The Impact of Soxe Transcription Factors on the Development of Neural Crest Derivatives

The impact of SoxE transcription factors on the development of neural crest derivatives

Die Bedeutung von SoxE-Transkriptionsfaktoren für die Entwicklung von Neuralleistenderivaten

Den Naturwissenschaftlichen Fakultäten der Friedrich-Alexander-Universität Erlangen-Nürnberg zur Erlangung des Doktorgrads

vorgelegt von Simone Reiprich aus Erding Als Dissertation genehmigt von den Naturwissenschaftlichen Fakultäten der Universität Erlangen-Nürnberg.

Tag der mündlichen Prüfung: 14. Juli 2010

Vorsitzender der Prüfungskommission: Prof. Dr. Eberhard Bänsch

Erstberichterstatter: Prof. Dr. Michael Wegner

Zweitberichterstatter: Prof. Dr. Manfred Frasch L’hésitation est le propre de l’intelligence. – Das Charakteristikum der Intelligenz ist Ungewissheit, Tasten ihr Werkzeug.

Henry de Montherland (1896-1972)

Contents

Zusammenfassung ...... XI Summary ...... XIII

1 Introduction 1 1.1 The neural crest and its derivatives ...... 1 1.1.1 The adrenal medulla ...... 2 1.1.1.1 Sympathoadrenal progenitors ...... 3 1.1.1.2 Regulation of the differentiation of chromafﬁn cells ...... 5 1.1.2 Schwann cells of the PNS ...... 10 1.1.2.1 Schwann cell development ...... 11 1.1.2.2 Regulation of Schwann cell myelination ...... 11 1.2 Sox proteins ...... 15 1.2.1 SoxE proteins in general ...... 16 1.2.1.1 Sox10 ...... 17 1.2.1.2 Sox8 ...... 17 1.2.2 SoxE proteins in neural crest cell development ...... 18 1.2.2.1 SoxE proteins in chromafﬁn cell development ...... 19 1.2.2.2 SoxE proteins in Schwann cell development ...... 19

2 Aim of the Study 21

3 Results 23 3.1 The impact of SoxE transcription factors on adrenal gland development ...... 23 3.1.1 Expression pattern of SoxE proteins in the developing adrenal gland ...... 23 3.1.2 The impact of Sox10 on adrenal gland development ...... 26 3.1.3 The impact of Sox8 on adrenal gland development ...... 30 3.1.4 Functional redundancy between Sox10 and Sox8 ...... 34 3.1.5 The importance of conserved SoxE protein domains ...... 36 3.1.6 Conditional Sox10 deletion ...... 40 3.1.7 Analysis of sympathetic ganglia ...... 41 3.2 The impact of the Sox10 transcription factor on the Krox20 MSE ...... 43 3.2.1 Analysis of Sox10 binding sites in the Krox20 MSE ...... 43 3.2.2 The importance of Sox10 binding sites for the activation of the Krox20 MSE . . . 47

V Contents

3.2.3 Synergism of Sox and POU proteins during activation of the Krox20 MSE . . . . . 49 3.2.4 Speciﬁcity of the synergism of Sox and POU proteins ...... 50 3.2.5 Domain requirements for synergistic activation of the Krox20 MSE ...... 52 3.2.6 Interaction of Sox10 and Oct6 ...... 55 3.2.7 The in vivo importance of the K2 domain for Krox20 expression ...... 56 3.2.8 The interdependence of Sox10 and Oct6 expression ...... 57

4 Discussion 59 4.1 SoxE proteins in the adrenal gland ...... 59 4.1.1 The theory of the common sympathoadrenal precursor ...... 59 4.1.1.1 The early heterogeneity of the sympathoadrenal population ...... 60 4.1.1.2 The role of Sox10 before lineage segregation ...... 61 4.1.2 The impact of Sox10 and its domains on adrenal chromafﬁn cell development . . . 62 4.1.3 Functional redundancy between SoxE proteins ...... 63 4.1.4 The importance of Sox10 for neural crest cell survival ...... 66 4.1.5 The rostro-caudal gradient of Sox10 importance ...... 67 4.1.6 The interplay of BMPs, Sox10 and Mash1/Phox2b ...... 68 4.1.6.1 BMPs during early development ...... 68 4.1.6.2 BMPs during late development ...... 69 4.2 Sox10 in myelinating Schwann cells ...... 71 4.2.1 The role of Sox10 during myelination ...... 71 4.2.2 Synergistic activation of Krox20 expression ...... 74 4.2.3 Sox10 and its DNA binding properties ...... 76 4.2.4 The combined activity of several Sox10 binding sites ...... 78

5 Material and Methods 81 5.1 Material ...... 81 5.1.1 Organisms ...... 81 5.1.1.1 Mouse lines ...... 81 5.1.1.2 Chicken line ...... 81 5.1.1.3 Cell lines ...... 81 5.1.2 Chemicals and general reagents ...... 82 5.1.3 Buffers and solutions ...... 82 5.1.4 Oligonucleotides ...... 86 5.1.4.1 Oligonucleotides for genotyping ...... 86 5.1.4.2 Oligonucleotides for mutagenesis ...... 86 5.1.4.3 Oligonucleotides for EMSA ...... 87 5.1.5 Antibodies ...... 89 5.1.5.1 Primary antibodies ...... 89 5.1.5.2 Secondary antibodies ...... 89

VI Contents

5.2 Methods ...... 90 5.2.1 Animal husbandry ...... 90 5.2.2 Standard methods ...... 90 5.2.3 Site-directed mutagenesis ...... 90 5.2.4 Cell culture methods ...... 90 5.2.4.1 Cultivation of eukaryotic cells ...... 90 5.2.4.2 Transfection of HEK293 cells ...... 91 5.2.4.3 Preparation of whole cell extracts ...... 91 5.2.4.4 Transfection of S16 cells ...... 91 5.2.4.5 Luciferase reporter gene assay ...... 91 5.2.5 Chicken in ovo-electroporation ...... 92 5.2.6 Genotyping ...... 92 5.2.6.1 Isolation of genomic DNA for genotyping ...... 92 5.2.6.2 PCR for genotyping ...... 92 5.2.7 Histological methods ...... 94 5.2.7.1 Tissue preparation ...... 94 5.2.7.2 Immunohistochemistry ...... 94 5.2.7.3 Terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL) . . . . . 95 5.2.8 Protein-biochemical methods ...... 96 5.2.8.1 SDS-PAGE ...... 96 5.2.8.2 Western blot and protein detection ...... 96 5.2.8.3 GST-Pulldown ...... 96 5.2.8.4 Electromobility shift assay EMSA ...... 97 5.2.9 Image analysis and statistics ...... 98 5.2.9.1 Quantiﬁcation of immunohistochemistry ...... 98 5.2.9.2 Image editing and statistical analysis ...... 99

Abbreviations 101

Bibliography 105

Publications & Presentations 115

VII

List of Figures

1.1 Derivatives of neural crest cells ...... 2 1.2 Migration of neural crest cells to sympathetic ganglia and adrenal glands ...... 4 1.3 Schwann cells myelinating a peripheral nerve axon ...... 10 1.4 Regulation of Krox20 expression by the MSE ...... 14 1.5 Conserved SoxE protein domains ...... 16 1.6 SoxE proteins in the terminal differentiation of neural crest deriatives ...... 19

3.1 SoxE expression in the early embryonic adrenal gland ...... 24 3.2 SoxE expression during embryonic adrenal development ...... 25 3.3 Sox10 expression in the late embryonic adrenal gland ...... 25 3.4 The late adrenal gland in Sox10-deficient mice I ...... 26 3.5 The late adrenal gland in Sox10-deficient mice II ...... 27 3.6 The early embryonic adrenal gland in Sox10-deficient mice ...... 28 3.7 Neural crest cells in the presumptive adrenal gland region ...... 29 3.8 The late adrenal gland in mice with Sox8- and Sox10-deficiencies I ...... 30 3.9 The late adrenal gland in mice with Sox8- and Sox10-deficiencies II ...... 31 3.10 The early adrenal gland in mice with Sox8- and Sox10-deficiencies I ...... 32 3.11 The early adrenal gland in mice with Sox8- and Sox10-deficiencies II ...... 33 3.12 The late adrenal gland in mice with hypomorphic Sox10 alleles I ...... 34 3.13 The late adrenal gland in mice with hypomorphic Sox10 alleles II ...... 35 3.14 The early adrenal gland in mice with hypomorphic Sox10 alleles I ...... 36 3.15 The early adrenal gland in mice with hypomorphic Sox10 alleles II ...... 37 3.16 Relative contribution of cortex and medulla to the adrenal gland area ...... 39 3.17 The late embryonic adrenal gland in mice with conditional Sox10 alleles ...... 40 3.18 The early adrenal gland in mice with conditional Sox10 alleles ...... 41 3.19 Development of sympathetic ganglia in the adrenal gland region ...... 42 3.20 Identification of putative Sox10 binding regions within the Krox20 MSE ...... 43 3.21 Binding of Sox10 to putative binding regions within the Krox20 MSE ...... 44 3.22 Identification of exact Sox10 binding sites in high-affinity binding regions ...... 46 3.23 The impact of single Sox10 binding site mutations on MSE activation ...... 47 3.24 The impact of multiple Sox10 binding site mutations on MSE activation ...... 48 3.25 The impact of Sox10 binding site mutations on synergistic MSE activation ...... 49 3.26 Specificity of the synergistic MSE activation ...... 51 3.27 POU protein domain requirements for synergistic MSE activation ...... 53 3.28 Sox protein domain requirements for synergistic MSE activation ...... 54 3.29 The impact of Sox10∆K2 on MSE activation in combination with Brn2 ...... 55 3.30 Binding of Oct6 to Sox10 protein domains ...... 56 3.31 Krox20 expression along spinal nerves of Sox10∆K2/∆K2 animals ...... 56 3.32 Overexpression of Sox10 or Oct6 in the chicken neural tube ...... 58

4.1 BMPs and Sox10 inducing the catecholaminergic phenotype ...... 69 4.2 Sox10 and the activation of Krox20 expression ...... 74

Zusammenfassung

Transkriptionsfaktoren der Sox-Protein-Familie erlangen immer mehr Aufmerksamkeit als wichtige Regulatoren zahlreicher entwicklungsbiologischer Vorgänge. Mitglieder der Untergruppe E haben sich als unverzichtbar in allen Stadien der Neuralleistenentwick- lung erwiesen. Das Augenmerk dieser Studie liegt auf der Bedeutung der beiden SoxE- Proteine Sox10 und Sox8 für die Entwicklung chromaffiner Zellen des Nebennierenmarks und myelinisierender Schwann Zellen des peripheren Nervensystems, deren Ursprung in der Neuralleiste liegt. In Vorläuferzellen des Nebennierenmarks waren Sox8 und Sox10 anfangs koexprim- iert, bevor Sox8 im Gegensatz zu Sox10 nach und nach verschwand. Im Mausmodell hatte der Verlust von Sox10 ein vollständiges Fehlen chromaffiner Zellen zur Folge, die aufgrund erhöhter Apoptose schon vor der Einwanderung in die Nebennierenanlagen zu- grunde gingen. Auch vor dem apoptotischen Absterben exprimierten Sox10-defiziente Zellen kein Sox8, was auf eine Regulation von Sox8 durch Sox10 hinweist. Im Gegen- satz dazu hatte der Verlust von Sox8 weder Auswirkungen auf die Expression von Sox10 noch auf die sonstige Entwicklung chromaffiner Zellen. Daher konnte Sox10 durch seine funktionelle Redundanz den Verlust von Sox8 ausgleichen. Wurde Sox8 anstelle von Sox10 exprimiert, konnte es einen signifikanten Teil der chromaffinen Population aufrecht erhalten. Hier zeigte sich, dass Sox8 bei ausreichender Expression Sox10 teilweise erset- zen konnte. Bei der zusätzlichen Analyse hypomorpher Mausmutanten wurde die Be- deutung der Dimerisierungsdomäne von Sox10 und der konservierten K2-Domäne für die Entwicklung chromaffiner Zellen deutlich. Die Beobachtung, dass die Anzahl chromaffiner Zellen in allen untersuchten Mausmutanten schon sehr früh erniedrigt war, ließ auf die besondere Bedeutung von Sox10 für das Überleben dieser Zellen in frühen En- twicklungsstadien schließen. In Schwann Zellen ist Sox10 entscheidend an der Spezifizierung beteiligt, vermut- lich aber auch an der terminalen Differenzierung und Myelinisierung. Sox10 induziert Krox20, den Haupt-Regulator der Myelinisierung im peripheren Nervensystem, indem es in Synergie mit Oct6 ein Enhancer-Element transaktivert, das die Schwann Zell-Expression von Krox20 steuert. Dieses Enhancer-Element enthält sieben hoch-affine Bindestellen für Sox10, die nachweislich an der Aktivierung beteiligt sind. Für die synergistische Aktivierung war die DNA-bindende HMG-Domäne von Sox10 ebenso von Nöten wie die Transaktivierungsdomäne und die konservierte K2-Domäne. Im Oct6-Protein war die DNA-bindende POU-Domäne von vergleichbarer Wichtigkeit, während die Transak- tivierungsdomäne nicht vorhanden sein musste. Die Bedeutung der K2-Domäne zeigte sich auch in vivo anhand einer hypomorphen Mausmutante mit deletierter K2-Domäne. Infolge dieser Mutation wiesen Schwann Zellen trotz intakter Expression von Oct6 kein Krox20 auf. Somit konnte die unverzichtbare Funktion von Sox10 für die terminale Dif- ferenzierung myelinisierender Schwann Zellen bestätigt werden.

Summary

In recent years, Sox transcription factors have come under increasing scrutiny as important regulators of diverse developmental processes. Members of the subgroup E of Sox proteins emerged as indispensable modulators through all stages of neural crest cell development. This study adressed the impact of the two SoxE proteins Sox10 and Sox8 on the development of adrenal chromaffin cells and myelinating Schwann cells as two prominent neural crest derivatives. During development of the adrenal gland, Sox10 and Sox8 were co-expressed in neural crest cells giving rise to the adrenal medulla. Whereas Sox8 expression declined with ongoing development, Sox10 persisted at least until birth. Sox10 deficiency in mice resulted in a complete loss of the chromaffin cell population due to increased apoptosis of neural crest cells prior to immigration into the adrenal anlagen. Sox10-deficient cells already lacked Sox8 expression before dying apoptotically, arguing that Sox10 regulates Sox8 in this cell type. In contrast, loss of Sox8 did not affect Sox10 expression. Because of functional redundancy and compensation by Sox10, loss of Sox8 was without phenotypic consequence in the corresponding mouse mutant. When Sox8 was expressed instead of Sox10, it rescued half of the chromaffin cell population indicating that Sox8 is partly ca- pable of replacing Sox10 if its expression can be maintained in the absence of Sox10. The analysis of hypomorphic Sox10 mouse mutants additionally revealed the importance of an intact dimerization domain and the conserved K2 domain for the generation of chromaffin cells in appropriate numbers. The early loss of chromaffin cells in all mutants demonstrated the essential importance of Sox10 for survival at this developmental stage. In Schwann cells, Sox10 was already identified as a key factor for specification and was additionally implicated in terminal differentiation and myelination. Sox10 induced expression of Krox20 as the master regulator of myelination through activation of the MSE, an enhancer downstream of the Krox20 gene. Seven high-affinity binding sites existed for Sox10 in the MSE and contributed to Sox10-dependent transactivation. Sox10 functioned synergistically with Oct6. For synergism, the DNA-binding domain of Sox10 was necessary as were the transactivation domain and the conserved K2 domain. Oct6 on the other hand required the DNA-binding POU domain but not the transactivation domain. The importance of the K2 domain for induction of Krox20 was also demonstrated in vivo in a hypomorphic mouse mutant where Schwann cells expressed a Sox10 protein without K2 domain. In these mice, Schwann cells failed to initiate expression of Krox20 despite Oct6 expression. This proved that Sox10 is indispensable in Schwann cells for terminal differentiation and myelination.

XIII

1 Introduction

A major challenge during embryogenesis is how to get the appropriate cell type at the right time, at the right place. To this end, embryonic development proceeds in a highly regulated manner and results in the generation and maintenance of functional tissues and organs. On a transcriptional level, regulation depends on the spatiotemporally concerted action of transcription factors. Sox proteins constitute one of the transcription factor families essentially involved in diverse developmental processes. Their importance becomes evident by the fact that every tissue appears to express at least one of the Sox proteins during any one of its developmental stages.

1.1 The neural crest and its derivatives

Neural crest cells originating from the ectoderm germ layer are unique to vertebrates. They arise from the neural plate border, the transition zone between the non-neural ectoderm and the neuroectoderm. During neurulation, FGF (fibroblast growth factor) and Wnt signaling from the underlying mesoderm and the adjacent non-neural ectoderm act in concert with intermediate levels of BMPs (bone morphogenetic proteins) to induce specification of the neural plate border, which then becomes specified as neural crest. Among the neural crest specifiers are transcription factors like Snail, SoxE and FoxD3 proteins, which control on one hand proliferation and maintenance of a multipotent cell population. On the other hand, they regulate the epithelial mesenchymal transition that enables neural crest cells to delaminate and to start migration concomitantly with the separation of the neural tube from the epidermis. Neural crest cells emigrate at all rostro-caudal levels of the embryo either on a ventromedial pathway passing the anterior parts of the somites or on a dorsolateral pathway underneath the epidermis. They invade the whole body and differentiate into distinct neural crest derivatives (see Fig. 1.1). In the diversity of emerging derivatives, the multipotent nature of the neural crest population becomes evident. Neural crest cells following the ventromedial route contribute to neuronal and glial cells of the PNS (peripheral nervous system) and to neuroendocrine cells of the adrenal medulla and of the thyroid gland, whereas cells taking the dorsolateral route become melanocytes. The

1 1 Introduction neural crest is subdivided into a cranial, trunk, vagal, sacral and cardiac part, which differ in their developmental potential. For example, only neural crest cells of cranial origin can give rise to bone and cartilage tissue of the face. The trunk neural crest is the origin of the PNS and of endocrine intra- as well as extra-adrenal chromafﬁn cells and is as such of special interest in the present analysis. To achieve differentiation into such a variety of cell types, the development of neural crest cells depends on speciﬁc endogenous and local environmental signals that guide their intrinsic potential into different directions. (Loring and Erickson 1987, Douarin et al. 2004, Sauka-Spengler and Bronner-Fraser 2008)

FIG. 1.1 Derivatives of neural crest cells. Neural crest cells migrate throughout the body and give rise to different cell types according to their anteroposterior level of origin. From Knecht and Bronner-Fraser (2002).

1.1.1 The adrenal medulla

As organs of the endocrine system, adrenal glands are located on the rostromedial side of the kidneys. The 3-layered adrenal cortex produces a number of different steroid hormones: mainly mineralcorticoids in the outer zona glomerulosa, glucocorticoids in the middle layer of the zona fasciculata and sexual hormones in the inner zona reticularis. The cortex surrounds the chromaffin cells of the adrenal medulla that synthesize, store and secrete catecholamines from their morphologically typical large chromaffin vesicles. The main component of the secreted catecholamines is adrenalin, whereas noradrenalin is only produced in lower amounts and dopamine serves more as precursor rather than being released itself (Ladas et al. 2009). Chromaffin cells secrete these catecholamines

2 1.1 The neural crest and its derivatives in response to acetylcholine signaling from active pre-ganglionic sympathetic neurons. Due to this direct innervation by cholinergic sympathetic ﬁbers from the intermediolateral column of the spinal cord, the medulla is also referred to as a sympathetic paraganglion. Chromafﬁn cells of the adrenal medulla and adrenocortical cells differ not only in function and morphology, but also in their site of origin. The cortex arises from the mesoderm, whereas adrenomedullary cells derive from the neural crest.

1.1.1.1 Sympathoadrenal progenitors

In chicken, the whole neural crest region caudal from somite 4 gives rise to sympathetic neurons and overlaps with the less extended region of origin of endocrine cells between somite 18 and 24 (Douarin et al. 2004). With ongoing lineage restriction, neural crest cells in this overlapping area build the subpopulation of so-called sympathoadrenal (SA) cells, a common progenitor population for sympathetic neurons and adrenal chromaffin cells (Anderson et al. 1991). For this purpose, multipotent neural crest cells gather near the dorsal aorta to form primary sympathetic ganglia. This occurs around E2–E2.5 in chicken and around 10 dpc (days post coitum) in mouse (Ernsberger et al. 1995, Huber 2006). Exposed to BMPs secreted from the wall of the dorsal aorta – BMP4 and BMP7 in chicken (Reissmann et al. 1996) and BMP2 and BMP4 in mouse (Shah et al. 1996) – SA cells become specified and acquire characteristic neuronal and catecholaminergic fea- tures. Induction of these markers is attributed to BMPs, because overexpression of BMP4 and BMP7 results in the upregulation of neuronal and catecholaminergic traits in vitro and in vivo (Reissmann et al. 1996). Vice versa, treatment with the BMP inhibitor noggin has the contrary effect (Schneider et al. 1999). These results show that BMPs are necessary and sufficient for the acquisition of a neuronal and catecholaminergic phenotype. Never- theless, the involvement of further largely unknown factors is highly probable, because BMPs are also expressed in parasympathetic neuron progenitors, which adopt an identity different from sympathetic neurons or chromaffin cells (Müller and Rohrer 2002). SA progenitors at the dorsal aorta can be identified by the expression of pan-neuronal markers like NF68 (neurofilament 68), SCG10 (also SGC10, superior cervical ganglion 10) and neuron-specific tubulin together with the catecholaminergic markers TH (tyrosine hydroxylase) and DBH (dopamine β hydroxylase) (Groves et al. 1995, Schneider et al. 1999). With regard to transcription factors, SA cells express Phox2b (paired homeobox 2b) and Mash1 (mammalian achaete scute homolog 1), two regulators of noradrenergic differentiation (Guillemot and Joyner 1993, Pattyn et al. 1999), as well as Insm1, Hand2 and Gata2/3 (Cserjesi et al. 1995, Moriguchi et al. 2006, Wildner et al. 2008). Follow- ing specification in primary ganglia, SA cells start a second round of migration to reach

3 1 Introduction their final destinations, the secondary sympathetic ganglion chain, the adrenal medulla and extra-adrenal chromaffin tissues (Anderson et al. 1991) (see Fig. 1.2). Under the regulation of local environmental signals and specific transcription factor combinations (see 1.1.1.2), SA cells differentiate into sympathetic neurons, intermediate SIF (small intensely fluorescent) cells or chromaffin cells.

FIG. 1.2 Migration of neural crest cells to sympathetic ganglia and adrenal glands. Neural crest cells migrate to the dorsal aorta (yellow cells) and form primary sympathetic ganglia exposed to BMPs. With a second migration (orange cells), these progenitors reach their ﬁnal destinations: the secondary sympathetic ganglia and the adrenal gland. From Moriguchi et al. (2007).

Sympathetic neurons One part of SA cells dorsally migrates back from the primary sympathetic ganglia to form pre- and paravertebral secondary sympathetic ganglia. As differentiated postganglionic sympathetic neurons, these cells express the enzymes TH and DBH for catecholamine biosynthesis and the neuronal markers NF68 and SCG10. The typical neuronal morphology comes along with the generation of neurites.

SIF cells SIF cells are an intermediate cell population. On one side they resemble chromaffin cells, since they contain large vesicles for the storage of catecholamines. On the other side, they share the ability of neurons to form neurites. SIF cells are found in sympathetic ganglia, but their role is not finally clarified (Eränkö 1978, Huber 2006).

Chromaﬃn cells Another part of SA cells invades the adrenal primordium, which is formed by the mesodermal portion of the adrenal gland. SA cells immigrate from the medio-cranial side into the anlagen (Yamamoto et al. 2004). Like sympathetic neurons,

4 1.1 The neural crest and its derivatives these cells are equipped with the TH and DBH enzymes for catecholamine synthesis. They can be distinguished from the neuronal population by the loss of NF68 expression at 14.5 dpc (Huber 2006). With ongoing differentiation into chromaffin cells, PNMT (phenylethanolamine-N-methyltransferase), a further enzyme of catecholamine biosynthesis, becomes expressed and the typical large chromaffin vesicles appear. Besides these intra-adrenal chromaffin cells, transiently existing extra-adrenal organs develop from SA cells that did not enter the adrenal gland anlagen, but continued ventral migration (Ya- mamoto et al. 2004). One of these pre- or para-aortal paraganglia, which degenerate during early life, is the organ of Zuckerkandl. In vivo expression analyses in mice showed that NF68 and SCG10 are co-expressed with TH at early stages around 11.5 dpc (Anderson et al. 1991). By 14.5 dpc, future chromaffin cells are no longer positive for NF68 and downregulate neuronal traits in contrast to future neurons (Huber 2006). In vitro analyses of embryonic SA cells gave further insight into their differentiation potential. SA cells isolated from embryonic sympathetic ganglia or from adrenal glands can give rise to sympathetic neurons or to chromaffin cells, respectively, depending on the supplementation of the culture media. Glucocorti- coids promote differentiation towards the chromaffin phenotype at least in culture (see 1.1.1.2), whereas FGF and NGF (nerve growth factor) favor the generation of neurons (Anderson 1993). Even transdifferentiation between the two cell types is possible. Post- natal chromaffin cells can adopt a sympatho-neuronal phenotype, when exposed to NGF (Unsicker 1993). In light of these data, it is probable that SA cells are a common progenitor population for both, sympathetic neurons and chromaffin cells. Nevertheless, there are data contradicting this hypothesis and arguing for the existence of two distinct progenitor populations giving rise to either sympathetic neurons or chromaffin cells from early timepoints on (Ernsberger et al. 2005) (see Discussion).

1.1.1.2 Regulation of the diﬀerentiation of chromaﬃn cells

The characteristics of chromaffin cells are well described in terms of specific marker proteins and of their typical morphology. Evolution towards this identity spans the development from a multipotent neural crest cell via a possibly bipotential SA cell to the finally differentiated chromaffin cell. There are several possible factors that regulate this progressive lineage restriction and the concomitant separation from other cell types: i) Signals from the environment may provide locally distinct differentiation impulses. ii) Intrinsic signals like transcription factors or chromatin modifiers may adapt the expression pro- file. In combination, signals from the local environment may trigger intrinsic signals to regulate the proper differentiation processes.

5 1 Introduction

Regulation by environmental signals The adrenal cortex is the closest environment to chromaffin cells in the adrenal medulla and as such a probable source of environmental signals. In mice, neural crest cells start to enter the adrenal primordium at 11.5 dpc and establish a distinct medulla surrounded by the cortex around 13.5 dpc (Gut et al. 2005). In contrast, in chicken the adrenal gland is not organized into medulla and cortex. Avian interrenal cells correspond to vertebrate adrenocortical cells and are intermingled with chromaffin cells throughout lifetime (Ernsberger et al. 2005). Nevertheless, cortical or interrenal cells, respectively, are in close contact to chromaffin cells and may influence their development. The adrenal cortex secretes high amounts of glucocorticoids. Since glucocorticoids inhibited the transdifferentiation of chromaffin cells to neurons in vitro, they were thought to be involved in the maintenance of the chromaffin phenotype (Unsicker 1993). In cultures of SA cells, glucocorticoids suppressed neuronal differentiation and induced at the same time expression of the chromaffin cell marker PNMT, mediated by a glucocorticoid response element in the promoter of the PNMT gene (Ross et al. 1990, Michelsohn and Anderson 1992). For some time, glucocorticoid-mediated induction of PNMT expression was taken as a hint for induction of chromaffin differentiation. This hypothesis was disproved by the analysis of a glucocorticoid receptor (GR) mutant mouse (Finotto et al. 1999). Contrary to what was expected, chromaffin cells are generated in normal numbers in the absence of GR signaling and show the typical ultrastructure of chromaffin vesicles. Furthermore, they do not adopt neuronal traits and chromaffin differentiation is not essentially affected. The importance of GR signaling for PNMT expression was confirmed, as GR-deficient chromaffin cells do not express PNMT. However, it cannot be excluded that in vivo intact mineralcorticoid receptors can compensate at least in part for the loss of GRs (Finotto et al. 1999). In contrast to the mild defects in embryonic development, adult mice with a conditional deletion of GRs show a more severe phenotype regarding the chromaffin cell population. GR signaling proved to be important for the survival of chromaffin cells after birth as seen by a dramatic progressive loss of adrenomedullary cells due to increased apoptosis in these mice (Parlato et al. 2009). To get insight into the role of the adrenal cortex as a whole, the effects of a complete loss of adreno-cortical tissue were analyzed (Gut et al. 2005). Mice with a mutation in the gene for the nuclear orphan receptor SF1 (steroidogenic factor 1) lack the entire adrenal cortex. SF1-deficient mice develop chromaffin cells in the appropriate region, which express most of the typical markers and show the characteristic ultrastructure. But through all embryonic stages the number of chromaffin cells is reduced to about 50%. This reduction is attributed to an early immigration defect. There are less neural crest cells settling in the adrenal gland anlagen than in wildtype mice and the number of SA cells is reduced

6 1.1 The neural crest and its derivatives ab initio (Gut et al. 2005). The analysis of SF1 heterozygous mice, in which adrenal cortex development is retarded, strengthens the observation of an immigration defect (Lohr et al. 2006). Similar to SF1-/- mice, heterozygous animals develop correctly differentiated chromaffin cells, albeit reduced to about 70% of the wildtype numbers, without any changes in apoptosis or proliferation. A part of the arriving chromaffin progenitor cells however remains ectopically on the medial surface of the adrenal gland anlagen and cannot immigrate (Lohr et al. 2006). Recently, BMP4 was shown to be secreted by adreno-cortical cells in chicken and to be involved in the induction of TH expression in chromaffin cells (Huber et al. 2008). However, ectopically expressed BMP4 alone did not result in an increase of chromaffin cells. BMP4 from adreno-cortical cells may function similarly to BMP4 from the wall of the dorsal aorta in contributing to the specification of SA cells, but later during migration (Huber et al. 2008). Mouse and chicken analyses argue for a role of the adrenal cortex in attraction, immigration and maintenance of future chromaffin cells. Nevertheless, the cortex does not seem to promote differentiation apart from the activation of PNMT expression by glucocorticoids. According to the recent knowledge, the adrenal cortex has some influence on embryonic chromaffin cell development, but is not of essential importance.

