Sustainable Biotransformation of Oleic Acid to 10-Hydroxystearic Acid by a Recombinant Oleate Hydratase from Lactococcus Garvieae

processes

Article Sustainable Biotransformation of Oleic Acid to 10-Hydroxystearic Acid by a Recombinant Oleate Hydratase from Lactococcus garvieae

Jing Zhang 1, Muhammad Bilal 1 , Shuai Liu 1, Jiaheng Zhang 1, Hedong Lu 1, Hongzhen Luo 1, Chuping Luo 1, Hao Shi 1, Haﬁz M. N. Iqbal 2 and Yuping Zhao 1,* 1 School of Life Science and Food Engineering, Huaiyin Institute of Technology, Huaian 223003, China; [email protected] (J.Z.); [email protected] (M.B.); [email protected] (S.L.); [email protected] (J.Z.); [email protected] (H.L.); [email protected] (H.L.); [email protected] (C.L.); [email protected] (H.S.) 2 Tecnologico de Monterrey, School of Engineering and Sciences, Campus Monterrey, Ave. Eugenio Garza Sada 2501, CP 64849 Monterrey, Mexico; haﬁ[email protected] * Correspondence: [email protected]

Received: 6 April 2019; Accepted: 14 May 2019; Published: 1 June 2019

Abstract: Enzymatic hydration of oleic acid into 10-hydroxystearic acid (10-HSA) represents a theme of substantial scientific and practical interest. In this study, a fatty acid hydratase (OHase) from Lactococcus garvieae was cloned and expressed in Escherichia coli. The recombinantly expressed enzyme was identified as oleate hydratase (EC 4.2.1.53) confirming its highest hydration activity for oleic acid. The optimally yielded enzyme fraction was purified and subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). A solitary band on SDS-PAGE confirmed the molecular weight of 65 kDa. Gas chromatography-mass spectrometry (GC-MS) analysis scrutinized the silylated hydroxy fatty acid products acquired from the hydration of oleic acid by the oleate hydratase from L. garvieae. Optimal reaction conditions for the enzymatic production of 10-HSA from oleic acid using the purified oleate hydratase were pH 7.5, 30 ◦C, 105.49 U/mL enzyme solution and 30 g/L oleic acid. In the presence of activity stimulators, that is, magnesium (II) (Mg2+), the oleate hydratase activity was found to be greatly improved at 30 ◦C. In conclusion, the results revealed the potential efficacy of recombinant enzyme for the biotechnological conversion of oleic acid to 10-HSA acid with high efficiency. The results would be useful for the improved industrial-scale biosynthesis of 10-HSA via an economical and environmentally friendly bioprocess approach.

Keywords: Lactococcus garvieae; biotransformation; oleate acid; oleate hydratase; 10-hydroxystearic acid; bio-based process; optimization

1. Introduction As a biocatalyst, hydratases have attracted more attention in recent years. These enzymes catalyze the hydrogenation of unsaturated fatty acids (UFAs) by stereo-selectively adding water to the carbon-carbon double bond [1]. Therefore, hydroxyl groups can be incorporated without the requirement for costly cofactors such as recycling or electron releasing groups [2]. These unique characteristics of hydratases render them interesting candidates for numerous applications in industrial bioprocesses. A large number of microorganisms have been recognized to synthesize oleic acid hydratase with diﬀerent regioselectivity. For example, Escherichia coli hydratase shows the greatest activity against oleic acid. A recent study revealed that oleic acid hydratase necessitates ﬂavin adenosine dinucleotide (FAD) as a cofactor for the production of 10-hydroxystearic acid [2]. Microscopic characterization revealed that the hydratase is an integral membrane protein, and therefore, enzymatic

Processes 2019, 7, 326; doi:10.3390/pr7060326 www.mdpi.com/journal/processes Processes 2019, 7, 326 2 of 12 reaction carries out at the periphery of the cell. This reaction site might be beneficial in the detoxification process because the toxic linoleic acid molecule transformed to non-toxic 10-hydroxy-9-cis-octadecenoic acid by interacting with the hydratase before reaching the cell membrane. In addition, the amino-acid based structural analysis identified a binding site with linoleic acid during the reaction with the hydratase: Site 1, and Site 2, which are located in the external hydrophobic pocket of the protein and in the central contacting with FAD molecules. It was also interesting to note that linoleic acid molecules are arranged around the methionine residue at two sites (Met81 and Met154), which serve as a rigid pole and therefore plays a pivotal role in the binding of UFAs [3]. Hydroxy fatty acids have been discovered in plants, animals, and various microorganisms. However, the plants are considered the main source including plant seeds to get waxes and other lipids [4]. Hydroxy fatty acids (HFAs) are valuable raw materials that can be utilized to produce a range of industrially relevant compounds such as resins and polymers, plastics, nylons, cosmetics, biodiesel, lubricants, additives in paints and varnish formulations [5,6]. In addition, HFAs are also lactones precursors that indicate their wide applicability in the flavor and fragrance industries. Since its first discovery, more research on 10-hydroxystearic acid (10-HAS) has been undertaken with growing industrial interest. The 10-HSA can be obtained by whole cell transformation or enzymatic reaction. In the earlier case (whole cell transformation), Nocardia paraffinae [7], N. cholesterolicum [8], Selenomonas ruminantium [9], and Stenotrophomonas nitritireducens, Lactobacillus acidophilus [10] have been exploited to produce HFAs by the hydration of oleate acids. The hydration of UFAs is speculated to characterize a detoxification mechanism in bacteria, so the production of HFAs is very low. Kim et al. [11] used the whole cells of S. nitritireducens to produce higher titers of 10-hydroxystearic acid under optimal reaction conditions, that is, pH 7.5, 35 ◦C, 0.05% (w/v) Tween 80, 20 g cells/L, and 30 g/L oleic acid in an anaerobic atmosphere. The enzymatic hydration of oleic acid (naturally occurring and one of the most abundant UFAs) into 10-HSA, has become a topic of substantial research and has received scientific attention in recent years. As the hydroxystearic acid is a precursor of γ-lactone (an important ingredient for perfumes and other cosmetics), biotransformation of oleic acid to 10-HAS is of great interest from an industrial perspective, particularly the flavor and fragrance industries [2]. In recent years, numerous studies have been carried out to convert various substrates into lactones, though using different materials (as a substrate) and strategies, such as olive oil, perilla oil, microalgae oil, and waste oil [12–14]. Herein, a putative oleate hydratase gene from L. garvieae was expressed in E. coli. The process operating conditions such as pH, temperature, the influence of metal ions, the concentration of substrate, and reaction duration were also optimized for the maximal bioconversion of oleic acid to 10-HSA by the oleic acid hydratase.

