Biochemical Characterization of the Maize Cytokinin Dehydrogenase

Plant Physiology and Biochemistry 74 (2014) 283e293

Contents lists available at ScienceDirect

Plant Physiology and Biochemistry

journal homepage: www.elsevier.com/locate/plaphy

Research article Biochemical characterization of the maize cytokinin dehydrogenase family and cytokinin proﬁling in developing maize plantlets in relation to the expression of cytokinin dehydrogenase genes

David Zalabák a, Petr Galuszka a, Katarina Mrízová a, Katerina Podlesáková b, Riliang Gu c, Jitka Frébortová b,* a Centre of the Region Haná for Biotechnological and Agricultural Research, Department of Molecular Biology, Slechtitelu 11, Olomouc 783 71, Czech Republic b Centre of the Region Haná for Biotechnological and Agricultural Research, Department of Chemical Biology and Genetics, Slechtitelu11, Olomouc 783 71, Czech Republic c Key Lab of Plant Nutrition, MOA, College of Resources and Environmental Science, China Agricultural University, 100193 Beijing, China article info abstract

Article history: The cytokinin dehydrogenases (CKX; EC 1.5.99.12) are a protein family that maintains the endogenous Received 26 September 2013 levels of cytokinins in plants by catalyzing their oxidative degradation. The CKX family in maize (Zea Accepted 19 November 2013 mays L.) has thirteen members, only two of which - ZmCKX1 and ZmCKX10 - have previously been Available online 28 November 2013 characterized in detail. In this study, nine further maize CKX isoforms were heterologously expressed in Escherichia coli, purified by affinity and ion-exchange chromatography and biochemically characterized. Keywords: ZmCKX6 and ZmCKX9 could only be expressed successfully after the removal of putative sequence- Zea mays L. specific vacuolar sorting signals (LLPT and LPTS, respectively), suggesting that these proteins are local- Cytokinin fi Cytokinin dehydrogenase ized to the vacuole. Substrate speci city analyses revealed that the CKX isoforms can be grouped into two fi Escherichia coli IMPACT expression system subfamilies: members of the rst strongly prefer cytokinin free bases while members of the second Substrate preference degrade a broad range of substrates. The most active isoform was found to be ZmCKX1. One of the studied isoforms, ZmCKX6, seemed to encode a nonfunctional enzyme due to a mutation in a conserved HFG protein domain at the C-terminus. Site-directed mutagenesis experiments revealed that this domain is essential for CKX activity. The roles of the maize CKX enzymes in the development of maize seedlings during the two weeks immediately after radicle emergence were also investigated. It appears that ZmCKX1 is a key regulator of active cytokinin levels in developing maize roots. However, the expression of individual CKX isoforms in the shoots varied and none of them seemed to have strong effects on the cytokinin pool. Ó 2013 Elsevier Masson SAS. All rights reserved.

1. Introduction

Cytokinins are ubiquitous plant hormones that govern a wide range of plant developmental and physiological processes. Cyto- Abbreviations: AtCKX, cytokinin dehydrogenase from Arabidopsis thaliana; CKX, kinin homeostasis in plant tissues and organs is crucial for normal cytokinin dehydrogenase; cZ, cis-zeatin; cZ9G, cis-zeatin-N9-glucoside; cZRMP, cis- growth and development, so cytokinin levels within cells, tissues, 0 zeatin riboside-5 -monophosphate; DCPIP, 2,6-dichlorophenolindophenol; DHZ, and organs must be ﬁnely controlled. One of the most important dihydrozeatin; DMAPP, dimethylallyl diphosphate; EDTA, ethylenediaminetetra- mechanisms by which this is achieved involves the irreversible acetic acid; iP, N6-(D2-isopentenyl)adenine; iP9G, N6-(D2-isopentenyl)adenine-N9- glucoside; iPR, N6-(D2-isopentenyl)adenosine; iPRMP, N6-(D2-isopentenyl)adeno- degradation of active cytokinins by cytokinin dehydrogenases. sine-50-monophosphate; IPT, isopentenyl transferase; tZ, trans-zeatin; tZ9G, trans- Cytokinins are chemical compounds that derive from adenine. zeatin-N9-glucoside; tZR, trans-zeatin riboside; tZRMP, trans-zeatin riboside-50- The adenine moiety is substituted with either isoprenoid or aromatic monophosphate; ZmCKX, cytokinin dehydrogenase from Zea mays. side chains at the N6- position to form so-called cytokinin free bases. * Corresponding author. Tel.: þ420 585634871; fax: þ420 585634870. In planta, cytokinins are synthesized from adenosine mono-, di- and E-mail addresses: [email protected] (D. Zalabák), [email protected] (P. Galuszka), [email protected] (K. Mrízová), [email protected] triphosphates and dimethylallyl pyrophosphate (DMAPP), which (K. Podlesáková), [email protected] (R. Gu), [email protected] (J. Frébortová). functions as a side-chain precursor. This biosynthetic process is

0981-9428/$ e see front matter Ó 2013 Elsevier Masson SAS. All rights reserved. http://dx.doi.org/10.1016/j.plaphy.2013.11.020 284 D. Zalabák et al. / Plant Physiology and Biochemistry 74 (2014) 283e293 catalyzed by isopentenyl transferase (IPT; dimethylallyl- 2. Results and discussion diphosphate: AMP dimethylallyltransferase; EC 2.5.1.27) enzymes and yields isopentenyladenine nucleotides (Kakimoto, 2001; Takei 2.1. Heterologous expression and purification of ZmCKXs et al., 2001), which can be further hydroxylated by cytokinin- specific cytochrome P450 monooxygenase to form trans-zeatin nu- ZmCKX proteins were prepared by means of intracellular het- cleotides (Takei et al., 2004). Nucleotides of both isopentenyladenine erologous expression in Escherichia coli using the pTYB12 expres- and trans-zeatin are activated by cytokinin-specific phosphor- sion vector, which enables quick and easy affinity purification of the ibohydrolases to form free bases (Kurakawa et al., 2007), which can inserted protein because it fuses a self-cleavable chitin-binding be further modified, mainly by glycosylation of the adenine moiety intein tag to the protein’s N-terminus. The sole exception was the or the zeatin side chain forming N-glucosides and O-glucosides, ZmCKX1 enzyme, which was prepared in a Pichia pastoris expres- respectively (reviewed by Frébortet al. 2011). sion system (Bilyeu et al., 2001), as the recombinant enzyme ob- Cytokinin dehydrogenases (CKX; N6-dimethylallyladenine: tained by expression of ZmCKX1 gene in yeast was used in most acceptor oxidoreductase; EC 1.5.99.12) are flavoproteins that cata- biochemical studies of ZmCKX1 performed up to date and thus lyze the irreversible cleavage of the side chains from cytokinin served as a reference. molecules. The final products of these cytokinin degradation re- As shown in Arabidopsis, the various CKX isoforms encoded in actions are adenine derivatives and aldehydes formed from the side the genome of an individual species have distinct biochemical chains. It was originally assumed that these enzymes function properties, are expressed in different tissues, and have different exclusively as oxidases, with molecular oxygen serving as the final subcellular localizations (Galuszka et al., 2007; Werner et al., 2003). electron acceptor (Paces et al., 1971). However, they were subse- The localization of each isoform is determined by an N-terminal quently reclassified as dehydrogenases because it was found that sequence motif. In previous experiments, the presence of these they strongly prefer electron acceptors such as quinones rather signal sequences was found to impair the heterologous expression than molecular oxygen (Galuszka et al., 2001; Frébortová et al., of some Arabidopsis CKX isoforms in P. pastoris; this effect could be 2010). alleviated by using expression vectors containing cloned CKX genes The cytokinin dehydrogenases are usually encoded by a small in which the targeting sequences had been removed (Kowalska family of genes. The number of genes within these families et al., 2010). These sequences can also cause undesirable in- varies from species to species: the Arabidopsis thaliana genome has teractions between heterologous proteins and the post-translational seven, but monocot species tend to have more. For example, rice processing machinery of E. coli, resulting in the formation of non- and Brachypodium have 11, and maize has 13 (Mameaux et al., functional heterologous proteins and/or their targeting to inclu- 2012). sion bodies. The predictive tool SignalP 4.0 (Petersen et al., 2011) Even though they catalyze similar reactions, different CKXs have was therefore used to identify sequences encoding potential N- different rates of reaction and substrate preferences (Galuszka terminal signal peptides in the ZmCKX proteins. SignalP 4.0 was et al., 2007; Kowalska et al., 2010). They also usually have unable to identify the signal peptide sequence of ZmCKX9 so a different spatial and temporal expression patterns. That is to say, different predictive tool, iPSORT, was used in this case (Bannai et al., different CKX enzymes are expressed in different tissues and or- 2002). Putative N-terminal signal sequences were found in all of the gans, and at different stages of development. It has been shown that studied sequences (namely ZmCKX1; 2; 3; 4a; 4b; 5; 6; 8; 9 and 12) the levels of CKX gene expression can change very rapidly and with the exception of the cytosolic ZmCKX10 (Fig. 1). The signal dramatically, especially in response to stress signals (Vyroubalová sequences of enzymes ZmCKX1 to 6, ZmCKX9, ZmCKX11 and et al., 2009). Because each CKX enzyme has unique substrate ZmCKX12 seem to direct their secretion to the apoplast whereas preferences and reaction rates, localized changes in the expression that of ZmCKX8 was predicted to be a mitochondrial targeting of specific CKX genes can cause pronounced changes in the cyto- sequence. However, there is no precedent for CKX proteins being kinin distribution within individual tissues and organs. This in turn localized in the mitochondria, so it seems likely that this is a case of affects their growth and development. The different CKX enzymes misidentification. Notably, two Arabidopsis CKX isoforms, AtCKX1 are also targeted to different subcellular compartments. Of the and AtCKX3, were initially predicted to be localized to the mito- seven Arabidopsis CKX isoforms, one is cytosolic, two are vacuolar, chondria (Schmülling et al., 2003). However, subsequent GFP and the others are secreted into the extracellular environment. tagging experiments demonstrated that they are actually localized Moreover, CKX overexpression studies have suggested a close cor- to the vacuoles (Werner et al., 2003). relation between the subcellular localization of the overexpressed The removal of the putative secretory signals strengthened the CKX enzyme and the severity of the resulting cytokinin deficiency expression of some of the recombinant CKX proteins, thus all of phenotype (Werner et al., 2003). One maize CKX isoform, ZmCKX1, them were cloned without them. For example, clarified extracts of is known to be localized to the apoplast while another, ZmCKX10, is bacteria expressing the entire ZmCKX12 ORF exhibited negligible cytosolic (Smehilová et al., 2009). While the localization of the cytokinin degradation activity. However, significant activity was remaining maize CKX isoforms is currently unknown, it can detected in the equivalent extracts of bacteria expressing the same reasonably be expected to differ somewhat from that of their gene with the signal peptide removed. Therefore, the secretory counterparts in Arabidopsis, especially given the recently reported signals were removed from all of the cloned CKX genes that were differences in cytokinin metabolite levels between monocots and inserted into the expression vectors. dicots (Gajdosová et al., 2011). There are several closely homologous CKX gene pairs in the In the work reported herein, we characterized the entire maize maize genome that were formed during recent chromosome CKX gene family in detail in order to understand how each member duplication events (Gaut, 2001). The enzymes ZmCKX7 and contributes to the regulation of cytokinin homeostasis. Maize was ZmCKX11 are very close paralogs of ZmCKX8 and ZmCKX12, selected because it is an important model species for monocots in respectively, having very high levels of amino acid sequence general. This work builds on our previous investigations into its identity (96.7 and 91.5%, respectively), and were excluded from this CKX enzymes (Vyroubalová et al., 2009; Smehilová et al., 2009), study because they are very weakly expressed in maize, and their which focused on the roles of cytokinin metabolism in abiotic stress abundance was below the limit of detection for the method used in responses and the subcellular localization of two maize CKX iso- this work (Vyroubalová et al., 2009). All four of the recombinant forms (ZmCKX1 and ZmCKX10), respectively. proteins corresponding to two other closely homologous pairs D. Zalabák et al. / Plant Physiology and Biochemistry 74 (2014) 283e293 285

