P73 Expression Is Associated with the Cellular Radiosensitivity in Cervical Cancer After Radiotherapy

Vol. 10, 3309–3316, May 15, 2004 Clinical Cancer Research 3309 p73 Expression Is Associated with the Cellular Radiosensitivity in Cervical Cancer after Radiotherapy

Stephanie Si Liu,1 Rebecca Ching-Yu Leung,1 ings suggested that p73 expression was related to the radi- Kelvin Yuen-Kwong Chan,1,2 Pui-Man Chiu,2 osensitivity of cervical cancer cells and may play an impor- Annie Nga-Yin Cheung,2 Kar-Fai Tam,1 tant role in the regulation of cellular radiosensitivity. Tong-Yow Ng,1 Ling-Chui Wong,1 and Hextan Yuen-Sheung Ngan1 INTRODUCTION Departments of 1Obstetrics & Gynaecology and 2Pathology, Queen Carcinoma of the uterine cervix is the second commonest Mary Hospital, The University of Hong Kong, Hong Kong, People’s female cancer worldwide. Radiotherapy is the most effective Republic of China therapy for advanced stages cervical cancer. It is equally effective as radical surgery in treating early tumors, and it reduces ABSTRACT local recurrences after surgery for patients with high-risk fea- tures (1). Resistance of cancer to radiotherapy is one of the Apoptosis is one of the causes of cell death in cervical reasons for treatment failure. It is well known that the response cancer following radiotherapy (S. S. Liu et al., Eur. J. Can- of tumor to ionizing radiation varies widely, which may be cer, 37: 1104–1110, 2001). By studying the gene expression explained by differences in tumor cell death-inducing effects. profile with cDNA apoptotic array, the p73 gene was found One cellular mechanism common to various therapeutic regi- overexpressed in radiosensitive cervical cancers when com- mens, including radiation, is tumor cell death via apoptosis. Our pared with radioresistant ones. To investigate the role of the previous study has demonstrated a close relationship between p73 gene in relation to clinical assessment of radiosensitivity spontaneous apoptosis and patient survival (2). Apoptosis may in cervical cancer based on the findings of residual tumor thus play a role in the response of cervical cancer to radiation cells in cervical biopsies after completion of radiotherapy, treatment. we studied the protein expression of p73 in 59 cervical Apoptosis is known to be activated or inactivated by a cancers after radiotherapy and 68 normal cervices using variety of genes. Deregulation of genes involved in the activa- immunohistochemistry. The expression of p73 was found to tion or execution of the apoptotic process may lead to radiore- be significantly increased in cancer samples and, more im- sistance in cells. In our pilot study, using cDNA expression portantly, in those samples sensitive to radiotherapy (P < array, the expressions of human apoptotic genes in radiosensi- 0.001). The overexpression of p73 actually predicted a better tive and radioresistant cervical cancers were profiled. Different prognosis in cervical cancer patients (P < 0.001). To inves- patterns of gene expression were observed between these two tigate the possible involvement of p73 downstream genes, the groups of cancers. Among the differentially expressed genes protein expressions of p21 and Bax were studied. The ex- identified, p73 mRNA expression was found to be decreased or pression of p21, but not Bax, was found to be positively even absent in radioresistant cervical cancers when compared -Further .(0.001 ؍ correlated with the expression of p73 (P with radiosensitive cancers. This difference in p73 gene expres- more, the epigenetic regulation of p73 expression via DNA sion has led to a further study based on: (a) cervical cancer is methylation was also investigated in 103 cervical cancers often associated with human papillomavirus (HPV), its oncop- and 124 normals. Hypermethylation of p73 gene was ob- roteins E6 and E7 disrupt the functions of tumor suppressor served in 38.8% of cervical cancers, and it was significantly genes such as p53 and Rb, resulting in genomic instability and associated with reduced or absent p73 expression (P < development of additional genetic alteration (3–5); (b) p73 is a 0.001). Reactivation of p73 expression in two cervical cancer member of p53 tumor suppressor gene family with substantial cell lines by demethylation treatment supported the role of structural and functional homology (6). It activates the transcrip- methylation in the regulation of p73 expression. Our find- tion of p53-responsive genes and induces apoptosis in a p53-like manner (7). Because p53 function is impaired in cervical cancer, it will be interesting to know whether p73, if its function is intact in cervical cancer, can compensate the impaired p53 function to Received 8/28/03; revised 12/8/03; accepted 2/6/04. trigger p53-independent apoptosis or cell cycle effectors of Grant support: Research Grant Council grant 10212.10204693. cancer cells in response to radiation. To confirm the pilot 28410.20900.324.01. findings and to further investigate the relationship between p73 The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked expression and radiosensitivity, the present study was conducted advertisement in accordance with 18 U.S.C. Section 1734 solely to in a large group of cervical cancer patients who had undergone indicate this fact. radiotherapy. Requests for reprints: Hextan Yuen-Sheung Ngan, Department of p73 shares a remarkable homology in DNA sequence and Obstetrics & Gynaecology, 6th Floor, Professorial Block, Queen Mary Hospital, Pokfulam Road, Hong Kong, People’s Republic of China. protein structure with p53 (6). It maps to chromosome 1p36, a Phone: 852-28554684; Fax: 852-28550947; E-mail: hysngan@hkucc. region that is frequently deleted in many types of human tumors. hku.hk. Therefore, it has been postulated to be a new candidate tumor

suppressor gene. The p73 gene encodes two different proteins residual tumor cells in the cervical biopsy specimens taken after that are expressed under the control of two independent promot- the completion of radiotherapy. Fifty-nine samples were ra- ers and that have opposite activities: the transcriptionally active dioresistant, and 56 were radiosensitive.