2. Materials and Methods

2.1. Strains, Vectors, Growth Conditions and Reagents Escherichia coli DH5α and BL21 (DE3) strains procured from Novagen (Madison, WI, USA), were utilized as cloning and expression host cells, respectively. A pET28a vector from Novagen was used both for cloning as well as expression purposes. Gene encoding oleate hydratase (UniProt ID: 34204340) was derived from Lactococcus garvieae (China Center for Type Culture Collection, China). E. coli DH5α and BL21 (DE3) were cultivated in Luria-Bertani (LB) medium (tryptone 10 g/L, yeast extract 5 g/L, sodium chloride 10 g/L (2% agar powder, if solid) with a final concentration of 50-µg kanamycin at 37 ◦C. BU-Taq Plus 2X Master PCR Mix (Biouniquer Technology, Beijing, China), restriction endonuclease (Thermo Fisher Scientific, Waltham, MA, USA), and T4 DNA ligase (NEB, Ipswich, MA, USA), were used for molecular cloning. A His-Bind Purification kit was provided by the Sangon Biotech Company (Shanghai, China). All other reagents and solvents were of the highest-purity grade and used as such. ProcessesProcesses2019 2019,,7 7,, 326 x FOR PEER REVIEW 33 of 1212

2.2. Gene Cloning 2.2. Gene Cloning The genomic DNA of L. garvieae was extracted by using a bacterial genomic DNA extraction kit The genomic DNA of L. garvieae was extracted by using a bacterial genomic DNA extraction kit (Easy Pure Genomic DNA Kit, Transgen Biotech, Beijing, China). Gene encoding the oleate hydratase (Easy Pure Genomic DNA Kit, Transgen Biotech, Beijing, China). Gene encoding the oleate hydratase was polymerase chain reaction (PCR) amplified using genomic DNA as a template. The gene was polymerase chain reaction (PCR) amplified using genomic DNA as a template. The gene sequence sequence of the upstream primer GF for gene cloning: of the upstream primer GF for gene cloning: 5 TTTCCATGGTGCGTTATACAAACGGAAATT3 and 5′TTTCCATGGTGCGTTATACAAACGGAAATT30 ′ and downstream primer 0 GR: downstream primer GR: 5 TTTCTCGAGAAGTAGCCCTGCATCTTTAA3 . Underlined are restriction 5′TTTCTCGAGAAGTAGCCCTGCATCTTTAA30 ′. Underlined are restriction0 sites by Nco1 and Xho1. sites by Nco1 and Xho1. Figure1 illustrates the complete process for constructing oleate hydratase Figure 1 illustrates the complete process for constructing oleate hydratase enzymes. The PCR- enzymes. The PCR-amplified DNA fragment and the pET-28a (+) plasmid vector were enzymatically amplified DNA fragment and the pET-28a (+) plasmid vector were enzymatically digested, and the digested, and the target gene was inserted into the pET-28a (+) vector followed by transformation target gene was inserted into the pET-28a (+) vector followed by transformation into E. coli DH5α. into E. coli DH5α. Recombinant E. coli DH5α was subjected to double enzyme digestion verification Recombinant E. coli DH5α was subjected to double enzyme digestion verification and colony PCR and colony PCR verification, and plasmid sequencing was performed. After successful sequencing, verification, and plasmid sequencing was performed. After successful sequencing, the recombinant the recombinant plasmids thus constructed were confirmed by sequence analysis and transformed into plasmids thus constructed were confirmed by sequence analysis and transformed into E. coli BL21 E. coli BL21 (DE3). (DE3).

Figure 1. A schematic representation for construction of the oleate hydratase. Figure 1. A schematic representation for construction of the oleate hydratase.

2.3.2.3. EnzymeEnzyme PurificationPurification E.E. colicoli BL21(DE3)BL21(DE3) positivepositive transformantstransformants werewere inoculatedinoculated andand growngrown intointo 500500 mLmL ofof LBLB cultureculture medium,medium, andand thenthen inducedinduced byby thetheincorporation incorporationof of 0.5 0.5 mM mMβ -D-thiogalactosideβ-D-thiogalactoside (IPTG) (IPTG) after after OD OD600600 reachedreached 0.6–0.8.0.6–0.8. After After 12 12 h, cultured cells were harvestedharvested andand washedwashed usingusing sterilesterile waterwater andand resuspendedresuspended inin aa 2020 mLmL bindingbinding bubufferffer (Novagen,(Novagen, HisHis BindBind PurificationPurification kit).kit). TheThe cellscells werewere brokenbroken byby sonication,sonication, centrifuged,centrifuged, andand thethe supernatantsupernatant waswas collectedcollected andand usedused forfor purification.purification. TheThe fusionfusion proteinsproteins with with His His (6 (6×)) tags tags were were applied applied on Hison BindHis Bind Purification Purification kit (Novagen) kit (Novagen) for purification. for purification. Briefly, × theBriefly, protein the extractprotein was extract mixed was with mixed the with binding the bubindingffer, added buffer, to added the column, to the andcolumn, collected and collected the flow throughthe flow to through the centrifuge to the centrifuge tube. This operationtube. This was operation repeated was three repeated times forthree better times protein for better combination protein withcombination the resin. with The columnthe resin. was The then column washed was with then a double washed column with volume a double of binding column/wash volume buff erof andbinding/wash the flow through buffer wasand collected.the flow through The histidine-tagged was collected. protein The histidine-tagged on the column protein was eluted on the twice column with was eluted twice with 50 mM imidazole. The eluate containing the fusion protein was then

