft tumors were stained for Ki67 using Novolink™ Min Polymer Detection System (Leica). TUNEL staining was performed using Trevigen In Situ Apoptosis Detection Kit following manufacturer’s instruction. Three tumors from each group were analyzed. Ten histologically similar fields were randomly selected from each slide for analysis. Apoptosis and proliferation of tumor cells was determined quantitatively by counting the numbers and calculating the percentage of positively stained cells for TUNEL and Ki67 at 20x magnification respectively. 22

In Situ hybridization

The double DIG labeled probe for miR-487b-3p and miR-656-3p and hybridization kit were purchased from Exiqon. Hybridization was performed following Exiqon’s protocol.

Briefly, tissues were deparaffinized and digested with proteinase K (15 μg/ml; Exiqon) for 10 min at 37°C. Slides were incubated in hybridization buffer with 40 nM probe (miR-487b-3p

5DigN/AAGTGGATGACCCTGTACGATT/3Dig_N/, miR-656-3p 5DigN/

AGAGGTTGACTGTATAATAT /3Dig_N/) in a humidified chamber at 45°C overnight. Slides were then blocked with anti-digoxigenin-alkaline phosphatase antibodies (Roche) at 1:800 dilution for 1 hr and stained with AP substrate (NBT/BCIP tablet, Roche) at 30°C for 6 hrs. The nuclei were counterstained with nuclear fast red (Sigma). The slides were scanned with IScan

Coreo (Ventana Medical Systems, Inc). The staining intensity of epithelial cells was determined using Image-Pro Plus (Media Cybernetics. Inc).

Transwell assays

Cells were seeded onto the upper surface of 8-µm pore, 6.5 mm polycarbonate filters

(Corning Costar Corp.) in medium without growth factors or serum, allowed to migrate towards medium with 10% FBS for 18 hrs and stained with MTT. The cells on the upper surface of the filter were removed with a cotton swab, and those migrated to the underside were dissolved in

DMSO. Absorbance was read at 570 nm.

Statistical analysis

Statistical analyses were performed using Bonferroni two-sided t-test, two-way ANOVA or Student’s t-test. *P < 0.05, ** P < 0.01, *** P < 0.001.

Table 2.1 Antibodies

Antibodies Companies Western blots IHC

anti-PARP Cell Signaling # 9542S 1:1000

anti-pAKT S473 Cell Signaling # 9271S 1:1000

anti-CREB Cell Signaling # 9197S 1:1000

anti-pCREB Cell Signaling # 9198S 1:1000

anti-AKT Cell Signaling # 4691S 1:1000

anti-SMAD2 Cell Signaling # 5339S 1:1000

anti-SMAD3 Cell Signaling # 9523S 1:1000

anti-pSMAD1/5 Cell Signaling # 9516S 1:1000

anti-ERK Santa Cruz sc-514302 1:1000

anti-pERK Santa Cruz sc-7383 1:1000

anti-Actin Thermo Scientific MA5-15739 1:5000

anti-GAPDH Thermo Scientific MA1-16757 1:5000

anti-Ki67 Thermo Scientific MA5-14520 1:1000

anti-GRM3 Alomone labs AGC-012 1:1000 1:500

anti-VGLUT3 Alomone labs AGC-037 1:1000 1:500

Table 2.2. Primers

Primers sequence

5-GAGAAGGTGGGCCGTGCCATGAG-3 GRM2 5-CGCTGCCTGCCCGCAGATAGGT-3

5-GCTCCAACATCCGCAAGTCCTA-3 GRM3 5-TGTCAATGGCCAGGTGCTTGTC-3

VGLUT3 5-TGGGCTGGGATTCTGCATTT-3

5-TGACAAGAGACCCACACTTAGAC-3

VGLUT2 5-TGGCAACCACCTCCTTTTGT-3

5-CATAGTGGACTAGGGCAGCG-3

VGLUT1 5-CAGGAAGGCGCGAGACATTGGAG-3

5-AGTGAACACGGGCTGCTGAAGGGA-3

VGLUT3 sh2 GCTGTAGGATTTAGTGGCTTCGCTA

VGLUT3 sh3 CCCAGAATTGTGAAGTCCAGAAGAA

CHAPTER 3: MIRNA LIBRARY SCREENING.

Accumulating reports have shown that miRNAs are important players in many types of human cancers. TGFβ is an important regulator in colon cancer. Functional genetic screening is a systematic, non-biased and powerful approach for gene discovery. Here we used a microarray based miRNAs screening approach and identified some nova miRNAs that involved in TGFβ function in colon cancer cells.

The functional screening is described in Figure 3.1. A library of 560 miRNAs expression vectors was introduced into FET cells, after recovery from infection, cells were seeded into

10cm dish at a density of 9000 cell per well in the presence of 10ng/ml TGFβ (eight replicates).

The empty vector-transduced cells were plated at the same density as a negative control, and

TGFβ response defect FET Dominant negative RII cells as positive control. Two weeks after treatment, colonies were harvested and a second round of TGFβ selection was performed. By the end of two rounds selection, survived cells were harvested and genome DNA was extracted from each plate. The integrated miRNAs were amplified from genomic DNA by PCR using specific primers. The PCR product was purified and labeled with cy3 as end sample. PCR product from vector control cells which underwent two round of colony formation without any

TGFβ treatment will be labeled with cy5 as initial sample. Equal amount of initial sample and end sample were mixed and hybridized to the customized microarray. Microarray data was analyzed by Agilent, the average fold change of each miRNAs compared to control was calculated, p value was calculated by Student t test. As shown in Table 3.1, some miRNAs are enriched while some others are significantly dropped out after TGFβ selection. We then focused on the dropped out miRNAs which can potentially make FET cells sensitive to TGFβ for future 26

studies.

We then used DIANA miPath to look for the common pathways that are regulated by the miRNAs we identified. Interestingly we found that glutamatergic pathway is highly regulated by those miRNAs. Many studies have shown the importance of glutamatergic pathway in cancers. GRM3 and VGLUT3 are two important components in glutamatergic pathway, they are also targets of the miRNAs we identified. So, we hypothesize that, GRM3 and VGLUT3 might be very important regulators of colon cancer tumorigenesis and TGFβ function. 27

Fig 3.1

Figure 3.1 workflow of miRNAs screening in FET cells using TGFβ.

Table 3.1

Table 3.1 List of increased and decreased miRNAs from screening 28

CHAPTER 4 ：THE MIR-487B-3P/GRM3/TGFΒ SIGNALING AXIS IS AN

IMPORTANT REGULATOR OF COLON CANCER TUMORIGENESIS

INTRODUCTION

Glutamate functions as a major excitatory neurotransmitter in mammalian central nervous system. Glutamate signaling is mediated by two classes of glutamate receptors, ionotropic and metabotropic receptors 122. Metabotropic receptors (mGluR), a group C family of G-protein- coupled receptors (GPCRs), consist of eight members, classified into three subtypes 123,124.

Group I receptors (mGluR1 and 5) are coupled to phospholipase C leading to activation of protein kinase C, whereas group II (mGluR2 and 3) and group III (mGluR4, 6, 7 and 8) receptors are negatively coupled to adenylyl cyclase, inhibiting production of cyclic AMP

(cAMP) 102. Although glutamatergic system is mainly restricted to the CNS, expression of functional glutamate receptors has been reported in non-neuronal peripheral cells such as skin and pancreatic islets 125,126. Furthermore, studies have revealed that glutamate signaling is dysregulated and may play a role in cancer 118,127.

GRM3 is the gene encoding mGluR3, which is frequently mutated in melanoma. Mutant

GRM3 selectively activates MEK, leading to increased anchorage-independent growth and migration117. Activation of GRM3 has been reported to BMP signaling and sustain tumorigenic potential of glioma-initiating cells128. Pharmacological blockade of GRM3 reduced growth of glioma cells in vitro and in vivo 113,129. These studies suggest that GRM3 plays a role in cancer and could be a potential target for cancer treatment.

TGFβ signaling plays a dual role in cancer. While studies show that TGFβ promotes metastasis and is associated with worse prognosis130,131, others demonstrate that it suppresses 29

tumorigenicity and metastasis 132-135 and that loss or reduction of TGFβ signaling is associated with development of metastasis 136,137. In genetically engineered mouse models, inactivation of

TGFβ signaling increases malignancy and invasiveness of intestinal tumors of Apc mutant mice

138-141.

miRNAs are a group of small non-protein coding RNAs evolutionarily conserved 142.

MiRNAs suppress expression of gene targets at the posttranscriptional level through sequence- specific interaction with the 3’-untranslated regions (UTR), leading to translation inhibition or mRNA degradation 48. Alterations in miRNA expression are found to be associated with many human cancers 79.

Here we demonstrate that GRM3 expression is significantly upregulated in majority of human colonic adenocarcinomas tested and colon cancer cell lines. Knockdown of GRM3 expression or pharmacological blockade of GRM3 in colon cancer cells reduces cell survival and anchorage-independent growth in vitro and inhibits tumor growth in vivo.

Mechanistically, GRM3 antagonizes TGFβ-mediated activation of protein kinase A (PKA) and inhibition of AKT activation. In addition, TGFβ signaling increases GRM3 protein stability and knockdown of GRM3 expression enhances TGFβ-mediated tumor suppressor function. Further studies indicate that GRM3 is a direct target of miR-487b-3p and that miR-487b-3p mimics the effects of GRM3 knockdown in colon cancer cells in vitro and in vivo. Expression of miR-

487b-3p is decreased in colon adenocarcinomas and inversely correlates with GRM3 expression. Taken together, these studies indicate that the miR-487b-3p/GRM3/TGFβ signaling axis is an important regulator of colon cancer tumorigenesis and that upregulation of GRM3 is a functionally important molecular event in colon cancer. Therefore, GRM3 is a promising 30

molecular target for colon cancer treatment. This is particularly interesting and important from a therapeutic standpoint because numerous metabotropic glutamate receptor antagonists are available 143(37), many of which have been found unsuitable for treatment of neuropsychiatric disorders due to their inability to readily penetrate blood brain barriers. Since GRM3 is upregulated in colon cancer, but rarely expressed in normal peripheral tissues, targeting GRM3 with such agents would not likely cause adverse neurological or peripheral side effects, making

GRM3 an attractive and specific molecular target for colon cancer treatment.

RESULTS

Expression of GRM3 is markedly increased in colon cancer specimens.

Although it has been implicated that GRM3 is an important player in melanoma and glioma

107, 128,120, it is unknown whether GRM3 plays a role in colon cancer. GRM3 expression was therefore examined in human specimens using immunohistochemistry (IHC) analysis.

Verification of the anti-GRM3 antibody is shown in Fig. 3c. Tissue micro-arrays (TMAs) consisting of 29 normal colon and 65 colon adenocarcinomas were analyzed. Mouse brain tissue was used as a positive control. GRM3 expression was very low in normal colon epithelium, but increased significantly in colon tumors (Fig. 4.1a). Quantification showed that the average intensity of GRM3 staining and percentage of GRM3 positive cells were approximately 5.5-fold and 3.8-fold higher respectively in tumors than in normal colon (Fig.

4.1b & 4.1c). In addition, GRM3 expression was increased in more than 90% of colon tumors examined (Fig. 4.1b & 4.1c). These results demonstrate that GRM3 expression is upregulated in majority of colon adenocarcinomas.

Fig 4.1

Figure 4.1. GRM3 expression is elevated significantly in colon cancer specimens. a, Immunohistochemistry staining of GRM3 was performed in normal colon and colon adenocarcinomas. Mouse brain tissue stained with the anti-GRM3 antibody in the absence or 32

presence of a specific blocking peptide was used as a positive and negative control respectively.

Representative images are shown. Scale bars, 100 µm. b&c, Quantification of GRM3 staining intensity (b) and percentage of GRM3 positive cells (c) was performed. The values of individual samples are shown. Error bars indicate SEM of the values. *** P < 0.001.

GRM3 is critical for tumor growth in vivo.

These observations prompted us to investigate whether GRM3 plays a functional role in colon cancer. A panel of human colon cancer cell lines and an immortalized human colon epithelial cell line, HCEC119, were used. HCT116 and RKO cells are defective in TGFβ signaling due to lack of TGFβ RII 144. HCT116b cells were isolated from the same colon tumor as HCT116, but displayed much lower metastatic potential 145. FET cells, isolated from a well differentiated colon tumor, are sensitive to TGFβ-mediated growth inhibition and apoptosis 21.

CBS and GEO cells are partially responsive to TGFβ due to low TGFβ RII and RI expression, respectively 146. HT29 cells do not express SMAD4 due to mutations 147. All cell lines bear either KRAS or BRAF mutations, and all except RKO 148 have mutated APC or β-catenin.

GRM3 expression was much higher in colon cancer cells than in HCECs (Fig. 4.2a, left), consistent with the results from human specimens. However, GRM3 mRNA levels were similar between HCECs and most of colon cancer cell lines (Fig. 4.2a, middle and right), suggesting that upregulation of GRM3 may be through post-transcriptional mechanism(s). Of note, expression of GRM2, the other member of group II metabotropic glutamate receptors, was almost undetectable in all cell lines (Fig. 4.2a, middle). Mouse brain tissue was used as a positive control. These results indicate that expression of GRM3 but not GRM2 is increased in colon cancer cells.

To determine GRM3 function, its expression was knocked down in FET, CBS and HCT116, three colon cancer cell lines with different genetic background. Each of two independent shRNAs (sh1 and sh2) reduced GRM3 expression by more than 90% as compared to a scrambled shRNA and had no effect on GRM2 expression (Fig. 4.2b, data not shown). 34

Knockdown of GRM3 increased sensitivity to growth factor deprivation stress (GFDS)-induced apoptosis, reflected by enhanced PARP cleavage (Fig. 4.2c) and increased apoptosis in DNA fragmentation assays (Fig. 4.2d). In addition, GRM3 knockdown decreased anchorage- independent growth (Fig. 4.2e,) and inhibited motility and migration (Fig. 4.2f).