Regulation by transcription factors A number of studies of sympathetic neuron development identified a complex transcriptional network rather than a linear signaling cascade involved in the differentiation of SA cells (for review see Goridis and Rohrer (2002), Huber (2006)). At early stages, BMPs from the wall of the dorsal aorta are involved in the initiation of this transcriptional cascade (Shah et al. 1996, Schneider et al. 1999). Because of the common origin, chromaffin cell development is similarly influ- enced by the same set of transcription factors including Mash1, Phox2b, Insm1, Hand2 and Gata2/3. The following description focuses on the findings about these transcription factors particularly in chromaffin cell development. The homeodomain transcription factor Phox2b is primarily associated with the acquisition of a noradrenergic identity, in both the CNS and the PNS (Pattyn et al. 1999). As such its expression starts in SA cells during the assembly near the dorsal aorta and occurs concomitant with, but independent of Mash1 expression (Huber et al. 2002). In mice with a targeted deletion of Phox2b, slightly reduced numbers of chromaffin cell progenitors migrate to the adrenal anlagen, but express none of the typical markers apart from Mash1. The following premature downregulation of Mash1 expression and the lack of NF68, Hand2 and TH expression result in an increased apoptosis from 15.5 dpc onwards (Huber

7 1 Introduction et al. 2005). On a molecular level, binding of Phox2b to the promoters of TH and DBH demonstrates its direct influence on the acquisition of noradrenergic traits (Yang et al. 1998). Adrenal gland development is more severely affected in the absence of Phox2b than in the absence of Mash1 consistent with an arrest of chromaffin cell development at a more immature stage in Phox2b-deficient mice. With its influence on the maintenance of Mash1 expression and the induction of TH and DBH expression, Phox2b has the most fundamental role in the transcription factor network regulating chromaffin cell differentiation (Huber et al. 2005). The activity of the closely related transcription factor Phox2a is either dispensable for chromaffin cell development or redundant to that of Phox2b, because its loss is not associated with adrenal gland defects (Morin et al. 1997). The bHLH (basic helix-loop-helix) transcription factor Mash1 (also known as Ascl1) is expressed in all neural crest cells that give rise to the autonomous nervous system including SA cells (Guillemot and Joyner 1993). Being of transient nature, Mash1 expression starts in SA cells in primary sympathetic ganglia near the dorsal aorta and stops in chromaffin cells by 16.5 dpc (Huber et al. 2002). Upon loss of Mash1, SA cells immigrate into the adrenal anlagen and correctly express Phox2b and NF68. But they arrest in an immature state, as evident by the missing expression of the differentiation markers TH, DBH or PNMT, and die eventually by apoptosis. As the cells sustain the expression of neuronal markers like NF68 and do not form typical chromaffin vesicles, they resemble rather immature sympathetic neurons than chromaffin cells. At birth, the chromaffin population is reduced to about 30% of wildtype levels. However, a subpopulation of SA cells seems to be independent of Mash1, since a small fraction of chromaffin cells de- velops normally in the absence of Mash1, possibly due to Mash1-independent Phox2b expression. Thus, Mash1 has important functions for the progression of differentiation and for the expression of catecholaminergic subtype-specific genes, with the exception of Phox2b (Guillemot et al. 1993, Huber et al. 2002, 2005). In mouse SA progenitors, the zinc finger protein Insm1 is first detectable, when neural crest cells accumulate at the dorsal aorta, i.e. around the time of Mash1 and Phox2b expression (Wildner et al. 2008). Insm1 expression continues in SA derivatives at least until birth. Loss of Insm1 results in the prenatal death of embryos due to a lethal catecholamine deficiency. This early embryonic lethality can be overcome by feeding pregnant dams with catecholamine intermediates, which allows the analysis of mutant embryos at late stages. The chromaffin cell population in Insm1-deficient mice is reduced to 40% of wildtype levels at 18.5 dpc. Initially, normal numbers of chromaffin cells immigrate into the adrenal anlagen in the absence of Insm1, thereby correctly expressing Phox2b. But then, Mash1 and NF68 are not downregulated in time, while TH, DBH and PNMT expression is strongly decreased. Thus, these chromaffin cells resemble immature SA

8 1.1 The neural crest and its derivatives progenitors, before they are progressively lost by apoptosis. Since Insm1 is missing in Mash1- or Phox2b-deficient SA cells, it is thought to act downstream of these two factors, but with a negative feedback regulation on Mash1. Due to the Insm1-/- phenotype that resembles the Mash1-/- phenotype, Insm1 is possibly a mediator of Mash1 functions in SA cells (Wildner et al. 2008). Hand2 (heart and neural crest derivatives expressed 2) belongs to the family of bHLH transcription factors (Morikawa et al. 2007). Its expression in SA cells starts shortly after the onset of Phox2b expression in already specified cells and continues throughout the development of chromaffin cells (Morikawa et al. 2005). But the role of Hand2 for chromaffin cell generation remains to be elucidated. As yet, the consequences of a loss of Hand2 are only described regarding SA cell-derived sympathetic neurons (Morikawa et al. 2007, Hendershot et al. 2008). In the absence of Hand2, the proliferative activity of the neural precursor pool is affected resulting in a reduced number of sympathetic neurons. Similarly, there are first hints that the number of TH-positive cells in adrenal glands is decreased by P0 (Hendershot et al. 2008). In terms of transcriptional regulation, Hand2 was shown to control the DBH promoter by direct binding (Rychlik et al. 2005). Further- more, Hand2 seems to be involved in the maintenance of Phox2b expression (Hendershot et al. 2008). At least in sympathetic neurons, Hand2 is dispensable for neuronal specification, but important for the acquisition of catecholaminergic subtype-specific traits. These functions of Hand2 could be largely confirmed by the analysis of the zebrafish mutant hands off (Lucas et al. 2006). The six known Gata transcription factors are zinc finger proteins with only Gata2 and Gata3 being expressed in the nervous system (Moriguchi et al. 2006). In chicken SA cells, Gata2 (corresponding to mouse Gata3) expression starts in primary sympathetic ganglia slightly after the appearence of Mash1 and Phox2b and persists in differentiated cells of the SA lineage. Like in Insm1 mutant mice, early embryonic lethality of Gata3- deficient mice can be overcome by feeding catecholaminergic intermediates (Lim et al. 2000). In the adrenal glands of Gata3-/- mice, increased apoptosis from 13.5 dpc onwards leads to a size reduction of the medulla. Furthermore, expression of Phox2b, Hand2, TH and DBH is remarkably weak in chromaffin cells at 18.5 dpc, whereas Mash1 expression is de-repressed and not downregulated as in wildtype chromaffin cells. Persistence of Mash1 may inhibit further differentiation of chromaffin cells (Moriguchi et al. 2006). De- tailed analyses in chicken show that expression of Mash1, Phox2b and Hand2 precedes and induces expression of Gata2. Together with the observation that Phox2b-deficient mice do not express Gata3, these results demonstrate the induction of Gata2/3 by Phox2b (Tsarovina et al. 2004). Gata2/3 acts differentially on its upstream regulators – with a positive feedback on Phox2b expression, but a negativ feedback on Mash1 expression.

9 1 Introduction

Furthermore, Gata3 can bind to regulatory regions of the TH gene (Hong et al. 2006). Gata3 is thus essential for the induction of TH and DBH expression and for the survival and differentiation of SA cell derivatives (Moriguchi et al. 2006).

The numerous gain-of-function and loss-of-function studies give evidence that the same set of transcription factors is involved in the differentiation of sympathetic neurons and of chromafﬁn cells. Obviously, these transcription factors interact in a complex network of feed-back and feed-forward regulation steps, which are similar but not identical for the two different subtypes of SA cells.

1.1.2 Schwann cells of the PNS

Schwann cells are the major glial cell population of the PNS. Besides a small percentage of non-myelinating Schwann cells, the majority of the Schwann cell population is responsible for proper myelination of peripheral nerve axons. The function of myelination is evident from the fact that demyelination of nerve fibres is associated with tremor and paralysis as observed in patients suffering from demyelinating neuropathies. A myelinating Schwann cell establishes a myelin sheath by tight wrapping of its myelin-containing plasma membrane around one axon (see Fig. 1.3). Myelinated internode segments are separated by nodes of Ranvier, where the axon is unwrapped to allow saltatory conduction of action potentials that jump from node to node. This saltatory propagation of action potentials along myelinated fibers enables an increase in nerve conduction velocity compared to unmyelinated fibers without increasing the nerve diameter. The myelin sheath is a membranous high lipid structure with characteristic proteins like myelin protein zero

(P0), proteolipid protein (PLP) and myelin basic protein (MBP).

FIG. 1.3 Schwann cells myelinating a peripheral nerve axon. Schwann cells myelinate each a single internode on a single axon. Nodes of Ranvier between the intern- odes are bare of myelin. From Poliak and Peles (2003).

10 1.1 The neural crest and its derivatives

1.1.2.1 Schwann cell development

The PNS with its different cell types is one of the major neural crest derivatives. Future glial and neuronal cells arise from the entire trunk neural crest and migrate in streams through the anterior part of each somite (Sauka-Spengler and Bronner-Fraser 2008). In mouse, migrating neural crest cells get in contact with outgrowing nerves and populate them as Schwann cell precursors (SCP) around 12–13 dpc. SCP depend on survival signals from axons, with which they are intimately associated. The type III isoform of neuregulin-1 expressed in axons is one of the known molecules involved in this signaling between neurons and glia. It interacts with ErbB3-ErbB2 complexes on developing Schwann cells to guarantee survival and regulate myelin sheath thickness at later stages (Riethmacher et al. 1997, Wolpowitz et al. 2000). By 13–15 dpc, SCP develop into immature Schwann cells and are irreversibly committed to the Schwann cell fate. Concomi- tantly with this switch, SCP overcome their dependence on paracrine survival signals and ensure as immature Schwann cells their own survival by the use of autocrine circuits. Morphologically, nerves become vascularized and surrounded by a perineurium at that stage. Immature Schwann cells exit the cell cycle and progress either to mature non- myelinating Schwann cells or to a promyelinating state in 1:1 contact with large diameter axons. The process of matching Schwann cell and axon numbers establishing the 1:1 relationship is known as radial sorting and only poorly understood on a molecular level. Finally, the transition from the promyelinating to the myelinating state around birth is characterized by the expression of myelin-speciﬁc proteins (Jessen and Mirsky 2005).

1.1.2.2 Regulation of Schwann cell myelination

The onset of myelination depends on the one hand on the de-repression of myelin genes, since there are several pathways known to inhibit premature myelination during earlier stages of Schwann cell development. Among these myelination inhibition pathways are JNK signaling, Notch signaling and the concerted action of Pax3 and Sox2 (for review see Jessen and Mirsky (2005)). On the other hand, myelination is induced by the activation of pro-myelin signals, which involve the transcription factors Sox10, Oct6, Brn2 and Krox20, the Krox20-binding proteins NAB1 and 2 (NGFI-A-binding proteins 1 and 2) and PI3K (phosphatidylinositol 3-kinase) signaling (Jessen and Mirsky 2005). The effects of such trans-acting proteins are mediated by cis-acting DNA elements, which translate particular transcription factor combinations into transcriptional changes. The present description focuses on the positive regulators of myelination.

11 1 Introduction

Trans-acting proteins Two proteins of the class III of POU (Pit1-Oct1/2-Un86) domain transcription factors are essentially involved in Schwann cell development: Oct6 (Pou3f1, SCIP, Tst1) and Brn2. These two close relatives share most of their structural characteristics. A very N-terminal transactivation domain is combined with a bipartite DNA-binding domain, the POU domain consisting of the POU specific domain and the POU homeodomain. Amongst other tissues, Oct6 is transiently expressed in Schwann cells along peripheral nerves with a peak before myelination and a subsequent postnatal downregulation. Largely unknown axonal signals and rising intracellular cAMP levels are inductive for Oct6 expression. Two mouse mutants were generated to analyze the loss of function of Oct6 – one having deleted the major N-terminal part of Oct6 (Berming- ham et al. 1996), the other having interrupted the DNA-binding domain by insertion of a β-galactosidase reporter (Jaegle et al. 1996). Both showed a comparable phenotype. Upon loss of function of Oct6, Schwann cell differentiation and myelin formation is delayed. Mutant Schwann cells correctly enter the promyelinating stage in normal numbers and establish 1:1 contacts to axons. But in the absence of Oct6, the transition to the myelinating state is delayed by about 1–2 weeks. The small percentage of animals surviving birth, suffers from occasional tremors indicative of a myelination defect. Once the Schwann cells progress through the promyelinating stage, terminal differentiation proceeds normally. According to its transient expression, Oct6 seems to be of transient importance during a defined period (Jaegle et al. 1996, Bermingham et al. 1996). Since mutant animals recover, further factors probably expressed slightly later may finally compensate the loss of Oct6. Brn2 is one of the proteins possibly fulfilling this function. It is expressed in a pattern comparable with Oct6, but independent of it (Jaegle et al. 2003). Overexpression of Brn2 in an Oct6-mutant background can partially rescue the phenotype of the Oct6 deficiency. Loss of Brn2 in addition to the mutation of Oct6 ag- gravates the Oct6 phenotype dramatically (Jaegle et al. 2003). Myelination is delayed up to 4 month in combined mutant mice, whereas Brn2 deletion alone has no deleterious consequences on myelination. Consistent with the transient expression of these two POU proteins, myelinogenesis is delayed in their absence, but nevertheless not abolished, so that further factors are proposed that drive the transition to the myelinating stage. In summary, Oct6 and Brn2 are essentially involved in the transition from the promyelinating to the myelinating stage, but terminal differentiation is largely independent of these POU proteins (Jaegle et al. 1996, 2003).

NFATc4 (nuclear factor of activated T cells, cytoplasmic, calcineurin-dependent4) proteins have just recently been implicated in the differentiation of Schwann cells (Kao et al. 2009). Emerging NFAT activity was shown in mouse neural crest cells at 9 dpc. In a mouse mutant with inactive NFATc4, the expression of Krox20 is reduced as well as

12 1.1 The neural crest and its derivatives the amount of the early myelin protein MAG (myelin associated glycoprotein) and the later myelin proteins MBP and P0 in Schwann cells. Defective peripheral myelination in these mice was linked to an involvement of NFATc4 signaling in the direct and indirect activation of myelin gene expression – directly via induction of the P0 promoter, indirectly via regulation of Krox20 expression, the upstream regulator of several myelin genes. Nuclear translocation of NFATc4 and thus its incorporation in transcription regulation complexes depends on its dephosphorylation by the phosphatase calcineurin, which in turn is active at high levels of intracellular calcium. An increase in intracellular calcium can be induced by neuregulin-1 signaling via membranous ErbB3-ErbB2 receptor complexes in immature Schwann cells. Thus, NFATc4 is one of the downstream effectors of neuregulin-1 signaling (see 1.1.2.1). Nevertheless, this pathway covers only a part of the effects of neuregulin-1 during Schwann cell development, since the function of neuregulin-1 for SCP survival and proliferation is not affected in this mutant. As a consequence, NFATc4 mutants differ from the phenotypes of neuregulin-1 or ErbB mutant mice (Kao et al. 2009).

Since its detection in the Schwann cell lineage of the PNS, Krox20/Egr2 has emerged as the master regulator of peripheral myelination. Krox20 is a zinc-finger transcription factor, whose PNS expression in mouse starts at 10.5 dpc in boundary cap cells. Up to 14.5 dpc its weak expression is confined to motor and sensory nerve roots, before it is activated along the entire peripheral nerves at 15.5 dpc. Thus, Krox20 expression is weak in immature Schwann cells, peaks immediately before the onset of myelination and continues throughout life in myelinating Schwann cells, but is not expressed in non-myelinating Schwann cells (Topilko et al. 1994, 1997, Zorick et al. 1996). Targeted deletion of Krox20 is not compatible with the formation of myelin, so that Krox20-deficient Schwann cells never express the late myelin proteins P0 and MBP. Schwann cell development in the absence of Krox20 is arrested at the immature stage with continuing proliferation, which results in supernumerary Schwann cells. Nevertheless, Schwann cell development proceeds normally through radial sorting and the initial wrapping around axons. Even early Schwann cell markers like Oct6 (Ghislain et al. 2002) and S100 or the early myelin protein MAG are expressed in Krox20-deficient Schwann cells (Topilko et al. 1994). But the further formation of compacted myelin fails to occur. The general absence of peripheral myelin manifests in mutant mice as tremor from P10 onwards and a shortened lifespan (Topilko et al. 1994). Mutations in the human Krox20 gene are associated with congenital hypomyelinating neuropathy and Charcot-Marie-Tooth disease type 1 (Warner et al. 1998). The essential involvement of Krox20 in myelination was also confirmed by the finding, that Krox20 regulates a number of myelin genes in vitro and in vivo. Promoter and enhancer elements regulating the expression of P0, MBP, Connexin32 or MAG, re-

13 1 Introduction spectively, harbor binding sites for Krox20 often in close proximity to Sox10 binding sites (see Svaren and Meijer (2008)). Involved in the expression of the major myelin compo- nents, Krox20 is one of the central transcription factors, on which signals converge that regulate myelinogenesis.

Gene regulatory elements In Schwann cells, Krox20 expression is under the control of stage-speciﬁc cis-acting DNA-elements (Ghislain et al. 2002). The immature Schwann cell element ISE and the myelinating Schwann cell element MSE were named after the Schwann cell stage, during which they activate expression of Krox20. Both elements are activated in response to axonal signals, whose nature is not known. Moreover, they are not subject to autoregulatory activity of Krox20, since the ISE and the MSE are as well active in a Krox20-negative background. To geht further insight into the mechanism of Krox20 expression under control of the ISE and the MSE, the respective DNA elements were analyzed in regard to their protein-binding and transactivating capacity with reporter constructs in vitro and in vivo (Ghislain et al. 2002, Ghislain and Charnay 2006, Kao et al. 2009). Whereas the enhancer activity of the ISE could not be attributed to a single continuous DNA-element, the MSE could be located 35 kb downstream of the Krox20 transcriptional start. Within a region of 1.3 kb, this conserved enhancer harbors multiple Oct6 binding sites (Ghislain et al. 2002). Indeed, Oct6 directly binds to the MSE and activates Krox20 expression synergistically with Sox10. Brn2 can functionally substitute for Oct6 in MSE transactivation (Ghislain and Charnay 2006). Recently, the set of transcription factors acting on the MSE was extended to NFATc4 (Kao et al. 2009). NFATc4 as downstream effector of neuregulin-1 signaling is essentially involved in Schwann cell differentiation (see 1.1.2.2). It activates the MSE in synergy with Oct6 and Sox10 via binding to one of the NFAT consensus sites within the MSE (see Fig. 1.4). Furthermore, NFATc4 interacts via its Rel homology domain with Sox10 through direct protein-protein binding (Kao et al. 2009).

FIG. 1.4 Regulation of Krox20 expression by the MSE. Expression of Krox20 in myelinating Schwann cells is under control of the MSE enhancer, which is transactivated by Sox10, Oct6 and NFATc4. From Stolt and Wegner (2010).

14 1.2 Sox proteins

1.2 Sox proteins

As transcription factors, Sox proteins are characterized by their DNA-binding high mobility group (HMG) domain. Among the numerous members of the HMG box protein superfamily, the sequence of the HMG domain is highly diverse and conservation in this domain is taken as a criterion for the classification into different families. Sox proteins are grouped into such a family, because at least 50% of the amino acids of their HMG domains are similar to those of the eponymous Sry-box, the HMG box of the Sry protein (Wegner 1999). Sequence conservation is also one of the decisive parameters for the classification of Sox proteins into the subgroups A–J (Bowles et al. 2000). Members of one subgroup contain at least 80% identical amino acids within their HMG boxes surrounded by further highly conserved domains. In contrast, members of different subgroups can diverge in their sequences to various extents (Wegner 1999). Sox proteins, together with the distantly related TCF/LEF transcription factors, are the only members of the HMG box superfamily that bind DNA sequence-specifically. Their HMG domains interact with the heptameric consensus sequence 5’-(A/T)(A/T)CAA(A/T)G-3’, which is found in regulatory regions of Sox target genes (Harley et al. 1994, Wegner 2010). The HMG box consists of 70–80 amino acids arranged in three α-helices and binds DNA in the mi- nor groove, thereby introducing a strong bend of 70–85 ° in the DNA molecule. This architectural influence facilitates the contact between Sox transcription factors and other DNA-associated proteins and is a prerequisite for the involvement of Sox proteins into numerous different transcriptional networks. Besides DNA-binding and DNA bending, the third function of the HMG domain is to create a platform for protein-protein interactions (Wissmüller et al. 2006). Sox family members interact with each other, with further transcription factors and with chromatin remodelling complexes via conserved dimerization or protein interaction domains (for review see Bernard and Harley (2010)). Therefore, Sox proteins can cause conformational changes of the DNA structure in two ways: either directly by binding DNA or indirectly by recruiting chromatin remodelling complexes. Depending on the tissue- and stage-specific context of expressed interaction partners, one single Sox protein can exert very different functions during development by recog- nizing and binding specific DNA elements, rearranging DNA structure and interacting in protein complexes.

15 1 Introduction

1.2.1 SoxE proteins in general

The SoxE subgroup consists of the members Sox8, Sox9 and Sox10 (Bowles et al. 2000). Besides the HMG box, three highly conserved domains characterize SoxE proteins (see Fig. 1.5): N-terminally of the HMG domain, about 40 amino acids form a DNA-dependent dimerization domain, which is essential for cooperative binding of Sox10 to dimer binding sites in regulatory regions of different target genes (Schlierf et al. 2002). The central part of SoxE proteins contains the so-called K2 domain, a highly conserved domain of 70–80 amino acids, whose transactivating capacity was shown for Sox8 in vitro (Schep- ers et al. 2000) and which was characterized as a tissue-speciﬁc transactivation domain of Sox10 in vivo (Schreiner et al. 2007). The 60–70 most C-terminally located amino acids represent the transactivation domain, which is only partially conserved among the SoxE members (Bowles et al. 2000).

FIG. 1.5 Conserved SoxE protein domains. Members of the SoxE subgroup are characterized by four conserved domains: the dimerization domain (Dim), the DNA-binding HMG domain (HMG), the largely un-characterized K2 domain (K2) and the transactivation domain (TA). Modiﬁed from Wegner and Stolt (2006).

Despite the ability of cooperative dimeric binding to DNA, SoxE proteins cannot dimerize in solution. In vitro analyses identified the third α-helix of the HMG boxes of Sox10 and Sox8 and the adjacent C-terminal tail region as critical protein-protein interaction region (Wissmüller et al. 2006), which contacts various types of DNA-binding domains of several transcription factors. Furthermore, subunits of chromatin remodelling complexes, chromatin modifiers or protein kinases are among the potential interaction partners of SoxE proteins. This increases the flexibility of SoxE proteins in choosing partners and exerting various functions (Wissmüller et al. 2006).

16 1.2 Sox proteins

1.2.1.1 Sox10

Early in mouse embryonic development, Sox10 is expressed in neural crest cells emigrat- ing from the dorsalmost portion of the neural tube around 8.5 dpc. During the ongoing development of neural crest derivatives, Sox10 is only transiently expressed in melanoblasts, but continously in postmigratory glial cells of the peripheral nervous system. In contrast, Sox10 expression is downregulated in neural crest cells destined to become neurons (Hong and Saint-Jeannet 2005). In the mouse spinal cord, expression of Sox10 begins at 12–12.5 dpc in oligodendrocyte precursor cells arising from the ventral neuroepithelium. Sox10 expression continues in terminally differentiating oligodendrocytes, where it promotes myelination by directly activating the MBP (myelin basic protein) promoter among other target genes (Stolt et al. 2002). In line with this expression pattern, homozygous loss of Sox10 in a mouse mutant leads to severe developmental defects (Britsch et al. 2001). In Sox10-/- mice, undifferentiated neural crest cells settle in future ganglionic regions and develop into neurons, but specification of glial cells and subsequent differentiation do not occur. In consequence, spinal nerves as well as neurons in sensory and sympathetic ganglia degenerate without the trophic support of Schwann cells and satellite glia (Britsch et al. 2001). In spinal cord, terminal differentiation of oligodendrocytes is impaired in the absence of Sox10, so that the cells fail to myelinate (Stolt et al. 2002). Homozygous Sox10-deficient animals die immediately after birth, whereas heterozygous animals survive with an increased occurrence of a more or less severe megacolon and pigmentation defects. This phenotype is ascribed to the reduced levels of Sox10 in neural crest-derived enteric glial cells and in melanocytes and can be explained by haploinsufficiency. It was first observed in a naturally occuring mouse mutant, the heterozygous Sox10dom-mouse (dominant megacolon mutation) and is comparable with the Waardenburg-Hirschsprung syndrome in human patients. However, heterozygous Sox10 mutation is only one of several genetic defects causing Waardenburg-Hirschsprung syndrome (Herbarth et al. 1998, Southard-Smith et al. 1998).

1.2.1.2 Sox8

The expression pattern of Sox8 is in part overlapping with that of Sox10. In the mouse neural crest, Sox8 is detectable at 9.5 dpc soon after Sox9 and Sox10 and persists in enteric, sympathetic and sensory ganglia as well as chromafﬁn adrenomedullary cells (Sock et al. 2001, Hong and Saint-Jeannet 2005). In contrast to Sox10, Sox8 expression

17 1 Introduction slowly fades in most parts of the PNS around 14.5 dpc with the exception of the enteric nervous system. Outside the neural crest and its derivatives, Sox8 is expressed in muscle, kidney and the testes as well as in chondrocytes, osteoblasts and oligodendrocytes of the CNS. Despite the broad range of Sox8-expressing tissues, loss of Sox8 has no fatal consequences in vivo. Sox8-deficient mice are largely normal, but eventually develop during postnatal life a reduced body weight, mild osteopenia and late-onset infertility (Sock et al. 2001, Schmidt et al. 2005, O’Bryan et al. 2008). Furthermore, Sox8 was found to be a genetic modifier of Sox10 in oligodendrocyte and enteric nervous system development (Stolt et al. 2004, Maka et al. 2005). It plays an accessory role for functions of Sox10 in terminal differentiation of oligodendrocytes (Stolt et al. 2004). Heterozygous loss of Sox10 in combination with a homozygous Sox8 deficiency leads more often and more severely to symptoms of Hirschsprung disease as compared to Sox10 heterozygous animals. This aggravation of the phenotype is caused by increased apoptosis in the vagal neural crest before the colonization of the gut (Maka et al. 2005).

In most of the tissues, where SoxE proteins are found, at least two of them are co- expressed. That points to a possible functional redundancy with the capacity to compensate the loss of each other. It can however not explain, why Sox10 deﬁciency is much more deleterious than the loss of Sox8. The analysis of a mouse mutant expressing Sox8 instead of Sox10, but under the regulatory elements of Sox10, showed that Sox8 has on one hand the potential to compensate for the loss of Sox10 in certain tissues. On the other hand, there are tissues, where Sox10 has unique functions and cannot be replaced by Sox8 (Kellerer et al. 2006).

1.2.2 SoxE proteins in neural crest cell development

Neural crest cell development depends in many aspects on the function of Sox proteins of the subgroup E (Hong et al. 2006). In chicken, ectopic expression of each of the three SoxE proteins favors the generation of neural crest cells at the expense of neural tube cells (Cheung and Briscoe 2003). In arising neural crest cells, SoxE proteins are involved in speciﬁcation, precursor formation, survival and migration. During differentiation, Sox8, Sox9 and Sox10 are required in different combinations in most neural crest derivatives. While Sox10 combines with Sox9 during pigment cell development, it pairs with Sox8 in developing sensory and autonomic neurons and in chromafﬁn cells. Sox10 alone is the major SoxE protein required for glial development in the PNS (for recent review see Haldin and LaBonne (2010)). Additionally, SoxE proteins do not only interact with each

18 1.2 Sox proteins other, but also with further transcription factors speciﬁc for the different arising tissues, thus contributing to the diversiﬁcation of neural crest progeny (Kondoh and Kamachi 2010) (see Fig. 1.6).

FIG. 1.6 SoxE proteins involved in the terminal differentiation of various neural crest deriatives. SoxE proteins interact with different factors to give neural crest derived cell types their differentiated characteristics. From Sauka-Spengler and Bronner-Fraser (2008).

1.2.2.1 SoxE proteins in chromaﬃn cell development

The role of SoxE proteins in chromafﬁn cell development was barely investigated so far. Sox8 was shown to be expressed in the mouse adrenal medulla, but a possible requirement of Sox8 in this tissue was not analyzed (Sock et al. 2001). Sox10 proved to be involved in adreno-medullary cell development, since Sox10dom/dom mutant mice lack an adrenal medulla (Kapur 1999). The mechanism of this loss is however not clearly attributed to Sox10 functions, because the truncated Sox10dom-protein may act in a dominant-negative manner. Therefore, a detailed analysis of Sox mouse mutants should allow further insight into the relationship of SoxE proteins and chromafﬁn cell development.

1.2.2.2 SoxE proteins in Schwann cell development

In Schwann cells of the PNS, Sox10 is expressed through all different developmental steps from the migrating neural crest cell to the fully differentiated Schwann cell. In

19 1 Introduction

Sox10-deficient mice, Schwann cells are not even specified and thus completely missing. Because of this early loss of the Schwann cell lineage, the analysis of the role of Sox10 during later stages of Schwann cell development required mouse mutants with a milder phenotype. Such hypomorphic mutants are the Sox10 aa1 and the Sox10 ∆K2 mutant (Schreiner et al. 2007). The Sox10 aa1 mutant allele encodes a Sox10 protein with a triple alanine substitution in the dimerziation domain, which fails to form DNA-dependent dimers (Schlierf et al. 2002). The loss of Oct6 expression in the aa1 mutant, points to a role of Sox10 in the activation of Oct6 and thus during the transition to the promyelinating stage. The other mutant allele encodes a Sox10 protein without the K2 domain. Sox10 ∆K2 mice fail to initiate myelination, indicating another function of Sox10 at an even later stage of Schwann cell development. Proper expression of Oct6, but the complete loss of Krox20 expression demonstrate an involvement of Sox10 in the transition to the myelinating stage (Schreiner et al. 2007). On a molecular level, Sox10 was shown to act synergistically with Oct6 to activate expression from artificial reporter constructs bearing Sox10 and Oct6 binding sequences in close proximity (Kuhlbrodt et al. 1998). This synergism was confirmed to occur during activation of the MSE enhancer of Krox20 expression (see 1.1.2.2). Furthermore, several Sox binding sites in myelin gene regulatory regions were shown to be biologically relevant. Often these sites are combined elements for Sox10 and Krox20 binding (Svaren and Meijer 2008). In some of these cases, the ability of Sox10 to dimerize on DNA seems to be important. Sox10 activates, for example, the P0 promoter via dimeric binding to adjacent consensus sites and is therefore involved in the direct activation of myelin gene expression (Peirano et al. 2000). During development of myelinating Schwann cells along peripheral nerves, Sox10 is involved in a number of consecutive steps, including specification of neural crest cells, transition from the immature through the promyelinating to the myelinating stage and the direct activation of myelin gene expression.

20 2 Aim of the Study

Sox proteins of the subgroup E are intrinsically tied to the development of the neural crest and its derivatives. Expression of SoxE proteins in these derivatives is generally well characterized, but many details of their function remain to be understood. In this study the focus of interest was on two different aspects of the neural crest functions of Sox10, first on its role in adrenal gland development and then on its involvement in peripheral myelination by Schwann cells. Chromaffin cells of the adrenal gland are neural crest derived. Occurrence of the two SoxE proteins Sox10 and Sox8 in this tissue was already reported and the starting point of the present analysis. First, expression of these SoxE proteins had to be exactly determined at different developmental stages. Several mouse models with full or partial deficiencies of Sox10 or Sox8 were then chosen to evaluate the impact of these proteins on chromaffin cell development and their mutual dependence in this tissue. A mouse mutant in which Sox10 was replaced by Sox8 was also included in the study to answer the question of a possible functional equivalence between Sox10 and Sox8. To determine the exact time at which Sox10 protein function was required in adrenomedullary cells, conditional deletion was also performed and hypomorphic Sox10 mouse mutants were used to define the importance of conserved domains of Sox10 for adrenomedullary development. The strategy thus was to use diverse mouse mutants to obtain a comprehensive overview of the impact of Sox10 and Sox8 on chromaffin cell development. Additional studies on the sympathetic nervous system in the same mouse mutants helped to compare SoxE function in this closely related neural crest derivative. In the peripheral nervous system, neural crest derived Schwann cells depend on Sox10 for their specification. The continued presence of Sox10 in Schwann cells beyond specification argues for additional functions at later stages. One of the decisive steps of Schwann cell differentiation is expression of Krox20 as the central regulator of peripheral myelination. The identification of the MSE as the enhancer responsible for Krox20 expression in myelinating Schwann cells implicated Sox10 in the process. Sox10 activates the enhancer synergistically with Oct6. The exact mechanism of activation and synergism was however unknown and the second subject of this study. Sox10 binding sites in the MSE were identified, validated in vitro and studied with regard to their functional importance for Sox10-dependent activation and synergism with Oct6. This synergism was further analyzed by defining the domain requirements in both proteins using cell culture-based assays and hypomorphic Sox10 mutant mice thereby defining the role of Sox10 during late stages of Schwann cell development.