Fig. 1. Identification of putative N-terminal signal sequences and vacuolar sorting signals in maize CKX proteins. An alignment of maize CKX protein sequences revealed the positions of the putative N-terminal signal sequences identified using the SignalP 4.0 Server and iPSORT Server online prediction tools. Full arrows indicate the ends of the putative signal peptides that were removed to form the recombinant proteins. Boxes indicate putative sequence-specific vacuolar sorting signals and open arrows indicate the sequences that were removed to form the recombinant ZmCKX6 and ZmCKX9 proteins.

(ZmCKX4a and ZmCKX4b, ZmCKX2 and ZmCKX3) were prepared first purification step in these cases. All of the purified recombinant because they are all expressed relatively strongly in different tis- proteins were examined by SDS-PAGE to estimate their molecular sues. In total, eight different recombinant pTYB12 vectors that mass and to evaluate the overall performance of the purification yielded detectable CKX activity in cell lysates were created. process (see Fig. 2). The observed molecular masses of the ZmCKX No CKX activity was detected in lysates derived from bacterial proteins prepared in the bacterial heterologous expression system cultures expressing either the complete ORFs of ZmCKX6 and ranged from 55.6 to 60.9 kDa (determined using the Alpha DigDoc ZmCKX9 or the corresponding ORFs with the predicted signal pep- program). These values are consistent with the theoretical molec- tides removed (Fig. 1). The bacterial lysate from cells transformed ular masses of the recombinant proteins, which range from 55.2 with an expression vector carrying the ZmCKX6 ORFs was subjected (ZmCKX2 and ZmCKX4b) to 59.3 kDa (ZmCKX5). The ZmCKX1 to a Western blot analysis using an anti-chitin binding domain protein generated a band corresponding to a mass of approximately antibody, which revealed that the targeted CKX protein was not 60.9 kDa rather than its predicted mass of 53.1 kDa. This was being expressed. The ZmCKX6 gene with the putative N-terminal probably due to protein hyperglycosylation, which is common in signal peptide removed was also subcloned into the pGAPZaA(His) the P. pastoris expression system (for a detailed discussion of this 10 expression vector (Kowalska et al., 2010) and transformed into phenomenon, see (Bilyeu et al., 2001). P. pastoris strain X33. Once again, however, no expression of the target protein was detected. Further analysis of the ZmCKX6 and ZmCKX9 sequences revealed the presence of a short sequence downstream of the predicted signal peptide that was homologous to a sequence-specific vacuolar sorting signal consisting of the amino acid residues [N/L]-[P/I/L]-[I/P]-[R/N/S] (Nakamura and Matsuoka, 1993; Vitale and Raikhel, 1999). The putative vacuolar retention signals 38LLPT and 37LPTS were identified in ZmCKX6 and ZmCKX9, respectively (see Fig. 1). The removal of all N-terminal residues of ZmCKX9 up to position 42/43 resulted in the expression of a functional enzyme. In the case of ZmCKX6, no CKX activity was detected even after the deletion of this putative vacuolar sorting signal sequence. All of the active ZmCKX proteins were initially purified from clarified cell lysates by chitin affinity chromatography. Although this purification step yielded good results, further purification was required to remove some minor contaminating proteins. Therefore, the dialyzed and concentrated samples were separated by High Q ion-exchange chromatography, after which the collected protein fractions were analyzed by SDS-PAGE and the fractions containing Fig. 2. SDS-PAGE results for the purified ZmCKX enzymes. The purified recombinant ZmCKX proteins (2ug each) were separated by gradient tricine-SDS-PAGE (4e12% pure ZmCKX protein were pooled and concentrated. The High Q polyacrylamide gel) and then stained with Coomassie Brilliant Blue. Lane contents: 1- fi puri cation step was omitted in the case of ZmCKX9 and ZmCKX12 molecular mass standard, 2 e ZmCKX1, 3 e ZmCKX9, 4 e ZmCKX12, 5 e ZmCKX2, 6 e because of the low recombinant protein yields obtained after the ZmCKX3, 7 e ZmCKX4a, 8 e ZmCKX4b, 9 e ZmCKX5, 10 e ZmCKX8, 11 e ZmCKX10. 286 D. Zalabák et al. / Plant Physiology and Biochemistry 74 (2014) 283e293

2.2. Site-directed mutagenesis of the ZmCKX6 gene

To test the functionality of the ZmCKX6 gene, transgenic tobacco plants expressing the full length native version of ZmCKX6 were prepared as described by Galuszka et al. (Galuszka et al., 2004). It had previously been shown that the constitutive expression of CKX in both tobacco and Arabidopsis plants produces a cytokinin deficiency phenotype that is characterized by retarded shoot growth and an extremely well-developed root system (Werner et al., 2003). Approximately 10 independent transgenic lines were prepared, all of which had wild-type phenotypes in the T1 generation. The fact that heterologous expression of the ZmCKX6 protein did not result in detectable enzyme activity in E. coli lysates or in eukaryotic expression systems may indicate that its coding sequence is a pseudogene. However, ZmCKX6 is expressed strongly in intact maize tissues at the mRNA level (Vyroubalová et al., 2009). While pseudogene transcription is known to occur in some cases, they are usually expressed much less strongly than their functional counterparts (Zou et al., 2009). Furthermore, the ZmCKX6 gene sequence contains no frame shifts or premature termination co- dons and has a normal distribution of exons and introns. These factors, together with its strong expression in planta suggest that it is a functional gene (Gu et al., 2010) rather than a pseudogene that would be subject to negative selective pressure. It is possible that the lack of detectable CKX activity for ZmCKX6 may be due to a mutation that affects its folding, making it inactive or unstable and prone to rapid degradation. There are several conserved domains within the CKX protein family (Popelková et al., 2004). These include the GHS domain, which is responsible for the covalent binding of the enzyme’s flavin adenine dinucleotide cofactor, and the aspartate residue that functions as a catalytical base during the reaction (Malito et al., 2004). Other unique char- acteristic domains of the cytokinin dehydrogenases include the PHPWLN and HFG domains located in the C-terminal region. These sequences are strongly conserved, suggesting that they have some important structural or functional role. However, the nature of this role has yet to be determined. When the protein sequences of the maize CKXs were aligned with those from rice, barley, wheat, Bra- chypodium and Sorghum bicolor, ZmCKX6 has an unusual variation in the conserved 375PHPWLN domain: the proline 375 residue (underlined) is replaced by a histidine, changing the domain sequence to HHPWLN. Interestingly, this variation occurs in five monocotyledonous CKX proteins: ZmCKX6, OsCKX2, HvCKX3, sorghum CKX (Sb01g019000.1) and Brachypodium CKX (Bradi3g29130). These CKX proteins cluster together in the phylogenetic tree, suggesting that each monocot species probably has one isoform carrying this mutation within its CKX gene family (Fig. 3). ZmCKX6 also has a mutation in a second highly conserved sequence: the 499HFG domain; specifically, in this isoform, the phenylalanine 500 residue (underlined) is replaced with leucine. The HFG domain is very strongly conserved both among monocot CKXs and among those of Arabidopsis; ZmCKX6 is the only known monocot enzyme to carry such a mutation. In fact, there is only one other monocot cytokinin dehydrogenase (the barley enzyme HvCKX9) that carries a mutation in the HFG domain e an exchange of the phenylalanine residue for tyrosine. However, this change does not affect its CKX activity: HvCKX9 overexpression in tobacco plants produces a strong cytokinin-deficient phenotype (Galuszka et al., 2004) (note that this

