RNA Chaperone Activity of Human La Protein is Mediated by Variant RNA Recognition Motif

Amir Naeeni

A THESIS SUBMITTED TO THE FACULTY OF GRADUATE STUDIES IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF

MASTER OF SCIENCE

GRADUATE PROGRAM IN BIOLOGY YORK UNIVERSITY TORONTO, ONTARIO JULY 2012

© Amir Naeeni, 2012 Library and Archives Bibliotheque et Canada Archives Canada

Published Heritage Direction du Branch Patrimoine de I'edition

395 Wellington Street 395, rue Wellington Ottawa ON K1A0N4 Ottawa ON K1A 0N4 Canada Canada Your file Votre reference ISBN: 978-0-494-90091-8

Our file Notre reference ISBN: 978-0-494-90091-8

NOTICE: AVIS: The author has granted a non­ L'auteur a accorde une licence non exclusive exclusive license allowing Library and permettant a la Bibliotheque et Archives Archives Canada to reproduce, Canada de reproduire, publier, archiver, publish, archive, preserve, conserve, sauvegarder, conserver, transmettre au public communicate to the public by par telecommunication ou par I'lnternet, preter, telecommunication or on the Internet, distribuer et vendre des theses partout dans le loan, distrbute and sell theses monde, a des fins commerciales ou autres, sur worldwide, for commercial or non­ support microforme, papier, electronique et/ou commercial purposes, in microform, autres formats. paper, electronic and/or any other formats.

The author retains copyright L'auteur conserve la propriete du droit d'auteur ownership and moral rights in this et des droits moraux qui protege cette these. Ni thesis. Neither the thesis nor la these ni des extraits substantiels de celle-ci substantial extracts from it may be ne doivent etre imprimes ou autrement printed or otherwise reproduced reproduits sans son autorisation. without the author's permission.

In compliance with the Canadian Conformement a la loi canadienne sur la Privacy Act some supporting forms protection de la vie privee, quelques may have been removed from this formulaires secondaires ont ete enleves de thesis. cette these.

While these forms may be included Bien que ces formulaires aient inclus dans in the document page count, their la pagination, il n'y aura aucun contenu removal does not represent any loss manquant. of content from the thesis. Canada Abstract

La is a ubiquitous, eukaryotic protein first identified as an autoantigen in systemic lupus erythematosus and Sjogren's syndrome. It is involved in the processing of many RNA products including non-coding pol II transcripts and pol HI transcripts, as well as the translation of several mRNAs containing atypical translation initiation contexts, such as internal ribosome entry sites. Human La (hLa) has previously been shown to bind pre-tRNAs based on two mechanisms: sequence-specific binding of UUU 3'-OH, and a UUU 3'-OH independent mode relying on uncharacterized RNA structural determinants. La up-regulates the translation of some viral and cellular mRNAs but the mechanism of this enhancement is unknown. We hypothesize that La performs this function by harbouring RNA chaperone activity. RNA chaperones can assist RNAs in attaining their native structure by providing strand annealing and/or strand dissociation activities.

Using in vitro fluorescence resonance energy transfer (FRET) assays I have shown that

hLa is an RNA chaperone that harbours both strand annealing and dissociation activities, and

that these activities are centered on the RNA recognition motif, including a C-terminal, non-

canonical a3-helix and a subsequent disordered region. These same amino acids are also

required for the hLa dependent rescue of misfolded tRNAs in vivo.

ii Acknowledgements

First and foremost I would like to thank my friend and supervisor, Dr. Bayfield. His guidance on general lab techniques, assistance in troubleshooting experiments, and motivation at times of distress were all important reasons for the success of my project. I could not have become the scientist that I am today without his constant dedication to improve me and my work.

I would also like to thank my advisor Dr. Donaldson for providing me with constructive comments and advice throughout my thesis and allowing me unlimited access to the Cary Eclipse fluorimeter. As well, his knowledge and guidance on setting up the fluorimeter program were greatly appreciated and were an important part of the success of my work.

Finally, I would like to thank the Bayfield Lab members Neha, Rawaa, Lidia, Bianca,

Karine, Sam, Jyotsna and Ana for making my tenure in the Bayfield Lab a very enjoyable one and one that I will cherish for the rest of my life.

iii Table of Contents

Abstract ii Acknowledgements iii Table of Contents iv Abbreviations v List of Figures vi

1. Chapter I- Introduction 1 1.1 A general introduction to La Protein 2 1.2 La function in tRNA maturation 2 1.3 Conserved and divergent elements of La proteins 3 1.4 UUU-3'OH dependent and UUU-3'OH independent La-RNA binding 6 1.5 Intracellular trafficking by La 9 1.6 Complex La functions 12 1.7 La in mRNA translation 13 1.8 RNA Chaperones 15 1.9 Proposal 17

2. Chapter II- RNA Chaperone Activity of Human La Protein is Mediated by Variant RNA Recognition Motif. 19

3. Chapter III- The role of hLa phosphorylation in RNA chaperone activity 20 3.1 Introduction 21 3.2 Materials and Methods 23 3.3 Results 24

4. Chapter IV- Discussion 27 4.1 RNA chaperone activity and the RRM 28 4.2 Amino acids of the RRM responsible for RNA chaperone activity 29 4.3 RNA chaperones acting as a quality control check 30 4.4 a3-helix mediated enhancement of strand annealing activity 31 4.5 CTD hLa RNA chaperone activity 32 4.6 The role of the LAM in hLa RNA chaperone activity 33 4.7 The role of the UUU-3'OH sequence in hLa RNA chaperone activity 33 4.8 The role of phosphorylation in hLa RNA chaperone activity 34 4.9 Future implications of hLa RNA chaperone activity in La associated diseases 35

5. References 36

iv Abbreviations hLa = human La

HCV= Hepatitis C virus

LAM= La motif

RRM= RNA recognition motif

FRET= Fluoresence Resonance Energy Transfer

CTD= C-terminal domain

NTD= N-terminal domain

SBM= Short basic motif

NLS= Nuclear localization signal

NRE= Nuclear retention element

CK2= Casein Kinase 2

IRES= Internal ribosome entry site

ITAF= ERES trans acting factor

CML= Chronic myelogenous leukemia uORF= Upstream open reading frame

LARPs= La Related Proteins

MDM2= Murine double minute 2

CRM1= chromosomal region maintenance 1

RNP= Ribonucleoprotein

PABP= Poly(A)-binding protein

TOP= Terminal Oligopyrimidine Tract

v List of Figures

Chapter I

Figure 1- Structural conservation among La proteins from various organisms ..5 Figure 2- Comparison of the protein-RNA interaction of hLa and other proteins ..7 Figure 3- Overview of hLa-UUU-3'OH dependent binding 10

Chapter II

Figure 1- hLa and Slalp display RNA strand association and strand dissociation activity. Figure 2- Enhancement of RNA strand annealing and dissociation by hLa does not require UUU-3'OH mediated RNA binding. Figure 3- Domain mapping of the RNA chaperone activity of human La. Figure 4- The canonical RRMl RNA binding surface and the a3-helix are required for RNA chaperone activity by the La domain. Figure 5- The a3-helix of hLa can enhance RNA chaperone activity of the U1A protein in vitro and is required for tRNA mediated suppression via a mutated pre-tRNA in vivo.

Chapter III

Figure 1- Confirmation of hLa phosphorylation by CK2 in vitro 25 Figure 2- Affect of phosphorylation on hLa RNA chaperone activity 26

vi Chapter I

Introduction

1 1. Introduction

1.1 A general introduction to La protein

La proteins are conserved and are abundantly expressed in all eukaryotic cells1.

Human La (hLa) protein was first identified as an autoantigen in systemic lupus erythematosus and Sjogren's syndrome2. Although it is the autoantigen in these diseases, there is little known about the mechanism of La's involvement. La protein is essential in all metazoans examined, such as Drosophila, mice, trypanosoma, and Arabidopsis,3-6 but it can be deleted in fission and budding yeast, where La has been extensively studied7'8.

La is very well known to be an RNA binding protein. It associates with polymerase m precursor transcripts for tRNAs, 5S rRNAs, U6 snRNAs, SRP RNAs and the cytoplasmic Y

RNAs9. In fact, it has been suggested that La may be the first protein to associate with nascent polymerase III transcripts due to its presence in the pol III holoenzyme. As well, La has been found to bind intermediates of newly synthesized pol II transcripts such as the Ul, U2, U4, and U5 pre-snRNAs10. La binds all of these substrates by associating with the UUU-3'OH sequence that is present at their 3' ends at some point during their processing (see section 1.4).

The best known function of La is in tRNA maturation.

1.2 La function in tRNA maturation

Several steps have to be completed before a premature tRNA is processed to a mature tRNA11. First, the 5' leader is cleaved endonucleolytically by RNAse P, followed by cleavage of the UUU-3'OH containing trailer by RNAse Z. The intron (if present) of the pre-tRNA is then spliced, and CCA addition at the 3' end occurs. Pre-tRNAs also undergo specific post-

2 transcriptional modifications that are important for their maturation and are associated with proper folding. If the tRNAs have acquired mutations, are misfolded, are hypomodified, or are otherwise defective in any way, they may be degraded by nuclear surveillance via the

TRAMP/nuclear exosome complex. However, for some defective pre-tRNAs, the presence of

La may be sufficient to rescue them from degradation until they are processed into functional, mature tRNAs.

La must be present in order for tRNAs to be processed via the steps outlined above.

While most tRNAs are processed in this way, some are processed via a La independent pathway that operates through exonucleolytic removal of the trailer. In fact, when La is deleted all tRNAs must be processed via the La independent pathway at the expense of the degradation of misfolded tRNAs that would otherwise have been rescued by La. In the La dependent pathway, La interacts with the trailer UUU-3'OH sequence of pre-tRNAs and protects them from exonuclease digestion. This allows for pre-tRNA trailer cleavage to happen endonucleolytically by RNAse Z, as mentioned above8'12. This protection is an essential component of pre-tRNA maturation as La mutants that lack the ability to bind and protect the UUU-3'OH sequence also lose the ability to help pre-tRNAs mature13. Although it interacts with pre-tRNAs, La has not been found to associate with mature tRNAs. It is hypothesized that once 3' trailer removal has occurred, La releases the pre-tRNA and recycles back on a nascent pre-tRNA in order to facilitate further rounds of maturation.

1.3 Conserved and divergent elements of La proteins

La proteins share a conserved structure at the N-terminal Domain (NTD) which is comprised of a La motif (LAM) and RNA recognition motif (RRM) separated by a linker

3 sequence and collectively called the La domain14'15. In human La (hLa) the LAM spans amino

acids 10-90 and the RRM1 spans amino acids 112-18416. The LAM is also found in other eukaryotic proteins,15 including a group of proteins termed La Related Proteins (LARPs),

which show different degrees of conservation to human La protein. The RRM is a very 17 18 common RNA binding protein domain in eukaryotes ' . The C-terminal Domain (CTD) of

hLa and other La proteins are not well conserved. In hLa it contains a nuclear retention element (NRE), a short basic motif (SBM), a nuclear localization signal (NLS), and an

uncharacteristic RRM termed RRM2.

The conservation between hLa and Slalp (Schizosaccharomyces pombe La) is

primarily in the NTD, including the LAM and the RRM19 (Figure 1). This conservation is

mostly based on structure rather than sequence. The LAM structure is a winged helix fold

similar to that found in other nucleic acid binding proteins, with an alal'a2pia3a4a5p2p3

topology. The RRM is made of P chains and a helices, in the canonical plalp2p3a2p4

orientation, and contains aromatic amino acids on the pi and (33 strands (hLa: Y114 and

F155) typically associated with the recognition of RNA targets. Both the RRM1 and RRM2 of

hLa have also been shown to contain non-canonical a3-helices at their CTDs that serve

unknown functions. The LAM and the RRM1 of the NTD co-operate to bind hLa's best

characterized substrates, RNAs that end in UUU 3'-OH (see following section)16. The length

and complexity of the CTD varies and ranges from -70 amino acids in Slalp, to 200 amino

acids in hLa. The CTD of hLa contains a NRE important for La shuttling (see section 1.5),

whereas this function is associated with the NTD of Slalp immediately following the RRM.

4 specific RNA binding charged C-terminus i 1 r~ La motif RRM RRM SBM NLS H. sapiens La II 1 II 408 dimeriz. ? 9 D. melanogaster La 390

C. elegansCAAEAA 395

S. pombe Sla1 298

S. cerevisiae Lhp1 p 275 NLS T. brucei La El 335

Figure 1- Structural conservation among La proteins from various organisms. Most of the conservation is seen in the La motif and RRM of the NTD. The CTD of La proteins are more divergent. RRM- RNA recognition motif, SBM- short basic motif, NLS- nuclear localization signal. Adapted from19.

5 1.4 UUU-3'OH dependent and UUU-3'OH independent La-RNA binding

The best known target of La are RNAs that end in a UUU-3'OH sequence. These are

present at the ends of all polymerase HI transcripts and are transiently acquired during the

processing of some non-coding polymerase II transcripts. Previous studies have shown that

both the LAM and the RRM are required to bind the UUU-3'OH sequence 20'21, and so it was

assumed that the canonical RNA binding surfaces of these domains would be utilized in this

binding mode (Figure 2). However, this was not the case as was shown in a co-crystal

structure of the La NTD bound to an RNA ending in UUU-3'OH. This structure showed that

although both the LAM and the RRM are required to bind the RNA, all of the direct contacts

are to amino acids in the LAM opposite the face normally used by winged helix proteins for

nucleic acid engagement, leaving the canonical binding surfaces of the LAM and RRM1 free

to perform other functions22. Specifically, the 3' hydroxyl group on the terminal uracil

hydrogen bonds with the side chain carboxylate group of D33. This interaction is

hypothesized to help discriminate between RNAs that have been newly synthesized and those

destined for degradation, since ones cleaved by nucleases should contain a 3' phosphate. For a

similar reason, the presence of the 3'OH also helps discriminate between internal and terminal

polyuridine stretches. When binding the UUU-3'OH, hLa has a specific preference for the

penultimate uracil22. The O2 atom of this uracil hydrogen bonds with the side chain amide of

Q20, stacks with Y23, and hydrogen bonds with L140 of the RRM (Figures 2 and 3).

Consistent with the idea that the canonical nucleic acid binding surfaces may perform

functions other than UUU-3'OH engagement, mutation to the conserved amino acids of the

canonical RRM1 binding surface, (hLa Y114A/F155A), resulted in a mutant that retained the

6 B La motif/RRMl and RNA U1A and RNA Genesis and DNA

Figure 2- Comparison of the protein-RNA interaction of hLa and other proteins. Left- Interaction between the RRM of U1A and an RNA. Middle- Interaction between the hLa NTD and a UUU-3'OH containing RNA. Right- Interaction between the winged helix protein Genesis and double stranded DNA. hLa interacts with its RNA in a way that does not resemble canonical nucleic acid binding by an RRM or a winged helix. This leaves the canonical binding surfaces of these free to be involved in other functions. The three terminal U nucleotides in the La structure are colored yellow; other nucleotides are green. The winged- helix domains are in blue, with the typical nucleic acid recognition helix in red and p sheets in cyan. RRM domains are in pink, with the P strands in violet. Adapted from12.