Fig 4.2

Figure 4.2. GRM3 expression is upregulated in colon cancer cells. a, GRM3 expression was determined in colon cancer cell lines and HCECs by western blot 35

analysis (left). GRM2 and GRM3 mRNA expression was determined by RT-PCR assays.

Mouse brain tissue was used as a positive control (right). GRM3 mRNA expression was determined by Q-PCR assays (lower). b, GRM3 expression was knocked down by two shRNAs. c&d, Control or GRM3 knockdown cells were subjected to GFDS. Cleaved PARP (c) and apoptosis (d) were determined. e, Colony numbers were determined in soft agarose assays of control or GRM3 knockdown cells. f, Cell motility and migration were determined in Transwell assays of control or GRM3 knockdown HCT116 cells. The data are presented as the mean ±

SD of three replications. ** P < 0.01.

We next examined the effect of GRM3 knockdown in vivo. Mice were subcutaneously injected with CBS cells stably expressing a scrambled shRNA or GRM3 shRNAs. Xenograft tumor growth curves showed that tumors of GRM3 shRNA-expressing cells (designated GRM3 shRNA tumors) grew at a significantly lower rate than those of control cells (designated control tumors) (Fig. 4.3a). As a result, GRM3 shRNA tumors were much smaller than control tumors

(Fig. 4.3b). IHC staining confirmed GRM3 knockdown in GRM3 shRNA tumors and verified the specificity of the anti-GRM3 antibody (Fig. 4.3c). TUNEL and Ki67 staining showed much more apoptotic cells and fewer proliferative cells in GRM3 shRNA tumors than in control tumors (Fig. 4.3d). These results indicate that knockdown of GRM3 inhibits tumor growth in vivo and that this inhibitory effect is a combined result of increased apoptosis and suppressed proliferation.

Fig 4.3

Figure 4.3. GRM3 mediates tumor growth in vivo. a, Xenograft tumor growth curves of CBS control and GRM3 shRNA-expressing cells are shown. n=16. b, Images of tumors at the endpoint of experiments are shown. The pictures were taken on the same scale with the ruler with each tumor (Fig. S9). c, Representative images of GRM3 staining in xenograft tumors are shown (left). Quantification of staining intensity and percentage of GRM3 positive cells was 38

performed (right). d, Representative images of TUNEL and Ki67 staining are shown (upper).

Percentage of positive staining cells was determined (lower). Scale bars, 100 µm. The data are presented as the mean ± SD. *P < 0.05, ** P < 0.01.

A GRM3 antagonist mimics GRM3 knockdown in vitro and in vivo.

LY341495 is a potent and selective antagonist of GRM2/3 149. As shown in Fig. 4a a,

LY341495 reduced colony formation of HCT116 cells in soft agar. When mice subcutaneously injected with HCT116 cells were treated with LY341495, tumors grew at a slower rate than those treated with vehicle control (Fig. 4.4b). Therefore, tumors were markedly smaller in

LY341495-treated group than in control group (Fig. 4.4c). TUNEL and Ki67 staining showed that LY341495 increased apoptotic cells and decreased proliferative cells (Fig. 4.4d). These results indicate that pharmacological blockade of GRM3 reduces anchorage-independent growth in vitro and tumor growth in vivo.

Fig 4.4

Figure 4.4. The GRM3 antagonist inhibits tumor growth in vivo. a, Colony numbers were determined in soft agarose assays of control or LY341495-treated HCT116 cells. b, Xenograft tumor growth curves of HCT116 cells treated with LY341495 or vehicle are shown. n=14. c,

Images of tumors at the endpoint of experiments are shown. d, Representative images of

TUNEL and Ki67 staining are shown (left). Percentage of positive staining cells was 41

determined (right). Scale bars, 100 µm. The data are presented as the mean ± SD. *P < 0.05,

** P < 0.01.

GRM3 antagonizes TGFβ to regulate cell survival through the PKA/AKT signaling axis.

GRM3 is negatively coupled to adenylyl cyclase, inhibiting production of cAMP. Since cAMP activates PKA, which inhibits AKT activation, activation of PKA and AKT was determined. PKA activity assays showed that knockdown of GRM3 increased PKA activity

(Fig. 4.5a). Phosphorylation of CREB, a target of PKA 150, was also used to indicate PKA activity. Knockdown of GRM3 increased pCREB and decreased pAKT (Fig. 4.5b, left and Fig.

4.5c). Treatment with LY341495 or forskolin, a PKA activator, showed similar effect (Fig. 4.5b, middle). Complementarily, overexpression of GRM3 reduced pCREB and increased pAKT

(Fig. 4.5b, right). These results indicate that GRM3 inhibits PKA and activates AKT in colon cancer cells.

To determine whether PKA is involved in GRM3-mediated cell survival, the PKA catalytic

α subunit (PKACα) was knocked down in FET cells 151. GRM3 knockdown-induced PKA activation and AKT inhibition were abrogated (Fig. 4.5d, right). Consequently, knockdown of

PKACα attenuated GRM3 knockdown-mediated increase of apoptosis under GFDS (Fig. 4.5e).

These results indicate that GRM3 knockdown inhibits AKT and suppresses cell survival through PKA activation.

Unlike GRM3’s coupling to cAMP, TGFβ activates PKA independent of cAMP, which inhibits AKT and suppresses cell survival. We confirmed TGFβ effect on pCREB and pAKT in

FET cells (Fig. 4.5d, left). Since GRM3 knockdown and TGFβ activate PKA independently, we determined whether combination of both would further activate PKA and inhibit AKT. The results showed that GRM3 knockdown and TGFβ treatment concomitantly led to additional increase in pCREB and decrease in pAKT (Fig. 4.5d, left). As a result, when cells were treated 43

with TGFβ under GFDS for 14 hours, TGFβ had little effect in control cells but induced apoptosis in GRM3 knockdown cells (Fig. 4.5f). In addition, GRM3 knockdown sensitized FET cells to TGFβ-mediated inhibition of anchorage-independent growth (Fig. 4.5g). These results indicate that GRM3 antagonizes TGFβ-mediated tumor suppressor function and that GRM3 knockdown enhances TGFβ effects.

To determine the mechanism underlying collaborative effect of TGFβ and GRM3 knockdown on PKA/AKT activation, cell survival and anchorage-independent growth, we investigated whether GRM3 mediates TGFβ signaling and found that GRM3 knockdown had no effect on expression of SMAD2, SMAD3, SMAD4 or on canonical TGFβ signaling (data not shown). However, TGFβ increased GRM protein expression in FET and CBS cells (Fig.

4.5h, left and middle) while had little effect on GRM3 mRNA (Fig. 5i). Inactivation of TGFβ signaling by a dominant negative TGFβ RII (DNRII) in FET cells abrogated TGFβ effect on

GRM3 expression (Fig. 4.5h, right). Time course experiments showed that TGFβ increased

GRM3 expression as early as 30 minutes (Fig. 4.5j), suggesting that TGFβ may increase GRM3 protein stability. Treatment with cycloheximide indicated that TGFβ markedly increased the half-life of GRM3 protein (Fig. 4.5k). Moreover, knockdown of SMAD2 or SMAD3 attenuated

TGFβ-induced GRM3 protein expression but had little effect on GRM3 mRNA levels (Fig.

4.5l), indicating that SMAD2/3 contributes to TGFβ-mediated GRM3 protein expression.

Fig 4.5

Figure 4.5. GRM3 antagonizes TGFβ-mediated activation of PKA/AKT. a, PKA activity was determined in FET, HCT116 and CBS cells. b, pCREB, and pAKT were determined in

FET control and GRM3 knockdown cells (left), FET cells treated with LY341495 or forskolin

(middle) and vector- or GRM3-expressing FET cells (right). c&d, pCREB, and pAKT were determined in HCT116 and CBS control and GRM3 knockdown cells (c) and FET control and

PKACα KD cells each infected with GRM3 sh2 or treated with 4 ng/ml TGFβ or both (d). e,

PKACα was knocked down in FET control or GRM3 knockdown cells. Cells were subjected 45

to GFDS for 24 hrs. Cleaved PARP (upper) and apoptosis (lower) were determined. f, FET control or GRM3 knockdown cells were treated with 4 ng/ml TGFβ under GFDS for 14 hrs.

Cleaved PARP (upper) and apoptosis (lower) were determined. g, Colony numbers were determined in soft agarose assays of FET control or GRM3 knockdown cells treated with 0.5 ng/ml TGFβ. h, Cells were treated with 4 ng/ml TGFβ for 6 hrs. GRM3 expression was determined by western blot assays. i, FET cells were treated with 4 ng/ml TGFβ for 6 hrs.

GRM3 mRNA was determined by RT-PCR assays. j, FET cells were treated with 4 ng/ml TGFβ for the indicated time. GRM3 expression was determined by western blot assays. k, FET cells were treated with cycloheximide in the presence or absence of TGFβ. GRM3 expression was determined by western blot assays. l, Expression of Smad2 or Smad3 was knocked down individually in FET cells (left). Cells were treated with TGFβ. GRM3 protein and mRNA expression was determined by western blot assays (middle) and RT-PCR analysis (right) respectively. The data are presented as the mean ± SD of three replications. * P < 0.05, ** P <

0.01.

MiR-487b-3p regulates GRM3 expression in colon cancer cells.

Although TGFβ increases GRM3 expression (Fig. 4.5h), it cannot fully explain ubiquitous upregulation of GRM3 expression in colon cancer cell lines regardless of their response to

TGFβ signaling (Fig. 4.2a, left). Since GRM3 expression may be regulated post- transcriptionally (Fig. 4.2a), we turned our attention to miRNAs, which function as posttranscriptional regulators of mRNA expression and/or translation. In the previous study we have identified several miRNAs that are potential regulators of TGFβ and colon cancer. We performed an in silico search for putative miRNA-binding sites in the 3’UTR of human GRM3 mRNA using TargetScan 152, PicTar 153 and miRanda-mirSVR154. Among miRNA candidates conserved between human and mouse, miR-487b-3p was identified as a potential regulator of

GRM3. Q-PCR assays indicated that expression of miR-487b-3p was much lower in colon cancer cell lines than in HCECs (Fig. 4.6a), suggesting that decreased miR-487b-3p expression may contribute to upregulated GRM3 expression in colon cancer cells.

To demonstrate that miR-487b-3p regulates GRM3 expression, miR-487b precursor was stably infected into FET and CBS cells. As a result, expression of mature miR-487b-3p was significantly increased (Fig. 4.6b, left). Complementarily, a chemically synthesized miR-487b-

3p inhibitor markedly reduced endogenous miR-487b-3p expression (Fig. 4.6b, right).

Overexpression of miR-487b-3p decreased GRM3 protein expression whereas the inhibitor increased GRM3 protein expression (Fig. 4.6c, left). However, GRM3 mRNA expression was not affected (Fig. 4.6c, right). These results indicate that miR-487b-3p suppresses GRM3 expression by inhibiting its translation. To determine whether GRM3 is a direct target of miR-

487b-3p, 3’-UTRs of GRM3 containing potential miR-487b-3p recognition element or mutated 47

seed sequence (Fig. 4.6d, left) was cloned into a luciferase construct. Luciferase assays revealed that miR-487b-3p repressed wild type but not mutant 3’-UTRs of GRM3 (Fig. 4.6d, right).

These results indicate that GRM3 is a direct target of miR-487b-3p. Of note, miR-487b-5p did not target GRM3 (Fig. 4.10).

MiR-487b-3p regulates PKA/AKT activation and mimics GRM3 knockdown effect in colon cancer cells.

Similar to GRM3 knockdown, miR-487b-3p enhanced PKA activity (Fig. 4.6e), increased pCREB and decreased pAKT (Fig. 4.6f). MiR-487b-3p-expressing cells displayed increased apoptosis under GFDS (Fig. 4.6g) and decreased anchorage-independent growth (Fig. 4.6h and ), indicating that miR-487b-3p mimicked the effect of GRM3 knockdown. In contrast, the miR-487b-3p inhibitor decreased GFDS-induced apoptosis (Fig. 4.6i).

To determine whether miR-487b-3p-mediated effect could be reversed by restoration of

GRM3 expression, GRM3 cDNA was infected into miR-487b-3p-expressing cells (Fig. 4.6j).

Ectopically expressed GRM3 is resistant to miR-487b-3p inhibition due to the lack of 3’-UTR.

Restored GRM3 expression reversed miR-487b-3p-mediated increase of apoptosis (Fig. 4.6k).

These results indicate that miR-487b-3p sensitizes colon cancer cells to GFDS-induced apoptosis through down-regulation of GRM3.

Fig 4.6

Figure 4.6. GRM3 is a direct target of miR-487b-3p. a, Expression of miR-487b-3p was determined in HCECs and colon cancer cells by Q-PCR assays. b, Expression of miR-487b-3p was determined after infection with miR-487b precursor (left) or transfection with the miR-

487b inhibitor (right). c, GRM3 expression was determined by western blot assays (left) and by RT-PCR assays (right) after infected with miR-487b precursor or transfected with the miR-

487b-3p inhibitor. d, The predicted miR-487b-3p recognition site in the 3’UTR of GRM3 and 49

corresponding mutated sequences are indicated by lines (left). After transfection with psiCheck-

2 constructs containing the wild type (Wt) or mutant (Mut) sequences, luciferase assays were performed in FET control and miR-487b-3p expressing cells (right). e, PKA activity was determined in colon cancer cells. f, pCREB and pAKT were determined in vector- or miR-

487b-3p-expressing FET and CBS cells. g, Vector- or miR-487b-3p-expressing FET and CBS cells were subject to GFDS for 24 and 48 hrs respectively. Cleaved PARP (upper) and apoptosis

(lower) were determined. h, Colony numbers were determined in soft agarose assays of vector- or miR-487b-3p-expressing FET and CBS cells. i, FET and HCT116b cells transfected with the miR-487b-3p inhibitor were subjected to GFDS for 24 or 48 hrs respectively. Cleaved PARP

(upper) and apoptosis (lower) were determined. j&k, GRM3 was ectopically expressed in miR-

487b-3p-expressing FET and CBS cells (j), which were subjected to GFDS for 24 and 48 hrs respectively. Cleaved PARP (k, upper) and apoptosis (k, lower) were determined. The data are presented as the mean ± SD of three replications. ** P < 0.01, *** P < 0.001.