3 Results

3.1 The impact of SoxE transcription factors on adrenal gland development

3.1.1 Expression pattern of SoxE proteins in the developing adrenal gland

The first step to get insight into the impact of SoxE proteins on chromaffin cell development was a detailed analysis of the expression pattern of Sox8, Sox9 and Sox10. So far, it was only shown that Sox8 and Sox10 are expressed in the embryonic adrenal medulla (Sock et al. 2001), but the exact onset, duration and cell specificity of this expression was not known. SoxE proteins are first expressed in all premigratory and migratory neural crest cells and then individually regulated in the different derivatives. Therefore, an expression analysis from as early as 12.5 dpc up to 18.5 dpc was performed. At the early stage 12.5 dpc, developing mouse adrenal glands were identified by staining for SF1, the steroidogenic factor 1, which visualizes adreno-cortical, but not adrenomedullary cells (Fig. 3.1 A, F). Sox10 was expressed in the migratory stream of neural crest cells from the dorsal aorta to the adrenal anlagen. Some Sox10-positive cells had already settled in the central portion of the adrenal gland, whereas most of them were still in the process of migration coming from dorso-medial (Fig. 3.1 A). The close relative Sox8 showed a comparable distribution. Co-immunostaining for Sox10 and Sox8 demonstrated a complete overlap between these two transcription factors (Fig. 3.1 G). In contrast, expression of Sox9, the third member of the SoxE subgroup, could not be detected through all stages analyzed (Fig. 3.1 B). The fact that neither SoxE protein was co-localized with SF1 argues against a contribution of SoxE-positive precursors to the adrenal cortex (Fig. 3.1 A, F high magnification). On the other hand, Sox10 was co- expressed with p75, the low-affinity neurotrophin receptor, which identifies cells of the neural crest population at this early stage (Fig. 3.1 C). Furthermore, Sox10 expression largely coincided with expression of Phox2b, a marker of cells determined to a catecholaminergic fate. Besides a large fraction of immunohistochemically double-labeled cells,

23 3 Results some cells were found expressing either Sox10 or Phox2b alone (Fig. 3.1 D). Expres- sion of TH served as an indicator for catecholaminergic differentiation and was detected in the developing adrenal gland (Fig. 3.1 E). Closer examination revealed that this enzyme is not co-expressed with SoxE transcription factors (Fig. 3.1 E, J high magniﬁca- tion). At 12.5 dpc, expression of Sox8 was in all aspects comparable with that of Sox10 (Fig. 3.1 F–J). Therefore, p75-positive neural crest cells express Sox10 and Sox8 during their migration and in the adrenal gland anlagen. These cells start to express Phox2b, but down-regulate Sox10 and Sox8 during this stage. Once the cells have advanced to the stage of TH-expression, they are no longer positive for Sox10 or Sox8.

FIG. 3.1 SoxE expression in the early embryonic adrenal gland. Co-immunohistochemistry on transverse sections of wildtype embryos at 12.5 dpc with antibodies against Sox10 (A–E) or Sox8 (F–J) (shown in red) and SF1 (A, F), Sox9 (B), Sox10 (G), p75 (C, H), Phox2b (D, I) or TH (E, J) (shown in green). The adrenal anlage is circled as identiﬁed by staining for SF1. Dorsal aortae are outlined by dashed lines. High magniﬁcations are shown as inlays.

During further embryonic development, expression of Sox10 was maintained up to 18.5 dpc in adreno-medullary cells, which assembled more and more into a compacted medulla distinct from the surrounding cortex (Fig. 3.2 A–D). In contrast, expression of Sox8 faded at 14.5 dpc and had disappeared by 16.5 dpc, as determined in immunohistochemical stainings (Fig. 3.2 E–H). Interestingly, X-gal stainings revealed β-galactosidase activity in the adrenal glands of Sox8+/lacZ mice even at 18.5 dpc (Sock et al. 2001). This argues that β-galactosidase expressed from the Sox8 locus is much longer present than Sox8 itself possibly because of higher stability which still allows β-galactosidase detection several days after protein expression has stopped already.

24 3.1 The impact of SoxE transcription factors on adrenal gland development

FIG. 3.2 SoxE expression during embryonic adrenal development. Immunohistochemistry on transverse sections of wildtype embryos at 12.5 dpc (A, E), 14.5 dpc (B, F), 16.5 dpc (C, G) and 18.5 dpc (D, H) with antibodies against Sox10 (A–D) or Sox8 (E–H). The adrenal gland area is circled (A–C, E–G).

Since Sox8 was downregulated before, the expression analysis of stage 18.5 dpc adrenal glands focused on Sox10 (Fig. 3.3). At that stage, 3β-hydroxysteroide-dehydrogenase (βHSD) was used to identify the adrenal cortex (Fig. 3.3 A). Sox10 was still not expressed in cortical cells, but in the medulla of the organ. Comparable with the situation at 12.5 dpc, Sox10-positive cells were distinct from differentiated TH-positive cells (Fig. 3.3 B).

FIG. 3.3 Sox10 expression in the late embryonic adrenal gland. Co-immunohistochemistry on transverse sections of wildtype embryos at 18.5 dpc with antibodies against Sox10 (A–D) (shown in red) and βHSD (A), TH (B), VMAT (C) or PNMT (D) (shown in green). High magniﬁcations are shown as inlays.

25 3 Results

To further exclude the occurrence of Sox10 in differentiated chromaffin cells, two more proteins indicative of this cell population were immunohistochemically labeled - VMAT (vesicular monoamine transporter 1), a monoamine transporter in the membranes of chromaffin vesicles and PNMT, an enzyme involved in the synthesis of adrenalin (Fig. 3.3 C, D). Sox10 was co-expressed with neither of the two proteins confirming its down-regulation in differentiated chromaffin cells (Fig. 3.3 C, D high magnification). Co-immunostaining with the Schwann cell markers GFAP, Oct6 and Krox20 did not show a notable co-expression with Sox10 (data not shown). Thus, most of the Sox10-positive cells do not represent glial cells along invading nerves. With these stainings the identity of the Sox10-positive population could not finally be determined. Most likely, these cells represent a residual precursor pool for chromaffin cells.

3.1.2 The impact of Sox10 on adrenal gland development

A mouse model constitutively lacking Sox10 yielded insight into the importance of Sox10 for the chromafﬁn cell lineage. Sox10lacZ/lacZ mice express the reporter-gene β-galactosidase instead of Sox10, which allows tracing of cells, that would normally express Sox10, at least as long as they survive in its absence (Britsch et al. 2001). As seen by the loss of Sox10 expression, targeted deletion of Sox10 was successful (compare Fig. 3.4 A and B). At the late stage 18.5 dpc, Sox10lacZ/lacZ animals lacked

FIG. 3.4 The late embryonic adrenal gland in Sox10-deficient mice. Immunohistochemistry on transverse sections of wildtype (A, C) and Sox10lacZ/lacZ (B, D) embryos at 18.5 dpc with antibodies against Sox10 (A, B) or βHSD (C, D). Quantification of the βHSD- immunoreactive area is shown as percentage of the total adrenal gland area (E). Data are presented as mean ± SEM. Statistically significant differences were determined by the Student’s t-test (∗ ∗ ∗p ≤ 0.001).

26 3.1 The impact of SoxE transcription factors on adrenal gland development the complete adrenal medulla (Fig. 3.4 B, D). Staining for the cortical marker βHSD confirmed this loss. In anti-βHSD immunostainings of wildtype tissue, the central region of the adrenal gland representing the medulla was spared and not labeled (Fig. 3.4 C). In contrast, in Sox10lacZ/lacZ animals the βHSD-positive signal covered the whole adrenal gland (Fig. 3.4 D).The βHSD-immunoreactive area was quantified morphometrically. The immunohistochemically labeled area is shown as percentage of the area covered by the whole adrenal gland on the respective section. Despite the complete loss of the adrenal medulla, βHSD-staining did not cover 100%, but only 80% of the whole adrenal gland area in Sox10-deficient animals, because there is some interstitial tissue, which is neither labeled by a cortical marker nor by a medullary marker (Fig. 3.4 E). However, the increase of cortical tissue by about 20% in the absence of Sox10 was statistically significant (Fig. 3.4 E). In consequence to the loss of Sox10, no cells with immunoreactivity for TH, PNMT or VMAT could be detected demonstrating the loss of the entire chromaffin cell population (Fig. 3.5 B, D, F). Interestingly, the cortical region was extended into the central portion of the organ and the size of the whole adrenal gland was not reduced despite the lack of the medulla (compare Fig. 3.4 C and D).

FIG. 3.5 The late embryonic adrenal gland in Sox10-deﬁcient mice. Immunohistochemistry on transverse sections of wildtype (A, C, E) and Sox10lacZ/lacZ (B, D, F) embryos at 18.5 dpc with antibodies against TH (A, B), PNMT (C, D) or VMAT (E, F).

27 3 Results

To determine the starting point, from which on chromafﬁn cell development had been affected, forming adrenal glands were examined at earlier stages. Immunohistochemical stainings against SF1, which marked the urogenital ridge and the descending adreno- cortical and gonadal cells, served to determine the region of the developing adrenal gland (encircled). For further histological analysis, only sections adjacent to SF1 labeled sections were taken into account. In Sox10lacZ/lacZ animals, not only Sox10, but also β-galactosidase expression was missing in the adrenal gland region at 12.5 dpc (Fig. 3.6 B, F). The loss of Sox10-expressing cells was mirrored by the loss of the Sox8-positive population (Fig. 3.6 D). Thus, the whole chromafﬁn precursor population expressing Sox10 in wildtype had already disappeared in Sox10 mutant animals at that stage. In line with this, no cells expressing Phox2b or TH could be detected (Fig. 3.6 H, J).

FIG. 3.6 The early embryonic adrenal gland in Sox10-deﬁcient mice. Immunohistochemistry on transverse sections of wildtype (A, C, E, G, I, K) and Sox10lacZ/lacZ (B, D, F, H, J, L) embryos at 12.5 dpc with antibodies against Sox10 (A, B), Sox8 (C, D), β-galactosidase (E, F), Phox2b (G, H), TH (I, J) or SF1 (K, L). The adrenal anlage is circled (A–J) as identiﬁed by staining for SF1 on adjacent sections. Dorsal aortae are to the left.

The analysis of even earlier developmental stages showed that the defect was obvious by 10.5 dpc (Fig. 3.7 A–H). Already at this early stage, the number of β-galactosidase- positive cells gathering near the dorsal aorta was reduced compared to the number of corresponding Sox10-positive cells in wildtype littermates (compare Fig. 3.7 A and E). The residual neural crest-derived SA cells in this region failed to induce expression of Sox8 (Fig. 3.7 F). This went along with a complete loss of Phox2b expression (Fig. 3.7 G).

28 3.1 The impact of SoxE transcription factors on adrenal gland development

In the vicinity of the dorsal aorta, apoptosis was dramatically increased (compare Fig. 3.7 D and H) in a way, that one day later during development, at 11.5 dpc, the SA population had almost entirely disappeared (Fig. 3.7 M–O). The few remaining β-galactosidase-positive cells did still not express Sox8 or Phox2b (Fig. 3.7 N, O) and were subject to increased apoptosis in this region as evident from TUNEL assays (Fig. 3.7 P). Therefore, Sox10-deﬁcient SA cells near the dorsal aorta do not initiate expression of Sox8 and only rarely of Phox2b. Subsequently, they are lost early due to increased apoptosis.

FIG. 3.7 Neural crest cells in the presumptive adrenal gland region. Immunohistochemistry (A–C, E–G, I–K, M–O) and TUNEL (D, H, L, P) on transverse sections of wildtype (A–D, I–L) and Sox10lacZ/lacZ (E–H, M–P) embryos at 10.5 dpc (A–H) and 11.5 dpc (I–P) with antibodies against Sox10 (A, I), β-galactosidase (E, M), Sox8 (B, F, J, N) or Phox2b (C, G, K, O). Nuclei were counterstained in the TUNEL assays by DAPI (D, H, L, P) (shown in blue). Dorsal aortae are outlined by dashed lines.

29 3 Results

3.1.3 The impact of Sox8 on adrenal gland development

The availability of a Sox8-deﬁcient mouse model, in which the Sox8 open reading frame was replaced by the reporter-gene β-galactosidase in the same way as in the Sox10lacZ/lacZ mouse strain, allowed to analyze the consequences of the loss of Sox8 (Sock et al. 2001). The outcome after constitutive deletion of Sox8 was in sharp contrast to the situation in Sox10lacZ/lacZ mice. Adrenal glands were normal in Sox8lacZ/lacZ animals at 18.5 dpc (Fig. 3.8 A, D; Fig 3.9 A, D, G). Labeling of the cortex with βHSD indicated a normal- sized adrenal medulla (Fig. 3.8 D and H). Regular expression of Sox10 (Fig. 3.8 A and G) was accompanied by the expression of the differentiation markers TH, PNMT and VMAT in levels comparable with wildtype

FIG. 3.8 The late embryonic adrenal gland in mice with Sox8- and Sox10-deficiencies. Immunohistochemistry on transverse sections of Sox8lacZ/lacZ (A, D), Sox10+/lacZ (B, E) and Sox8lacZ/lacZ Sox10+/lacZ (C, F) embryos at 18.5 dpc with antibodies against Sox10 (A–C) or βHSD (D–F). Quan- tification of Sox10-positive cells is shown as cell number per unit area (G) and quantification of the βHSD-immunoreactive area as percentage of the total adrenal gland area (H). Data are presented as mean ± SEM.

30 3.1 The impact of SoxE transcription factors on adrenal gland development

FIG. 3.9 The late embryonic adrenal gland in mice with Sox8- and Sox10-deficiencies. Immunohistochemistry on transverse sections of Sox8lacZ/lacZ (A, D, G), Sox10+/lacZ (B, E, H) and Sox8lacZ/lacZ Sox10+/lacZ (C, F, I) embryos at 18.5 dpc with antibodies against TH (A–C), PNMT (D– F) or VMAT (G–I). Quantification of the TH- and PNMT-immunoreactive area is shown as percentage of the total adrenal gland area (TH in J, PNMT in K). Data are presented as mean ± SEM. Statistically significant differences were determined by the Student’s t-test (∗∗p ≤ 0.01 and ∗ ∗ ∗p ≤ 0.001).

littermates (Fig. 3.9 A, D, G, J, K). TH and PNMT were quantiﬁed morphometrically as described for βHSD (see 3.1.2) Also, early embryonic development proceeded normally in Sox8lacZ/lacZ animals. At 12.5 dpc, the migratory stream from the dorsal aorta to the adrenal gland anlagen did not contain less Sox10- or Phox2b-positive cells than in wildtype littermates (compare Fig. 3.10 A / 3.11 A and Fig. 3.6 A, G, for quantiﬁcation see Fig. 3.10 J and Fig. 3.11 J). Expression of β-galactosidase indicated that loss of Sox8 expression did not result in

31 3 Results a loss of the usually Sox8 expressing cell population as observed in the corresponding Sox10-deficient situation (compare Fig. 3.10 G and Fig. 3.6 F). The amount of TH expressing cells did not differ from wildtype (compare Fig. 3.11 D and Fig. 3.6 I, for quantification see Fig. 3.11 K). Sox8 expression was therefore dispensable for survival and differentiation of chromaffin cell precursors. Normal adrenal gland development despite the loss of Sox8 may be ascribed to a functional redundancy between Sox8 and co-expressed Sox10, which might exert a com- pensatory activity. Therefore, the consequences of a Sox8 deficiency were analyzed on a background of reduced Sox10 levels. The heterozygous loss of Sox10 had no phe- notypical effects. Sox10+/lacZ adrenal glands were not notably different from wildtype adrenal glands at all stages analyzed (Fig. 3.8 B, E; Fig. 3.9 B, E, H; Fig. 3.10 B, E, H; Fig. 3.11 B, E, H). But consequences of the loss of Sox8 became obvious on this sensi- tized background. Whereas the adrenal medulla accounts for 22.5% of the whole wildtype adrenal gland, medullae of the compound mutants covered only 14.8% of the whole organ (Fig. 3.16). At stage 18.5 dpc, TH, PNMT and VMAT expression were consistently reduced (Fig. 3.9 C, F, I, J, K) in Sox8lacZ/lacZ Sox10+/lacZ animals.

FIG. 3.10 The early embryonic adrenal gland in mice with Sox8- and Sox10-deficiencies. Immunohistochemistry on transverse sections of Sox8lacZ/lacZ (A, D, G), Sox10+/lacZ (B, E, H) and Sox8lacZ/lacZ Sox10+/lacZ (C, F, I) embryos at 12.5 dpc with antibodies against Sox10 (A–C), Sox8 (D–F) or β-galactosidase (G–I). The adrenal anlage is circled as identified by staining for SF1 on adjacent sections. Dorsal aortae are to the left. Quantification of Sox10-positive cells is shown as cell number per section (J). Data are presented as mean ± SEM.

32 3.1 The impact of SoxE transcription factors on adrenal gland development

Already at 12.5 dpc, slight decreases in the expression of β-galactosidase, Phox2b and TH were observed (Fig. 3.10 I; Fig. 3.11 C, F). Thus, the loss of Sox8 or dose reduction of Sox10 in Sox10+/lacZ animals alone had no effect on adrenal gland development. Only a combination of both mutations and thus an overall reduced dosage of SoxE protein led to a partial loss of chromafﬁn cells.

FIG. 3.11 The early embryonic adrenal gland in mice with Sox8- and Sox10-deficiencies. Immunohistochemistry on transverse sections of Sox8lacZ/lacZ (A, D, G), Sox10+/lacZ (B, E, H) and Sox8lacZ/lacZ Sox10+/lacZ (C, F, I) embryos at 12.5 dpc with antibodies against Phox2b (A–C), TH (D–F) or SF1 (G–I). The adrenal anlage is circled (A–F) as identified by staining for SF1 on adjacent sections. Dorsal aortae are to the left. Quantification of Phox2b-positive cells is shown as cell number per section (J) and quantification of the TH-immunoreactive area in square micrometers × 103 per section (K). Data are presented as mean ± SEM.

33 3 Results

3.1.4 Functional redundancy between Sox10 and Sox8

The fact that induction of Sox8 expression required Sox10 expression in neural crest cells giving rise to the adrenal medulla, explained why Sox10 could compensate for the loss of Sox8 in Sox8lacZ/lacZ adrenal glands, but not vice versa. If the two proteins had similar biochemical properties, then expression of Sox8 in amounts that reflect the joint amount of Sox10 and Sox8 could possibly rescue the loss of chromaffin cells in Sox10- deficient animals. Therefore, a mouse mutant was analyzed that expressed Sox8 from its own genetic locus and from the Sox10 genetic locus. In these mice, the Sox10 open reading frame was replaced by the Sox8 coding sequence, which results in the additional expression of Sox8 under the regulatory elements of Sox10 (Kellerer et al. 2006).

FIG. 3.12 The late embryonic adrenal gland in mice with hypomorphic Sox10 alleles. Immunohistochemistry on transverse sections of wildtype (A, E), Sox10Sox8ki/Sox8ki (B, F), Sox10aa1/aa1 (C, G) and Sox10∆K2/∆K2 (D, H) embryos at 18.5 dpc with antibodies against Sox10 (A–D) or βHSD (E–H). Quantification of SoxE-positive cells is shown as cell number per unit area (I) and quantification of the βHSD-immunoreactive area as percentage of the total adrenal gland area (J). Data are presented as mean ± SEM. Statistically significant differences were determined by the Student’s t-test (∗∗p ≤ 0.01 and ∗ ∗ ∗p ≤ 0.001). Note that the numbers of Sox8-positive cells in Sox10Sox8ki/Sox8ki embryos are comparable with the numbers of Sox10-positive cells in other genotypes because of the replacement of Sox10 by Sox8.

34 3.1 The impact of SoxE transcription factors on adrenal gland development

At 18.5 dpc, the loss of Sox10 expression in the adrenal glands of Sox10Sox8ki/Sox8ki animals conﬁrmed the efﬁcient deletion of Sox10 (compare Fig. 3.12 A and B). Instead, Sox8 was found to be expressed at this late stage, when it was already downregulated in wildtype littermates (data not shown). Sox10-driven Sox8 expression could in general persist until 18.5 dpc, but only in a reduced number of cells compared to the number of Sox10-positive cells in wildtype (Fig. 3.12 I). To quantify SoxE protein expression in Sox10Sox8ki/Sox8ki mutants, Sox8-expressing cells were counted, which are comparable with Sox10-expressing cells in other genotypes because of the replacement allele.

FIG. 3.13 The late embryonic adrenal gland in mice with hypomorphic Sox10 alleles. Immunohistochemistry on transverse sections of wildtype (A, E, I), Sox10Sox8ki/Sox8ki (B, F, J), Sox10aa1/aa1 (C, G, K) and Sox10∆K2/∆K2 (D, H, L) embryos at 18.5 dpc with antibodies against TH (A– D), PNMT (E–H) or VMAT (I–L). Quantiﬁcation of the TH- or PNMT-immunoreactive area is shown as percentage of the total adrenal gland area (TH in M, PNMT in N). Data are presented as mean ± SEM. Statistically signiﬁcant differences were determined by the Student’s t-test (∗ ∗ ∗p ≤ 0.001).

35 3 Results

Despite the reduced number of chromaffin cells, Sox8 was in general able to fulfill the functions of Sox10 during differentiation of the residual chromaffin cell population, since all differentiation markers were expressed correctly in Sox10Sox8ki/Sox8ki animals (Fig. 3.13 B, F, J, M, N). But, chromaffin cells were reduced to about half of the wildtype numbers (Fig. 3.16) and the medullae were less compacted, with chromaffin cells more loosely interspersed. Already at early stages, the number of future chromaffin cells was reduced as assessed by the reduced number of cells expressing Sox8, Phox2b or TH (Fig. 3.14 F, I and Fig. 3.15 B, F, M, N). Sox10 and Sox8 are therefore redundant in their functions, but they are not equally effective in exerting them during chromaffin cell development.

FIG. 3.14 The early embryonic adrenal gland in mice with hypomorphic Sox10 alleles. Immunohistochemistry on transverse sections of wildtype (A, E), Sox10Sox8ki/Sox8ki (B, F), Sox10aa1/aa1 (C, G) and Sox10∆K2/∆K2 (D, H) embryos at 12.5 dpc with antibodies against Sox10 (A–D) or Sox8 (E–H). The adrenal anlage is circled as identified by staining for SF1 on adjacent sections. Dorsal aortae are to the left. Quantification of SoxE-positive cells is shown as cell number per section (I). Data are presented as mean ± SEM. Statistically significant differences were determined by the Student’s t-test (∗ ∗ ∗p ≤ 0.001). Note that the numbers of Sox8-positive cells in Sox10Sox8ki/Sox8ki embryos are comparable with the numbers of Sox10-positive cells in other genotypes because of the replacement of Sox10 by Sox8.

3.1.5 The importance of conserved SoxE protein domains

The early and complete loss of the chromafﬁn cell population in Sox10lacZ/lacZ mice excluded a further examination of possible functions of Sox10 during later developmental stages of the adrenal gland. Two mutations of the Sox10 gene were shown by Schreiner et al. to be associated with hypomorphic phenotypes.

36 3.1 The impact of SoxE transcription factors on adrenal gland development

In these two mutants conserved domains of the Sox10 protein are mutated or deleted. The aa1 mutation targets the dimerization domain, which is rendered non-functional by the introduction of a triple alanine substitution in the N-terminal part of the dimerization domain. In the Sox10∆K2 allele, the whole K2 domain spanning amino acids 233–306

FIG. 3.15 The early embryonic adrenal gland in mice with hypomorphic Sox10 alleles. Immunohistochemistry on transverse sections of wildtype (A, E, I), Sox10Sox8ki/Sox8ki (B, F, J), Sox10aa1/aa1 (C, G, K) and Sox10∆K2/∆K2 (D, H, L) embryos at 12.5 dpc with antibodies against Phox2b (A–D), TH (E–H) or SF1 (I–L). The adrenal anlage is circled (A–H) as identified by staining for SF1 on adjacent sections. Dorsal aortae are to the left. Quantification of Phox2b-positive cells is shown as cell number per section (M) and quantification of the TH-immunoreactive area in square micrometers × 103 per section (N). Data are presented as mean ± SEM. Statistically significant differences were determined by the Student’s t-test (∗ ∗ ∗p ≤ 0.001).

37 3 Results of Sox10 is deleted. This domain is described to be an additional tissue-specific transactivation domain possibly involved in the formation of protein-protein interactions. Both mouse mutants were analyzed in view of their adrenal gland phenotypes and in both cases adrenal gland development was severely affected. In stage 18.5 dpc Sox10aa1/aa1 animals, the area of the adrenal medulla accounted for only 4.9% of the whole adrenal gland area compared to 22.5% in wildtype (Fig. 3.16). This was reflected by anti-βHSD immunostainings, which showed labeling of the whole organs with only small βHSD-negative spaces spared for adreno-medullary cells (Fig. 3.12 G, J). The analysis of TH, PNMT and VMAT expression indicated a dramatic loss in the number of differentiated chromaffin cells (Fig. 3.13 C, G, K). Area measurements revealed a reduction of the TH-positive area to about a quarter of wildtype levels and an even more pronounced decrease for the marker PNMT (Fig. 3.13 M, N). The number of Sox10 expressing chromaffin precursor cells was also reduced in Sox10aa1/aa1 adrenal glands (compare Fig. 3.12 A and C). Nevertheless, the strongly diminished chromaffin cell population that survived up to 18.5 dpc correctly expressed all of the analyzed differentiation markers. In case of the ∆K2 mutation, chromaffin cell development was even more affected. The adrenal medullae covered only 2.6% of the whole adrenal glands indicating a reduction of chromaffin cells to nearly 1/10 of wildtype levels by 18.5 dpc (Fig. 3.16). But again, the few remaining chromaffin cells differentiated correctly as assessed by the expression of TH, PNMT and VMAT (Fig. 3.13 D, H, L). To clarify whether chromaffin cells were progressively lost during development or whether they were reduced from early on, stage 12.5 dpc embryos were analyzed (Fig. 3.14 and Fig. 3.15). All of the defects that had been observed at 18.5 dpc were already obvious at 12.5 dpc. The cell numbers expressing the mutant Sox10 proteins were significantly reduced (Fig. 3.14 I) and TH expression was almost not detectable (Fig. 3.15 G, H, N). These two mouse mutants show that both, the dimerization domain and the additional transactivation domain K2, are required for chromaffin cell development in normal numbers. In contrast, these conserved domains seem to be more or less dispensable for the completion of the differentiation program once the cells have survived early developmental stages. Interestingly, none of the mutations led to a reduced size of the whole adrenal gland despite the marked loss of chromaffin cells (compare Fig. 3.12 E and G, H).

38 3.1 The impact of SoxE transcription factors on adrenal gland development

FIG. 3.16 Relative contribution of cortex and medulla to the adrenal gland area. Raw data of the TH-immunoreactive and the βHSD-immunoreactive area measurements of 18.5 dpc adrenal glands were used to calculate the relative contribution of cortex (black portion of the bar) and medulla (gray portion of the bar) to the adrenal gland.

To compare all mutants that were implicated in this study, the relative contribution of medulla and cortex to the whole adrenal gland was calculated (Fig. 3.16). Therefore, the sum of the TH- and the βHSD-immunoreactive area was calculated and set to 100% for each genotype. The area labeled by these two markers together varied only by 2–3% between the different genotypes indicating that the whole adrenal gland size was comparable for all animals. The mutants were arranged according to the increasing severity of their phenotypes. Loss of Sox8 or of one Sox10 allele did not notably change the ratio of medulla and cortex, whereas the combination of both deletions resulted in a slight reduction of the medullary portion. The replacement of Sox10 by Sox8 further decreased the proportion of the medulla. This decrease was even stronger in the hypomorphic Sox10 mutants and the cortex accounted even for the whole adrenal gland area in Sox10-deﬁcient animals.

39 3 Results

3.1.6 Conditional Sox10 deletion

To further exclude an involvement of Sox10 in later chromaffin cell development, Sox10 was conditionally ablated using the Cre-lox recombination system. In a mouse strain carrying Sox10 alleles surrounded by loxP (locus of X-over P1)-sites (Finzsch et al. 2010), tissue-specific deletion of Sox10 was possible by intercrossing with a Cre (causes recombination)-expressing mouse strain. The DBH-Cre mouse strain used in this study expresses Cre under the control of the regulatory elements of the DBH gene (Parlato et al. 2007). DBH is one of the enzymes of catecholamine synthesis and as such expressed at a stage, when cells are already specified to a catecholaminergic identity and start to adopt catecholaminergic traits. Taking into account that Sox10 was seen to be downregulated once the cells express TH as another enzyme of the catecholamine synthesis it was likely that a DBH-Cre mediated loss of Sox10 would be without consequences for chromaffin cell development. This was indeed confirmed by immunohistochemical analyses of the stages 18.5 dpc (Fig. 3.17) and 12.5 dpc (Fig. 3.18). The adrenal glands of DBH-Cre Sox10∆/∆ mice were in no respect different from their wildtype littermates (compare Fig. 3.17 A–E and F– J; compare Fig. 3.18 A–E and F–J). This strengthened the finding that Sox10 exerts its functions very early during chromaffin cell development before the acquisition of catecholaminergic traits.

FIG. 3.17 The late embryonic adrenal gland in mice with conditional Sox10 alleles. Immunohistochemistry on transverse sections of wildtype (A–E) and DBH-Cre Sox10∆/∆ (F–J) embryos at 18.5 dpc with antibodies against Sox10 (A, F), βHSD (B, G), TH (C, H), PNMT (D, I) or VMAT (E, J).

40 3.1 The impact of SoxE transcription factors on adrenal gland development

FIG. 3.18 The early embryonic adrenal gland in mice with conditional Sox10 alleles. Immunohistochemistry on transverse sections of wildtype (A–E) and DBH-Cre Sox10∆/∆ (F–J) embryos at 12.5 dpc with antibodies against Sox10 (A, F), Sox8 (B, G), Phox2b (C, H), TH (D, I) or SF1 (E, J). The adrenal anlage is circled (A–D, F–I) as identiﬁed by staining for SF1 on adjacent sections. Dorsal aortae are to the left.