full-length TAp73 and the NH2-terminally truncated dominant- Cell Lines and Demethylation Treatment. Four cervi- negative ⌬Np73 (8). TAp73 has been reported to be involved in cal cancer cell lines, C4–1, SiHa, HeLa, and Caski, were in- the cellular response to DNA damage induced by radiation and cluded in this study. To induce p73 expression, SiHa and Caski chemotherapeutic agents (9–11). It could, when overexpressed cell lines were treated with a demethylation reagent, 5-aza-2Ј- in cells, activate the transcription of p53-responsive genes such deoxycytidine (Sigma Co., St. Louis, MO) at 1.0, 3.0, and 5.0 as p21, Bax, Mdm2, and GADD45 and inhibit cell growth in a ␮M for 3 days to achieve demethylation. p53-like manner by inducing apoptosis (7, 12, 13). In contrast to RNA Preparation and cDNA Array Hybridization. p53, however, mutation of p73 was rarely found in most human Total RNA was extracted from cervical tissues and cell lines cancers (14–17). using TRIzol reagent (Life Technologies, Inc.) as recommended The transcription of p73 can be regulated by the promoter by the manufacturer and described previously (27). Gene ex- and the exon 1, which is rich in CpG dinucleotides (18). Meth- pression was analyzed using the Atlas human cDNA apoptosis ylation of the cytosine residues at the CpG dinucleotides within array (Clontech Laboratories, Palo Alto, CA). The membrane this region plays an important role in inactivating the gene was immobilized with cDNAs of 205 apoptotic genes and 9 expression because this epigenetic modification has been com- housekeeping genes. Twelve cervical cancers and 5 normal monly observed in many tumor suppressor genes in various cervical samples were recruited for gene profiling. The proce- human cancers. Transcriptional silencing of the p73 gene dures and gene expression analysis were performed as described through methylation has been demonstrated in leukemias, lym- previously (27). phomas, brain tumors, and ovarian cell lines (19–25) but not in Reverse Transcription-PCR. The semiquantitative re- breast, renal, and colon cancers (19). verse transcription-PCR was used to confirm the differential The aim of this study was to investigate the relationship gene expression identified in cDNA array study and to assess between the p73 gene expression and the radiosensitivity of expression levels of p73 in cell lines. Three ␮g of total RNA cervical cancer cells. We assessed the p73 protein expression in were reverse transcribed with oligo-dT and Moloney murine cervical carcinomas with different degrees of radiosensitivity to leukemia virus reverse transcriptase according to manufacture’s determine whether the expression of the p73 gene was related to protocol (SuperScript first-stand synthesis system for reverse the cellular radiosensitivity. In addition, with the notion that p73 can activate some p53-responsive genes, expressions of p21 and transcription-PCR; Life Technologies, Inc.). The cDNA was Bax were also studied and correlated with p73 expression. then amplified by p73-specific primers flanking from exon 1 to Furthermore, the mechanism underlying the regulation of p73 3 and normalized with internal control glyceraldehyde-3-phos- gene expression was investigated. phate dehydrogenase (Table 1). Western Blot Analysis. Protein was extracted from tissues and cell lines using radioimmunoprecipitation assay buffer MATERIALS AND METHODS as described previously (28). Western blot was performed with Cervical Tissue Specimens. A total of 115 patients with 50 ␮g of protein and the polyclonal antibody p73 (raised against cervical carcinomas was recruited at the Department of Obste- the p73 ␣ and ␤ isoforms, Ab6, Neomarkers; Lab Vision Cor- trics and Gynaecology, Queen Mary Hospital, the University of poration, Fremont, CA) in a dilution of 1:250, and then visual- Hong Kong. All patients were treated with radiotherapy, and ized with the ECL chemiluminescent detection kit (enhanced some had additional treatment of chemotherapy and/or surgery. chemiluminescence; Amersham, Arlington Heights, IL) and au- The average age of patients was 53.8 years (ranged from 29 to toradiography. The membranes were also reprobed with ␤-actin 84 years). The stage of carcinoma was diagnosed according to (Sigma) after stripping. the criteria of the International Federation of Gynaecology and Immunohistochemistry. Three-step streptavidin-biotin Obstetrics classification (26): 52 (45.2%) early stage (I–IIa) and complex immunohistochemical assays were performed for de- 63 (54.8%) advanced stage (IIb and above). Histological cell tection of p73, p21, and Bax expressions as described previously types of the tumors were squamous cell carcinomas (95 of 115), (2). Antigen retrieval was performed by microwave pretreat- and adenocarcinoma and adenosquamous carcinomas (20 of ment in 0.01 M citrate buffer for 9 min (p73 and p21) or 12 min 115). All specimens were obtained before the treatment. Histo- (Bax). Antibodies of p73 (Ab6, Neomarkers), p21 (Ab1; Cal- logical assessment of frozen tissue section confirmed that all biochem, Boston, MA) and Bax (Ab1, Neomarkers) were di- cancer specimens consisted of at least 70% of tumor cells. luted in 1:50, 1:30, and 1:50, respectively. Positive and negative Among the 115 cancer samples, 59 of them had matched normal controls were included in each experiment. controls, including endometrium, myometrium, or blood lym- Sections were examined at high power (ϫ400), and 10 phocytes. Normal cervical tissues from 68 patients undergoing fields were chosen randomly. The nuclear positivity of p73 hysterectomy for benign gynecological diseases were also in- staining was assessed quantitatively, and the cytoplasmic stain- cluded as normal controls. Their age ranged from 37 to 89 years, ing was excluded as p73 is a nuclear protein. In each case, the with a mean age of 62.5 years. immunoreactivity of p73 and p21 was estimated by scoring the Cervical cancer samples were divided into radiosensitive percentage of positive nuclei. The cytoplasmic staining of Bax and radioresistant groups based on the histological findings of was scored with respect to the sum of the values of both

