Accessibility Differentiation Controls CIITA Promoter Epigenetic

Epigenetic Regulation during B Cell Differentiation Controls CIITA Promoter Accessibility

This information is current as Myesha R. Green, Hyesuk Yoon and Jeremy M. Boss of September 26, 2021. J Immunol 2006; 177:3865-3873; ; doi: 10.4049/jimmunol.177.6.3865 http://www.jimmunol.org/content/177/6/3865 Downloaded from

References This article cites 84 articles, 39 of which you can access for free at: http://www.jimmunol.org/content/177/6/3865.full#ref-list-1

Why The JI? Submit online. http://www.jimmunol.org/

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

*average by guest on September 26, 2021

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2006 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

Epigenetic Regulation during B Cell Differentiation Controls CIITA Promoter Accessibility1

Myesha R. Green, Hyesuk Yoon, and Jeremy M. Boss2

B cell to plasma cell maturation is marked by the loss of MHC class II expression. This loss is due to the silencing of the MHC class II transcriptional coactivator CIITA. In this study, experiments to identify the molecular mechanism responsible for CIITA silencing were conducted. CIITA is expressed from four promoters in humans, of which promoter III (pIII) controls the majority of B cell-mediated expression. Chromatin immunoprecipitation assays were used to establish the histone code for pIII and determine the differences between B cells and plasma cells. Speciﬁc histone modiﬁcations associated with accessible promoters and transcriptionally active genes were observed at pIII in B cells but not in plasma cells. A reciprocal exchange of histone H3 lysine 9 acetylation to methylation was also observed between B cells and plasma cells. The lack of histone acetylation correlated with

an absence of transcription factor binding to pIII, particularly that of Sp1, PU.1, CREB, and E47. Intriguingly, changes in Downloaded from chromatin architecture of the 13-kb region encompassing all CIITA promoters showed a remarkable deﬁcit in histone H3 and H4 acetylation in plasma cells, suggesting that the mechanism of silencing is global. When primary B cells were differentiated ex vivo, most of the histone marks associated with pIII activation and expression were lost within 24 h. The results demonstrate that CIITA silencing occurs by controlling chromatin accessibility through a multistep mechanism that includes the loss of histone acetylation and transcription factor binding, and the acquisition of repressive histone methylation marks. The Journal of Immunology, 2006,

177: 3865–3873. http://www.jimmunol.org/

he MHC class II (MHC-II)3 molecule presents exog- CIITA is transcriptionally regulated by four separate promoters enously derived Ag to CD4ϩ T cells to initiate and reg- (pI, pII, pIII, and pIV), each transcribing a unique first exon that T ulate adaptive immune responses (1–3). MHC-II mole- will ultimately encode distinct CIITA isoforms (21). Differential cules are cell surface glycoproteins constitutively expressed on the expression of the various CIITA isoforms contributes to CIITA’s surface of professional APCs, including macrophages, dendritic ability to regulate MHC-II expression in a cell type and develop- cells (4, 5), thymic epithelia, and B cells (6). By exposure to the mentally specific manner. Promoter pI drives CIITA expression in immune cytokine IFN-␥, MHC-II expression can also be induced splenic dendritic cells and macrophages (22, 23). Promoter pII is on most non-APCs, such as fibroblasts (7, 8). Expression of expressed at very low levels in humans, and little is known about by guest on September 26, 2021 MHC-II genes is transcriptionally regulated by a group of tran- its biological significance. Mice, however, lack pII. Promoter pIV scription factors that bind a conserved regulatory region located controls IFN-␥-inducible CIITA expression in most cell types (21, 150 bp upstream of the transcription start site. These factors, in- 24, 25). Finally, pIII primarily confers developmental and consti- ϩ cluding regulatory factor X (RFX) (9–12), CREB (13, 14), and tutive CIITA expression in B cells (26), as well as human CD4 NF-Y (15) are required for MHC-II gene expression. Although the T cells (27, 28), monocytes, and plasmacytoid dendritic cells (29). binding of these factors to the MHC-II promoters is necessary, it Low levels of CIITA transcripts from pIV can also be detected in is not sufficient for expression. CIITA, a non-DNA-binding tran- B cells (21, 24, 30). scriptional coactivator, is required for class II expression (16, 17). MHC-II expression is developmentally regulated in B cells (31, CIITA interacts directly with NF-Y, CREB, and RFX, while re- 32) and can be observed as early as the pre-B cell stage (33–35). cruiting histone acetyltransferases such as CBP, as well as other MHC-II expression increases upon B cell maturation and is con- basal transcriptional machinery to the promoters of MHC-II genes stitutively expressed in mature B cells. During the B cell to plasma (reviewed in Refs. 18–20). cell transition both MHC-II and CIITA gene expression are lost (6, 36–38). Transfection of CIITA into plasma cells can restore MHC-II expression (37), suggesting that silencing of MHC-II is solely due to the silencing of CIITA. Because B cell-specific ex- Department of Microbiology and Immunology, Emory University School of Medi- pression is controlled by pIII, it is the regulation of expression at cine, Atlanta, GA 30322 this promoter that is responsible for MHC-II silencing during this Received for publication April 25, 2006. Accepted for publication June 29, 2006. transition. The costs of publication of this article were defrayed in part by the payment of page CIITA pIII is regulated by a 5Ј promoter proximal regulatory charges. This article must therefore be hereby marked advertisement in accordance region extending Ϫ322 bp upstream to ϩ 124 bp downstream of with 18 U.S.C. Section 1734 solely to indicate this fact. the transcription start site (21, 26). In vivo genomic footprinting 1 This work was supported by a National Research Service Award F31 GM 20675 (to M.G.) and Grant AI34000 (to J.M.B.) from the National Institutes of Health. analyses identified several cis-regulatory elements termed site A, 2 Address correspondence and reprint requests to Dr. Jeremy M. Boss, Department of site B, site C, and activation response elements (ARE)1 and ARE2 Microbiology and Immunology, Room 3131, Rollins Research Center, Emory Uni- (39). These elements were occupied in B cells but not in plasma versity School of Medicine, 1510 Clifton Road, Atlanta, GA 30322. E-mail address: cells, suggesting either the loss of the factors that interact with [email protected] these elements or a loss in accessibility of this region to factor 3 Abbreviations used in this paper: MHC-II, MHC class II; Blimp, B late-induced maturation protein; ChIP, chromatin immunoprecipitation; HDAC, histone deacety- binding. Reporter assays and mutational studies indicated that lase; RFX, regulatory factor X; ARE, activation response element. ARE1 and ARE2 are critical for pIII transcriptional activation in