3.1.7 Analysis of sympathetic ganglia

The fact that chromafﬁn cells are thought to arise from the same precursors as sympathetic neurons, namely from SA cells, prompted us to take a look at sympathetic ganglion development at the rostro-caudal level of the adrenal glands. In 12.5 dpc wildtype sympathetic ganglia, Sox10 expressing cells encircled Phox2b- as well as TH-positive cells (Fig. 3.19 A–C). As a consequence of the loss of Sox10, none of these markers were expressed in regions, where sympathetic ganglia are normally located (Fig. 3.19 D– F). This indicated a complete absence of sympathetic ganglia in Sox10lacZ/lacZ animals. Sympathetic ganglia of Sox8-deﬁcient mice or Sox10+/lacZ mice appeared to be normal (Fig. 3.19 G–I; Fig. 3.19 J–L) and the combination of both mutations led to a marginally, if at all reduced ganglion size at that level (Fig. 3.19 M–O). A comparison of the situation in Sox10Sox8ki/Sox8ki, Sox10aa1/aa1 and Sox10∆K2/∆K2 animals unraveled that replacement of Sox10 by Sox8 resulted in a milder phenotype than the hypomorphic mutations (compare Fig. 3.19 P–R, S–U and V–X). Loss of the K2 domain affected the ganglion development slightly more than disruption of the dimerization domain. However, the differences between these three mutants were relatively weak.

41 3 Results

The severity of the observed phenotypes corresponds in all mutants for the sympathetic ganglia to that of the adrenal medulla. Only loss of Sox10 resulted in a loss of the whole cell population. In all other mutants, the sympathetic ganglion size was more or less reduced, but in all cases at least some cells matured to TH expressing cells.

FIG. 3.19 Development of sympathetic ganglia in the adrenal gland region. Immunohistochemistry on transverse sections of wildtype (A–C), Sox10lacZ/lacZ (D–F), Sox8lacZ/lacZ (G– I), Sox10+/lacZ (J–L), Sox8lacZ/lacZ Sox10+/lacZ (M–O), Sox10Sox8ki/Sox8ki (P–R), Sox10aa1/aa1 (S–U) and Sox10∆K2/∆K2 (V–X) embryos at 12.5 dpc with antibodies against Sox10 (A, D, G, J, M, S, V), Sox8 (P), Phox2b (B, E, H, K, N, Q, T, W) or TH (C, F, I, L, O, R, U, X). Note that Sox8 staining in Sox10Sox8ki/Sox8ki embryos is comparable with Sox10 staining in other genotypes because of the replacement of Sox10 by Sox8.

42 3.2 The impact of the Sox10 transcription factor on the Krox20 MSE

3.2 The impact of the Sox10 transcription factor on the Krox20 MSE

3.2.1 Analysis of Sox10 binding sites in the Krox20 MSE

In myelinating Schwann cells, expression of the transcription factor Krox20, a crucial regulator of myelination, is under control of the myelinating Schwann cell element MSE (Fig. 3.20). Ghislain and Charnay identified four Oct6 protein binding sites (indicated as grey boxes in Fig. 3.20) within the 1.3 kb of this enhancer element. They furthermore suggested potential Sox10 binding sites (indicated by grey arrowheads in Fig. 3.20), but did not test which of these sites are occupied and of biological relevance. A detailed re-examination of the MSE sequence resulted in the identification of additional potential Sox binding sites (indicated by black arrowheads in Fig. 3.20) according to the heptameric consensus sequence 5’-(A/T)(A/T)CAA(A/T)G-3’, which is specific for Sox protein binding. Sox transcription factor binding to DNA tolerates variations of the consensus motif to a greater or lesser extent depending on the flanking DNA sequences and the cooperation of neighboring Sox binding sites (Wegner 2010).

FIG. 3.20 Identification of putative Sox10 binding regions within the Krox20 MSE. Sequence of the mouse Krox20 MSE with asterisks indicating those nucleotides that are fully conserved among mouse, human and chicken. Putative Sox10 binding sites are marked by Roman numerals and arrows (Previously noted putative Sox10 binding sites are shown in grey, newly identified ones in black). Oct6 binding sites identified by Ghislain and Charnay (2006) are marked by grey boxes.

Therefore, this analysis included all sequence elements with less than two mismatches compared to the consensus sequence and in addition elements with two mismatches when located in close proximity to another putative binding site. With one exception, the mismatches had to be outside of the 5’-CAA-3’ core sequence to be acceptable for inclusion

43 3 Results into further analysis. According to these criteria, eleven putative binding regions designated I–XI were identiﬁed, which contained up to four consensus motifs named a–d. An alignment of the mouse, chicken and human MSE sequence showed conservation of these sites and of the whole core sequence among the three species (indicated by asterisks below conserved nucleotides in Fig. 3.20).

FIG. 3.21 Binding of Sox10 protein to putative binding regions within the Krox20 MSE. EMSA with radiolabeled, double-stranded oligonucleotides encompassing regions I–XI. Oligonu- cleotides were incubated in the absence (-) or presence (C, Sox10) of protein extracts before gel electrophoresis. Extracts were obtained from mock-transfected 293 cells (C) or 293 cells expressing Sox10 MIC (Sox10). Oligonucleotides containing site B or site C/C’ from the P0 promoter demonstrated high- afﬁnity monomeric (m) and dimeric (d) binding as controls. All oligonucleotides were size-matched.

Electromobility shift assays (EMSA) served to evaluate the binding properties of the identiﬁed regions (Fig. 3.21). Therefore, double-stranded, radiolabeled oligonucleotides of all eleven sites were incubated with Sox10 containing protein extracts. Protein-bound oligonucleotides migrate slower in the electric ﬁeld than unbound oligonucleotides. As far as possible, oligonucleotide sequences included neighboring candidate sites to preserve the possibility to detect dimeric binding sites. Two oligonucleotides containing known Sox10 binding sites from the promoter of the P0 gene demonstrated monomeric or dimeric binding of Sox10 as positive controls. Site B is known to interact with one molecule of Sox10, whereas the compound site C/C’ allows cooperative binding of two Sox10 molecules. Both oligonucleotides show characteristic migration properties indica-

44 3.2 The impact of the Sox10 transcription factor on the Krox20 MSE tive of monomeric or dimeric occupancy with Sox10. Radiolabeled oligonucleotides were then incubated either in the absence or in the presence of protein extracts. Control protein extracts from mock-transfected HEK293 cells served as negative control, since these cells do not express endogenous Sox10. Binding of Sox10 was assessed using extracts from HEK293 cells transfected with an expression plasmid encoding the MIC variant of Sox10. This shortened Sox10 version contains the 189 N-terminal amino acids of Sox10 including the DNA-binding HMG domain. It binds DNA with the same specificity and affinity as the holoprotein. The EMSA revealed one possible dimeric binding region among the chosen candidates, whereas the others were monomeric binding sites or did not bind Sox10 (Fig. 3.21). The further analysis focused on the high-affinity monomeric binding regions I, VI, VII, VIII, IX and XI and on the dimeric binding region II. Since all verified Sox10 binding regions contained two or three possible binding sites, but showed with the exception of region II binding of Sox10 monomers, the analysis had to be refined to single sites within the regions. Therefore, oligonucleotides that contained only one preserved binding site had to be generated. This was achieved in two ways: Mutation(s) of at least the 5’-CAA-3’ core sequence(s) destroyed all but one binding site in every region, while this single binding site remained intact. Alternatively, the exact position of the oligonucleotide was varied in such a way that all but one site remained excluded. For example, the oligonucleotide designated Ia bears an intact binding site a, but a mutated site b; vice versa, in Ib site b is intact, whereas site a is mutated (Fig. 3.22 A). These oligonucleotides were then again analyzed with EMSA (Fig. 3.22 B). In case of region I, the oligonucleotide with only site a being intact could not bind Sox10 MIC. In contrast, the corresponding oligonucleotide with a mutated site a, but an intact site b bound Sox10 protein. This identified site b as the Sox10 binding site within region I. The in-depth analysis of the single sites within the monomeric binding regions highlighted the sites Ib, VIa, VIIb, VIIIa, IXa and XIb as the actual Sox10-occupied DNA sequences among all the identified putative binding sites. Region II, which bound Sox10 dimers via its sites a and b, contained with site b a site that on its own allowed monomeric binding of Sox10. As expected mutation of site a disrupted dimeric binding, but forced alternative binding of one molecule of Sox10. Surprisingly, site a alone did not bind Sox10 at all. Therefore, site IIa enabled cooperative dimeric binding of Sox10 in combination with site IIb, although it could not bind Sox10 on its own.

45 3 Results

FIG. 3.22 Identification of the exact Sox10 binding sites within the high-affinity binding regions. A Oligonucleotides with wildtype sequences are marked by Roman numerals. Small letter suffixes indicate the remaining intact consensus site in each oligonucleotide with the other site(s) being mutated or excluded by shifting the position of the oligonucleotide. Arrowheads mark the location of putative binding sites in wildtype oligonucleotides. Their position within the Krox20 MSE according to acces- sion number AC153379 is indicated. Putative Sox10 binding sites are highlighted by capital letters. A change to lower-case letters shows base changes introduced in the mutant oligonucleotides. Bold face is indicative of experimentally confirmed Sox10 binding sites. B EMSA with radiolabeled, double-stranded oligonucleotides carrying single intact binding sites as indicated in A. Oligonucleotides were incubated in the absence (-) or presence (C, Sox10) of protein extracts before gel electrophoresis. Extracts were obtained from mock-transfected 293 cells (C) or 293 cells expressing Sox10 MIC (Sox10).

46 3.2 The impact of the Sox10 transcription factor on the Krox20 MSE

3.2.2 The importance of Sox10 binding sites for the activation of the Krox20 MSE

In the context of the MSE enhancer, Sox10 is an activator of transcription on its own and in synergy with other factors. Activity of the MSE can be monitored by luciferase reporter gene assays. The reporter plasmid used in this study contained a luciferase gene under the control of the full-length MSE enhancer sequence together with the β-globin minimal promoter.

FIG. 3.23 The impact of single Sox10 binding site mutations on Krox20 MSE activation. Transient transfection of S16 Schwann cells with luciferase reporters under the control of the Krox20 MSE in wildtype or mutant versions. Mutations in one of the seven binding sites (Roman numerals on the left) are indicated by M below the corresponding bars. Luciferase activities were determined after co-transfection of empty pCMV5 vector (-) or pCMV5-Sox10 (+). Data are presented as percentage of the transactivation of the wildtype MSE by Sox10 ± SEM. Statistically signiﬁcant differences in the MSE activation were determined by the Student’s t-test (∗∗p ≤ 0.01 and ∗ ∗ ∗p ≤ 0.001).

Transient transfection of this reporter plasmid into the Schwann cell line S16 showed a weak activation of luciferase expression possibly due to endogenous expression of Sox10 in S16 cells. Upon co-transfection of a plasmid expressing rat Sox10 under the control of the strong, constitutively active CMV promoter, luciferase activity increased reliably (Fig. 3.23). Keeping in mind this strong transactivational activity of high amounts of Sox10 on the MSE and the identification of six high-affinity monomeric Sox10 binding sites and one dimeric binding site within the MSE, it was of interest, how these sites contribute to the transactivation. Therefore, the identified binding sites in the regions I, II, VI, VII, VIII, IX or XI were mutagenized in the context of the full-length MSE enhancer.

47 3 Results

The mutants served to evaluate the single sites regarding their in vivo relevance during activation of Krox20 expression under the control of the MSE. Transactivation of the wildtype reporter construct by Sox10 was set to 100% and compared to the transactivation potential of the mutated reporter constructs (Fig. 3.23). Mutation of site XI was the only one that did not change transactivation of the MSE by Sox10, although site b and site c were mutated with regard to the weak binding of Sox10 to site c in addition to binding to site b (see Fig. 3.22 B). All the other single mutant reporter plasmids could still activate luciferase transcription in response to Sox10. But luciferase activity was reduced by about 50% compared to the wildtype activity in site II, VII and VIII mutants and by 70–80% in site I, VI and IX mutants. As activation of reporter gene expression by Sox10 was at least partially retained in all mutants, none of these sites is the only decisive one for mediating Sox10 activity.

FIG. 3.24 The impact of multiple Sox10 binding site mutations on Krox20 MSE activation. Transient transfection of S16 Schwann cells with luciferase reporters under the control of the Krox20 MSE in wildtype or mutant versions. Mutations in successively increasing numbers of binding sites (Ro- man numerals on the left) are indicated by M below the corresponding bars. Luciferase activities were determined after co-transfection of empty pCMV5 vector (-) or pCMV5-Sox10 (+). Data are presented as percentage of the transactivation of the wildtype MSE by Sox10 ± SEM. Statistically signiﬁcant differences in the MSE activation were determined by the Student’s t-test (∗ ∗ ∗p ≤ 0.001).

The next step was the generation of multiple mutants by combining up to seven mutant binding sites in the same full-length MSE enhancer element. As observed in the single mutant assay, mutation of site IX already reduced the responsiveness of the MSE to Sox10 signiﬁcantly (Fig. 3.24). Joint mutation of up to four sites further decreased, but did not abolish activation by Sox10. Only mutation of ﬁve or more sites was no longer compatible

48 3.2 The impact of the Sox10 transcription factor on the Krox20 MSE with activation of the MSE. Therefore, activation of the MSE is mediated by several Sox10 binding sites acting together. The sites are not equally efﬁcient in their Sox10 responsiveness, but none of the sites accounts for the complete transactivation of the MSE on its own.

3.2.3 Synergism of Sox and POU proteins during activation of the Krox20 MSE

In view of the fact, that Sox10 activates MSE driven transcription in synergism with Oct6, it was conceivable, that the disruption of Sox10 binding sites also impairs this synergism. Transfection of S16 Schwann cells with a reporter plasmid containing the wildtype, full- length MSE and with expression plasmids coding for the effectors Sox10 and Oct6 repro- duced the reported synergistic activation of expression (Fig. 3.25).

FIG. 3.25 The impact of Sox10 binding site mutations on synergistic Krox20 MSE activation. Transient transfection of S16 Schwann cells with luciferase reporters under the control of the Krox20 MSE in wildtype or mutant versions. Mutations in successively increasing numbers of binding sites (Roman numerals on the left) are indicated by M below the corresponding bars. Luciferase activities were determined after co-transfection of empty pCMV5 vector (black bars), pCMV5-Sox10 (striped bars), pCMV5-Oct6 (grey bars) or a combination of both (grey striped bars). Data are presented as fold induction ± SEM normalized to the luciferase activity obtained for each construct after co-transfection of empty pCMV5 vector. Empty bars represent the calculated sum from the single transcription factor transfections for each luciferase reporter. Statistically signiﬁcant differences between the calculated and the measured synergistic MSE activation were determined by the Student’s t-test (∗∗p ≤ 0.01 and ∗ ∗ ∗p ≤ 0.001).

49 3 Results

MSE transactivation was measured as x-fold induction normalized to the luciferase activity observed in the absence of effector, which was arbitrarily set to 1 for each reporter construct. The measured induction rate observed after co-transfection of Sox10 and Oct6 exceeded with 262-fold by far the theoretical, calculated sum of the induction rates after single transfection of either Sox10 or Oct6, which was 174-fold (Fig. 3.25). This represented a strong synergism between both transcription factors in the wildtype situation. Surprisingly, synergistic activation of the MSE enhancer by Sox10 and Oct6 was not affected in the multiple binding site mutants, although activation by Sox10 alone was progressively reduced. In all mutants, the induction rates after co-transfection of Sox10 and Oct6 remained higher than the summation of the induction rates obtained by single transfections and thus met the criterion of synergism (Fig. 3.25). Another rather unexpected result was the decrease in the activation by Oct6 alone concomitantly with the increasing number of binding site mutations. This may reflect the contribution of cell-endogenous Sox10 to the activation of reporter gene expression. Most likely binding of endogenous Sox10 is more and more hindered in consequence of the mutations like binding of overexpressed Sox10. Thus, endogenous Sox10 looses with progressive disruption of binding sites more and more its ability to support activation by Oct6. The strong synergism of Sox10 and Oct6 in the activation of the MSE enhancer proved to be largely unsusceptible to mutation of high-affinity Sox10 binding sites, possibly due to the presence of further low-affinity binding sites.

3.2.4 Speciﬁcity of the synergism of Sox and POU proteins

Ghislain and Charnay reported in their analysis of the MSE, that Brn2 could act in a manner comparable with Oct6 during activation of the MSE (Ghislain and Charnay 2006). Brn2 belongs like Oct6 to the class III of POU proteins and both transcription factors are therefore thought to have similar biochemical properties. POU proteins of other sub- classes are more distinct, but also expressed in the Schwann cell lineage. Brn5 and Oct1 are two further members of the POU family present in Schwann cells and thus possibly involved in the activation of the MSE. But unlike Oct6 and Brn2, the distant relatives Brn5 and Oct1 did not activate the MSE in luciferase reporter gene assays (Fig. 3.26). This result confirmed previous findings of Ghislain and Charnay. Furthermore, the co-expression of Brn5 or Oct1, respectively, and Sox10 allowed the analysis of a possible synergism of these POU proteins with Sox10. Neither Brn5 nor Oct1 could increase the induction rate obtained with Sox10 alone (Fig. 3.26). These findings demonstrate that the synergism is specific to class III POU proteins just as much as the MSE activation by POU proteins alone.

50 3.2 The impact of the Sox10 transcription factor on the Krox20 MSE

Sox10 shares its biochemical properties with its close relatives Sox8 and Sox9 from the subgroup E. Therefore, their expression might have comparable effects on MSE activation. Indeed, Sox8 as well as Sox9 could transactivate expression from the MSE in luciferase reporter gene assays at least as efﬁciently as Sox10 (Fig. 3.26). In addition, all SoxE proteins had the same ability to act synergistically with Oct6. In contrast, Sox2, a member of the more distant subgroup B1, could neither activate the MSE on its own nor could it cooperate with Oct6 (Fig. 3.26). The additional presence of Sox2 did not change the induction rate observed with Oct6 alone. Activation of the MSE and synergism with POU class III proteins on the MSE is therefore unique to SoxE proteins.

FIG. 3.26 Specificity of the synergistic MSE activation. Transient transfection of S16 Schwann cells with a luciferase reporter under the control of the wildtype Krox20 MSE. A Luciferase activities were determined after co-transfection of empty vector (-), Oct6, Brn5 or Oct1 either alone (-) or in combination with Sox10 (+). B Luciferase activities were determined after co-transfection of empty vector (-), Sox10, Sox9, Sox8 or Sox2 either alone (-) or in combination with Oct6 (+). Data are presented as percentage of the synergistic transactivation of the wildtype MSE by Sox10 and Oct6 ± SEM. Statistically significant differences compared to the MSE activation by Sox10 (in A) or Oct6 (in B) alone were determined by one-way ANOVA with Tukey’s multiple comparison post-test (∗ ∗ ∗p ≤ 0.001 and ns, not significant, p > 0.05).

51 3 Results

3.2.5 Domain requirements for synergistic activation of the Krox20 MSE

The specific combination of SoxE proteins and class III POU proteins resulted in synergistic activation of the MSE enhancer. Conserved domains within these groups are supposed to account for this specificity and the capacity to synergize. Luciferase reporter gene assays with different partially deleted or mutated versions of Oct6 or Sox10 served to evaluate the involvement of different domains in transactivation and synergism. Oct6 contains a N-terminal transactivation domain and a bi-partite DNA-binding POU domain, composed of the POU specific domain POUS and the POU homeodomain POUHD (Fig. 3.27).

To analyze the requirement of these domains for synergistic activation of the MSE, S16 Schwann cells were transfected with the wildtype MSE reporter plasmid and different combinations of effectors. First, co-transfection of an expression plasmid encoding the respective mutated version of Oct6 alone studied the transactivation potential of the mutated Oct6 proteins. Then, additional co-transfection of a second expression plasmid encoding wildtype Sox10 allowed to evaluate the requirement of different Oct6 protein domains for the synergism with Sox10 (Fig. 3.27). The Oct6∆N protein, which lacks all amino acids N-terminally of the POU domain including the whole transactivation domain, could no longer activate the MSE on its own, but still synergized with Sox10. This was largely similar, when the C-terminal part of the protein was missing, which does not contain any known conserved domains. However, the Oct6∆C mutant protein retained a bit more transactivating capacity on its own, possibly because it still contains its transactivation domain. Thus, loss of the N-terminal transactivation domain as well as loss of the C-terminus weakened the synergism, but did not disrupt it. Loss of the whole POU domain (Oct6∆POU) or of one of its two subdomains, either the POU speciﬁc domain (Oct6∆POUS) or the POU homeodomain (Oct6∆POUHD), completely eliminated the transactivating activity of the POU proteins alone and in combination with Sox10. Expression of the WF-CS mutant (Oct6 WF-CS) yielded the same results. In this mutant, DNA binding is disrupted by a double amino acid substitution in the POU homeodomain. This interfered as much with synergistic activation as the complete deletion of the homeodomain or the POU domain. Interestingly, the POU domain alone after deletion of the N- and the C-terminus retained at least part of the capacity to synergize with Sox10, although this mutant was not able to activate the MSE in the absence of Sox10 because it lacks a transactivation domain. Thus, the POU protein transactivation domain proved to be required for activation of the MSE in the absence of Sox10, but is dispensable for

52 3.2 The impact of the Sox10 transcription factor on the Krox20 MSE the synergistic activity of Oct6. Synergism with Sox10 requires an intact POU domain, which turned out to be necessary and even sufﬁcient for synergism. The coreciprocal approach was chosen to investigate the role of different domains of Sox10. These include the dimerization domain, the DNA-binding HMG domain, the conserved K2 domain and the C-terminal transactivation domain (Fig. 3.28). Activation of the wildtype MSE reporter was measured in response to several mutated variants of Sox10 alone or in combination with wildtype Oct6 (Fig. 3.28). The mutation WS95 is found in Waardenburg-Hirschsprung patients and leads to disruption of DNA binding by

FIG. 3.27 POU protein domain requirements for synergistic MSE activation. A Schematic representation of Oct6 mutant proteins compared to wildtype Oct6. B Transient transfection of S16 Schwann cells with a luciferase reporter under the control of the wildtype Krox20 MSE. Luciferase activities were determined after co-transfection of empty vector (-), Oct6 or various mutants of Oct6 either alone (-) or in combination with Sox10 (+). Data are presented as percentage of the synergistic transactivation of the wildtype MSE by Sox10 and Oct6 ± SEM. Statistically signiﬁcant differences compared to the MSE activation by Sox10 alone were determined by one-way ANOVA with Tukey’s multiple comparison post-test (∗∗p ≤ 0.01, ∗ ∗ ∗p ≤ 0.001 and ns, not signiﬁcant, p > 0.05).

53 3 Results the insertion of two amino acids into the DNA-binding HMG domain. This mutant version of Sox10 could neither activate the MSE on its own nor could it cooperate with Oct6. The Q377X mutant had exactly the same outcome. This mutation generates a premature stop codon yielding a truncated Sox10 version, which lacks the C-terminal transactivation domain but retains an intact K2 domain. However, disruption of the Sox10 dimerization domain was not detrimental to activation of the MSE or synergism with Oct6, since the Sox10aa1 protein acted like wildtype Sox10, although its dimerization domain is not functional. In contrast, the K2 domain was necessary for synergistic activation of the MSE. Interestingly, the Sox10∆K2 protein retained the full capacity to activate the MSE on its own. Nevertheless, it could not efﬁciently synergize with Oct6. The luciferase assays allow therefore the conclusion that for synergistic activation of the MSE an intact HMG box is as much necessary as the transactivation domain and the K2 domain.

FIG. 3.28 Sox protein domain requirements for synergistic MSE activation. A Schematic representation of Sox10 mutant proteins compared to wildtype Sox10. B Transient transfection of S16 Schwann cells with a luciferase reporter under the control of the wildtype Krox20 MSE. Luciferase activities were determined after co-transfection of empty vector (-), Sox10 or various mutants of Sox10 either alone (-) or in combination with Oct6 (+). Data are presented as percentage of the synergistic transactivation of the wildtype MSE by Sox10 and Oct6 ± SEM. Statistically signiﬁcant differences compared to the MSE activation by Oct6 alone were determined by one-way ANOVA with Tukey’s multiple comparison post-test (∗ ∗ ∗p ≤ 0.001 and ns, not signiﬁcant, p > 0.05).

54 3.2 The impact of the Sox10 transcription factor on the Krox20 MSE

The differential requirement of the Sox10 K2 domain for activation of the MSE on its own as compared to synergism with Oct6 prompted a further analysis of this mutant. First, the ability of Sox10∆K2 to synergize with Brn2 instead of Oct6 was in the focus of interest. Brn2 could activate the MSE synergistically with wildtype Sox10, but not with the Sox10∆K2 mutant version (Fig. 3.29). This resembled the results observed with Oct6.

FIG. 3.29 The impact of the Sox10∆K2 mutation on MSE activation in combination with Brn2. Transient transfection of S16 Schwann cells with a luciferase reporter under the control of the wildtype Krox20 MSE. Luciferase activities were determined after co-transfection of empty vector (-), Sox10 or Sox10∆K2 either alone (-) or in combination with Brn2 (+). Data are presented as percentage of the synergistic transactivation of the wildtype MSE by Sox10 and Brn2 ± SEM. Statistically signiﬁcant differences compared to the MSE activation by Brn2 alone were determined by one-way ANOVA with Tukey’s multiple comparison post-test (∗ ∗ ∗p ≤ 0.001 and ns, not signiﬁcant, p > 0.05).

3.2.6 Interaction of Sox10 and Oct6

The possibility that Sox10 might interact with Oct6 or Brn2 via its K2 domain suggested itself in light of the preceding results. It is one possible scenario, that Sox10 could achieve the synergism with Oct6 and its close relatives by recruiting them to DNA via direct protein-protein interaction. But GST pulldown experiments with the isolated K2 domain incubated with Oct6 protein extracts could not conﬁrm this hypothesis. Puriﬁcation and western blot analysis of the GST-coupled protein complexes did not detect Oct6 bound to the K2 domain (Fig. 3.30). In contrast, the N-terminal 230 amino acids of Sox10 could interact with Oct6. This part of the Sox protein contains its HMG box, which is known to interact with other DNA-binding domains via its third α-helix and the directly adjacent amino acids. A direct protein-protein interaction between the isolated K2 domain and the Oct6 protein is therefore unlikely or not strong enough to be detected.

55 3 Results

FIG. 3.30 Binding of Oct6 to Sox10 protein domains. Extracts of transiently transfected 293 cells expressing Oct6 were incubated with GSH-Sepharose beads carrying immobilized GST or GST fusions with amino acids 1-230 of Sox10 or its K2 domain. Oct6 protein pulled-down with the beads was visualized by western blot with Oct6-speciﬁc antibodies.

3.2.7 The in vivo importance of the K2 domain for Krox20 expression

Since the K2 domain was involved in the synergistic activation of the MSE enhancer and the MSE enhancer regulated in turn Krox20 expression in myelinating Schwann cells, possible consequences of the K2 domain deletion in vivo were of interest. In this regard, the Sox10∆K2/∆K2 mouse mutant was the appropriate tool to get further insight. Schreiner et al. could show that in these mice Schwann cells along peripheral nerves induce expression of Oct6 correctly, but myelin gene expression does not occur. Immunohistochemical analyses of spinal nerves of mouse embryos at stage 18.5 dpc highlighted the importance of the K2 domain for proper Schwann cell development. The correct expression of Oct6 was not followed by the induction of Krox20 expression in Sox10∆K2/∆K2 mice. Thus, the failure of the Sox10∆K2 protein to synergize with Oct6 during activation of the MSE enhancer resulted in a loss of Krox20 expression in vivo (compare Fig. 3.31 A and D).

FIG. 3.31 Krox20 expression along spinal nerves of wildtype as compared to Sox10∆K2/∆K2 animals. Co-immunohistochemistry on transverse sections of wildtype (A–C) and Sox10∆K2/∆K2 (D–F) spinal nerves at 18.5 dpc with antibodies against Krox20 (A, D) (shown in red) and Sox10 (B, E) (shown in green). The merge is shown in C and F. Courtesy of Silke Schreiner and Stefﬁ Scholz.

56 3.2 The impact of the Sox10 transcription factor on the Krox20 MSE

3.2.8 The interdependence of Sox10 and Oct6 expression

The concerted activity of Sox10 and Oct6 is critically involved in Schwann cell development. Both transcription factors are expressed in the Schwann cell lineage, but with a different time course. Sox10 is expressed from the early neural crest cell stage, through all stages of Schwann cell development and into adulthood, whereas transient Oct6 expression peaks with the onset of myelination and declines subsequently (for review see Svaren and Meijer (2008)). It is obvious from the analysis of the hypomorphic Sox10 mutant aa1, that expression of Oct6 depends somehow on specific functions of Sox10. In this mutant, disruption of the ability of Sox10 to form dimers results in the loss of the activation of Oct6 expression in peripheral nerve Schwann cells (Schreiner et al. 2007). It is however not clear, how Sox10 regulates expression of Oct6. To address this question, electroporation of expression plasmids into the chicken neural tube was used to determine the interdependence of Sox10 and Oct6. The Sox10 or Oct6 coding sequence was inserted into the pCAGGS-IRES-nls-GFP plasmid, which drives expression under the control of the chicken β-actin promoter. Because of the IRES (internal ribosomal entry sequence) perceding the GFP sequence, GFP was not fused to Sox10 or Oct6, respectively, but was expressed as a separate protein in the same cells. Therefore, GFP fluorescent signal served to identify and trace electroporated cells. The non-electroporated side of the chicken neural tube provided an internal control and represented the wildtype situation. As further control, chicken neural tubes were electroporated with the GFP-expressing pCAGGS- plasmid without insert to exclude artefacts in consequence of the experimental procedure. Chicken embryos were analyzed at 24 hae (hours after electroporation) by immunohistochemical stainings. Electroporation of Sox10 or Oct6 resulted in overexpression of each of these proteins on the electroporated side of the neural tube. The absence of labeling at the non-electroporated side indicated that neither of the two proteins was endogenously expressed in the chicken neural tube at this stage. Sox10 was however present in migrating neural crest cells independent of electroporation. Furthermore, expression of GFP from the control vector did not influence Sox10 or Oct6 expression. When Oct6 protein was overexpressed in the chicken neural tube, no change in Sox10 expression could be observed. But in consequence of overexpression of Sox10, Oct6 expression was strongly upregulated. This upregulation was the most pronounced at 24 hae. Earlier at 12 hae, some electroporated neural tubes showed Oct6 immunoreactivity and others not (data not shown). This may be due to the fact that chicken embryos advance with a certain vari- ability in their development and induction of Oct6 expression may occur with some hours variance around stage 12 hae. The analysis of chicken neural tubes at 48 hae indicated that upregulation of Oct6 expression was only transient, since Oct6 was no longer detectable

57 3 Results at that stage (data not shown). With regard to the common role of Sox10 and Oct6 during the induction of Krox20 expression, both proteins were overexpressed in the chicken neural tube and expression of Krox20 was monitored. The co-electroporation of Sox10 and Oct6 expression plasmids was not sufﬁcient to induce expression of Krox20 in chicken neural tube cells (data not shown).

FIG. 3.32 Overexpression of Sox10 or Oct6 in the chicken neural tube. Co-immunohistochemistry on transverse sections of chicken embryos at 24 hae with antibodies against Oct6 (B, E) or Sox10 (H) (shown in red). Autoﬂuorescence of GFP (A, D, G) (shown in green) indicates the electroporated part of the neural tube. Chicken embryos were electroporated with pCAGGS- IRES-nls-GFP (A–C), pCAGGS-Sox10-IRES-nls-GFP (D–F) or pCAGGS-Oct6-IRES-nls-GFP (G–I). The merge is shown in C, F, I.