also used to search for CKX protein sequences in the sorghum and Brachypodium genome, respectively. The tree was generated by protein sequence alignment with ClustalW using Fig. 3. Phylogenetic tree of CKX families from monocotyledonous plants. The NCBI data- the neighbor-joining method (Saitou and Nei, 1987)inprogramMEGA5(Tamura et al., base (http://www.ncbi.nlm.nih.gov/) of plant protein sequences was searched for ZmCKX 2011). The sequences of maize CKX enzymes were aligned with sequences from rice, homologs in various monocotyledonous species. The BLAST homology searches on SbGDB wheat, barley, Brachypodium and sorghum. The proteins in the circled cluster all have a and BdGDB (http://www.plantgdb.org/SbGDB/; http://www.plantgdb.org/BdGDB/) were common mutation in the PHPWLN domain but not in the HFG domain. D. Zalabák et al. / Plant Physiology and Biochemistry 74 (2014) 283e293 287 gene was recently renamed from HvCKX2 to HvCKX9 according to Table 1 Mameaux et al. (2012). All other known monocot CKXs and all of the Specific activities of ZmCKX enzymes. Specific activities were determined in 250 mM sodium phosphate buffer (pH 7.0) containing 2.5 mM EDTA, with 250 mM iP, iPRMP, Arabidopsis CKXs contain the conserved HFG domain. or iP9G as substrates and 0.125 mM DCPIP as an electron acceptor. Based on this sequence analysis, ZmCKX6 variants were pre- fi 1 pared carrying reverting mutations in either the HHPWLN or the Enzyme Speci c activity (nkat mg ) HLG domain and with the N-terminal LLPT signal removed (Fig. 1). iP iPRMP iP9G The reverting mutation in the HHPWLN domain of ZmCKX6 ZmCKX1 890.38 5.53 215.58 (H375P) did not yield a product with CKX activity. However, the ZmCKX2 29.29 20.87 62.32 reverting mutation in the HLG domain (L500F) produced a func- ZmCKX3 15.47 16.18 54.60 tional enzyme with CKX activity. The removal of both the signal ZmCKX4a 13.90 47.28 45.22 ZmCKX4b 17.94 47.32 56.15 peptide and the vacuolar sorting signal was required for CKX ac- ZmCKX5 42.87 44.08 27.54 tivity: no CKX activity was detected in cell lysates expressing a HLG ZmCKX8 51.23 6.52 50.35 reversion mutant with an intact LLPT signal. The expression of the ZmCKX9 0.64 0.22 0.45 native and mutated recombinant ZmCKX6 proteins was investi- ZmCKX10 9.21 0.08 14.68 gated by western blot analysis using an anti-ZmCKX6 antibody. ZmCKX12 26.83 0.48 2.87 Although no CKX activity was detected in cell lysates of bacteria expressing native ZmCKX6, western blot analysis revealed that the from 9.21 to 51.23 nkat mg 1. The isoforms’ specific activity towards protein was weakly expressed (Fig. 4), suggesting that the ZmCKX6 iPRMP ranged from 0.08 to 47.32 nkat mg 1with ZmCKX4a, gene either encodes a protein with very low activity or a non- ZmCKX4b and ZmCKX5 being particularly active towards this sub- functional protein, making it a pseudogene. This phenomenon strate. Conversely, ZmCKX9, ZmCKX10 and ZmCKX12 all exhibited seems to be unique since the protein-level expression of pseudo- very little specific activity towards iPRMP. Similarly, the isoforms’ genes has not previously been reported. The reverting mutation in specific activities towards iP9G ranged from 0.45 to 215.58 nkat mg 1. the HLG domain (L500F) of ZmCKX6 increased its level of expres- These results clearly show that the different CKX isoforms have very sion, but no such effect was observed for the reverting mutation in different activities towards cytokinin substrates with different sub- the HHPWLN domain (Fig. 4). These results suggest that the HFG stituents at the N9 position of the adenine ring. For instance, ZmCKX1 domain is crucial for both the activity and stability of CKX enzymes, is very active towards iP but 200 times less active towards iPRMP. a hypothesis that is consistent with the domain’s very strong Next, the maize CKX enzymes’ substrate preferences with conservation in this class of enzymes. respect to the other naturally occurring cytokinins were determined. DCPIP decolorization assays were performed for all isoforms 2.3. Biochemical properties of the ZmCKX enzymes using trans-zeatin (tZ), cZ, dihydrozeatin (DHZ) and the corresponding N9-glucoside and nucleotide derivatives (iP9G, tZ9G, To beginwith, the specific activity of each isoformwas determined cZ9G, iPRMP, tZRMP and cZRMP) as substrates. With the exception by means of the dichlorophenolindophenol (DCPIP) decolorization of ZmCKX5, all of the isoforms exhibited relatively high activity assay, using isopentenyladenine (iP), isopentenyladenosine 50- towardscZ(Fig. 5). Some isoforms, such as ZmCKX8, ZmCKX9, monophosphate (iPRMP) and isopentenyladenine-N9-glucoside ZmCKX10 and ZmCKX12 preferred cZ to all of the other tested (iP9G) as substrates (Laskey et al., 2003). This method was chosen cytokinin free bases. These results stand in contrast to those for the because it allows the use of cis-zeatin (cZ) derivatives as substrates Arabidopsis CKX enzymes, which exhibit comparatively little ac- and therefore makes it possible to determine reaction rates for all of tivity towards cZ (Gajdosová et al., 2011). Only two AtCKX enzymes, the natural CKX substrates. As shown in Table 1, the maize CKX the vacuolar AtCKX1 and the cytosolic AtCKX7, exhibited a level of enzyme with the highest specific activity towards iP is ZmCKX1 activity towards cZ that was similar to their activity towards iP. (890 nkat mg 1). All of the other isoforms were several orders of None of the tested ZmCKXs were able to degrade dihydrozeatin. magnitude less active towards this substrate, with activities ranging Interestingly, ZmCKX1 prefers cytokinin free bases (specifically, tZ

Fig. 5. Substrate preference profiles of the ZmCKX enzymes. Activities were deter- Fig. 4. Western blot analysis of various recombinant ZmCKX6 proteins. The clarified mined using a substrate concentration of 250 mM and a DCPIP concentration of protein lysates (5 mg of protein) from bacterial cells expressing various ZmCKX6-intein 0.125 mM, in 250 mM sodium phosphate buffer (pH 7.0), containing 2.5 mM EDTA. The fusions were subjected to SDSePAGE (10% polyacrylamide gel) and electro-blotted bars show the ratio of each CKX enzyme’s activity towards the indicated substrates onto a nitrocellulose membrane. The fusion proteins were detected using a polyclonal relative to its activity towards iP (which was arbitrarily chosen to represent 100% ac- antibody against the ZmCKX6-specific peptide CSANPGPEEDGDG and visualized color- tivity). DHZ was also tested but none of the ZmCKX enzymes were active towards this imetrically. Lane contents: 1 e molecular mass standard, 2 e negative control (empty substrate. Enzyme activities were measured 5e10 times for each enzyme and substrate vector), 3 e ZmCKX6 wild type, 4 e ZmCKX6 HFG reversion mutant, 5 e ZmCKX6 and the measured activities were averaged. In all cases, the standard deviation over PHPWLN reversion mutant. these 5e10 runs did not exceed 20% of the absolute values. 288 D. Zalabák et al. / Plant Physiology and Biochemistry 74 (2014) 283e293

