Cardiopulmonary Protective Role of Probiotics and the Ace2/Ang- (1-7)/Mas Axis of the Renin-Angiotensin System

CARDIOPULMONARY PROTECTIVE ROLE OF PROBIOTICS AND THE ACE2/ANG- (1-7)/MAS AXIS OF THE RENIN-ANGIOTENSIN SYSTEM

COLLEEN THERESE COLE JEFFREY

A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2017

To my husband and best friend, Randy, with whom all things seem possible, and to our children Amelia Therese, Adeline Jane, and Samuel Joseph, for I am a mother first and a scientist second. My most important work is you.

ACKNOWLEDGMENTS

There are many individuals who I need to acknowledge for their roles in my life.

Scientifically, I need to thank the people who first got me interested in science: my high school biology teacher, Scott McKissock, and three incredible undergraduate mentors at

Gannon University: Steve Ropski, Melanie Gustafson-Ropski, and Fr. Joseph Gregorek.

Since then, my PhD journey has been long, and I could not have been successful without the patient teaching and mentorship of lab mates whom I am lucky to call friends. From the University of Notre Dame, I am grateful for Luciana Caseletti, Sinji

Tauhata, Jason Bader, Jamie Kasuboski, and Kara Huegel. I am also in debt to my

Notre Dame friends: Amy (Rohly) Gorowsky, Ryne Gorsuch, Michelle Favila, Ellen

(Flannery) Kelly, Bryan Cassone, and Paul Kroeger, among many others. Go Irish!

From the University of Florida, I could not have completed my projects without the help and advice of Yanfei Qi and Vinayak Shenoy – and I am also very thankful for their friendship. I would also like to thank Elaine Sumners, Amrisha Verma, Quihong Li,

Sugata Hazra, Victor Aquino, Monica Santisteban, Gil Lobaton, CJ Song, Erin Bruce,

Avinash Singh Mandloi, Ashok Kumar, and Sara Croft for help with experiments and training. Thanks to Viktoria (Hyddmark) Sullivan and Kristy Shimp for first year study group and sharing the trials of graduate school. Further, I would be remiss if I did not thank my very supportive committee members for their time and thoughtful suggestions:

Peter Sayeski, Michael Katovich, Glenn Walter, and Naohiro Terada. Lastly, but most importantly, I am very grateful for my mentor, Mohan Raizada, and for the opportunities he has provided me. From Mohan, I have received invaluable scientific training in addition to learning important life lessons. Aside from being an incredible scientist,

Mohan is also a wise and thoughtful person. I absolutely could not have completed this

training without his guidance, understanding, patience, and humor. His often-repeated conviction that “Good parents make good scientists” is a sentiment that I will take with me.

Science aside, I have been blessed with a social support system that is unmatched. My parents, Kevin and Kathleen Cole, have provided unwavering encouragement and unconditional love, as well as much needed insight and perspective. The more I see of the world, the more I am convinced that what you accomplish in life is a (direct or indirect) result of who your parents are, and with my parents, I hit the jackpot. I am also lucky to have siblings (Diana, John, Bridget, Kevin, and Kaley) and their spouses and children who remind me that there is more to life than science and who provide me with humor and keep me grounded. Additionally, I need to thank my in-laws Derm and Laura for their support and love for our family, and Carole and Brian, for their selfless giving to us and our children and for keeping the home fires burning while we pursue our dreams. And I save the biggest thank you for my husband and best friend, Randy. The benefits of having a spouse who understands the demands, frustrations, and exhilaration of science and graduate school cannot be overstated. Randy has been my personal cardiology resource, and his outside perspective on my research has been invaluable. More importantly, he has been my rock through the joys and difficulties of the last ten years, and I could not ask for a better boyfriend for life. Lastly, I thank my beautiful and sweet children, Amelia, Adeline, and

Samuel, who are my constant inspiration. Seeing life through the eyes of my children is a blessing and a daily reminder that love is all that matters in the end.

TABLE OF CONTENTS

page

ACKNOWLEDGMENTS ...... 4

LIST OF TABLES ...... 9

LIST OF FIGURES ...... 10

LIST OF ABBREVIATIONS ...... 13

ABSTRACT ...... 15

CHAPTER

1 CARDIOPULMONARY DISEASE ...... 17

Heart Failure ...... 17 Pulmonary Hypertension ...... 24 Renin-Angiotensin System ...... 29 Overview ...... 29 Vasoprotective Renin-Angiotensin System in Cardiovascular Injury ...... 32 Vasoprotective Renin-Angiotensin System in Pulmonary Injury ...... 38 Future Therapies for Cardiopulmonary Disease ...... 40 Cell Therapy ...... 40 Gut Microbiota ...... 44 Summary ...... 48

2 BENEFICIAL EFFECTS OF ANGIOTENSIN-(1-7) ON CD34+ CELLS FROM HEART FAILURE PATIENTS ...... 52

Introduction ...... 52 Methods ...... 55 Patient Selection and Characterization ...... 55 Isolation of Human CD34+ Cells from Peripheral Blood of HF and Control Donors...... 56 Quantification of CD34+ Cells from Whole Blood ...... 56 Colony Formation Assay ...... 57 Cell Migration Assay ...... 58 Measurement of Nitric Oxide Production ...... 58 Measurement of Reactive Oxygen Species...... 59 Gene Expression by Real Time RT-PCR ...... 59 Acetylation of Human Cardiac Progenitor Cells ...... 60 Protein Quantification and Western Blot ...... 61 Statistical Analyses ...... 62 Determination of Total Protein ...... 62 Results ...... 66