To demonstrate that miR-487b-3p enhances TGFβ-mediated tumor suppressor function,

FET cells were treated with TGFβ under GFDS for 14 hours. TGFβ induced apoptosis in miR-

487b-3p-expressing cells but not in control cells (Fig. 4.7a). In addition, TGFβ inhibited anchorage-independent growth by 96% in miR-487b-3p-expressing cells but only by 50% in control cells (Fig. 4.7b). Restoration of GRM3 expression reversed miR-487b-3p-mediated sensitization to TGFβ-induced apoptosis (Fig. 4.7c). Complementarily, FET cells were treated with TGFβ under GFDS for 24 hours. While TGFβ induced apoptosis in control cells, the miR-

487b-3p inhibitor attenuated TGFβ-induced apoptosis (Fig. 4.7d). These results indicated that miR-487b-3p enhances TGFβ-induced apoptosis by repressing GRM3 expression and that inhibition of miR-487b-3p antagonizes TGFβ effect.

Fig 4.7

Figure 4.7. MiR-487b-3p mimics the effect of GRM3 knockdown in colon cancer cells. a,

Vector- or miR-487b-3p-expressing FET cells were treated with 4 ng/ml TGFβ under GFDS for

14 hrs. Cleaved PARP (left) and apoptosis (right) were determined. b, Colony numbers were determined in soft agarose assays of vector- or miR-487b-3p-expressing FET cells treated with

0.5 ng/ml TGFβ. c, MiR-487b-3p-expressing FET cells were infected with GRM3 cDNA and treated with 4 ng/ml TGFβ under GFDS for 14 hrs. Cleaved PARP (left) and apoptosis (right) were determined. d, FET cells transfected with the miR-487b-3p inhibitor were treated with 4 ng/ml TGFβ under GFDS for 24 hrs. Cleaved PARP (left) and apoptosis (right) were determined.

The data are presented as the mean ± SD of three replications. * P < 0.05, ** P < 0.01.

MiR-487b-3p inhibits tumor growth in vivo.

To determine the function of miR-487b-3p in vivo, athymic nude mice were subcutaneously inoculated with CBS control or miR-487b-3p-expressing cells. Xenograft tumor growth curves indicated that tumors of control cells (designated control tumors) grew at a significantly higher rate than those of miR-487b-3p-expressing cells (designated miR-487b-

3p tumors) (Fig. 4.8a). Consequently, control tumors were much bigger than miR-487b-3p tumors (Fig. 4.8b). Analysis of GRM3 expression showed that the intensity of GRM3 staining and percentage of GRM3 positive cells were notably lower in miR-487b-3p tumors than in control tumors (Fig. 4.8c). Moreover, TUNEL and Ki67 staining indicated more apoptotic cells and fewer proliferative cells in miR-487b-3p tumors than in control tumors (Figs. 4.8d & 4.8e).

These results demonstrate that miR-487b-3p suppresses GRM3 expression and inhibit tumor growth in vivo.

Fig 4.8

Figure 4.8. MiR-487b-3p suppresses GRM3 expression and inhibits tumor growth in vivo. a, Xenograft tumor growth curves of CBS control and miR-487b-3p-expressing cells is shown. n=16. b, Representative images of tumors at the endpoint of experiments are shown.

The pictures were taken on the same scale with the ruler with each tumor (Fig. S10). c,

Representative images of GRM3 staining in xenograft tumors are shown (upper).

Quantification of staining intensity and percentage of GRM3 positive cells was performed

(lower). d&e, Representative images of TUNEL (d) and Ki67 (e) staining are shown (left).

Percentage of positive TUNEL (d) and Ki67 (e) staining cells were determined (right). Scale bars, 100 µm. The data are presented as the mean ± SD. *P < 0.05, ** P < 0.01. f, A proposed model of crosstalk between miR-487b-3p, GRM3 and TGFβ signaling in regulation of

PKA/AKT activation, cell survival, proliferation and tumorigenesis of colon cancer cells. 54

Expression of miR-487b-3p is decreased in colon cancer specimens.

To explore clinical relevance of miR-487b-3p, its expression was determined by in situ hybridization in the same sets of TMAs utilized in Figure 1. The staining intensity of miR-

487b-3p was much stronger in miR-487b-3p-expressing tumors than in control tumors (Fig.

4.9a), verifying the specificity of the probe. Analysis of TMAs indicated that miR-487b-3p expression was very high in normal colon epithelium, but decreased markedly in colon tumors

(Fig. 4.9b). Quantification of staining showed that the average intensity was significantly lower in colon adenocarcinomas than in normal colon (Fig. 4.9c), which is consistent with results from TCGA databases (Fig. 4.11). In addition, the correlation study revealed a significant inverse correlation between miR-487b-3p and GRM3 expression (Fig. 9d, *** P = 0.0003).

These results demonstrate that miR-487b-3p expression is decreased in colon adenocarcinomas and that miR-487b-3p expression is inversely correlated with GRM3 expression.

Taken together, our studies suggest a novel model of crosstalk between miR-487b-3p,

GRM3 and TGFβ signaling (Fig. 4.8f). In this model, while miR-487b-3p inhibits GRM3 translation, TGFβ increases GRM3 protein stability as a negative feedback mechanism to antagonize TGFβ-induced PKA activation, AKT inhibition and suppression of cell survival, proliferation and tumorigenesis. Therefore, inhibition of GRM3 or expression of miR-487b-3p prevents this negative feedback and enhances TGFβ-mediated tumor suppressor function.

Fig 4.9

Figure 4.9. Expression of miR-487b-3p is decreased in colon cancer specimens. In situ hybridization analysis of miR-487b-3p was performed in xenograft tumors and human specimens. a, Representative images of miR-487b-3p staining in xenograft tumors are shown.

Scale bars, 100 µm. b, Normal colon in the absence of the probe was used as a negative control.

Representative images of miR-487b-3p staining in normal colon and colon tumors are shown. 56

Scale bars, 100 µm. c, Quantification of the staining intensity was performed. The values of individual samples are shown. Error bars indicate SEM of the values. ** P < 0.01. d, Correlation of expression of miR-487b-3p and GRM3 was determined using Pearson's test (r = -0.439, ***

P = 0.0003; n = 64). The slope was generated by lineage regression analysis.

Fig 4.10

FET

miR-487b-5p - +

GRM3 100

Actin 34

Fig. 4.10. FET cells were transfected with miR-487b-5p mimic. GRM3 expression was determined by western blot analysis.

Fig 4.11

Fig. 4.11. Comparison of miR-487b-3p expression between normal colon and colon tumor samples was performed by analyzing UNC-H_miRNA 8X15K level 3 dataset from TCGA database. The difference between two groups was evaluated by 2 tail student t test (*** P <

0.001).

Fig 4.12

GRM4

Actin

Fig. 4.12. RT-PCR analysis of GRM4 mRNA expression in HCECs and colon cancer cell lines.

Mouse brain tissues were used as a positive control.

Fig 4.13

Fig. 4.13. a, Comparison of percentage of GRM3 positive cells in well-, moderately- and poorly-differentiated colon tumors. The values of individual samples are shown. Error bars indicate SEM of the values. * P < 0.05. b, Immunohistochemistry staining of GRM3 was performed in normal pancreas and pancreatic tumors. Representative images are shown. Scale bars, 100 µm. c, Quantification of GRM3 staining intensity (left) and percentage of GRM3 positive cells (right) was performed. The values of individual samples are shown. Error bars indicate SEM of the values. *** P < 0.001.

Fig 4.14

Fig. 4.14. Western blot analysis of pERK and ERK in GRM3 knockdown (a) and miR-487b-

3p-expressing cells (b).

Fig 4.15

Fig. 4.15. a. Control and GRM3 knockdown cells were treated with 5 ng/ml BMP.

Phosphorylation of Smad1/5 was determined. b, FET and HCT116 cells were treated with 5 ng/ml BMP. Expression of GRM3 was determined.

DISCUSSION

Although GRM3 protein expression is considerably higher in colon adenocarcinomas than in normal colon (Fig. 4.1), analysis of TCGA databases reveals that GRM3 mRNA remains unchanged (data not shown). It suggests that GRM3 upregulation is mediated at the posttranscriptional level. While transcriptional regulation of GRM3 has been reported 155-157, our findings that miR-487b-3p directly targets GRM3 to suppress its translation and that TGFβ increases GRM3 protein stability provide novel mechanisms of posttranscriptional regulation of GRM3 in colon cancer. Of note, GRM2, the other group II metabotropic glutamate receptor, and GRM4, reported to be present in colon cancer cells118, are barely expressed in colon cancer cells used in the study (Fig. 4.2a and Fig. 4.12), suggesting that they may not play a role in colon cancer.

When correlating GRM3 expression with clinicopathological features of tumors, no significant correlation was found between GRM3 expression and tumor grades or stages (data not shown). However, percentage of GRM3 positive cells is noticeably higher in poorly- differentiated tumors than moderately-differentiated ones (Fig. 4.13a). Due to small sample size of well-differentiated tumors, the difference between well-differentiated tumors and moderately- or poor-differentiated ones is not significant. In addition, GRM3 expression is significantly higher in pancreatic tumors than in normal pancreas (Fig. 4.13b and 4.13c), indicating that upregulation of GRM3 expression is not specific to colon cancer.

It has been shown that mGluRs, such as GRM1 and mutant GRM3, activate the MEK pathway in nervous and melanoma cells 77,117. In this study, we show that GRM3 knockdown activates PKA and inhibits AKT in colon cancer cells. In addition, GRM3 knockdown or 64

overexpression of miR-487b-3p also decreases ERK activity (Fig. 4.14). It indicates that GRM3 can activate multiple cancer-related signaling pathways and that the components of the glutamatergic system are active in colon cancer cells. Although we show that GRM2 expression is not upregulated in colon cancer cells, it remains to be determined whether other glutamate receptors or other elements of glutamate signaling are aberrantly expressed in colon cancer.

Our studies indicate that GRM3 antagonizes TGFβ-mediated tumor suppressor effect and that TGFβ increases GRM3 protein stability in a Smad2/3-dependent manner. These results suggest that there is a negative feedback regulation between GRM3 and TGFβ signaling (Fig.

4.8f). This is of significance since TGFβ is a major tumor suppressor in colon cancer. The negative feedback regulation between TGFβ and GRM3 could potentially prevent efficient intervention of tumor growth and progression by TGFβ signaling. In addition, it will be interesting to investigate whether TGFβ increases GRM3 expression in cancers where TGFβ functions as a tumor promoter (i.e. breast cancer). If so, given that GRM3 activates AKT and

MEK signaling pathways, GRM3 could potentially contribute to TGFβ-mediated tumor promoting function (i.e. EMT, etc). Therefore, inhibition of GRM3 could not only enhance

TGFβ-mediated tumor suppressor function but also counteract TGFβ-mediated tumor promoting function, making targeting GRM3 an efficient anti-cancer approach despite of dual function of TGFβ signaling. Furthermore, GRM3 can also function independently of TGFβ signaling since GRM3 knockdown in HCT116 cells with defective TGFβ signaling increased apoptosis and reduced anchorage-independent growth (Fig. 4.2). Hence, GRM3 can be a promising molecular target in colon cancer defective of TGFβ signaling, which occurs in 30-

40% of colon cancer patients. 65

It has been reported that GRM3 negatively regulates BMP signaling in glioma cells 128.

However, we found that GRM3 knockdown did not activate BMP signaling in colon cancer cells (Fig. 4.15a). In addition, unlike TGFβ, BMP treatment did not increase GRM3 expression

(Fig. 4.15b). These results suggest that BMP signaling is not likely involved in the effects mediated by GRM3 knockdown and in the regulation of GRM3 expression.

Taken together, we have identified a signaling axis, miR-487b-

3p/GRM3/TGFβ/PKA/AKT, as an important regulator of tumorigenesis in colon cancer. Our studies suggest that GRM3 could be a novel molecular target for colon cancer treatment.

However, one concern to target glutamate signaling for cancer treatment is whether it would affect brain or neuron function. A significant amount of work has gone into designing and testing of drugs to modulate glutamatergic system to treat neurological and psychiatric disorders. Pharmaceutical companies have generated libraries of compounds that are not optimal for treating neuropsychiatric disorders due to problems such as inability to readily penetrate blood brain barriers. However, those compounds could be ideal agents for other applications, for example, anti-cancer therapy. Since GRM3 is mainly upregulated in colon cancer but rarely expressed in normal peripheral tissues, targeting GRM3 with such agents would not likely cause adverse neurological or peripheral side effects, making GRM3 an attractive and specific target for colon cancer treatment.

CHAPTER 5 ： MICRORNA-656-3P/VGLUT3 CROSSTALKS WITH TGFΒ

SIGNALING TO REGULATE COLON CANCER TUMORIGENESIS

INTRODUCTION

Colon cancer is the second leading cause of cancer death in the US, primarily due to metastatic disease 1(1). Treatment of metastatic colon cancer with molecule-targeting drugs has not had a large clinical impact; therefore, there is an urgent need to identify new molecule targets and develop novel target-specific therapies.

Glutamate is the predominant excitatory neurotransmitter in the central nervous system. In nervous glutamate is sorted in the synaptic vesicle before release to synaptic cleft 92. In mammals, two group of glutamate transport are responsible for maintaining glutamatergic system, Sodium-dependent excitatory Amino Acid Transporters (EAATs) and the VGLUTs.