Table 1 Primer sequences and PCR conditions used in reverse transcription-PCR, methylation-specific PCR and human papillomavirus (HPV) typing Gene Primer sequence (5Ј-3Ј) Annealing temperature (°C) PCR cycles Size (bp) p73 AACGCTGCCCCAACCACGAG 53 33 231 GCCGGTTCATGCCCCCTACA GAPDH CACCATCTTCCAGGAGCGAG 60 20 372 TCACGCCACAGTTTCCCGGA p73 methylation GGACGTAGCGAAATCGGGGTTC 60 40 60 ACCCCGAACATCGACGTCCG p73 unmethylation AGGGGATGTAGTGAAATTGGGGTTT 62 35 69 ATCACAACCCCAAACATCAACATCCA HPV-16 ATCATCAAGAACACGTAGAG 58 35 100 GATCAGTTGTCTCTGGTTGCAAAT HPV-18 GATTTCACAACATAGCTGGG 58 35 127 TGCCTTAGGTCCATGCATAC HPV-31 TGTCAAAGACCGTTGTGTCC 55 35 232 GAGCTGTCGGGTAATTGCTC HPV-52 TGTCAAACGCCATTATGTCC 55 35 231 GAGCTGTCACCTAATTGCTC HPV-58 TGTCAAAGACCATTGTGTCC 55 35 244 GAGCTGTCACATAATTGCTC HPV-E6 TGTCAAAAACCGTTGTGTCC 59 35 250 GAGCTGTCGCTTAATTGCTC ␤-Globin GAAGAGCCAAGGACAGGTAC 56 30 268 CAACTTCATCCACGTTCACC

percentage and intensity of the positive cells as described pre- RESULTS viously (2). Each case with positive staining in Ͼ50% of cancer Differential Expression of p73 in Cervical Cancers of cells was considered as strongly positive for statistical analysis Different Radiosensitivity. Tissue samples from 12 cervical in this study. cancers (6 radiosensitive and 6 radioresistant) and 5 normal Sodium Bisulfite Modification of DNA and Methyla- cervices were selected for apoptosis array experiment. Gene tion-Specific PCR. Genomic DNA was prepared from the expression patterns were compared between cancers and nor- tissue specimens and the cultured cells using conventional pro- mals, and genes that differentially expressed were identified in teinase K digestion and phenol/chloroform extraction method. radiosensitive and radioresistant cancers. p73 gene showed an The method for sodium bisulfite modification of DNA was increased expression in radiosensitive cancers but reduced or described previously (29). Briefly, genomic DNA (1 ␮g) was even absent expression in radioresistant samples (Fig. 1A). This denatured in NaOH and treated with sodium bisulfite and hyd- observation was then confirmed by the semiquantitative reverse roquinone. Sodium bisulfite converts unmethylated cytosine to transcription-PCR (Fig. 1B). Because the specific primers were uracil while leaving the methylated cytosine intact. This allows flanking from exon 1 to 3 of the p73 gene, the PCR amplified their differentiation by methylation-specific PCR. product was the full-length TAp73. Subsequently, Western blot The methylation status of the p73 gene was determined by analysis also demonstrated that p73 protein expression was specific primer sequences which were designed to amplify the concomitant with the RNA expression level for the samples 5Ј-CpG island (18, 19, 21, 22, 30). Unmethylated and methyl- studied and was higher in radiosensitive cancers (Fig. 1, B and ated fragments were amplified under different PCR conditions C). Such findings suggested that p73 expression might be re- (Table 1). Direct sequencing on bisulfite-treated tumor DNA lated to radiosensitivity of cervical cancer cells. To further was performed to confirm the result of the CpG methylation elucidate the potential correlation between the p73 expression sites of p73 gene. and the radiosensitivity of cervical cancer cells, the study was HPV Detection and Typing. DNA from 92 cervical carried out on more cervical cancer specimens from patients cancer samples were examined for HPV infection. Specific with known radiotherapeutic outcome. primers for HPV-16, HPV-18, HPV-31, HPV-52, and HPV-58, The p73 protein expression was evaluated in 59 cervical as well as consensus primers E6 were used in PCR amplification cancers and 68 normal cervices using immunohistochemistry (Table 1). The E6 consensus primers were used for screening (Fig. 2, A and B). Majority of the cancer cases (58 of 59, 98.3%) and positive samples were additionally typed by the HPV type- exhibited p73 expression, whereas nearly half of the normal specific primers. cervices (33 of 68, 48.5%) displayed no p73 expression (Table Statistical Analysis. Statistical analysis was performed 2). Only 3 of 68 (4.4%) normal tissues showed strong p73 using Statistical Package for the Social Sciences 10.0 (SPSS, expression (Ͼ50% of normal epithelia cells showed positive Inc., Chicago, IL). ␹2 and Kaplan-Meier tests were used for the p73 staining), and a significant difference (␹2 test, P Ͻ 0.001) comparison and survival analysis, respectively. P of Ͻ0.05 was was found when compared with cancer group. considered to be statistically significant. Regarding patient survival, increased p73 expression was