7 ability to bind the UUU-3'OH sequence, but lost the ability to rescue misfolded tRNAs in vivo. Thus, it was hypothesized that the canonical binding surface of the RRM contacts the tRNA at sites other than the UUU-3'OH trailer, and contributes to pre-tRNA maturation at least in part by helping tRNAs fold23.

Consistent with the idea of binding to other sites on the tRNA, mutation to the basic amino acids between the (32 and p3 sheets of the RRM1, termed loop 3, resulted in mutants that had normal capacity to bind a 12 nt UUU-3'OH containing trailer RNA substrate but had decreased affinity for pre-tRNAs and tRNAs. This suggested that perhaps there is a binding mode that binds the tRNA and operates independently of the UUU-3'OH dependent binding mode. Interestingly, this UUU-3'OH independent binding mode has alternate [Mg+2] sensitivity compared to the binding of the UUU 3'-OH trailer. This substantiated the idea that

La utilizes two distinct RNA binding modes: one that is [Mg+2] insensitive and UUU-3'OH dependent, and another that is [Mg+2] sensitive and UUU-3'OH independent13. Although much is known about the exact binding mechanism of the UUU-3'OH dependent mode, details about the UUU-3'OH independent mode are still unclear. However, it is thought that both of these binding modes work cooperatively for the maturation of pre-tRNAs. This is because both binding modes together provide stable binding to the pre-tRNA, as opposed to binding to the trailer or tRNA alone after endonucleolytic cleavage, which bind with lower affinity and dissociate relatively quickly. Hence, after the trailer has been cleaved off, the affinity of La for the separated trailer and tRNA body are low enough to allow La to dissociate and recycle on to a new pre-tRNA13.

In addition to binding the tRNA in a UUU-3'OH independent manner, this binding mode was also hypothesized to function in RNA folding. It is known that mutation of basic amino acids in loop3 results in a defective ability to rescue misfolded tRNAs and to rescue a misfolded self splicing intron (discussed more in detail in section 1.6). Therefore, it is now hypothesized that the 'unused' canonical binding surfaces of the RRM contributes to RNA folding.

Although the binding of RNAs that end in UUU 3'-OH by the La motif and RRM1 is well characterized, the role of RRM2 in RNA binding is still elusive as it does not resemble a typical RRM. Recent work has shown that RRM2 is important for recognizing the domain IV of the Hepatitis C Virus (HCV) IRES, and that this binding is distinct from the UUU-3'OH dependent binding that requires the La motif and RRM124. As more studies like this are completed, a thorough understanding of the binding by this domain may be achieved.

1.5 Intracellular trafficking by La

In the C terminal domain, hLa contains an a helix immediately C-terminal to RRM2 that folds back and obscures the canonical RRM2 RNA binding surface25. This helix also serves as the nuclear retention element (NRE), helping keep hLa localized to the nucleus .

Deletion of the NRE in the context of full length La protein resulted in the cytoplasmic accumulation of La concomitant with a defect in La dependent pre-tRNA processing27. The

NRE contains highly conserved lysine residues at positions 316 and 317 that are important for retention in the nucleus. Point mutation of these residues also resulted in mutants that are inactive in rescuing La associated, misfolded tRNAs in vivo because they mislocalize to the cytoplasm. Leptomycin B (LMB), an inhibitor of chromosomal region maintenance 1

(CRM1), a nuclear export factor, helps keep La in the nucleus and can rescue this function.

The other characterized trafficking element, the nuclear localization signal (NLS), is also

9 RRMl

Figure 3- Overview of hLa-UUU-3'OH dependent binding. The hLa NTD is shown with the LAM (pink) and the RRMl (blue). Amino acids involved in UUU-3'OH binding are shown as sticks, and ones known to make specific contacts are outlined in green. Mutants of interest and the non-canonical a3-helix of the RRMl are shown in red. The NTD of hLa is seen on the right, showing the La motif and the RRMl. On the left, a closer view of the amino acids involved in the recognition of the UUU-3'OH can be seen. The penultimate uracil (U8) hydrogen bonds with the side chain amide of Q20 and stacks with Y23. D33 makes bidentite contacts to the 2' OH and 3'OH of the last uracil nucleotide.

10 crucial for controlling hLa's subcellular localization as it is required for nuclear import.

Mutants that retain the NLS but lose the NRE first localize to the nucleus and are subject to export to the cytoplasm, while mutations to the NLS result in constitutive cytoplasmic accumulation26.

The short basic motif (SBM) is C-terminal to the NRE and is approximately 40 amino acids long. This motif has been shown to enhance the stability of pre-tRNA binding to hLa by engaging the 5' leader present on these substrates. The SBM also houses serine 366, a site of hLa phosphorylation. The non-phosphorylated version of the SBM inhibits 5' processing of

pre-tRNAs by stabilizing the La-tRNA leader interaction. However, phosphorylation of serine

366 in the nucleus by casein kinase 2 (CK2) relieves this inhibition by restoring access of the leader to RNase P28. Thus, phosphorylation is thought to be a switch for turning off the RNA

binding ability of the SBM. Interestingly, phosphorylated hLa is present in the nucleoplasm,

and non-phosphorylated hLa is present in the cytoplasm.

The phosphorylation status of hLa also correlates with the identity of La associated

RNAs28. Non-phosphorylated hLa is more highly associated with RNAs that lack the UUU-

3'OH sequence, and mRNAs in particular. This is because the relative abundance of non

UUU-3'OH containing RNAs are higher in the cytoplasm, where non-phosphorylated hLa

resides. Thus, it appears that interaction with the different substrates by phosphorylated or

non-phosphorylated hLa is a result of their different subcellular locations and not via distinct

binding mechanisms per se. Consistent with this, hLa mutants that are not phosphorylatable

(hLa S366A) experience similar subcellular distribution to wild type hLa . This suggests that

the phosphorylation status in different compartments is likely due to the local availability of

kinases and phosphatases and not due to phosphorylation specific trafficking mechanisms. La can also receive other post translational modifications, including phosphorylation at other sites and sumoylation. Phosphorylation of serine 302 by a mitogen activated kinase, akt, in mouse La promotes export out of the nucleus and is associated with recruitment to

polysomes29. When analyzing other La proteins, it is noted that such phosphorylation sites are

not conserved amongst different species, suggesting that different organisms utilize La

phosphorylation to different degrees. In addition to phosphorylation, sumoylation at lysine 41

of hLa has been shown to be important for the retrograde transport of La in neural axons30.

This was demonstrated by the fact that wild type hLa has the ability to perform both

retrograde and antiretrograde transport, while sumoylated La could only engage in retrograde

transport. This differential transport may be connected to the fact that sumoylated La is able to

interact with dynein whereas wild type La interacts with kinesin.

1.6 Complex La functions

As stated previously, La binds the UUU 3'-OH sequence and protects the ends of pre-

tRNAs from degradation. This is La's best characterized function, however, several pieces of

evidence suggest that it is not the sole function of La for pre-tRNAs. La can be deleted in

Saccharomyces cerevisiae, unlike in metazoans. However, La becomes an essential protein in

budding yeast when deleted in strains that also have mutations that destabilize the structure of

essential tRNAs8'31. Furthermore, La deletion is also synthetically lethal with mutations to

tRNA modification enzymes that are thought to stabilize tRNA secondary structures, and

ectopic La can rescue this function32. An example of such a tRNA modification enzyme is

Trmlp, which is thought to facilitate tRNA folding by catalyzing the formation of

dimethylguanosine at position 26 in many tRNAs. In other words, La is hypothesized to complement the function of tRNA modification enzymes by stabilizing tRNA structures. Also, certain La variants with mutations in the RRM1 region have been identified that retain the ability to bind and protect the 3' ends of pre-tRNAs, but are yet incapable of rescuing misfolded tRNAs13'23. In addition to these, hLa has also been shown to rescue the activity of a misfolded self-splicing intron in vitro33. This assay uses a modified pre-mRNA of the T4 phage thymidylate synthase gene whose intron is flanked by shortened exons. This cis- splicing reaction is only efficient in the presence of RNA chaperones that help the RNA fold into the native conformation. Finally, La protein is also important for the stability and assembly of certain non-coding pol II transcripts into ribonucleoproteins (RNPs)10. All of this evidence suggests that La has more complex functions in tRNA metabolism that surpass simple protection of the 3' ends from degradation. It has been hypothesized that La harbours

RNA chaperone activity and that it is this function that helps RNAs fold into their native conformations.

1.7 La in mRNA translation

mRNAs in eukaryotes can be translated via a cap dependent or a cap independent

pathway. In the normal cap dependent pathway, several eukaryotic initiation factors including eIF3, eIF4A, eEF4E, and eIF4G associate around the 5'cap and recruit the small ribosomal

subunit which scans in the 3' direction to find the AUG start codon34. Cap independent

translation works by different mechanisms with perhaps the best understood ones being those

pertaining to internal ribosome entry sites (IRESs). The main difference between this and the

cap dependent mechanism is that in the independent mechanism the pre-initiation machinery

does not first bind the cap and then scan for the start codon. Instead, specific IRES RNA structural elements recruit the translational machinery (either an initiation factor or the small ribosomal subunit) directly to the initiation codon. Notably, several cellular IRES trans acting factors (UAFs) have been associated with enhancement of IRES function and are thought to assist in this recruitment. In fact, the first UAF found to be important for translation from an

IRES (specifically, the poliovirus IRES) was La protein35.

In addition to poliovirus, La has also been shown to interact with the Hepatitis C Virus

(HCV) and encephalomyocarditis virus IRESs and be important for their translation36-38.

These IRESs are not similar in their sequence or their structure, yet all rely on La for their translation. Through inhibition of in vitro translation from a HCV or poliovirus IRES in a rabbit reticulosyte lysate system, it was concluded that the HCV IRES requires less La protein for optimal translation than the poliovirus IRES . As well, through mutational and UV cross- linking analysis, it was found that La binds the HCV IRES in the context of the initiator AUG, as La binding was not seen in mutants without the AUG start codon36. This binding of the

IRES element is dependent on amino acids 174-197, found in the linker between the NTD and

CTD, as point mutants in this region showed compromised IRES binding39.

In addition to viral mRNAs, La has also been implicated in the translation of cellular mRNAs, including the X-linked inhibitor of apoptosis protein (XIAP)40 and murine double minute 2 (MDM2)41. MDM2 is a well known negative regulator of p53, an essential tumour suppressor. As such, over expression of MDM2 is associated with tumour progression. It has been shown that in chronic myelogenous leukemia (CML), a cancer of the blood, MDM2 over expression is associated with shorter survival times and poor prognoses41. In this same disease, the up-regulation of La protein enhances translation of the MDM2 mRNA, which increases MDM2 levels and consequently decreases p53 levels, and leads to an enhanced diseased state. Similar to the HCV translation system, this cellular factor also utilizes a non- typical mode of translation, an upstream open reading frame (uORF). La was found to interact with a 27nt region upstream from the genuine MDM2 start codon and enhance translation from this, a phenomenon which can be reversed by the addition of competitor RNAs or the use of La mutants41.

1.8 RNA Chaperones

RNA molecules inherently have the ability to form traditional Watson-Crick base pairs as well as a variety of other non-conventional base pair interactions. This means that a single

RNA molecule can potentially adopt a variety of different conformations, some of which represent long lived, misfolded kinetic traps that act as barriers to the folding process42. These barriers are thought to be dominant in vitro, as shown with the Tetrahymena group I intron ribozyme43'44, yet efficient folding occurs in vivo. Thus, it is hypothesized that certain proteins help lead RNAs out of kinetic traps and towards their native conformations. A class of proteins that help RNAs attain their native conformation in order to perform their functions are RNA chaperones, thus making RNA chaperones an integral part of cellular systems.

Although little is known about the mechanism of RNA chaperone activity, it is hypothesized that they work by helping resolve kinetic traps in RNA molecules by unwinding these and allowing for subsequent attempts at correct folding42'45'46. It is thought that RNA chaperones accomplish this task via strand annealing and/or strand dissociation activity.

Strand annealing activity is thought to promote the interaction of RNA substrates, and strand dissociation is thought to facilitate the unwinding of alternate structures. Although no central motif or domain that performs these activities has been discovered, regions that are predicted to be disordered have previously been shown to be important for RNA chaperone activity45'46. It is thought that disordered regions function by an 'entropy transfer mechanism'. First, this

model assumes that the inherent disorder of this region allows for more promiscuity and

flexibility in order to bind a wide range of misfolded RNA substrates46. After binding the

RNA substrate, the flexibility of the disordered region is hypothesized to decrease while the

rigidity of the RNA molecule diminishes. Thus, it is thought that the disordered region

transfers entropy to the RNA in order to undo its structure. As well, the disordered region

allows for binding of the RNA substrates to be more of a transient phenomenon, as binding

and release of the RNA substrate repeatedly allows for more attempts at refolding46'47.

Consistent with this, RNA chaperones are generally thought to have lower affinity for RNA

substrates than RNA binding proteins that form stable RNPs. Consistent with this claim,

previous work has shown that a mutant version of the bacterial RNA chaperone StpA, that has

higher affinity for RNAs than wild type StpA, has diminished RNA chaperone activity48.

RNA chaperones do not have any external energy requirements such as ATP42. This

differentiates them from other classes of RNA remodelling proteins such as helicases, which

function via a distinct ATP dependent 'unwinding' mechanism in order to remodel RNPs and

promote splicing in ribozymes. RNA chaperone activity has already been linked to certain

roles in cellular processes including regulation of transcription, RNP assembly and

stabilization, RNA export, virus replication and histone-like nucleoid structuring42. It is

possible that many more roles for RNA chaperone activity will be elucidated in the coming

years as more data is obtained about their function.

16 1.9 Proposal

Several pieces of evidence suggest that hLa has complex functions in tRNA metabolism that surpass a simple 3'end protection role. Much evidence suggests that La may be helping them fold. In addition to the major known function of La in tRNA maturation, La also has implications in cellular and viral mRNA metabolism. Notably, La mRNA targets all harbour atypical translation initiation contexts in that they have 5' untranslated regions that assume strict secondary structures for optimal function. La dependent remodelling of these mRNAs has been proposed as a unifying hypothesis to explain La's complex roles in both pre- tRNA and mRNA processing.