Copyright © 2006 by The American Association of Immunologists, Inc. 0022-1767/06/$02.00 3866 EPIGENETIC REGULATION OF CIITA both B cells and human T cells (39). An additional 5ЈUTR region, 10 mM HEPES, 1.0 mM sodium pyruvate, 0.05 mM 2-ME, and 10% heat- as well an E box upstream of site C, are required for maximal inactivated FBS. Primary splenocytes were obtained from 5- to 6-wk-old transcriptional activity in B cells. The CREB protein has been C57BL/6 mice. The use of animals for these experiments was approved by Ј Emory University Institutional Animal Care and Use Committee. B lym- shown to interact with ARE2 and the 5 UTR of pIII. In addition, phocytes were isolated by CD43 depletion using MACS beads (Miltenyi PU.1, IRF4, and E47 were shown to interact with site C, as well as Biotec). Cells were treated for 5 days with 20 ng/ML IL-2 (Sigma-Aldrich two E box elements to potentially confer B cell-specific expression or PeproTech), 10 ng/ML IL-5 (Sigma-Aldrich), and 20 ␮g LPS (Sigma- of pIII (40). Although it is suggested that ARE1 binds a TEF-2-like Aldrich) in RPMI 1640 medium with 2 mM L-glutamine, 1.5 g/L sodium bicarbonate, 4.5 g/L glucose, 10 mM HEPES, 1.0 mM sodium pyruvate, factor in vitro, in vivo evidence for such factors has not been and 0.05 mM 2-ME. presented. Originally identified as a B lymphocyte-induced maturation pro- Abs to transcription factors tein, Blimp1 (41) has been shown to function as a transcriptional Abs to modified histone residues, as well as the Ab to Sp1, were purchased repressor that controls in part the developmental fate of plasma from Upstate Biotechnology. PU.1, IRF4, and E47 Abs were purchased cells (41, 42). The human ortholog PRD1-BF1 was originally iden- from Santa Cruz Biotechnology. The rabbit Ab against CREB was previ- tified due to its ability to bind and repress the IFN-␤ promoter ously described (14). through the PRD1 site (43). When ectopically expressed, Blimp1 Chromatin immunoprecipitation (ChIP) assays can silence CIITA expression and was found associated with pIII ChIP assays were preformed as previously described (52). One-tenth of the DNA (44, 45). Blimp1 was also found to interact with members of chromatin isolated from 4 ϫ 107 cells was used for each immunoprecipi- the GROUCHO family of corepressors (46), as well as with G9a tation. The chromatin was precleared with protein A beads to avoid non- (47, 48). G9a catalyzes the dimethylation of histone H3 lysine 9 specific binding. Immunoprecipitation of specific chromatin was per- Downloaded from (49, 50), a mark associated with transcriptional silencing (re- formed overnight with 5 ␮g of each indicated Ab. The amount of viewed in Ref. 51). Thus, one potential mechanism by which CI- immunoprecipitated ChIP DNA was determined by quantitative real-time PCR through comparison to a five point genomic DNA standard curve ITA expression could be silenced during the transition between B established during each experiment for each primer pair. To average sam- cell to plasma cell is through the loss of epigenetic histone mod- ples between experiments and apply statistics, the ChIP immunoprecipi- ifications associated with gene activation and the gain of silencing tated DNA was normalized to 1/30 of the amount of input chromatin used in each assay. The data were then plotted as fold over the irrelevant Ab. In marks. Such changes would be predicted to have an impact on the http://www.jimmunol.org/ the transcription factor binding experiments, pIV primers were used as a accessibility of the pIII region to its cognate transcription factors. negative control. In the histone acetylation studies, HLA-DRA promoter Chromatin remodeling has been previously shown to play an im- primers (52) served as a positive control for acetylation, whereas HLA- portant role in CIITA expression during dendritic cell maturation DRA promoter primers for the MCP1 gene (53), which is not expressed, (22) and may therefore play a role during B cell differentiation. were used as a negative control. Each ChIP analysis was repeated a min- To investigate whether the above predictions with respect to imum of three times from independent chromatin preparations. The Student t test was used to determine whether the obtained values were statistically chromatin accessibility and histone modification changes occur significant. The primer sequences include: RealCIITApIII, 5Ј-TCACC during the B cell to plasma cell transition, the histone code asso- AAATTCAGTCCACAGTAAGG and 3Ј-GCCCCAAGCGGTCAGATT ciated with CIITA promoters was examined in model human and TC; RealtimepONE, 5Ј-GGTTCCCTCGTCCTGGTTTTCAC and 3Ј-AG murine cell lines. The results showed that in contrast to B cells, TTGTTCATGGCAGCCCTTGG; RealtimepTWO, 5Ј-CCGCCTCAGTT by guest on September 26, 2021 TCCCCATCTATAAAGTG and 3Ј-TGCCTCAGACGCCAGCCTCAAG; plasma cells displayed a general absence of gene activation marks and RealtimepFOUR, 5Ј-CACTGTGAGGAACCGACTGGAG and across the entire CIITA upstream region encompassing all four 3Ј-TGGAGCAACCAAGCACCTACTG. human promoters. At the lymphocyte-specific promoter pIII, H3 lysine 9 acetylation, which was present in B cells, was replaced Real-time RT-PCR analysis with a dimethyl mark in plasma cells, indicating a multistep mech- RNA was prepared by using TRIzol Reagent (Invitrogen Life Technolo- anism of gene silencing. Chromatin inaccessibility prevented the gies), and reverse transcription was conducted using the GeneAmp RNA binding of specific transcription factors to pIII in plasma cells, PCR kit (Applied Biosystems) according to the manufacturer’s instruc- tions. There was 2 ␮g of RNA used per sample. Each reaction contained a despite the fact that the factors were present at the same levels in parallel control with no reverse transcriptase. One-tenth of a reverse tran- both cell types. A time course of ex vivo B cell differentiation scriptase reaction mixture was used as a template in a real-time PCR. showed that the transcriptionally active histone marks are lost Real-time RT-PCR was performed as previously described (54). For each within 24 h of the process, indicating a rapid mechanism by which sample, a parallel PCR with primers for GAPDH transcripts was also per- CIITA expression is silenced. These data provide evidence that the formed as an input control. To compare samples, the results for all PCR assays were normalized to results obtained for the corresponding GAPDH silencing of CIITA during this transition encompasses a mecha- RT-PCR assays, providing a relative quantitation value. The sequences of nism that orchestrates the transition from an active chromatin state the primers used for real-time RT-PCR were as follows: HGAPDH, 5Ј- to a repressed and inaccessible state. CCATGGGGAAGGTGAAGGTCGGAGTC and 3Ј-GGTGGTGCAGGC ATTGCTGATG; HCIITA, 5Ј-CTGAAGGATGTGGAAGACCTGGGAA AGC and 3Ј-GTCCCCGATCTTGTTCTCACTC; HLA-DR, 5Ј-GAGTT Materials and Methods TGATGCTCCAAGCCCTCTCCCA and 3Ј-CAGAGGCCCCCTGCGTT Cell culture CTGCTGCAAT; HSyndecan1, 5Ј-GAGCAGGACTTCACCTTTGA and 3Ј-TTCGTCCTTCTTCTTCATGC; HPRDM1BF1, 5Ј-ACTTGCAACAA Raji B cells (CCL-86; American Type Culture Collection (ATCC)), a Bur- GGGCTTTAC and 3Ј-ACCTTGCATGGTATGGTTT; MGAPDH, 5Ј- kett’s lymphoma-derived cell line, were grown in RPMI 1640 medium CAGTATGACTCCACTCACGGCA and 3Ј-CCTTCTCCATGGTGGTGA (Mediatech) supplemented with 5% FBS (HyClone Laboratories), 5% bo- AGAC; MCIITA, 5Ј-GATGTGGAAGACCTGGATCGT and 3Ј-AAGA vine calf serum (HyClone Laboratories), 100 U/ml penicillin, 100 U/ml GAAGGCTGGAAGGATCTTT; I-A, 5Ј-GACGCAGCGCATACGGCTC streptomycin, and 0.29 mg/ml L-glutamine (Invitrogen Life Technologies). and 3Ј-CCGCCGCAGGGAGGTGCT; and MBLIMP1 5Ј-ATGGAGG NCI-H929 plasma cells (CRL-9068; ATCC), a plasmacytoma-derived cell ACGCTGATATGC and 3Ј-CCTTACTTACCACGCCAATAAC. line, were grown in RPMI 1640 medium with 2 mM L-glutamine, 1.5 g/L sodium bicarbonate, 4.5 g/L glucose, 10 mM HEPES, 1.0 mM sodium FACS analysis pyruvate (Mediatech), and 0.05 mM 2-ME (Sigma-Aldrich). BCL1 clone 3B3 murine B cells (CRL-1669; ATCC) cells were grown in RPMI 1640 For analysis of human markers, 1 ϫ 106 cells were stained with anti- medium with 2 mM L-glutamine and 0.05 mM 2-ME and 10% heat-inac- HLA-DR or anti-Syndecan-1 PE-conjugated Abs (BD Biosciences) and tivated FBS. P3X63Ag8.653 (P3XAG, clone CRL-1580; ATCC) murine analyzed on a FACSCalibur apparatus. For analysis of mouse markers, 1 ϫ plasmacytoma cells and primary B cells were grown in RPMI 1640 me- 106 cells were stained with anti-IA/E or anti-syndecan-1 PE-conjugated dium with 2 mM L-glutamine, 1.5 g/L sodium bicarbonate, 4.5 g/L glucose, Abs (BD Biosciences) and analyzed on a FACSCalibur. The Journal of Immunology 3867