The family of VGLUTs is comprised of three highly homologous proteins VGLUT1-3. They transport glutamate from the cytoplasm into the synaptic vesicles 93. In addition to the CNS,

VGLUTs can be found in peripheral nervous system and in glutamate-secreting non-neuronal cells of different organs, such as the pineal gland 97, bone99 and testes100. It has been postulated that the peripheral glutamatergic system may use glutamate as an intercellular messenger to communicate with neighboring cells158.

In this study, we show for the first time that VGLUT3 expression is upregulated in human colonic adenocarcinomas and colon cancer cell lines. Knockdown of VGLUT3 expression in colon cancer cells reduces cell survival and anchorage-independent growth in vitro and inhibits tumor growth in vivo. In addition, VGLUT3 antagonizes TGFβ-mediated inhibition of AKT activation and suppression of cell survival and clonogenicity. Furthermore, VGLUT3 is a direct 67

target of miR-656-3p, expression of which mimics the effects of VGLUT3 knockdown in colon cancer cells in vitro and in vivo. Expression of miR-656-3p is downregulated in colon adenocarcinomas and inversely correlates with VGLUT3 expression. Taken together, these studies indicate that VGLUT3 maintains AKT activation and counteracts TGFβ signaling to regulate colon cancer tumorigenesis. It suggests that upregulation of VGLUT3 expression is a functionally important molecular event during colon cancer development and that VGLUT3 is a potential molecular target for colon cancer treatment. This is especially interesting and important from a therapeutic standpoint. Given that VGLUT3 is mainly present in CNS and upregulated in colon cancer, but rarely expressed in normal peripheral tissues, targeting

VGLUT3 with agents that cannot penetrate blood brain barrier would therefore not likely cause adverse neurological or peripheral side effects, making VGLUT3 an attractive and specific target for colon cancer treatment.

RESULTS

Expression of VGLUT3 is significantly increased in colon cancer specimens.

Aberrant glutamatergic signaling has been reported to play a role in cancer 118,127. VGLUTs are critical components in glutamatergic system. However, little is known of their expression and function in cancer. To determine whether VGLUTs may play a functional role in colon cancer, we examined expression of VGLUT1-3 in a panel of human colon cancer cell lines.

HCT116 and RKO cells are defective in TGFβ signaling due to the lack of TGFβ RII expression144. HCT116b cells were isolated from the same primary colon tumor as HCT116 cells, but displayed much lower metastatic potential 145. FET cells, isolated from a well differentiated early stage colon tumor, are sensitive to TGFβ-mediated growth inhibition and 68

apoptosis133. CBS and GEO cells are partially responsive to TGFβ due to low TGFβ RII and RI expression, respectively 134,146. All cell lines bear either KRAS or BRAF mutations, and all of them except RKO 148 have mutated APC or β-catenin. An immortalized human colon epithelial cell line, HCEC 119, was included as a control. RT-PCR assays indicated that VGLUT3 mRNA was ubiquitously expressed in HCECs and colon cancer cell lines whereas expression of

VGLUT1 and VGLUT2 mRNA was undetectable (Fig. 5.1A, left). Western blot analysis showed that VGLUT3 protein expression was markedly higher in colon cancer cells than in

HCECs (Fig. 5.1A, right). These results indicate that VGLUT1 and VGLUT2 are not expressed in HCECs and colon cancer cells and that VGLUT3 expression is upregulated in colon cancer cells as compared to immortalized colon epithelial cells. Given that VGLUT3 mRNA levels were similar between HCECs and most of colon cancer cell lines (Fig. 5.1A, left), it suggests that upregulation of VGLUT3 may be through post-transcriptional mechanism(s).

To determine the clinical relevance and significance of VGLUT3 upregulation, we extended our studies to patient specimens. VGLUT3 expression was determined in normal colon and colonic adenocarcinomas using immunohistochemistry (IHC) staining. Verification of the anti-VGLUT3 antibody is shown in Fig. 5.3C. Tissue micro-arrays (TMA) consisting of

35 normal colon and 66 colon tumors were analyzed. Mouse brain tissue was used as a positive control. VGLUT3 expression was very low in normal colon epithelium, but increased significantly in colon tumors (Fig. 5.1B). Quantification of the staining showed that the average intensity of VGLUT3 staining and percentage of VGLUT3 positive cells were approximately

2.7-fold and 2.2-fold higher in tumor samples than in normal colon respectively (Fig. 5.1C).

These results demonstrate that VGLUT3 expression is upregulated in colon tumors, suggesting 69

that VGLUT3 may play a functional role in colon cancer. When correlating VGLUT3 expression with clinicopathological features of tumors, no significant correlation was found between VGLUT3 expression and tumor grade, stage and differentiation (Figure 5.9). However, due to small sample size of certain groups, it is difficult to draw a clear conclusion.

Fig 5.1

Figure 5.1. VGLUT3 expression is elevated in colon cancer cells and patient specimens. A,

Expression of VGLUT1-3 mRNA was determined in a panel of colon cancer cell lines and

HECEs by RT-PCR assays. Mouse brain tissues were used as a positive control (left). VGLUT3 protein expression was determined by western blot analysis (right). B, Immunohistochemistry 70

staining of VGLUT3 was performed in normal colon and colon adenocarcinomas. Mouse brain tissues stained with the anti-VGLUT3 antibody in the absence or presence of a specific blocking peptide were used as a positive and negative control respectively. Representative images are shown. Scale bars, 100 µm. C, Quantification of VGLUT3 staining intensity (left) and percentage of VGLUT3 positive cells (right) was performed. The values of individual samples are shown. Error bars indicate SEM of the values. * P < 0.05, ** P < 0.01.

Knockdown of VGLUT3 expression decreases cell survival and clonogenicity of colon cancer cells and enhances TGFβ effect.

To determine whether upregulation of VGLUT3 plays an important role in colon cancer,

VGLUT3 expression was knocked down in FET, CBS and HCT116, three colon cancer cell lines with different genetic background. Each of two independent shRNAs (sh2 and sh3) reduced VGLUT3 expression markedly as compared to a scrambled shRNA control, but had no effect on VGLUT1 and VGLUT2 expression (Fig. 5.2A and Fig. 5.10A). Knockdown of

VGLUT3 expression led to increased sensitivity to growth factor deprivation stress (GFDS)- induced apoptosis, reflected by enhanced PARP cleavage (Fig. 5.2B) and 61% to 2.3-fold increase of apoptosis detected in DNA fragmentation assays (Fig. 5.2C). In addition, soft agar assays showed that reduction of VGLUT3 expression led to 34-46% decrease in colony formation under anchorage-independent conditions (Fig. 5.2D). These results demonstrate that downregulation of VGLUT3 expression decreases cell survival and clonogenecity in vitro.

We next determined the underlying mechanisms of VGLUT3 function. It has been shown that glutamatergic signaling mediates the MAPK/ERK and PI3K/AKT pathways 103. Therefore, activation of ERK and AKT was determined using phosphorylation of ERK (pERK) and phosphorylation of AKT (pAKT) as respective indicators. Knockdown of VGLUT3 in FET,

CBS and HCT116 cells resulted in decreased pAKT (Fig. 5.2E and 2F). However, it had no effect on pERK (Fig. 5.10B). These results indicate that VGLUT3 expression is involved in the activation of AKT, which is an important survival factor in colon cancer cells 133,159.

It has been shown that TGFβ signaling activates PKA, which inhibits AKT activation and cell survival in colon cancer cells 151. Although knockdown of VGLUT3 expression decreased 72

pAKT, it did not affect CREB phosphorylation (Fig. 5.10C), indicating that the effect of

VGLUT3 on AKT activation is independent of PKA. Since knockdown of VGLUT3 and TGFβ signaling inhibit activation of AKT independently, we determined whether combination of both would further repress AKT activation. The results showed that concomitant VGLUT3 knockdown and TGFβ treatment led to a greater decrease in pAKT than seen with either treatment alone (Fig. 5.2E). When cells were treated with TGFβ under GFDS for 14 hours,

TGFβ had little effect in control cells but induced apoptosis in VGLUT3 knockdown cells (Fig.

5.2G and 2H). In addition, knockdown of VGLUT3 also sensitized FET cells to TGFβ-mediated inhibition of anchorage-independent growth (Fig. 5.2I). Taken together, these results indicate that, in addition to activating AKT, VGLUT3 also antagonizes TGFβ-mediated tumor suppressor function and that knockdown of VGLUT3 enhances TGFβ effects.

Fig 5.2

Figure 5.2. Knockdown of VGLUT3 sensitizes colon cancer cells to stress-induced apoptosis and enhances TGFβ effect. A, VGLUT3 expression was knocked down by two shRNAs in FET, CBS and HCT116 cells. B & C, Control or VGLUT3 knockdown cells were subjected to GFDS for indicated time. Western blot analysis of PARP cleavage (B) and DNA fragmentation assays (C) were performed. D, Colony numbers were determined in soft agarose assays of control or VGLUT3 knockdown cells. E, Western blot analysis showed pAKT and

AKT in FET control and VGLUT3 knockdown cells treated with 4 ng/ml of TGFβ. F,

Expression of pAKT and AKT in CBS and HCT116 control and VGLUT3 knockdown cells.

G&H, FET control or VGLUT3 knockdown cells were treated with 4 ng/ml TGFβ under GFDS for 14 hrs. Cleaved PARP (G) and apoptosis (H) were determined. I, Colony numbers were determined in soft agarose assays of FET control or VGLUT3 knockdown cells treated with 0.5 ng/ml TGFβ. The data are presented as the mean ± SD of three replications. * P < 0.05, ** P <

0.01.

VGLUT3 plays a critical role in tumor growth in vivo.

To determine VGLUT3 function in tumor growth in vivo. athymic nude mice were injected with HCT116 cells stably expressing a scrambled shRNA or VGLUT3 shRNAs. Xenograft tumor growth curves showed that tumors of VGLUT3 shRNA-expressing cells (designated

VGLUT3 shRNA tumors) grew at a significantly lower rate than those of control cells

(designated control tumors) (Fig. 5.3A). Consequently, VGLUT3 shRNA tumors were much smaller than control tumors (Fig. 5.3B). IHC staining confirmed knockdown of VGLUT3 expression in VGLUT3 shRNA tumors and verified the specificity of the anti-VGLUT3 antibody (Fig. 5.3C). TUNEL and Ki67 staining showed much more apoptotic cells and fewer proliferative cells in VGLUT3 shRNA tumors than in control tumors (Fig. 5.3D). These results indicate that knockdown of VGLUT3 inhibits tumor growth in vivo and that this inhibitory effect is a combined result of increased apoptosis and suppressed proliferation.

Fig 5.3

Figure 3. VGLUT3 mediates tumor growth of colon cancer cells in vivo. A, Xenograft tumor growth curves of HCT116 control and VGLUT3 shRNA-expressing cells are shown. n=16. B,

Images of tumors at the endpoint of experiments are shown. Scale bars, 1 cm. C, Representative images of VGLUT3 staining in xenograft tumors are shown (upper). Quantification of staining intensity was performed (lower). D, Representative images of TUNEL and Ki67 staining are shown (upper). Percentage of positive staining cells was determined (lower). Scale bars, 100

µm. The data are presented as the mean ± SD. *P < 0.05, ** P < 0.01, *** P < 0.001.

MiR-656-3p regulates VGLUT3 expression in colon cancer cells.

Since VGLUT3 expression may be regulated post-transcriptionally, miRNAs, functioning as post-transcriptional regulators of mRNA expression and/or translation, could regulate its expression. We therefore performed an in silico search for putative miRNA-binding sites in the

3’-UTR of the human VGLUT3 mRNA using TargetScan 152, PicTar 153 and miRanda- mirSVR154. Among miRNA candidates conserved between human and mouse, miR-656-3p was identified as a potential regulator of VGLUT3. Q-PCR assays indicated that expression of miR-

656-3p was much lower in colon cancer cell lines than in HCECs (Fig. 5.4A), suggesting that decreased miR-656-3p expression may contribute to upregulated VGLUT3 expression in colon cancer cells.

To demonstrate that miR-656-3p regulates VGLUT3 expression, the miR-656 precursor was stably infected into FET, CBS and HCT116 cells. As a result, expression of mature miR-

656-3p was significantly increased (Fig. 5.4B). Complementarily, a chemically synthesized miR-656-3p inhibitor markedly reduced endogenous miR-656-3p expression by 40% and 43% in FET and HCT116 cells respectively (Fig. 5.4B). Overexpression of miR-656-3p decreased

VGLUT3 protein expression (Fig. 5.4C) whereas the miR-656-3p inhibitor increased VGLUT3 protein expression (Fig. 5.4D). However, VGLUT3 mRNA expression was not affected (Fig.

5.4E). These results indicate that miR-656-3p suppresses VGLUT3 expression by inhibiting its translation. To determine whether VGLUT3 is a direct target of miR-656-3p, three sequences in the 3’-UTRs of VGLUT3 containing the potential miR-656-3p recognition element (Fig.

5.4F) was cloned into a luciferase construct. Luciferase assays revealed that miR-656-3p repressed site 1 but not site 2 or site 3 of 3’-UTRs of VGLUT3 (Fig. 5.4G). These results 77

indicate that miR-656-3p directly targets VGLUT3 partially through binding to site 1 to inhibit its translation.

MiR-656-3p inhibits AKT activation and mediates stress-induced apoptosis and clonogenicity in colon cancer cells.

Similar to VGLUT3 knockdown, miR-656-3p decreased pAKT (Fig. 5.4C) but had no effect on ERK or PKA activation (Fig. 5.10D and 5.10E). MiR-656-3p-expressing cells displayed increased PARP cleavage and 48-54% increase of apoptosis under GFDS (Fig. 5.5A).

In addition, anchorage-independent growth was reduced by 34-60% in miR-656-3p-expressing cells (Fig. 5.5B). These results indicate that miR-656-3p mimics the effect of VGLUT3 knockdown. In contrast, the miR-656-3p inhibitor, which effectively inhibited miR-656-3p expression in FET and HCT116 cells (Fig. 5.4B), reduced PARP cleavage and decreased GFDS- induced apoptosis by 34% and 54% respectively (Fig. 5.5C).