and iP) to the almost complete exclusion of other substrates, which it degrades only very slowly. ZmCKX12 exhibits a similar substrate preference pattern. In light of its specific activity, substrate preferences, and ubiquitous expression profile (see Section 2.5.), ZmCKX1 is probably the main isoform responsible for the rapid degradation of cytokinin free bases in the extracellular space. The vacuolar and cytosolic CKXs of Arabidopsis exhibit a significant preference for cytokinin-9-glucosides and cytokinin mono-, di- and triphosphates relative to free bases (Kowalska et al., 2010). Interestingly, the cytosolic maize enzyme ZmCKX10 preferentially degraded cZ, followed by tZ and iP, and its ability to degrade cytokinin monophosphates and zeatin-9-glucosides was very low (Fig. 5). While ZmCKX10 was more active towards iP9G than iP, the difference between the rates at which it degrades the two substrates was much less pronounced than those for the intracellular Arabi- dopsis CKXs, which typically degrade free bases several orders of magnitude more slowly than cytokinin phosphates or N9- glucosides. These different substrate preference patterns probably create different cytosolic cytokinin distributions in the two plant species. The substrate preferences of ZmCKX9, a putative vacuolar isoform, were very similar to those of the cytosolic CKX enzyme, and it did not exhibit any preference for N9-glucosides or phosphates. Another putative vacuolar isoform, ZmCKX6, was not characterized because it did not exhibit any detectable CKX activity in the bacterial cell lysates. Interestingly, ZmCKX8 predicted to be localized to the mitochondria had similar substrate preferences to the cytosolic and vacuolar CKXs. The substrate preference patterns of ZmCKX2 and ZmCKX3 were very similar, in keeping with the suggestion that one of them was formed by a recent duplication of the other (the two enzymes exhibit 93.5% sequence identity at the amino acid level). ZmCKX4a and ZmCKX4b also had very similar substrate profiles and exhibit around 93.4% sequence identity. Moreover, both of these two enzyme pairs had broadly similar substrate preferences (Fig. 5). However, compared to ZmCKX2 and ZmCKX3, ZmCKX4a and ZmCKX4b had a stronger preference for iP and cZ derivatives and were less capable of degrading tZ-type cytokinins. All four isoforms degraded iP9G preferentially, but unlike ZmCKX2 and ZmCKX3, ZmCKX4a and ZmCKX4b also exhibited similar rates of reaction with iPRMP. UHPLC was also used to investigate the substrate preferences of the ZmCKX enzymes in order to complement the results obtained with the DCPIP decolorization assay. In these experiments, the enzymes were probed with a mixture of cytokinins and the depletion of each substrate was monitored over a period of 120 min (Pertry et al., 2009). Three different cytokinin mixtures were tested. CKX activity was measured in both dehydrogenase (pH 5.0, with ferricyanide as an electron acceptor) and oxidase modes (pH 5.0, O2 as an electron acceptor) in each case. The first contained only free bases (iP, tZ, cZ and DHZ) while the second and third contained derivatives of iP (iP, isopentenyladenosine, iPRMP, iP9G and

Fig. 6. Temporal cytokinin profiling in the organs of developing maize seedlings. The heat map shows the distribution of cytokinins in maize kernels (A), roots (B) and shoots (C) during the first 20 days after germination. Roots, shoots and kernels from maize seedlings (cv. ‘Cellux’), cultivated on hydroponic system were harvested at defined time points and analyzed to determine the concentrations of each cytokinin species. The heat map shows the average accumulation of each plant hormone over time. Red and blue correspond to higher and lower concentrations, respectively. The color scale is shown at the top. The value in each block indicates the measured concentration of the compound in question (based on the mean of two measurements). The concentration in A is expressed in units of pmol per 20 kernels, whereas those in B and C are expressed in pmol g 1 of fresh weight. Total-CK represents the summed concentrations of each cytokinin group: tZ e trans-zeatin, cZ e cis-zeatin, DHZ e dihydrozeatin, and iP e isopentenyladenine. ND e value below the limit of quantifi- cation. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.) D. Zalabák et al. / Plant Physiology and Biochemistry 74 (2014) 283e293 289 isopentenyladenine-N7-glucoside) and tZ (tZ, trans-zeatin riboside, glucoside and cZ) account for around 80% of the total CK content tZRMP, tZ9G and trans-zeatin-O-glucoside), respectively. Surpris- of maize leaves (Gajdosová et al., 2011). As shown in Fig. 6, the levels ingly, all of the tested CKX isoforms preferred iP as a substrate in of cZ-type cytokinins change very rapidly during seedling growth. It this experiment, indicating that iP has the lowest Km values for all of is likely that both cZ catabolism (promoted by CKXs) and glycosyl- the ZmCKXs. With the exception of iP, the order of substrate pref- ation by cZ O-glucosyl transferases (UDP-glucose : cis-zeatin O-b-D- erences for each enzyme was found to be the same as in the DCPIP glucosyltransferase; EC 2.4.1.215) work synergistically to fine tune decolorization assays (for details, see Supplementary Fig. 1). This the cZ levels during this developmental stage. The concentrations of experiment also revealed that isopentenyladenine-N7-glucoside iP derivatives in the roots and shoots were generally low; those in and trans-zeatin-O-glucoside are resistant to degradation by the shoots were more or less constant whereas their levels in the maize cytokinin dehydrogenases. There were no differences in roots decreased gradually during seedling development. substrate preference between the dehydrogenase and oxidase The roles played by DHZ derivatives during plant development modes of the studied enzymes (data not shown). The rates of re- remain unclear, as do the details of their metabolism. Due to their action with oxygen as the electron acceptor were significantly abundance in dormant seeds, they are assumed to be inactive cy- lower than those observed in dehydrogenase mode, indicating that tokinins that provide a substrate pool for the synthesis of active all of the ZmCKXs will function as dehydrogenases if an appropriate cytokinin compounds (Frébort et al., 2011). Some reports have electron acceptor is available. described the conversion of tZ to DHZ by a putative enzyme, zeatin þ The putative inhibitory effect of DHZ on cytokinin dehydroge- reductase (dihydrozeatin: NADP oxidoreductase; EC 1.3.1.69), nase activity was tested using the endpoint method with p-ami- although the enzyme itself has not yet been purified and charac- nophenol (Frébort et al., 2002) (data not shown). Interestingly, no terized (Martin et al., 1989; Gaudinová et al., 2005). The existence of inhibition was observed when the ZmCKXs were probed with DHZ a reverse pathway could explain the dramatic depletion of the DHZ either at equimolar concentrations or with a fivefold excess of the cytokinin pool observed in imbibing maize seeds (Stirk et al., 2012; potential inhibitor relative to the substrate (100 mM iP). This sug- Fig. 6A). However, no enzyme capable of converting DHZ into tZ, cZ gests that DHZ cannot access the active sites of the ZmCKX enzymes. or iP has yet been described. The degradation of DHZ by cytokinin dehydrogenases is excluded because none of the maize cytokinin 2.4. Cytokinin profiling in developing maize plantlets dehydrogenases examined in this work was able to accept DHZ as a substrate. The absence of a double bond in the DHZ side chain The cytokinin profiles in maize plants have been studied seems to be responsible for its resistance to degradation by cyto- extensively, but these investigations have either focused on the kinin dehydrogenases (Popelková et al., 2006). Although it is often spatial rather than the temporal distribution of the cytokinins assumed that DHZ is an inactive cytokinin, several reports have (Gajdosová et al., 2011; Stirk et al., 2012) or have been limited to demonstrated that it has varied biological effects. Among other only few cytokinin species (Cheikh and Jones, 1994; Dietrich et al., things, it delays senescence in oat leaves and is active in the pha- 1995). The roles of cytokinins during the early stages of maize seed seolus callus assay (Mok et al., 1978; Letham et al., 1983). On the imbibition and germination (during the first 36 h of the plant’s life) other hand, DHZ does not bind to Arabidopsis cytokinin receptors at have been described in detail (Stirk et al., 2012). In this work, we physiologically relevant concentrations. All three Arabidopsis focused on the developmental stages that follow the emergence of cytokinin receptors (AHK4/CRE1, AHK2 and AHK3) have been bio- the radicle on day 4 of the plant’s life, and studied the cytokinin chemically characterized in detail (Spíchal et al., 2004; Stolz et al., profiles in the kernels, roots and shoots of young maize seedlings 2011), revealing that their KD values for binding to DHZ range over a two-week period. from 50 nM to 400 nM. The KD values for their best substrates The prevalent cytokinins in dormant maize seeds are DHZ de- ranged from 1.3 to 3.9 nM. Moreover, the levels of DHZ in Arabi- rivatives (Stirk et al., 2012)(Fig. 6A), of which the predominant dopsis tissues are usually below the limits of detection (Zdárská forms are DHZ-O-glucoside and DHZ riboside-O-glucoside. The et al., 2013). Interestingly, the situation is different in maize since levels of these specific compounds and the overall concentration of one of the three maize cytokinin receptors, ZmHK2, has a high af- DHZ-type cytokinins both decrease dramatically during the first finity for DHZ. The KD value of this receptor for DHZ is 2 nM, which 48 h of imbibition but remain high compared to other CK forms. The is very close to its KD values for tZ (0.4 nM) and iP (0.6 nM) (Lomin total concentration of DHZ-type species stabilize at around 25% of et al., 2011). However, the ability of DHZ to activate the receptor’s their initial levels on the fifth day (Fig. 6A). A similar trend was downstream phosphorylation signaling pathway has not yet been observed for tZ-type cytokinins; however the decrease in this case tested. It is therefore not clear whether DHZ is an active cytokinin in was less pronounced, and their overall levels were much lower than tissues where it is abundant (e.g. kernels) or whether it functions as those of the DHZ-type compounds at all stages. The levels of iP-type a sort of anti-cytokinin, competitively inhibiting the binding of cytokinins in the kernels of developing maize seedlings were stable active cytokinins to the ZmHK2 receptor and thereby attenuating and relatively low. After an initial fluctuation, the concentrations of cytokinin perception. cZ-type cytokinins increased on the fifth day, reaching levels approaching those of the DHZ-type compounds at day 12. 2.5. Expression profiles of ZmCKX genes The concentration of DHZ-type compounds in the shoots mirrored the trend seen in the kernels, gradually falling to As described in Section 2.4, the early stages of maize seedling 5 pmol g 1 of fresh weight over the studied period (Fig. 6C). Inter- development are accompanied by diverse changes in the cytokinin estingly, the opposite trend was observed in the roots: the DHZ contents of the roots and shoots. To determine whether these concentration did not vary much initially but started to increase changes in CK contents are due to changes in CKX enzyme activ- approximately two weeks after germination, primarily due to the ities, their expression was profiled using qPCR. The expression of accumulation of the corresponding O-glucoside (Fig. 6B). The levels ZmCKX genes was determined in the roots, stems, and first leaves of of tZ-type cytokinins in developing maize roots fluctuated whereas developing maize seedling during the first 20 days after imbibition. those in the shoots increased slowly. In contrast, the concentration The changes in the expression of some ZmCKX genes in devel- of cZ-type cytokinins increased slowly in both the roots and the oping roots mirror the changes in the concentrations of their shoots of the seedlings. It has previously been shown that cZ-type preferred substrates (Fig. 7A). The trend is most pronounced in cytokinins (mainly cis-zeatin-O-glucoside, cis-zeatin riboside-O- the case of ZmCKX1, whose level of expression initially increases 290 D. Zalabák et al. / Plant Physiology and Biochemistry 74 (2014) 283e293