Processes 2019, 7, x FOR PEER REVIEW 4 of 12 Processes 2019, 7, 326 4 of 12 concentrated by ultrafiltration and stored at −20 °C. The concentration of fusion proteins was 50quantified mM imidazole. with a BCA The eluateprotein containing assay kit. the fusion protein was then concentrated by ultrafiltration and stored at 20 ◦C. The concentration of fusion proteins was quantified with a BCA protein assay kit. 2.4. SDS-PAGE− 2.4. SDS-PAGE Approximately 100 mL of cultured cells were concentrated to 10 mL with a citrate-sodium citrate buffer,Approximately sonicated for 100one mLsec, ofrested cultured for 4 cellss, and were worked concentrated for 45 min. to After 10 mL sonication, with a citrate-sodium the cells were citratecentrifuged buffer, at sonicated 12,000 rpm for for one 15 sec, min. rested The for supern 4 s, andatant worked was used for 45 as min. a sample After for sonication, sodium thedodecyl cells weresulfate-polyacrylamide centrifuged at 12,000 gel rpmelectrophoresis for 15 min. (SDS The-PAGE) supernatant analysis. was Samples used as afor sample SDS-PAGE for sodium were dodecylneutralized sulfate-polyacrylamide using 1.0 M Tris-HCl gel (pH electrophoresis 6.8) before (SDS-PAGE)mixing with analysis.an equal Samplesvolume forof Laemmli SDS-PAGE Sample were neutralizedBuffer that contained using 1.0 M1% Tris-HCl SDS and (pH 10 mM 6.8) dithiothreitol. before mixing After with heating an equal at volume 95 °C for of 5 Laemmli min, all samples Sample Buwereffer separated that contained on a 12% 1% SDSSDS-PAGE and 10 mMgel prepared dithiothreitol. in house. After After heating electrophoresis, at 95 ◦C for 5gels min, were all samples fixed in werea fixing separated solution on (50% a 12% methanol, SDS-PAGE 10% gel acetic prepared acid) for in house.10 min, After washed electrophoresis, with water for gels at wereleast fixed40 min, in aand fixing protein solution bands (50% were methanol, visualized 10% using acetic a Coomassie acid) for 10 brilliant min, washed blue G-250 with staining. water for at least 40 min, and protein bands were visualized using a Coomassie brilliant blue G-250 staining. 2.5. Optimization of Reaction Conditions for 10-HSA Production 2.5. Optimization of Reaction Conditions for 10-HSA Production A range of buffers with a pH range of 5.5 to 8.0 was used in this assay to determine the optimal pH ofA rangethe oleate of bu ffhydratase.ers with a pHOptimal range temperatures of 5.5 to 8.0 was of used the inpurified this assay enzymes to determine were investigated the optimal pHby ofincubating the oleate the hydratase. reaction Optimal mixture temperatures at a temperature of the purifiedrange of enzymes 20 to 45 were °C investigatedand pH 7.5. by The incubating thermal thestabilities reaction of mixturethe oleate at ahydratas temperaturee were range measured of 20 toby 45 heating◦C and enzymes pH 7.5. Theat different thermal temperatures stabilities of the(20 oleate°C–45 hydratase°C) for up were to 120 measured h. Moreover, by heating the pH enzymes stabilities at diofff theerent oleate temperatures hydratase (20 were◦C–45 also◦ C)determined for up to 120following h. Moreover, incubating the pH enzymes stabilities into of the the sodium oleate hydratasecitrate buffer were (pH also 5.5–pH determined 8.0) with following a concentration incubating of enzymes100 mM intoat 30 the °C sodiumfor 90 min. citrate Chemicals buffer (pH with 5.5–pH a final 8.0) concentration with a concentration of 1 mM of were 100 mM added at 30 into◦C forthe 90reaction min. Chemicalscombination with to a investigate final concentration their effects of 1 mM on werethe oleate added hydratase into the reaction activities. combination In order toto investigatedetermine theirthe effect effects of on substrate the oleate concentration hydratase activities. on oleic In acid order hydratase, to determine the theamount effect of of oleic substrate acid concentrationincorporated onwas oleic ranged acid hydratase,from 10 g/L the to amount 70 g/L of at oleic 30 °C acid for incorporated 10 min. All was the rangedoptimization-related from 10 g/L to 70reactions g/L at 30 were◦Cfor carried 10 min. out All at the30 °C optimization-related in a 100 mM sodium reactions citratewere buffer carried (pH 7.5) out comprising at 30 ◦C in a of 100 30 mM g/L sodiumoleic acid, citrate 4% ethanol, buffer (pH and 7.5) 10 comprisingμL enzyme of solution 30 g/L oleic(105.49 acid, U/mL) 4% ethanol, for 10 min. and 10Theµ Lbiotransformation enzyme solution (105.49of oleic Uacid/mL) to for 10-HSA 10 min. in Thethe presence biotransformation of oleate hydratase of oleic acid under to 10-HSA optimized in thereaction presence conditions of oleate is hydrataseshown in Scheme under optimized 1. reaction conditions is shown in Scheme1.

SchemeScheme 1. 1. The biotransformation biotransformation of ofoleic oleic acid acid to 10-hydroxystearic to 10-hydroxystearic acid in acid the inpresence the presence of oleate of oleate hydratase. hydratase. 2.6. Analytical Methods 2.6. Analytical Methods The standard of 10-hydroxystearic acid was prepared in ethyl acetate solution at a concentration of The standard of 10-hydroxystearic acid was prepared in ethyl acetate solution at a concentration 64 µg/mL. A 0.5 mL of the standard solution (or sample) was taken in a 2 mL sample vial, and 100 µL of of 64 μg/mL. A 0.5 mL of the standard solution (or sample) was taken in a 2 mL sample vial, and 100 pyridine and 50 µL of N-methyl-N-(trimethylsilyl) trifluoroacetamide were added, mixed, and allowed μL of pyridine and 50 μL of N-methyl-N-(trimethylsilyl) trifluoroacetamide were added, mixed, and to react at 70 ◦C for 30 min to obtain silylated fatty acids [9]. After cooling to room temperate, the sample allowed to react at 70 °C for 30 min to obtain silylated fatty acids [9]. After cooling to room temperate, (1 µL) was injected in gas chromatography (SHIMADZU Excellence in Science GCMS-QP2010S, Tokyo the sample (1 μL) was injected in gas chromatography (SHIMADZU Excellence in Science GCMS- Japan), and quantified by a DB-5 capillary column (30 m 0.25 mm 0.25 µm) coupled to a flame QP2010S, Tokyo Japan), and quantified by a DB-5 capillary× column× (30 m × 0.25 mm × 0.25 μm) ionization detector (FID). He (purity: 99.999%) was used as the carrier gas with a constant flow rate coupled to a flame ionization detector (FID). He (purity: 99.999%) was used as the carrier gas with a of 1 mL/min. Injection temperature was 240 ◦C. The temperature program was as follows: the initial constant flow rate of 1 mL/min. Injection temperature was 240 °C. The temperature program was as oven temperature at 120 ◦C was held for 0.5 min and increased at 20 ◦C/min to reach 250 ◦C for 8 min. follows: the initial oven temperature at 120 °C was held for 0.5 min and increased at 20 °C/min to The hydroxy fatty acid products were identified by GC–mass spectrometry (MS) with an electron reach 250 °C for 8 min. The hydroxy fatty acid products were identified by GC–mass spectrometry impact ionization source. The ion source was operated at 70 eV and held at 230 ◦C.