Fig 5.4

Figure 5.4. VGLUT3 is a direct target of miR-656-3p. A, Expression of miR-656-3p was determined in HCECs and colon cancer cells by Q-PCR assays. B, Expression of miR-656-3p was determined after infection with miR-656 precursor or transfection with the miR-656-3p inhibitor. C&D, VGLUT3 expression was determined by western blot assays after infected with the miR-656 precursor (C) or transfected with the miR-656-3p inhibitor (D). Expression of

AKT and pAKT was also determined. E, mRNA expression of VGLUT3 was determined by

RT-PCR assays after infected with miR-656 precursor or transfected with the miR-656-3p inhibitor. F, The predicted miR-656-3p recognition sites in the 3’-UTR of VGLUT3 are indicated by vertical lines. G, After transfection with psiCheck-2 constructs containing site 1,

2 or 3 sequences, luciferase assays were performed in FET control and miR-656-3p expressing cells. 79

To determine whether miR-656-3p-mediated sensitization to GFDS-induced apoptosis could be reversed by restoration of VGLUT3 expression, VGLUT3 cDNA was infected into miR-656-3p-expressing FET and HCT116 cells (Fig. 5.5D, upper). Ectopically expressed

VGLUT3 is resistant to down-regulation mediated by miR-656-3p due to the lack of 3’-UTR.

Ecotopic VGLUT3 expression reversed miR-656-3p-mediated increase of apoptosis under

GFDS (Fig. 5.5D). These results indicate that miR-656-3p sensitizes colon cancer cells to

GFDS-induced apoptosis through the downregulation of VGLUT3 expression.

To investigate whether miR-656-3p enhances TGFβ-mediated tumor suppressor function,

FET cells were treated with TGFβ under GFDS for 14 hours. TGFβ induced apoptosis in miR-

656-3p-expressing cells but not in control cells (Fig. 5.5E). In addition, TGFβ inhibited anchorage-independent growth by 61% in miR-656-3p-expressing cells but only by 30% in control cells (Fig. 5.5F). Complementarily, FET cells were treated with TGFβ under GFDS for

24 hours. While TGFβ induced apoptosis in control cells, the miR-656-3p inhibitor significantly attenuated TGFβ-induced apoptosis (Fig. 5.5G). These results indicated that miR-656-3p enhances TGFβ-induced apoptosis and that inhibition of miR-656-3p antagonizes TGFβ effect.

Fig 5.5

Figure 5.5. MiR-656-3p mimics the effect of VGLUT3 knockdown in colon cancer cells. A,

Vector- or miR-656-3p-expressing FET, CBS and HCT116 cells were subject to GFDS for indicated time. Cleaved PARP (left) and apoptosis (right) were determined. B, Colony numbers were determined in soft agarose assays of vector- or miR-656-3p-expressing cells. C, FET and

HCT116 cells transfected with the miR-656-3p inhibitor were subjected to GFDS for 24 or 72 hrs respectively. Western blot analysis of cleaved PARP (left) and DNA fragmentation assays

(right) were determined. D, VGLUT3 was ectopically expressed in miR-656-3p-expressing

FET and HCT116 cells (upper), which were subjected to GFDS for 24 and 72 hrs respectively.

Cleaved PARP (upper) and apoptosis (lower) were determined. E, Vector- or miR-656-3p- expressing FET cells were treated with 4 ng/ml TGFβ under GFDS for 14 hrs. Cleaved PARP

(left) and apoptosis (right) were determined. F, Colony numbers were determined in soft 81

agarose assays of vector- or miR-656-3p-expressing FET cells treated with 0.5 ng/ml TGFβ. G,

FET cells transfected with the miR-656-3p inhibitor were treated with 4 ng/ml TGFβ under

GFDS for 24 hrs. Cleaved PARP (left) and apoptosis (right) were determined. The data are presented as the mean ± SD of three replications. * P < 0.05, ** P < 0.01, *** P < 0.001.

MiR-656-3p inhibits tumor growth in vivo.

We next determine the function of miR-656-3p in vivo. Athymic nude mice were subcutaneously inoculated with HCT116 control or miR-656-3p-expressing cells. Xenograft tumor growth curves showed that tumors of miR-656-3p-expressing cells (designated miR-656-

3p tumors) grew at a significantly lower rate than those of control cells (designated control tumors) (Fig. 5.6A). Consequently, miR-656-3p tumors were much smaller than control tumors

(Fig. 5.6B). Analysis of VGLUT3 expression showed that the intensity of VGLUT3 staining was notably lower in miR-656-3p tumors than in control tumors (Fig. 5.6C). Furthermore,

TUNEL and Ki67 staining indicated more apoptotic cells and fewer proliferative cells in miR-

656-3p tumors than in control tumors (Fig. 5.6D). These results demonstrate that miR-656-3p suppresses VGLUT3 expression, increases apoptosis, decreases proliferation and inhibit tumor growth in vivo.

Fig 5.6

Figure 5.6. MiR-656b-3p suppresses VGLUT3 expression and inhibits tumor growth in vivo. A, Xenograft tumor growth curves of HCT116 control and miR-656-3p-expressing cells is shown. n=16. B, Images of tumors at the endpoint of experiments are shown. Scale bars, 1 cm. C, Representative images of VGLUT3 staining in xenograft tumors are shown (left).

Quantification of staining intensity was performed (right). D, Representative images of TUNEL and Ki67 staining are shown (left). Percentage of positive TUNEL and Ki67 staining cells were determined (right). Scale bars, 100 µm. The data are presented as the mean ± SD. *P < 0.05,

** P < 0.01.

Expression of miR-656-3p is decreased in colon cancer specimens.

To explore clinical relevance of miR-656-3p, its expression was determined by in situ hybridization in the same sets of TMAs utilized in Figure 1. The staining intensity of miR-656-

3p was much stronger in miR-656-3p-expressing tumors than in control tumors (Fig. 5.7A), verifying the specificity of the probe. Analysis of TMAs indicated that miR-656-3p expression was high in normal colon epithelium, but decreased markedly in colon tumors (Fig. 5.7B).

Quantification of staining showed that the average intensity was significantly lower in colon adenocarcinomas than in normal colon (Fig. 5.7C). In addition, the correlation study revealed a moderate negative correlation between miR-656-3p and VGLUT3 expression (Fig. 5.7D, *P

= 0.025). These results demonstrate that miR-656-3p expression is decreased in colon adenocarcinomas and inversely correlates with VGLUT3 expression and that downregulation of miR-656-3p in colon tumors is at least partially responsible for VGLUT3 upregulation.

Fig 5.7

Figure 5.7. Expression of miR-656-3p is decreased in colon cancer specimens. In situ hybridization analysis of miR-656-3p was performed in xenograft tumors and human specimens. A, Representative images of miR-656-3p staining in xenograft tumors are shown.

Scale bars, 100 µm. B, Normal colon in the absence of the probe was used as a negative control.

Representative images of miR-656-3p staining in normal colon and colon tumors are shown.

Scale bars, 100 µm. C, Quantification of the staining intensity was performed. The values of individual samples are shown. Error bars indicate SEM of the values. *** P < 0.001. D, 86

Correlation of expression of miR-656-3p and VGLUT3 was determined in colon tumors using

Pearson's test (r = -0.3, * P = 0.025; n = 59). The slope was generated by lineage regression analysis.

Taken together, our studies suggest a novel model of crosstalk between miR-656-3p,

VGLUT3, AKT and TGFβ signaling (Fig. 5.8). In this model, miR-656 downregulates

VGLUT3 expression, which leads to AKT inhibition. On the other hand, TGFβ signaling activates PKA and suppresses AKT activation. Consequently, downregulation of VGLUT3 or expression of miR-656-3p collaborates with TGFβ signaling to inhibit AKT activation and enhance TGFβ-mediated tumor suppressor function whereas upregulation of VGLUT3 expression antagonizes TGFβ signaling to promote proliferation, survival and tumorigenesis.

Fig 5.8

Figure 5.8. A proposed model of crosstalk between miR-656-3p, VGLUT3 and TGFβ signaling in regulation of AKT activation, cell survival, proliferation and tumorigenesis of colon cancer cells.

Fig 5.9

Fig. 5.9. Comparison of VGLUT3 intensity and percentage of VGLUT3 positive cells was made in low, moderate and high grade colon tumors (A), in different stages of colon tumors (B) and in well-, moderately- and poorly-differentiated colon tumors (C). The values of individual samples are shown. Error bars indicate SEM of the values. There is no significant difference among the groups.

Fig 5.10

Fig. 5.10. A, RT-PCR analysis of VGLUT1-3 mRNA expression in VGLUT3 knockdown FET cells. Mouse brain tissues were used as a positive control. B&D, Western blot analysis of pERK and total ERK in VGLUT3 knockdown cells (B) and miR-656-3p expressing cells (D). C&E,

Western blot analysis of pCREB and total CREB in VGLUT3 knockdown cells (C) and miR-

656-3p expressing cells (E).

Fig 5.11

Fig. 5.11. Glutamate secretion was evaluated in the control and VGLUT3 knockdown cells.

Cells were cultured in glutamine-free, glutamate-free and phenol red-free DMEM (Gibco) for

48 hours. Conditioned medium was collected and glutamate levels were determined using

AMPLEX Red Glutamic Acid assay kit (Invitrogen) and analyzed on a fluorescence plate reader.

The average concentrations of glutamate per 10,000 cells are shown. Error bars indicate SD of the values. There is no significant difference among the groups.

DISCUSSION

Glutamatergic signaling has been extensively studied in nerve cells, where they modulate excitatory synaptic transmission. VGLUT3, a vesicular glutamate transporter, is an unusual member of the VGLUT family. It is expressed not only in glutamatergic neurons but also in non-glutamatergic neurons such as serotonergic and cholinergic neurons and in astrocytes as well. In addition, its subcellular localization is not restricted to synaptic boutons, but also includes the cell soma and dendrites 95,96. In this study, we discover that expression of VGLUT3 is upregulated significantly in colon tumors as compared to normal colon. Additional findings indicate that miR-656-3p directly targets VGLUT3 to suppress its translation and that downregulation of miR-656-3p in colon tumors is at least partially responsible for VGLUT3 upregulation. Therefore, our studies provide a novel mechanism by which VGLUT3 expression is regulated in colon cancer. Of note, VGLUT1 and VGLUT2, two other vesicular glutamate transporters, are barely expressed in colon cancer cells (Fig. 5.1A), suggesting that they may not play a role in colon cancer.

It has been reported that VGLUTs transport cytoplasmic glutamate into the synaptic vesicles, which is then released by glutamatergic neurons 93. Outside the nervous system,

VGLUTs can be found in the glutamate-secreting non-neuronal cells of different organs, such as the pineal gland 97, bone 99 and testes 100. It has been proposed that this peripheral glutamatergic system may use glutamate as a messenger to transduce signaling in an autocrine or paracrine manner. We have shown that GRM3, a group II metabotropic glutamate receptor, is significantly upregulated in colon cancer and that knockdown or inhibition of GRM3 activation in colon cancer cells reduces cell survival and anchorage-independent growth in vitro 92

and inhibits tumor growth in vivo 160. These studies suggest that peripheral glutamatergic signaling may contribute to colon cancer development. Therefore, a potential function of

VGLUT3 in colon cancer would be to facilitate glutamate secretion, which then activates

GRM3 or other glutamate receptors to promote tumor growth. However, knockdown of

VGLUT3 expression did not affect glutamate secretion in FET and HCT116 cells (Fig. 5.11), indicating that VGLUT3 is not involved in glutamate secretion of colon cancer cells. In addition, glutamate signaling, for example GRM3 activation, has been shown to activate downstream signaling pathways including PI3K/AKT and MAPK/ERK 103,160. Although knockdown of

VGLUT3 inhibits AKT activation, it has no effect on ERK activity (Fig. 5.10B). It remains to be determined whether VGLUT3 contributes to glutamatergic signaling and how VGLUT3 regulates AKT activation in colon cancer cells.

Our studies indicate that VGLUT3 antagonizes TGFβ-mediated tumor suppressor effect.

This is of significance since TGFβ is an important tumor suppressor in colon cancer 132-135.

Upregulation of VGLUT3 could potentially prevent efficient intervention of tumor growth and progression by TGFβ signaling. TGFβ has been shown to activate PKA, which subsequently inhibits AKT activation in colon cancer cells 159. However, knockdown of VGLUT3 has no effect on PKA signaling, but represses AKT activation. Therefore, VGLUT3 and TGFβ signaling counteract each other to regulate AKT activity (Fig. 5.8). Furthermore, VGLUT3 can also function independently of TGFβ signaling since knockdown of VGLUT3 in HCT116 cells with defective TGFβ signaling led to decreased AKT activation, increased apoptosis and reduced anchorage-independent growth (Fig. 5.2). Therefore, VGLUT3 is a potential molecular target in colon cancer regardless of the status of TGFβ signaling. In addition, VGLUT3 93

expression is also markedly higher in pancreatic tumors than in normal pancreas (data not shown), indicating that upregulation of VGLUT3 expression is not specific to colon cancer and that VGLUT3 could be a prospective therapeutic target in other cancers as well.

Taken together, we have identified a signaling axis, miR-656-3p/VGLUT3/AKT, as an important regulator of tumorigenesis in colon cancer. Our studies suggest that VGLUT3 could be a novel molecular target for colon cancer treatment. Therefore, development of VGLUT3 inhibitors that cannot cross blood brain barriers is of clinical significance. Since VGLUT3 is mainly expressed in CNS and upregulated in colon cancer but rarely expressed in normal peripheral tissues, targeting VGLUT3 with those inhibitors will not likely cause adverse neurological or peripheral side effects, making VGLUT3 an attractive and specific target for colon cancer treatment.