The major goal of this project is to determine whether or not hLa harbours RNA chaperone activity, what substrate requirements are needed for this and which regions of the protein contribute to this function. RNA chaperones have already been described in many systems and several assays have been identified that have the ability to test for RNA chaperone activity. One such assay is the self splicing intron assay, which relies on the ability of the putative RNA chaperone to resolve the shape of a misfolded self splicing intron and restore self cleavage (see section 1.6). However, the drawback of this assay is that it is incapable of differentiating between strand annealing and strand dissociation activity. A more recently,developed assay uses the basic principle of fluorescence coupled with fluorescence resonance energy transfer (FRET) in order to differentiate between RNA chaperones that have one or both of strand annealing and strand dissociation activity. Thus, this was adopted as the assay of choice when testing for hLa RNA chaperone activity.

Using the aforementioned FRET assays I have shown that hLa is an RNA chaperone that harbours both strand annealing and dissociation activities and that these activities are evolutionarily conserved in the fission yeast homologue of La, Slalp. Furthermore, I have shown that the RNA chaperone activity is UUU-3'OH independent, and relies on the RNA recognition motif and the amino acids immediately after this, which also includes a non- canonical a3-helix. This same helix, if appended on to the end of the unrelated UI A RRM, enhances strand annealing activity by more than two fold. Finally, the mutation of certain

conserved amino acids in RRMl results in the loss of RNA chaperone activity in vitro, and a

loss of the ability to rescue misfolded tRNAs in vivo. The results that were highlighted here

are described in detail in the attached manuscript in Chapter 2.

18 Chapter II

RNA Chaperone Activity of Human La Protein is Mediated by Variant RNA Recognition Motif

This chapter is presented as a published research article describing the RNA chaperone activity of human La protein. It shows that hLa is an RNA chaperone with UUU-3'OH independent strand annealing and dissociation activities. It also demonstrates that the RRM1 with the a3-helix and subsequent disordered region form the minimal requirements for hLa

RNA chaperone activity.

Author's contributions:

Amir R. Naeeni: Performed all (100%) of the experiments presented in the manuscript and in the supplemental data. Contributed to experimental design and in the writing and editing of the manuscript.

Maria R. Conte: Provided some of the DNA constructs (-20%) used for the experiments.

Mark A. Bayfield: Contributed to the design of the experiments and was the primary author of the manuscript.

19 Supplemental Material can be found at: http://www.jbc.org/content/suppl/2011/12/27/M111.276071.DC1 .html

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 287, NO.8, pp. 5472-5482. February 17,2012 2S Author's Choice © 2012 by The American Society for Biochemistry and Molecular Biology, Inc. Published in the USA

RNA Chaperone Activity of Human La Protein Is Mediated by Variant RNA Recognition Motif*0 Received for publication, June 24,2011, and in revised form, December 23,2011 Published, JBC Papers in Press, December 27,2011, DOI 10.1074/jbcMl 11.276071 AmirR. Naeeni*1, Maria R. Conte5,and Mark A. Bayfield*2 From the *Department of Biology, York University, Toronto, Ontario M3J 1P3, Canada and the §Randall Division of Cell and Molecular Biophysics, King's College London, London SE1 1UL, United Kingdom

La proteins are conserved factors in eukaryotes that bind and shown to bind certain noncoding polymerase II transcripts via a protect the 3' trailers of pre-tRNAs from exonuclease digestion terminal UUU-3'OH motif that they obtain transiently during via sequence-specific recognition of UUU-3'OH. La has also their processing (7, 8). been hypothesized to assist pre-tRNAs in attaining their native La proteins contain a conserved N-terminal domain called a fold through RNA chaperone activity. In addition to binding La domain or La module, which is responsible for specific polymerase III transcripts, human La has also been shown to UUU-3'OH binding (1). The La domain is made up of two enhance the translation of several internal ribosome entry sites motifs: an N-terminal La motif, similar in structure to a winged and upstream ORF-containing mRNA targets, also potentially helix fold, and an RNA recognition motif (RRM),3 separated by through RNA chaperone activity. Using in vitro FRET-based a short linker (9, 10). Crystallographic studies on co-crystals assays, we show that human and Schizosaccharomycespombe La containing the La domain and a UUU-3'OH containing short proteins harbor RNA chaperone activity by enhancing RNA RNA, as well as accompanying biochemical work, have revealed strand annealing and strand dissociation. We use various RNA conserved residues in the La motif that are important for UUU- substrates and La mutants to show that UUU-3'OH-dependent 3'OH-dependent RNA binding, and mutations to these cause La-RNA binding is not required for this function, and we map enhanced degradation of pre-tRNAs by 3' exonucleases in vivo RNA chaperone activity to its RRM1 motif including a nonca- (11-13). In addition to UUU-3'OH-dependent contacts, nonical «3-helix. We validate the importance of this or3-helix by regions important for UUU-3'OH independent binding of pre- appending it to the RRM of the unrelated U1A protein and show tRNAs have been mapped to other regions of La proteins, that this fusion protein acquires significant strand annealing including the loop 3 region of the conserved RRM1 motif and activity. Finally, we show that residues required for La-mediated the less well conserved C-terminal domain, but the structural RNA chaperone activity in vitro are required for La-dependent requirements of RNA targets for these binding modes are less rescue of tRNA-mediated suppression via a mutated suppressor well understood (14,15). tRNA in vivo. This work delineates the structural elements In addition to protecting the 3' ends of pre-tRNAs, La pro­ required for La-mediated RNA chaperone activity and provides teins have also been hypothesized to function as RNA chaper- a basis for understanding how La can enhance the folding of its ones for these. Although the simple capacity of La proteins to various RNA targets. enhance the propensity of pre-tRNAs to be correctly processed through their transient binding and associated 3' end protec­ tion would be sufficient to characterize them as molecular La proteins are conserved throughout nearly all eukaryotes chaperones (7), other data point to a function for La proteins in and are highly expressed RNA binding factors with important RNA folding more directly. For example, La deletion in budding functions in the processing and metabolism of a variety of RNA yeast is synthetically lethal with tRNA mutations predicted to targets (1). Their best characterized function is to engage the result in their misfolding or with mutations to tRNA modifica­ UUU-3'OH trailers of polymerase III transcripts, such as pre- tion enzymes thought to stabilize tRNA structure (6, 16-19). tRNAs, and protect them from exonuclease digestion during Furthermore, yeast La has been shown to stabilize the native their processing. Although La is essential in higher eukaryotes, structure of mutated, misfolded tRNA anti-codon stems in including Drosophila and mice (2, 3), La can be deleted in bud­ vitro, and can rescue the respective mutant tRNAs in vivo (16). ding yeast and fission yeast (4, 5), and La study in yeast has Finally, mutations to the RRM1 domain of human La (hLa) and shown that La binding to pre-tRNAs can also influence the Schizosaccharomyces pombe La (Slalp) have been associated order of tRNA processing events (6). Yeast La has also been with defects in the rescue of mutated pre-tRNAs despite nor­ mal 3' end binding and protection activity (13). Consistent with

* This work was supported by the Banting Research Foundation and the Nat­ this hypothesis, human La is active in an in vitro assay in which ural Sciences and Engineering Research Council of Canada (to M. A. B.), as a misfolded, self-splicing intron relies on an RNA chaperone to v well as The Wellcome Trust (to M. R. C). acquire the native fold required for catalysis (14,20). ** Author's Choice—Final version full access. ®This article contains supplemental Tables S1-S4 and Figs. SI and S2. In addition to binding UUU-3'OH containing RNA targets, 1 Supported by a Canadian Institutes of Health Research Frederick Banting La binds to a significant number of viral and cellular coding and Charles Best Canada Graduate Scholarship Master's Award. 2 To whom correspondence should be addressed:York University, 4700 Keele St., Life Science Bldg. #327E, Toronto, ON M3J 1P3, Canada. Fax: 416-736- 3The abbreviations used are: RRM, RNA recognition motif; hLa, human La; 5698; E-mail: [email protected]. IRES, internal ribosome entry site; LARP, La-related protein.

5472 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 287-NUMBER 8-FEBRUARY 17, 2012 Recognition Motif Mediates La Protein RNA Chaperone Activity mRNA transcripts and has been implicated in the translation of templates (14). Full-length U1A was cloned as a cDNA from these. A common feature of these mRNAs is that they typically total RNA (HeLa cells) into the Hindlll and Ndel sites of harbor atypical translation initiation motifs, including internal pET28a, which was subsequently used as a template for the ribosome entry sites (IRESs), upstream ORFs or 5' terminal other U1A variants. All of the clones were confirmed through oligopyrimidine sites (21-28). La can either enhance or repress sequencing analysis. the translation of these, but for the IRES and upstream ORF Protein Purification—His-tagged proteins were expressed in mRNA targets, La is generally thought to act as a translational BL21 Star (DE3) pLysS or RosettaBlue (DE3) pLysS. Protein enhancer. Notably, the very first IRES trans-acting factor, char­ production was induced with 0.1-1 mM isopropyl /3-D-thioga- acterized as a protein important for the enhancement of trans­ lactopyranoside for 3 h to overnight and purified using cobalt lation from the poliovirus IRES, was identified to be human La affinity chromatography (His-TRAP; ThermoFisher). Proteins (21). One mechanism that has been hypothesized for La func­ were then concentrated and desalted into RNA chaperone tion for such mRNAs is that it can assist in the correct folding of buffer (50 mM Tris-HCl, pH 7.5,1.5 mM MgCl2, and 1 mM DTT) RNA structures required for optimal translation by acting as an and quantified using SDS-PAGE and Coomassie staining. RNA chaperone (22,29 -31). Thus, the capacity for La to act as FRET Assays—RNA chaperone assays were performed as an RNA chaperone has been suggested to represent a unifying described (37), with the following modifications: RNA sub­ feature for La function between its pre-tRNA and mRNA tar­ strates (see text and supplemental Table SI for sequences) were gets (32, 33). Despite the importance that such a role may play obtained from IDT and Dharmacon and labeled with Cy5 in La function, a rigorous analysis of La-dependent RNA chap­ (upper strand) and Cy3 or Dy547 (lower strand). FRET reac­ erone activity is currently lacking. tions took place in a total volume of400 jllI in a heated cuvette at Recent FRET-based assays have been developed that are 37 °C. For hLa and mutants, the concentration of each labeled capable of measuring strand annealing and strand dissociation RNA was 25 nM, and the concentration of protein was 0.1 /XM. capabilities of RNA chaperones (34, 35). In this work, we use For the positive control StpA, the concentrations of each such an assay to demonstrate that human La harbors both of labeled RNA substrate was 5 nM, and the concentration of pro­ these RNA chaperone activities and that this is a conserved tein was 0.5 ixm. At time = 180 s, excess, nonlabeled competitor feature between S. pombe and human La proteins. Consistent RNA, with sequence 5'-ACUGCUAGAGAUUUUCCACAU- with a role in the folding of mRNA transcripts, we show that 3', was injected at 10-fold excess compared with the protein. All La-dependent RNA chaperone activity does not require UUU- of the fluorescence readings were obtained by a Cary Eclipse 3'OH-mediated RNA binding. Using deletion and point fluorimeter. FRET indexes and rate constants were obtained as mutants of hLa, we show that the N-terminal La domain har­ described (37): briefly, a FRET index (emission at 680 nm versus bors both strand annealing and strand dissociation activity; emission at 590 nm) was calculated over time (s) in half-second specifically, the RRM1 motif is necessary and sufficient for time points and normalized between 0 and 1 using Graphpad these. Notably, an a-helix present at the C terminus of RRM1 Prism 5.0. To obtain rate constants, the phase I for strand that is not part of the typical RRM fold is important for this annealing was least square-fitted with the exponential function activity. We further demonstrate the relevance of this a-helix in for signal increase, and phase II was least square-fitted with an RNA chaperone activity by appending it as a fusion onto the C exponential function for signal decay or signal increase depend­ terminus of an unrelated RRM, that from the human U1A pro­ ing on the presence or absence of strand displacement activity, tein, and show that we can enhance the capacity of this motif to respectively. Histograms and tables with rate constants show act as an RNA chaperone. Finally, we show that hLa mutants the results of a minimum of three independent experiments. defective in RNA chaperone activity are also compromised in tRNA-mediated Suppression—tRNA-mediated suppression their capacity to rescue a mutated pre-tRNA in vivo. These data was performed as described (14). Briefly, plasmids encoding confirm that RNA chaperone activity is a conserved feature of hLa and mutants cloned into the Sail and BamHI sites of pREP4 La proteins and identify the motifs of La required for this func­ were transformed into ySH18 (13), and representative single tion, as well as provide insight on the RNA binding modes used colonies were selected and streaked out on selective media con­ by La for this process. It is expected that this work will inform taining 5 /xg/ml adenine. future research on the mechanisms by which La proteins con­ tribute to the metabolism of both their noncoding and coding RESULTS RNA targets. To investigate strand annealing and strand dissociation activities of La proteins, we performed FRET-based assays that EXPERIMENTAL PROCEDURES rely on the annealing of 21-nucleotide complementary RNA Cloning—The gene for the bacterial StpA protein was ampli­ strands labeled at their 5' ends with the fluorophores Cy5 (top fied by Escherichia coli colony PCR and cloned into the Ncol strand) or Cy3 (bottom strand) (35, 37) (Fig. L4). Briefly, the and Hindlll restriction sites of pET30a. Deletion mutants of RNA substrates were incubated together in a heated fluorime­ hLa, except 105-202 and 105-229, are described in Ref. 36. hLa ter cuvette held at a constant temperature of 37 °C, and the rate

1-235 a-3 was constructed by QuikChange using hLa pET28a of strand annealing (Arannl) in the presence or absence of an hLa 1-235 as a template (36). hLa 1—235 Y114A/F155AandhLa RNA chaperone was measured as an increase in FRET index 1-235 loop3 were cloned into the pREP4 and pET28a vectors between the fluorophores over time (phase I; Fig. LB). In phase using the Sail and BamHI or Ncol and Hindlll restriction sites, II (at t = 180 s), the capacity of candidate RNA chaperones to respectively, using their full-length hLa equivalents (pET28a) as dissociate annealed duplexes formed in phase I was determined

FEBRUARY 17,2012- VOLUME 287 • NUMBER 8 JOURNAL OF BIOLOGICAL CHEMISTRY 5473 Recognition Motif Mediates La Protein RNA Chaperone Activity

A. _ 680 nm Phase I

535 nm

t = 0 sec

Phase II t = 180 sec 535 nm 590 nm

or ^ann2 "35" (no RNA (Cy3) chaperone with strand ^ \ dissociation 535 nm 590 nm activity) B. C.