expression (Ͻ50%) were associated with decreased p21 expression (␹2 test, P ϭ 0.001) (Table 4). However, no correlation was found between p73 and Bax expressions in cancers (results not shown). Methylation-Dependent p73 Expression in Cervical Cancers and Normal Cervices. Epigenetic silencing of p73 gene via methylation of promoter and exon one CpG islands has been demonstrated in some tumors. To understand whether hypermethylation leads to reduction or absence of p73 expression in cervical cancers, the methylation status of the CpG island of p73 gene was evaluated in 103 cervical cancers and 59 matched normal controls, as well as 65 normal cervices (Fig. 4A). All cancer samples showed unmethylated band, which may be because of the contamination of normal cells. Direct sequencing of methylation-positive and -negative PCR products confirmed the methylated and unmethylated alleles in CpG island of p73 gene (Fig. 4B). It was found that p73 was frequently methylated in 38.8% of cervical cancers (40 of 103) versus 3.2% in normal controls (4 of 124), including both matched controls and normal cervices (␹2 test, P Ͻ 0.001; Table 5). Consistently, p73 expression was down-regulated in most of cancer samples with p73 hypermethylation. A significant association was observed between decreased p73 expression and p73 hypermethylation (␹2 test, P Ͻ 0.001; Table 5). These data indicated that Fig. 1 Differential expression of p73 gene in normal cervix, radiosen- DNA methylation might be an important mechanism in regu- sitive and radioresistant cervical cancers demonstrated by cDNA ex- lating the expression of the p73 gene in cervical cancers. pression array (A), reverse transcription-PCR (B), and Western blot (C). In relation to radiosensitivity of cancer tissues, 58% of Circled gene 1, actin; circled gene 2, p73. M, marker; N, normal; radioresistant tissues (29 of 50) had p73 methylation, which was T1–T6, radioresistant cancers; T7–T12, radiosensitive cancers; C4-1, positive control for p73 expression. significantly higher than radiosensitive tissues (11 of 53, 20.8%;

significantly associated with a better survival of cervical cancer patients (log-rank test, P Ͻ 0.001; Fig. 3). More importantly, there was significantly increased p73 expression found in radiosensitive cancer samples (20 of 26, 76.9%) when compared with radioresistant samples (8 of 33, 24.2%; ␹2 test, P Ͻ 0.001; Table 3). Taken together, p73 expression was likely to be related to radiosensitivity of cervical cancer cells. Expression Patterns of p21 and Bax in Cervical Can- cers and Normal Cervices. To investigate the possible involvement of p73 downstream genes, the protein expressions of p21 and Bax genes were also examined in the same batch of cervical cancer and normal cervical samples by immunohistochemistry (Fig. 2C–F). All cancer samples showed positive p21 expression, but the immunoreactivity was mainly Ͻ50% (Table 2). A similar staining pattern was also found in normal cervices, whereas 26.9% of samples (18 of 67) were p21 negative. No significant difference was found between cancers and normal cervices (␹2 test, P Ͼ 0.05). Similar to p21, positive Bax staining was found in most of cervical cancers, and 78% of cancer samples (46 of 59) had the Bax immunoreactivity Ͻ 50% (Table 2). In normal cervices, 65.7% of the cases (44 of 67) had Fig. 2 Immunohistochemical analysis of p73, p21, and Bax expres- positive Bax expression, but most of the expression was Ͻ50%, sions in cervical cancer and normal cervix. A, p73 staining was homo- which was similar to cancer cases. Hence, there was no signif- geneous, involving all of the cancer cells, whereas (B) the immunore- icant difference of Bax expression found between cancers and activity was less frequently found in normal epithelial cells. C, p21 ␹2 Ͼ staining was localized mainly in well-differentiated cancer cells, and (D) normal cervical tissues ( test, P 0.05). in supra-basal and some intermediate layers of normal cervix. E, Bax p73 protein expression was compared with that of p21 and staining was also homogeneous in cancer cells, and (F) mainly in basal Bax in cervical cancers. Cancer samples with decreased p73 and suprabasal layers of normal cervix.

Table 2 Immunohistochemical analysis of p73, p21, and Bax in cervical cancers and normal cervices p73 p21 Bax Immunohistochemistry Tumor Normal Tumor Normal Tumor Normal Positive Ͼ 50%a 28 (47.5%) 3 (4.4%) 9 (15.3%) 4 (6.0%) 12 (20.3%) 12 (17.9%) Յ 50%b 30 (50.8%) 32 (47.1%) 50 (84.7%) 45 (67.1%) 46 (78.0%) 32 (47.8%) Negativeb 1 (1.7%) 33 (48.5%) 0 (0.0%) 18 (26.9%) 1 (1.7%) 23 (34.3%) Total 59 68 59 67 59 67 ␹2 test (a versus b) P Ͻ 0.001 P Ͼ 0.05 P Ͼ 0.05

␹2 test, P Ͻ 0.001; Table 5). Moreover, p73 hypermethylation Table 4 p73 expression in association with p21 expression in a was also found to correlate with the adverse outcome of the cervical cancers patients (log-rank test, P Ͻ 0.001; Fig. 5). Therefore, p73 p21 hypermethylation may also carry prognostic significance in cer- IHCb Յ 50% Ͼ 50% vical cancer patients after radiotherapy. Ͼ To further strengthen our hypothesis, an in vitro study was p73 50% 19 9 p73 Յ 50% 31 0 performed on three cervical cancer cell lines. Methylated p73 a ␹2 ϭ gene was detected in two cervical cancer cell lines, SiHa (com- test, P 0.001. b IHC, immunohistochemistry. plete methylation) and Caski (partial methylation), and both cell lines showed absence of p73 expression. Methylated p73 was not found in C4-1 cell line, which had detectable p73 expression (Fig. 6A). This observation was concomitant with our findings duced expression of p73. The demethylation agent, 5-aza-2Ј- in the tissue samples that methylation was correlated with re- deoxycytidine, being able to alter the CpG methylation, was used to treat SiHa and Caski cells to assess the methylation effect on p73 gene expression. After 3 days of treatment with 5-aza-2Ј-deoxycytidine, SiHa and Caski expressed p73 mRNA and protein levels comparable with untreated C4-1 cell (Fig. 6B). This again demonstrated that DNA hypermethylation was important for regulating the expression of p73 gene. HPV Infection in Cervical Cancers. High-risk HPV infections were detected in 79 of 92 (85.9%) cancer samples, and 72 of them (78.3%) were HPV type 16 or/and 18 positive, and 7 of them (7.6%) were other high-risk type, including HPV-31, HPV-52, and HPV-58. Thirteen cancer samples showed negative HPV result. No correlation between p73 expression and HPV infection was observed (␹2 test, P ϭ 0.61). Moreover, HPV status correlated neither with tumor radiosensitivity nor with patient survival (␹2 test, P ϭ 0.56 and P ϭ 0.98, respectively).