EMSA analysis scriptional activation of CIITA pIII (28, 39). Although CREB was DNA protein interactions were analyzed by EMSA according to protocols identified as an ARE2-binding element (28), the factors interacting previously described (13, 55). A DNA probe containing the ARE1 element with ARE1 were not identified. To better understand the transcrip- of CIITA pIII was synthesized: ARE1, 5Ј-GGGGAGGGCTTAAGG tional regulation of CIITA pIII, it was necessary to first identify Ј GAGTGTGGTAAAATTAGA-3 . Mutated probes were also used as com- factors interacting with this critical region. EMSA to identify pu- petitors, including Mut1, 5Ј-GGGGAAAATTTAAGGGAGTGTGGTA AAATTAGA; Mut2, 5Ј-GGGGAGGGCTTATAAATGTGTGGTAAA tative binding factors for the ARE1 region in vitro was performed ATTAGA; and Mut3 5Ј-GGGGAGGGCTTAAGGGAGTAAACCAAAA using nuclear extracts prepared from the B cell line Raji. A specific TTAGA. Ab supershift assays using anti-Sp1, Sp3, CIITA, AML1, p65 and protein-DNA complex was resolved with the ARE1 probe (Fig. ␬ ␬ p50 NF- B, I B, USF1, Stat1, IRF1, IRF4, CBP, cFos, cJun, AP2, ATF2, 1B). EMSA analysis using Abs to various transcription factors CBP, CREB, CREM, NF1, cMyc, cMyb, and RAR␣ (Santa Cruz Biotech- nology) were incubated with the DNA-binding reaction mixture for 20 min identified the zinc finger transcription factor Sp1 as a potential before electrophoresis. candidate, as the Sp1 Ab supershifted the complex. Although a failure to supershift an EMSA product does not eliminate the pos- Results sibility that the factor does bind the ARE1, a supershift was not Sp1 binds the ARE1 region of CIITA pIII in B cells seen by any of the other 16 Abs tested, including Sp3, a protein CIITA and MHC-II expression is regulated by pIII in B lympho- that shares sequence homology with Sp1. Additional EMSA anal- cytes (21, 26). In vivo genomic DNA footprinting and reporter ysis was conducted using labeled mutant DNA probes to demon- assays have previously revealed several DNA-binding elements strate DNA binding specificity (Fig. 1, A and B). Of the mutant Ј

(Fig. 1A) that were occupied in B cells (our unpublished data and probes, only Mut2, a DNA probe containing mutations at the 5 Downloaded from Ref. 28). Two regions, ARE1 and ARE2 were required for tran- end of the ARE1 region, failed to bind the factor. Additional Ab http://www.jimmunol.org/ by guest on September 26, 2021

FIGURE 1. Sp1 binds the ARE1-binding element in pIII. A, A schematic of DNA-binding elements in CIITA pIII, and the sequences of wild-type and mutant ARE1 probes are shown. B, Nuclear extracts from Raji B cells were incubated with wild-type (left) or mutant (right) ARE1 probes in the presence or absence of Abs to the indicated transcription factors. The arrows indicate the position of the main reactive protein/DNA ARE1 complex and the complex supershifted by Ab. Comparison of the mutant probes to wild-type shows that Mut2 is the only probe with reduced activity to the binding of the factors. C, ChIP assays were conducted using control and Sp1 Abs. Real-time PCR was used to quantify the immunoprecipitated DNA. All values obtained using ChIP assays were normalized to input chromatin and then normalized to the irrelevant Ab control. The mean raw value for the irrelevant Ab control was 2.8 ng Ϯ 1.7. The mean of three independent experiments ϩ SEM is shown. 3868 EPIGENETIC REGULATION OF CIITA supershifts demonstrated that Sp1 was the factor binding to the by flow cytometry demonstrated a lack of MHC-II cell surface probes. These data indicate that Sp1 binds the ARE1 element in expression in the H929 plasma cell line as well (Fig. 2C), dem- vitro. onstrating that the cell lines provide a model system to investigate To verify these in vitro findings, ChIP assays were conducted CIITA silencing. using Abs to an irrelevant Ab or Sp1. Real-time PCR analysis of the immunoprecipitated DNA with primers for CIITA pIII DNA B cell factor occupancy is absent at CIITA pIII in plasma cells indicated a significant level of Sp1 binding to pIII DNA (Fig. 1C). In addition to our identification of Sp1, CREB (56), Pu.1, IRF4, Sp1 binding was not observed at an irrelevant locus control (data and E47 have been shown to interact with CIITA pIII in B cells not shown). This result indicates that Sp1 not only binds CIITA (40). To determine whether the occupancy of these factors differs pIII in vitro, but also in vivo. between B cells and plasma cells, ChIP assays for the presence of these factors were conducted on CIITA pIII in Raji and H929 cells. CIITA and MHC-II expression in plasma cells Sp1, CREB, PU.1, and E47 but not IRF4 were associated with To establish model cell lines and end points to monitor CIITA and CIITA pIII DNA by (Fig. 3A). Intriguingly, in H929 plasma cells MHC-II expression during the differentiation of B cells into the binding of Sp1, CREB, and E47 was the same as a nonspecific plasma cells, the expression of CIITA and MHC-II genes were control Ab, and the binding of PU.1 was reduced by 3- to 4-fold. evaluated in human and murine B and plasma cell lines. Raji and IRF4 also showed no binding. The failure to assemble at pIII may BCL-1 were used as model mature human and murine B cell lines, be due to the loss of expression of one or all of these factors. To respectively, and NCI-H929 and P3XAG were examined as human determine whether this loss was the case, Western blot analysis for and murine plasma cell lines. Real-time RT-PCR conducted on each for these proteins was conducted (Fig. 3B). As shown, CREB, Downloaded from RNA isolated from these cells showed that both MHC-II gene Sp1, E47, and PU.1 were expressed similarly in both Raji and expression as well as CIITA expression was highly expressed in H929 cells. This finding suggests that a more active or alternative the B cell lines but silenced in the plasma cell lines (Fig. 2, A and epigenetic mechanism may be at play to regulate the occupancy of B). CIITA expression in this case was assayed from pIII. Analysis pIII in plasma cells. These findings are in agreement with previous in vivo genomic footprinting comparisons between B cells and

plasma cells (our unpublished observations) and (39). http://www.jimmunol.org/

Changes in histone architecture at CIITA pIII One mechanism that may limit the accessibility of factors to CIITA pIII in plasma cells may be due to changes in the posttranslational modifications of the local histones that package the pIII DNA, as such modifications regulate the accessibility and transcriptional competence of a locus (reviewed in Refs. 57 and 58). To determine the histone code associated with pIII, as well as characterize changes in local chromatin architecture during B cell to plasma cell differentia- by guest on September 26, 2021 tion, ChIP analysis using Abs to acetylated histones H3 and H4 was performed on the model cell lines. In Raji and BCL-1 B cells, high levels of histone H3 and modest levels of histone H4 acetylation were observed (Fig. 4A). In contrast, these marks were near absent in the human and mouse plasma cell lines. This absence of histone acetylation infers a closed chromatin conformation at pIII, and correlates perfectly with a silencing of CIITA in plasma cells. Although the above ChIP analysis of H3 and H4 provides an overall indication of chromatin accessibility, it does not address the dynamics of specific modifications that may ultimately indicate