Processes 2019, 7, x FOR PEER REVIEW 5 of 12

(MS) with an electron impact ionization source. The ion source was operated at 70 eV and held at 230 Processes°C. 2019, 7, 326 5 of 12

2.7. Statistical Analysis 2.7. Statistical Analysis All the experiments were carried out in triplicate and the results were expressed as means ± All the experiments were carried out in triplicate and the results were expressed as means standard deviation. ± standard deviation.

3.3. ResultsResults andand DiscussionDiscussion

3.1.3.1. CloningCloning andand MolecularMolecular CharacterizationCharacterization ofof FattyFatty AcidAcid HydrataseHydratase fromfromLactococcus Lactococcus garvieaegarvieae AA genegene encoding oleic oleic acid acid hydratase hydratase from from L.L. garvieae garvieae waswas cloned cloned into into the the pET-28a pET-28a (+) vector (+) vector and andthen then over-expressed over-expressed in E. in coliE. BL21(DE3). coli BL21(DE3). The oleic The oleicacid hydrat acid hydratasease gene was gene transformed was transformed into E. into coli E.BL21 coli byBL21 double by double enzyme enzyme digestion digestion of Nco1 of Nco1and Xh ando1, Xho1, and verified and verified by sequencing. by sequencing. The target The target gene geneand plasmid and plasmid were were approximately approximately 1700 1700 bp bpand and 5000 5000 bp, bp, respectively respectively (Figure (Figure 22A).A). TheThe sequencingsequencing resultsresults corroboratedcorroborated thatthat thethe targettarget genegene andand thethe vectorvector werewere transformedtransformed successfullysuccessfully intointo E.E. colicoli,, resultingresulting inin thethe constructionconstruction ofof recombinantrecombinant E.E. colicoli.. AA commerciallycommercially availableavailable Ni-NTANi-NTA resinresin columncolumn purifiedpurified thethe obtainedobtained crudecrude enzymeenzyme solution.solution. TheThe proteinprotein waswas mainlymainly over-expressedover-expressed asas aa solublesoluble formform inin the the recombinant recombinant cells cells with with the the occasional occasional observation observation of inclusion of inclusion bodies. bodies. When When eluted eluted 8 times 8 withtimes imidazole with imidazole at a concentration at a concentration of 10 mM, of the10 mM hybrid, the protein hybrid was protein almost was eluted, almost and eluted, thenthe and target then proteinthe target was protein eluted withwas 50eluted mM imidazole.with 50 mM The im purifiedidazole. protein The purified was immediately protein was concentrated immediately by ultrafiltrationconcentrated becauseby ultrafiltration imidazole because may precipitate imidazole the may protein precipitate following the aprotein longer exposure.following Notably,a longer theexposure. concentration Notably, and the purity concentration of the protein and were purity greatly of increasedthe protein by ultrafiltration.were greatly increased The purified by enzymeultrafiltration. elucidated The apurified solitary enzyme band on elucidated SDS-PAGE a withsolitary an band approximate on SDS-PAGE molecular with weight an approximate of 65 kDa (Figuremolecular2B), weight which wasof 65 found kDa (Figure to be in 2B), agreement which was with found the calculatedto be in agreement value of 67.2with kDa the basedcalculated on 587value amino of 67.2 acids kDa residues based on and 587 six amino histidine acids residues. residues and six histidine residues.

FigureFigure 2.2. ((AA)) DNA DNA gel gel electrophoresis, electrophoresis, M1—15K M1—15K DNA DNA marker, marker, M2—2K M2—2K DNA DNA marker, marker, Lane Lane 1 to 1 4— to 4—doubledouble digested digested bands; bands; (B) (MolecularB) Molecular mass mass determination determination of purified of puriﬁed oleate oleate hydratase hydratase enzyme enzyme from fromLactococcusLactococcus garvieae garvieae by SDS-PAGEby SDS-PAGE stained stained with Coomassie with Coomassie Blue. Lane Blue. M1—molecular Lane M1—molecular mass marker mass markerproteins proteins (100, 70, (100, 50, 40, 70, 30, 50, 25, 40, and 30, 14 25, kDa), and 14Lane kDa), 1—crude Lane 1—crudeextract, Lane extract, 2—purified Lane 2—puriﬁed oleate hydratase oleate hydrataseenzyme. enzyme.

3.2.3.2. IdentiﬁcationIdentification ofof ProductsProducts byby GC-MSGC-MS AnalysisAnalysis FigureFigure3 3 represents represents the the GC-MS GC-MS spectra spectra of of the the silylated silylated hydroxy hydroxy fatty fatty acid acid product product obtained obtained from from oleicoleic acidacid hydrationhydration byby thethe oleateoleate hydratasehydratase fromfrom L.L. garvieaegarvieae.. AA characteristiccharacteristic peakpeak appearedappeared atat mm/z/z 215.20 by the loss of C H O Si moiety from the silylated HFA. Similarly, the elimination of C H and 215.20 by the loss of 12C12H2525O2 2Si moiety from the silylated HFA. Similarly, the elimination8 of17 C8H17 C12H27OSi from the silylated product results in the formation of a peak at m/z 331. These characteristic fragmentation peaks clearly indicate the HFA as 10-hydroxystearic acid (Figure S1).

Processes 2019, 7, x FOR PEER REVIEW 6 of 12

Processesand C122019H27, OSi7, 326 from the silylated product results in the formation of a peak at m/z 331. These6 of 12 characteristic fragmentation peaks clearly indicate the HFA as 10-hydroxystearic acid (Figure S1).