58 4 Discussion

4.1 SoxE proteins in the adrenal gland

4.1.1 The theory of the common sympathoadrenal precursor

In the structural hierarchy of the PNS, the adrenal medulla as a sympathetic paraganglion ranges at a position comparable with sympathetic chain ganglia, since both these struc- tures are directly innervated by pre-ganglionic cholinergic neurons. Furthermore, each of these tissues produces and stores catecholamines and secretes them in response to neuronal excitation. These functional similarities are reflected in the common origin from the neural crest, which also gives rise to numerous other derivatives of tremendous diversity. Therefore, questions of lineage segregation are of essential relevance during neural crest development. Several lines of evidence suggested that chromaffin cells and sympathetic neurons derive from the same progenitor population, which was therefore termed the sympathoadrenal lineage. Neural crest cells from the levels of somite 18–24, which give rise to chromaffin cells and also sympathetic neurons, migrate on the same route to the dorsal aorta and settle in the transient structure of the primary sympathetic ganglion chain (Douarin et al. 2004, Huber 2006). There, the SA cell population could be identified by co-expression of the chromaffin markers SA1–5 with the neuronal markers SCG10 and NF68 and the catecholaminergic marker TH (Anderson et al. 1991) indicating that pan- neuronal and catecholaminergic specification had occured. With ongoing development, SA cells would split into chromaffin cells, that express SA1–5, but downregulate neuronal markers, and into sympathetic neurons, that in turn lose expression of SA1–5 and gain more neuronal traits (Anderson 1993). Further differentiation was thought to depend on locally distinct environmental signals, which SA cells are exposed to during migration or at their final destinations. But more detailed examination of SA cells revealed the early heterogeneity of this population and challenged the hypothesis of the common progenitor for chromaffin cells and sympathetic neurons (Ernsberger et al. 2005).

59 4 Discussion

4.1.1.1 The early heterogeneity of the sympathoadrenal population

Expression analyses in chicken could detect that early in development the amount of neurofilament in TH-positive cells at the dorsal aorta is highly variable ranging from strong to barely detectable (Ernsberger et al. 2005). Furthermore, the hypothesized general downregulation of neuronal markers in future chromaffin cells was not observed in chicken. This points to the existence of a catecholaminergic progenitor population that never expresses neurofilament in substantial amounts and is therefore distinct from the sympatho- neuronal lineage already at very early stages (Ernsberger et al. 2005). In view of these results, it is probable, that the developing chromaffin cell and sympathetic neuronal lineages diverge prior to catecholaminergic differentiation, which then occurs independently in both cell lineages during or after migration (Huber et al. 2009). The present study strengthens the observation that neural crest cells near the dorsal aorta are not a homogeneous population. At stage 12.5 dpc in mouse, when Sox10- and p75-positive neural crest cells joined the migratory stream towards the adrenal anlagen, they did not uniformely express the catecholaminergic markers Phox2b and TH. Instead, some of the Sox10-positive cells obviously did not express Phox2b at the dorsal aorta or in the adrenal anlagen, whereas others showed a clear co-labelling. This suggests that neural crest cells in primary sympathetic ganglia had only partially adopted a catecholaminergic identity. A possible explanation for this heterogeneity might be, that some of the cells are more advanced in their differentiation process than others and that catecholaminergic specification is still ongoing near the dorsal aorta at that early stage. But catecholaminergic specification is rather unlikely to finally occur in all neural crest cells at the dorsal aorta, because some of the Sox10-positive cells had immigrated into the adrenal anlagen and did still not express Phox2b. Accordingly, the cell population inside the adrenal medulla was still quite heterogeneous, ranging from p75-positive neural crest cells in a precursor state to cells expressing TH in the differentiation process. Chromaffin cells downregulated Sox10 during the phase of Phox2b expression or as soon as they started to express TH. Thus, the existence of Sox10- and p75-positive, but TH-negative cells in the adrenal medulla indicated that at least some neural crest cells had reached the adrenal gland as undifferentiated precursors. The fact that there were still Sox10-expressing cells in the adrenal medulla at 18.5 dpc, which lacked expression of differentiation markers, corroborates the idea of migration in an undifferentiated state. To date, it is not completely clear how long and if at all chromaffin and sympatho- neuronal progenitors constitute the common, bipotential population of SA cells. The present data argue for an early lineage segregation, because neural crest cells near the dorsal aorta are rather distinct than uniform from early on. Future chromaffin cells migrate

60 4.1 SoxE proteins in the adrenal gland mostly as undifferentiated cells into the adrenal gland suggesting that catecholaminergic differentiation occurs afterwards under the inﬂuence of local signals. Most likely neural crest cells become committed to the chromafﬁn fate at the dorsal aorta or even before, but depend on further signals during or after migration to the adrenal anlagen in order to complete their differentiation.

4.1.1.2 The role of Sox10 before lineage segregation

Constitutive or conditional deletion of genes involved in the development of SA cells hits in general both, the chromaffin and the sympatho-neuronal population. Comparing the outcome of both lineages allows a better understanding of differences between these cells. In some knockout studies, the divergence of the phenotypes of chromaffin cells and sympathetic neurons becomes apparent so early, that the hypothesis of a common SA progenitor is unlikely. In Mash1-deficient mice, the adrenal medulla is reduced to 30% of wildtype levels. Most of the chromaffin cells arrest in an immature state and die eventually (Huber et al. 2002). In contrast, although neurons in sympathetic ganglia remain longer in the early neuroblast stage and express pan-neuronal as well as subtype-specific genes behind schedule, they finally recover (Pattyn et al. 2006). Insm1-deficient animals similarly exhibit distinct phenotypes for the two cell populations. The number of sympathetic neurons is decreased due to reduced proliferation. Nevertheless, remaining cells in the secondary sympathetic ganglia mature correctly, but delayed, whereas chromaffin cells are reduced to 40% compared to wildtype (Wildner et al. 2008). The loss of Phox2b affects sympathetic neuronal development even stronger than chromaffin cells, since sympathetic ganglia are completely lost by 13.5 dpc, while at least some chromaffin cells survive until 16.5 dpc, albeit in a very immature state (Pattyn et al. 1999, Huber et al. 2005). The different impact of these transcription factors on the development of sympatho-adrenal as compared to sympatho-neuronal cells indicates that these factors exert part of their functions at a stage, when the two lineages are already distinct. In contrast to these phenotypes, loss or mutation of Sox10 had the same consequences for chromaffin cell or sympathetic neuron development, at least at the rostro-caudal level under study. Thus, both lineages are probably not yet separate during the period of Sox10 action, which is therefore assumed to precede lineage segregation. This is in line with the fact, that Sox10 is already expressed before the other transcription factors and might act upstream. The analysis of the conditional DBH-Cre-mediated loss of Sox10 also pointed to an early role of Sox10 during chromaffin cell development. Deletion of Sox10 in DBH- expressing and therefore differentiated chromaffin cells did not impair development of the

61 4 Discussion adrenal medulla. This proves that differentiated chromafﬁn cells do not require Sox10 for their maintenance, in contrast to the absolute requirement of Sox10 during early phases of neural crest and SA cell development.

4.1.2 The impact of Sox10 and its domains on adrenal chromaﬃn cell development

The present analysis focused on the role of SoxE transcription factors during chromaffin cell development. Sox8 and Sox10 expression was maintained in neural crest cells that gave rise to chromaffin cells, whereas Sox9 was not expressed in SA cells or chromaffin cells and therefore not involved in the formation of the adrenal medulla. Loss of Sox10 was not compatible at all with the generation of chromaffin cells demonstrating the essential requirement of the presence of Sox10. At the end of embryonic development, Sox10-deficient animals lacked the entire adrenal medulla, whereas cortex development was unaffected. This reflects the different sites of origin of adrenal medulla and cortex. Already at day 12.5 dpc of mouse embryogenesis, SA cells migrating into the adrenal anlagen were completely missing in Sox10lacZ/lacZ mice arguing for an early developmental defect. Indeed, neural crest cells at the dorsal aorta disappeared between 11.5 dpc and 12.5 dpc due to an enormous increase in apoptosis in the absence of Sox10. Since chromaffin cell progenitors were lost that early, further factors of the transcriptional network regulating catecholaminergic differentiation like Hand2 or Gata2/3 were not analyzed. Sox10dom/dom mice were the first Sox10 mutants with a reported absence of an adrenal medulla (Kapur 1999). The spontaneous dom-mutation in the mouse Sox10 gene results in a truncated Sox10 protein, whose dimerization and DNA-binding domains are intact (Herbarth et al. 1998, Southard-Smith et al. 1998). Therefore, the phenotype of these mice could be ascribed to a dominant-negative effect of the truncated protein. Sox10-dom protein could compete with the closely related co-expressed Sox8 protein for DNA binding sites or it could dimerize with Sox8. This dominant-negative activity would prevent Sox8 from being fully functional. But the Sox10lacZ/lacZ phenotype was comparable with the phenotype of Sox10dom/dom mice. Obviously, loss of Sox10 is sufficient to completely disrupt chromaffin cell development without any dominant-negative effects on co-expressed Sox proteins. This corroborates results of a comparison of Sox10+/dom and Sox10+/lacZ mice. A recent study demonstrated that there was no difference in chromaffin cell development between both heterozygous mutants (Cossais et al. 2010). Neither the phenotype of mutant mice pointed to a dominant-negative activity of the Sox10dom protein nor did electroporation of Sox10dom into the chicken neural tube. The analysis of the binding properties of Sox10dom protein to high-affinity Sox consensus sites revealed that it is sev-

62 4.1 SoxE proteins in the adrenal gland erley impaired in its binding activity. Therefore, the Sox10dom protein is not in general acting dominant-negatively. There is rather a dominant-negative activity restricted to the enteric nervous system, where the defects of Sox10+/dom mice are more severe than those of Sox10+/lacZ mice (Cossais et al. 2010). Two domains of the Sox10 protein proved to be essentially involved in the implemen- tation of the functions of Sox10 – the dimerization domain and the conserved K2 domain. Mice with mutation or deletion of one of these domains show hypomorphic phenotypes since they exhibit only part of the defects observed in mice with a Sox10 null mutation (Schreiner et al. 2007). The requirement of these domains varies substantially among the diverse tissues expressing Sox10. As sympathetic ganglion development, which is closely related to chromaffin cell development, was shown to be only mildly affected in both these mutants at rostral levels (Schreiner et al. 2007), it was rather unexpected that adrenal glands of these mice harbored only few residual chromaffin cells at 18.5 dpc. In addition, sympathetic ganglia were equally affected, when examined at the rostro-caudal level of the adrenal gland (see 4.1.5). Deletion of the conserved K2 domain was even more deleterious than disruption of the dimerization domain. In Sox10lacZ/lacZ mice, it was not feasible to unravel a possible involvement of Sox10 in later developmental steps because of the complete and early loss of neural crest cells at the dorsal aorta. The milder phenotypes of both hypomorphic mouse mutants potentially allowed to address this question. Residual chromaffin cells differentiated properly in both mutants indicating that neither the dimerization nor the K2 domain did mediate functions of Sox10 during later steps of specification or differentiation. Rather both domains were primarily involved in early survival of neural crest cells at the dorsal aorta, since the reduction of the chromaffin cell population in the hypomorphic mutants was already evident at 12.5 dpc. Development and migration of neural crest cells in the hypomorphic mutants are thought to be unal- tered at least until 11.5 dpc (Schreiner et al. 2007). Thus, neural crest cells giving rise to the adrenal gland may be lost by apoptosis at 11.5 dpc. Nevertheless, the number of cells joining the migratory stream seemed to be reduced ab initio. Therefore, a detailed re-examination of neural crest cell migration might be of interest, not least in light of the fact that some of the defects change gradually along the rostro-caudal level (see 4.1.5).

4.1.3 Functional redundancy between SoxE proteins

In contrast to the severe phenotypes upon deletion or mutation of Sox10, loss of Sox8 was without consequence on the development of the adrenal medulla. At early as well as late stages, Sox8-deﬁcient chromafﬁn cells were not distinct from wildtype cells, neither in their number nor in the expression of differentiation markers. It may be the consequence

63 4 Discussion of a somehow unidirectional redundancy between the functions of Sox8 and Sox10 that the loss of Sox8 did not affect adrenal development.

Co-expression of Sox proteins with similar biochemical properties accounts for functional redundancy that is frequently observed among members of the same subgroup. The SoxE proteins Sox8 and Sox10 were in general co-expressed during adrenal gland development. However, their expression was not identically regulated. Both proteins were expressed in migrating neural crest cells and during early stages of adrenal development and were downregulated in the phase of Phox2b expression as soon as the cells started to differentiate. But there was a cell population that sustained Sox10 expression at least until 18.5 dpc (see 4.1.6.2), whereas Sox8 expression faded around 14.5 dpc in adrenal glands. Prolonged expression of Sox10 compared to Sox8 ﬁts the observation of the severe phenotype in the absence of Sox10, whereas Sox8 was largely dispensable for chromafﬁn cell development.

In this regard, it was important to analyze the interdependence of Sox10 and Sox8 expression. At stage 12.5 dpc, the Sox10 deficiency in Sox10lacZ/lacZ mice came along with the loss of Sox8 expression at the dorsal aorta. But since the whole neural crest derived cell population was already lost at that stage as monitored by the absence of β-galactosidase-expressing cells, no conclusion on the mutual regulation of Sox10 and Sox8 could be drawn. The analysis of the situation at the early stage 10.5 dpc led to the finding, that induction of Sox8 expression required Sox10. In Sox10lacZ/lacZ animals, surviving early neural crest cells identified by the expression of β-galactosidase were Sox8-negative, in contrast to the corresponding cells in wildtype animals. Therefore, Sox8 could not compensate for the loss of Sox10 because its expression was dependent of Sox10 and never properly induced. Sox10 expression on the other hand was independent of Sox8 in the adrenal gland as evident by its regular expression in the absence of Sox8 at 12.5 dpc and at 18.5 dpc. Since loss of Sox8 did not impair the generation of an adrenal medulla and left Sox10 expression unaffected, Sox8 had either no major functions during chromaffin cell development or its absence was substituted by a redundantly functioning Sox10.

That Sox8 had at least some impact on chromaffin cell development was obvious by the consequences of the loss of Sox8 in a Sox10 heterozygous background. In this compound mutant, the reduction of the chromaffin cell population was not drastic, but nevertheless apparent. As Sox10 heterozygous animals had normal adrenal glands, the decrease in the number of chromaffin cells in Sox10+/lacZ Sox8lacZ/lacZ mice was attributed to the additional loss of Sox8. The phenotype of these compound mutant mice in the adrenal gland resembled the situation in the enteric nervous system and in oligodendrocytes (Stolt

64 4.1 SoxE proteins in the adrenal gland et al. 2004, Maka et al. 2005). However unlike the adrenal medulla, both these tissues were sensitive to haploinsufficiency and showed some defects upon heterozygous loss of Sox10. In the enteric nervous system, aganglionosis of the colon of Sox10+/lacZ mice was strongly aggravated upon the additional loss of Sox8. This was attributed to increased apoptosis in pre-migratory vagal neural crest cells (Maka et al. 2005). The combined activity of Sox8 and Sox10 is not only important for survival, but also involved in terminal differentiation as seen in oligodendrocytes of the CNS. In this tissue, Sox8 deficiency in a Sox10 heterozygous background delayed terminal differentiation more than each of the single mutations (Stolt et al. 2004). In the adrenal medulla, the reduced number of chromaffin cells in compound mutant mice is rather attributed to reduced survival than to impaired differentiation as evident from the proper expression of differentiation markers.

The analysis of the Sox10Sox8ki/Sox8ki mouse mutant, which expressed Sox8 under the regulatory elements of Sox10, directly addressed the question, whether Sox8 was able to fully replace Sox10. In the diverse cell types depending on Sox10 during their development, the potential of Sox8 to functionally replace Sox10 was tissue-specific and rescue of development varied from none to complete (Kellerer et al. 2006). With regard to SA cell development, Sox8 could partially fullfil the functions of Sox10. Although Sox10Sox8ki/Sox8ki animals were Sox10-deficient just like Sox10lacZ/lacZ animals, expression of Sox8 in a Sox10-like pattern rescued 50% of the chromaffin cell population. These residual chromaffin cells were fully differentiated and did not show any obvious defect. The fact that the number of chromaffin cells was reduced, but differentiation was unaffected in this mouse model proved that Sox8 could replace all the functions of Sox10, but not with the same efficiency. Therefore, the different impact of Sox10 and Sox8 on adrenal gland development is more attributed to differential regulation, which might not only include gene-regulatory DNA elements but also protein interactions, than to dissimi- lar functions per se.

Recently, a comparable replacement strategy was used to characterize the Drosophila SoxE ortholog Sox100B regarding its potential to exert functions of Sox10 (Cossais et al. 2010a). In neural crest cells of the SA lineage, Drosophila Sox100B replaces Sox10 as efficient as mammalian Sox8 and it supports chromaffin cell development even more than the hypomorphic Sox10 mutant alleles. This high degree of functional conservation is sur- prising in light of the fact that Drosophila have no neural-crest like cells at all. However, comparable to the knock-in of Sox8, knock-in of Sox100B rescued the development of Sox10-expressing tissues with more or less efficiency depending on the cell type (Kellerer et al. 2006, Cossais et al. 2010a).

65 4 Discussion

4.1.4 The importance of Sox10 for neural crest cell survival

Increased cell death of Sox10-deficient neural crest stem cells in culture demonstrated that Sox10 is required for the survival of undifferentiated migratory and postmigratory neural crest cells in vitro (Paratore et al. 2001). This survival function is probably mediated by neuregulin-1, which serves as a survival factor for wildtype cells in culture. In the absence of Sox10, neuregulin-1 is no longer able to ensure cell survival. Sox10 supports survival probably by regulating expression of ErbB3, the receptor for neuregulin-1 (Paratore et al. 2001). Maintenance of ErbB3 expression, which is required for proper migration, survival and differentiation of neural crest cells, depends critically on the presence of Sox10 (Britsch et al. 1998, 2001). In line with these observations, the analysis of Sox10dom/dom mice revealed increased apoptosis as the major reason for the developmental defects in these mice (Kapur 1999). Similarly in Sox10lacZ/lacZ mice, neural crest cells of the SA lineage were lost by apoptotic cell death, before they could immigrate into the adrenal anlagen and before differentiation, indicating that Sox10 is of special importance for survival at early stages. By 12.5 dpc, all SA cells near the dorsal aorta were lost in the absence of Sox10 due to increased apoptosis through 10.5 dpc and 11.5 dpc. Probably, apoptosis occured even earlier in this region considering the reduced number of β-galactosidase-positive cells already at 10.5 dpc in Sox10lacZ/lacZ animals compared to wildtype animals. Accordingly, cell death in cultures of Sox10-deficient neural crest cells occured before lineage segregation (Paratore et al. 2001). Thus, a major function of Sox10 is to ensure survival of neural crest derived cells even before the acquisition of a chromaffin identity. This explains also why both, adrenal chromaffin cells and sympathetic ganglion cells, are absent in Sox10-deficient animals, although both lineages may diverge quite early during development (see 4.1.1). The critical period for the survival function of Sox10 seems to precede lineage segregation.

Loss of only one Sox10 allele had different consequences on neural crest stem cell survival. In culture, survival of Sox10+/lacZ neural crest stem cells was not sensitive to reduced levels of Sox10 (Paratore et al. 2001). This was confirmed in vivo, since heterozygous loss of Sox10 in mice did not affect survival of neural crest cells colonizing the gut, although maintenance of the progenitor state and migration were impaired (Paratore et al. 2002). In line with this, increased apoptosis upon loss of one Sox10 allele was only observed in neural crest cells at an earlier stage before colonization of the gut (Maka et al. 2005). This demonstrates that the different functions of Sox10 are not equally sensitive to alterations in Sox10 levels. Accordingly, heterozygous loss of Sox10 did not affect SA cell development confirming that the reduced dosage of Sox10 was sufficient to support survival of the cells. Since haploinsufficiency of Sox10 did not account for

66 4.1 SoxE proteins in the adrenal gland increased cell death, a more extensive reduction of the overall SoxE protein dosage was analyzed. The Sox10+/lacZ Sox8lacZ/lacZ compound mutant had effectively lost expression from three out of four SoxE alleles, since only Sox8 and Sox10, but not Sox9, were expressed during chromafﬁn cell development. The resulting reduction of the adrenal medulla by about 30% indicated that the amount of SoxE proteins in total was a critical parameter for cell survival. The analysis of the Sox10Sox8ki allele addressed this issue in the same aspect. In Sox10Sox8ki/Sox8ki animals, Sox8 is expressed from four alleles, whereas Sox10 is completely missing. However, despite the presence of four intact alleles for SoxE protein expression, the loss of chromafﬁn cells was even more pronounced than in the compound mutant with only one allele of Sox10. This indicates that dosage of SoxE protein is not the only decisive parameter. Sox10 is obviously more potent in ensuring cell survival than is Sox8.

4.1.5 The rostro-caudal gradient of Sox10 importance

Remarkably, the impact of Sox10 on sympathetic ganglion development is subject to a rostro-caudal gradient. Loss of Sox10 protein in Sox10lacZ/lacZ mice or loss of its function in Sox10dom/dom mice results in hypoplasia of sympathetic ganglia increasing in severity from rostral to caudal up to the complete absence of a sympathetic ganglion chain (Herbarth et al. 1998, Kapur 1999). The present study focused for the first time on the analysis of sympathetic ganglion development in the caudal part of the embryo exactly at the trunk level of the adrenal gland. The complete loss of all markers indicative of sympathetic ganglia, which was observed in Sox10-deficient animals at adrenal gland levels, was in line with the reported caudally increasing severity of the hypoplasia of sympathetic ganglia (Kapur 1999). Normally developed Sox10+/lacZ ganglia demonstrated that this tissue is not prone to haploinsufficiency. Even in combination with a loss of Sox8, which had itself no consequences on sympathetic chain development, ganglion size was only slightly reduced. The phenotypes observed after mutation or replacement of Sox10 dif- fered from previously reported results, which were however gained from analyses at more rostral levels. Rostral sympathetic ganglia exhibited no obvious defects in Sox10aa1/aa1 or Sox10∆K2/∆K2 animals and only a slight size reduction in Sox10Sox8ki/Sox8ki animals (Kellerer et al. 2006, Schreiner et al. 2007). In all these mutants, sympathetic ganglia were more severely affected, when analyzed at adrenal gland levels. This is not contradictory, but in line with the gradient observed after the complete loss of Sox10. This gradient could in part be based on a slightly different cellular composition of rostral as compared to caudal ganglia. If the glial fraction was increased relatively to the number of neurons in caudal ganglia, loss or mutation of Sox10 could be more deleterious at these levels,

67 4 Discussion since Sox10 is of special importance for glial cell development. But to conﬁrm this, it would be necessary to quantify ganglionic cell types at different rostro-caudal levels and stages. In light of these regional distinct phenotypes, it is important to be aware of the level analyzed, espacially when chromafﬁn cell and sympathetic ganglion development is compared.

4.1.6 The interplay of BMPs, Sox10 and Mash1/Phox2b

4.1.6.1 BMPs during early development

When neural crest cells arrive at the dorsal aorta, BMPs expressed and secreted from endothelial cells induce important steps of SA cell development (Shah et al. 1996). In chicken, experimental administration of the BMP inhibitor noggin caused the loss of TH and DBH expression in neural crest derived cells. This loss was accompanied by the downregulation of the chicken Mash1 orthologue, but let Sox10 expression largely unal- tered (Schneider et al. 1999). Vice versa, addition of BMP2 to cultured neural crest stem cells upregulated Mash1 and Phox2b, followed by the expression of TH and DBH (Reiss- mann et al. 1996, Shah et al. 1996, Lo et al. 1999, Kim et al. 2003). Notably, induction of Mash1 expression by BMP2 in vitro required the preceding presence of Sox10 (Kim et al. 2003). If before the administration of BMP2, the neural crest stem cells had lost Sox10 expression due to the culturing conditions, BMP2 could no longer induce Mash1. Similarly, Sox10 required the presence of BMP2 to activate Mash1 expression and was not sufficient to do so in the absence of BMP2. Comparable observations were made regarding Phox2b. This suggests, that BMP2 can induce expression of Mash1 and Phox2b in neural crest stem cells in combination with endogenous Sox10. Accordingly, this study shows that BMPs from the dorsal aorta were not able to induce notable expression of Phox2b in a Sox10-deficient environment. At stage 10.5 dpc, neural crest derived cells had still survived at the dorsal aorta as detected by the expression of β-galactosidase, but they failed to induce expression of Phox2b. This confirms the loss of Phox2b as observed in neural crest cells at the dorsal aorta of Sox10dom/dom mutant mice (Kim et al. 2003). Secretion of BMPs from the dorsal aorta was not monitored in the present study, but there is no reason to suspect a downregulation of BMPs in consequence to the loss of Sox10. Expression of BMPs in endothelial cells of the dorsal aorta is spatiotemporally separated from Sox10 expression in neural crest cells, which argues against an effect of Sox10 on BMP expression in this context. In vivo, Phox2b and Mash1 are only transiently co-localized with Sox10, which is subsequently downregulated (this study and Kim et al. (2003)). In neural crest cell cul-

68 4.1 SoxE proteins in the adrenal gland tures, downregulation of Sox10 occurs in response to BMP2 or upon overexpression of Phox2b or Mash1, respectively (Kim et al. 2003). Interestingly, BMP2 activates expression of Mash1 and Phox2b resulting in a downregulation of endogenous Sox10, which was needed before for the activation. It is a possible scenario in vivo, that Sox10-positive neural crest cells arriving at the dorsal aorta become exposed to BMPs, which induce expression of Phox2b and Mash1. BMPs depend thereby on the permissive role of Sox10, which is thus necessary, but not sufﬁcient for Mash1 and Phox2b induction. Subsequently, Sox10 is downregulated by the BMPs and by the negative feedback of Phox2b and Mash1, because it is not necessary for their maintenance. One function of Sox10 might therefore be to preserve the competence of neural crest cells to become induced to a catecholaminergic fate. It is however not clear, if Sox10 acts directly on the expression of Phox2b and Mash1 or rather by establishing a permissive environment (see Fig. 4.1).

FIG. 4.1 BMPs and Sox10 inducing the catecholaminergic phenotype.

4.1.6.2 BMPs during late development

Recently, Huber et al. showed that BMP4 is continuously expressed by chicken adreno- cortical cells, which surround chromaffin cells. In contrast, it is hardly detectable in sympathetic ganglia or on the migration route to there (Huber et al. 2008). This demonstrates the exposure of developing sympathetic neurons and chromaffin cells to different envi- ronments and may reflect a distinct requirement of BMP signaling. In chromaffin cells, BMP4 was able to induce expression of TH and thus catecholaminergic differentiation. It may act in the same way as BMPs from the dorsal aorta, but later during or after migration (Huber et al. 2008). Therefore it is possibly of special importance for the Sox10-positive

69 4 Discussion progenitors in the adrenal gland that were still present at 18.5 dpc, because it can locally induce their catecholaminergic specification and differentiation. As long as these cells express Sox10, they may possess the competence to be induced to a catecholaminergic fate by BMPs. Thus, these progenitors could represent a precursor pool that regularly replaces older chromaffin cells, in case this population had a certain turnover rate. Alternatively, adrenal medullary development may not be completed until 18.5 dpc and residual Sox10- positive cells would differentiate under the influence of cortical BMP4 to finish formation of the adrenal medulla. In this respect, the analysis of adult adrenal glands will give further insight. Somehow contradictory, a recent investigation of a neural crest specific disruption of canonical BMP signaling showed that Mash1-, Hand2- and TH-expression in sympathetic ganglia is preserved in the absence of Smad4-mediated BMP signaling. BMP signals were rather required for neuronal proliferation in ganglia than for differentiation (Büchmann-Møller et al. 2009). On first sight this contradicts the reported requirement of BMPs for the induction of autonomic neuronal differentiation. Possibly, induction of autonomic marker expression is mediated by Smad4-independent non-canonical BMP signaling and therefore not affected upon disruption of canonical Smad4 (Büchmann-Møller et al. 2009).

In summary, SoxE transcription factors were shown to be involved in adrenal chromaffin cell development. Whereas Sox8 is only of minor importance, Sox10 proved to be indispensable for the proper generation of an adrenal medulla. So far, two major functions of Sox10 were unraveled: i) Sox10 acts as a survival factor in early neural crest cells before the segregation of sympatho-adrenal and sympatho-neuronal cell lineages. ii) Sox10 preserves the potential of neural crest cells to be induced to a catecholaminergic fate. Thus, Sox10 was shown to be a major component of the transcriptional network regulating catecholaminergic differentiation together with Mash1, Phox2b, Insm1, Hand2 and Gata2/3. But Sox10 is the only factor that disrupted chromaffin cell development even before the immigration into the adrenal anlagen. In contrast, deletion of each one of the other factors allowed at least the generation of some immature chromaffin cells. This places Sox10 upstream of this transcriptional network, which it might regulate directly or indirectly toghether with BMPs and further unknown factors.