CHAPTER 6: DISCUSSION AND FUTURE DIRECTIONS miRNAs and TGFβ

In this study, we identified several miRNAs whose expression is either downregulated or upregulated after TGFβ treatment in a functional screening. We confirmed that miR-487b-3p and miR-656-3p modulated TGFβ function in colon cancer cells. TGFβ signaling plays multiple roles in different stages of cancer. During tumor progression, there are many genetic events occur in TGFβ signaling pathway, including the mutations of TGFβ receptor RII as well as

SMAD proteins 24 31. However, those changes cannot fully explain the alterations in TGFβ signaling during tumor progression. miRNAs are important regulators of TGFβ, they modulate

TGFβ function by targeting canonical TGFβ signaling components or regulating TGFβ target genes74. Both miR-487b-3p and miR-656-3p enhance TGFβ function by inhibiting AKT activation. However, they have no effect on canonical TGFβ signaling itself. MiR-487b-3p and miR-656-3p are both located at 14q32.31 locus. By analyzing TCGA data base, we found that loss of copy number of this region was frequently occurred in colon cancer (data not shown).

Those data suggest that during cancer progression, decrease of those two miRNAs may contribute to attenuated TGFβ tumor suppressing effect in colon cancer. By analyzing the target genes of those miRNAs, we will be able to identify novel regulators of TGFβ signaling and tumor growth.

Regulation of glutamate homeostasis in cancers

We have demonstrated that expression of GRM3 and VGLUT3 was increased in colon cancer patient samples and both of them played important roles in tumorigenesis of colon cancer.

GRM3 and VGLUT3 are both key components of glutamatergic signaling. Two decades ago, 95

people noticed that glutamate level was increased in colon cancer tissues 161. Glutamate is a major product of glutaminolysis in mammalian cells. Tumor cells use glutamine as a major fuel for their bioenergetic needs and intermediates for macromolecular synthesis. When transported into the cells, glutamine is rapidly converted into glutamate by phosphate-dependent glutaminase (GLS), which consequentially, provides materials to meet cell’s energy and biosynthetic needs 162. There are many glutamate transporters that maintain intracellular and extracellular glutamate homeostasis. EAATs transport L-and D-aspartate along with glutamate from extracellular environment to the cells and maintain low level of extracellular glutamate

163 − . Another transporter, Na+-independent cystine/glutamate exchanger, System xc (SXC), uptakes extracellular cysteine and exports intracellular glutamate outside of the cells 164 . In neurons, cytoplasmic glutamate is transported into vesicles by VGLUTs, and released into synaptic cleft 93. In tumors, loss of glutamate homeostasis is usually attributed to abnormal expression of glutamate transporters 165. In this study, we found VGLUT3 was upregulated in colon cancer cells. However, knockdown of VGLUT3 did not change the extracellular glutamate level. Since the other two vesicular glutamate transporters, VGLUT1 and VGULT2, are barely expressed in colon cancer cells, other types of transporters may play major role in the increased level of extracellular Glutamate. People found EAAT2 mediated glutamate transportation was defect in glioma tissues166. In breast cancer, high level of glutamate

– 167 secretion is mediated by System xc . In colon cancer cells, downregulation of EAAT1 and

EAAT3 were found to be correlated with drug resistance 168. Therefore, it will be very interesting to find out whether EAATs and SXC are abnormally expressed in colon cancers.

Studying their function will help understand the regulation and function of the glutamate 96

pathway during tumor development.

Glutamate activates multiple pathways through multiple receptors

Glutamate is a major excitatory neurotransmitter in central nervous system. In cancers, increasing evidence is showing its important role in tumor development. Like growth factors, glutamate acts through binding to a large family of receptors to active multiple downstream pathways. There are two types of glutamate receptors, ionotropic glutamate receptors and metabotropic glutamate receptors, both families have been proven to foster tumor growth in different cell context 102. We found that knockdown of GRM3 inhibits AKT activation and inhibits tumor growth of colon cancer cells both in vitro and in vivo. In addition, knockdown of

GRM3 also inhibits ERK activation. Those results indicate GRM3 activates multiple downstream pathways to regulate colon cancer tumor growth. However, GRM2 and GRM4 are absent in our cell model and do not appear to play any role. Considering that there are more than 20 glutamate receptors, future efforts will determine the function of those receptors in colon cancer.

Regulation of GRM3

We showed that GRM3 was upregulated in colon cancer and that the upregulation was at the posttranscriptional level. We also showed that TGFβ increased GRM3 protein stability in a

Smad2/3-dependent manner. How GRM3 is upregulated during tumor progression remains an interesting question. For most GPCRs, the endocytic pathway tightly controls their activity 169.

On the cell surface, GPCRs are able to bind their ligands and activate signaling cascades inside the cells. After that, receptors are first phosphorylated by GPCR kinases (GRKs) and then internalized, which is mediated by arrestins and clathrin-coated pits. Some of the receptors are 97

recycled back to cell membrane and others are targeted to the lysosome for degradation, which results in the complete termination of receptor activity 169. Whether GRM3 turnover is dysregulated in colon cancer remains to be investigated. Defects of the recycling machinery will lead to increased expression of GRM3 on the cell surface and prolonged receptor activity.

Other insights of VGLUT3 and GRM3

VGLUTs are responsible for transporting glutamate into synaptic vesicles93. In this study, we found that VGLUT3 was upregulated in colon cancer, leading to increased AKT activation.

It suggests the importance of glutamate transportation in cancer development. Surprisingly, knockdown of VGLUT3 in colon cancer cells does not affect the extracellular glutamate level, indicating that there may be other mechanisms involved in the function of VGLUT3. In pancreatic β cells, it was found that VGLUT3 mediated glutamate uptake into insulin containing secretory vesicles 170, which modulated insulin release 171. Those findings reveal that VGLUT3 may co-transport other growth factors through the glutamate-containing vesicles. Once released to the extracellular environment, those growth factors may bind to their receptors and active various downstream signaling in cancer cells.

Like other G protein coupled receptors, GRM3 converts extracellular signals into intracellular responses. However, some G protein coupled receptors are found to be localized on intracellular membranes, and their function is distinct from their cell surface counterparts.

For example, more than 80% of GRM5 was found at intracellular membrane in the rat and monkey substantia nigra 172. Only intracellular mGluR5 is able to phosphorylate ERK1/2 and

Elk-1173. Those findings emphasize that glutamate may activate distinct signaling pathways by binding to intracellular glutamate receptors. So far, there is no evidence showing that GRM3 is 98

exclusively expressed on the cell membrane. Therefore, it will be very interesting to determine whether GRM3 is also expressed on the membrane of other intracellular organelles. The change of intracellular glutamate may trigger distinct signaling pathways. Moreover, in that case,

VGLUTs may also play a role in this process by transporting glutamate from cytoplasm to subcellular compartments, where glutamate binds to their receptors and activates intracellular glutamate signaling.

Pharmacology of glutamate pathway inhibitors in cancer treatment

In recent years, increasing evidence shows the importance of glutamate signaling in tumor development. Many glutamate receptor antagonists have been implicated to have potential for cancer treatment. AMPAR/KR inhibitors, ZK 200775 and GYKI 52466 showed antiproliferative effect in glioma models102. An NMDAR antagonist, memantine has been employed in a Phase II clinical trial now 102. The glutamate release inhibitor riluzole which is approved by FDA for treating amyotrophic lateral sclerosis showed promising inhibitory effect in glioma, breast cancer and prostate cancers 174. mGluRs are considered more susceptible for anti-cancer drug design due to their structure –function relationship 60. However, clinical studies of mGluR antagonists are still lacking. In this study, we showed that a GRM3 inhibitor,

LY341495, inhibited tumor growth of colon cancer cells in vivo. Future studies are needed to validate the anti-cancer effect of GRM3 antagonists in clinical trials. Since GRM3 activates multiple signaling pathways, combination of GRM3 antagonists with other drugs may help increase their anti-tumor efficiency.

Literature Cited

1. Siegel, R., Ma, J., Zou, Z. & Jemal, A. Cancer statistics, 2014. CA: a cancer journal

for clinicians 64, 9-29 (2014).

2. Markowitz, S.D. & Bertagnolli, M.M. Molecular basis of colorectal cancer. New

England Journal of Medicine 361, 2449-2460 (2009).

3. Fabricant, R.N., De Larco, J.E. & Todaro, G.J. Nerve growth factor receptors on human

melanoma cells in culture. Proceedings of the National Academy of Sciences 74, 565-

569 (1977).

4. Roberts, A.B. et al. Purification and properties of a type beta transforming growth

factor from bovine kidney. Biochemistry 22, 5692-5698 (1983).

5. Massague, J. The transforming growth factor-beta family. Annual review of cell biology

6, 597-641 (1990).

6. Heldin, C.-H., Miyazono, K. & Ten Dijke, P. TGF-β signalling from cell membrane to

nucleus through SMAD proteins. Nature 390, 465-471 (1997).

7. Massagué, J., Seoane, J. & Wotton, D. Smad transcription factors. Genes &

development 19, 2783-2810 (2005).

8. Hayashi, H. et al. The MAD-related protein Smad7 associates with the TGFβ receptor

and functions as an antagonist of TGFβ signaling. Cell 89, 1165-1173 (1997).

9. Nakao, A. et al. Identification of Smad7, a TGFβ-inducible antagonist of TGF-β

signalling. Nature 389, 631-635 (1997).

10. Kavsak, P. et al. Smad7 binds to Smurf2 to form an E3 ubiquitin ligase that targets the

TGFβ receptor for degradation. Molecular cell 6, 1365-1375 (2000). 100

11. Tian, M., Neil, J.R. & Schiemann, W.P. Transforming growth factor-beta and the

hallmarks of cancer. Cell Signal 23, 951-62 (2011).

12. Massagué, J. TGFβ in cancer. Cell 134, 215-230 (2008).

13. Hannon, G.J. & Beach, D. p15INK4B is a potential effector of TGF-beta-induced cell

cycle arrest. Nature 371, 257-61 (1994).

14. Datto, M.B. et al. Transforming growth factor beta induces the cyclin-dependent kinase

inhibitor p21 through a p53-independent mechanism. Proceedings of the National

Academy of Sciences 92, 5545-5549 (1995).

15. Coffey, R. et al. Selective inhibition of growth-related gene expression in murine

keratinocytes by transforming growth factor beta. Molecular and cellular biology 8,

3088-3093 (1988).

16. Kang, Y., Chen, C.-R. & Massagué, J. A self-enabling TGFβ response coupled to stress

signaling: Smad engages stress response factor ATF3 for Id1 repression in epithelial

cells. Molecular cell 11, 915-926 (2003).

17. Siegel, P.M. & Massagué, J. Cytostatic and apoptotic actions of TGF-β in homeostasis

and cancer. Nature Reviews Cancer 3, 807-820 (2003).

18. Perlman, R., Schiemann, W.P., Brooks, M.W., Lodish, H.F. & Weinberg, R.A. TGF-β-

induced apoptosis is mediated by the adapter protein Daxx that facilitates JNK

activation. Nature cell biology 3, 708-714 (2001).

19. Schuster, N. & Krieglstein, K. Mechanisms of TGF-ß-mediated apoptosis. Cell and

tissue research 307, 1-14 (2002).

20. Valderrama-Carvajal, H. et al. Activin/TGF-β induce apoptosis through Smad- 101

dependent expression of the lipid phosphatase SHIP. Nature cell biology 4, 963-969

(2002).

21. Wang, J. et al. Transforming growth factor beta induces apoptosis through repressing

the phosphoinositide 3-kinase/AKT/survivin pathway in colon cancer cells. Cancer

Res 68, 3152-60 (2008).

22. Saltzman, A. et al. Transforming Growth Factor-β-Mediated Apoptosis in the Ramos

B-Lymphoma Cell Line Is Accompanied by Caspase Activation and Bcl-X< sub>

L Downregulation. Experimental cell research 242, 244-254 (1998).

23. Lacerte, A. et al. Transforming growth factor-β inhibits telomerase through SMAD3

and E2F transcription factors. Cellular signalling 20, 50-59 (2008).

24. Grady, W.M. & Markowitz, S.D. Genetic and epigenetic alterations in colon cancer.

Annual review of genomics and human genetics 3, 101-128 (2002).

25. Grady, W.M. et al. Mutational inactivation of transforming growth factor β receptor

type II in microsatellite stable colon cancers. Cancer Research 59, 320-324 (1999).

26. Xu, Y. & Pasche, B. TGF-beta signaling alterations and susceptibility to colorectal

cancer. Hum Mol Genet, R14-20 (2007).

27. Kim, S.-J., Im, Y.-H., Markowitz, S. & Bang, Y.-J. Molecular mechanisms of

inactivation of TGF-β receptors during carcinogenesis. Cytokine & growth factor

reviews 11, 159-168 (2000).

28. Hata, A., Massagué, J. & Shi, Y. TGF-β singaling and cancer: structural and functional

consequences of mutations in Smads. Molecular medicine today 4, 257-262 (1998).

29. Kleeff, J. et al. The TGF-β signaling inhibitor Smad 7 enhances tumorigenicity in 102

pancreatic cancer. Oncogene 18, 5363-5372 (1999).

30. Nagata, H. et al. Inhibition of c‐Jun NH2‐terminal kinase switches Smad3 signaling

from oncogenesis to tumor‐suppression in rat hepatocellular carcinoma. Hepatology 49,

1944-1953 (2009).

31. Akhurst, R.J. & Derynck, R. TGF-beta signaling in cancer--a double-edged sword.

Trends Cell Biol 11, S44-51 (2001).

32. Dalal, B., Keown, P. & Greenberg, A. Immunocytochemical localization of secreted

transforming growth factor-beta 1 to the advancing edges of primary tumors and to

lymph node metastases of human mammary carcinoma. The American journal of

pathology 143, 381 (1993).

33. Geissmann, F. et al. TGF-β1 prevents the noncognate maturation of human dendritic

Langerhans cells. The Journal of Immunology 162, 4567-4575 (1999).