80 x • RNA - 70 H fc 0.8 V) __ w ® BSA 60 - • hla J 50 ^ ^ 40 - • StpA c-» K kannl £ 30 - In* 1020 i IkSD £ 0 RNA BSA StpA hLa

Time (s) FIGURE 1. hLa and Slalp display RNA strand association and strand dissociation activity. A, assay for strand annealing and strand dissociation. B, RNA strand annealing (phase I) and strand dissociation (phase II) of hLacompared with StpA was measured as a change in FRET index between complementary Cy5- and Cy3-labeled RNA strands over time. C, FRET index data over time were used to calculate strand annealing rates (kannV phase I), strand dissociation rates

(kso, phase II) and strand annealing in phase II in the absence of strand dissociation (kann2, phase II). The error bars show the standard deviation of at least three separate experiments.

by injection of an excess of unlabeled bottom strand. In the Conserved RNA Chaperone Activities of La Proteins—To absence of an RNA chaperone with strand dissociation activity, assay the strand annealing and dissociation activities of purified this results in an increase in measured strand annealing {kann2) hLa, we first used a modified, 33-nucleotide top strand contain­ because the concentration of one of the partners in the anneal­ ing the 21-nucleotide region of complimentarity followed by a ing reaction has now increased (37). However, in the presence 12-nucleotide trailer ending with UUUU-3'OH (21F Cy5 of an RNA chaperone with strand dissociation activity, the Trailer UUUU; supplemental Table SI and Fig. 2A), because we excess unlabeled bottom strands can trap dissociated upper had previously shown this trailer sequence binds hLa with high strands resulting in a decrease in FRET index (Fig. IB; meas­ affinity using the UUU-3'OH-dependent binding mode (14).

ured as the rate of strand dissociation, Ars D). As negative con­ Incubation of the positive control StpA with the 21F Cy5 trols, we measured the rates of strand annealing and strand Trailer UUUU top strand and the bottom strand (21R Cy3) dissociation in the absence of added protein or in the presence resulted in an approximate 10-fold increase in the rate of strand of BSA. As a positive control, we performed assays using the annealing (£annl) compared with RNA alone or BSA, confirm­ E. coli StpA protein, which has been previously characterized as ing that this modification of the top strand sequence was not harboring both strand annealing and dissociation activity (37). prohibitive to the assay (FRET indices shown in Fig. IB-, derived

5474 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 287-NUMBER 8-FEBRUARY 17,2012 Recognition Motif Mediates La Protein RNA Chaperone Activity A.

5'AUGUGGAAAAUCUCUAGCAGU OR 21F Cy5 (cjS)

UACACCUUUUAGAGAUCGUCA- 5' 5' AUGUGGAAAAUCUCUAGCAGUUUUU 21R Cy3 OR 21F Cy5 UUUU

5' AUGUGGAAAAUCUCUAGCAGUGUGUAAGCUUUU 21FCy5 Trailer UUUU B.

90 ,r 80 i W. 70 8 60 50 m~~ 40 I kannl O •«- 30 -I • kSD * 20 e 10

21 F 21F UUU 21F trailer hLa 21F hLa 21F hla 21F UUU UUU trailer UUU FIGURE 2. Enhancement of RNA strand annealing and dissociation by hLa does not require UUU-3'OH-mediated RNA binding. A CyS-labeled top strands containing varying UUU-3'OH contexts at their 3' ends were assayed in the FRET-based assay to determine whether this motif was required for hLa-dependent RNA chaperone activity. B, hLa has similar RNA strand annealing and dissociation activity for RNAs lacking UUU-3'OH or containing this sequence with or without an intervening trailer. rate constants from these shown in Fig. 1C; all specific rate yeast La has been hypothesized to function as an RNA chaper­ constants and associated standard deviations given in supple­ one during the rescue of misfolded pre-tRNAs (6, 13, 16), we mental Table S2). Likewise, the addition of excess unlabeled also tested the S. pombe La homolog Slalp for RNA chaperone bottom strand in phase II resulted in a decrease in the amount activity and found that it also enhanced strand annealing and _I of FRET in the presence of StpA (kSD = 0.014 s ), but not with dissociation compared with negative controls (Fig. 1C). We RNA alone or BSA (kS D = 0), which instead showed continued conclude that RNA chaperone activity is conserved between S. annealing, /rarm2 (^ann2 rates provided in supplemental Tables pombe and human La. S2, S3, and S4). Substitution of hLa in the strand annealing hLa RNA Chaperone Activity Functions Independently of phase also resulted in a greater than 10-fold increase in the rate UUU-3' OH-dependent Binding—The best characterized bind­ of FRET compared with RNA alone or BSA (Fig. 1, B and C), and ing mode for La proteins involves the specific recognition of addition of unlabeled bottom strand in phase II also resulted in UUU-3'OH, largely by amino acids on the conserved La motif. -1 comparable strand dissociation (kSD = 0.017 s ) to StpA For pre-tRNA maturation, binding of the UUU-3'OH trailer is compared with zero loss of FRET for the negative controls. hypothesized to be distinct from the binding and enhancement Titration of hLa into the assay showed a concentration-depen­ of folding of the main tRNA body via RRM1, and consequently dent increase in RNA chaperone activity that effectively La-mediated RNA chaperone activity may depend more became saturated at a concentration of 100 nM (supplemental strongly on UUU-3'OH-independent RNA binding (13, 14). Fig. SI), compared with 500 nM for StpA (data not shown). Consistent with this, our previous work revealed that point Notably, this saturating concentration for hLa was similar to mutation of the RRM1 02-/33 loop-3 of hLa causes both a estimates of hLa concentration in human cell extracts (50 nM) decrease in UUU-3'OH-independent RNA binding, as well as (38). As a control for the validity of the assay, we also varied the the ability of hLa to resolve a misfolded self-splicing intron (14). length of the annealing phase in both the presence and absence To test the importance of the La UUU-3'OH binding mode in of RNA chaperone (hLa versus RNA alone) to ensure that this RNA chaperone activity more directly, we compared strand had no effect on our assignments of strand annealing or disso­ annealing and strand dissociation rates using three different ciation activity (supplemental Fig. S2). We found that increas­ top strand substrates with the same bottom 21R Cy3 substrate ing phase I from 180 to 600 s had negligible effects on /rannl or (Fig. 2A): (i) a 21-nucleotide substrate complementary to the ks D rates in either the presence or absence of an RNA chaper­ 21-nucleotide bottom strand and lacking UUUU-3'OH (21F one. From these data we conclude that like StpA, hLa contains Cy5, ending in CAGU-3'OH), (ii) a 25-nucleotide substrate both RNA strand annealing and dissociation activities. Because containing the same 21-nucleotide sequence but with an added

FEBRUARY 17, 2Q12-VOLUME287-NUMBER 8 ^0#®^ JOURNAL OF BIOLOGICAL CHEMISTRY 5475 Recognition Motif Mediates La Protein RNA Chaperone Activity

A. La Domain Mi hLa BUB loop 3 1-235 225-408 1-104 1-187 105-202 105-229

B. o 30

* 25 H CO qCo 20 ^ 15 nO Ikannl 10 IkSD X i2- ® 1 o i • BSA 1-235 1-104 1-187 105-202 105-229 225-408 C. 50 45 n 40 O 35 -5? 30 25 • kannl o 20 15 • kSD X 10 5 0 -H1 H L 1-235 1-104 1-187 105-202 105-229 FIGURE 3.Domain mapping of theRNA chaperone activity of human La. A, architecture of the human La protein and the deletion mutants used in this study.

NRE, nuclear retention element; SBM, short basic motif; NLS, nuclear localization signal. B, kB, 100 nM (saturating concentration for wild-type hLa). C, fcann1, k5

UUUU-3'OH overhang (21F Cy5 UUUU), and iii) the 21F Cy5 largely absent in La proteins from fission and budding yeast (see Trailer UUUU substrate. In the absence of any added proteins, "Discussion"), we focused on studying the N-terminal La minimal strand annealing and strand dissociation rates were domain shared between all La homologs to gain insight into observed for all three top strand substrates (Fig. 25). The addi­ how La-dependent RNA chaperone activity should function tion of hLa to these various substrates resulted in similar generally across eukaryotes. This N-terminal region includes increases in strand annealing and strand dissociation rates, the winged helix fold containing La motif followed by RRM1, consistent with the UUU-3'OH-dependent RNA binding not which in addition to having the expected /31al/32/33a2/34 RRM contributing significantly to La-dependent RNA chaperone fold (39) contains an extra C-terminal a-helix (a3) not typically activity. found in unrelated RRMs and previously hypothesized to be in Mapping of hLa Structural Determinants Required/or Strand an orientation particular to La proteins (Fig. 4A) (9). Notably, Annealing and Dissociation—We performed strand annealing this helix includes three basic lysine residues, two of which and dissociation assays using various point and deletion point toward the canonical RNA binding RRM1 j3-sheet sur­ mutants of hLa to identify which elements were required for face, as well as a universally conserved aromatic residue (hLa: each activity (Fig. 3 and 4). Surprisingly, we found that both the Tyr-188) that stacks upon a conserved aromatic (hLa: Tyr-114) N- and C-terminal halves of hLa (hLa 1-235 and hLa 225-408) also on this /3-sheet (39). We found that the La motif in isolation harbored both strand annealing and strand dissociation activ­ (amino acids 1-104) had insignificant strand annealing or dis­ ity, although neither had strand annealing activity at the same sociation activity compared with controls (Fig. 35). Surpris­ _1 level as full-length hLa (hLa 1-235 £annl = 0.025 s and hLa ingly, we found that including both the La motif and the canon­ 225-408 = 0.021 s" versus hLa kannl = 0.058 s Fig. 3B). ical /31al/32/33a2/34 RRM fold (hLa 1-187) also showed very Because the C-terminal half of human La is not conserved and is little activity, suggesting that the region between hLa 187 and

5476 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 287-NUMBER 8-FEBRUARY 17, 2012 Recognition Motif Mediates La Protein RNA Chaperone Activity

A.

a3 helix

Loop 3

Y114

B. ^ 30

* 25

RNA BSA 1-235 1-235 1-235 loop 3 1-235 a-3 1 -5 J -ac(0 Y114A/F155A

50 ] "" 45 J VX 40 iI ^ 35 1 £ 30 -j Ikannl ^ 25 -j

O 20 IkSD X 15 to- 10 1 5 § 0 BSA 1-235 1-235 1-235 loop 3 1-235 a-3 Y114A/F155A FIGURE 4. The canonical RRM1 RNA binding surface and the a3-heiix are required for RNA chaperone activity by the La domain. A, regions of the hLa RRM1 containing point mutations and tested for RNA chaperone activity are colored in black.The a3 helix mutations were: hLa 1-235 K185A/K191A/K192A; the loop-3 mutations were: hLa 1-235 R142A/R143A/K148A/K151A. 8, fcann1, kSD and kann2 rates for indicated point mutations of the La domain at 100 nM (saturating concentration for wild-type hLa). C,fcann),/rSD, and/cann2 rates for indicated point mutations of the La domain at 5X concentration (500 nM).

235 is important for RNA chaperone activity. This region lix, and adjacent linker representing the necessary elements for includes the noncanonical a3-helix as well as a predicted strand association activity. Interestingly, we noted that the hLa unstructured linker region between RRM1 and RRM2. 105-202 and 105-229 mutants, but not the hLa 1-104 or

To examine the importance of the canonical RRM, the RRM1 1-187 mutants, showed significantly higher kann2 rates (supple­ a3-helix, and linker region further, we tested RRM1 without mental Table S2; hLa 105-202 and hLa 105-229 kann2 = 0.449 the La motif but including successively greater sections of the and 0.198 s respectively, versus hLa 1-104 and hLa 1-187 region between amino acids 187 and 235 (hLa 105-202 and hLa £ann2 = 0.024 and 0.067 s~\ respectively). This led us to con­ 105-229; Fig. 3, A and B) in the assays. We found that these sider the possibility that the hLa 105-202 and 105-229 mutants RRM1 mutants acquired modest strand annealing activity with only had decreased affinity for substrate in strand annealing successively greater C-terminal extensions (hLa 1-187 kannl = and that the higher levels of substrate available in phase II upon -1, 0.0058 s versus hLa 105-202 kannl = 0.0079 s~\ versus hLa competitor addition were sufficient to rescue some strand -1 105-229 &annl = 0.0095 s ), consistent with the RRM, «3-he­ annealing activity. To test this possibility, we performed the