DISCUSSION Fig. 3 Cumulative patient survival as a function of p73 expression was p73 is a member of the p53 tumor suppressor protein stratified as more than and less than or equal to 50% of positive staining. family, which is implicated in development, cellular differentiation, apoptosis, and tumor suppression (8). However, the type of stimuli inducing p73 and the mechanism of activity regula- Table 3 p73 expression in RR and RS cervical cancersa,b tion are yet to be identified. In this study, we demonstrated the overexpression of p73 gene in cervical cancers and, more importantly, in radiosensitive cancers that had significantly higher p73 expression than radioresistant cancers. Furthermore, p73 expression also had prognostic significance in predicting the outcome of patients after radiotherapy. To our knowledge, this is the first evidence showing an association between the p73 expression and the radiosensitivity of cancer cells. These findings suggested that p73 might be important in regulating radi- a ␹2 test, P ϭ 0.001. ation response of cervical cancer cells. However, its function b RR, radioresistant, RS, radiosensitive, IHC, immunohistochem- and the underlying mechanism need to be further elucidated. istry. Similar to p53, p73 can elicit either cell cycle arrest or

Fig. 4 Methylation and expression analysis of the p73 gene. A, methylation-specific PCR analysis of four representative paired cervical cancers (T) and normal controls (N). M and U indicates, respectively, the methylated and unmethylated fragments. Posi- tive control (Pos): placenta DNA was in vitro methylated at the CpG islands by SssI methyltrans- ferase. Negative control (Neg): the untreated placenta DNA. B, direct sequencing of 5Ј-CpG island methylation of p73 gene. The top panel showed the original sequence of the p73 exon 1. The methylated CpG dinucleotides were found in the tumor DNA (middle panel), whereas unmethylated CpG dinucleotides were demonstrated in normal control DNA (bottom panel).

Table 5 Methylation analysis of p73 gene in normal controls and identical to those described for p53 (8). p73 is able to drive, with cervical cancers and radioresistant and radiosensitive cancers, as well different activities, the transcription of several apoptotic effec- as the correlation with p73 expression in cancers tors that are also induced by p53, including p21, GADD45, Bax, Methylation (ϩ) Methylation (Ϫ) Total ␹2 NOXA, p53AIP1, and CD95 (13, 32–34). In the present study, Normal 4 (3.2%) 120 (96.8%) 124 P Ͻ 0.001 p21 expression was detected in all cancer samples, but the Cancer 40 (38.8%) 63 (61.2%) 103 expression level of them was mainly Ͻ50%. An association was Radioresistant 29 (58.0%) 21 (42.0%) 50 P Ͻ 0.001 found between the expressions of p73 and p21. It had previously Radiosensitive 11 (20.8%) 42 (79.2%) 53 been reported that the level of p21 induced by p73 was several p73 Ͼ 50% 5 15 20 P Ͻ 0.001 Յ 50% 23 4 27 times less than that by p53 (13). On the other hand, Bax transactivation via p73 was still controversial (13, 35). Our results showed no significant correlation between the expressions of Bax and p73. Substantially, Bax might not be the effective downstream gene of p73 in cervical cancer. Additional studies on p73-responsive genes may shed some light on the p73 function in regulating cellular response to radiation.

Fig. 5 Cumulative patient survival as a function of p73 methylation stratified as methylated or unmethylated DNA.

Fig. 6 Demethylation study in cancer cell lines. A, methylation- specific PCR analysis of C4-1 and pre- and post-5-aza-2Ј-deoxycytidine-treated SiHa and Caski cells. 5-Aza-2Ј-deoxycytidine concentra- apoptosis in response to DNA damage such as radiation (6, 7, tion was applied at 1.0, 3.0, and 5.0 ␮M. DMSO represented the negative control for 5-aza-2Ј-deoxycytidine. B, detection of p73 mRNA and 31). However, the molecular mechanisms by which p73 triggers protein expressions in C4-1 and pre- and post-5-aza-2Јdeoxycytidine- cell death have not been studied in great detail. There is an treated SiHa and Caski cells by reverse transcription-PCR and Western overall assumption that p73 adapts pathways that are almost blot, respectively.