34. Letterio, J.J. & Roberts, A.B. Regulation of immune responses by TGF-β. Annual

review of immunology 16, 137-161 (1998).

35. Dong, Y., Tang, L., Letterio, J.J. & Benveniste, E.N. The Smad3 protein is involved in

TGF-β inhibition of class II transactivator and class II MHC expression. The Journal

of Immunology 167, 311-319 (2001).

36. De Jong, J.S., van Diest, P.J., Van Der Valk, P. & Baak, J. Expression of growth factors,

growth‐inhibiting factors, and their receptors in invasive breast cancer. II: Correlations

with proliferation and angiogenesis. The Journal of pathology 184, 53-57 (1998).

37. Hasegawa, Y. et al. Transforming growth factor‐β1 level correlates with angiogenesis,

tumor progression, and prognosis in patients with nonsmall cell lung carcinoma. 103

Cancer 91, 964-971 (2001).

38. Pertovaara, L. et al. Vascular endothelial growth factor is induced in response to

transforming growth factor-beta in fibroblastic and epithelial cells. Journal of

Biological Chemistry 269, 6271-6274 (1994).

39. Shimo, T. et al. Involvement of CTGF, a hypertrophic chondrocyte-specific gene

product, in tumor angiogenesis. Oncology 61, 315-322 (2001).

40. Hagedorn, H.G., Bachmeier, B.E. & Nerlich, A.G. Synthesis and degradation of

basement membranes and extracellular matrix and their regulation by TGF-b in

invasive carcinomas (Review). International journal of oncology 18, 669-682 (2001).

41. Enholm, B. et al. Comparison of VEGF, VEGF-B, VEGF-C and Ang-1 mRNA

regulation by serum, growth factors, oncoproteins and hypoxia. Oncogene 14, 2475-

2483 (1997).

42. Thiery, J.P. Epithelial–mesenchymal transitions in development and pathologies.

Current opinion in cell biology 15, 740-746 (2003).

43. Thuault, S. et al. Transforming growth factor-β employs HMGA2 to elicit epithelial–

mesenchymal transition. J cell Biol 174, 175-183 (2006).

44. Lampropoulos, P. et al. TGF-beta signalling in colon carcinogenesis. Cancer letters

314, 1-7 (2012).

45. Xu, Y. & Pasche, B. TGF-β signaling alterations and susceptibility to colorectal cancer.

Human molecular genetics 16, R14-R20 (2007).

46. Trobridge, P. et al. TGF-β receptor inactivation and mutant Kras induce intestinal

neoplasms in mice via a β-catenin-independent pathway. Gastroenterology 136, 1680- 104

1688. e7 (2009).

47. Levy, L. & Hill, C.S. Smad4 dependency defines two classes of transforming growth

factor β (TGF-β) target genes and distinguishes TGF-β-induced epithelial-

mesenchymal transition from its antiproliferative and migratory responses. Molecular

and cellular biology 25, 8108-8125 (2005).

48. Bartel, D.P. MicroRNAs: target recognition and regulatory functions. Cell 136, 215-

233 (2009).

49. Ha, M. & Kim, V.N. Regulation of microRNA biogenesis. Nature reviews Molecular

cell biology 15, 509-524 (2014).

50. Lee, Y. et al. MicroRNA genes are transcribed by RNA polymerase II. The EMBO

journal 23, 4051-4060 (2004).

51. Lee, Y. et al. The nuclear RNase III Drosha initiates microRNA processing. Nature 425,

415-419 (2003).

52. Lund, E., Güttinger, S., Calado, A., Dahlberg, J.E. & Kutay, U. Nuclear export of

microRNA precursors. Science 303, 95-98 (2004).

53. Bernstein, E., Caudy, A.A., Hammond, S.M. & Hannon, G.J. Role for a bidentate

ribonuclease in the initiation step of RNA interference. Nature 409, 363-366 (2001).

54. Mourelatos, Z. et al. miRNPs: a novel class of ribonucleoproteins containing numerous

microRNAs. Genes & development 16, 720-728 (2002).

55. Hirabara, S.M. et al. Molecular targets related to inflammation and insulin resistance

and potential interventions. BioMed Research International 2012(2012).

56. Calin, G.A. et al. Human microRNA genes are frequently located at fragile sites and 105

genomic regions involved in cancers. Proceedings of the National Academy of Sciences

of the United States of America 101, 2999-3004 (2004).

57. Calin, G.A. et al. Frequent deletions and down-regulation of micro-RNA genes miR15

and miR16 at 13q14 in chronic lymphocytic leukemia. Proceedings of the National

Academy of Sciences 99, 15524-15529 (2002).

58. Visone, R. & Croce, C.M. MiRNAs and cancer. The American journal of pathology

174, 1131-1138 (2009).

59. Hayashita, Y. et al. A polycistronic microRNA cluster, miR-17-92, is overexpressed in

human lung cancers and enhances cell proliferation. Cancer Research 65, 9628-9632

(2005).

60. Iorio, M.V. et al. MicroRNA signatures in human ovarian cancer. Cancer Research 67,

8699-8707 (2007).

61. Lujambio, A. CpG island hypermethylation of tumor suppressor microRNAs in human

cancer. Cell cycle 6, 1454-1458 (2007).

62. Zhang, B., Pan, X., Cobb, G.P. & Anderson, T.A. microRNAs as oncogenes and tumor

suppressors. Developmental biology 302, 1-12 (2007).

63. Costinean, S. et al. Pre-B cell proliferation and lymphoblastic leukemia/high-grade

lymphoma in Eμ-miR155 transgenic mice. Proceedings of the National Academy of

Sciences 103, 7024-7029 (2006).

64. Hossain, A., Kuo, M.T. & Saunders, G.F. Mir-17-5p regulates breast cancer cell

proliferation by inhibiting translation of AIB1 mRNA. Molecular and cellular biology

26, 8191-8201 (2006). 106

65. Schetter, A.J., Okayama, H. & Harris, C.C. The role of microRNAs in colorectal cancer.

Cancer journal (Sudbury, Mass.) 18, 244 (2012).

66. Visone, R. et al. MicroRNAs (miR)-221 and miR-222, both overexpressed in human

thyroid papillary carcinomas, regulate p27Kip1 protein levels and cell cycle.

Endocrine-related cancer 14, 791-798 (2007).

67. Liu, Q. et al. miR-16 family induces cell cycle arrest by regulating multiple cell cycle

genes. Nucleic acids research 36, 5391-5404 (2008).

68. Murakami, Y. et al. Comprehensive analysis of microRNA expression patterns in

hepatocellular carcinoma and non-tumorous tissues. Oncogene 25, 2537-2545 (2006).

69. Schetter, A.J. et al. MicroRNA expression profiles associated with prognosis and

therapeutic outcome in colon adenocarcinoma. Jama 299, 425-436 (2008).

70. Ranade, A.R. et al. MicroRNA 92a-2*: a biomarker predictive for chemoresistance and

prognostic for survival in patients with small cell lung cancer. Journal of thoracic

oncology 5, 1273-1278 (2010).

71. Cho, W.C. Great potential of miRNAs as predictive and prognostic markers for cancer.

Expert review of molecular diagnostics 12, 315-318 (2012).

72. Davis-Dusenbery, B.N. & Hata, A. Mechanisms of control of microRNA biogenesis.

Journal of biochemistry 148, 381-392 (2010).

73. Davis, B.N., Hilyard, A.C., Lagna, G. & Hata, A. SMAD proteins control DROSHA-

mediated microRNA maturation. Nature 454, 56-61 (2008).

74. Butz, H., Racz, K., Hunyady, L. & Patocs, A. Crosstalk between TGF-beta signaling

and the microRNA machinery. Trends Pharmacol Sci 33, 382-93 (2012). 107

75. Rogler, C.E. et al. MicroRNA‐23b cluster microRNAs regulate transforming growth

factor‐beta/bone morphogenetic protein signaling and liver stem cell differentiation by

targeting Smads. Hepatology 50, 575-584 (2009).

76. Shan, H. et al. Downregulation of miR-133 and miR-590 contributes to nicotine-

induced atrial remodelling in canines. Cardiovascular research 83, 465-472 (2009).

77. Liu, G. et al. miR-21 mediates fibrogenic activation of pulmonary fibroblasts and lung

fibrosis. Journal of Experimental Medicine 207, 1589-1597 (2010).

78. Leeper, N.J. et al. MicroRNA‐26a is a novel regulator of vascular smooth muscle cell

function. Journal of cellular physiology 226, 1035-1043 (2011).

79. Wang, B. et al. miR-200a prevents renal fibrogenesis through repression of TGF-β2

expression. diabetes 60, 280-287 (2011).

80. Petrocca, F. et al. E2F1-regulated microRNAs impair TGFβ-dependent cell-cycle arrest

and apoptosis in gastric cancer. Cancer cell 13, 272-286 (2008).

81. Fontana, L. et al. Antagomir-17-5p abolishes the growth of therapy-resistant

neuroblastoma through p21 and BIM. PloS one 3, e2236 (2008).

82. Alix, J.J. & de Jesus Domingues, A.M. White matter synapses Form, function, and

dysfunction. Neurology 76, 397-404 (2011).

83. Fairman, W. & Amara, S. Functional diversity of excitatory amino acid transporters:

ion channel and transport modes. American Journal of Physiology-Renal Physiology

277, F481-F486 (1999).

84. Kleinschmidt, A., Bear, M.F. & Singer, W. Blockade of “NMDA” receptors disrupts

experience-dependent plasticity of kitten striate cortex. Science 238, 355-358 (1987). 108

85. Komuro, H. & Rakic, P. Modulation of neuronal migration by NMDA receptors.

SCIENCE-NEW YORK THEN WASHINGTON- 260, 95-95 (1993).

86. Ikonomidou, C. et al. Blockade of NMDA receptors and apoptotic neurodegeneration

in the developing brain. Science 283, 70-74 (1999).

87. Rzeski, W., Turski, L. & Ikonomidou, C. Glutamate antagonists limit tumor growth.

Proceedings of the National Academy of Sciences 98, 6372-6377 (2001).

88. Sharma, M.K., Seidlitz, E.P. & Singh, G. Cancer cells release glutamate via the

cystine/glutamate antiporter. Biochemical and biophysical research communications

391, 91-95 (2010).

89. Lyons, S.A., Chung, W.J., Weaver, A.K., Ogunrinu, T. & Sontheimer, H. Autocrine

glutamate signaling promotes glioma cell invasion. Cancer Research 67, 9463-9471

(2007).

90. Koochekpour, S. et al. Serum glutamate levels correlate with Gleason score and

glutamate blockade decreases proliferation, migration, and invasion and induces

apoptosis in prostate cancer cells. Clinical Cancer Research 18, 5888-5901 (2012).

91. Herner, A. et al. Glutamate increases pancreatic cancer cell invasion and migration via

AMPA receptor activation and Kras‐MAPK signaling. International journal of cancer

129, 2349-2359 (2011).

92. Curtis, D., Phillis, J. & Watkins, J. Chemical excitation of spinal neurones. Nature 183,

611-612 (1959).

93. Liguz-Lecznar, M. & Skangiel-Kramska, J. Vesicular glutamate transporters

(VGLUTs): the three musketeers of glutamatergic system. Acta neurobiologiae 109

experimentalis 67, 207 (2007).

94. Fremeau, R.T. et al. The expression of vesicular glutamate transporters defines two

classes of excitatory synapse. Neuron 31, 247-260 (2001).

95. Gras, C. et al. A third vesicular glutamate transporter expressed by cholinergic and

serotoninergic neurons. Journal of Neuroscience 22, 5442-5451 (2002).

96. Fremeau, R.T. et al. The identification of vesicular glutamate transporter 3 suggests

novel modes of signaling by glutamate. Proceedings of the National Academy of

Sciences 99, 14488-14493 (2002).

97. Morimoto, R. et al. Co‐expression of vesicular glutamate transporters (VGLUT1 and

VGLUT2) and their association with synaptic‐like microvesicles in rat pinealocytes.

Journal of neurochemistry 84, 382-391 (2003).

98. Hayashi, M., Morimoto, R., Yamamoto, A. & Moriyama, Y. Expression and

localization of vesicular glutamate transporters in pancreatic islets, upper

gastrointestinal tract, and testis. Journal of Histochemistry & Cytochemistry 51, 1375-

1390 (2003).

99. Hinoi, E., Takarada, T., Ueshima, T., Tsuchihashi, Y. & Yoneda, Y. Glutamate signaling

in peripheral tissues. The FEBS Journal 271, 1-13 (2004).

100. Redecker, P., Kreutz, M.R., Bockmann, J., Gundelfinger, E.D. & Boeckers, T.M. Brain

synaptic junctional proteins at the acrosome of rat testicular germ cells. Journal of

Histochemistry & Cytochemistry 51, 809-819 (2003).

101. Traynelis, S.F. et al. Glutamate receptor ion channels: structure, regulation, and

function. Pharmacological reviews 62, 405-496 (2010). 110

102. Stepulak, A., Rola, R., Polberg, K. & Ikonomidou, C. Glutamate and its receptors in

cancer. Journal of Neural Transmission 121, 933-944 (2014).

103. Willard, S.S. & Koochekpour, S. Glutamate, glutamate receptors, and downstream

signaling pathways. Int J Biol Sci 9, 948-959 (2013).

104. M Ribeiro, F., Paquet, M., P Cregan, S. & SG Ferguson, S. Group I metabotropic

glutamate receptor signalling and its implication in neurological disease. CNS &

Neurological Disorders-Drug Targets (Formerly Current Drug Targets-CNS &

Neurological Disorders) 9, 574-595 (2010).

105. Li, X.M. et al. JNK1 contributes to metabotropic glutamate receptor‐dependent long‐

term depression and short‐term synaptic plasticity in the mice area hippocampal CA1.

European Journal of Neuroscience 25, 391-396 (2007).