Figure 3. Gas chromatography spectrum. (A) Standard, and (B) silylated hydroxy fatty acid product (10-hydroxystearicFigure 3. Gas chromatography acid) obtained spectrum. from oleic (A acid) Standard, by the oleateand (B hydratase) silylated from hydroxyL. garvieae fatty .acid product 3.3. Optimization(10-hydroxystearic of Reaction acid) obtained Conditions from oleic acid by the oleate hydratase from L. garvieae.

3.3.1.3.3. Optimization Inﬂuence of of Temperature Reaction Conditions

3.3.1.The Influence thermal of inﬂuence Temperature of varying reaction temperatures ranging from 20 to 45 ◦C on the relative activity of oleate hydratase was performed. The results obtained are portrayed in Figure4A.

The time-dependentThe thermal influence thermal of stability varying was reaction investigated temperatures by incubating ranging thefrom optimally 20 to 45 active°Con the fraction relative of activity of oleate hydratase was performed. The results obtained are portrayed in Figure 4A. The oleate hydratase for various times (0 to 120 h) at the temperature range 20 to 45 ◦C (Figure4B). In an earliertime-dependent case (activity thermal proﬁle), stability percent was relative investigated activity of by oleate incubating hydratase the was optimally increased active gradually fraction with of oleate hydratase for various times (0 to 120 h) at the temperature range 20 to 45 °C (Figure 4B). In an increasing temperature and found to be maximum at 30 ◦C. Beyond this temperature, the enzyme earlier case (activity profile), percent relative activity of oleate hydratase was increased gradually activity was dramatically decreased at 35 ◦C (up to 71% loss) presumably due to enzyme denaturation with increasing temperature and found to be maximum at 30 °C. Beyond this temperature, the and thereafter remains negligibly unchanged up to 45 ◦C. This sudden reduction in relative activity atenzyme30 C activity has also was been dramatically found in another decreased oleate at hydratase35 °C (up [ 11to ],71% regardless loss) presumably of the enzyme due sourceto enzyme and ≥ ◦ fermentationdenaturation strategy.and thereafter In the remains latter case negligibly (stability unchanged proﬁle), the up optimalto 45 °C. fraction This sudden incubated reduction for 90 in h relative activity at ≥30 °C has also been found in another oleate hydratase [11], regardless of the at 30 ◦C retained the highest stability (more than 50%) among all tested fractions at lower/higher enzyme source and fermentation strategy. In the latter case (stability profile), the optimal fraction temperatures. The stability trend was followed by fractions incubated at 25 ◦C and 35 ◦C for the sameincubated period for (90 90 h)h at and 30 retained°C retained up tothe 40% highest relative stability activity. (more At than the end 50%) of among stability all analysis tested fractions (120 h), at lower/higher temperatures. The stability trend was followed by fractions incubated at 25 °C and the fractions incubated at 20 ◦C, 40 ◦C and 45 ◦C showed the highest activity loss (up to 90%). However, 35 °C for the same period (90 h) and retained up to 40% relative activity. At the end of stability analysis the optimal fraction incubated at 30 ◦C retained up to 25% of its activity with an overall loss of 75% at that incubation period. Relatively high-thermostability of an enzyme is a desirable and fascinating Processes 2019, 7, x FOR PEER REVIEW 7 of 12

(120 h), the fractions incubated at 20 °C, 40 °C and 45 °C showed the highest activity loss (up to 90%). However, the optimal fraction incubated at 30 °C retained up to 25% of its activity with an overall Processesloss of 75%2019, 7at, 326that incubation period. Relatively high-thermostability of an enzyme is a desirable7 ofand 12 fascinating characteristic for industrial applications [15]. Earlier, Takeuchi et al. [16] reported that the enzyme CLA-HY (hydratase/dehydratase) retained higher than 80% of its original activity at characteristic for industrial applications [15]. Earlier, Takeuchi et al. [16] reported that the enzyme temperatures up to 32 °C and 28 °C in the presence and absence of FAD, respectively. CLA-HY (hydratase/dehydratase) retained higher than 80% of its original activity at temperatures up to 32 ◦C and 28 ◦C in the presence and absence of FAD, respectively.

100 A

20 Relative activity (%)

0 15 20 25 30 35 40 45 50 Temperature (°C)

Figure 4.4. InfluenceInﬂuence of varying temperature on the relative activity (A) andand thermalthermal stabilitystability ((B)) ofof oleate hydratasehydratase forfor oleicoleic acidacid biotransformationbiotransformation toto 10-hydroxystearic10-hydroxystearic acid.acid.

3.3.2. InfluenceInfluence of pH InIn orderorder toto assessassess thethe eeffectffect ofof pHpH onon enzymeenzyme activityactivity and stability, thethe reactionreaction waswas carriedcarried out at varyingvarying pHpH rangingranging fromfrom pHpH 5.55.5 toto 8.0.8.0. TheThe time-dependenttime-dependent stabilitystability analysis was performedperformed by incubatingincubating thethe optimallyoptimally activeactive fractionfraction ofof oleateoleate hydratasehydratase forfor variousvarious timestimes (0(0 toto 9090 min) at the same pHpH rangerange usedused forfor anan activityactivity profile.profile. Results in Figure5 5AA revealedrevealed thatthat thethe relativerelative activityactivity of of oleateoleate hydratase was graduallygradually increased withwith increasingincreasing pHpH values.values. The optimal pH ofof oleateoleate hydratasehydratase waswas foundfound toto bebe pHpH 7.5,7.5, andand aboveabove thisthis pH,pH, thethe enzymeenzyme activityactivity waswas decreased.decreased. TheThe stabilitystability curvescurves revealedrevealed thatthat oleate oleate hydratase hydratase incubated incubated at pHat pH 7.5 for7.5 30for min 30 min was thewas most the stablemost stable fraction fraction at that periodat that andperiod retained and retained up to 75% up of to its 75% original of its relative original activity, relative as activity, shown in as Figure shown5B. in The Figure fraction 5B. incubatedThe fraction at pH 5.5 at the same period was the least stable and retained only up to 25% (loss up to 75%). At the end of 90 min incubation, almost all fractions were not stable and showed maximum activity loss, that is, up to 100% at pH 5.5, 6 and 6.5, up to 95% at pH 7 and 8, and up to 90% at pH 7.5 (optimal Processes 2019, 7, x FOR PEER REVIEW 8 of 12