not change significantly during the studied period. On the other hand, ZmCKX6 gene expression increased gradually and peaked on day 16. However, its contribution to cytokinin homeostasis is unclear because it probably encodes a non-functional enzyme. The overall levels of CK free bases and ribosides in the developing shoot were low and mirrored the trends seen in the roots with a delay of approximately two days. While ZmCKX1 is not significantly expressed in the aerial parts of maize seedlings, it might contribute to the regulation of cytokinin levels in the leaves and stem due to acropetal cytokinin transport. The ZmCKX1 protein is known to be primarily localized in vascular bundles (Brugiere et al., 2003; Galuszka et al., 2005) and as a highly active apo- plastic isoform, it will therefore influence the flow of root-borne cytokinins into the aerial parts of the plant. Other CKX genes probably contribute to the maintenance of cytokinin homeostasis in specialized cells. For instance, the peak in ZmCKX2 and ZmCKX12 expression in the stems during the 3rd week after germination may reflect the observed decrease in the levels of free bases and tZ and iP nucleotides at this point in time (Fig. 7C). However, these pro- posed relationships between cytokinin levels and the expression of individual CKX genes are highly speculative because only two maize isoforms have had their cellular localizations determined, and little is currently known about the subcellular distributions of various cytokinin forms. Because O-glucosides are not substrates for any maize CKX enzyme, their concentrations increase continu- ously as the plant ages.