70 4.2 Sox10 in myelinating Schwann cells

4.2 Sox10 in myelinating Schwann cells

4.2.1 The role of Sox10 during myelination

Sox10 is considered to be one of the major regulators of glial cell development in the central and in the peripheral nervous systems (for review see Stolt and Wegner (2010)). Two major glial populations, namely oligodendrocytes of the central nervous system (CNS) and Schwann cells of the peripheral nervous system (PNS), are similar in their function to myelinate axons. Nevertheless, they arise from different origins, pass through unique developmental steps and achieve myelination in rather distinct ways. Furthermore, both types of glia have in common the requirement for Sox10 during their development, but rely on Sox10 in completely different contexts. In oligodendrocytes, the most important function of Sox10 concerns terminal differentiation (Stolt et al. 2002). The impact of Sox10 on myelinogenesis by oligodendrocytes is well-documented. In the absence of Sox10, oligodendrocyte precursor cells develop properly until terminal differentiation should occur. But their failure to mature then results in the lack of myelination in the CNS of Sox10-deficient mice. Accordingly, Sox10 is kown to be directly involved in transcriptional regulation of the myelin genes MBP (myelin basic protein) and Connexin-47 (Stolt et al. 2002, Schlierf et al. 2006). Even more than in the CNS, Sox10 is required for peripheral gliogenesis including Schwann cell generation. Expression of Sox10 spans the whole life of a Schwann cell, from the neural crest precursor to the adult Schwann cell (Kuhlbrodt et al. 1998). From the phenotypes of Sox10lacZ/lacZ or Sox10dom/dom mice, it was obvious that Sox10 must be involved in fundamental steps of glial development, because these Sox10-deficient mouse mutants lack all peripheral glial cells (Herbarth et al. 1998, Southard-Smith et al. 1998, Britsch et al. 2001). The loss of the peripheral glial cell population already during specification in the absence of Sox10 impeded the analysis of a possible involvement of Sox10 in later stages of peripheral glial development. But per- sisting expression of Sox10 into adulthood suggested that it might exert further functions at later stages as known for oligodendrocytes in addition to its role during specification. One of these functions is the direct regulation of expression of the peripheral myelin protein P0 in myelinating Schwann cells (Peirano et al. 2000). The analysis of two mouse mutants with hypomorphic phenotypes resulting from Sox10 gene mutation instead of deletion allowed to get insight into the order of events after glial specification (Schreiner et al. 2007). In both these hypomorphic mutants, myelin proteins fail to appear along peripheral nerves. The aa1 mutant lacks the ability to form Sox10 dimers due to a triple alanine substitution in the dimerization domain. In this mutant, Schwann cells are generated along peripheral nerves, but they arrest in an immature stage. Expression of Oct6,

71 4 Discussion which is characteristic for the transition to the pro-myelinating stage, fails to be induced (Schreiner et al. 2007). This points to a role of Sox10 in the induction of Oct6 protein expression. Indeed, there is a regulatory element, the Schwann cell enhancer SCE downstream of the Oct6 gene, which contains several Sox protein binding sites (Mandemakers et al. 2000, Svaren and Meijer 2008). Activation via these binding sites may require an intact dimerization domain for cooperative binding of two Sox10 molecules. Overex- pression experiments shown in this study corroborate the strong impact of Sox10 on the expression of Oct6. In-ovo-electroporation of chicken embryos with Sox10 expression plasmids indicated that Sox10 might even be sufficient to induce Oct6. Sox10 overexpression in the chicken neural tube at least led to an upregulation of Oct6 in a tissue, where it is normally not expressed. This regulation was unidirectional since overexpressed Oct6 could not induce Sox10. The other hypomorphic mutant lacks the K2 domain, a conserved domain in the central part of the protein. This mutation derails Schwann cell development slightly later than the disruption of the dimerization domain. Mutant Schwann cells enter the pro-myelinating Schwann cell stage with proper expression of Oct6, but nevertheless fail to initiate myelination (Schreiner et al. 2007). The present study addressed for the first time the question of Krox20 expression in the Sox10∆K2 mutant, because loss of Krox20 expression is incompatible with a proper onset of myelination (Topilko et al. 1994). Interestingly, Schwann cells along peripheral nerves of Sox10∆K2/∆K2 animals did not express Krox20. This was rather unexpected, since expression of Oct6 was unaffected in these mutants. Oct6 is known to be critically involved in the activation of Krox20 expression in myelinating Schwann cells (Ghislain et al. 2002). This transcriptional regulation is mediated by the MSE enhancer, a cis-regulatory element, which was shown to be activated by Oct6 together with Sox10 and NFATc4 in vitro (Ghislain and Charnay 2006, Kao et al. 2009). The observed loss of Krox20 expression in a Sox10 mutant mouse model confirmed that activation of MSE-driven Krox20 expression depends on the presence of a fully functional Sox10 protein not only in vitro, but also in vivo. Obviously, the mutant Sox10 protein was not able to induce Krox20 expression in combination with Oct6. This is unlikely the consequence of a reduced expression level or of decreased protein stability of the Sox10∆K2 protein, since both parameters were shown to be comparable with wildtype Sox10 (Schreiner et al. 2007). Rather it is ascribed to a loss of function of Sox10 in this tissue. Thus, Sox10 and its K2 domain proved to be essential for the transition from the pro-myelinating to the myelinating Schwann cell stage and in particular for expression of Krox20 (this study and Schreiner et al. (2007)). Oct6, NFATc4 and Sox10 are the three known factors whose activity converges on the MSE to induce expression of Krox20. Mutation or deletion of each of these tran-

72 4.2 Sox10 in myelinating Schwann cells scriptional regulators were examined to highlight the events during transition from the immature Schwann cell stage through the pro-myelinating and ﬁnally to the myelinating stage. Loss of functional Oct6 protein results in a transient arrest in the pro-myelinating stage, which is eventually overcome (Jaegle et al. 1996, Bermingham et al. 1996). The observed delay in myelination is unlikely to result from a general loss of Krox20 expression because myelination is thought to be completely inhibited in the absence of Krox20 (Topilko et al. 1994). Krox20 might rather be reduced or activated behind schedule. However, the amount of Krox20 expression was not monitored in the respective Oct6- deﬁcient animals. Similarly, inactivation of NFATc4 in Schwann cells of mice leads to a reduced expression of myelin structural proteins. In this mutant, the concomitant diminished Krox20 expression in Schwann cells was shown (Kao et al. 2009). Neither loss of Oct6 nor of NFATc4 function leads to a complete loss of Krox20 expression. Sox10, the third factor acting on the MSE, proved to be the only one that is indispensable for Krox20 expression in Schwann cells. The present analysis of Sox10∆K2/∆K2 mutant mice demonstrates the complete absence of Krox20 expression along peripheral nerves of 18.5 dpc mice, although expression of Oct6 was not affected. Therefore, Sox10 seems to exert a particularly important function among the factors acting on the MSE. However, it can not be excluded that expression of Krox20 might eventually recover, as an analysis beyond birth was not possible due to the perinatal death of Sox10∆K2/∆K2 animals.

In a larger context, there are several further hints, that Sox10 is implicated in the regulation of myelination at a higher hierarchical level than Oct6 and NFATc4. The involvement of NFATc4 relates the activation of Krox20 expression to neuregulin-1 signaling. ErbB2- ErbB3 receptor complexes on Schwann cells translate neuregulin-1 signals via different downstream pathways, which are each implicated in different effects of neuregulin-1 during Schwann cell development (Jessen and Mirsky 2005). One of these signaling cascades results in the nuclear translocation of NFATc4 (see 1.1.2.2). It was already known that neuregulin-1 is a positive regulator of myelin sheath thickness (Garratt et al. 2000). With the recent discovery that NFATc4 is directly involved in the activation of Krox20 expression (Kao et al. 2009) the mechanism behind the relation of neuregulin-1 and myelination becomes clearer. Sox10 is also related to neuregulin-1 signaling because it is necessary for proper expression of ErbB3 receptors (Britsch et al. 2001, Kim et al. 2003). Taken together, Sox10 is likely to be involved in the activation of Oct6 expression (Svaren and Meijer 2008) and it is known to be necessary for Erb3 expression (Britsch et al. 2001), which in turn is needed for NFATc4 activation (Kao et al. 2009). Therefore, Sox10 en- sures the availability of Oct6 and NFATc4, before it interacts with these factors during the activation of the Krox20 MSE enhancer to promote myelination (see Fig. 4.2).

73 4 Discussion

FIG. 4.2 Sox10 and the activation of Krox20 expression. Solid lines indicate direct or indirect transcriptional activation, dashed lines mark signaling cascades involved in the activation of the MSE enhancer. Modiﬁed from Stolt and Wegner (2010).

4.2.2 Synergistic activation of Krox20 expression

The simultaneous action of Sox10, Oct6 and NFATc4 on the Krox20 MSE enhancer results not only in an additive activation, but even in a synergistic stimulation of the enhancer activity. It is however not known how this synergism occurs. It was shown that Oct6 binds to four consensus sites within the MSE and NFATc4 to three consensus sites (Ghislain and Charnay 2006, Kao et al. 2009). The present study adds seven sites bound by Sox10 to this set. Whereas the Oct6 binding sites are the only ones that were confirmed by the analysis of transgenic mice (Ghislain and Charnay 2006), the Sox10 and NFATc4 binding sites are up to now only identified in vitro and await further analysis in vivo. Sox proteins are known to change the architecture of DNA dramatically and could bring DNA elements that are separated by many nucleotides in close contact to each other due to induced DNA bending (Wegner 1999). The isolated oligonucleotides that were used in EMSA for the identification of binding sites may thus not reflect the actual situation in the context of the whole enhancer sequence and the EMSA results need to be interpreted with caution. In this regard, luciferase reporter gene assays with the full-length MSE were less artifical. Nevertheless, reporter gene assays were carried out in the presence of co-transfected and thus saturating amounts of transcription factors and do not reflect the actual amount of protein that is present in vivo. With these restrictions in mind, the in vitro experiments allowed the in-depth examination of transcriptional regulation using targeted mutagenesis under controlled stable conditions.

74 4.2 Sox10 in myelinating Schwann cells

The present analysis of the synergism of Sox10 and Oct6 in luciferase reporter gene assays revealed that this synergism is rather robust to mutations of Sox10 binding sites. Even mutation of all high-affinity Sox10 binding sites, which disrupted the activation of the enhancer by Sox10 alone, allowed a significant synergistic activation in combination with Oct6 protein. This may reflect, that there were several intact low-affinity binding sites, which possibly substituted for the mutated sites to a certain extent. Another possibility is that Sox10 is recruited to the DNA via NFATc4 irrespective of the presence of its binding sites. Bound to oligonucleotides, NFATc4 interacts directly with Sox10 via its Rel homology domain and this interaction occurs independently of the presence of Sox10 binding motifs in the oligonucleotides (Kao et al. 2009). Whether in fact S16 Schwann cells express sufficient amounts of NFATc4 remains to be elucidated. Mutational analysis of the proteins focused on the domain requirement of Sox10 and Oct6 for their synergistic activity. In the Oct6 protein, the DNA-binding POU domain was clearly the most important domain to allow the synergism to occur. Neither deletion of the whole POU domain, nor deletion of one of its subdomains or its functional disruption were compatible with synergistic MSE activation. Both parts of the POU domain, the POU specific domain and the POU homeodomain, are required for DNA recognition and binding (Dailey and Basilico 2001). Therefore, deletion of each of the subdomains is thought to result in the loss of DNA binding. Furthermore, POU domains can establish protein-protein interactions and thus recruit further factors in transcriptional complexes (Dailey and Basilico 2001). However, in the context of the MSE, DNA binding seems to be the primarily important function of the POU domain. This is inferred from the loss of the Oct6 transactivating potential following the exchange of two amino acids in the WF-CS mutant. This mutant can not bind to DNA, but the POU subdomains may still be able to contact their partner proteins, which is clearly not possible in the deletion mutants. Vice versa, the POU domain alone was sufficient to sustain the synergism. The importance of the POU domain was also reflected in the fact that only Brn2, a member of the same subgroup of POU proteins, could synergize with Sox10 as efficiently as Oct6. Distantly related POU proteins with less related POU domains were not able to synergize with Sox10. It is thus probable that the POU domain contributes to the specificity of the synergism with Sox10. DNA binding proved to be equally important on the side of the Sox protein. This is in line with the observation that the interaction of Sox and POU proteins on DNA requires independent binding of both proteins to DNA in most of the cases (Kuhlbrodt et al. 1998, Dailey and Basilico 2001). Sox10 and Oct6 behaved differently regarding the requirement of their transactivation domains. The transactivation domain of Oct6 was only necessary for the activation of the MSE by the POU protein on its own. Despite the loss of its transactivating poten-

75 4 Discussion tial, the Oct6∆N protein could still synergize with Sox10. In contrast, Sox10 without its transactivation domain could neither alone nor in combination with Oct6 activate the Krox20 MSE. The transactivation domain of the Sox protein may in part account for the speciﬁcity of this interaction. This domain is highly conserved among the members of the SoxE subgroup. Accordingly, Sox8 and Sox9 could synergize with Oct6 just like Sox10. In contrast, Sox2 as a member of the SoxB1 subgroup could not substitute for Sox10. Sox2 may equally be able to recognize the Sox binding sites within the MSE as the consensus binding motif is the same for all Sox proteins. But in the context of the MSE it could not transactivate, possibly because it has a transactivation domain different from the one that is conserved among SoxE proteins (Bowles et al. 2000). Sox2 may in contrast rather act negatively on myelination because it was reported to be an inhibitor of Schwann cell differentiation and myelination (Le et al. 2005). With regard to the synergism of Sox10 and Oct6, the most interesting domain was the K2 domain. Deletion of this domain did not affect the transactivating capacity of Sox10 on its own, but it disrupted its synergistic interaction with Oct6 or Brn2. This explains why Schwann cells of Sox10∆K2/∆K2 animals did not express Krox20 in the presence of Oct6 and the mutant Sox10 protein demonstrating that this synergism is indeed important in vivo. One possibility was that the K2 domain may contribute to the synergism by direct interaction with Oct6, but such an interaction was not observed with the isolated K2 domain. Oct6 and Sox10 interacted rather via the HMG domain of the Sox protein. This would be in line with previous reports that related the C-terminal part of the HMG domain to interactions with the DNA binding domains of other transcription factors (Wissmüller et al. 2006).

4.2.3 Sox10 and its DNA binding properties

Transcription factors contact DNA either directly by binding or indirectly by protein- protein interactions to other DNA-bound factors. There is a huge diversity in the way of DNA binding among different transcription factors, which contain different DNA-binding domains like zinc finger domains, bHLH (basic helix loop helix) domains or HMG boxes among others. The HMG-box superfamily of transcription factors comprises two main classes of proteins: on one hand the HMG/UBF family, whose members contain several HMG-boxes and bind DNA without any known sequence specificity, and on the other hand the TCF/SOX family, which is characterized by the presence of one single HMG- box that binds DNA sequence-specifically (Laudet et al. 1993). Although the various members of the TCF/SOX family diverge to a large extent in many of their properties, they all recognize the 5’-(A/T)(A/T)CAA(A/T)G-3’ heptameric DNA motif and bind to

76 4.2 Sox10 in myelinating Schwann cells its minor grove (Laudet et al. 1993, Harley et al. 1994). This consensus sequence provides a common denominator for the classification of a large group of transcription factors, but it does not reflect the complexity of DNA binding and recognition. If all TCF/SOX factors competed equally for binding to this motif, tissue-specific transcriptional regulation would not be possible. Therefore, parameters like flanking DNA-sequences, cooperative DNA binding or interaction between different transcription factors modulate the sim- ple sequence-specificity for the heptameric consensus sequence (for review see Wegner (2010)). Furthermore, many of the identified Sox-binding elements in promoter or enhancer regions match the consensus only in most, but not all of the seven nucleotides. Given this non-stringent demand to exactly adhere to the binding motif, the sequence of the MSE was re-examined in this analysis to identify possible Sox protein binding sites. Only seven out of eleven theoretically possible binding regions that contained up to four consensus motifs in close proximity could be confirmed as high-affinity binding regions in EMSA. This discrepancy between the prediction due to structural analysis and the factual in vitro binding demonstrates that binding of Sox proteins can not be reliably predicted without experimental prove and that the presence of a consensus motif is not the only prerequisite. The comparison of the seven single motifs, which were identified as high- affinity binding sites within the binding regions, did not apparently suggest a preferential choice of nucleotides outside the 5’-CAA-3’ core. If at all, an A at the second position of the heptamer may be preferred, since six of the seven sites had an adenine there.

Sox10 is known to bind cooperatively to the regulatory elements of some of its target genes. A conserved protein domain directly preceding the HMG-box mediates the dimerization of two Sox10 molecules on DNA. However, this domain does not promote dimer formation in solution. A detailed analysis of the P0 promoter region, which is activated by Sox10, unraveled important characteristics of monomeric as compared to dimeric binding of Sox10 (Peirano and Wegner 2000). Expression of P0 is activated by binding of one molecule of Sox10 to site B or by cooperative binding of two molecules to the composite element C/C’. On the side of the protein, dimerization required the presence of the conserved N-terminal dimerization domain. On the side of the DNA element, the two consensus heptamers had to be oriented face to face and spaced by 4–6 basepairs. This was more important than the strict adherence to the consensus sequence, since both binding elements had one mismatch within the heptamer (Peirano and Wegner 2000). In light of the particular ability of Sox10 to activate target gene promoters either as a monomer or as a dimer, nearby putative binding sites in the MSE were analyzed together in this study to detect possible cooperative binding. Indeed, region II proved to be a dimeric binding element. Its composition resembles the C/C’ dimeric binding region in the P0 promoter, since the two consensus sequences show a face to face orientation and are sepa-

77 4 Discussion rated by 4 nucleotides. Even more striking is the complete sequence identity between the two high-affinity binding sites in the P0 promoter and the MSE enhancer. Both sites are composed of the nucleotides 5’-CACAAAG-3’ and both are able to bind Sox10 protein on their own (this study and Peirano et al. (2000)). Furthermore, these sites allow cooperative binding of Sox10 together with a nearby located second consensus motif. In both cases, the second low-affinity site did not bind Sox10 on its own, but only in conjunction with the high-affinity site. In case of the MSE, this was reflected by the fact, that the low-affinity site had a mismatch within the three nucleotides of the core sequence. The low-affinity sites of these two composite elements were completely different between the

P0 promoter and the MSE enhancer, but obviously both able to allow cooperative binding to DNA. The dimer binding element in the MSE indicated once more, that spacing is a rather strict requirement for cooperative binding. Directly adjacent to the high-affinity binding site exists a heptameric sequence that fits the consensus better than the one within four nucleotides distance. But mutation of this directly following sequence did not disrupt the dimeric binding properties in EMSA, which indicated that this consensus site is not used. The distance of 4 nucleotides proved to be more appropriate to mediate dimeric binding of Sox10 to this composite element. These observations confirm what is known about the characteristics of dimeric DNA binding of Sox10. However, there are no hints that the identified dimer-binding region II is of special importance during activation of the Krox20 MSE in vivo. Luciferase reporter gene analyses demonstrated that mutation of the dimeric binding site in the context of the full-length Krox20 MSE reduced the ability of the MSE to be transactivated by Sox10 to extents similar to the other binding site mutations. Thus, cooperative binding is not the main mechanism of Sox10 on the MSE as evident from the notable remaining inducibility of the Krox20 enhancer when the dimer binding site was disrupted. It points to the same direction as the finding that the aa1-mutant version of Sox10, which can not dimerize any more, induced the Krox20 enhancer as efficient as the wildtype protein, alone as well as in combination with Oct6. The analysis of aa1-mutant mice argues for an involvement of dimeric DNA binding during earlier steps of Schwann cell development because Schwann cells of these mice fail to induce Oct6 expression. Therefore, there may be Sox dimer binding elements in regulatory sequences of the Oct6 gene. In contrast, dimeric binding of Sox10 to the Krox20 MSE enhancer seems to be of minor importance.

4.2.4 The combined activity of several Sox10 binding sites

As described adherence to the heptameric consensus motif for Sox protein binding is not an absolute requirement and variations are tolerated to a certain extent, particularly out-

78 4.2 Sox10 in myelinating Schwann cells side of the 5’-CAA-3’ core sequence. The occurence of such a short motif within a DNA element of the size of 1.3 kb like the MSE is statistically quite likely and indeed frequent. Although the search for consensus motifs was restricted to sequences that are largely conserved among mouse, human and chicken, 23 such motifs were identified and grouped into eleven putative binding regions. The in vitro binding capacity of these sites and regions varied from strong to no binding at all. Thus, some binding sites were classified as high-affinity binding sites as opposed to low-affinity binding sites and only the high- affinity sites were subjected to further investigation. Since the oligonucleotides analyzed in EMSA covered only 30–40 nucleotides around each binding region of interest, possible influences of flanking DNA sequences were neglected in this assay. In this regard, mutation in the context of the whole Krox20 MSE was less artificial. Luciferase reporter gene analyses revealed that only site XI was probably not involved in transactivation, despite its observed binding potential in EMSA. Mutation of this site did not affect the ability of the Krox20 MSE to be activated by Sox10. In contrast, single mutation of all the other high-affinity binding sites reduced transactivation of the Krox20 MSE, but did not completely disrupt it. This argues that the mode of action of Sox10 on the MSE is not to induce the enhancer via one specific monomeric or dimeric binding site, but rather to act on the MSE by binding at several positions. Accordingly, the number of intact binding sites within the MSE seemed to be more important than the existance of one particular site. This was evident from the complete loss of transactivation upon mutation of at least five of the binding sites. This mechanism is in favor of a dose-dependent activation of Krox20 expression. Increasing amounts of Sox10 before the onset of Krox20 expression could result in the occupation of more and more binding sites, even including low-affinity Sox10 binding sites. In this model, Sox10 would only activate Krox20 expression when present in high amounts and would thus regulate transcription depending on its concentration. To this end, it will be of interest to monitor expression levels of Sox10 during Schwann cell development because this could in part explain why Sox10 induces Krox20 not during the whole peroid of its expression, but concomitant with the onset of myelination. A similar mechanism was suggested to underly the activation of the P0 promoter (Peirano and Wegner 2000). Besides the two high-affinity binding sites B and C/C’, there are several low-affinity binding sites in this promoter, which contributed to the transactivation of the promoter in reporter gene assays. Sterical aspects may also be involved in such a mechanism, where the number of bound Sox10 molecules is important. Binding of every additional Sox10 protein can change the structure of the whole promoter and thereby promote or inhibit binding of further transcription factors in close proximity.

Dosage-dependent activation of regulatory elements is not only sensitive to mutations of binding sites, but also to reduced amounts of available intact transcription factors.

79 4 Discussion

This aspect of reduced levels of Sox10 is obvious in patients with heterozygous SOX10 mutations. Several cases were reported, where patients suffered from a combination of four syndromes in a newly identiﬁed neurocristopathy, called PCWH - peripheral demyelinating neuropathy, central dismyelinating leukodystrophy, Waardenburg syndrome and Hirschsprung disease (Inoue et al. 2004). This syndrome is ascribed to mutations in exon 5 of the SOX10 gene and is a rather severe syndrome compared to other phenotypes in SOX10 heterozygous patients (Herbarth et al. 1998, Inoue et al. 2004). PCWH includes the appearence of peripheral neuropathy, which points to defects in the Schwann cell population. It was speculated that PCWH causing mutations generate Sox10 proteins with a dominant-negative activity and lead thus to particularly severe defects (Inoue et al. 2004). A recent analysis of the respective mutants with regard to their effects on early neural crest cell development detected dominant-negative activity only in some of the mutations related to PCWH (Cossais et al. 2010). This does however not exclude that the other mutant proteins act dominant-negatively during later stages of development. Whatever the exact mechanism is like, it may result in a more or less severe decrease in the level of intact Sox10 protein. Either Sox10 is only transcribed from one allele or dominant-negative Sox10 from a mutated allele inactivates additionally the residual wildtype Sox10 protein. If activation of the Krox20 MSE is indeed sensitive to the dose of Sox10 present at diverse developmental stages, it may also be affected by these mutations and therefore relate to the observed peripheral neurocristopathies.

80 5 Material and Methods

5.1 Material

5.1.1 Organisms

5.1.1.1 Mouse lines

The following genetically modiﬁed mouse lines were used:

Mouse line from published in DBHCre G. Schütz, Heidelberg Parlato et al. (2007) Sox8lacZ E. Sock, Erlangen Sock et al. (2001) Sox10lacZ D. E. Görich, Hamburg Britsch et al. (2001) Sox10Sox8ki S. Kellerer, Erlangen Kellerer et al. (2006) Sox10aa1 S. Schreiner, Erlangen Schreiner et al. (2007) Sox10∆K2 S. Schreiner, Erlangen Schreiner et al. (2007) Sox10loxP S. Schreiner, Erlangen Finzsch et al. (2010)

The wildtype C3HeB/FeJ strain from Jackson Laboratory (Bar Harbor, Maine, USA) was used for breeding.

5.1.1.2 Chicken line

Fertilized chicken eggs (Gallus gallus) were obtained from Lohmann (Cuxhaven, Ger- many) and LSL Rhein-Main (Dieburg, Germany).

5.1.1.3 Cell lines

Transformed human embryonic kidney cells (HEK293) and immortalized primary rat Schwann cells (S16) from the American type culture collection (ATCC) were used in this work.

81 5 Material and Methods

5.1.2 Chemicals and general reagents

Chemicals, solutions, salts and general reagents were purchased from Carl Roth (Karlsruhe), Merck (Darmstadt) and Sigma (Munich) except when speciﬁed. Culture media, buffers and cell culture material were purchased from Gibco/BRL (Eggen- stein), Invitrogen (Karlsruhe), Serva (Heidelberg), Sarstedt (Nümbrecht), Renner (Darm- stadt) and TPP (Trasadingen, Schweiz). Enzymes were purchased from Gibco/BRL (Eggenstein), MBI Fermentas (St. Leon-Roth), New England Biolabs (Frankfurt) or Roche Diagnostics (Mannheim). Radioactive chemicals were purchased from Amersham (Braunschweig).

5.1.3 Buﬀers and solutions

Reagent-grade water from a MilliQ deionizator (Millipore, Eschborn) with a speciﬁc re- sistance set to 18.2 MΩ/cm3 was used for buffers, solutions and dilutions.

Binding-washing buffer 4.3 mM Na2HPO4 1.47 mM KH2PO4 137 mM NaCl 2.7 mM KCl

Cell lysis buffer 10 mM Hepes, pH 7.9 10 mM KCl 0.1 mM EDTA 0.1 mM EGTA immediately before use: add DTT to a ﬁnal conc. of 2 mM add leupeptin and aprotinin to a ﬁnal conc. of 10 µg/ml

Citrate buffer citrate solution A: 0.1 M citric acid (21.01 g/l) citrate solution B: 0.1 M sodium citrate (29.41 g/l)

9 ml solution A and 41 ml solution B in 450 ml H2O

Coomassie staining solution 0.1% Coomassie brilliant blue R-250 2% glacial acetic acid 40% ethanol

82 5.1 Material

Coomassie de-staining solution 2% glacial acetic acid 40% ethanol

10x DNA loading buffer 50% TE 50% glycerol 0.05% xylene cyanol 0.05% bromophenol blue

ECL solution A 0.025% luminol 0.1 M Tris, pH 8.6

ECL solution B 0.11% p-hydroxy-cumaric acid in DMSO

ECL developer reagent 3 ml solution A 60 µl solution B 3 ml PBS

1.8 µl H2O2 (30%)

3x Laemmli buffer 187 mM Tris, pH 6.8 6% SDS 3% glycerol 0.02% bromophenol blue 15% β-mercaptoethanol

LB-agar LB-medium 1.5% agar

LB-medium 1% bacto-trypton 0.5% yeast extract 0.5% NaCl

Lower Tris 1.5 M Tris, pH 8.8 0.4% SDS

83 5 Material and Methods

Luciferase lysis buffer 88 mM Tris, pH 7.8 88 mM MES, pH 7.8 12.5 mM MgOAc 1 mM DTT 0.1% Triton X-100 2.5 mM ATP

10x Mobility shift buffer 100 mM HEPES, pH 8.0 250 mM NaCl

50 mM MgCl2 20 mM DTT 1 mM EDTA 50% glycerol

Mowiol 6 g glycerol 2.4 g Mowiol 4-88 (Calbiochem)

incubate in 6 ml H2O for 2 h at room temperature add 12 ml 0.2 M Tris, pH 8.5 rotate o/n at 53°C, centrifuge 2x 20 min, 4000 rpm

4% paraformaldehyde dissolve 20 g paraformaldehyde in 250 ml H2O (65°C) (PFA) add dropwise 10 M NaOH, add 50 ml 10x PBS

adjust to pH 7.4, add H2O ad 500 ml sterile ﬁlter, store at -20°C

10x Phosphate buffered saline 1.4 M NaCl (PBS) 27 mM KCl

100 mM Na2HPO4·2H2O 18 mM KH2PO4 adjust to pH 7.4

PBS-T PBS with 0.1% Tween-20

SDS-running buffer 25 mM Tris, pH 8.3 190 mM glycine 0.1% SDS

84 5.1 Material

Sonication buffer 50 mM NaH2PO4 300 mM NaCl immediately before use: add lysozym to a final conc. of 2.5 µg/ml add DNaseI to a final conc. of 10 µg/ml add leupeptin and aprotinin to a final conc. of 10 µg/ml

Tail lysis buffer 50 mM Tris, pH 8.0 100 mM EDTA, pH 8.0 0.5% SDS

10x TBE buffer 0.9 M Tris 0.9 M boric acid 25 mM EDTA adjust to pH 8.3

TE buffer 10 mM Tris 0.1 mM EDTA adjust to pH 8.0

Upper Tris 0.5 M Tris, pH 6.8 0.4% SDS

Western-transfer buffer 48 mM Tris 39 mM glycine 0.04% w/v SDS 20% v/v methanol

85 5 Material and Methods

5.1.4 Oligonucleotides

5.1.4.1 Oligonucleotides for genotyping

The following oligonucleotides were used as primers for mouse genotyping by PCR:

Primer Sequence (5’-3’) EiCre1 GACAGGCAGGCCTTCTCTGAA EiCre2 CTTCTCCACACCAGCTGTGGA LacZ ko5 TAAAAATGCGCTCAGGTCAA Sx8 ki2 GCCCAGTTCAGTACCAGAGG Sx8 ko15 GTCCTGCGTGGCAACCTTGG Sx8 ko16 GCCCACACCATGAAGGCATTC Sx10 ki1 GTGAGCCTGGATAGCAGCAG Sx10 ki3 TCCCAGGCTAGCCCTAGTG Sx10 ko5 CAGGTGGGCGTTGGGCTCTT Sx10 ko6 CAGAGCTTGCCTAGTGTCTT

5.1.4.2 Oligonucleotides for mutagenesis

The following oligonucleotides were used for Sox binding site mutagenesis (roman numerals indicate corresponding sites in the MSE (see Fig. 3.20):

Site Sequence (5’-3’) I fwd GAGGAAGGATCAGGAGTTTCCATGGTCGTTTCCAGCATAAATCAAAAC rev GTTTTGATTTATGCTGGAAACGACCATGGAAACTCCTGATCCTTCCTC II fwd CGTTTCCAGCATAAATCAAAACGGATCCTTCACGCTGTGGTGCGAGC rev GCTCGCACCACAGCGTGAAGGATCCGTTTTGATTTATGCTGGAAACG VI fwd GAATCCAACATGAAGGACGGATCCTTGTGACAAACC rev GGTTTGTCACAAGGATCCGTCCTTCATGTTGGATTC VII fwd CGCAGCCCATGAACGTTGTCCCATGGTGAGTGGATGTACGGGTTGTAC rev GTACAACCCGTACATCCACTCACCATGGGACAACGTTCATGGGCTGCG VIII fwd CCTTTCCTTTTTCCTGACCAGAAAGCCATGGATTGAGCCCTTCACAAAGC rev GCTTTGTGAAGGGCTCAATCCATGGCTTTCTGGTCAGGAAAAAGGAAAGG IX fwd GTGTGTTAAAAAAATGTTAGGATCCCAAAGAAGTTATAAAAATTTATAAGTTGGC rev GCCAACTTATAAATTTTTATAACTTCTTTGGGATCCTAACATTTTTTTAACACAC XI fwd GGCCCTGCTATTTAAATTTGATTTATTCCCCATGGGGGAAATAGTGTCCATCATG rev CATGATGGACACTATTTCCCCCATGGGGAATAAATCAAATTTAAATAGCAGGGCC

86 5.1 Material

5.1.4.3 Oligonucleotides for EMSA

The following oligonucleotides were analyzed in EMSA with regard to their Sox10 binding capacity (roman numerals indicate corresponding sites in the MSE, small letter suf- ﬁxes indicate remaining intact sites in mutated sequences (see Fig. 3.20 and Fig. 3.22)):