Processes 2019, 7, 326 8 of 12 incubated at pH 5.5 at the same period was the least stable and retained only up to 25% (loss up to 75%). At the end of 90 min incubation, almost all fractions were not stable and showed maximum fraction).activity The loss, current that is, optimal up to 100% pH ﬁnding at pH 5.5, is well 6 and aligned 6.5, up with to 95% earlier at pH reported 7 and 8, literature.and up to 90% Kim at et pH al. [11] 7.5 (optimal fraction). The current optimal pH finding is well aligned with earlier reported literature. reported that the conversion of oleic acid to 10-hydroxystearic acid by whole cells of S. nitritireducens Kim et al. [11] reported that the conversion of oleic acid to 10-hydroxystearic acid by whole cells of was maximal at 35 C and pH 7.5. Nocardia cholesterolicum NRRL 5767 gave a good yield with optimum S. nitritireducens◦ was maximal at 35 °C and pH 7.5. Nocardia cholesterolicum NRRL 5767 gave a good conditionsyield with at 40 optimum◦C and conditions pH 6.5, while at 40 the°C and conversion pH 6.5, while rate the was conversion maximal rate at 35was◦C maximal and pH at 7.535 °C by the wholeand cells pH of 7.5Nocardia by the whole paraﬃ cellsnae [of7, Nocardia8]. paraffinae [7,8].

FigureFigure 5. Inﬂuence 5. Influence of varying of varying pH pH levels levels on on the the relative relative activity (A (A) )and and stability stability (B) ( ofB) oleate of oleate hydratase hydratase for oleicfor acidoleic acid bioconversion bioconversion to 10-hydroxystearicto 10-hydroxystearic acid. acid.

3.3.3.3.3.3. Influence Influence of Metal of Metal Ions Ions TheThe stimulatory stimulatory or inhibitoryor inhibitory influence influenc of variouse of monovalent,various monovalent, divalent, and divalent, trivalent metaland ions includingtrivalent K+, Na metal+, Ca ions2+, Mg including2+, Fe2+, ZnK+2,+ ,Na Cu+,2 +Ca, Mn2+, 2Mg+, and2+, Fe Fe2+3+, ,Zn respectively2+, Cu2+, Mn were2+, and tested Fe against3+, the freshly obtained oleate hydratase (Figure6). As compared to the control, the oleate hydratase activity was significantly influenced and induced by monovalent and divalent metal ions, except Fe2+. The stimulatory potential order of these metal ions was as: Mg2+ > Ca2+ > Cu2+ > Mn2+ > Zn2+ > K+ > Na+. Both Fe2+ and Fe3+ inhibited the oleate hydratase activity. The inhibitory potential of Fe3+ was more evident. The inhibitory activity may be due to the insoluble complex formation Processes 2019, 7, x FOR PEER REVIEW 9 of 12

respectively were tested against the freshly obtained oleate hydratase (Figure 6). As compared to the control, the oleate hydratase activity was significantly influenced and induced by monovalent and divalent metal ions, except Fe2+. The stimulatory potential order of these metal ions was as: Mg2+ Processes 2019, 7, 326 9 of 12 > Ca2+ > Cu2+ > Mn2+ > Zn2+ > K+ > Na+. Both Fe2+ and Fe3+ inhibited the oleate hydratase activity. The inhibitory potential of Fe3+ was more evident. The inhibitory activity may be due to the insoluble withcomplex these metals formation [16,17 with]. In these a previous metals [16,17]. study, In Joo a etprev al.ious [18 ]study, reported Joo et up al. to [18] 25–44% reported reduction up to 25– in the ethylenediaminetetraacetic44% reduction in the ethylenediaminetetraacetic acid (EDTA)-treated oleate acid hydratase (EDTA)-treated activity oleate upon hydratase the addition activity of divalent metalupon ions. the As addition compared of to divalent earlier studies, metal ions. the activity As compared proﬁle ofto oleateearlier hydratase studies, the showed activity its high stabilityprofile against of oleate diﬀerent hydratase metal ions. showed its high stability against different metal ions.

FigureFigure 6. Inﬂuence 6. Influence of variousof various monovalent, monovalent, divalent,divalent, and and tr trivalentivalent metal metal ions ions on onthe theactivity activity of freshly of freshly obtainedobtained oleate oleate hydratase hydratase from fromLactococcus Lactococcus garvieae garvieae..

3.3.4.3.3.4. Influence Influence of Substrate of Substrate Concentration Concentration To investigateTo investigate the the substrate substrate influence influence onon thethe ol oleateeate hydratase hydratase activity, activity, varying varying concentrations, concentrations, that is,that 10–70 is, 10–70 g/ Lg/L of ofoleic oleic acid, acid, as as a substrate, a substrate, were weretrialed. trialed. The results The obtained results are obtained displayed are in Figure displayed in Figure7. The7 .maximal The maximal enzyme activity enzyme was activity found at was the foundsubstrate at concentration the substrate of concentration30 g/L. The substrate- of 30 g /L. dependent activity curve in Figure 7 confirms that the recorded activity trend was proportional to The substrate-dependent activity curve in Figure7 confirms that the recorded activity trend was the substrate concentration. This is because the enzyme activity increases initially with increasing proportionalsubstrate to concentration. the substrate However, concentration. beyond This the opti is becausemal substrate the enzyme level (30 activity g/L), the increases enzyme initially activity with increasingstarts substratedecreasing. concentration. This observed However,increasing/decre beyondasing the activity optimal phenomenon substrate level is according (30 g/L), theto the enzyme activityenzyme-substrate starts decreasing. interfaces This which observed follow increasing the law of/decreasing mass-action activity [19]. Further phenomenon addition of is substrate according to the enzyme-substratebeyond the optimal interfaces level (30 g/L) which causes follow reduction the law in of the mass-action relative activity, [19]. wh Furtherich could addition be due of to substrate the beyondsubstrate the optimal hindrance level around (30 g the/L) catalytic causes reduction site, and substrate in the relative or product activity, inhibition which phenomena. could be due to the Processessubstrate 2019 hindrance, 7, x FOR PEER around REVIEW the catalytic site, and substrate or product inhibition phenomena.10 of 12

FigureFigure 7. InfluenceInﬂuence of of varying varying substrate substrate (oleic (oleic acid) acid) concen concentrationstrations on on the the activity activity of of freshly freshly obtained obtained oleateoleate hydratase from Lactococcus garvieae .