FEBRUARY 17,2012-VOLUME 287-NUMBER 8 JOURNAL OF BIOLOGICAL CHEMISTRY 5477 Recognition Motif Mediates La Protein RNA Chaperone Activity assays again but increased the concentration of protein in the To test whether the point mutations in RRM1 and the a3-he- assay by 5-fold (Fig. 3C and supplemental Table S3). We found lix were defective only in the binding of RNA substrates, as we that this indeed increased the strand annealing activity of hLa had hypothesized for deletion of the La motif, we also tested 105-202 (/Tan,,! = 0.013 s-1 at 5X versus 0.0079 s-1 at IX) and these point mutants at 5X concentration. Contrary to the hLa _1 1 hLa 105-229 (kannl = 0.013 s at 5X versus 0.0095 s" at IX) 105-202 and 105-229 mutants, however, each of these point and rescued strand dissociation activity for hLa 105-202 (ks D mutants were incapable of strand annealing at 5X concentra­ _1 = 0.024 s at 5X versus 0 at IX) and 105-229 (kSD — 0.0046 tion (Fig. 4C; see rates, supplemental Table S3), suggesting that s~1 at 5X versus 0 at 1X), but not for the isolated La motif (hLa an intact RRM1 motif/a3-helix forms the minimal requirement _1 1-104 Arannl = 0.0039 at 5X, versus 0.0046 s at 1X;&SD = Oat for this activity. Notably, the strand dissociation of hLa 1-235 -1 5 X and 1X). No rescue in strand annealing was observed at 5 X Y114A/F155A (kS D = 0.027 s ), but not of hLa 1-235 loop3 protein concentration for hLa 1-187, but strand dissociation or hLa 1-235 a3, was rescued at 5X concentration, suggesting was rescued. These data are consistent with a model in which that the basic amino acids of the RRM1 /32-/33 loop3 and the the RRM1 (including its a3-helix) and adjacent linker regions a3-helix form the critical element for hLa strand dissociation. form the basis for strand annealing activity, whereas the canon­ hLa RRM1 a3-Helix Can Enhance RNA Chaperone Activity ical RRM1 domain is sufficient for strand displacement activity. of an Unrelated RRM—Our results suggest that the c*3-helix at The decrease in strand annealing activity between 1-235 and the end of RRM1 of hLa is important for the strand annealing activity of this motif. Structural analysis of the hLa N-terminal 105-229 is also consistent with the La motif providing an acces­ o domain indicates that this helix is relatively short (hLa amino s sory domain that enhances affinity of hLa for RNA substrates O3 acids 185-192) before becoming disordered, and both the a3 CD even in the absence of the UUU-3'OH motif (Fig. 2; see Q. "Discussion"). helix and unstructured region have a high number of basic res­ CLCD Point Mutations of RRM1 That Inhibit RNA Chaperone idues (see "Discussion") (12). Notably, most of the basic resi­ 3 dues in the helix (Lys-185 and Lys-192) project toward the 3 Activity—Previous work has shown that mutation of conserved aromatics in the RRM1 RNP motifs of both human (hLa Y114A canonical RNA binding surface of RRM1, as does a universally conserved aromatic residue (hLa Tyr-188) that stacks on the and F155A) and fission yeast La results in defective La-depen- CT aromatic residue projecting from the RRM RNP2 motif (hLa O dent rescue of tRNA-mediated suppression without a loss in o Tyr-114) typically associated with canonical RRM-mediated <3 their 3' end protection. Furthermore, point mutation of basic RNA binding (39). Because the RNA recognition motif is a residues in the j32-/33 loop-3 region of RRM1 of hLa decreased < highly ubiquitous motif, we decided to test the hypothesis that o tRNA binding and the ability of hLa to resolve a misfolded, this particular a3-helix might be capable of conferring strand C self-splicing intron, but not UUU-3'OH-dependent binding, 3 annealing activity to an unrelated RRM by appending it to its C a>< suggesting that the canonical RRM1 RNA binding surface may terminus. To test this, we chose the highly studied N-terminal 3 play important functions in the binding and folding of sub­ RRM (U1A 1-102) from the snRNP-associated human U1A strates lacking UUU-3'OH. We therefore decided to test point O protein. Notably, the U1A protein also contains an a3-helix O mutants in the canonical RRM1 RNA binding surface of the La c C-terminal to its RRM (starting around U1A amino acid 91), domain (Fig. 4A) in our assay. We found that mutation of the but this helix is shorter, has fewer basic amino acids, is in a conserved RNP aromatic residues (hLa 1-235 Y114A/F155A; ti different orientation with respect to the RRM, and begins after CD ^anni = 0.0041 s_1) or of the basic residues of RRM1 02-/33 O"—i a longer linker sequence (5 amino acids versus 1) compared 0)c loop3 (hLa 1-235 loop 3 = hLa 1-235 R142A/R143A/K148A/ with the equivalent a3 helix in hLa (Fig. 5A) (40). •3 _1 K151A; /rannl = 0.0012 s ) resulted in a loss of strand anneal­ We first tested the U1A 1-102 fragment, consisting of the ing activity compared with the 1-235 control (Arannl = 0.025 wild-type U1A RRM and C-terminal a3-helix (Fig. SB and sup­ s~'; Fig. 45). Both mutants also lacked strand displacement plemental Table S4) in the RNA chaperone assay and found activity. Notably, our previous work has shown that these point that it harbored a low level of strand annealing activity com­ mutations have negligible effects on the binding of UUU- pared with RNA alone (U1A 1-102 ka 0.0072 s versus -1 3'OH-containing RNAs, suggesting that neither set of muta­ RNA alone kannl = 0.0039 s ). Based on our work on human tions cause significant misfolding of the RRM (13,14). Because La, we hypothesized that this low level of U1A RRM activity our work here also suggested that the RRM1 a3-helix and sub­ might be dependent on its own «3-helix, and so also we tested sequent linker participates in RNA chaperone activity, we also U1A1 - 88, in which we deleted this helix and some of the inter­ mutated basic residues in the a3-helix (1-235 a3 = hLa 1-235 vening linker, but this mutant had approximately the same low K185A/K191A/K192A) and tested this in our assay. Like the level of strand annealing activity as U1A 1-102 (U1A 1-88 = -1 point mutations to the basic residues of RRM1 /32-j33 loop3, /rannl 0.0083 s ). To test the importance of the a3-helix of this mutant was also defective in both strand annealing (/rannl = hLa in RNA chaperone activity, we appended the hLa a3 helix 0.0028 s_1) and dissociation activity. Like the Y114A/F155A and the first 10 unstructured residues (hLa 185-202) onto the and (32-/33 loop 3 point mutants, this mutant was also active in U1A RRM (U1A 1-88 hLa a3) and tested this in the assay. RNA binding as determined by gel shift (data not shown). Consistent with our hypothesis, we found that U1A 1-88 hLa Taken together, these data suggest that the canonical RNA a3 showed enhanced RNA strand annealing activity compared binding surface of RRM1, including the a3-helix particular to with U1A 1-88 and U1A 1-102 (U1A 1-88 hLa a3 A:annl = La proteins, forms the minimal functional requirement for La 0.0209 s-1; Fig. 5B). No U1A variants or the UlA-hLa fusion domain-associated RNA chaperone activity. showed strand displacement activity. From these data, we con-

5478 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 287 • NUMBER 8- FEBRUARY 17,2012 Recognition Motif Mediates La Protein RNA Chaperone Activity

U1A mutants and U1A- hLa fusions used in this assay: 81 102 I I U1A 1-102 PMRIQYAKTDSDIIAKMKGTFV U1A1-88 PMRIQYAK U1A 1-88 hLa a-3 PMRIQYAKKDDYFAKKNEERKQSKVE

B. hLa

O 25 T— X 1-235 Empty Rep vector T 20

• kannl

o 10 @kSD 11 1-235 a-3 1-235 Loop 3 BSA U1A1-102 U1A1-88 U1A1-88 hLa a-3 1-235 Y114A/F155A FIGURE 5. The <*3-helix of hLa can enhance RNA chaperone activity of the U1A protein in vitro and is required for tRNA mediated suppression via a mutated pre-tRNA in vivo. A, comparison of the hLa RRM1 (/eft panel) and human U1A N-terminal (right panel) RRMs. /3-Sheet strands are shown in red, a3-helices are in blue, and the spacer between 04 and <*3 (0 amino acids in hLa;5 amino acids in U1 A) are in cyan. The stacking interaction between the «3-helix and /3-sheet surface of hLa is also shown, with Tyr-187 and Tyr-114 in orange and gold, respectively. Inset, amino acid identities for U1A and U1 A/hLa proteins tested. 8, kann,,ks o , and kann2 rates for U1A 1-88, U1A 1-102 (wild-type), and the U1 A/hLa fusion are given. C, point mutation of the canonical hLa RRM1 RNA binding surface (1-235 Y114A/F155A or 1-235 Loop-3) or the a3-helix(1-235 a3) causes defects in La-dependent rescue of tRNA-mediated suppression inS. pombe, compared with wild-type hLa or the wild-type hLa La domain (1-235). elude that the c*3-helix found at the end of the hLa RRM1 mutants shown to be defective in in vitro RNA chaperone activ­ enhances the strand annealing activity of this RRM and that this ity into a La null S. pombe strain (slal~) containing an inte­ a-helix can enhance the strand annealing of an unrelated RRM grated suppressor tRNA allele previously characterized to when appended to its C terminus. require La for maturation and suppression of red pigment accu­ Mutants Defective in RNA Chaperone Activity in Vitro Are mulation. Mutation of the RRM1 RNP aromatic residues (hLa Defective in Rescue of Mutated pre-tRNA in Vivo—La function 1-235 Y114A/F155A) or the basic amino acids of J32-/33 loop3 in tRNA processing can be assessed in vivo using a red-white (hLa 1-235 loop3) showed defects in rescue of suppression of suppressor tRNA assay in S. pombe in which La-dependent res­ red pigment accumulation, compared with wild-type hLa and cue of a mutated suppressor tRNA results in suppression of red the N-terminal hLa 1-235, which showed comparable activity pigment accumulation via readthrough of an in-frame stop (Fig. 5C). Notably, mutation of basic residues in the a3-helix of codon in the ade6-704 allele (41). We transformed plasmids RRM1 (hLa 1-235 K185A/K191A/K192A) also showed defects encoding either wild-type hLa, hLa 1-235, or our RRM1 point in suppression of red pigment accumulation in vivo. These data

FEBRUARY 17,2012 - VOLUME 287 • NUMBER 8 JOURNAL OF BIOLOGICAL CHEMISTRY 5479 Recognition Motif Mediates La Protein RNA Chaperone Activity are consistent with a model in which mutations that cause La proteins in higher eukaryotes (including humans) often defects in RNA strand annealing and dissociation in vitro also contain a second RRM (RRM2 or RRMc), which like RRMl is cause defects in La-dependent rescue of mutated pre-tRNAs in also followed by a C-terminal a-helix (previously characterized vivo, suggesting that La may act directly as an RNA chaperone in human and S. pombe La to harbor a nuclear retention ele­ in vivo for misfolded pre-tRNAs. ment (44,45)), although this is in a different orientation to the a3 helix found after RRMl (43). In human La, the a-helix after DISCUSSION RRM2 is also followed by a predicted disordered region, previ­ ously described as the short basic motif, which has been shown In addition to a hypothesized function in the folding of mis- to interact with the 5' end of the pre-tRNA, with access of this folded pre-tRNAs ending in UUU-3'OH, La proteins have also region to the pre-tRNA 5' leader controlled by the phosphoryl­ been hypothesized to function as an RNA chaperone for ation of hLa at serine 366 (38). We found that both the N- and mRNAs lacking this motif by enhancing the correct folding of C-terminal halves of human La were capable of strand anneal­ complex 5'-UTR structures required for optimal translation. In ing and strand dissociation, although with rates of strand this work, we show that both human La and S. pombe La harbor annealing that were lower than that of the full-length protein RNA strand annealing and dissociation activity and as such can (Fig. 3B and supplemental Table S2). Although the C-terminal be considered genuine RNA chaperones. Focusing on the con­ half of human La is less conserved and is largely absent in La served N-terminal La motif and RNA recognition motif from proteins of lower eukaryotes, it would be interesting to test human La, we mapped strand annealing to the RRMl and adja­ whether RRM2 and its associated C-terminal a-helix and sub­ cent a3-helix, with the predicted disordered region between sequent disordered region may function equivalently to the La RRMl and RRM2 of human La enhancing this activity. Point domain counterparts found in the La proteins of all species that mutation to the canonical RRM RNA binding surface (RNP contain them. mutations Y114A/F155A), a basic loop shown to be important We used three different Cy5-containing RNA substrates in tRNA binding (/32-/33 loop 3), or to basic residues in the containing varying 3' ends to test the importance of the UUU- a3-helix all inhibited strand annealing activity at both 1X pro­ 3'OH motif in La-dependent RNA chaperone activity. All three tein concentration (saturating concentration for wild-type hLa) substrates showed similar RNA association and dissociation and 5X concentration in vitro and La-dependent rescue of a rates, consistent with the UUU-3'OH-dependent RNA binding mutated pre-tRNA in vivo. For strand dissociation, mutation of not playing a critical role in these processes. These data are conserved basic residues of RRMl (J32-/33 loop 3 or the a3 consistent with models in which La-dependent RNA chaperone helix) resulted in a loss of activity at both IX and 5X, whereas activity plays an important function in the translation of the Y114A/F155A mutant was still active in strand displace­ mRNAs lacking the UUU-3'OH motif, as well as previous data ment at 5X protein concentration, suggesting that the basic indicating that the UUU-3'OH-independent RNA binding residues of the RRM are more highly associated with this func­ mode by which La engages the main body of pre-tRNAs (i.e. tion. Our data are consistent with the conserved RRMl and through RRMl /32//33 loop 3) is also important for RNA chap­ adjacent a3-helix and linker representing the minimum ele­ erone activity (14). Crystallographic and biochemical data have ment required for La domain associated RNA chaperone shown that the La motif is primarily responsible for UUU-3'OH activity. binding and associated 3' pre-tRNA trailer protection from Although strict structural requirements for RNA chaperone exonucleases (11,12), but this motif in isolation was found to be activity in other proteins have not been rigorously delineated, it incapable of supporting RNA chaperone activity (Fig. 3 and has been noted that RNA chaperones frequently contain supplemental Table S2). However, significant drops in strand regions predicted to be disordered, and these regions have been annealing and dissociation rates were nonetheless observed hypothesized to function in RNA chaperone activity through upon deletion of the La motif from the greater context of the La entropy transfer via RNA binding-dependent folding (37). domain (compare 1-235 with 105-229; Fig. SB). Incubation of Notably, we have found that the unstructured region between the RNA substrates with a 5-fold increase in 105-229 protein the RRMl a3-helix and RRM2 of hLa contributes to strand was able to rescue significant strand annealing and dissociation, annealing associated with the conserved La domain. Further­ suggesting that with respect to RNA chaperone activity, the La more, the RRMl a3 helix and subsequent unstructured region motif may function as an accessory domain that enhances the between RRMl and RRM2 have a high propensity of basic binding of La to RNA targets, even in the absence of the UUU- amino acids (10 of 24 or 42% of residues 185-209 K or R; pKa = 3'OH motif. Consistent with this possibility, various nucleotide 9.78), a feature also commonly found in other RNA chaperones substitutions in the UUU-3'OH motif of short RNAs decrease (42). Although the well ordered La motif, RRMl and RRM2 hLa affinity for these targets by at most 10-fold (11), and the from human La have been well studied both structurally and deletion of the UUU-3'OH-containing trailer of a pre-tRNA biochemically (9-12,43), the function of unstructured regions reduced affinity for the respective tRNA sequence by only of La proteins is less well understood. Recent work indicates 3-fold (14). It is therefore possible that the La motif may play an that in addition to the modular La domain, the disordered important role in the folding of RNA targets irrespective of region C-terminal to RRMl in the S. cerevisiae La homolog these ending in UUU-3'OH by enhancing the affinity of La for Lhplp is required for the correct folding of pre-tRNA anti- them. codon stems in vivo (15) and in human La in binding to the Recently the study of La motif-containing proteins has hepatitis C IRES (31). expanded into the investigation of La-related proteins (LARPs),