Site Sequence (5’-3’) I fwd GGG ATCAGGAGTTTGTTGTTTCGTTTCC rev GGG GGAAACGAAACAACAAACTCCTGAT Ia fwd GGG ATCAGGAGTTTGGCTTTTCGTTTCC rev GGG GGAAACGAAAAGCCAAACTCCTGAT Ib fwd GGG ATCAGGAGTGCTTTGTTTCGTTTCC rev GGG GGAAACGAAACAAAGCACTCCTGAT II fwd GGG CATAAATCAAAACTTTGTGTTCACG rev GGG CGTGAACACAAAGTTTTGATTTATG IIa fwd GGG CATAAATCAAAACTGCCTGTTCACG rev GGG CGTGAACAGGCAGTTTTGATTTATG IIb fwd GGG CCGACGTAGGAACTTTGTGTTCACG rev GGG CGTGAACACAAAGTTCCTACGTCGG III fwd GGG ACAGACATGTTTTGAAGCTGGTCAT rev GGG ATGACCAGCTTCAAAACATGTCTGT IV fwd GGG CCGGACTTGCATTGCACAGAAGTCAC rev GGG GTGACTTCTGTGCAATGCAAGTCCGG V fwd GGG CATAAAGTCTTCAATAACTTAGAGA rev GGG TCTCTAAGTTATTGAAGACTTTATG VI fwd GGG GGACATTGTGTTGTGACAAACCCAT rev GGG ATGGGTTTGTCACAACACAATGTCC VIa fwd GGG CATGAAGGACATTGTGTTGTGACAA rev GGG TTGTCACAACACAATGTCCTTCATG VIb fwd GGG GGACAGCCTGTTGTGACAAACCCAT rev GGG ATGGGTTTGTCACAACAGGCTGTCC VII fwd GGG GAACGTTGTCTTTGTGTGAGTGGAT rev GGG ATCCACTCACACAAAGACAACGTTC VIIa fwd GGG GAACGTTGTCTGCCTGTGAGTGGAT rev GGG ATCCACTCACAGGCAGACAACGTTC VIIb fwd GGG GAACGGCCTCTTTGTGTGAGTGGAT rev GGG ATCCACTCACACAAAGAGGCCGTTC

87 5 Material and Methods

Site Sequence (5’-3’) VIII fwd GGG AAGATTGTTATTGAGCCCTTCACAAAGCT rev GGG AGCTTTGTGAAGGGCTCAATAACAATCTT VIIIa fwd GGG CCAGAAAGATTGTTAGCCAGCCCTT rev GGG AAGGGCTGGCTAACAATCTTTCTGG VIIIb fwd GGG CCAGAAAGAAATTTATTGAGCCCTT rev GGG AAGGGCTCAATAAATTTCTTTCTGG VIIIc fwd GGG CCCTTCACAAAGCTGAAATCCTGCA rev GGG TGCAGGATTTCAGCTTTGTGAAGGG IX fwd GGG AAAATGTTAACAATTCAAAGAAGTT rev GGG AACTTCTTTGAATTGTTAACATTTT IXa fwd GGG AAAATGTTAACAATTAGCAGAAGTT rev GGG AACTTCTGCTAATTGTTAACATTTT IXb fwd GGG AAAATGTTAAAGCTTCAAAGAAGTT rev GGG AACTTCTTTGAAGCTTTAACATTTT Xa–c fwd GGG AATGCAAATATTTGTTCATTGCATT rev GGG AATGCAATGAACAAATATTTGCATT Xb–d fwd GGG AAATATTTGTTCATTGCATTGAGAG rev GGG CTCTCAATGCAATGAACAAATATTT XI fwd GGG AAATTTGATTTATTTGATTACATTGAAAT rev GGG ATTTCAATGTAATCAAATAAATCAAATTT XIa fwd GGG AAATTTGATTTATCCTATTACAGCTAAAT rev GGG ATTTAGCTGTAATAGGATAAATCAAATTT XIb fwd GGG AAATCCTATTTATTTGATTACAGCTAAAT rev GGG ATTTAGCTGTAATCAAATAAATAGGATTT XIc fwd GGG AAATCCTATTTATCCTATTACATTGAAAT rev GGG ATTTCAATGTAATAGGATAAATAGGATTT

88 5.1 Material

5.1.5 Antibodies

5.1.5.1 Primary antibodies

The following primary antibodies were used for immunohistochemistry or protein detection on membranes:

Antigen Species Dilution Supplier β-Gal rabbit antisera 1:500 Cappel/ICN β-Gal goat antisera 1:500 Biotrend, Köln βHSD rabbit antisera 1:500 A. Payne, Stanford Krox20 rabbit antisera 1:500 Covance, Berkley Oct6 rabbit antisera 1:3000 E. Sock, Hamburg Phox2b rabbit antisera 1:500 C. Goridis, Paris PNMT rabbit antisera 1:500 Immunostar, Wisconsin SF1 rabbit antisera 1:1000 K. Morohashi, Japan Sox8 guinea pig antisera 1:1000 E. Sock, Erlangen Sox9 rabbit antisera 1:2000 E. Sock, Erlangen Sox10 guinea pig antisera 1:1000 E. Sock, Erlangen Sox10 rabbit antisera 1:7500 E. Sock, Erlangen TH rabbit antisera 1:1000 Biomol, Hamburg VMAT-1 rabbit antisera 1:1000 E. Weihe, Marburg

5.1.5.2 Secondary antibodies

The following secondary antibodies couples to ﬂuorescent dyes were used for detection of primary antibodies:

Antigen Species Fluorescent dye Dilution Supplier rabbit mouse Cy2 1:100 Dianova, Hamburg rabbit mouse Cy3 1:200 Dianova, Hamburg rabbit goat Alexa488 1:500 Invitrogen, Karlsruhe rabbit goat Cy3 1:200 Dianova, Hamburg mouse goat Cy2 1:100 Dianova, Hamburg mouse goat Cy3 1:200 Dianova, Hamburg guinea pig goat Cy2 1:100 Dianova, Hamburg guinea pig goat Cy3 1:200 Dianova, Hamburg goat mouse Cy2 1:100 Dianova, Hamburg goat mouse Cy3 1:200 Dianova, Hamburg

89 5 Material and Methods

5.2 Methods

5.2.1 Animal husbandry

Mice were kept in an adequate animal husbandry of the Institut für Biochemie (Erlangen) under standard conditions according to the Tierschutzgesetz. For breeding of all mouse lines, heterozygous mice were mated with wildtype C3HeB/FeJ animals. For the generation of homozygous mutant embryos, heterozygous animals were intercrossed. In the morning after mating, a post coitum vaginal protein plaque indicated the possibility of a pregnancy and this day was assumed as 0.5 dpc (days post coitum).

5.2.2 Standard methods

Standard methods such as isolation of plasmid DNA in analytic and preparative scale, puriﬁcation of nucleic acids using phenol-extraction and precipitation with ethanol, concentration measurement of nucleic acid solutions, electrophoretic separation of nucleic acids, elution of DNA fragments from agarose gels, enzymatic restriction digests of DNA, ligation of DNA fragments in linearized plasmids and transformation of plasmid DNA in E.coli were performed according to standard protocols (Ausubel et al. 2002, Sambrook et al. 2001).

5.2.3 Site-directed mutagenesis

The QuickChange XL Site-Directed Mutagenesis Kit (Stratagene, La Jolla, USA) was used to mutate the wildtype MSE sequence by PCR. Mutagenesis was performed on the MSE sequence in the pGEM plasmid backbone according to the manufacturer’s instructions with primers listed in 5.1.4.2. Mutations were controlled by sequencing and mutant MSE sequences were ligated into the pTATAluc luciferase reporter plasmid.

5.2.4 Cell culture methods

5.2.4.1 Cultivation of eukaryotic cells

HEK293 and S16 cells were maintained at 37°C and 5% CO2 in Dulbecco’s modiﬁed Eagle’s medium (DMEM; Gibco/BRL, Eggenstein) containing 10% v/v fetal calf serum (FCS; Invitrogen), 100 U/ml penicillin and 10 mg/ml streptomycin. Adherent cells were trypsinized (Trypsin-EDTA; Gibco/BRL, Eggenstein) for propagation every 3–5 days.

90 5.2 Methods

5.2.4.2 Transfection of HEK293 cells

For protein overexpression, HEK293 cells were transfected with polyethylenimine (PEI; Sigma, Munich) at the day after plating. Per 10 cm cell culture plate (Sarstedt, Nüm- brecht), 10 µg DNA were mixed with 30 µl PEI and 500 µl serum-free DMEM. The mix- ture was thoroughly vortexed for 10 sec, incubated at room temperature for 10–15 min and added dropwise to the medium on the cells (7 ml DMEM/10% FCS). After incubation over night, medium was changed to DMEM/10% FCS. Cells were harvested 48 h post transfection for the preparation of whole cell extracts.

5.2.4.3 Preparation of whole cell extracts

Whole cell extracts from transfected HEK293 cells were prepared 48 h post-transfection. Cells on a 10 cm plate were washed twice with cold PBS, scraped off the plate with 400 µl cell lysis buffer and transferred to an eppendorf tube. 15 µl NP40 20% (Applichem, Darmstadt) and 20 µl NaCl 5 M were added each followed by 10 sec of vortexing. The samples were rotated for 15 min and cleared by centrifugation for 5–10 min at 13000 rpm at 4°C. The supernatant was mixed with 10% glycerol and stored at -80°C.

5.2.4.4 Transfection of S16 cells

For luciferase assays, S16 cells were transfected in duplicates with 4.5 µl Superfect reagent per 35 mm plate (Qiagen, Hilden) according to the manufacturer’s instructions. To analyze the impact of Sox10 alone, S16 cells were transfected with 1.5 µg luciferase reporter plasmid and 0.5 µg empty pCMV5 plasmid or pCMV5-Sox10 plasmid. To analyze synergistic activity, S16 cells were transfected with combinations of 750 ng luciferase reporter plasmid and 750 ng effector plasmids per plate. Effector plasmids for Sox and POU proteins were employed in a 10:1 ratio. The total amount of expression plasmid was kept constant with empty pCMV5 plasmid.

5.2.4.5 Luciferase reporter gene assay

48 h post-transfection, S16 cells were washed with cold PBS and harvested with 300 µl luciferase lysis buffer per 35 mm plate. After 10 min incubation in lysis buffer, 250 µl of the extracts were assayed for luciferase activity in a luminometer (Lumat LB 9501; Berthold, Bad Wildbad). 100 µl of a 0.5 mM luciferin (Serva, Heidelberg) solution in

5 mM K3PO4 were added automatically to the extracts and light emission was measured in relative light units.

91 5 Material and Methods

5.2.5 Chicken in ovo-electroporation

Fertilized chicken eggs were incubated in a humidified incubator at 37.8°C for 43–44 h, corresponding to Hamburger Hamilton stage 10–11 of chick embryonic development. Expression plasmids based on the pCAGGS-IRES-nls-GFP plasmid were injected into the neural tube at a concentration of 2 µg/µl supplemented with low amounts of Fast Green. For in ovo-electroporation, electrodes were placed on either side of the neural tube and five square pulses of 50 ms and 30 V were applied to the embryos (BTX ECM830). Transfected embryos were covered with parafilm and were allowed to develop for further 12, 24 or 48 h in a humidified incubator at 37.8°C.

5.2.6 Genotyping

5.2.6.1 Isolation of genomic DNA for genotyping

DNA for genotyping was isolated from mouse tail tips or embryonic yolk sacs. Tissue samples were lysed for 1–2 h in 250 µl tail lysis buffer supplemented with 5–10 µl pro- teinase K (20 µg/µl, Roth, Karlsruhe) shaking at 1400 rpm and 55°C in a thermomix (Eppendorf, Hamburg). DNA was precipitated by the addition of 0.8% v/v isopropanol. After centrifugation for 15 min at 13000 rpm (centrifuge 5415 D; Eppendorf, Hamburg), the DNA pellet was washed with 500 µl ethanol (70%) and centrifuged for 5 min at

13000 rpm. The DNA was dried at room temperature and dissolved in 400 µl H2O. 0.5– 2 µl of the DNA solution were used as template in PCR (polymerase chain reaction).

5.2.6.2 PCR for genotyping

Mice were genotyped by PCR with the primers specified in 5.1.4.1. Primers were used in the combinations listed in table 5.1. Amplification reactions were performed in a total volume of 20 µl reaction mix (see table 5.2) in a PCR-T3-Thermocycler (Biometra, Göt- tingen) or a PTC200 Peltier Thermal Cycler (Biozym, Oldendorf) according to the amplification programs specified in table 5.3. Genotypes were determined by electrophoretic separation of the amplification products supplemented with DNA loading buffer in 1% agarose gels. DNA fragments were visualized with ethidium bromide.

92 5.2 Methods

Mouse line Primer Allele Ampliﬁed fragment DBHCre EiCre1 fwd EiCre2 rev Cre tg 522 bp Sox8lacZ Sx8 ko15 fwd Sx8 ko16 rev wt 431 bp LacZ ko5 rev Sox8lacZ 600 bp Sox10lacZ Sx10 ko5 fwd Sx10 ko6 rev wt 506 bp LacZ ko5 rev Sox10lacZ 600 bp Sox10Sox8ki Sx10 ko5 fwd Sx10 ki3 rev wt 568 bp Sx8 ki2 rev Sox10Sox8ki 732 bp Sox10aa1 Sx10 ko5 fwd Sx10 ki3 rev wt 568 bp Sx10 ki1 rev Sox10aa1 698 bp Sox10∆K2 Sx10 ko5 fwd Sx10 ki3 rev wt 568 bp Sx10 ki1 rev Sox10∆K2 698 bp Sox10loxP Sx10 ko5 fwd Sx10 ki3 rev wt 568 bp Sx10 ki1 rev Sox10loxP 698 bp

TABLE 5.1 Genotyping - Primer combinations and corresponding DNA fragment sizes.

Reaction mix for genotyping of: Sox8lacZ Sox10aa1 Sox10lacZ Sox10∆K2 DBHCre Sox10Sox8ki Sox10loxP Buffer (10x) 2.0 2.0 2.0 MgCl2 (25 mM) 1.6 1.2 1.6 dNTPs (each 2.5 mM) 1.0 1.0 1.0 DMSO 1.0 1.0 1.0 Primer fwd (40 pmol/µl) 0.4 0.5 0.4 Primer rev 1 (40 pmol/µl) 0.4 0.5 0.4 Primer rev 2 (40 pmol/µl) 0.4 0.5 – Taq DNA polymerase 0.4 0.5 0.4 Template DNA 0.5 1.0 1.0 H2O ad 20 µl ad 20 µl ad 20 µl

TABLE 5.2 Genotyping - Reaction mixes (volumes in µl).

93 5 Material and Methods

Sox10lacZ Sox10aa1 Sox8lacZ Sox10Sox8ki Sox10∆K2 DBHCre Sox10loxP 1. 94°C 1 min 94°C 3 min 95°C 5 min 94°C 1min 2. 94°C 30 sec 94°C 30 sec 94°C 30 sec 94°C 20 sec 3. 56°C 30 sec 55°C 30 sec 60°C 40 sec 58°C 20 sec 4. 72°C 30 sec 72°C 30 sec 72°C 1 min 72°C 20 sec 5. 72°C 2 min 72°C 10 min 72°C 1 min 72°C 1 min 6. 4°C 2 min 4°C 2 min 4°C 3 min 4°C 2 min cycles 28 33 34 35

TABLE 5.3 Genotyping - Ampliﬁcation programs.

5.2.7 Histological methods

5.2.7.1 Tissue preparation

Mouse embryos were obtained from staged pregnancies at 10.5 dpc, 11.5 dpc, 12.5 dpc, 14.5 dpc, 16.5 dpc and 18.5 dpc. Pregnant dams were euthanized by cervical dislocation and embryos were isolated by Caesarean section under a stereomicroscope (Leica Mi- crosystems, Wetzlar). For genotyping, yolk sack tissue of each embryo was used at stage 10.5–12.5 dpc. At older stages, tails or extremities were collected for DNA isolation. Em- bryos up to stage 12.5 dpc were fixed as a whole in 4% PFA at 4°C for 4 h, older ones over night. At 14.5 dpc and 16.5 dpc, head and extremities were removed prior to fixation. At 18.5 dpc, embryos were skinned and bisected at the sternum. After fixation, embryos were washed 6x with PBS for at least 1 h on ice and transferred into 30% sucrose in PBS for one night at 4°C. Embryos were frozen in TissueTek freezing medium (Jung, Nussloch) and stored at -80°C. Chicken embryos were removed from the eggs and fixed in 4% PFA at 4°C for 1 h. After fixation, embryos were washed 4–6x with PBS on ice, transferred into 30% sucrose in PBS and subsequently processed like mouse embryos.

5.2.7.2 Immunohistochemistry

Genotyped frozen embryos were transversally sectioned (10 µm) on a cryotome (Leica Microsystems, Wetzlar). Sections were allowed to dry at room temperature for 2-3 h and stored at -80°C. For immunostaining, thawed sections were washed 2x with PBS

94 5.2 Methods for 7 min. Only for labeling of βHSD, sections were pre-treated in 10 mM citrate buffer (pH 6.0). They were heated to 120°C for 2 min in a pressure cooker (Dako, Glostrup), immersed in water and washed with PBS 2x for 5 min. The tissue was permeabilized for 10 min in PBS with 0.1% Triton X-100 and again washed with PBS for 10 min. Blocking of unspeciﬁc binding was performed at room temperature for 2 h with 400 µl PBS with 10% FCS and 1% BSA per slide. Primary antibodies were diluted in blocking solution as indicated in 5.1.5.1. Sections were incubated over night at 4°C with 150 µl of diluted antibody per slide. The antibodies anti-SF1, anti-PNMT and anti-VMAT were diluted in PBS with 0.1% Triton X-100 (irrespective of the combined antibody in case of co-labelings). Slides were washed 6x for 10 min with PBS and incubated in the dark at room temperature for 2 h with 150 µl secondary antibody diluted in blocking solution (see 5.1.5.2). After further 6 washing steps with PBS for 10 min in the dark, sections were stained with 10 µl DAPI (Sigma, Munich) in 80 ml PBS for 1 min and again washed with PBS. Stained sections were mounted with 45 µl Mowiol (Calbiochem/Merck Biosciences, Bad Soden) per slide and stored at 4°C. Fluorescence signal was detected with an inverted ﬂu- orescence microscope DM-IRB (Leica Microsystems, Bensheim) and documented with a SPOT-CCD camera (Diagnostic Instruments, Michigan USA).

5.2.7.3 Terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL)

To detect apoptotic cell bodies, TUNEL was performed according to the manufacturer’s instructions with the ApopTag Red kit (Serologicals/QBiogene, Heidelberg). Tissue sections were prepared as described in 5.2.7.2. Thawed sections were washed once with PBS for 5 min and permeabilized with 0.5% Triton-X100 in PBS for 10 min. After further 5 min in PBS, slides were incubated in ethanol/glacial acetic acid (2:1) for 5 min at -20°C and re-transferred into PBS for 2x 5 min. The tissue was pre-incubated on slide with equilibration buffer for 10 min at room temperature, before TdT (terminal deoxynucleotidyl transferase) enzyme solution was added. After an incubation of 1 h at 37°C, the reaction was stopped by the addition of a stop/wash buffer for 10 min at room temperature. The slides were again washed with PBS, 3x for 5 min at room temperature. Rhodamine-conjugated anti-DIG-antibody was added and incubated for 2 h at room temperature. After further 4x 5 min washing with PBS, the tissue was stained with DAPI and mounted as described in 5.2.7.2.

95 5 Material and Methods

5.2.8 Protein-biochemical methods

5.2.8.1 SDS-PAGE

Proteins were separated by polyacrylamide gel electrophoresis under denaturing conditions in a Minigel Twin G-42 chamber (Biometra, Göttingen). Samples were mixed with Laemmli buffer, denatured at 95°C for 7 min and loaded onto a polyacrylamide gel, which was composed of a stacking gel (1.25 ml Upper Tris, 650 µl acrylamide 40%, 15 µl APS

20%, 6 µl TEMED, 3 ml H2O) and a 10% acrylamide separating gel (3 ml Lower Tris, 3 ml acrylamide 40%, 45 µl APS 20%, 10 µl TEMED, 6 ml H2O). Gel electrophoresis was performed in SDS-running buffer at 120 V for about 2 h.

5.2.8.2 Western blot and protein detection

Proteins separated by SDS-PAGE were transferred to Protran BA 85-nitrocellulose membranes (Schleicher&Schüll, Dassel) by semi-dry blotting with a Fastblot B-44 (Biometra, Göttingen). A nitrocellulose membrane wetted in Western-transfer buffer was placed onto the anode of the blot apparatus. The protein-containing gel was applied and covered by two sheets of Whatman 3MM paper also wetted in Western-transfer buffer on each side. Protein transfer was performed at 270 mA for 45 min for one gel or at 250 mA for 60 min for two gels. After the transfer, the nitrocellulose membrane was washed with PBS-T and incubated at 4°C over night in 5% dry milk powder solved in PBS-T and Western-transfer buffer (1:1) to reduce unspecific binding. After washing with PBS-T, the membrane was incubated at room temperature for 1 h with primary antibody (see 5.1.5.1) diluted in PBS-T. After 3x 5 min washing with PBS-T, the membrane was incubated at room temperature for 20 min with ProteinA-coupled horseradish peroxidase diluted in PBS-T (1:3000). The membrane was again washed 3x 5 min with PBS-T to remove unbound ProteinA before protein detection. Therefore, the membrane was covered with freshly mixed ECL developer reagent and incubated for 1 min. A super RX X-ray film (FUJI Medical) was exposed to the lumi- nescence signal from the membrane for 0.5–5 min and then developed in a X-Omat 1000 processor film developer (Kodak).

5.2.8.3 GST-Pulldown

GST or GST fusion proteins were expressed in E. coli strain BL21 DE3. To test the induction of protein expression, 3 ml LB-medium with ampicillin (LB-Amp) were inoculated

96 5.2 Methods from single colonies of bacteria, which had been transformed with the respective plasmids and plated on LB-Amp agar before. Bacteria were grown on a shaker at 37°C over night. 20 ml of LB-Amp medium were inoculated from the precultures (about 1 ml) to an optical density (OD) of 0.1–0.2 and incubated at 37°C on a shaker until OD 0.4–0.6 was obtained. 2 ml of the cultures were collected for control SDS-PAGE before induction of protein expression with 20 µl IPTG (isopropyl-β-D-thiogalactopyranoside). After further 4 h of growth at 37°C 500 µl of the cultures were collected to control induction of protein expression. Control SDS-PAGE was performed with pelletized bacteria denatured in Laemmli buffer and protein was visualized by Coomassie staining. For protein expression, the same procedure was applied on a larger scale. 200 ml LB-Amp medium were inoculated from precultures. After induction and growth, bacteria were centrifuged for 15 min at 6000 rpm and 4°C. The bacterial pellet was washed with 10 ml PBS and centrifuged for 5 min at 6000 rpm and 4°C. (Pellets may be stored at -80°C.) Pellets were resuspended in 2.5 ml cold sonication buffer and Triton X-100 was added to a fincal concentration of 0.1%. After 30 min incubation on ice, samples were sonified 6x 10 sec intermittent with 10 sec on ice. Sonified bacteria were centrifuged twice for 15 min at 4000 rpm and 4°C and the supernatant was transferred to a new vial. 60 µl of a glutathion sepharose bead suspension (GE Healthcare) were added to the supernatant and rotated for 2 h at 4°C. The samples were centrifuged for 5 min at 2000 rpm and 4°C, the supernatant was discarded and the beads were washed with 500 µl binding-washing buffer for three times. Beads were resuspended in 100 µl binding-washing buffer. For pulldown experiments, 10–20 µl of the beads mixed with extracts from transfected HEK293 cells and 100 µl binding-washing buffer were rotated for 2 h at 4°C. The samples were centrifuged for 5 min at 2000 rpm and 4°C, the supernatant was discarded and the beads were washed with 200 µl binding-washing buffer for three times. Beads were resuspended in Laemmli buffer and bound proteins were analyzed by SDS-PAGE and western blot.

5.2.8.4 Electromobility shift assay EMSA

For analysis of protein binding to DNA, oligonucleotides (see 5.1.4.3) containing Sox10 binding sequences were synthesized of both DNA strands with three guanins added at the 5’ end (Invitrogen, Karlsruhe). Single stranded oligonucleotides were resolved in an- alytical grade water (Roth, Karlsruhe) to a concentration of 1 µg/µl and hybridized in the presence of 100 mM KCl by heating to 95°C for 5 min and slow subsequent cooling- down. Hybridized oligonucleotides were diluted to 0.1 µg/µl and then radio-labeled with 32P. Therefore, 100 ng double stranded oligonucleotides were incubated for 1 h in NEB2

97 5 Material and Methods

(New England Biolabs reaction buffer 2) with 1.5 µl 32P-dCTP (10 µCi/µl; Amersham, Braunschweig) and 1 µl Klenow-enzyme (2.5 U/µl; Invitrogen, Karlsruhe) in a total volume of 50 µl. Labeled oligonucleotides were puriﬁed using QuickSpin Mini Columns (Roche Diagnostics, Mannheim) and were ﬁxed to 10000 cpm/µl as determined by measurement in a scintillation counter (Tri-Carb 2800TR, Perkin Elmer). For complex formation of protein and DNA, 1 µl radio-labeled oligonucleotide and 1 µl protein extract from Sox10 MIC-transfected HEK293 cells were incubated for 20 min on ice in the presence of 2 µl Mobility shift buffer (10x), 5 mM DTT, 1 µg poly-dGdC and 3 µg BSA in a total volume of 20 µl. Samples supplemented with DNA loading buffer were separated in a native 5% polyacrylamide gel, which contained 3.75 ml acrylamide

40%, 400 µl APS 20%, 10 µl TEMED, 1.5 ml TBE 10x and 24 ml H2O. 120V were applied to the gel in 0.5x TBE buffer for 1 h before loading of the samples and electrophoresis was continued for further 1.5–2 h with the samples. The gel was dried on a Whatmann 3MM paper (Whatman; Schleicher&Schüll, Dassel) in a SE1160 gel dryer (Hoefer Sci- enctific Instruments). RX X-ray films (FUJI Medical) were exposed for autoradiography at -80°C for 12–48 h and then developed in a X-Omat 1000 processor film developer (Kodak).

5.2.9 Image analysis and statistics

5.2.9.1 Quantiﬁcation of immunohistochemistry

After immunohistochemistry and documentation, the number of immunoreactive cells in the adrenal gland was counted when nuclear markers were stained. For all other markers, the immunoreactive area of the adrenal gland was determined morphometrically using NIH Image J software. The size of the labeled region was measured by summariz- ing suprathreshold zones regardless of variations in brightness. At 12.5 dpc, the adrenal gland was identified as the region containing SF1-positive cells, and quantifications were shown as the actual mean number of immunoreactive cells or the actual size of the immunoreactive area per section. At 18.5 dpc, the complete area of the adrenal gland was calculated in parallel to the immunoreactive areas, with the outer margin of the βHSD- immunoreactivity serving to demarcate the adrenal gland. Quantifications for nuclear markers at this embryo stage were shown as the mean number of positive cells per unit area of the complete adrenal gland. Immunoreactive areas for all other markers were ex- presssed as percentage of the whole adrenal gland at 18.5 dpc. The combined immunoreactivity for βHSD as a cortical marker, and TH as a medullary marker accounted for 80±2% of the total adrenal gland area, with the remaining 20% corresponding to inter-

98 5.2 Methods cellular space and connective tissue. Data were obained from at least ﬁve adrenal glands for each genotype.

5.2.9.2 Image editing and statistical analysis

Images were edited with Adobe Photoshop CS, CS2 or CS3 or Corel Draw 12. Area measurements for quantiﬁcation were performed with ImageJ software (NIH, Bethesda). For statistical analysis GraphPad-Prism 4.0 software (GraphPad Software Inc., La Jolla) was used.