3. Conclusions

The maize genome contains thirteen genes that encode cyto- Fig. 7. Expression profiles of ZmCKXs in maize roots (A), first leaves (B) and stems (C) during early seedling development. Total RNA was isolated from maize tissues from kinin dehydrogenases. Three of these had previously been shown to two independent biological replicates. cDNA from each sample was obtained in at least encode functional protein products but only two, ZmCKX1 and two independent reactions and amplified in two separate PCRs. The b-actin and ZmCKX10, had been studied in detail. This work described the elongation factor 1 genes were used as an endogenous controls, and tissue samples properties of nine further isoforms, which were obtained in pure from day 4 (root) or day 6 (leaf and stem), respectively were used as calibrators (blue form by expressing them as recombinant fusion proteins with bars) to define an expression level of 1. The bars indicate relative gene expression and the error bars indicate SD values (n ¼ 4). (For interpretation of the references to color inteins in E. coli and subsequently isolating them from cell lysates. in this figure legend, the reader is referred to the web version of this article.) In contrast to the case for most members of the CKX family in Arabidopsis, maize CKXs are generally able to degrade cZ-type cytokinins, often at rates that are higher than those for tZ-type cy- gradually, reaching a peak on the 14th day, and then starts to tokinins. This preference for cZ-type cytokinins probably reflects decline. The levels of its preferred substrates (tZ, its riboside, and iP) the fact that cZ-type cytokinins are abundant in maize tissues, peak just a few days before this. The abundance of ZmCKX1 tran- whereas in Arabidopsis they predominate only in seeds. As is the scripts is thus clearly dependent on the levels of active cytokinins, case in Arabidopsis, maize contains two putative vacuolar (ZmCKX6 and it seems that this enzyme plays a key role in maintaining and ZmCKX9) and one cytosolic (ZmCKX10) CKX isoforms. In Ara- cytokinin homeostasis in maize. A similar relationship between bidopsis, the vacuolar and cytosolic CKXs have strong preferences ZmCKX1 expression and the levels of active cytokinins has previ- for cytokinin-9-glucosides and cytokinin mono-, di- and tri- ously been observed in the pedicel tissue of developing kernels phosphates relative to free bases, whereas the maize enzymes (Brugiere et al., 2003). The levels of ZmCKX2 and ZmCKX4b tran- degrade cytokinin monophosphates and zeatin-9-glucosides more scripts also decreased in six-day old roots in parallel with decreases slowly than free bases. Although the ZmCKX6 gene is expressed in the levels of their preferred substrates e nucleotides and N9- strongly in maize roots and shoots, the protein it encodes is prob- glucosides. The expression of the other members of the ZmCKX ably inactive. Sequence analysis and subsequent site directed family did not vary greatly during the studied period of time. The mutagenesis showed that the protein does not contain the concentrations of the transcripts of ZmCKX3, ZmCKX4a and conserved HFG domain motif, which is essential for CKX activity ZmCKX5, ZmCKX9 and ZmCKX12 were below the limit of detection and stability in heterologous expression systems. The physiological at all times and so these enzymes are unlikely to play significant relevance of this finding remains to be determined. roles during the development of maize primary roots. In the first maize leaf, the expression of the ZmCKX2 and 4. Materials and methods ZmCKX3 genes fluctuated and no obvious trend could be discerned (see Fig. 7B). The expression of ZmCKX4b and ZmCKX6 peaked on 4.1. Cloning of ZmCKX genes the 8th day. ZmCKX10 expression also peaked on the 8th day, with a second peak on day 20. ZmCKX1, ZmCKX4a, ZmCKX5, ZmCKX8, Complementary DNA sequences encoding ZmCKX2, 4a, 4b, 5, 6 ZmCKX9 and ZmCKX12 were only weakly expressed and so their and 12 cloned in the pGEM-T Easy vector have been prepared pre- transcript levels could not be quantified with any precision. viously (Gu et al., 2010). A complementary DNA sequence encoding As shown in Fig. 7C, the expression of ZmCKX4b, ZmCKX8, ZmCKX3 cloned in the pINA1267 vector was kindly provided by Dr. ZmCKX9 and ZmCKX10 in the stems was similar each other as it did David Kopecný (Massonneau et al., 2004). A complementary DNA D. Zalabák et al. / Plant Physiology and Biochemistry 74 (2014) 283e293 291 sequence coding for ZmCKX10 cloned in the pDrive vector was to 0.5. Expression of the recombinant protein was induced by kindly provided by Dr. Mária Smehilová et al. (2009). The coding adding IPTG to a final concentration of 0.5 mM. Overnight cultures regions of ZmCKX8 and ZmCKX9 were synthesized using the GeneArt incubated at 18 C on an orbital shaker (160 rpm) were then service (Invitrogen) based on predictions generated by the maize centrifuged at 4500 g to harvest bacterial cells. genome project (http://www.maizesequence.org/). The cloned The recombinant proteins were purified according to the man- cDNA sequences were used as starting materials for PCR amplifi- ufacturer’s protocol with some modifications (IMPACT, NEB). The cation. Genes were amplified without putative signal peptides in bacterial pellet from 5 to 10 L of expression culture was dissolved in cases where such peptides were present using the Phusion DNA lysis buffer (20 mM Tris/HCl, pH 8.0, 1 M NaCl, 0.1% Triton X-100, 5% polymerase (Finzymes). The forward and reverse primers were glycerol, 1 mM PMSF) and then disrupted using a French press designed to contain NdeI and EcoRI restriction sites, respectively; (Thermo Scientific) at 25,000 psi. The cell lysates were clarified by the primer sequences used in each case are listed in Table 2. The centrifugation at 20,000 g, after which the supernatants were amplification program was as follows: 30 s at 98 C, followed by 30e loaded onto an equilibrated chitin column at a flow rate of 35 cycles of 10 s at 98 C, 30 s at 61 C and 60 s at 72 C. The program 0.5 mL min 1. The column was then washed with column buffer was then terminated with a final extension step of 10 min at 72 C. (which was identical to the lysis buffer without glycerol), flushed The PCR reactions were performed in the presence of 1.3% dimethyl with DTT (50 mM in column buffer) and incubated for 64 h at þ4 C sulfoxide and 1.3 M betaine. PCR products were purified using to induce intein cleavage. The protein was then eluted with 60 mL QIAquick PCR Purification Kit (Qiagen) and subsequently digested of column buffer and dialyzed against 2 L of 50 mM Tris/HCl, pH 8.0 with NdeI and EcoRI (NEB) overnight at 37 C. The pTYB12 plasmid (three times, with the second dialysis being performed overnight). was treated in the same way. Gel-extracted PCR fragments and The dialyzed sample was then concentrated using an ultrafiltration linearized samples of the pTYB12 vector were ligated using the T4 cell (10 kDa cutoff membrane, Amicon) and loaded onto an ion- DNA ligase (NEB) overnight at 16 C. The ligation mixtures were exchange chromatographic column High Q (BioRad) to remove electroporated into competent E. coli cells of the TOP10 (NEB) strain. residual contaminating bacterial proteins. The purified proteins The positive clones were then sequenced to confirm the nucleotide were eluted with a linear gradient of KCl (0e1 M), collecting 2 mL sequences of the cloned genes (GATC Biotech, Germany). fractions. The purity of each fraction was tested by SDS-PAGE. Pure fractions were subsequently pooled and concentrated by ultrafil- 4.2. Heterologous production and purification of recombinant tration to a final volume of about 2 mL. The ZmCKX1 enzyme was ZmCKX enzymes expressed in P. pastoris as described by Bilyeu et al. (2001) and purified by ion-exchange chromatography on hydroxypatite. All of the ZmCKX enzymes with the exception of ZmCKX1 were purified from E. coli BL21 STAR (DE3) cell cultures transformed with 4.3. Site-directed mutagenesis of ZmCKX6 pTYB12:ZmCKX constructs. Bacteria were cultivated overnight at 37 C in 50 mL of liquid LB media (ampicillin 100 mg L 1)ina The open reading frame of ZmCKX6 was modified in two sepa- 250 mL Erlenmeyer flask, with orbital shaking at 160 rpm. The rate positions using a QuikChange II XL Site-Directed Mutagenesis bacterial culture was then used to inoculate fresh 50 mL LB media Kit according to the manufacturer’s protocol (Stratagene). The aliquots supplemented with glucose (10 g L 1) and carbenicillin following primers were used to change the CAC sequence encoding 1 (mg L )toafinal OD600 value of 0.1. These aliquots were cultivated residue 375 to CCC (histidine to proline): ZmCKX6_PHPWLN_f 0 e 0 at 37 C on an orbital shaker (160 rpm) until their OD600 value rose (forward; 5 - GG GAG GAG GTG CCC CAC CCG TGG CTC 3 ) and ZmCKX6_PHPWLN_r (reverse; 50- G AGC CAC GGG TGG GGC ACC 0 Table 2 TCC TCC C e 3 ). The CTG sequence encoding the residue at position Primer sequences used to clone ZmCKX genes into the pTYB12 vector. The 500 was converted to TTT (leucine to phenylalanine) using the underlined sequences correspond to the NdeI (fw primers) and EcoRI (rev primers) following primer pair: ZmCKX6_HLG_f (forward; 50- GG CAG CAG restriction sites, respectively. CAC TTT GGC CGG CGC TGG e 30) and ZmCKX6_HLG_r (reverse; 50- 0 0 Primer name Position Sequence 5 to 3 -end direction CCA GCG CCG GCC AAA GTG CTG CTG CC e 30). Bold letters indicate of signal the positions of the introduced