FIGURE 3. Transcription factor binding is lost in plasma cells, although FIGURE 2. CIITA and MHC-II expression in B cells and plasma cells. all requisite factors are present. A, ChIP assays using Abs for Sp1, CREB, RNA was isolated from Raji and BCL-1 B cell lines or H929 and P3XAG E47, PU.1, and IRF4 were used to compare factor binding at pIII in Raji plasma cell lines. mRNA levels of human or mouse CIITA (A) and MHC-II and H929 cells. The DNA recovered from the ChIP assays were normal- (B) were quantitated by real-time RT-PCR. The expression of each mRNA ized to input chromatin and then normalized to an irrelevant Ab control. level is expressed relative to GAPDH control. C, Raji and H929 cells were The mean raw value for the irrelevant Ab control was 2.8 ng Ϯ 1.7. B, incubated with PE-conjugated HLA-DR-speciﬁc Abs. Cell surface expres- Western blot analysis was conducted on equal amounts of Raji or H929 sion of MHC-II was then analyzed by ﬂow cytometry. whole cell extract and probed with the indicated antisera. The Journal of Immunology 3869

FIGURE 4. CIITA pIII histone acetylation is lost in human and mouse plasma cells. A, Comparisons between CIITA promoter II acetylation in Raji B cells and H929 plasma or BCL-1 B cells and P3XAG plasma cells using ChIP for di- acetylated H3 and tetra-acetylated H4 modifications. B, ChIP assays were conducted using Abs to acetylated histone H3 lysine 9, lysine 18, and lysine 27 and to dimethylated and trimethylated H3 lysine 4 or to histone H3 lysine 9 dimethylation (C). Real-time PCR was used to quantitate the immunoprecipitated DNA. All values obtained using ChIP assays were normalized to input chromatin and then normalized to the irrelevant Ab con- Downloaded from trol. The mean of four independent experiments is shown with SEM. Differ- ences between dimethyl lysine 9 in B cells and plasma cells were evaluated using the Student t test and were found to be statistically significant (p ϭ 0.0363 http://www.jimmunol.org/ and p ϭ 0.0386, respectively). The mean raw values for the irrelevant Ab controls in the human and mouse cells were 2.1 ng Ϯ 0.29 and 4.2 ng Ϯ 1.2, respectively. by guest on September 26, 2021 the factors that are regulating accessibility. To further characterize the clearly observed in both plasma cell lines (Fig. 4C), indicating that pIII chromatin architecture, ChIP was conducted using Abs to specific there is an active mechanism to repress/silence CIITA expression. histone acetylation of H3 lysines 9, 18, and 27, modifications associated with transcriptional activation. B cells displayed a high level of Global changes in CIITA promoter histone architecture histone H3 acetylation at lysines 9, 18, and 27 (Fig. 4B). In the plasma The silencing of CIITA pIII as indicated by the loss of activating cell lines, acetylation of lysine 9 and lysine 27 was absent or near and gain of silencing epigenetic chromatin marks may not be lim- absent, and acetylation of lysine 18 was reduced 8- to 10-fold when ited to just pIII and may be more widespread and include the other compared with the B cell lines. The levels of histone H3 dimethyl CIITA promoter regions. To test this hypothesis, the nucleosome lysine 4, which indicate a region competent for transcription (59), and modifications at the other CIITA promoters, which span 13 kb of trimethyl lysine 4, which indicate a promoter region actively being CIITA 5Ј DNA, were examined by ChIP (Fig. 5). Each promoter transcribed (60), were also examined. Both human and murine B cells region displayed a significant level of acetylation of H3 lysine 9, displayed high levels of H3 lysine 4 dimethylation and trimethylation lysine 18, and lysine 27 in Raji cells, albeit less than that seen at (Fig. 4B). In the plasma cell lines, the level of H3 lysine 4 dimethy- the constitutively active pIII. In H929, this acetylation was com- lation was between two and four times lower than the comparable B pletely absent at pI and nearly absent at pIV. A residual level of cell line, suggesting that the region was less competent for transcrip- lysine 18 acetylation was observed at pII. The levels of H3 lysine tion and less accessible. In addition, trimethylation of lysine 4, a mark 4 dimethylation were also high at all three promoters in Raji cells for active transcription, was robust in both B cell lines and completely and greatly reduced in the H929 plasma cells. In Raji cells, only absent in the plasma cell lines. Importantly, both human and murine pIV displayed trimethylation of H3 lysine 4, a marker for tran- systems provided near identical results, indicating that the modifica- scriptional activation. This result correlates with the fact that low tions observed and the loss of these modifications likely occur through levels of CIITA transcripts have been observed from pIV in B cells similar mechanisms. (30, 62). H3 lysine 4 trimethylation was absent in H929 cells. Histone H3 lysine 9 modification has been suggested to repre- These data suggest that not only is the lymphocyte-specific pro- sent a molecular switch between active and silenced chromatin. moter silenced, but the chromatin in the entire region is deacety- Although acetylation of this site is an indication of transcriptional lated and likely to be silenced in plasma cells. activation (58), methylation is indicative of transcriptional silencing (61). As discussed, histone H3 lysine 9 acetylation was robust CIITA pIII regulation in primary differentiated cells in the B cell lines and absent in the plasma cell lines. To determine Although model cell lines are invaluable tools for understanding whether the switch of modifications had occurred, ChIP assays for molecular mechanisms, their immortalization may prevent an ac- H3 dimethyl lysine 9 were conducted. Histone H3 lysine 9 di- curate representation of the primary cell situation. CIITA silencing methylation was not observed in Raji or BCL-1 B cells but was in the context of a primary cell system was therefore examined. 3870 EPIGENETIC REGULATION OF CIITA Downloaded from http://www.jimmunol.org/

FIGURE 5. All CIITA promoters display low acetylation transcriptional competence in plasma cells. The histone modiﬁcation proﬁles of CIITA pI, pII, and pIV were evaluated in Raji B cells and H929 plasma cells using ChIP-coupled real-time PCR with the indicated Abs. The mean of three independent experiments is shown with SEM. The mean raw value for the irrelevant Ab control was 2.2 ng Ϯ 0.8. by guest on September 26, 2021

CD43Ϫ splenic B cells were isolated from C57BL/6 mice. The cells were stimulated with IL-2, IL-5, and LPS to induce plasma cell differentiation. After 5 days of stimulation, mRNA levels of both CIITA and class II molecules were greatly reduced (Fig. 6A). In addition, CIITA protein expression was lost (Fig. 6B) and cell surface MHC-II expression was reduced significantly (data not shown). Increased mRNA levels of the plasma cell markers Blimp1, XBP1, and syndecan 1, as well as decreased levels of B cell-specific factors, Bcl-6 and Pax5 were also observed, verifying the plasma cell phenotype (data not shown). ChIP was used to analyze factor binding and histone acetylation in these primary differentiated cells. After 5 days, a significant loss in the binding of Sp1, CREB, E47, and PU.1 to pIII DNA was observed (Fig. 6C). Acetylation and methylation were also examined in a time course following stimulation with IL-2, IL-5, and FIGURE 6. Primary B cell differentiation induces histone deacetylation LPS. Whereas unstimulated cells displayed a high level of histone and loss of methylation accessibility marks at CIITA pIII. Primary B cells isolated from ϳ5-wk-old mouse spleens were treated with IL-2, IL5, and LPS acetylation at pIII, differentiated cells showed marked decreases in for 0, 12, or 24 h or 5 days as indicated. A, RNA was isolated from 0-day and histone acetylation over the time course (Fig. 6D). Examination of 5-day treated cells and levels of CIITA and I-A␣ mRNA were quantitated by individual histone modifications showed a rapid decrease in acet- real-time RT-PCR. The expression of each mRNA level is expressed relative ylation at 12 h, with histone H3 acetylation of lysine 9 and lysine to GAPDH mRNA level control. B, Western blot analysis for CIITA was 27 approaching background levels (Fig. 6E). Histone H3 lysine 18 conducted on whole cell lysates isolated from 0-day and 5-day treated cells. C, acetylation, although markedly decreased at 5 days, was delayed. ChIP assays using Abs for Sp1, CREB, E47, Pu.1, and IRF4 were used to Similarly, H3 lysine 4 dimethylation did not reach a plateau until compare factor binding at pIII in 0-day and 5-day treated cells. The mean raw Ϯ D E after 24 h (Fig. 6E). In contrast, H3 lysine 4 trimethylation de- value for the irrelevant Ab control was 3.6 1.7 ng. and , Cells treated with IL-2, IL5, and LPS for the designated time were subjected to ChIP real- creased rapidly. Taken together, these results suggest that histone time PCR analysis using the indicated Abs and were processed as described. deacetylation and loss of histone methylation plays a significant The mean raw values for the irrelevant Ab controls used were 1.2 ng Ϯ 0.6, role in the silencing of CIITA pIII, not only in human but in mouse 2.8 ng Ϯ 1.9, 1.5 ng Ϯ 0.6, and 2.8 ng Ϯ 0.6 for the 0, 12, and 24 h and 5-day as well. time course experiment. The Journal of Immunology 3871