106. Saugstad, J.A. & Ingram, S.L. Group I metabotropic glutamate receptors (mGlu1 and

mGlu5). in The Glutamate Receptors 387-463 (Springer, 2008).

107. Niswender, C.M. & Conn, P.J. Metabotropic glutamate receptors: physiology,

pharmacology, and disease. Annual review of pharmacology and toxicology 50, 295-

322 (2010).

108. Hou, L. & Klann, E. Activation of the phosphoinositide 3-kinase-Akt-mammalian

target of rapamycin signaling pathway is required for metabotropic glutamate receptor-

dependent long-term depression. Journal of Neuroscience 24, 6352-6361 (2004).

109. Page, G. et al. Group I metabotropic glutamate receptors activate the p70S6 kinase via

both mammalian target of rapamycin (mTOR) and extracellular signal-regulated kinase

(ERK 1/2) signaling pathways in rat striatal and hippocampal synaptoneurosomes. 111

Neurochemistry international 49, 413-421 (2006).

110. Brocke, K.S. et al. Glutamate receptors in pediatric tumors of the central nervous

system. Cancer biology & therapy 9, 455-468 (2010).

111. Pollock, P.M. et al. Melanoma mouse model implicates metabotropic glutamate

signaling in melanocytic neoplasia. Nature genetics 34, 108-112 (2003).

112. Ohtani, Y. et al. Metabotropic glutamate receptor subtype-1 is essential for in vivo

growth of melanoma. Oncogene 27, 7162-7170 (2008).

113. D'onofrio, M. et al. Pharmacological blockade of mGlu2/3 metabotropic glutamate

receptors reduces cell proliferation in cultured human glioma cells. Journal of

neurochemistry 84, 1288-1295 (2003).

114. Aronica, E. et al. Expression and functional role of mGluR3 and mGluR5 in human

astrocytes and glioma cells: opposite regulation of glutamate transporter proteins.

European Journal of Neuroscience 17, 2106-2118 (2003).

115. Zhang, C. et al. Anti-cancer effect of metabotropic glutamate receptor 1 inhibition in

human glioma U87 cells: involvement of PI3K/Akt/mTOR pathway. Cellular

Physiology and Biochemistry 35, 419-432 (2015).

116. Chen, S., Zhu, H., Wetzel, W.J. & Philbert, M.A. Spotaneous Melanocytosis in

Transgenic Mice. Journal of investigative dermatology 106, 1145-1151 (1996).

117. Prickett, T.D. et al. Exon capture analysis of G protein-coupled receptors identifies

activating mutations in GRM3 in melanoma. Nature genetics 43, 1119-1126 (2011).

118. Chang, H.J. et al. Metabotropic glutamate receptor 4 expression in colorectal

carcinoma and its prognostic significance. Clinical Cancer Research 11, 3288-3295 112

(2005).

119. Roig, A.I. et al. Immortalized epithelial cells derived from human colon biopsies

express stem cell markers and differentiate in vitro. Gastroenterology 138, 1012-1021.

e5 (2010).

120. Boyd, D., Levine, A., Brattain, D., McKnight, M. & Brattain, M. Comparison of growth

requirements of two human intratumoral colon carcinoma cell lines in monolayer and

soft agarose. Cancer Research 48, 2469-2474 (1988).

121. Gulubova, M. et al. Role of TGF-β1, its receptor TGFβRII, and Smad proteins in the

progression of colorectal cancer. International journal of colorectal disease 25, 591-

599 (2010).

122. Tanabe, Y., Masu, M., Ishii, T., Shigemoto, R. & Nakanishi, S. A family of metabotropic

glutamate receptors. Neuron 8, 169-179 (1992).

123. Aramori, I. & Nakanishi, S. Signal transduction and pharmacological characteristics of

a metabotropic glutamate receptor, mGluRl, in transfected CHO cells. Neuron 8, 757-

765 (1992).

124. Skerry, T.M. & Genever, P.G. Glutamate signalling in non-neuronal tissues. Trends in

Pharmacological Sciences 22, 174-181 (2001).

125. Hoogduijn, M. et al. Glutamate receptors on human melanocytes regulate the

expression of MiTF. Pigment cell research 19, 58-67 (2006).

126. Tong, Q., Ouedraogo, R. & Kirchgessner, A.L. Localization and function of group III

metabotropic glutamate receptors in rat pancreatic islets. American Journal of

Physiology-Endocrinology and Metabolism 282, E1324-E1333 (2002). 113

127. Martino, J.J. et al. Metabotropic glutamate receptor 1 (Grm1) is an oncogene in

epithelial cells. Oncogene 32, 4366-4376 (2013).

128. Ciceroni, C. et al. Type-3 metabotropic glutamate receptors negatively modulate bone

morphogenetic protein receptor signaling and support the tumourigenic potential of

glioma-initiating cells. Neuropharmacology 55, 568-576 (2008).

129. Arcella, A. et al. Pharmacological blockade of group II metabotropic glutamate

receptors reduces the growth of glioma cells in vivo. Neuro-oncology 7, 236-245

(2005).

130. Wakefield, L.M. & Roberts, A.B. TGF-β signaling: positive and negative effects on

tumorigenesis. Current opinion in genetics & development 12, 22-29 (2002).

131. Calon, A. et al. Dependency of colorectal cancer on a TGF-β-driven program in stromal

cells for metastasis initiation. Cancer cell 22, 571-584 (2012).

132. Wang, J. et al. Demonstration that mutation of the type II transforming growth factor β

receptor inactivates its tumor suppressor activity in replication error-positive colon

carcinoma cells. Journal of Biological Chemistry 270, 22044-22049 (1995).

133. Wang, J. et al. Transforming growth factor β induces apoptosis through repressing the

phosphoinositide 3-kinase/AKT/survivin pathway in colon cancer cells. Cancer

Research 68, 3152-3160 (2008).

134. Wang, J. et al. Reduced expression of transforming growth factor β type I receptor

contributes to the malignancy of human colon carcinoma cells. Journal of Biological

Chemistry 271, 17366-17371 (1996).

135. Forrester, E. et al. Effect of conditional knockout of the type II TGF-β receptor gene in 114

mammary epithelia on mammary gland development and polyomavirus middle T

antigen induced tumor formation and metastasis. Cancer Research 65, 2296-2302

(2005).

136. Veenendaal, L.M. et al. Differential Notch and TGFβ signaling in primary colorectal

tumors and their corresponding metastases. Analytical Cellular Pathology 30, 1-11

(2008).

137. Bacman, D. et al. TGF-beta receptor 2 downregulation in tumour-associated stroma

worsens prognosis and high-grade tumours show more tumour-associated macrophages

and lower TGF-beta1 expression in colon carcinoma: a retrospective study. BMC

cancer 7, 156 (2007).

138. Hamamoto, T. et al. Compound disruption of smad2 accelerates malignant progression

of intestinal tumors in apc knockout mice. Cancer Research 62, 5955-5961 (2002).

139. Muñoz, N.M. et al. Transforming growth factor β receptor type II inactivation induces

the malignant transformation of intestinal neoplasms initiated by Apc mutation. Cancer

Research 66, 9837-9844 (2006).

140. Sodir, N.M. et al. Smad3 deficiency promotes tumorigenesis in the distal colon of

ApcMin/+ mice. Cancer Research 66, 8430-8438 (2006).

141. Takaku, K. et al. Intestinal tumorigenesis in compound mutant mice of both Dpc4

(Smad4) and Apc genes. Cell 92, 645-656 (1998).

142. Du, T. & Zamore, P.D. microPrimer: the biogenesis and function of microRNA.

Development 132, 4645-4652 (2005).

143. Schoepp, D.D., Jane, D.E. & Monn, J.A. Pharmacological agents acting at subtypes of 115

metabotropic glutamate receptors. Neuropharmacology 38, 1431-1476 (1999).

144. Markowitz, S., Wang, J., Myeroff, L. & Parsons, R. Inactivation of the type II TGF-

beta receptor in colon cancer cells with microsatellite instability. Science 268, 1336

(1995).

145. Chowdhury, S. et al. Intra-tumoral heterogeneity in metastatic potential and survival

signaling between iso-clonal HCT116 and HCT116b human colon carcinoma cell lines.

PloS one 8, e60299 (2013).

146. Ye, S.-C. et al. Contextual effects of transforming growth factor β on the tumorigenicity

of human colon carcinoma cells. Cancer Research 59, 4725-4731 (1999).

147. Woodford-Richens, K. et al. SMAD4 mutations in colorectal cancer probably occur

before chromosomal instability, but after divergence of the microsatellite instability

pathway. Proceedings of the National Academy of Sciences 98, 9719-9723 (2001).

148. Da Costa, L.T. et al. CDX 2 is mutated in a colorectal cancer with normal APC/β-

catenin signaling. Oncogene 18, 5010-5014 (1999).

149. Kingston, A. et al. LY341495 is a nanomolar potent and selective antagonist of group

II metabotropic glutamate receptors. Neuropharmacology 37, 1-12 (1998).

150. Banerjee, A., Pirrone, V., Wigdahl, B. & Nonnemacher, M.R. Transcriptional regulation

of the chemokine co-receptor CCR5 by the cAMP/PKA/CREB pathway. Biomedicine

& Pharmacotherapy 65, 293-297 (2011).

151. Geng, L., Chaudhuri, A., Talmon, G., Wisecarver, J.L. & Wang, J. TGF-Beta suppresses

VEGFA-mediated angiogenesis in colon cancer metastasis. PloS one 8, e59918 (2013).

152. Grimson, A. et al. MicroRNA targeting specificity in mammals: determinants beyond 116

seed pairing. Molecular cell 27, 91-105 (2007).

153. Krek, A. et al. Combinatorial microRNA target predictions. Nature genetics 37, 495-

500 (2005).

154. Betel, D., Koppal, A., Agius, P., Sander, C. & Leslie, C. Comprehensive modeling of

microRNA targets predicts functional non-conserved and non-canonical sites. Genome

biology 11, R90 (2010).

155. Cha, J.-H.J. et al. Altered brain neurotransmitter receptors in transgenic mice

expressing a portion of an abnormal human huntington disease gene. Proceedings of

the National Academy of Sciences 95, 6480-6485 (1998).

156. Neto, F.L. et al. Expression of metabotropic glutamate receptors mRNA in the thalamus

and brainstem of monoarthritic rats. Molecular Brain Research 81, 140-154 (2000).

157. Neto, F. et al. Up‐regulation of metabotropic glutamate receptor 3 mRNA expression

in the cerebral cortex of monoarthritic rats. Journal of neuroscience research 63, 356-

367 (2001).

158. Moriyama, Y. & Yamamoto, A. Glutamatergic chemical transmission: look! Here, there,

and anywhere. Journal of biochemistry 135, 155-163 (2004).

159. Chowdhury, S. et al. Identification of a novel TGFβ/PKA signaling transduceome in

mediating control of cell survival and metastasis in colon cancer. PloS one 6, e19335

(2011).

160. Yi, H. et al. The miR-487b-3p/GRM3/TGFβ signaling axis is an important regulator of

colon cancer tumorigenesis. Oncogene (2017).

161. Okada, A. et al. Increased aspartate and glutamate levels in both gastric and colon 117

cancer tissues. The Tokushima journal of experimental medicine 40, 19-25 (1993).

162. Hensley, C.T., Wasti, A.T. & DeBerardinis, R.J. Glutamine and cancer: cell biology,

physiology, and clinical opportunities. The Journal of clinical investigation 123, 3678-

3684 (2013).

163. Robert, S.M. & Sontheimer, H. Glutamate transporters in the biology of malignant

gliomas. Cellular and molecular life sciences 71, 1839-1854 (2014).

164. Thomas, A.G. et al. High-Throughput Assay Development for Cystine-Glutamate

Antiporter (xc-) Highlights Faster Cystine Uptake than Glutamate Release in Glioma

Cells. PloS one 10, e0127785 (2015).

165. Takahashi, M. et al. The role of glutamate transporters in glutamate homeostasis in the

brain. Journal of Experimental Biology 200, 401-409 (1997).

166. de Groot, J.F., Liu, T.J., Fuller, G. & Yung, W.A. The excitatory amino acid transporter-

2 induces apoptosis and decreases glioma growth in vitro and in vivo. Cancer Research

65, 1934-1940 (2005).

167. Fazzari, J., Lin, H., Murphy, C., Ungard, R. & Singh, G. Inhibitors of glutamate release

from breast cancer cells; new targets for cancer-induced bone-pain. Scientific reports

5(2015).

168. Pedraz-Cuesta, E. et al. The glutamate transport inhibitor DL-Threo-β-

Benzyloxyaspartic acid (DL-TBOA) differentially affects SN38-and oxaliplatin-

induced death of drug-resistant colorectal cancer cells. BMC cancer 15, 411 (2015).

169. Hanyaloglu, A.C. & Zastrow, M.v. Regulation of GPCRs by endocytic membrane

trafficking and its potential implications. Annu. Rev. Pharmacol. Toxicol. 48, 537-568 118

(2008).

170. Stamenkovic, J.A. et al. Inhibition of the malate–aspartate shuttle in mouse pancreatic

islets abolishes glucagon secretion without affecting insulin secretion. Biochemical

Journal 468, 49-63 (2015).

171. Gammelsaeter, R. et al. A role for glutamate transporters in the regulation of insulin

secretion. PloS one 6, e22960 (2011).

172. Hubert, G.W., Paquet, M. & Smith, Y. Differential subcellular localization of mGluR1a

and mGluR5 in the rat and monkey substantia nigra. Journal of Neuroscience 21, 1838-

1847 (2001).

173. Jong, Y.-J.I., Kumar, V. & O'Malley, K.L. Intracellular metabotropic glutamate receptor

5 (mGluR5) activates signaling cascades distinct from cell surface counterparts.

Journal of Biological Chemistry 284, 35827-35838 (2009).

174. Kim, V.N., Han, J. & Siomi, M.C. Biogenesis of small RNAs in animals. Nature

reviews Molecular cell biology 10, 126-139 (2009).