3.3.5. Influence of Reaction Time on Oleic Acid Biotransformation to 10-HSA Time-course reactions for biotransformation of oleic acid to 10-HSA by oleate hydratase was carried out for 0.5 to 8 h using the optimal conditions of pH 7.5, and 30 °C. The results obtained are shown in Figure 8. The biotransformation rate of oleic acid to 10-hydroxystearic acid by oleate hydratase was quite slow during initial reaction hours. At the end of 3 h reaction period, up to 92 μg/mL, 10-hydroxystearic acid was recorded. However, by the end of 7th h, the biotransformation of oleic acid to 10-HSA was increased up to 250 μg/mL, which is double of the first 3 h reaction. Further, with an increase in the reaction time from 7 h up to 8 h, the product conversion was not significant, and the maximum yield was 258 μg/mL. As reported earlier by Kim et al. [11], only 19.9 g/L 10- hydroxystearic acid was produced within 2.7 h with a yield of 63% (mol/mol) under aerobic conditions. Koritala et al. [8] reported that anaerobic conditions are more favorable for a stimulated conversion of oleic acid to 10-hydroxystearic acid. Comparatively, under anaerobic conditions, around 98% hydroxy acid and 2% keto acid were obtained, whereas, under aerobic conditions, only 88% hydroxy acid and 12% keto acid were obtained [8].

Figure 8. Time-course reactions for oleic acid transformation to 10-hydroxystearic acid by oleate hydratase under the optimal conditions of pH 7.5 and 30 °C. Data represent the means of three experiments and error bars represent standard deviation.

Processes 2019, 7, x FOR PEER REVIEW 10 of 12

ProcessesFigure2019 ,7.7 ,Influence 326 of varying substrate (oleic acid) concentrations on the activity of freshly obtained10 of 12 oleate hydratase from Lactococcus garvieae.

3.3.5.3.3.5. Influence Influence of of Reaction Reaction Time Time on Oleic Acid Biotransformation to 10-HSA Time-courseTime-course reactions reactions for for biotransformation of of oleic oleic acid acid to to 10-HSA by oleate hydratase was carriedcarried out out for for 0.5 0.5 to to 8 8h husing using the the optimal optimal conditions conditions of ofpH pH 7.5, 7.5, and and 30 °C. 30 ◦TheC. The results results obtained obtained are shownare shown in Figure in Figure 8. 8The. The biotransformation biotransformation rate rate of of oleic oleic acid acid to to 10-hydroxystearic 10-hydroxystearic acid by oleateoleate hydratasehydratase was was quite quite slow slow during during initial initial reaction reaction hours. hours. At At the the end end of of3 h 3 reaction h reaction period, period, up upto 92 to μ92g/mL,µg/mL, 10-hydroxystearic 10-hydroxystearic acid acid was was recorded. recorded. However, However, by bythe the end end of 7th of 7th h, the h, the biotransformation biotransformation of oleicof oleic acid acid to 10-HSA to 10-HSA was increased was increased up to up250 to μg/mL, 250 µ gwhich/mL, whichis double is doubleof the first of the3 h reaction. first 3 h Further, reaction. withFurther, an increase with an in increase the reaction in the time reaction from time7 h up from to 8 7 h, h the up product to 8 h, the conversion product conversionwas not significant, was not andsignificant, the maximum and the yield maximum was 258 yield μg/mL. was As 258 reportedµg/mL. Asearlier reported by Kim earlier et al. by [11], Kim only et al.19.9 [11 g/L], only 10- hydroxystearic19.9 g/L 10-hydroxystearic acid was acidproduced was produced within 2.7 within h with 2.7 h witha yield a yield of 63% of 63% (mol/mol) (mol/mol) under under aerobic aerobic conditions.conditions. KoritalaKoritala et et al. al. [8] [8] reportedreported that that anaerobic anaerobic conditions conditions are are more more favorable for for a stimulated conversionconversion ofof oleicoleic acid acid to to 10-hydroxystearic 10-hydroxystearic acid. acid. Comparatively, Comparatively, under under anaerobic anaerobic conditions, conditions, around around98% hydroxy 98% hydroxy acid and acid 2% and keto 2% acid keto were acid obtained,were obtained, whereas, whereas, under under aerobic aerobic conditions, conditions, only only 88% 88%hydroxy hydroxy acid acid and 12%and 12% keto keto acid acid were were obtained obtained [8]. [8].

FigureFigure 8. Time-courseTime-course reactions reactions for for oleic oleic acid acid transformation transformation to to 10-hydr 10-hydroxystearicoxystearic acid acid by by oleate hydratasehydratase under under the the optimal optimal conditions conditions of of pH pH 7. 7.55 and and 30 30 °C.◦C. Data Data represent represent the the means means of of three three experimentsexperiments and and error error bars re representpresent standard deviation.

4. Conclusions In conclusion, the production of 10-HSA by recombinant oleic acid hydratase has more advantages than microbial biotransformation. The use of recombinant technology to obtain a purified enzyme is a simple, low-cost operation and results in 10-HSA with high yield. Genes encoding oleic acid hydratase could be improved by genetic manipulation, error-prone PCR, DNA shuffling and modifying determinant residues on or near the active site. The characterization profiles revealed that the pH and thermal tolerance of freshly obtained and recombinant oleate hydratase from Lactococcus garvieae was higher compared with the previous reports. The effect of monovalent metal ions was also positive and stimulated the enzyme activity up to a certain extent. Moreover, a maximal of 258 µg/mL 10-hydroxystearic acid was also recorded during the biotransformation of oleic acid by oleate hydratase. This research could be helpful for the industrial-scale synthesis of 10-HAS and contributes to the promotion of the flavor and fragrance industries.