Discussion and human T cells (28, 39); however, no factors associated with The developmental control of MHC-II expression in the B lym- this element were identified. Sp1 was found to bind to this site. Sp1 phocyte lineage reflects the biology and function of B cells during is ubiquitously expressed in both B cells and T cells (reviewed in the generation of humoral immune responses. MHC-II gene ex- Ref. 70) and belongs to a large family of factors known to bind pression and subsequent Ag presentation in B lymphocytes is prin- GC-rich sequences. Sp1 as well as other Sp1 like molecules have cipally regulated by CIITA driven from pIII. As B cells differen- been shown to interact with CBP/p300 coactivators (71, 72) as tiate into plasma cells where their terminal function is to secrete well as TFIID (73). In addition to Sp1, the factors CREB, PU.1, Ab, Ag presentation and MHC-II expression are no longer neces- and E47 are also known to recruit CBP/p300 (74–76), basal tran- sary. The loss of CIITA pIII expression is marked and controlled scriptional machinery (77), and RNA polymerase II (78) to pro- by changes in chromatin accessibility and transcriptional compe- moters. CBP and p300 are responsible for modification of histone tence and can be divided into several stages based on our data. H3 lysine 18 in vivo (79). Thus, it is likely that the combination of Mature B cells express high levels of MHC-II and CIITA. PIII these DNA binding factors mediate the recruitment of coactivators is highly acetylated at multiple histone residues, each serving as that are responsible for the histone code associated with the CIITA activation markers and substrates for additional chromatin remod- locus. eling enzymes and components of the transcriptional machinery. The last stage involved in CIITA silencing is the dimethylation The chromatin is fully accessible to at least four transcription fac- of histone H3 lysine 9. Histone H3 lysine 9 dimethylation, a mark tors, Sp1, E47, PU.1, and CREB. Moreover histone methylation of transcriptional silencing, was observed in both human and murine plasma cell lines. Thus, the switch from a transcriptionally marks, associated with active transcription, are present. Addition- active to silent state is revealed by this lysine modification ex- Downloaded from ally, low levels of transcripts have been observed from the down- change. Despite several attempts, this mark was not observed in stream pIV region (21, 24, 30, 62), demonstrating that this region the primary differentiated mouse B cells. Several reasons could is also competent for transcription. account for failure to detect this mark. The first is that the 5-day ex In the initial stage of B cell differentiation to plasma cell, histone vivo culture may not be long enough to allow this complete change H3 acetylation marks that are associated directly with transcrip- in chromatin structure to have occurred. A second possibility is tional activation, such as lysine 9 and lysine 27, are lost, as is

that the ex vivo differentiation process lacks the necessary signal- http://www.jimmunol.org/ histone H3 lysine 4 trimethylation, a mark associated with actively ing events required to completely silence CIITA and therefore only transcribed genes. The loss of these marks occurs within the first shows the initial stages of the process. Because the endpoint stages 12 h of the ex vivo differentiation process. The loss of H3 lysine of in vivo differentiation are revealed by the plasma cell lines, this 9 acetylation can have profound effects as this mark is associated possibility is favored. The dimethyl lysine 9 mark can be catalyzed with the recruitment of components of the general transcription by histone methyltransferases G9a, GLP, SUVar39h1, or machinery to promoters (63). Acetylation marks can be rapidly SUVar9h2 (reviewed in Ref. 80) and can serve as a substrate for removed by histone deacetylases (HDACs), suggesting that the the heterochromatin protein-1 (HP1) (81). Minimal binding of HP1 first step may be the recruitment of a HDAC. Alternatively, re- was observed by ChIP in H929 cells (data not shown). moval of the acetylation marks can be mediated by the replace- Previous studies have suggested that CIITA silencing is medi- by guest on September 26, 2021 ment of histones (reviewed in Ref. 64). Recently, H3 replacement ated by expression and binding of Blimp1 to pIII in plasma cells with variant H3.3 has been shown to be associated with transcrip- (44). Blimp1 is a transcriptional repressor responsible in part for tional activation of previously silenced genes (65, 66). It is possible initiating plasma cell differentiation (41, 82). Exogenously ex- that an exchange of modified H3 with histone variants (67) is asso- pressed tagged Blimp1 in a pre-B cell line or in IgM- and LPS- ciated with initial steps toward gene silencing. Also occurring at the stimulated splenocytes down-modulated CIITA 4-fold, and was same time is the loss of histone H3 lysine 4 trimethylation. The mech- found associated with pIII, indicating a role for this factor in or- anism by which histones lose trimethylated lysine modifications is not chestrating CIITA silencing (44, 45). Experiments in which known, although it is possible again that these histones are replaced/ Blimp1 was exogenously expressed by either retrovirus or adeno- exchanged with unmodified histones (reviewed in Ref. 64). virus infection in mature human or murine B cells displayed a A second or a parallel event is the loss of acetylation of histone modest increase in plasma cell markers but failed to ablate CIITA H3 lysine 18 and the decrease of dimethylated lysine 4. Lysine 18 to the levels seen in our system (data not shown). Based on these deacetylation displayed slower kinetics than the loss of lysine 9 or results, we suggest that Blimp1 may be necessary but not sufficient lysine 27 acetylation, suggesting that it may be mediated by a to completely silence CIITA. It is intriguing that Blimp1 can in- different HDAC/complex or that the HDAC responsible has a teract with G9a in vitro (47). This interaction may serve as the lower affinity for lysine 18 acetyl residues. The delay in the loss of mechanism to epigenetically mark CIITA chromatin in the silent H3 dimethyl lysine 4 may indicate a stepwise process of lysine 4 state once differentiation is complete. dimethylation (i.e., tri- to di- to mono-). H3 dimethyl lysine 4 can Epigenetic mechanisms are critical to B cell development. be removed by the coREST complex containing the histone lysine- Treatment of cells with HDAC inhibitors (trichostatin and bu- specific demethylase LSD1 (68, 69), suggesting a possible role for tyrate) alone can induce splenic B cell to plasma cell transition as this factor in this process. This mark is associated with overall indicated by increased expression of plasma cell specific genes, accessibility (59); thus, it is somewhat intriguing that some pIII such as Blimp1, J chain, and syndecan-1, and CD43, and down- regions still carry this mark. This finding was also true in the modulation of IgM, Pax5, and c-myc. In these experiments, how- plasma cell lines, which are fully differentiated, possibly indicating ever, MHC-II cell surface expression was not affected (83), sug- some plasticity even at silenced genes. The loss of DNA binding gesting that simple inhibition of deacetylases is not sufficient for factor occupancy likely occurs at a time point that is concordant MHC-II expression in splenic B cells. Conversely, trichostatin can with the loss in acetylation and accessibility. This timing naturally induce endogenous CIITA pI and pIII CIITA expression in mac- represents a significant step as these factors are likely responsible rophage and dendritic cells and in plasmacytomas, respectively for the recruitment of the histone acetyltransferases to pIII. (data not shown) and (84). It remains unclear whether this re- The ARE1 binding element within pIII was identified previously expression of CIITA is due to specific effects on the HDACs tar- as a critical region required for CIITA transcription in both B cells geted toward the promoters or results from more global effects. 3872 EPIGENETIC REGULATION OF CIITA