site mutations. As the template for peptide site-directed mutagenesis, 50 ng of two constructs carrying long ZmCKX2_fw 19/20 GGAATTCCATATGAGGCTGACCATGCACGTCC and short version of the ZmCKX6 gene were used per reaction, ZmCKX2_rev CCGGAATTCTCACAAAGACAATGGGAGTGAC fi ZmCKX3_fw 23/24 GGAATTCCATATGCACGTCCCCGACGAG respectively. The long version contained the ORF ampli ed without ZmCKX3_rev CCGGAATTCTCACAAAGGCAATGGCAGTGAC the putative secretory signal (corresponding to the first 30 amino ZmCKX4a_fw 21/22 GGAATTCCATATGCTCCCCGTCGAGCCGC acids). The short version contained the ORF amplified without the ZmCKX4a_rev CGGAATTCCAGCTGGATTACGTTACGAGTC putative vacuolar sorting signal (corresponding to the first 44 ZmCKX4b_fw 22/23 GGAATTCCATATGCTGCCGGTGGAGCCGC amino acids). Each construct was repaired in two separate reactions ZmCKX4b_rev CCGGAATTCTCACGAGTCGGCGACGAG ZmCKX5_fw 21/22 GGAATTCCATATGACCCCTTCCACGCTCGCC of 18 cycles each, with annealing at 68 C. The successful formation ZmCKX5_rev CGGAATTCGATCATGAGGCAAGTAGCGGG of the desired mutated constructs was initially verified by restric- ZmCKX6_fw 30/31 GGAATTCCATATGGACCTGGGCCCCCTG tion analyses since the changes resulted in the deletion of an ApaLI ZmCKX6_rev CCGGAATTCCTAGCTCCCGTACGCAGC (PHPWLN domain) restriction site and the creation of an EaeI re- ZmCKX6_fw 44/45 GGGAATTCCATATGGCGGCCGCGTCCAGCG ZmCKX6_rev CCGGAATTCCTAGCTCCCGTACGCAGC striction site (HFG domain), respectively. All of the repaired con- ZmCKX8_fw 23/24 GGAATTCCATATGCACCCCCGGCCACTGC structs were then analyzed by sequencing. ZmCKX8_rev CGGAATTCCTCAGGCAGAAGCAATGCCAG ZmCKX9_fw 30/31 GGGAATTCCATATGCTCATCGTCACCAGCTTCCTCC 4.4. Western-blot analysis ZmCKX9_rev CCGGAATTCTTAAAGAACATTTCGAGAATCAGAGCCC ZmCKX9_fw 42/43 GGGAATTCCATATGCATTCCCATGTGCCTGCTGTAAC fi ZmCKX9_rev CCGGAATTCTTAAAGAACATTTCGAGAATCAGAGCCC A polyclonal rabbit antibody raised against the ZmCKX6-speci c ZmCKX10_fw e GGAATTCCATATGATGCTCGCGTACATGGAC peptide CSANPGPEEDGDG was prepared by a commercial firm ZmCKX10_rev CCGGAATTCCTACACGGCGACGGACG (GenScript) and used for western-blot analysis. SDSePAGE was ZmCKX12_fw 20/21 GGAATTCCATATGGTGAATTTCATACAGAGCCC performed on a slab gel (10%) in Triseglycine running buffer. The ZmCKX12_rev CCGGAATTCTCACATCGGGCTCGAGG PageRuler Unstained Protein Ladder (Thermo Scientific) was used 292 D. Zalabák et al. / Plant Physiology and Biochemistry 74 (2014) 283e293 as a marker. Protein samples were heated before application at 4.6. Plant material (hydroponic cultivation) 95 C for 10 min in the presence of 1% SDS and 1% 2- mercaptoethanol. Proteins were blotted onto a nitrocellulose Dry kernels of Zea mays cv. ‘Cellux’ were imbibed in tap water membrane (0.45 mm) in the MiniTrans blot system (Bio-Rad, Her- and germinated on wetted filter paper. After 3 days, the seedlings cules, CA, USA). Membranes were stained with Ponceau S blue to were transferred to aerated hydroponic tanks filled with Hoag- visualize proteins. After decolorization in water, the membrane was land’s nutrient solution. The plants were grown in an environ- blocked with 3% gelatine in 20 mM Tris/HCl (pH 7.5), containing mental chamber with 16 h light periods (250 mmol m 2 s 1)at 500 mM NaCl (TBS buffer), for 2 h. After the blocking, the mem- 27 C and 8 h dark periods at 20 C. Samples of roots and shoots (or brane was washed twice for 10 min in TBS buffer containing 0.05% stems and first leaves) were collected at the defined time-points of Tween-20, and then probed with rabbit anti-ZmCKX6 antibody from at least 10 maize seedlings and immediately frozen in liquid diluted in 1% gelatine in TBS buffer (1:1000). The membrane was nitrogen. subsequently rinsed twice with Tween-TBS, and then incubated for 2 h with anti-rabbit IgG containing conjugated alkaline phospha- 4.7. qPCR expression profiling tase (Sigma) in 1% gelatine in TBS buffer (1:5000). After rinsing in Tween-TBS buffer, the membrane was washed quickly in a buffer The expression of CKX genes was profiled and analyzed as for the alkaline phosphatase reaction (100 mM Tris/HCl, 100 mM described previously (Vyroubalová et al., 2009). Briefly, total RNA Ò NaCl, 5 mM MgCl2, pH 9.5) and then developed in the same buffer was isolated using the RNAqueous kit and treated twice with the with the addition of nitrotetrazolium blue chloride (NBT) and 5- TURBO DNase-freeÔ kit (Life Technologies) and then used in first bromo-4-chloro-3-indolyl phosphate, disodium salt (BCIP). strand cDNA synthesis with the RevertAidÔ H Minus M-MuLV reverse transcriptase and oligo-dT mixture (Fermentas). Diluted 4.5. CKX activity assay cDNA samples were used as templates in real-time PCR reactions Ò containing the POWER SYBR Green PCR Master mix or TaqMan 4.5.1. DCPIP decolorization assay Gene Expression Master Mix (Life Technologies), 300 nM of each Thecytokinindehydrogenaseenzymeassaywasbasedonthe primer, and 250 nM of specific50 6-carboxyfluorescein and 30 tet- decolorization of the electron acceptor 2,6-dichlorophenolindophenol ramethylrhodamine labeled probes, respectively. RNA from each (DCPIP) according to Laskey et al. (2003). The reaction mixture con- biological replicate was transcribed in two independent reactions tainedasubstrateataconcentrationof250mM(iP,tZ,cZ,DHZ,iP9G, and each cDNA sample was analyzed in at least two technical tZ9G, cZ9G, iPRMP, tZRMP or cZRMP) and 0.125 mM DCPIP in 250 mM replicates on a StepOnePlusÔ Real-Time PCR System using one of sodium phosphate buffer at pH 7.0, with 2.5 mM EDTA. The reaction the default programs (Life Technologies). Ct values were normalized was initiated by adding of 20 mLofasuitablydilutedenzymeto2mLof with respect to b-actin and elongation factor 1 genes. Expression reaction mixture. The decrease in absorbance at 590 nm was recorded values were determined and statistically evaluated using the at15sintervalsfor3mininaspectrophotometerequippedwitha DataAssist v3.0 Software package (Life Technologies). multi-cell holder (Agilent). A reference sample was also analyzed in which the substrate was replaced with the solvent dimethyl sulfoxide. 4.8. Cytokinin analysis iP was used as a reference substrate for all of the tested compounds, enabling the determination of relative activities. Reactions were con- Cytokinins were purified from maize tissues and subsequently ducted in duplicate and each substrate was analyzed in triplicate at analyzed according the procedure described in detail by fi least. In addition to the determination of relative activity, the speci c Vyroubalová et al. (2009). activity of each enzyme towards iP was measured. Acknowledgments 4.5.2. UHPLC method The activity of each enzyme towards a mixture of cytokinin This work was supported by the Czech Science Foundation grant substrates was determined by measuring the depletion of each P501/10/1141 and by the OP RD&I grant No. ED0007/01/01 Centre of cytokinin over a period of 120 min. The reaction mixtures con- the Region Haná for Biotechnological and Agricultural Research. tained various cytokinins at concentrations of 1 mM each and P.G. and J.F. were partly supported by the Operational Program 0.5 mM ferricyanide or O in 100 mM McIlvaine buffer at pH 5.0. 2 Education for Competitiveness e European Social Fund (project The first cytokinin mixture consisted of iP, tZ, cZ and DHZ; the CZ.1.07/2.3.00/20.0165). We thank Marta Greplová for preparation second contained iP, iPR, iPRMP, iP9G and iP-N7G; and the third of ZmCKX1. contained tZ, tZR, tZRMP, tZ9G and tZ-O-glucoside. In each case, the reaction was initiated by adding 20 mL of suitably diluted enzyme to Appendix A. Supplementary data 400 mL of reaction mixture at 37 C. At preselected time points (0, 5, 10, 20, 60 and 120 min) aliquots of 50 mL were collected, heated to Supplementary data related to this article can be found at http:// 95 C for 5 min to inactivate the enzyme, and then chilled on ice. dx.doi.org/10.1016/j.plaphy.2013.11.020 The aliquot was then combined with 50 mL of mobile phase A (15 mM ammonium formate, pH 4.0) and filtered through 0.22 mm nylon filters. The resulting samples were injected onto a C18 References reverse-phase column (ZORBAX RRHD Eclipse Plus 1.8 mm, Bannai, H., Tamada, Y., Maruyama, O., Nakai, K., Miyano, S., 2002. Extensive feature 2.1 50 mm, Agilent) connected to a Nexera (Shimadzu) ultra detection of N-terminal protein sorting signals. Bioinformatics 18, 298e305. performance liquid chromatograph. The column was eluted with a Bilyeu, K.D., Cole, J.L., Laskey, J.G., Riekhof, W.R., Esparza, T.J., Kramer, M.D., Morris, R.O., 2001. Molecular and biochemical characterization of a cytokinin linear gradient of mobile phase A and methanol (B) using the e e e oxidase from maize. Plant Physiol. 125, 378 386. following solvent mixtures: 0 min, 20% B; 3 8 min, 20 100% B. The Brugiere, N., Jiao, S.P., Hantke, S., Zinselmeier, C., Roessler, J.A., Niu, X.M., Jones, R.J., flow rate was 0.4 mL min 1 and the column temperature was 40 C. Habben, J.E., 2003. Cytokinin oxidase gene expression in maize is localized to The depletion of various cytokinins from the reaction mixture at the vasculature, and is induced by cytokinins, abscisic acid, and abiotic stress. Plant Physiol. 132, 1228e1240. each time point was determined by peak area subtraction using the Cheikh, N., Jones, R.J., 1994. Disruption of maize kernel growth and development by LabSolutions software package (Shimadzu). heat stress. Role of cytokinin/abscisic acid balance. Plant Physiol. 106, 45e51. D. Zalabák et al. / Plant Physiology and Biochemistry 74 (2014) 283e293 293