Supplementary Materials: The following are available online at http://www.mdpi.com/2227-9717/7/6/326/s1. Figure S1. Gas chromatography/mass spectroscopy (GC/MS) spectrum of the silylated hydroxy fatty acid product (10-hydroxystearic acid) obtained from oleic acid by the oleate hydratase from L. garvieae. Processes 2019, 7, 326 11 of 12

Author Contributions: Study design, J.Z. (Jing Zhang) and Y.Z.; Data collection, J.Z. (Jiaheng Zhang); Data analysis, S.L. and H.L.; Data interpretation, C.L. and H.L.; Literature search, J.Z. (Jing Zhang) and H.S.; Writing-Original Draft Preparation, M.B., and H.M.N.I.; Revisions & Final editing, J.Z. (Jing Zhang), M.B., H.M.N.I. and Y.Z.; Project & Grant acquisition, Y.Z. Funding: This work was financially supported by a study on highly efficient biotransformation of oleic acid and linoleic acid to γ-decalactone in Yarrowia lipolytica based on synthetic biology (21606097). The authors also acknowledge the support from Postgraduate Research & Practice Innovation Program of Jiangsu Province (SJCX17_0700), and Young academic leaders in Jiangsu Province, Six-talent peaks project in Jiangsu Province (2015-SWYY-026). Conflicts of Interest: The authors report no conflicting interests in any capacity; competing or financial.

References

1. Chen, B.S.; Otten, L.G.; Hanefeld, U. Stereochemistry of enzymatic water addition to c=c bonds. Biotechnol. Adv. 2015, 33, 526–546. [CrossRef][PubMed] 2. Park, A.K.; Lee, G.H.; Kim, D.W.; Jang, E.H.; Kwon, H.T.; Chi, Y.M. Crystal structure of oleate hydratase from, Stenotrophomonas, sp. kctc 12332 reveals conformational plasticity surrounding the fad-binding site. Biochem. Biophys. Res. Commun. 2018, 499, 772–776. [CrossRef][PubMed] 3. Ortega-Anaya, J.; Hernández-Santoyo, A. Functional characterization of a fatty acid double-bond hydratase from lactobacillus plantarum and its interaction with biosynthetic membranes. Biochim. Biophys. Acta-Biomembr. 2015, 1848, 3166–3174. [CrossRef][PubMed] 4. Chance, D.L.; Gerhardt, K.O.; Mawhinney, T.P. Gas-liquid chromatography-mass spectrometry of hydroxy fatty acids as their methyl esters tert.-butyldimethylsilyl ethers. J. Chromatogr. A 1998, 793, 91–98. [CrossRef] 5. Naughton, F.C. Production, chemistry and commercial applica-tions of various chemicals from castor oil. J. Am. Oil Chem. Soc. 1974, 51, 65–71. [CrossRef] 6. Kim, K.R.; Oh, D.K. Production of hydroxy fatty acids by microbial fatty acid-hydroxylation enzymes. Biotechnol. Adv. 2013, 31, 1473–1485. [CrossRef][PubMed] 7. Latrasse, A.; Paitier, S.; Lachot, B.; Bonnarme, P.; Feron, G.; Durand, A.; Le, Q.J. Conversion of oleic acid to 10-hydroxystearic acid by Nocardia paraﬃnae. Biotechnol. Lett. 1997, 19, 715–718. [CrossRef] 8. Koritala, S.; Hou, C.; Hesseltine, C.; Bagby, M. Microbial conversion of oleic acid to 10-hydroxystearic acid. Appl. Microbiol. Biotechnol. 1989, 32, 299–304. [CrossRef] 9. Hudson, J.; MacKenzie, C.; Joblin, K. Conversion of oleic acid to 10-hydroxystearic acid by two species of ruminal bacteria. Appl. Microbiol. Biotechnol. 1995, 44, 1–6. [CrossRef][PubMed] 10. Oh, H.J.; Kim, S.U.; Song, J.W.; Lee, J.H.; Kang, W.R.; Jo, Y.S. Biotransformation of linoleic acid into hydroxy fatty acids and carboxylic acids using a linoleate double bond hydratase as key enzyme. Adv. Synth. Catal. 2015, 357, 408–416. [CrossRef] 11. Kim, B.N.; Yeom, S.J.; Oh, D.K. Conversion of oleic acid to 10-hydroxystearic acid by whole cells of Stenotrophomonas nitritireducens. Biotechnol. Lett. 2011, 33, 993–997. [CrossRef][PubMed] 12. Kitazume, T.; Yamazaki, Y.; Matsuyama, S.; Shoun, H.; Takaya, N. Production of hydroxy-fatty acid derivatives from waste oil by Escherichia coli cells producing fungal cytochrome P450foxy. Appl. Microbiol. Biotechnol. 2008, 79, 981–988. [CrossRef][PubMed] 13. Ahmad, F.B.; Zhang, Z.; Doherty, W.O.; O’Hara, I.M. A multi-criteria analysis approach for ranking and selection of microorganisms for the production of oils for biodiesel production. Bioresour. Technol. 2015, 190, 264–273. [CrossRef][PubMed] 14. Kim, K.R.; An, J.U.; Lee, S.H.; Oh, D.K. Selective production of 9R-hydroxy-10E,12Z,15Z-octadecatrienoic acid from alpha-linolenic acid in perilla seed oilhydrolyzate by a lipoxygenase from Nostoc Sp. SAG 25.82. PLoS ONE 2015, 10, e0137785. 15. Fadel, M. Production physiology of cellulases and β-glucosidase enzymes of Aspergillus niger grown under solid state fermentation conditions. Online J. Biol. Sci. 2000, 1, 401–411. 16. Takeuchi, M.; Kishino, S.; Hirata, A.; Park, S.B.; Kitamura, N.; Ogawa, J. Characterization of the linoleic acid ∆9 hydratase catalyzing the ﬁrst step of polyunsaturated fatty acid saturation metabolism in Lactobacillus plantarum AKU 1009a. J. Biosci. Bioeng. 2015, 119, 636–641. [CrossRef][PubMed] 17. Chen, L.; Meng, H.; Jiang, L.; Wang, S. Fatty-Acid–Metal-Ion Complexes as Multicolor Superhydrophobic Coating Materials. Chem. Asian J. 2011, 6, 1757–1760. [CrossRef][PubMed] Processes 2019, 7, 326 12 of 12

18. Joo, Y.C.; Jeong, K.W.; Yeom, S.J.; Kim, Y.S.; Kim, Y.; Oh, D.K. Biochemical characterization and FAD-binding analysis of oleate hydratase from Macrococcus caseolyticus. Biochimie 2012, 94, 907–915. [CrossRef][PubMed] 19. Bhagavan, N.V.; Ha, C.E. Enzymes and Enzyme Regulation. In Essentials of Medical Biochemistry; Academic Press: Cambridge, MA, USA, 2011; pp. 47–58.

© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).