5480 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 287-NUMBER8-FEBRUARY 17, 2012 Recognition Motif Mediates La Protein RNA Chaperone Activity which share a conserved La motif (and often an RRM1 or guishable activities in tRNA maturation. Nat. Struct. Mol Biol. 13, RRMl-like domain) with genuine La proteins but have evolved 611-618 independent functions (1,46). RNA chaperone activity has not 14. Bayfield, M. A., and Maraia, R. J. (2009) Precursor-product discrimination by La protein during tRNA metabolism. Nat. Struct. MoL BioL 16, yet been formally investigated in the LARPs, but it is interesting 430 - 437 to note that the Tetrahymena thermophila telomerase associ­ 15. Kucera, N. J., Hodsdon, M. E., and Wolin, S. L. (2011) An intrinsically ated protein p65, a La motif containing member of the LARP7 disordered C terminus allows the La protein to assist the biogenesis of family, is active in the remodeling the telomerase RNA and diverse noncoding RNA precursors. Proc. Natl. Acad. Sci. U.S.A. 108, required for the assembly of the telomerase RNP (47). Based on 1308-1313 secondary structure prediction (48), there is a weak prediction 16. Chakshusmathi, G., Kim, S. D., Rubinson, D. A., and Wolin, S. L. (2003) A La protein requirement for efficient pre-tRNA folding. EMBO J. 22, that the regions immediately following the RRM1 or RRMl-like 6562-6572 motifs from the human LARPs HsLARPl, HsLARP4A, 17. Anderson, J., Phan, L., Cuesta, R., Carlson, B. A., Pak, M., Asano, K„ Bjork, HsLARP6 and HsLARP7 also form a-helices (data not shown), G. R„ Tamame, M., and Hinnebusch, A. G. (1998) The essential GcdlOp- but further structural and biochemical investigation of the Gcdl4p nuclear complex is required for 1-methyladenosine modification LARPs will have to be performed before it can be concluded and maturation of initiator methionyl-tRNA. Genes Dev. 12, 3650-3662 18. Copela, L. A., Chakshusmathi, G„ Sherrer, R. L., and Wolin, S. L. (2006) that any of these may harbor RNA chaperone activity or may The La protein functions redundantly with tRNA modification enzymes function in vivo as RNA chaperones. to ensure tRNA structural stability. RNA 12, 644 - 654 19. Johansson, M. J., and Bystrom, A. S. (2002) Dual function of the O o Acknowledgments—We thank Richard Maraia and K.Andrew White tRNA(m(5)U54)methyltransferase in tRNA maturation. RNA 8,324-335 3S 20. Belisova, A., Semrad, K., Mayer, O., Kocian, G„ Waigmann, E., Schroeder, for providing comments on the manuscript. Oso R., and Steiner, G. (2005) RNA chaperone activity of protein components of human Ro RNPs. RNA 11,1084-1094 21. Meerovitch, K., Svitkin, Y. V., Lee, H. S., Lejbkowicz, F., Kenan, D. J., Chan, o REFERENCES E. K., Agol, V. I., Keene, J. D„ and Sonenberg, N. (1993) La autoantigen 3 1. Bayfield, M. A., Yang, R., and Maraia, R.J. (2010) Conserved and divergent enhances and corrects aberrant translation of poliovirus RNA in reticulo­ features of the structure and function of La and La-related proteins cyte lysate./. Virol. 67, 3798-3807 (LARPs). Biochim. Biophys. Acta 1799, 365-378 22. Costa-Mattioli, M., Svitkin, Y., and Sonenberg, N. (2004) La autoantigen is o 2. Bai, C., and Tolias, P. P. (2000) Genetic analysis of a La homolog in Dro- necessary for optimal function of the poliovirus and hepatitis C virus u3 sophila melanogaster. Nucleic Acids Res. 28,1078 -1084 internal ribosome entry site in vivo and in vitro. MoL Cell. BioL 24, S. 6861-6870 -< 3. Park, J. M„ Kohn, M. J., Bruinsma, M. W„ Vech, C., Intine, R. V., o Fuhrmann, S., Grinberg, A., Mukherjee, L, Love, P. E., Ko, M. S., DePam- 23. Trotta, R., Vignudelli, T., Pecorari, L., Intine, R. V., Guerzoni, C., Santilli, yr philis, M. L., and Maraia, R. J. (2006) The multifunctional RNA-binding G., Candini, O., Byrom, M. W., Goldoni, S., Ford, L. P., Caligiuri, M. A., C protein La is required for mouse development and for the establishment of Maraia, R., Perrotti, D„ and Calabretta, B. (2003) BCR/ABL activates embryonic stem cells. Mol. Cell. Biol. 26,1445-1451 mdm2 mRNA translation via the La antigen. Cancer Cell 3,145-160 <*> 4. Yoo, C. J., and Wolin, S. L. (1994) La proteins from Drosophila melano­ 24. Intine, R. V., Tenenbaum, S. A., Sakulich, A. L., Keene, J. D„ and Maraia, gaster and Saccharomyces cerevisiae. A yeast homolog of the La autoanti- R. J. (2003) Differential phosphorylation and subcellular localization of La o gen is dispensable for growth. Mol. Cell. Biol. 14, 5412-5424 RNPs associated with precursor tRNAs and translation-related mRNAs. o 5. Van Horn, D.J., Yoo, C. J., Xue, D„ Shi, H„ and Wolin, S. L. (1997) The La MoL Cell 12,1301-1307 protein in Schizosaccharomyces pombe. A conserved yet dispensable 25. Sommer, G., Dittmann, J., Kuehnert, J., Reumann, K., Schwartz, P. E., Will, phosphoprotein that functions in tRNA maturation. RNA 3, 1434-1443 H., Coulter, B. L„ Smith, M. T., and Heise, T. (2011) The RNA-binding cr 3' endonucleolytic cleavage that matures tRNA precursors. Cell 89, cogene 30,434-444 •2 393-402 26. Schwartz, E. I., Intine, R. V., and Maraia, R. J. (2004) CK2 is responsible for 7. Xue, D., Rubinson, D. A., Pannone, B. K., Yoo, C. J., and Wolin, S. L. (2000) phosphorylation of human La protein serine-366 and can modulate ro U snRNP assembly in yeast involves the La protein. EMBO /. 19, 5'TOP mRNA metabolism. Mol. Cell. Biol. 24, 9580 -9591 o 1650-1660 27. Ali, N., Pruijn, G. J., Kenan, D. J., Keene, J. D., and Siddiqui, A. (2000) 8. Kufel, J., Allmang, C., Chanfreau, G., Petfalski, E., Lafontaine, D. L., and Human La antigen is required for the hepatitis C virus internal ribosome Tollervey, D. (2000) Precursors to the U3 small nucleolar RNA lack small entry site (IRES)-mediated translation./. BioL Chem. 275, 27531-27540 nucleolar RNP proteins but are stabilized by La binding. MoL Cell. Biol. 20, 28. Pudi, R., Srinivasan, P., and Das, S. (2004) La protein binding at the GCAC 5415-5424 site near the initiator AUG facilitates the ribosomal assembly on the hep­ 9. Alfano, C., Sanfelice, D., Babon, J., Kelly, G., Jacks, A., Curry, S., and Conte, atitis C virus RNA to influence internal ribosome entry site-mediated M. R. (2004) Structural analysis of cooperative RNA binding by the La translation./. BioL Chem. 279, 29879-29888 motif and central RRM domain of human La protein. Nat Struct. MoL 29. Svitkin, Y. V., Pause, A., and Sonenberg, N. (1994) La autoantigen allevi­ Biol. 11,323-329 ates translational repression by the 5' leader sequence of the human im­ 10. Dong, G„ Chakshusmathi, G., Wolin, S. L„ and Reinisch, K. M. (2004) munodeficiency virus type 1 mRNA. J. Virol. 68,7001-7007 Structure of the La motif. A winged helix domain mediates RNA binding 30. Holcik, M., and Sonenberg, N. (2005) Translational control in stress and via a conserved aromatic patch. EMBO /. 23,1000-1007 apoptosis. Nat. Rev. MoL Cell Biol. 6,318-327 11. Teplova, M., Yuan, Y. R., Phan, A. T., Malinina, L., Ilin, S., Teplov, A., and 31. Martino, L., Pennell, S„ Kelly, G., Bui, T. T., Kotik-Kogan, O., Smerdon, Patel, D. J. (2006) Structural basis for recognition and sequestration of S. J., Drake, A. F., Curry, S., and Conte, M. R. (2011) Analysis of the inter­ UUU(OH) 3' temini of nascent RNA polymerase III transcripts by La, a action with the hepatitis C virus mRNA reveals an alternative mode of rheumatic disease autoantigen. Mol. Cell 21, 75-85 RNA recognition by the human La protein. Nucleic Acids Res., in press 12. Kotik-Kogan, O., Valentine, E. R., Sanfelice, D., Conte, M. R., and Curry, S. 32. Horke, S., Reumann, K., Rang, A., and Heise, T. (2002) Molecular charac­ (2008) Structural analysis reveals conformational plasticity in the recog­ terization of the human La protein-hepatitis B virus RNA. B interaction in nition of RNA 3' ends by the human La protein. Structure 16,852-862 vitro. J. BioL Chem. 277,34949-34958 13. Huang, Y., Bayfield, M. A., Intine, R. V., and Maraia, R. J. (2006) Separate 33. Belsham, G. J„ Sonenberg, N. (2000) Picornavirus RNA translation. Roles RNA-binding surfaces on the multifunctional La protein mediate distin­ for cellular proteins. Trends Microbiol. 8, 330-335

FEBRUARY 17,2012-VOLUME 287- NUMBER 8 JOURNAL OF BIOLOGICAL CHEMISTRY 5481 Recognition Motif Mediates La Protein RNA Chaperone Activity

34. Rajkowitsch, L., Semrad, K„ Mayer, O., and Schroeder, R. (2005) Assays is controlled by phosphorylation of the human La antigen on serine 366. for the RNA chaperone activity of proteins,. Biochem. Soc. Trans. 33, MoL Cell 6, 339-348 450 - 456 42. Woodson, S. A. (2010) Taming free energy landscapes with RNA chaper- 35. Rajkowitsch, L., Chen, D., Stampfl, S., Semrad, K., Waldsich, C., Mayer, O., ones. RNA Biol. 7,677-686 Jantsch, M. F., Konrat, R., Blasi, U., and Schroeder, R. (2007) RNA chap- 43. Jacks, A., Babon, J., Kelly, G., Manolaridis, I., Cary, P. D., Curry, S., and erones, RNA annealers and RNA helicases. RNA Biol. 4,118-130 Conte, M. R. (2003) Structure of the C-terminal domain of human La 36. Goodier,). L., Fan, H., and Maraia, R. J. (1997) A carboxy-terminal basic protein reveals a novel RNA recognition motif coupled to a helical nuclear region controls RNA polymerase 111 transcription factor activity of human retention element. Structure 11,833- 843 La protein. Mol. Cell. Biol. 17, 5823-5832 44. Intine, R. V., Dundr, M., Misteli, T„ and Maraia, R. J. (2002) Aberrant 37. Rajkowitsch, L., and Schroeder, R. (2007) Dissecting RNA chaperone ac­ nuclear trafficking of La protein leads to disordered processing of associ­ tivity. RNA 13, 2053-2060 ated precursor tRNAs. Mol. Cell 9, 1113-1123 38. Fan, H., Goodier, J. L., Chamberlain, J. R., Engelke, D. R., and Maraia, R. J. 45. Bayfield, M. A., Kaiser, T. E., Intine, R. V., and Maraia, R. J. (2007) Con­ (1998) 5' Processing of tRNA precursors can be modulated by the human servation of a masked nuclear export activity of La proteins and its effects La antigen phosphoprotein. MoL Cell. Biol. 18,3201-3211 on tRNA maturation. Mol. Cell. Biol. 27, 3303-3312 39. Maris, C„ Dominguez, C„ and Allain, F. H. (2005) The RNA recognition 46. Bousquet-Antonelli, C., and Deragon, J. (2009) A comprehensive analysis motif, a plastic RNA-binding platform to regulate post-transcriptional of the La-motif protein superfamily. RNA 15,750-764 gene expression. FEBS J. 272, 2118-2131 47. Stone, M. D., Mihalusova, M., O'connor, C. M., Prathapam, R., Collins, K., 40. Rupert, P. B., Xiao, H., and Ferre-D'Amare, A. R. (2003) U1A RNA-bind- and Zhuang, X. (2007) Stepwise protein-mediated RNA folding directs ing domain at 1.8 A resolution. Acta Crystallogr. D Biol. Crystallogr. 59, assembly of telomerase ribonucleoprotein. Nature 446, 458- 461 1521-1524 48. Katzman, S., Barrett, C„ Thiltgen, G., Karchin, R., and Karplus, K. (2008) 41. Intine, R. V., Sakulich, A. L., Koduru, S. B., Huang, Y., Pierstorff, E., PREDICT-2ND. A tool for generalized protein local structure prediction. Goodier, J. L., Phan, L., and Maraia, R. J. (2000) Transfer RNA maturation Bioinformatics 24, 2453-2459

5482 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 287 • NUMBER 8-FEBRUARY 17,2012 Supplementary Figure 1

1.4 i

1.2 - Oo0oo00o0oo0o°oooo°

X XxxxXxXx xXxx 1 - #g-i«**|l£^ * ** ,"x«° c « * ° - • X O * lOOnM fc 0.8 • v _ • 200nM X o =5 0.6 X O * 50nM E o xo° z * 25nM 0.4 - ORNA X o o 0.2 • • X 4 x O

50 100 150 200 250 300 350 400

Time (s)

B Phase I Phase II Protein ^annl &SD hLa 200nM 31.55 12.47 hLa lOOnM 33.09 13.96 hLa 50nM 23.53 15.99 hLa 25nM 7.704 0.051

Supplementary Figure 1: Concentration dependence of RNA chaperone activity of hLa. Increasing levels of hLa protein were assayed for strand annealing and strand displacement activity. A: Raw data indicating FRET indices for strand annealing and displacement at different hLa levels. B: Rates calculated from A. RNA chaperone activity was determined to effectively saturate at approximately 100 nM. Supplementary Figure 2:

• kannl

RNA RNA hLa hLa Phase 1 Phase 1: Phase 1 Phase 1: 3 min. 10 min. 3 min. 10 min.

Supplementary Figure 2: Varying the length of Phase I (strand annealing) has no effect on the observed k ann] or rates in the absentee (RNA) or presence (hLa) of RNA chaperone. Supplementary Table 1: RNA substrates used in this work

Name of RNA Strand orientation Sequence 2IF Cy5 Trailer Top Cy5-AUGUGGAAAAUCUCUAGCAGUGUGUA UUUU AGCUUUU 21F Cy5 UUUU Top Cy5-AUGUGGAAAAUCUCUAGCAGUUUUU 2IF Cy5 Top Cy5-AUGUGGAAAAUCUCUAGCAGU 21R Cy3 Bottom Cy 3 -ACUGCUAGAGAUUUUCC AC AU 21R Bottom ACUGCUAGAGAUUUUCCACAU Supplementary Table 2: Rate constants of candidate RNA chaperones.