The similarity of p73 to p53 suggested that p73 might be a tions, but no correlation was observed between the infections new candidate tumor suppressor gene (6). However, it has thus and p73 expression, suggesting that p73 response was unlikely far not been classified as a classical two-hit tumor suppressor to be affected by HPV oncoproteins in cervical cancer. We because its mutations or homozygous deletion is absent or very anticipated that the p73 gene might play a role, in p53-inde- rarely found (14, 15, 36–38). It has been suggested that p73 was pendent manner, in triggering apoptosis or cell cycle arrest an imprinted gene, with loss of protein expression in cancer effectors in p53-deficient cervical cancer cells in response to through selective loss of the normally expressed allele rather radiation. The possible role of p73 in modulating radiation than an inactivating mutation. However, the fact that the p73 response will be further investigated. gene has monoallelic or biallelic expression in different tissue In conclusion, our study demonstrated a significant asso- types (6, 39) makes it more difficult to understand the role of ciation between the overexpression of p73 and the cellular this gene in cancer. radiosensitivity in cervical cancers after radiotherapy. There- In the present study, the epigenetic modification of p73 via fore, p73 may play an important role in regulating the cellular CpG island hypermethylation represents a critical alternative response of cervical cancer to radiotherapy. The underlying mechanism for inactivation of this gene in cervical cancer. The mechanism on how p73 signaling the apoptotic pathway in the methylation analysis showed a high incidence of p73 hyper- consequence of irradiation needs further investigation. Aberrant methylation (38.8%) in cervical cancer. This hypermethylation methylation was found to be an important epigenetic mechanism seemed to be tumor-specific because it was rarely observed in in contributing to the inappropriate silencing of p73 gene ex- the normal controls studied (3.2%), and it was significantly pression in cervical cancer. A better understanding of epigenetic correlated with decreased or loss of p73 expression in cancers. mechanisms leading to the suppression of the gene, subse- In addition, radioresistant cancer samples had significantly quently to radioresistance, may not only allow us to delineate higher methylation rate than radiosensitive ones. In vitro de- the function of p73 in radiosensitivity of cancer cells but may methylation assay was successful in restoring the expression of also enable the development of new cancer therapeutic agents. p73 on the cervical cancer cell lines that were previously found On the clinical aspect, p73 expression appears to be a potential to have methylated p73 and lack of p73 mRNA and protein prognostic marker in evaluating the treatment regimens and expressions. Such results additionally confirmed the role of predicting the outcome of the cervical cancer patients after hypermethylation in silencing of p73 gene expression in cervical radiotherapy. cancer. Epigenetic silencing of p73 gene via promoter and exon 1 hypermethylation was a common event in some leukemias, lymphomas, and brain tumors, as well as ovarian cell lines ACKNOWLEDGMENTS (19–25) but not in cancers of breast, renal, and colon (19). We thank Dr. Elly S. W. Ngan for helpful suggestions and critique Overall findings on our methylation study suggested that hyper- of the manuscript. methylation might also be one of the important mechanisms in suppressing the p73 gene expression in cervical cancer. How- REFERENCES ever, because a small proportion of the cancer samples with 1. Berek J, Hacker N. In: J. Berek and N. Hacker, editors. Practical decreased p73 gene expression were not found to have aberrant gynecology oncology, 3rd ed., Chp. 9, Philadelphia: Lippincott, Wil- methylation pattern, additional mechanisms and/or factors may liams & Wilkins; 2000. p. 345–406. be involved leading to loss of p73 expression. 2. Liu SS, Tsang BK, Cheung et al. Anti-apoptotic proteins, apoptotic Cervical cancer develops through a multistep process and proliferative parameters and their prognostic significance in cervical through cervical cancer precursor lesions that are known to carcinoma. Eur J Cancer 2001;37:1104–10. originate after HPV infection (40). HPV infection was found in 3. Dyson N, Howley PM, Munger K, Harlow E. The human papilloma Ͼ virus-16 E7 oncoprotein is able to bind to the retinoblastoma gene 85% of cervical cancers (41). High-risk HPV types 16 and 18 product. Science (Wash. DC) 1989;243:934–7. carry two major oncoproteins E6 and E7, which bind and 4. Werness BA, Levine AJ, Howley PM. Association of human papil- inactivate p53 and pRb tumor suppressors for ubiquitin-medi- lomavirus types 16 and 18 E6 proteins with p53. Science (Wash. DC) ated degradation (3–5, 42). Loss of p53 function leads to im- 1990;248:76–9. pairment in the control of cell cycle and induction of apoptosis 5. Kessis TD, Slebos RJ, Nelson WG, et al. Human papillomavirus 16 in response to DNA damage. This makes cervical cancer unique E6 expression disrupts the p53-mediated cellular response to DNA among other cancers in that the predominant mechanism for damage. Proc Natl Acad Sci USA 1993;90:3988–92. inactivation of p53 is gene mutation. It is important to know 6. Kaghad M, Bonnet H, Yang A, et al. Monoallelically expressed gene related to p53 at 1p36, a region frequently deleted in neuroblastoma and whether HPV oncoproteins E6 and E7 could inactivate p73 other human cancers. Cell 1997;90:809–19. function similar to p53. Some studies have found controversial 7. Jost CA, Marin MC, Kaelin WG Jr. p73 is a simian [correction of results. Park et al. (43) had demonstrated that HPV E6 inter- human] p53-related protein that can induce apoptosis. Nature (Lond.) acted with p73 both in vivo and in vitro and functionally inac- 1997;389:191–4. tivated p73. On the other hand, Marin et al. (44) have reported 8. Melino G, De Laurenzi V, Vousden KH. p73: friend or foe in that viral oncoproteins, including adenovirus E1B, SV40 T, and tumorigenesis Nat Rev Cancer 2002;2:605–15. HPV E6, did not interact with p73 protein. In fact, p73␤ induced 9. Agami R, Blandino G, Oren M, Shaul Y. Interaction of c-Abl and p73␣ and their collaboration to induce apoptosis. Nature (Lond.) 1999; growth inhibition and apoptosis in cancer cells that produce E6 399:809–13. (45). Furthermore, HPV E7 was found to transactivate p73 in 10. Gong JG, Costanzo A, Yang HQ, et al. The tyrosine kinase c-Abl cell lines and primary human keratinocytes (46). In the present regulates p73 in apoptotic response to cisplatin-induced DNA damage. study, ϳ86% of the cancer samples had detectable HPV infec- Nature (Lond.) 1999;399:806–9.