CIITA expression from pI in dendritic cells is regulated by epige- 19. Boss, J. M., and P. E. Jensen. 2003. Transcriptional regulation of the MHC class netic mechanisms as well (22). Immature dendritic cells express II antigen presentation pathway. Curr. Opin. Immunol. 15: 105–111. 20. LeibundGut-Landmann, S., J. M. Waldburger, M. Krawczyk, L. A. Otten, CIITA until exposed to TNF-␣, LPS, or other maturation stimuli. T. Suter, A. Fontana, H. Acha-Orbea, and W. Reith. 2004. Mini-review: speci- Stimulated dendritic cells down-regulate CIITA mRNA and pro- ficity and expression of CIITA, the master regulator of MHC class II genes. Eur. J. Immunol. 34: 1513–1525. tein levels. Unlike the B cell to plasma cell transition, analysis of 21. Muhlethaler-Mottet, A., L. A. Otten, V. Steimle, and B. Mach. 1997. Expression the pI region did not show changes in the in vivo footprint region of MHC class II molecules in different cellular and functional compartments is during this differentiation, but rather a global deacetylation of controlled by differential usage of multiple promoters of the transactivator CIITA. EMBO J. 16: 2851–2860. histones H3 and H4 across the entire 13 kb region encompassing 22. Landmann, S., A. Muhlethaler-Mottet, L. Bernasconi, T. Suter, J. M. Waldburger, the CIITA promoters (22). In this study, a similar change in global K. Masternak, J. F. Arrighi, C. Hauser, A. Fontana, and W. Reith. 2001. Matu- acetylation during the B cell to plasma cell transition was ob- ration of dendritic cells is accompanied by rapid transcriptional silencing of class II transactivator (CIITA) expression. J. Exp. Med. 194: 379–391. served. Together, these data suggest that histone deacetylation and 23. Waldburger, J. M., T. Suter, A. Fontana, H. Acha-Orbea, and W. Reith. 2001. global chromatin remodeling of the CIITA upstream regulatory Selective abrogation of major histocompatibility complex class II expression on region is a common mechanism for developmental silencing of extrahematopoietic cells in mice lacking promoter IV of the class II transactivator gene. J. Exp. Med. 194: 393–406. CIITA among APCs. 24. Piskurich, J. F., C. A. Gilbert, B. D. Ashley, M. Zhao, H. Chen, J. Wu, S. C. Bolick, and K. L. Wright. 2006. Expression of the MHC class II transactivator (CIITA) type IV promoter in B lymphocytes and regulation by IFN-␥. Acknowledgments Mol. Immunol. 43: 519–528. We thank members of the laboratory and Dr. Paul Wade for their com- 25. Muhlethaler-Mottet, A., W. Di Berardino, L. A. Otten, and B. Mach. 1998. Ac- ments on this work. tivation of the MHC class II transactivator CIITA by interferon-␥ requires co- operative interaction between Stat1 and USF-1. Immunity 8: 157–166. 26. Lennon, A. M., C. Ottone, G. Rigaud, L. L. Deaven, J. Longmire, M. Fellous, Downloaded from Disclosures R. Bono, and C. Alcaide-Loridan. 1997. Isolation of a B-cell-specific promoter The authors have no financial conflict of interest. for the human class II transactivator. Immunogenetics 45: 266–273. 27. Wong, A. W., N. Ghosh, K. P. McKinnon, W. Reed, J. F. Piskurich, K. L. Wright, and J. P. Ting. 2002. Regulation and specificity of MHC2TA promoter usage in References human primary T lymphocytes and cell line. J. Immunol. 169: 3112–3119. 1. Benacerraf, B. 1981. Role of MHC gene products in immune regulation. Science 28. Holling, T. M., N. van der Stoep, E. Quinten, and P. J. van den Elsen. 2002. 212: 1229–1238. Activated human T cells accomplish MHC class II expression through T cell- 2. Long, E. O. 1992. Antigen processing for presentation to CD4ϩ T cells. New specific occupation of class II transactivator promoter III. J. Immunol. 168: http://www.jimmunol.org/ Biol. 4: 274–282. 763–770. 3. Cresswell, P. 1994. Assembly, transport, and function of MHC class II molecules. 29. LeibundGut-Landmann, S., J. M. Waldburger, C. Reis e Sousa, H. Acha-Orbea, Annu. Rev. Immunol. 12: 259–293. and W. Reith. 2004. MHC class II expression is differentially regulated in plas- 4. Cella, M., A. Engering, V. Pinet, J. Pieters, and A. Lanzavecchia. 1997. Inflam- macytoid and conventional dendritic cells. Nat. Immunol. 5: 899–908. matory stimuli induce accumulation of MHC class II complexes on dendritic 30. Pai, R. K., D. Askew, W. H. Boom, and C. V. Harding. 2002. Regulation of class cells. Nature 388: 782–787. II MHC expression in APCs: roles of types I, III, and IV class II transactivator. 5. Pierre, P., S. J. Turley, E. Gatti, M. Hull, J. Meltzer, A. Mirza, K. Inaba, J. Immunol. 169: 1326–1333. R. M. Steinman, and I. Mellman. 1997. Developmental regulation of MHC class 31. Noelle, R. J., W. A. Kuziel, C. R. Maliszewski, E. McAdams, E. S. Vitetta, and II transport in mouse dendritic cells. Nature 388: 787–792. P. W. Tucker. 1986. Regulation of the expression of multiple class II genes in 6. Kara, C. J., and L. H. Glimcher. 1993. Developmental and cytokine-mediated murine B cells by B cell stimulatory factor-1 (BSF-1). J. Immunol. 137: regulation of MHC class II gene promoter occupancy in vivo. J. Immunol. 150: 1718–1723. by guest on September 26, 2021 4934–4942. 32. Dellabona, P., F. Latron, A. Maffei, L. Scarpellino, and R. S. Accolla. 1989. 7. Steimle, V., C. A. Siegrist, A. Mottet, B. Lisowska-Grospierre, and B. Mach. Transcriptional control of MHC class II gene expression during differentiation 1994. Regulation of MHC class II expression by interferon-␥ mediated by the from B cells to plasma cells. J. Immunol. 142: 2902–2910. transactivator gene CIITA. Science 265: 106–109. 33. Lala, P. K., G. R. Johnson, F. L. Battye, and G. J. Nossal. 1979. Maturation of 8. Collins, T., A. J. Korman, C. T. Wake, J. M. Boss, D. J. Kappes, W. Fiers, B lymphocytes. I. Concurrent appearance of increasing Ig, Ia, and mitogen re- K. A. Ault, M. A. Gimbrone, Jr., J. L. Strominger, and J. S. Pober. 1984. Immune sponsiveness. J. Immunol. 122: 334–341. interferon activates multiple class II major histocompatibility complex genes and 34. Kincade, P. W., G. Lee, T. Watanabe, L. Sun, and M. P. Scheid. 1981. Antigens the associated invariant chain gene in human endothelial cells and dermal fibro- displayed on murine B lymphocyte precursors. J. Immunol. 127: 2262–2268. blasts. Proc. Natl. Acad. Sci. USA 81: 4917–4921. 35. Miki, N., M. Hatano, K. Wakita, S. Imoto, S. Nishikawa, and T. Tokuhisa. 1992. 9. Durand, B., P. Sperisen, P. Emery, E. Barras, M. Zufferey, B. Mach, and Role of I-A molecules in early stages of B cell maturation. J. Immunol. 149: W. Reith. 1997. RFXAP, a novel subunit of the RFX DNA binding complex is 801–807. mutated in MHC class II deficiency. EMBO J. 16: 1045–1055. 36. Sartoris, S., G. Tosi, A. De Lerma Barbaro, T. Cestari, and R. S. Accolla. 1996. 10. Masternak, K., E. Barras, M. Zufferey, B. Conrad, G. Corthals, R. Aebersold, Active suppression of the class II transactivator-encoding AIR-1 locus is respon- J. C. Sanchez, D. F. Hochstrasser, B. Mach, and W. Reith. 1998. A gene encoding sible for the lack of major histocompatibility complex class II gene expression a novel RFX-associated transactivator is mutated in the majority of MHC class II observed during differentiation from B cells to plasma cells. Eur. J. Immunol. 26: deficiency patients. Nat. Genet. 20: 273–277. 2456–2460. 11. Nagarajan, U. M., P. Louis-Plence, A. DeSandro, R. Nilsen, A. Bushey, and 37. Silacci, P., A. Mottet, V. Steimle, W. Reith, and B. Mach. 1994. Developmental J. M. Boss. 1999. RFX-B is the gene responsible for the most common cause of extinction of major histocompatibility complex class II gene expression in plas- the bare lymphocyte syndrome, an MHC class II immunodeficiency. Immunity mocytes is mediated by silencing of the transactivator gene CIITA. J. Exp. Med. 10: 153–162. 180: 1329–1336. 12. Reith, W., S. Satola, C. H. Sanchez, I. Amaldi, B. Lisowska-Grospierre, 38. Lennon, A. M., C. Ottone, M. Rosemblatt, M. Fellous, M. R. Bono, and C. Griscelli, M. R. Hadam, and B. Mach. 1988. Congenital immunodeficiency C. Alcaide-Loridan. 1998. CIITA B-cell-specific promoter suppression in MHC with a regulatory defect in MHC class II gene expression lacks a specific class II-silenced cell hybrids. Immunogenetics 48: 283–291. HLA-DR promoter binding protein, RF-X. Cell 53: 897–906. 39. Ghosh, N., J. F. Piskurich, G. Wright, K. Hassani, J. P. Ting, and K. L. Wright. 13. Hasegawa, S. L., and J. M. Boss. 1991. Two B cell factors bind the HLA-DRA 1999. A novel element and a TEF-2-like element activate the major histocom- X box region and recognize different subsets of HLA class II promoters. Nucleic patibility complex class II transactivator in B-lymphocytes. J. Biol. Chem. 274: Acids Res. 19: 6269–6276. 32342–32350. 14. Moreno, C. S., G. W. Beresford, P. Louis-Plence, A. C. Morris, and J. M. Boss. 40. van der Stoep, N., E. Quinten, M. Marcondes Rezende, and P. J. van den Elsen. 1999. CREB regulates MHC class II expression in a CIITA-dependent manner. 2004. E47, IRF-4, and PU. 1 synergize to induce B-cell-specific activation of the Immunity 10: 143–151. class II transactivator promoter III (CIITA-PIII). Blood 104: 2849–2857. 15. Wright, K. L., B. J. Vilen, Y. Itoh-Lindstrom, T. L. Moore, G. Li, M. Criscitiello, 41. Turner, C. A., Jr., D. H. Mack, and M. M. Davis. 1994. Blimp-1, a novel zinc P. Cogswell, J. B. Clarke, and J. P. Ting. 1994. CCAAT box binding protein finger-containing protein that can drive the maturation of B lymphocytes into NF-Y facilitates in vivo recruitment of upstream DNA binding transcription fac- immunoglobulin-secreting cells. Cell 77: 297–306. tors. EMBO J. 13: 4042–4053. 42. Shapiro-Shelef, M., K. I. Lin, L. J. McHeyzer-Williams, J. Liao, 16. Riley, J. L., S. D. Westerheide, J. A. Price, J. A. Brown, and J. M. Boss. 1995. M. G. McHeyzer-Williams, and K. Calame. 2003. Blimp-1 is required for the Activation of class II MHC genes requires both the X box region and the class II formation of immunoglobulin secreting plasma cells and pre-plasma memory B transactivator (CIITA). Immunity 2: 533–543. cells. Immunity 19: 607–620. 17. Steimle, V., L. A. Otten, M. Zufferey, and B. Mach. 1993. Complementation 43. Keller, A. D., and T. Maniatis. 1991. Identification and characterization of a cloning of an MHC class II transactivator mutated in hereditary MHC class II novel repressor of ␤-interferon gene expression. Genes Dev. 5: 868–879. deficiency (or bare lymphocyte syndrome). Cell 75: 135–146. 44. Piskurich, J. F., K. I. Lin, Y. Lin, Y. Wang, J. P. Ting, and K. Calame. 2000. 18. Ting, J. P., and J. Trowsdale. 2002. Genetic control of MHC class II expression. BLIMP-I mediates extinction of major histocompatibility class II transactivator Cell 109(Suppl.): S21–S33. expression in plasma cells. Nat. Immunol. 1: 526–532. The Journal of Immunology 3873