Abbreviations

aa1 CIR 71-73 to AAA mutation of the Sox10 protein APS ammonium persulphate bHLH basic helix-loop-helix protein β-Gal β-galactosidase BMP bone morphogenetic protein Brn2 Brain2 BSA bovine serum albumine CNS central nervous system Cy2, Cy3 carbocyanine 2 and 3 DAPI 4’,6-diamidino-2’-phenylindole-dihydrochlorid DBH dopamin-β-hydroxylase DIG digoxygenine DMEM Dulbecco’s Modified Eagle’s Medium DMSO dimethylsulfoxide DNA deoxyribonucleic acid DNase deoxyribonuclease dNTP deoxyribonucleoside-5’-triphosphate Dom Dominant megacolon mutation dpc days post coitum DTT dithiothreitol ECL enhanced chemiluminescence E. coli Escherichia coli EDTA ethylenediaminetetraacetate ErbB2, ErbB3 avian erythroblastosis viral (v-erb-B2) oncogene B2, 3 FCS fetal calf serum FGF fibroblast growth factor Fig. figure fwd forward GFP green fluorescent protein GR glucocorticoid receptor h hour(s) HEPES N-2-hydroxyethylpiperazine-N’-2’ethanesulfonic acid

101 Abbreviations

HMG-box high-mobility-group box IPTG isopropyl-β-D-thiogalactopyranoside ISE Immature Schwann cell Element kb kilo base pairs LacZ β-galactosidase-gene from E.coli LEF-1 lymphoid enhancer factor 1 M, mM, µm molar, millimolar, micromolar mA milliAmpere MAG myelin-associated glycoprotein Mash1 mammalian achaete scute homolog 1 MBP myelin basic protein mg, µg, ng milligram, microgram, nanogram min minute(s) ml, µl milliliter, microliter mm, µm millimeter, micrometer MSE Myelinating Schwann cell Element NF neuroﬁlament NFAT nuclear factor of activated T-cells NGF nerve growth factor NIH National Institutes of Health NLS nuclear localization signal Oct6 octamer-binding transcription factor 6 o/n over night

P0 myelin protein zero PBS phosphate buffered saline PCR polymerase chain reaction PCWH peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, Waardenburg syndrome and Hirschsprung disease pH -log H+ concentration Phox2a/b paired-like homeobox 2a/b PLP proteolipid protein PNMT phenylethanolamin-N-methyltransferase PNS peripheral nervous system poly-dGdC poly-deoxy-guanylate-deoxy-cytidylate POU Pit1-Oct1/2-Unc86 rev reverse rpm rounds per minute SA sympathoadrenal SCE Schwann cell Element

102 SCG10 superior cervical ganglion 10 SDS sodium dodecyl sulphate sec second(s) SF1 steroidogenic faktor 1 SIF small intensely ﬂuorescent Sox Sry-like HMG-box protein SRY sex determining region Y chromosome TA transactivation domain TBE Tris/boric acid/EDTA TCF T-cell-factor TEMED N,N,N’,N’-Tetramethylethylenediamine TH tyrosine hydroxylase Tris Tris-hydroxymethyl-aminomethane TUNEL terminal dUTP nick end labeling Tween-20 polysorbate 20 U Unit v volume V Volt VMAT-1 vesicular monoamine transporter 1 w weight X-Gal 5-Brom-4-chlor-3-indolyl-β-D-galactopyranosid

103

Bibliography

Anderson, D. J.: 1993, Molecular control of cell fate in the neural crest: the sympathoadrenal lineage., Annu Rev Neurosci 16, 129–158. Anderson, D. J., Carnahan, J. F., Michelsohn, A. and Patterson, P. H.: 1991, Antibody markers identify a common progenitor to sympathetic neurons and chromaffin cells in vivo and reveal the timing of commitment to neuronal differentiation in the sympathoadrenal lineage., J Neurosci 11(11), 3507–3519. Ausubel, F., Brent, R., Kingston, R., Moore, D., Seidman, J., Smith, J. and Struhl, K.: 2002, Current Protocols in Molecular Biology., New York: John Wiley & Sons. Büchmann-Møller, S., Miescher, I., John, N., Krishnan, J., Deng, C.-X. and Sommer, L.: 2009, Multiple lineage-specific roles of smad4 during neural crest development., Dev Biol 330(2), 329–338. Bermingham, J. R., Scherer, S. S., O’Connell, S., Arroyo, E., Kalla, K. A., Powell, F. L. and Rosenfeld, M. G.: 1996, Tst-1/oct-6/scip regulates a unique step in peripheral myelination and is required for normal respiration., Genes Dev 10(14), 1751–1762. Bernard, P. and Harley, V. R.: 2010, Acquisition of sox transcription factor specificity through protein-protein interaction, modulation of wnt signalling and post-translational modification., Int J Biochem Cell Biol 42(3), 400–410. Bowles, J., Schepers, G. and Koopman, P.: 2000, Phylogeny of the sox family of developmental transcription factors based on sequence and structural indicators., Dev Biol 227(2), 239–255. Britsch, S., Goerich, D. E., Riethmacher, D., Peirano, R. I., Rossner, M., Nave, K. A., Birchmeier, C. and Wegner, M.: 2001, The transcription factor sox10 is a key regulator of peripheral glial development., Genes Dev 15(1), 66–78. Britsch, S., Li, L., Kirchhoff, S., Theuring, F., Brinkmann, V., Birchmeier, C. and Riethmacher, D.: 1998, The erbb2 and erbb3 receptors and their ligand, neuregulin-1, are essential for development of the sympathetic nervous system., Genes Dev 12(12), 1825–1836. Cheung, M. and Briscoe, J.: 2003, Neural crest development is regulated by the transcription factor sox9., Development 130(23), 5681–5693. Cossais, F., Sock, E., Hornig, J., Schreiner, S., Kellerer, S., Bösl, M. R., Russell, S. and Wegner, M.: 2010a, Replacement of mouse sox10 by the drosophila ortholog sox100b provides evidence

105 Bibliography

for co-option of soxe proteins into vertebrate-specific gene-regulatory networks through altered expression., Dev Biol 341(1), 267–281. Cossais, F., Wahlbuhl, M., Kriesch, J. and Wegner, M.: 2010, Sox10 structure-function analysis in the chicken neural tube reveals important insights into its role in human neurocristopathies., Hum Mol Genet . Cserjesi, P., Brown, D., Lyons, G. E. and Olson, E. N.: 1995, Expression of the novel basic helix- loop-helix gene ehand in neural crest derivatives and extraembryonic membranes during mouse development., Dev Biol 170(2), 664–678. Dailey, L. and Basilico, C.: 2001, Coevolution of hmg domains and homeodomains and the generation of transcriptional regulation by sox/pou complexes., J Cell Physiol 186(3), 315–328. Douarin, N. M. L., Creuzet, S., Couly, G. and Dupin, E.: 2004, Neural crest cell plasticity and its limits., Development 131(19), 4637–4650. Eränkö, O.: 1978, Small intensely fluorescent (sif) cells and nervous transmission in sympathetic ganglia., Annu Rev Pharmacol Toxicol 18, 417–430. Ernsberger, U., Esposito, L., Partimo, S., Huber, K., Franke, A., Bixby, J. L., Kalcheim, C. and Unsicker, K.: 2005, Expression of neuronal markers suggests heterogeneity of chick sympathoadrenal cells prior to invasion of the adrenal anlagen., Cell Tissue Res 319(1), 1–13. Ernsberger, U., Patzke, H., Tissier-Seta, J. P., Reh, T., Goridis, C. and Rohrer, H.: 1995, The expression of tyrosine hydroxylase and the transcription factors cphox-2 and cash-1: evidence for distinct inductive steps in the differentiation of chick sympathetic precursor cells., Mech Dev 52(1), 125–136. Finotto, S., Krieglstein, K., Schober, A., Deimling, F., Lindner, K., Brühl, B., Beier, K., Metz, J., Garcia-Arraras, J. E., Roig-Lopez, J. L., Monaghan, P., Schmid, W., Cole, T. J., Kellendonk, C., Tronche, F., Schütz, G. and Unsicker, K.: 1999, Analysis of mice carrying targeted mutations of the glucocorticoid receptor gene argues against an essential role of glucocorticoid signalling for generating adrenal chromaffin cells., Development 126(13), 2935–2944. Finzsch, M., Schreiner, S., Kichko, T., Reeh, P., Tamm, E. R., Bösl, M. R., Meijer, D. and Wegner, M.: 2010, Sox10 is required for schwann cell identity and progression beyond the immature schwann cell stage., J Cell Biol 189(4), 701–712. Garratt, A. N., Voiculescu, O., Topilko, P., Charnay, P. and Birchmeier, C.: 2000, A dual role of erbb2 in myelination and in expansion of the schwann cell precursor pool., J Cell Biol 148(5), 1035–1046. Ghislain, J. and Charnay, P.: 2006, Control of myelination in schwann cells: a krox20 cis- regulatory element integrates oct6, brn2 and sox10 activities., EMBO Rep 7(1), 52–58. Ghislain, J., Desmarquet-Trin-Dinh, C., Jaegle, M., Meijer, D., Charnay, P. and Frain, M.: 2002, Characterisation of cis-acting sequences reveals a biphasic, axon-dependent regulation of krox20 during schwann cell development., Development 129(1), 155–166.

106 Bibliography

Goridis, C. and Rohrer, H.: 2002, Speciﬁcation of catecholaminergic and serotonergic neurons., Nat Rev Neurosci 3(7), 531–541.

Groves, A. K., George, K. M., Tissier-Seta, J. P., Engel, J. D., Brunet, J. F. and Anderson, D. J.: 1995, Differential regulation of transcription factor gene expression and phenotypic markers in developing sympathetic neurons., Development 121(3), 887–901.

Guillemot, F. and Joyner, A. L.: 1993, Dynamic expression of the murine achaete-scute homo- logue mash-1 in the developing nervous system., Mech Dev 42(3), 171–185.

Guillemot, F., Lo, L. C., Johnson, J. E., Auerbach, A., Anderson, D. J. and Joyner, A. L.: 1993, Mammalian achaete-scute homolog 1 is required for the early development of olfactory and autonomic neurons., Cell 75(3), 463–476.

Gut, P., Huber, K., Lohr, J., Brühl, B., Oberle, S., Treier, M., Ernsberger, U., Kalcheim, C. and Un- sicker, K.: 2005, Lack of an adrenal cortex in sf1 mutant mice is compatible with the generation and differentiation of chromafﬁn cells., Development 132(20), 4611–4619.

Haldin, C. E. and LaBonne, C.: 2010, Soxe factors as multifunctional neural crest regulatory factors., Int J Biochem Cell Biol 42(3), 441–444.

Harley, V. R., Lovell-Badge, R. and Goodfellow, P. N.: 1994, Deﬁnition of a consensus dna binding site for sry., Nucleic Acids Res 22(8), 1500–1501.

Hendershot, T. J., Liu, H., Clouthier, D. E., Shepherd, I. T., Coppola, E., Studer, M., Firulli, A. B., Pittman, D. L. and Howard, M. J.: 2008, Conditional deletion of hand2 reveals critical functions in neurogenesis and cell type-speciﬁc gene expression for development of neural crest-derived noradrenergic sympathetic ganglion neurons., Dev Biol 319(2), 179–191.

Herbarth, B., Pingault, V., Bondurand, N., Kuhlbrodt, K., Hermans-Borgmeyer, I., Puliti, A., Lemort, N., Goossens, M. and Wegner, M.: 1998, Mutation of the sry-related sox10 gene in dominant megacolon, a mouse model for human hirschsprung disease., Proc Natl Acad Sci U S A 95(9), 5161–5165.

Hong, C.-S. and Saint-Jeannet, J.-P.: 2005, Sox proteins and neural crest development., Semin Cell Dev Biol 16(6), 694–703.

Hong, S. J., Huh, Y., Chae, H., Hong, S., Lardaro, T. and Kim, K.-S.: 2006, Gata-3 regulates the transcriptional activity of tyrosine hydroxylase by interacting with creb., J Neurochem 98(3), 773–781.

Huber, K.: 2006, The sympathoadrenal cell lineage: speciﬁcation, diversiﬁcation, and new per- spectives., Dev Biol 298(2), 335–343.

Huber, K., Brühl, B., Guillemot, F., Olson, E. N., Ernsberger, U. and Unsicker, K.: 2002, Devel- opment of chromafﬁn cells depends on mash1 function., Development 129(20), 4729–4738.

Huber, K., Franke, A., Brühl, B., Krispin, S., Ernsberger, U., Schober, A., von Bohlen und Hal- bach, O., Rohrer, H., Kalcheim, C. and Unsicker, K.: 2008, Persistent expression of bmp-4 in

107 Bibliography

embryonic chick adrenal cortical cells and its role in chromaffin cell development., Neural Dev 3, 28. Huber, K., Kalcheim, C. and Unsicker, K.: 2009, The development of the chromaffin cell lineage from the neural crest., Auton Neurosci 151(1), 10–16. Huber, K., Karch, N., Ernsberger, U., Goridis, C. and Unsicker, K.: 2005, The role of phox2b in chromaffin cell development., Dev Biol 279(2), 501–508. Inoue, K., Khajavi, M., Ohyama, T., ichi Hirabayashi, S., Wilson, J., Reggin, J. D., Mancias, P., Butler, I. J., Wilkinson, M. F., Wegner, M. and Lupski, J. R.: 2004, Molecular mechanism for distinct neurological phenotypes conveyed by allelic truncating mutations., Nat Genet 36(4), 361–369. Jaegle, M., Ghazvini, M., Mandemakers, W., Piirsoo, M., Driegen, S., Levavasseur, F., Raghoe- nath, S., Grosveld, F. and Meijer, D.: 2003, The pou proteins brn-2 and oct-6 share important functions in schwann cell development., Genes Dev 17(11), 1380–1391. Jaegle, M., Mandemakers, W., Broos, L., Zwart, R., Karis, A., Visser, P., Grosveld, F. and Meijer, D.: 1996, The pou factor oct-6 and schwann cell differentiation., Science 273(5274), 507–510. Jessen, K. R. and Mirsky, R.: 2005, The origin and development of glial cells in peripheral nerves., Nat Rev Neurosci 6(9), 671–682. Kao, S.-C., Wu, H., Xie, J., Chang, C.-P., Ranish, J. A., Graef, I. A. and Crabtree, G. R.: 2009, Calcineurin/nfat signaling is required for neuregulin-regulated schwann cell differentiation., Science 323(5914), 651–654. Kapur, R. P.: 1999, Early death of neural crest cells is responsible for total enteric aganglionosis in sox10(dom)/sox10(dom) mouse embryos., Pediatr Dev Pathol 2(6), 559–569. Kellerer, S., Schreiner, S., Stolt, C. C., Scholz, S., Bösl, M. R. and Wegner, M.: 2006, Replacement of the sox10 transcription factor by sox8 reveals incomplete functional equivalence., Develop- ment 133(15), 2875–2886. Kim, J., Lo, L., Dormand, E. and Anderson, D. J.: 2003, Sox10 maintains multipotency and inhibits neuronal differentiation of neural crest stem cells., Neuron 38(1), 17–31. Knecht, A. K. and Bronner-Fraser, M.: 2002, Induction of the neural crest: a multigene process., Nat Rev Genet 3(6), 453–461. Kondoh, H. and Kamachi, Y.: 2010, Sox-partner code for cell specification: Regulatory target selection and underlying molecular mechanisms., Int J Biochem Cell Biol 42(3), 391–399. Kuhlbrodt, K., Herbarth, B., Sock, E., Hermans-Borgmeyer, I. and Wegner, M.: 1998, Sox10, a novel transcriptional modulator in glial cells., J Neurosci 18(1), 237–250. Ladas, T., Chan, S.-A., Ogier, M., Smith, C. and Katz, D. M.: 2009, Enhanced dense core gran- ule function and adrenal hypersecretion in a mouse model of rett syndrome., Eur J Neurosci 30(4), 602–610.

108 Bibliography

Laudet, V., Stehelin, D. and Clevers, H.: 1993, Ancestry and diversity of the hmg box superfamily., Nucleic Acids Res 21(10), 2493–2501. Le, N., Nagarajan, R., Wang, J. Y. T., Araki, T., Schmidt, R. E. and Milbrandt, J.: 2005, Analysis of congenital hypomyelinating egr2lo/lo nerves identifies sox2 as an inhibitor of schwann cell differentiation and myelination., Proc Natl Acad Sci U S A 102(7), 2596–2601. Lim, K. C., Lakshmanan, G., Crawford, S. E., Gu, Y., Grosveld, F. and Engel, J. D.: 2000, Gata3 loss leads to embryonic lethality due to noradrenaline deficiency of the sympathetic nervous system., Nat Genet 25(2), 209–212. Lo, L., Morin, X., Brunet, J. F. and Anderson, D. J.: 1999, Specification of neurotransmitter identity by phox2 proteins in neural crest stem cells., Neuron 22(4), 693–705. Lohr, J., Gut, P., Karch, N., Unsicker, K. and Huber, K.: 2006, Development of adrenal chromaffin cells in sf1 heterozygous mice., Cell Tissue Res 325(3), 437–444. Loring, J. F. and Erickson, C. A.: 1987, Neural crest cell migratory pathways in the trunk of the chick embryo., Dev Biol 121(1), 220–236. Lucas, M. E., Müller, F., Rüdiger, R., Henion, P. D. and Rohrer, H.: 2006, The bhlh transcription factor hand2 is essential for noradrenergic differentiation of sympathetic neurons., Development 133(20), 4015–4024. Maka, M., Stolt, C. C. and Wegner, M.: 2005, Identification of sox8 as a modifier gene in a mouse model of hirschsprung disease reveals underlying molecular defect., Dev Biol 277(1), 155–169. Mandemakers, W., Zwart, R., Jaegle, M., Walbeehm, E., Visser, P., Grosveld, F. and Meijer, D.: 2000, A distal schwann cell-specific enhancer mediates axonal regulation of the oct-6 transcription factor during peripheral nerve development and regeneration., EMBO J 19(12), 2992–3003. Michelsohn, A. M. and Anderson, D. J.: 1992, Changes in competence determine the timing of two sequential glucocorticoid effects on sympathoadrenal progenitors., Neuron 8(3), 589–604. Müller, F. and Rohrer, H.: 2002, Molecular control of ciliary neuron development: Bmps and downstream transcriptional control in the parasympathetic lineage., Development 129(24), 5707–5717. Moriguchi, T., Lim, K.-C. and Engel, J. D.: 2007, Transcription factor networks specify sympathetic and adrenal chromaffin cell differentiation, Functional Development and Embryology 1(2), 130–135. Moriguchi, T., Takako, N., Hamada, M., Maeda, A., Fujioka, Y., Kuroha, T., Huber, R. E., Hasegawa, S. L., Rao, A., Yamamoto, M., Takahashi, S., Lim, K.-C. and Engel, J. D.: 2006, Gata3 participates in a complex transcriptional feedback network to regulate sympathoadrenal differentiation., Development 133(19), 3871–3881. Morikawa, Y., Dai, Y.-S., Hao, J., Bonin, C., Hwang, S. and Cserjesi, P.: 2005, The basic helix-loop-helix factor hand 2 regulates autonomic nervous system development., Dev Dyn 234(3), 613–621.

109 Bibliography

Morikawa, Y., D’Autréaux, F., Gershon, M. D. and Cserjesi, P.: 2007, Hand2 determines the noradrenergic phenotype in the mouse sympathetic nervous system., Dev Biol 307(1), 114–126.

Morin, X., Cremer, H., Hirsch, M. R., Kapur, R. P., Goridis, C. and Brunet, J. F.: 1997, Defects in sensory and autonomic ganglia and absence of locus coeruleus in mice deﬁcient for the homeobox gene phox2a., Neuron 18(3), 411–423.

O’Bryan, M. K., Takada, S., Kennedy, C. L., Scott, G., Harada, S., Ray, M. K., Dai, Q., Wilhelm, D., de Kretser, D. M., Eddy, E. M., Koopman, P. and Mishina, Y.: 2008, Sox8 is a critical regulator of adult sertoli cell function and male fertility., Dev Biol 316(2), 359–370.

Paratore, C., Eichenberger, C., Suter, U. and Sommer, L.: 2002, Sox10 haploinsufﬁciency affects maintenance of progenitor cells in a mouse model of hirschsprung disease., Hum Mol Genet 11(24), 3075–3085.

Paratore, C., Goerich, D. E., Suter, U., Wegner, M. and Sommer, L.: 2001, Survival and glial fate acquisition of neural crest cells are regulated by an interplay between the transcription factor sox10 and extrinsic combinatorial signaling., Development 128(20), 3949–3961.

Parlato, R., Otto, C., Begus, Y., Stotz, S. and Schütz, G.: 2007, Speciﬁc ablation of the transcription factor creb in sympathetic neurons surprisingly protects against developmentally regulated apoptosis., Development 134(9), 1663–1670.

Parlato, R., Otto, C., Tuckermann, J., Stotz, S., Kaden, S., Gröne, H.-J., Unsicker, K. and Schütz, G.: 2009, Conditional inactivation of glucocorticoid receptor gene in dopamine-beta- hydroxylase cells impairs chromafﬁn cell survival., Endocrinology 150(4), 1775–1781.

Pattyn, A., Guillemot, F. and Brunet, J.-F.: 2006, Delays in neuronal differentiation in mash1/ascl1 mutants., Dev Biol 295(1), 67–75.

Pattyn, A., Morin, X., Cremer, H., Goridis, C. and Brunet, J. F.: 1999, The homeobox gene phox2b is essential for the development of autonomic neural crest derivatives., Nature 399(6734), 366– 370.

Peirano, R. I., Goerich, D. E., Riethmacher, D. and Wegner, M.: 2000, Protein zero gene expression is regulated by the glial transcription factor sox10., Mol Cell Biol 20(9), 3198–3209.

Peirano, R. I. and Wegner, M.: 2000, The glial transcription factor sox10 binds to dna both as monomer and dimer with different functional consequences., Nucleic Acids Res 28(16), 3047– 3055.

Poliak, S. and Peles, E.: 2003, The local differentiation of myelinated axons at nodes of ranvier., Nat Rev Neurosci 4(12), 968–980.

Reissmann, E., Ernsberger, U., Francis-West, P. H., Rueger, D., Brickell, P. M. and Rohrer, H.: 1996, Involvement of bone morphogenetic protein-4 and bone morphogenetic protein-7 in the differentiation of the adrenergic phenotype in developing sympathetic neurons., Development 122(7), 2079–2088.

110 Bibliography

Riethmacher, D., Sonnenberg-Riethmacher, E., Brinkmann, V., Yamaai, T., Lewin, G. R. and Birchmeier, C.: 1997, Severe neuropathies in mice with targeted mutations in the erbb3 receptor., Nature 389(6652), 725–730.

Ross, M. E., Evinger, M. J., Hyman, S. E., Carroll, J. M., Mucke, L., Comb, M., Reis, D. J., Joh, T. H. and Goodman, H. M.: 1990, Identiﬁcation of a functional glucocorticoid response element in the phenylethanolamine n-methyltransferase promoter using fusion genes introduced into chromafﬁn cells in primary culture., J Neurosci 10(2), 520–530.

Rychlik, J. L., Hsieh, M., Eiden, L. E. and Lewis, E. J.: 2005, Phox2 and dhand transcription factors select shared and unique target genes in the noradrenergic cell type., J Mol Neurosci 27(3), 281–292.

Sambrook, J., Fritsch, E. and Maniatis, T.: 2001, Molecular Cloning: A Laboratory Manual., Cold Spring Harbor: Cold Spring Harbor Press.

Sauka-Spengler, T. and Bronner-Fraser, M.: 2008, A gene regulatory network orchestrates neural crest formation., Nat Rev Mol Cell Biol 9(7), 557–568.

Schepers, G. E., Bullejos, M., Hosking, B. M. and Koopman, P.: 2000, Cloning and characterisation of the sry-related transcription factor gene sox8., Nucleic Acids Res 28(6), 1473–1480.

Schlierf, B., Ludwig, A., Klenovsek, K. and Wegner, M.: 2002, Cooperative binding of sox10 to dna: requirements and consequences., Nucleic Acids Res 30(24), 5509–5516.

Schlierf, B., Werner, T., Glaser, G. and Wegner, M.: 2006, Expression of connexin47 in oligodendrocytes is regulated by the sox10 transcription factor., J Mol Biol 361(1), 11–21.

Schmidt, K., Schinke, T., Haberland, M., Priemel, M., Schilling, A. F., Mueldner, C., Rueger, J. M., Sock, E., Wegner, M. and Amling, M.: 2005, The high mobility group transcription factor sox8 is a negative regulator of osteoblast differentiation., J Cell Biol 168(6), 899–910.

Schneider, C., Wicht, H., Enderich, J., Wegner, M. and Rohrer, H.: 1999, Bone morphogenetic proteins are required in vivo for the generation of sympathetic neurons., Neuron 24(4), 861–870.

Schreiner, S., Cossais, F., Fischer, K., Scholz, S., Bösl, M. R., Holtmann, B., Sendtner, M. and Wegner, M.: 2007, Hypomorphic sox10 alleles reveal novel protein functions and unravel developmental differences in glial lineages., Development 134(18), 3271–3281.

Shah, N. M., Groves, A. K. and Anderson, D. J.: 1996, Alternative neural crest cell fates are instructively promoted by tgfbeta superfamily members., Cell 85(3), 331–343.

Sock, E., Schmidt, K., Hermanns-Borgmeyer, I., Bösl, M. R. and Wegner, M.: 2001, Idiopathic weight reduction in mice deﬁcient in the high-mobility-group transcription factor sox8., Mol Cell Biol 21(20), 6951–6959.

Southard-Smith, E. M., Kos, L. and Pavan, W. J.: 1998, Sox10 mutation disrupts neural crest development in dom hirschsprung mouse model., Nat Genet 18(1), 60–64.

111 Bibliography

Stolt, C. C., Lommes, P., Friedrich, R. P. and Wegner, M.: 2004, Transcription factors sox8 and sox10 perform non-equivalent roles during oligodendrocyte development despite functional redundancy., Development 131(10), 2349–2358.

Stolt, C. C., Rehberg, S., Ader, M., Lommes, P., Riethmacher, D., Schachner, M., Bartsch, U. and Wegner, M.: 2002, Terminal differentiation of myelin-forming oligodendrocytes depends on the transcription factor sox10., Genes Dev 16(2), 165–170.

Stolt, C. C. and Wegner, M.: 2010, Soxe function in vertebrate nervous system development., Int J Biochem Cell Biol 42(3), 437–440.

Svaren, J. and Meijer, D.: 2008, The molecular machinery of myelin gene transcription in schwann cells., Glia 56(14), 1541–1551.

Topilko, P., Levi, G., Merlo, G., Mantero, S., Desmarquet, C., Mancardi, G. and Charnay, P.: 1997, Differential regulation of the zinc ﬁnger genes krox-20 and krox-24 (egr-1) suggests antagonistic roles in schwann cells., J Neurosci Res 50(5), 702–712.

Topilko, P., Schneider-Maunoury, S., Levi, G., Evercooren, A. B.-V., Chennouﬁ, A. B., Seitanidou, T., Babinet, C. and Charnay, P.: 1994, Krox-20 controls myelination in the peripheral nervous system., Nature 371(6500), 796–799.

Tsarovina, K., Pattyn, A., Stubbusch, J., Müller, F., van der Wees, J., Schneider, C., Brunet, J.-F. and Rohrer, H.: 2004, Essential role of gata transcription factors in sympathetic neuron development., Development 131(19), 4775–4786.

Unsicker, K.: 1993, The chromafﬁn cell: paradigm in cell, developmental and growth factor biology., J Anat 183 ( Pt 2), 207–221.

Warner, L. E., Mancias, P., Butler, I. J., McDonald, C. M., Keppen, L., Koob, K. G. and Lupski, J. R.: 1998, Mutations in the early growth response 2 (egr2) gene are associated with hereditary myelinopathies., Nat Genet 18(4), 382–384.

Wegner, M.: 1999, From head to toes: the multiple facets of sox proteins., Nucleic Acids Res 27(6), 1409–1420.

Wegner, M.: 2010, All purpose sox: The many roles of sox proteins in gene expression., Int J Biochem Cell Biol 42(3), 381–390.

Wegner, M. and Stolt, C. C.: 2006, Transcription Factors in the Nervous System, Wiley-VCH, chapter 10, pp. 181–197.

Wildner, H., Gierl, M. S., Strehle, M., Pla, P. and Birchmeier, C.: 2008, Insm1 (ia-1) is a crucial component of the transcriptional network that controls differentiation of the sympatho-adrenal lineage., Development 135(3), 473–481.

Wissmüller, S., Kosian, T., Wolf, M., Finzsch, M. and Wegner, M.: 2006, The high-mobility- group domain of sox proteins interacts with dna-binding domains of many transcription factors., Nucleic Acids Res 34(6), 1735–1744.

112 Bibliography

Wolpowitz, D., Mason, T. B., Dietrich, P., Mendelsohn, M., Talmage, D. A. and Role, L. W.: 2000, Cysteine-rich domain isoforms of the neuregulin-1 gene are required for maintenance of peripheral synapses., Neuron 25(1), 79–91. Yamamoto, M., Yanai, R. and Arishima, K.: 2004, Study of migration of neural crest cells to adrenal medulla by three-dimensional reconstruction., J Vet Med Sci 66(6), 635–641. Yang, C., Kim, H. S., Seo, H., Kim, C. H., Brunet, J. F. and Kim, K. S.: 1998, Paired-like homeodomain proteins, phox2a and phox2b, are responsible for noradrenergic cell-speciﬁc transcription of the dopamine beta-hydroxylase gene., J Neurochem 71(5), 1813–1826. Zorick, Syroid, Arroyo, Scherer and Lemke: 1996, The transcription factors scip and krox-20 mark distinct stages and cell fates in schwann cell differentiation, Mol Cell Neurosci 8(2/3), 129–145.

113

Publications & Presentations

Publications

Simone Reiprich, C. Claus Stolt, Silke Schreiner, Rosanna Parlato, and Michael Wegner. 2008. SoxE Proteins Are Differentially Required in Mouse Adrenal Gland Development. Molecular Biology of the Cell.19: 1575–1586.

Michael Wolf, Petra Lommes, Elisabeth Sock, Simone Reiprich, Ralf P. Friedrich, Jana Kriesch, C. Claus Stolt, John R. Bermingham Jr., and Michael Wegner. 2009. Replacement of related POU transcription factors leads to severe defects in mouse fore- brain development. Developmental Biology.332: 418–428.

Simone Reiprich, Jana Kriesch, Silke Schreiner, and Michael Wegner. 2010. Ac- tivation of Krox20 gene expression by Sox10 in myelinating Schwann cells. Journal of Neuroscience.112: 744–754.

Presentations

Simone Reiprich, C. Claus Stolt, Silke Schreiner, and Michael Wegner. SoxE Pro- teins Are Differentially Required in Mouse Adrenal Gland Development. (Poster) Annual Meeting of the Society for Neuroscience. 3.–7.11.2007, San Diego, USA.

Simone Reiprich. SoxE Proteins in Mouse Adrenal Gland Development. (Talk) Neuro- und entwicklungsgenetisches Kolloquium. 24.06.2008, Erlangen, Deutschland.

Simone Reiprich, Jana Kriesch, Matthias Weider, and Michael Wegner. Activation of Krox20 gene expression by Sox10 in myelinating Schwann cells. (Poster) European Glial Cell Meeting. 8.–12.09.2009, Paris, Frankreich.

115

Lebenslauf

Persönliche Daten: Name: Simone Reiprich Geburtsdatum: 05.07.1983 Geburtsort: Erding Staatsangehörigkeit: Deutsch

Schulbildung: 1989 – 1993 Grundschule Erding 1993 – 2002 Gymnasium Erding 2002 Erwerb der Allgemeinen Hochschulreife

Studium: 2002 – 2007 Studium der Molekularen Medizin, FAU Erlangen-Nürnberg 2004 Diplomvorprüfung 2007 Diplomhauptprüfung 2006 –2007 Diplomarbeit am Institut für Biochemie Die Rolle von Sox-Proteinen in der Entwicklung der Nebenniere 2007 Diplom der Molekularen Medizin

Promotion: 2007 –2010 Dissertation durchgeführt am Institut für Biochemie der Universität Erlangen-Nürnberg unter der Leitung von Prof. Dr. M. Wegner im Rahmen des Graduierten-Programms BIGSS (BioMedTec International Graduate School of Science) Thema: Die Bedeutung von SoxE-Transkriptionsfaktoren für die Entwicklung von Neuralleistenderivaten

Danksagung

Mein Dank gilt Prof. Dr. Michael Wegner für die intensive und unmittelbare Betreuung während der gesamten Phase meiner Doktorarbeit, für die Zielstrebigkeit, Projekte voran und zu Ende zu bringen, und für die Herausforderungen, an denen ich wachsen konnte.

Prof. Dr. Manfred Frasch danke ich für die freundliche Übernahme der Zweitberichterstattung.

Ich bedanke mich für die Förderung und Finanzierung durch das Promotionsprogramm BIGSS. Die Angebote zur Weiterbildung und die Möglichkeit zu reisen waren eine echte Bereicherung! In diesem Zusammenhang möchte ich auch allen Doktoranden aus BIGSS für den guten Zusammenhalt und die erfolgreiche Organisation der Summer School in Erlangen danken!

Ein besonderer Dank gilt Claus Stolt für die fachliche und seelische Unterstützung bei so vielen Fragen und Problemen; dafür dass jemand versteht, dass die letzten 20% zur Vollendung 80% der Zeit kosten; für die eingehenden Diskussionen über Protokolle und Rezepte - nicht nur für die Laborküche - und nicht zuletzt für das Ertragen meiner Launen in den letzten Wochen!

Meine Korrekturleser Claus Stolt, Jill de Jong und Magdalena Bremer haben wesentlich zu der schnellen Fertigstellung dieser Arbeit beigetragen! Danke für das zügige Lesen und die hilfreichen Anmerkungen!

Mandy Wahlbuhl, Magdalena Bremer, Markus Finzsch, Michaela Potzner, Claus Stolt und Matthias Weider danke ich besonders dafür, dass sie der "harte Kern"sind und wir so viele unterhaltsame Stunden miteinander verbracht haben!

Für die nette Bench-Nachbarschaft und die geduldige Unterstützung bei tausenden von Minis und vielen anderen Experimenten bedanke ich mich ganz besonders bei Jana Kriesch!

Jeden Tag wieder gerne ins Labor zu kommen, war das schönste Anzeichen dafür, dass das Labor nicht nur mein Arbeitsplatz, sondern immer auch ein bisschen mein Zuhause war. Dafür sage ich Danke - jedem, der auf seine Art und Weise dazu beigetragen hat!

Außerhalb des Labors gilt ein ganz großer Dank meiner Mitbewohnerin Jill de Jong für "Ich halte Dir den Rücken frei!". Und ein Danke geht auch an den Molmädels-Stammtisch und die fachliche und nicht-fachliche Unterstützung und Anteilnahme!

Ein Dank von ganzem Herzen gilt meiner Mutter und meinem Vater für die unerschütterliche Sicherheit in meinem Leben, die mir so viel Freiheit gibt!