11. Yuan ZM, Shioya H, Ishiko T, et al. p73 is regulated by tyrosine 30. Siu LL, Chan JK, Wong KF, Kwong YL. Specific patterns of gene kinase c-Abl in the apoptotic response to DNA damage. Nature (Lond.) methylation in natural killer cell lymphomas: p73 is consistently in- 1999;399:814–7. volved. Am J Pathol 2002;160:59–66. 12. Yang A, Kaghad M, Wang Y, et al. p63,ap53 homolog at 3q27-29, 31. De Laurenzi V, Costanzo A, Barcaroli D, et al. Two new p73 splice encodes multiple products with transactivating, death-inducing, and variants, gamma and delta, with different transcriptional activity. J Exp dominant-negative activities. Mol Cell 1998;2:305–16. Med 1998;188:1763–8. 13. Zhu J, Jiang J, Zhou W, Chen X. The potential tumor suppressor 32. Levrero M, De Laurenzi V, Costanzo A, Gong J, Wang JY, Melino p73 differentially regulates cellular p53 target genes. Cancer Res 1998; G. The p53/p63/p73 family of transcription factors: overlapping and 58:5061–5. distinct functions. J Cell Sci 2000;113(Pt 10):1661–70. 14. Nomoto S, Haruki N, Kondo M, et al. Search for mutations and 33. Flores ER, Tsai KY, Crowley D, et al. p63 and p73 are required for examination of allelic expression imbalance of the p73 gene at 1p36.33 in human lung cancers. Cancer Res 1998;58:1380–3. p53-dependent apoptosis in response to DNA damage. Nature (Lond.) 2002;416:560–4. 15. Takahashi H, Ichimiya S, Nimura Y, et al. Mutation, allelotyping, and transcription analyses of the p73 gene in prostatic carcinoma. 34. Costanzo A, Merlo P, Pediconi N, et al. DNA damage-dependent Cancer Res 1998;58:2076–7. acetylation of p73 dictates the selective activation of apoptotic target 16. Ichimiya S, Nimura Y, Kageyama H, et al. p73 at chromosome genes. Mol Cell 2002;9:175–86. 1p36.3 is lost in advanced stage neuroblastoma but its mutation is 35. Steegenga WT, Shvarts A, Riteco N, Bos JL, Jochemsen AG. infrequent. Oncogene 1999;18:1061–6. Distinct regulation of p53 and p73 activity by adenovirus E1A, E1B, and 17. Han S, Semba S, Abe T, et al. Infrequent somatic mutations of the E4orf6 proteins. Mol Cell Biol 1999;19:3885–94. p73 gene in various human cancers. Eur J Surg Oncol 1999;25:194–8. 36. Kovalev S, Marchenko N, Swendeman S, LaQuaglia M, Moll UM. 18. Banelli B, Casciano I, Romani M. Methylation-independent silenc- Expression level, allelic origin, and mutation analysis of the p73 gene in ing of the p73 gene in neuroblastoma. Oncogene 2000;19:4553–6. neuroblastoma tumors and cell lines. Cell Growth Differ 1998;9:897– 19. Corn PG, Kuerbitz SJ, van Noesel MM, et al. Transcriptional 903. silencing of the p73 gene in acute lymphoblastic leukemia and Burkitt’s 37. Mai M, Huang H, Reed C, et al. Genomic organization and muta- lymphoma is associated with 5Ј CpG island methylation. Cancer Res tion analysis of p73 in oligodendrogliomas with chromosome 1 p-arm 1999;59:3352–6. deletions. Genomics 1998;51:359–63. 20. Kawano S, Miller CW, Gombart AF et al. Loss of p73 gene 38. Sunahara M, Ichimiya S, Nimura Y, et al. Mutational analysis of the expression in leukemias/lymphomas due to hypermethylation. Blood p73 gene localized at chromosome 1p36.3 in colorectal carcinomas. Int 1999;94:1113–20. J Oncol 1998;13:319–23. 21. Martinez-Delgado B, Melendez B, Cuadros M, et al. Frequent 39. Mai M, Qian C, Yokomizo A, et al. Loss of imprinting and inactivation of the p73 gene by abnormal methylation or LOH in allele switching of p73 in renal cell carcinoma. Oncogene 1998;17: non-Hodgkin’s lymphomas. Int J Cancer 2002;102:15–9. 1739– 41. 22. Garcia-Manero G, Bueso-Ramos C, Daniel J, Williamson J, Kan- 40. Walboomers JM, Jacobs MV, Manos MM, et al. Human papillo- tarjian HM, Issa JP. DNA methylation patterns at relapse in adult acute lymphocytic leukemia. Clin Cancer Res 2002;8:1897–903. mavirus is a necessary cause of invasive cervical cancer worldwide. J Pathol 1999;189:12–9. 23. Watanabe T, Huang H, Nakamura M, et al. Methylation of the p73 gene in gliomas. Acta Neuropathol (Berl.) 2002;104:357–62. 41. Ngan HY, Stanley M, Liu SS, Ma HK. HPV and p53 in cervical cancer. Genitourin Med 1994;70:167–70. 24. Dong S, Pang JC, Hu J, Zhou LF, Ng HK. Transcriptional inactivation of TP73 expression in oligodendroglial tumors. Int J Cancer 42. zur Hausen H. Papillomaviruses causing cancer: evasion from host- 2002;98:370–5. cell control in early events in carcinogenesis. J Natl Cancer Inst (Be- 25. Chen CL, Ip SM, Cheng D, Wong LC, Ngan HY. p73 gene thesda) 2000;92:690–8. expression in ovarian cancer tissues and cell lines. Clin Cancer Res 43. Park JS, Kim EJ, Lee JY, Sin HS, Namkoong SE, Um SJ. Func- 2000;6:3910–5. tional inactivation of p73, a homolog of p53 tumor suppressor protein, 26. International Federation of Gynecology and Obstetrics. Cancer by human papillomavirus E6 proteins. Int J Cancer 2001;91:822–7. committee. Staging announcement. Gynecol Oncol 1986;25:383–5. 44. Marin MC, Jost CA, Irwin MS, DeCaprio JA, Caput D, Kaelin WG 27. Liu SS, Cheung AN, Ngan HY. Differential gene expression in Jr. Viral oncoproteins discriminate between p53 and the p53 homolog cervical cancer cell lines before and after ionizing radiation. Int J Oncol p73. Mol Cell Biol 1998;18:6316–24. 2003;22:1091–9. 45. Prabhu NS, Somasundaram K, Satyamoorthy K, Herlyn M, El 28. Ngan HY, Tsao SW, Liu SS, Stanley M. Abnormal expression and Deiry WS. p73␤, unlike p53, suppresses growth and induces apoptosis mutation of p53 in cervical cancer: a study at protein, RNA and DNA of human papillomavirus E6-expressing cancer cells. Int J Oncol 1998; levels. Genitourin Med 1997;73:54–8. 13:5–9. 29. Chan KY, Ozcelik H, Cheung AN, Ngan HY, Khoo US. Epigenetic 46. Brooks LA, Sullivan A, O’Nions J, et al. E7 proteins from onco- factors controlling the BRCA1 and BRCA2 genes in sporadic ovarian genic human papillomavirus types transactivate p73: role in cervical cancer. Cancer Res 2002;62:4151–6. intraepithelial neoplasia. Br J Cancer 2002;86:263–8.