Phase I Phase II Protein ^annl kamU &SD No protein (RNA) 3.93 ±0.6 34.51 ±3.67 BSA 2.63 ± 0.25 27.63 ± 7.26 StpA 47.47 ± 10.63 13.82 ±3.93 hLa 58.16± 1.53 16.60 ±2.57 sLa 22.67 ± 0.8 51.75 ±17.58 225-408 21.42 ± 1.33 10.46 ±2.96 1-187 5.8 ±0.27 67.82 ±21.33 1-104 4.46 ± 0.44 24.69 ± 20.4 1-235 25 ± 0.75 19.11 ±5.22 1-235 Y114A/F155A 4.16 ±0.85 ±0.82 0.0000022 ± 0.000000292 1-235 loop 3 1.22 ±0.26 172.15 ±55.65 1-235 a-3 2.78 ±0.88 36.89 ± 19.27 105-202 7.88 ± 0.40 449.8 ± 138.7 105-229 9.48 ± 0.72 198.0 ±90.6

1 3 * fcann and fcS(j are in sec" x 10 and stated as mean ± standard deviation based on 3 separate trials Supplementary Table 3: RNA chaperone rate constants for hLa mutants at 5X protein concentration

Phase I Phase II Protein kanrt} kanrt2 ksD BSA 3.31 ±0.8 22.6 ±5.42 1-104 3.94 ±0.09 116.3 ±6.32 1-187 2.53 ±0.7 8.33 ±2.28 1-235 43.51 ±2.27 13.84 ±7 1-235 Y114A/F155A 6.08 ±0.6 27.12 ±6.78 1-235 loop 3 1.47 ±0.33 93.93 ± 30.56 1-235 a-3 2.02 ± 1.27 87.40 ±2.61 105-202 13.01 ± 1.14 24 ± 0.82 105-229 12.8 ±0.47 4.55 ± 1.68

* tann and kso are in sec'1 x 103

Supplementary Table 4: RNA chaperone rate constants for U1A and UlA-hLa fusion.

Phase I Phase II Protein kannl kann2 No protein (RNA) 3.93 ± 0.6 34.51 ±3.67 BSA 2.63 ± 0.25 27.63 ± 7.26 U1A 1-88 8.325 ±2.75 61.61 ±33.78 U1A 1-102 7.21 ±0.69 87.92 ±36.18 U1A K88 hLa a-3 20.93±1.14 369.2 ± 50.45

1 3 * kanrt and kso are in sec" x 10 Chapter III The Role of hLa Phosphorylation in RNA Chaperone Activity

This chapter is presented as unpublished data. The goal of this study was to determine what role, if any, phosphorylation of hLa plays in RNA chaperone activity. It was found that phosphorylation of hLa at S366 by CK2 significantly decreased strand annealing activity and resulted in a loss of strand dissociation activity.

20 3.1 Introduction

hLa is primarily a nuclear protein but shuttles to the cytoplasm26'27. In the nucleus, it binds to the UUU-3'OH sequence present at the end of pre-tRNAs and protects them from exonucleolytic digestion. This is an important component of tRNA maturation as it allows the pre-tRNA trailer to be cleaved endonucleolytically by RNaseZ8. hLa mutants that lose the ability to bind and protect the UUU-3'OH sequence also lose the ability to help pre-tRNAs mature13'23. In the cytoplasm, hLa is known to interact with viral mRNAs that contain IRESs like those of the Hepatitis C Virus, poliovirus, and encephalomyocarditis virus, and enhance their translation -JQ . As well, it also binds and enhances the translation of some cellular mRNAs that contain upstream open reading frames (uORFs), like that of MDM241. The mechanism of La's involvements in mRNA translation is still unclear. However, because these mRNAs assume defined secondary structures in order to perform their functions, it is hypothesized that La may be acting as an RNA chaperone to help them attain their native conformations.

hLa has a different phosphorylation status in the nucleus versus the cytoplasm. In the nucleus it is phosphorylated by Casein Kinase 2 (CK2) at S366 and in the cytoplasm it is non- phosphorylated27. The different phosphorylation states in the nucleus and cytoplasm is hypothesized to be a consequence of the local availability of kinases and phosphatases ' .

This means that the phosphorylation status does not determine hLa's subcellular localization, rather its localization determines whether or not it is phosphorylated. It is possible that phosphorylation may also have evolved to control hLa RNA chaperone activity in the different compartments. Therefore, it is interesting to determine what role, if any, phosphorylation plays in hLa RNA chaperone activity. Purified CK2 and hLa can be used to initiate a phosphorylation reaction in vitro. Our goal was to combine this technique with the FRET assay for RNA chaperone activity (Chapter

II) in order to determine whether or not any significant changes arise in hLa RNA chaperone activity due to phosphorylation at S366.

22 3.2 Materials and Methods

2(xg of purified hLa was phosphorylated by 1,000 units of Casein Kinase 2 (CK2)

(purchased from New England Biolabs). The phosphorylation reaction was performed in a final volume of 10[iL with IX CK2 buffer (20mM Tris-HCl pH 7.5, 50mM KC1, lOmM

MgCIa) and l|iL of 0.01M GTP. The reactions were then incubated at 30°C for 2 hours.

Phosphorylation was confirmed by adding 15|i.Ci of [y-32P]-GTP and visualizing via coomassie staining and phosphorimager screen. Negative controls of phosphorylation were made either without CK2 or GTP. The entire reaction was then used in the FRET assays for

RNA chaperone activity as described in Chapter II.

23 3.3 Results hLa phosphorylation decreases strand annealing and dissociation activity

Phosphorylation of recombinant hLa purified from E. coli was carried out in vitro by

CK2 and confirmed using radioactive film (Figure 1). The rates of strand annealing for non- phosphorylated and phosphorylated hLa were 14 ± 2.3 and 9.5 ±1.3 sec"1 x 103, respectively

(Figure 2). Therefore, a significant loss of strand annealing was seen due to phosphorylation of hLa by CK2. The rates of strand dissociation for non-phosphorylated and phosphorylated hLa were 5.6 ± 3.2 and 0.097 ± 0.096 sec"1 x 103, respectively. Thus, a complete loss of strand dissociation activity was noted with phosphorylated hLa.

24 Figure 1- Confirmation of hLa phosphorylation by CK2 in vitro. A) Coommassie gel showing both non-phosphorylated and phosphorylated hLa. B) Radioactive film showing phosphorylated hLa.

25 Ikannl

ikSD

RNA BSA non-phosphorylated phosphorylated hLa hLa

Figure 2- Affect of phosphorylation on hLa RNA chaperone activity. fcanni and &Sd rates of phosphorylated and non-phosphorylated hLa. Phosphorylated hLa shows a significant decrease in strand annealing activity and a loss of strand dissociation activity.

26 Chapter IV

Discussion

27 4. Discussion

4.1 RNA chape rone activity and the RRM

RNA chaperones are a key component of living cells with roles in several cellular pathways such as regulation of transcription, RNP assembly and stabilization, RNA export, virus replication and histone-like nucleoid structuring42. Despite these important roles, there is still not much known about how RNA chaperones function, or even the basic requirements for

RNA chaperone activity. The RNA chaperone activity of human La protein is hypothesized to

have implications in cellular processes such as pre-tRNA maturation and viral infections, thus

our work has dissected the RNA chaperone activity of human La protein in order to gain a

better understanding of La's roles in these processes.

In this work, we have shown that human La is an RNA chaperone with both strand

annealing and dissociation activities and that these activities are conserved in Slalp. Focusing

on the universally conserved NTD of human La, we revealed through mutational analysis that

these activities require the RRMl and the adjacent a3-helix region, as well as the disordered

linker that connects RRMl and RRM2. The identification of this variant RRM as the central

requirement to RNA chaperone activity in La protein is novel, but is nevertheless consistent

with what is known about other RRMs. RRMs have a long history of plasticity and

involvement in a plethora of cellular processes, and are associated with diverse functions often

by co-operating with adjacent domains49. For example, the association of the human poly(A)-

binding protein (PABP) RRM with a PABP domain allows it to be involved in protein-protein

interactions50. Thus it was not entirely surprising when the RNA chaperone activity of human

La was found to be dependent on its N-terminal RRM and the region immediately C-terminal

to it. Consistent with a novel function in the RRM superfamily, this region engages the canonical RRM making it structurally distinct. Specifically, the non-canonical a3-helix lies adjacent to the (3-sheet normally associated with RNA binding and partially obscures this, suggesting that this RRM does not bind RNAs in the expected manner, and that it may have evolved to perform other novel functions such as RNA chaperone activity16,22. Further C- terminal to the a3-helix lies a disordered linker region containing a high density of basic charge that was found to enhance RNA chaperone activity. Previous studies have also found disordered regions with high basic content to be important for the RNA chaperone activity of the bacterial StpA protein48. This region in La proteins is also important for binding the HCV

IRES element, as shown by the fact that a La deletion mutant containing only the region of

174-197 was able to compete with wild type La for HCV IRES engagement51. These data are consistent with the hypothesis in which La interacts with the HCV IRES using this region and acts as an RNA chaperone to enhance translation from the IRES element.

4.2 Amino acids of the RRM responsible for RNA chaperone activity

Our site directed mutagenesis studies identified specific amino acids of the RRM1 that are required for hLa RNA chaperone activity. Notably, several of these mutations (loop-3 and

Y114A/F155A) are at residues typically associated with canonical RRM RNA binding, suggesting some functional overlap between La-UUU-3'OH independent RNA engagement,

RNA chaperone activity, and this binding mode. Mutation of the basic amino acids in loop 3, which is the region connecting the 02 and 03 sheets, resulted in mutants that lost strand annealing and dissociation activity. This could not be rescued by increasing the amount of protein in the assay, suggesting that these residues are required for these functions. Mutation of the basic amino acids in the a-3 helix produced similar results. Mutation of the binding surface amino acids (Y114A/F155A) resulted in loss of strand annealing and dissociation at

IX protein concentration, and strand annealing at 5X protein concentration. The rescue of strand dissociation activity at 5X in 1-187 and 1-235 Y114A/F155A is consistent with a model in which the basic amino acids in loop 3 (R142/R143/K148/K151) and K185 in the a3 helix form the minimal requirements for strand dissociation activity, and that this is enhanced by Y114/F155 and by adding the basic amino acids of the disordered linker region. More specifically, at IX concentration the Y114A/F155A mutants lack sufficient affinity for the

RNA chaperone substrates to participate in strand dissociation, a defect that is overcome by adding more protein to the assay. We hypothesize that those mutants that could not be rescued by adding more protein to the assay have a fundamental defect in RNA chaperone activity due to their mutations.

4.3 RNA chaperones acting as a quality control check

In our work, we showed that hLa mutant 1-235 Y114A/F155A is defective in strand annealing activity and may have diminished affinity for substrates. Previous evidence showed that the hLa Y114A/F155A retained the ability to bind and protect the UUU-3'OH sequence of pre-tRNAs, but lost the ability to rescue mutated, misfolded tRNAs in vivo23. While this mutant was shown to be important for the accumulation of mature mutated tRNAs which were more prone to misfolding, this was not the case for wild type tRNAs as the accumulation and efficiency of processing of wild type tRNAs actually increased in the context of hLa

Y114A/F155A compared to hLa. In light of this, it was hypothesized that hLa is not capable of recognizing and binding misfolded tRNAs. Rather, it may bind every pre-tRNA and use its

RNA chaperone activity to serve as a quality control check to ensure that they are folded properly. By doing so, hLa will benefit the maturation of pre-tRNAs that are misfolded at the expense of slowing down the processing of tRNAs that are not misfolded. This is consistent with hLa dependent RNA chaperone activity not functioning by recognizing structural differences between folded and unfolded tRNA targets, but rather by attempting to fold all tRNA substrates . Thus, our data on 1-235 Y114A/F155A being defective in strand annealing activity and impaired in strand dissociation activity is consistent with the hypothesis that this mutant is less capable to serve as an RNA chaperone that performs a quality control check on pre-tRNAs.

4.4 a3-helix mediated enhancement of strand annealing activity

In order to test the importance of this a3-helix and subsequent disordered region in

RNA chaperone activity more generally, these elements were appended to the C-terminal end of an RRM with no history of RNA chaperone activity, the Ul A RRM. The a3-helix and a small portion of the disordered basic region were able to enhance the strand annealing activity of this motif, but no strand dissociation activity was observed. The U1A RRM was chosen because it is very well characterized and also because it contains its own a3-helix, albeit with

a different sequence and in a different conformation than the hLa a3-helix52. The enhancement

of activity seen after adding the hLa a3-helix on to the Ul A RRM is consistent with the

hypothesis that this region is centrally important to RRM associated RNA chaperone activity

and that the hLa RRM1 has evolved to perform functions not typically associated with other

RRMs. Future work may elucidate whether other RRMs also utilize C-terminal extensions in

the remodelling of RNA substrates; in particular, the study of the RRMs of the La-related

proteins may provide important insight into this question. 4.5 CTD hLa RNA chaperone activity

Our work also indicated that both the NTD of hLa (1-235), and the CTD of hLa (225-

408) were active in strand annealing and dissociation activities, albeit not to the same degree as the wild type hLa protein. The fact that these separate domains are not as active as the full length suggests that perhaps these domains function independently to increase the overall activity of hLa, or that different domains of hLa may have varying degrees of RNA chaperone activity towards the different classes of La associated RNA targets. As stated earlier, the focus of this study was on the determinants of the NTD RNA chaperone activity, since this is the part of La that is evolutionarily conserved among all species. The CTD of hLa also has an

RRM, called RRM2, that also contains an a3-helix followed by a disordered basic rich region.

Unlike the RRM1 a3-helix, this a3-helix completely obscures the (3-sheet binding surface, likely preventing canonical RNA binding. Deletion of this region in the context of the full length protein resulted in mutants that did not retain the ability to rescue misfolded tRNAs in vivo, however, this drop in activity was attributed to aberrant La localization27. Notably, deletion of the RRM2 a3-helix is associated with hLa accumulation in the cytoplasm via mechanisms that are not yet understood. Based on the similarities between RRM1 and RRM2, we hypothesize that the RNA chaperone activity in the CTD is centered around RRM2, and the combination of RRM1 and RRM2 in the full length protein leads to higher activity due to the summation of the individual activities harboured by the NTD and CTD. In the future it would be interesting to test this hypothesis by deleting the a3-helix of the CTD, as well as several other CTD structures (see chapter 1), to see which region of the CTD is important for in vitro RNA chaperone activity as determined by the FRET assay.

32 4.6 The role of the LAM in hLa RNA chaperone activity

The LAM is by itself inactive in the RNA chaperone assay. However, deletion of the

LAM results in a decrease of RNA chaperone activity when comparing 1-235 and 105-229.

Previous work has shown that point mutation of LAM residues associated with UUU-3'OH dependent binding results in mutants that have between a 10 and 500 fold decrease in the engagement of such substrates22. However, removal or point mutation of the UUU-3'OH sequence from RNA ligands results in a more moderate (~3 fold) decrease in affinity13. Thus, even though the LAM is the site of UUU-3'OH dependent binding, it appears that it is also important for increasing affinity for non UUU-3'OH containing RNAs. Similarly, it was found that the LAM by itself does not interact with the HCV IRES, but for wild type binding, a minimal region including the La motif is required24. These observations are consistent with our data suggesting that the LAM has roles in binding the RNA substrates, but not in RNA chaperone activity. Thus, the role of the LAM in RNA chaperone activity is indirect as it seems to function solely as an 'accessory' structure.