45. Ghosh, N., I. Gyory, G. Wright, J. Wood, and K. L. Wright. 2001. Positive 65. Ahmad, K., and S. Henikoff. 2002. The histone variant H3.3 marks active chro- regulatory domain I binding factor 1 silences class II transactivator expression in matin by replication-independent nucleosome assembly. Mol. Cell 9: 1191–1200. multiple myeloma cells. J. Biol. Chem. 276: 15264–15268. 66. Janicki, S. M., T. Tsukamoto, S. E. Salghetti, W. P. Tansey, R. Sachidanandam, 46. Ren, B., K. J. Chee, T. H. Kim, and T. Maniatis. 1999. PRDI-BF1/Blimp-1 K. V. Prasanth, T. Ried, Y. Shav-Tal, E. Bertrand, R. H. Singer, and repression is mediated by corepressors of the Groucho family of proteins. Genes D. L. Spector. 2004. From silencing to gene expression: real-time analysis in Dev. 13: 125–137. single cells. Cell 116: 683–698. 47. Gyory, I., J. Wu, G. Fejer, E. Seto, and K. L. Wright. 2004. PRDI-BF1 recruits 67. Hake, S. B., B. A. Garcia, E. M. Duncan, M. Kauer, G. Dellaire, J. Shabanowitz, the histone H3 methyltransferase G9a in transcriptional silencing. Nat. Immunol. D. P. Bazett-Jones, C. D. Allis, and D. F. Hunt. 2006. Expression patterns and 5: 299–308. post-translational modifications associated with mammalian histone H3 variants. 48. Osipovich, O., R. Milley, A. Meade, M. Tachibana, Y. Shinkai, M. S. Krangel, J. Biol. Chem. 281: 559–568. and E. M. Oltz. 2004. Targeted inhibition of V(D)J recombination by a histone 68. Shi, Y., F. Lan, C. Matson, P. Mulligan, J. R. Whetstine, P. A. Cole, and methyltransferase. Nat. Immunol. 5: 309–316. R. A. Casero. 2004. Histone demethylation mediated by the nuclear amine oxi- 49. Tachibana, M., K. Sugimoto, T. Fukushima, and Y. Shinkai. 2001. Set domain- dase homolog LSD1. Cell 119: 941–953. containing protein, G9a, is a novel lysine-preferring mammalian histone meth- 69. Lee, M. G., C. Wynder, N. Cooch, and R. Shiekhattar. 2005. An essential role for yltransferase with hyperactivity and specific selectivity to lysines 9 and 27 of CoREST in nucleosomal histone 3 lysine 4 demethylation. Nature 437: 432–435. histone H3. J. Biol. Chem. 276: 25309–25317. 70. Kaczynski, J., T. Cook, and R. Urrutia. 2003. Sp1- and Kru¨ppel-like transcription 50. Tachibana, M., K. Sugimoto, M. Nozaki, J. Ueda, T. Ohta, M. Ohki, M. Fukuda, factors. Genome Biol. 4: 206. N. Takeda, H. Niida, H. Kato, and Y. Shinkai. 2002. G9a histone methyltrans- 71. Chu, B. Y., K. Tran, T. K. Ku, and D. L. Crowe. 2005. Regulation of ERK1 gene ferase plays a dominant role in euchromatic histone H3 lysine 9 methylation and expression by coactivator proteins. Biochem. J. 392: 589–599. is essential for early embryogenesis. Genes Dev. 16: 1779–1791. 72. Song, C. Z., K. Keller, K. Murata, H. Asano, and G. Stamatoyannopoulos. 2002. 51. Martin, C., and Y. Zhang. 2005. The diverse functions of histone lysine meth- Functional interaction between coactivators CBP/p300, PCAF, and transcription ylation. Nat. Rev. Mol. Cell. Biol. 6: 838–849. factor FKLF2. J. Biol. Chem. 277: 7029–7036. 52. Beresford, G. W., and J. M. Boss. 2001. CIITA coordinates multiple histone 73. Gill, G., E. Pascal, Z. H. Tseng, and R. Tjian. 1994. A glutamine-rich hydro- acetylation modifications at the HLA-DRA promoter. Nat. Immunol. 2: 652–657. phobic patch in transcription factor Sp1 contacts the dTAFII110 component of 53. Boekhoudt, G. H., Z. Guo, G. W. Beresford, and J. M. Boss. 2003. Communi- ␬ the Drosophila TFIID complex and mediates transcriptional activation. Proc. Downloaded from cation between NF- B and Sp1 controls histone acetylation within the proximal Natl. Acad. Sci. USA 91: 192–196. promoter of the monocyte chemoattractant protein 1 gene. J. Immunol. 170: 74. Chrivia, J. C., R. P. Kwok, N. Lamb, M. Hagiwara, M. R. Montminy, and 4139–4147. R. H. Goodman. 1993. Phosphorylated CREB binds specifically to the nuclear 54. Gomez, J. A., P. Majumder, U. M. Nagarajan, and J. M. Boss. 2005. X box-like protein CBP. Nature 365: 855–859. sequences in the MHC class II region maintain regulatory function. J. Immunol. 75. Yamamoto, H., F. Kihara-Negishi, T. Yamada, Y. Hashimoto, and T. Oikawa. 175: 1030–1040. 1999. Physical and functional interactions between the transcription factor PU.1 55. Hasegawa, S. L., J. L. Riley, J. H. Sloan, III, and J. M. Boss. 1993. Protease and the coactivator CBP. Oncogene 18: 1495–1501. treatment of nuclear extracts distinguishes between class II MHC X1 box DNA- 76. Qiu, Y., A. Sharma, and R. Stein. 1998. p300 mediates transcriptional stimulation