Downloaded from clincancerres.aacrjournals.org on October 1, 2021. © 2004 American Association for Cancer Research. Correction Clinical Cancer Correction: p73 Expression Is Associated Research with the Cellular Radiosensitivity in Cervical Cancer after Radiotherapy

In this article (Clin Cancer Res 2004;10:3309–16), which was published in the May 15, 2004 issue of Clinical Cancer Research (1), the author presented us with a replacement image for Fig. 6B, stating that several incorrect Western blot images were mistakenly included in the final figure. AACR Publications staff members reviewed all figures in the article and, through a posting on PubPeer, discovered potential reuse within the TP73 reverse transcription PCR (RT-PCR) results shown in Fig. 1B and methylation-specific PCR results shown in Fig. 4A. Because the original images were no longer available, the authors repeated the experiments, and the results were consistent with the published findings.

Radioresistant cancer Radiosensitive cancer

M N T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 T11 T12

p73

GAPDH

Figure 1B. The gel picture of p73 mRNA expressions in radioresistant and radiosensitive cervical cancers.

Pos T1 N1 T2 N2 T3 N3 T4 N4 Neg

MMUMUMUMU MUMU MUMU U

p73 Methylation

Figure 4A. The gel picture of p73 methylation study.

C4-1 SiHa Caski 5-aza (µM) Pre 1.0 3.0 5.0 DMSO Pre 1.0 3.0 5.0 DMSO p73 mRNA

GAPDH

p73 Protein

Actin

Figure 6B. The gel picture of p73 demethylation study.

www.aacrjournals.org 1297 Correction

Specific details of the repeated experiments are as follows: In Fig. 1B, the RT-PCR was performed on RNAs extracted from six radioresistant and six radiosensitive cervical cancer samples with the same p73 primers and PCR conditions described in the Materials and Methods section of the published article. In Fig. 4A, genomic DNA of four cervical cancer samples and normal control samples were bisulfate-treated and PCR-amplified with p73 methylation and unmethylation primers, respectively, following the procedure described in the Materials and Methods section of the published article. Because the authors had only mini-gel apparatus available to them, the PCR products had to be resolved in two 10% acrylamide gels (first gel: Pos, T1M, T1U, N1M, N1U, T2M, T2U, N2M, N2U; second gel: T3M, T3U, N3M, N3U, T4M, T4U, N4M, N4U, Neg). Thus, the corrected Fig. 4A gel image contains two gel pictures. In Fig. 6B, the authors repeated the experiments in the SiHa and Caski cell lines. Both cell lines were treated with 5-aza 20-deoxycytidine of 1, 3, and 5 mM/L or DMSO alone following the procedure described in the Materials and Methods section of the published article. The mRNA and protein expressions of p73 were detected.

The corrected versions of Figs. 1B, 4A, and 6B are above. The results and conclusions put forth in this article remain unchanged. The authors regret these errors.

Reference 1. Liu SS, Leung RC, Chan KY, Chiu PM, Cheung AN, Tam KF, et al. p73 expression is associated with the cellular radiosensitivity in cervical cancer after radiotherapy. Clin Cancer Res 2004;10:3309–16.

Published online March 1, 2016. doi: 10.1158/1078-0432.CCR-15-2881 2016 American Association for Cancer Research.

1298 Clin Cancer Res; 22(5) March 1, 2016 Clinical Cancer Research p73 Expression Is Associated with the Cellular Radiosensitivity in Cervical Cancer after Radiotherapy

Stephanie Si Liu, Rebecca Ching-Yu Leung, Kelvin Yuen-Kwong Chan, et al.

Clin Cancer Res 2004;10:3309-3316.

Updated version Access the most recent version of this article at: http://clincancerres.aacrjournals.org/content/10/10/3309

Cited articles This article cites 43 articles, 15 of which you can access for free at: http://clincancerres.aacrjournals.org/content/10/10/3309.full#ref-list-1

Citing articles This article has been cited by 8 HighWire-hosted articles. Access the articles at: http://clincancerres.aacrjournals.org/content/10/10/3309.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://clincancerres.aacrjournals.org/content/10/10/3309. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.