4.7 The role of the UUU-3'OH sequence in hLa RNA chaperone activity

Consistent with the RRM1 associated UUU-3'OH independent binding mode being more directly associated with RNA chaperone activity, we used three different cy5 labelled substrates either containing or lacking this motif to show that hLa RNA chaperone activity does not depend on the presence of a UUU-3'OH sequence. This is reminiscent of previous observations indicating that La RRM1 mutants that retain the ability to bind the UUU-3'OH sequence lose the ability to help rescue misfolded tRNAs. This is also consistent with the hypothesis that hLa can act as an RNA chaperone not only for UUU-3'OH containing pre- tRNAs, but also for UUU-3'OH lacking mRNAs. In the future, it would be interesting to examine the role of hLa RNA chaperone activity in mRNA translation more directly by testing whether hLa mutants noted in this work to be defective in RNA chaperone activity are also defective in HCV IRES dependent protein translation.

4.8 The role of phosphorylation in hLa RNA chaperone activity

Human La is phosphorylated at serine 366 in the nucleus and is non-phosphorylated in

the cytoplasm. In the nucleus it associates with pre-tRNAs and in the cytoplasm it associates

with mRNAs that contain IRESs, TOPs, or uORFs. Therefore, it was interesting to determine

if the phosphorylation status of hLa yields any differences in the context of the RNA chaperone assay. We found that phosphorylation of hLa at S366 by CK2 resulted in a decrease

in strand annealing activity and a loss of strand dissociation activity. As stated before, both the

NTD and the CTD of hLa were active in the RNA chaperone assay, but not to the same degree

as full-length hLa. As stated previously, non-phosphorylated hLa inhibits processing of the

pre-tRNAs by RNase P because it binds the leader and sequesters it away from

endonucleolytic cleavage28. However, once phosphorylated, hLa releases the leader and

processing by RNAse P is rescued. Thus, phosphorylation of S366 in the nucleus may be

viewed as a signal that turns off the inhibitory binding of the CTD to pre-tRNAs in order to

allow tRNA processing to occur. Similarly, the loss of RNA chaperone activity seen with

phosphorylated hLa could be a result of the RNA chaperone activity of the CTD for the

substrates in our assay being 'shut off. We hypothesize that this phophorylation dependent

regulation evolved as a mechanism to target the RNA chaperone activity associated with the

NTD toward proper pre-tRNA processing in the nucleus. Moreover, in the cytoplasm, the RNA chaperone activity associated with the CTD could be activated to allow it to interact with distinct cytoplasmic substrates, that is, the 5' untranslated regions of mRNAs, and enhance their translation. This hypothesis is consistent with recent data attributing the importance of RRM2 (in the CTD) in HCV IRES binding24, while pre-tRNA binding is largely associated with the NTD. As such it would be interesting to determine whether phosphorylated versus non-phosphorylated hLa have any variations in their ability to engage and modulate the structures of mRNA substrates. Moreover, using the previously discussed alternate cy5 labelled substrates, it would be interesting to determine if the phosphorylation status of hLa provides selectivity in acting as RNA chaperones for RNAs that contain or lack the UUU-3'OH tail.

4.9 Future implications of hLa RNA chaperone activity in La associated diseases

Our work showed that hLa is an RNA chaperone and this may be an evolutionarily conserved function amongst other La and La related proteins. By characterizing the regions important for this function we have identified possible new modes of interaction between hLa and its highly variable targets. In the future, this understanding could prove useful for better describing La's involvement in the pathogenicity of several viruses and in the progression of some cancers. We hope that the work outlined here on La RNA chaperone activity could one day provide more insight into the mechanisms of La's involvement in several La associated challenges to human health.

35 5. References

1. Bousquet-Antonelli, C. & Deragon, J.-M. A Comprehensive Analysis of the La-Motif Protein Superfamily. RNA 15, 750-764 (2009). 2. Mattioli, M. & Reichlin, M. Heterogeneity of RNA protein antigens reactive with sera of patients with systemic lupus erythematosus description of a cytoplasmic nonribosomal antigen. Arthritis & Rheumatism 17, 421—429 (1974). 3. Park, J.-M. et al. The Multifunctional RNA-Binding Protein La Is Required for Mouse Development and for the Establishment of Embryonic Stem Cells. Mol. Cell. Biol. 26, 1445-1451 (2006). 4. Bai, C. & Tolias, P. P. Genetic Analysis of a La Homolog in Drosophila Melanogaster. Nucl. Acids Res. 28, 1078-1084 (2000). 5. Arhin, G. K., Shen, S., Perez, I. F., Tschudi, C. & Ullu, E. Downregulation of the essential Trypanosoma brucei La protein affects accumulation of elongator methionyl-tRNA. Mol. Biochem. Parasitol. 144, 104-108 (2005). 6. Fleurdepine, S., Deragon, J.-M., Devic, M., Guilleminot, J. & Bousquet-Antonelli, C. A bona fide La protein is required for embryogenesis in Arabidopsis thaliana. Nucleic Acids Res. 35, 3306-3321 (2007). 7. Van Horn, D. J., Yoo, C. J., Xue, D., Shi, H. & Wolin, S. L. The La protein in Schizosaccharomyces pombe: a conserved yet dispensable phosphoprotein that functions in tRNA maturation. RNA 3, 1434-1443 (1997). 8. Yoo, C. J. & Wolin, S. L. La proteins from Drosophila melanogaster and Saccharomyces cerevisiae: a yeast homolog of the La autoantigen is dispensable for growth. Mol. Cell. Biol. 14, 5412-5424 (1994). 9. Pannone, B. K., Xue, D. & Wolin, S. L. A role for the yeast La protein in U6 snRNP assembly: evidence that the La protein is a molecular chaperone for RNA polymerase III transcripts. EMBO J17, 7442-7453 (1998). 10. Xue, D., Rubinson, D. A., Pannone, B. K., Yoo, C. J. & Wolin, S. L. U snRNP assembly in yeast involves the La protein. EMBO J19, 1650-1660 (2000). 11. Bayfield, M. A., Yang, R. & Maraia, R. J. Conserved and divergent features of the structure and function of La and La-related proteins (LARPs). Biochim. Biophys. Acta 1799, 365-378 (2010). 12. Maraia, R. J. & Bayfield, M. A. The La Protein-RNA Complex Surfaces. Molecular Cell 21, 149-152 (2006). 13. Bayfield, M. A. & Maraia, R. J. Precursor-product discrimination by La protein during tRNA metabolism. Nat Struct Mol Biol 16, 430—437 (2009). 14. Ohndorf, U. M., Steegborn, C., Knijff, R. & Sondermann, P. Contributions of the individual domains in human La protein to its RNA 3'-end binding activity. J. Biol. Chem 276,27188-27196(2001). 15. Sobel, S. G. & Wolin, S. L. Two Yeast La Motif-containing Proteins Are RNA-binding Proteins that Associate with Polyribosomes. Mol. Biol. Cell 10, 3849-3862 (1999). 16. Alfano, C. et al. Structural analysis of cooperative RNA binding by the La motif and central RRM domain of human La protein. Nat Struct Mol Biol 11, 323-329 (2004).

36 17. Birney, E., Kumar, S. & Krainer, A. R. Analysis of the RNA-recognition motif and RS and RGG domains: conservation in metazoan pre-mRNA splicing factors. Nucleic Acids Res 21, 5803-5816 (1993). 18. Kenan, D. J., Query, C. C. & Keene, J. D. RNA recognition: towards identifying determinants of specificity. Trends Biochem. Sci 16, 214—220 (1991). 19. Wolin, S. L. & Cedervall, T. The La protein. Annu. Rev. Biochem. 71, 375-403 (2002). 20. Goodier, J., Fan, H. & Maraia, R. A carboxy-terminal basic region controls RNA polymerase IH transcription factor activity of human La protein. Mol. Cell. Biol. 17, 5823-5832 (1997). 21. Horke, S., Reumann, K., Schulze, C., Grosse, F. & Heise, T. The La motif and the RNA recognition motifs of human La autoantigen contribute individually to RNA recognition and subcellular localization. J. Biol. Chem. 279, 50302-50309 (2004). 22. Teplova, M. et al. Structural basis for recognition and sequestration of UUU(OH) 3' temini of nascent RNA polymerase III transcripts by La, a rheumatic disease autoantigen. Mol. Cell 21,75-85 (2006). 23. Huang, Y., Bayfield, M. A., Intine, R. V. & Maraia, R. J. Separate RNA-binding surfaces on the multifunctional La protein mediate distinguishable activities in tRNA maturation. Nat Struct Mol Biol 13, 611-618 (2006). 24. Martino, L. et al. Analysis of the interaction with the hepatitis C virus mRNA reveals an alternative mode of RNA recognition by the human La protein. Nucleic Acids Res. 40, 1381-1394 (2012). 25. Jacks, A. et al. Structure of the C-Terminal Domain of Human La Protein Reveals a Novel RNA Recognition Motif Coupled to a Helical Nuclear Retention Element. Structure 11, 833-843 (2003). 26. Bayfield, M. A., Kaiser, T. E., Intine, R. V. & Maraia, R. J. Conservation of a masked nuclear export activity of La proteins and its effects on tRNA maturation. Mol. Cell. Biol. 27, 3303-3312 (2007). 27. Intine, R. V., Dundr, M., Misteli, T. & Maraia, R. J. Aberrant nuclear trafficking of La protein leads to disordered processing of associated precursor tRNAs. Mol. Cell 9, 1113— 1123 (2002). 28. Intine, R. V., Tenenbaum, S. A., Sakulich, A. L., Keene, J. D. & Maraia, R. J. Differential phosphorylation and subcellular localization of La RNPs associated with precursor tRNAs and translation-related mRNAs. Mol. Cell 12, 1301-1307 (2003). 29. Brenet, F., Socci, N. D., Sonenberg, N. & Holland, E. C. Akt phosphorylation of La regulates specific mRNA translation in glial progenitors. Oncogene 28, 128-139 (2009). 30. van Niekerk, E. A. et al. Sumoylation in axons triggers retrograde transport of the RNA- binding protein La. Proc. Natl. Acad. Sci. U.S.A. 104, 12913-12918 (2007). 31. Chakshusmathi, G., Kim, S. D., Rubinson, D. A. & Wolin, S. L. A La protein requirement for efficient pre-tRNA folding. EMBO J 22, 6562-6572 (2003). 32. Copela, L. A., Chakshusmathi, G., Sherrer, R. L. & Wolin, S. L. The La protein functions redundantly with tRNA modification enzymes to ensure tRNA structural stability. RNA 12, 644-654 (2006). 33. Belisova, A. et al. RNA chaperone activity of protein components of human Ro RNPs. RNA 11, 1084-1094 (2005). 34. Gebauer, F. & Hentze, M. W. Molecular mechanisms of translational control. Nat. Rev. Mol. Cell Biol. 5, 827-835 (2004).

37 35. Meerovitch, K., Pelletier, J. & Sonenberg, N. A cellular protein that binds to the 5'- noncoding region of poliovirus RNA: implications for internal translation initiation. Genes Dev 3, 1026-1034(1989). 36. Ali, N. & Siddiqui, A. The La antigen binds 5' noncoding region of the hepatitis C virus RNA in the context of the initiator AUG codon and stimulates internal ribosome entry site-mediated translation. Proc. Natl. Acad. Sci. U.S.A 94, 2249-2254 (1997). 37. Isoyama, T. et al. Lower concentration of La protein required for internal ribosome entry on hepatitis C virus RNA than on poliovirus RNA. J Gen Virol 80, 2319-2327 (1999). 38. Kim, Y. K. & Jang, S. K. La protein is required for efficient translation driven by encephalomyocarditis virus internal ribosomal entry site. J. Gen. Virol. 80 ( Pt 12), 3159- 3166(1999). 39. Mondal, T. et al. Structural Determinant of Human La Protein Critical for Internal Initiation of Translation of Hepatitis C Virus RNA. J. Virol. 82, 11927-11938 (2008). 40. Holcik, M. & Korneluk, R. G. Functional characterization of the X-linked inhibitor of apoptosis (XIAP) internal ribosome entry site element: role of La autoantigen in XIAP translation. Mol. Cell. Biol. 20, 4648-4657 (2000). 41. Trotta, R. et al. BCR/ABL activates mdm2 mRNA translation via the La antigen. Cancer Cell 3, 145-160 (2003). 42. Rajkowitsch, L. et al. RNA chaperones, RNA annealers and RNA helicases. RNA Biol 4, 118-130(2007). 43. Russell, R. & Herschlag, D. Probing the folding landscape of the Tetrahymena ribozyme: commitment to form the native conformation is late in the folding pathway. J. Mol. Biol. 308, 839-851 (2001). 44. Russell, R. & Herschlag, D. New pathways in folding of the Tetrahymena group I RNA enzyme. J. Mol. Biol. 291, 1155-1167 (1999). 45. Rajkowitsch, L. & Schroeder, R. Dissecting RNA chaperone activity. RNA 13, 2053-2060 (2007). 46. Tompa, P. & Csermely, P. The role of structural disorder in the function of RNA and protein chaperones. FASEB J. 18, 1169-1175 (2004). 47. Waldsich, C., Grossberger, R. & Schroeder, R. RNA chaperone StpA loosens interactions of the tertiary structure in the td group I intron in vivo. Genes Dev. 16, 2300-2312 (2002). 48. Mayer, O., Rajkowitsch, L., Lorenz, C., Konrat, R. & Schroeder, R. RNA chaperone activity and RNA-binding properties of the E. coli protein StpA. Nucleic Acids Res. 35, 1257-1269 (2007). 49. Maris, C., Dominguez, C. & Allain, F. H.-T. The RNA recognition motif, a plastic RNA- binding platform to regulate post-transcriptional gene expression. FEBS Journal 272, 2118-2131 (2005). 50. Kozlov, G. et al. Structure and function of the C-terminal PABC domain of human poly(A)-binding protein. Proc. Natl. Acad. Sci. U.S.A. 98, 4409-4413 (2001). 51. Pudi, R., Ramamurthy, S. S. & Das, S. A Peptide Derived from RNA Recognition Motif 2 of Human La Protein Binds to Hepatitis C Virus Internal Ribosome Entry Site, Prevents Ribosomal Assembly, and Inhibits Internal Initiation of Translation. J. Virol. 79, 9842- 9853 (2005). 52. Avis, J. M. et al. Solution structure of the N-terminal RNP domain of U1A protein: the role of C-terminal residues in structure stability and RNA binding. J. Mol. Biol. 257, 398- 411 (1996).

38