binding proteins in wild-type and class II-deficient B cells. J. Immunol. 150: http://www.jimmunol.org/ 1781–1793. by the basic helix-loop-helix activators of the insulin gene. Mol. Cell. Biol. 18: 56. van der Stoep, N., E. Quinten, and P. J. van den Elsen. 2002. Transcriptional 2957–2964. regulation of the MHC class II trans-activator (CIITA) promoter III: identification 77. Xing, L., V. K. Gopal, and P. G. Quinn. 1995. cAMP response element-binding of a novel regulatory region in the 5Ј-untranslated region and an important role protein (CREB) interacts with transcription factors IIB and IID. J. Biol. Chem. for cAMP-responsive element binding protein 1 and activating transcription fac- 270: 17488–17493. tor-1 in CIITA-promoter III transcriptional activation in B lymphocytes. J. Im- 78. Felinski, E. A., J. Kim, J. Lu, and P. G. Quinn. 2001. Recruitment of an RNA munol. 169: 5061–5071. polymerase II complex is mediated by the constitutive activation domain in 57. Peterson, C. L., and M. A. Laniel. 2004. Histones and histone modifications. CREB, independently of CREB phosphorylation. Mol. Cell. Biol. 21: 1001–1010. Curr. Biol. 14: R546–R551. 79. Schiltz, R. L., C. A. Mizzen, A. Vassilev, R. G. Cook, C. D. Allis, and 58. Jenuwein, T., and C. D. Allis. 2001. Translating the histone code. Science 293: Y. Nakatani. 1999. Overlapping but distinct patterns of histone acetylation by the 1074–1080. human coactivators p300 and PCAF within nucleosomal substrates. J. Biol.

59. Santos-Rosa, H., R. Schneider, A. J. Bannister, J. Sherriff, B. E. Bernstein, Chem. 274: 1189–1192. by guest on September 26, 2021 N. C. Emre, S. L. Schreiber, J. Mellor, and T. Kouzarides. 2002. Active genes are 80. Zhang, Y., and D. Reinberg. 2001. Transcription regulation by histone methyl- tri-methylated at K4 of histone H3. Nature 419: 407–411. ation: interplay between different covalent modiﬁcations of the core histone tails. 60. Strahl, B. D., R. Ohba, R. G. Cook, and C. D. Allis. 1999. Methylation of histone Genes Dev. 15: 2343–2360. H3 at lysine 4 is highly conserved and correlates with transcriptionally active 81. Lachner, M., D. O’Carroll, S. Rea, K. Mechtler, and T. Jenuwein. 2001. Meth- nuclei in Tetrahymena. Proc. Natl. Acad. Sci. USA 96: 14967–14972. ylation of histone H3 lysine 9 creates a binding site for HP1 proteins. Nature 410: 61. Sims, R. J., III, K. Nishioka, and D. Reinberg. 2003. Histone lysine methylation: 116–120. a signature for chromatin function. Trends Genet. 19: 629–639. 82. Shaffer, A. L., K. I. Lin, T. C. Kuo, X. Yu, E. M. Hurt, A. Rosenwald, 62. Fujita, N., D. L. Jaye, C. Geigerman, A. Akyildiz, M. R. Mooney, J. M. Boss, and J. M. Giltnane, L. Yang, H. Zhao, K. Calame, and L. M. Staudt. 2002. Blimp-1 P. A. Wade. 2004. MTA3 and the Mi-2/NuRD complex regulate cell fate during orchestrates plasma cell differentiation by extinguishing the mature B cell gene B lymphocyte differentiation. Cell 119: 75–86. expression program. Immunity 17: 51–62. 63. Agalioti, T., G. Chen, and D. Thanos. 2002. Deciphering the transcriptional hi- 83. Lee, S. C., A. Bottaro, and R. A. Insel. 2003. Activation of terminal B cell stone acetylation code for a human gene. Cell 111: 381–392. differentiation by inhibition of histone deacetylation. Mol. Immunol. 39: 923–932. 64. Hake, S. B., and C. D. Allis. 2006. Histone H3 variants and their potential role 84. Chou, S. D., A. N. Khan, W. J. Magner, and T. B. Tomasi. 2005. Histone acet- in indexing mammalian genomes: the “H3 barcode hypothesis”. Proc. Natl. Acad. ylation regulates the cell type speciﬁc CIITA promoters, MHC class II expression Sci. USA 103: 6428–6435. and antigen presentation in tumor cells. Int. Immunol. 17: 1483–1494.