Dietrich, J.T., Kamínek, M., Blevins, D.G., Reinbott, T.M., Morris, R.O., 1995. Changes Mok, M.C., Mok, D.W.S., Armstrong, D.J., 1978. Differential cytokinin structure- in cytokinins and cytokinin oxidase activity in developing maize kernels and activity relationships in Phaseolus. Plant Physiol. 61, 72e75. the effects of exogenous cytokinin on kernel development. Plant. Physiol. Bio- Nakamura, K., Matsuoka, K., 1993. Protein targeting to the vacuole in plant cells. chem. 33, 327e336. Plant Physiol. 101, 1e5. Frébort, I., Sebela, M., Galuszka, P., Werner, T., Schmülling, T., Pec, P., 2002. Cytokinin Paces, V., Werstiuk, E., Hall, R.H., 1971. Conversion of N6-(D2-Isopentenyl)adenosine oxidase/dehydrogenase assay: optimized procedures and applications. Anal. to adenosine by enzyme activity in tobacco tissue. Plant Physiol. 48, 775e778. Biochem. 306, 1e7. Pertry, I., Václavíková, K., Depuydt, S., Galuszka, P., Spíchal, L., Temmerman, W., Frébort, I., Kowalska, M., Hluska, T., Frébortová, J., Galuszka, P., 2011. Evolution of Stes, E., Schmülling, T., Kakimoto, T., Van Montagu, M.C.E., Strnad, M., cytokinin biosynthesis and degradation. J. Exp. Bot. 62, 2431e2452. Holsters, M., Tarkowski, P., Vereecke, D., 2009. Identification of Rhodococcus Frébortová, J., Novák, O., Frébort, I., Jorda, R., 2010. Degradation of cytokinins by fascians cytokinins and their modus operandi to reshape the plant. Proc. Natl. maize cytokinin dehydrogenase is mediated by free radicals generated by Acad. Sci. U. S. A. 106, 929e934. enzymatic oxidation of natural benzoxazinones. Plant J. 61, 467e481. Petersen, T.N., Brunak, S., von Heijne, G., Nielsen, H., 2011. SignalP 4.0: discrimi- Gajdosová, S., Spíchal, L., Kamínek, M., Hoyerová, K., Novák, O., Dobrev, P.I., nating signal peptides from transmembrane regions. Nat. Methods 8, 785e786. Galuszka, P., Klíma, P., Gaudinová, A., Zizková, E., Hanus, J., Dancák, M., Popelková, H., Galuszka, P., Frébortová, J., Bilyeu, K.D., Frébort, I., 2004. Cytokinin Trávnícek, B., Pesek, B., Krupicka, M., Vanková, R., Strnad, M., Motyka, V., 2011. dehydrogenase: characterization and structure homology modeling of the Distribution, biological activities, metabolism, and the conceivable function of flavoprotein catabolizing plant hormones cytokinins. In: Pandalai, S.G. (Ed.), cis-zeatin-type cytokinins in plants. J. Exp. Bot. 62, 2827e2840. Recent Research Developments in Proteins, vol. 2Transworld Research Network, Galuszka, P., Frébort, I., Sebela, M., Sauer, P., Jacobsen, S., Pec, P., 2001. Cytokinin Kerala, pp. 63e81. oxidase or dehydrogenase? Mechanism of cytokinin degradation in cereals. Eur. Popelková, H., Fraaije, M.W., Novák, O., Frébortová, J., Bilyeu, K.D., Frébort, I., 2006. J. Biochem. 268, 450e461. Kinetic and chemical analyses of the cytokinin oxidase/dehydrogenase Galuszka, P., Frébortová, J., Werner, T., Yamada, M., Strnad, M., Schmülling, T., catalysed reaction: correlations with the crystal structure. Biochem. J. 398, Frébort, I., 2004. Cytokinin oxidase/dehydrogenase genes in barley and wheat: 113e124. cloning and heterologous expression. Eur. J. Biochem. 271, 3990e4002. Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for recon- Galuszka, P., Frébortová, J., Luhová, L., Bilyeu, K.D., English, J.T., Frébort, I., 2005. structing phylogenetic trees. Mol. Biol. Evol. 4, 406e425. Tissue localization of cytokinin dehydrogenase in maize: possible involvement Schmülling, T., Werner, T., Riefler, M., Krupková, E., Bartrina y Manns, I., 2003. of quinone species generated from plant phenolics by other enzymatic systems Structure and function of cytokinin oxidase/dehydrogenase genes of maize, rice, in the catalytic reaction. Plant Cell Physiol. 46, 716e728. Arabidopsis and other species. J. Plant Res. 116, 241e252. Galuszka, P., Popelková, H., Werner, T., Frébortová, J., Pospísilová, H., Mik, V., Köllmer, I., Spíchal, L., Rakova, N.Y., Riefler, M., Mizuno, T., Romanov, G.A., Strnad, M., Schmülling, T., Frébort, I., 2007. Biochemical characterization and histochemical Schmülling, T., 2004. Two cytokinin receptors of Arabidopsis thaliana, CRE1/ localization of cytokinin oxidases/dehydrogenases from Arabidopsis thaliana AHK4 and AHK3, differ in their ligand specificity in a bacterial assay. Plant Cell expressed in Nicotiana tabaccum L. J. Plant Growth Regul. 26, 255e267. Physiol. 45, 1299e1305. Gaudinová, A., Dobrev, P.I., Solcová, B., Novák, O., Strnad, M., Friedecký, D., Stirk, W.A., Václavíková, K., Novák, O., Gajdosová, S., Kotland, O., Motyka, V., Motyka, V., 2005. The involvement of cytokinin oxidase/dehydrogenase and Strnad, M., van Staden, J., 2012. Involvement of cis-zeatin, dihydrozeatin, and zeatin reductase in regulation of cytokinin levels in pea (Pisum sativum L.) aromatic cytokinins in germination and seedling establishment of maize, oats, leaves. J. Plant Growth Regul. 24, 188e200. and lucerne. J. Plant Growth Regul. 31, 392e405. Gaut, B.S., 2001. Patterns of chromosomal duplication in maize and their implica- Stolz, A., Riefler, M., Lomin, S.N., Achazi, K., Romanov, G.A., Schmülling, T., 2011. The tions for comparative maps of the grasses. Genome Res. 11, 55e66. specificity of cytokinin signalling in Arabidopsis thaliana is mediated by Gu, R., Fu, J., Guo, S., Duan, F., Wang, Z., Mi, G., Yuan, L., 2010. Comparative differing ligand affinities and expression profiles of the receptors. Plant J. 67, expression and phylogenetic analysis of maize cytokinin dehydrogenase/oxi- 157e168. dase (CKX) gene family. J. Plant Growth Regul. 29, 428e440. Smehilová, M., Galuszka, P., Bileyu, K.D., Jaworek, P., Kowalska, M., Sebela, M., Kakimoto, T., 2001. Identification of plant cytokinin biosynthetic enzymes as Sedlárová, M., English, J.T., Frébort, I., 2009. Subcellular localization and dimethylallyl diphosphate: ATP/ADP isopentenyltransferases. Plant Cell Physiol. biochemical comparison of cytosolic and secreted cytokinin dehydrogenase 42, 677e685. enzymes from maize. J. Exp. Bot. 6, 2701e2712. Kowalska, M., Galuszka, P., Frébortová, J., Sebela, M., Béres, T., Hluska, T., Takei, K., Sakakibara, H., Sugiyama, T., 2001. Identification of genes encoding ade- Smehilová, M., Bilyeu, K.D., Frébort, I., 2010. Vacuolar and cytosolic cytokinin nylate isopentenyltransferase, a cytokinin biosynthesis enzyme, in Arabidopsis dehydrogenases of Arabidopsis thaliana: heterologous expression, purification thaliana. J. Biol. Chem. 276, 26405e26410. and properties. Phytochemistry 71, 1970e1978. Takei, K., Yamaya, T., Sakakibara, H., 2004. Arabidopsis CYP735A1 and CYP735A2 Kurakawa, T., Ueda, N., Maekawa, M., Kobayashi, K., Kojima, M., Nagato, Y., encode cytokinin hydroxylases that catalyze the biosynthesis of trans-zeatin. Sakakibara, H., Kyozuka, J., 2007. Direct control of shoot meristem activity by a J. Biol. Chem. 279, 41866e41872. cytokinin-activating enzyme. Nature 445, 652e655. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: Laskey, J.G., Patterson, P., Bilyeu, K., Morris, R.O., 2003. Rate enhancement of cyto- molecular evolutionary genetics analysis using maximum likelihood, evolu- kinin oxidase/dehydrogenase using 2,6-dichloroindophenol as an electron tionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731e acceptor. Plant Growth Regul. 40, 189e196. 2739. Letham, D.S., Palni, L.M.S., Tao, G.-Q., Gollnow, B.I., Bates, C.M., 1983. Regulators of Vitale, A., Raikhel, N.V., 1999. What do proteins need to reach different vacuoles? cell division in plant tissues XXIX. The activities of cytokinin glucosides and Trends Plant Sci. 4, 149e155. alanine conjugates in cytokinin bioassays. J. Plant Growth Regul. 2, 103e115. Vyroubalová, S., Václavíková, K., Turecková, V., Novák, O., Smehilová, M., Hluska, T., Lomin, S.N., Yonekura-Sakakibara, K., Romanov, G.A., Sakakibara, H., 2011. Ligand- Ohnoutková, L., Frébort, I., Galuszka, P., 2009. Characterization of new maize binding properties and subcellular localization of maize cytokinin receptors. genes putatively involved in cytokinin metabolism and their expression during J. Exp. Bot. 62, 5149e5159. osmotic stress in relation to cytokinin levels. Plant Physiol. 151, 433e447. Malito, E., Coda, A., Bilyeu, K.D., Fraaije, M.W., Mattevi, A., 2004. Structures of Werner, T., Motyka, V., Laucou, V., Smets, R., van Onckelen, H., 2003. Cytokinin Michaelis and product complexes of plant cytokinin dehydrogenase: implica- deficient transgenic Arabidopsis plants show multiple developmental alter- tions for flavoenzyme catalysis. J. Mol. Biol. 341, 1237e1249. ations indicating opposite functions of cytokinins in the regulation of shoot and Mameaux, S., Cockram, J., Thiel, T., Steuernagel, B., Stein, N., Taudien, S., Jack, P., root meristem activity. Plant Cell 15, 1e20. Werner, P., Gray, J.C., Greenland, A.J., Powell, W., 2012. Molecular, phylogenetic Zou, C., Lehti-Shiu, M.D., Thibaud-Nissen, F., Prakash, T., Buell, C.R., Shiu, S., 2009. and comparative genomic analysis of the cytokinin oxidase/dehydrogenase Evolutionary and expression signatures of pseudogenes in Arabidopsis and rice. gene family in the Poaceae. Plant Biotechnol. J. 10, 67e82. Plant Physiol. 151, 3e15. Martin, R.C., Mok, M.C., Shaw, G., Mok, D.W.S., 1989. An enzyme mediating the Zdárská, M., Zatloukalová, P., Keinrad, M.B., Sedo, O., Potesil, D., Novák, O., conversion of zeatin to dihydrozeatin in phaseolus embryos. Plant Physiol. 90, Svacinová, J., Pesek, B., Malbeck, J., Vasícková, J., Zdráhal, Z., Hejátko, J., 2013. 1630e1635. Proteome analysis in Arabidopsis reveals shoot- and root-specific targets of Massonneau, A., Houba-Hérin, N., Pethe, C., Madzak, C., Falque, M., Mercy, M., cytokinin action and differential regulation of hormonal homeostasis. Plant Kopecný, D., Majira, A., Rogowsky, P., Laloue, M., 2004. Maize cytokinin oxidase Physiol. 161, 918e930. genes: differential expression and cloning of two new cDNAs. J. Exp. Bot. 55, 2549e2557.