CD34+ Cells from HF Patients Exhibit Reduced Number, Impaired Migration, and Altered Colony-Forming Ability ...... 66 CD34+ Cells from HF Patients Demonstrate Aberrant Production of Nitric Oxide and Reactive Oxygen Species ...... 67 CD34+ Cells from HF Patients Display Altered Renin-Angiotensin System Gene Expression ...... 67 Ang-(1-7) Improves Migratory Ability, NO Bioavailability, and ROS Production of CD34+ Cells...... 68 Ang-(1-7) Treatment Induces Alterations in Histone Acetylation and Protein Expression ...... 69 Discussion ...... 70

3 ORAL DELIVERY OF LACTOBACILLUS PARACASEI CONFERS PROTECTION AGAINST PULMONARY HYPERTENSION ...... 99

Introduction ...... 99 Methods ...... 101 Bacterial Culture and Lysis ...... 101 Pulmonary Hypertension Experimental Design ...... 103 Right Ventricular Systolic Pressure Measurement ...... 103 Hypertrophy and Histological Analysis ...... 104 Real-Time RT-PCR Analysis ...... 106 Feces Collection and Bacterial Analysis ...... 107 FITC-dextran Permeability Assay ...... 110 ACE and ACE2 Activity ...... 111 Measurement of Angiotensin-(1-7) ...... 112 Statistical Analysis ...... 112 Results ...... 113 Oral Feeding of Lactobacillus paracasei Prevents Development of Monocrotaline-Induced Pulmonary Hypertension...... 113 Oral Feeding of Lactobacillus paracasei Is Associated with Reduction in Proinflammatory Cytokines...... 114 Monocrotaline-Induced Dysbiosis and Gut Pathology Are Altered by Oral Feeding of Lactobacillus paracasei ...... 115 Lactobacillus paracasei Contains ACE and ACE2 Enzymatic Activity ...... 116 Discussion ...... 117

4 GENETICALLY MODIFIED LACTOBACILLUS PARACASEI FOR ORAL DELIVERY OF ANGIOTENSIN-(1-7) CONFERS PROTECTION AGAINST PULMONARY HYPERTENSION ...... 144

Introduction ...... 144 Methods ...... 146 Plasmids and Construction of Recombinant Plasmid ...... 146 Bacterial Culture and Electroporation ...... 147 Measurement of Angiotensin-(1-7) ...... 148 Pulmonary Hypertension Experimental Design ...... 148

Right Ventricular Systolic Pressure Measurement ...... 149 Hypertrophy and Histological Analysis ...... 149 Real-Time RT-PCR Analysis ...... 150 Statistical Analysis ...... 151 Results ...... 151 Oral Feeding of LP-Ang-(1-7) Attenuates Monocrotaline-Induced Pulmonary Hypertension...... 151 Oral Feeding of LP-Ang-(1-7) Is Associated with Alterations in Proinflammatory Cytokines and the Renin-Angiotensin System...... 153 LP-Ang-(1-7) Prevents Monocrotaline-Induced Gut Pathology ...... 154 Discussion ...... 154

5 CONCLUSIONS ...... 170

APPENDIX: ANG-(1-7)-INDUCED ALTERATIONS IN PROTEIN EXPRESSION IN HUMAN CARDIAC PROGENITOR CELLS ...... 173

LIST OF REFERENCES ...... 188

BIOGRAPHICAL SKETCH ...... 222

LIST OF TABLES

Table page

2-1 Baseline characteristics of study participants ...... 93

2-2 Proteins upregulated ≥ 3 fold after Ang-(1-7) treatment of hCPCs...... 95

2-3 Proteins downregulated ≥ 3 fold after Ang-(1-7) treatment of hCPCs...... 96

2-4 List of top ten most significantly altered canonical pathways...... 97

3-1 qPCR analysis of Lactobacillus paracasei levels in feces following one time oral gavage of L.paracasei in rats ...... 143

A-1 Proteins downregulated ≥ -1.5 and < -3 fold after Ang-(1-7) treatment of hCPCs...... 173

A-2 Proteins upregulated ≥ 1.5 and < 3 fold after Ang-(1-7) treatment of hCPCs. .. 174

LIST OF FIGURES

Figure page

1-1 Pathophysiology of heart failure...... 49

1-2 Pathophysiology of pulmonary hypertension...... 50

1-3 Renin-angiotensin system...... 51

2-1 Reduced number of CD34+ cells in HF patients...... 81

2-2 Reduced migratory capacity of CD34+ cells in HF patients ...... 81

2-3 Altered colony-forming capability of CD34+ cells in HF patients ...... 82

2-4 Decreased nitric oxide bioavailability of CD34+ cells in HF patients...... 83

2-5 Increased reactive oxygen species production in CD34+ cells in HF patients .... 83

2-6 Altered gene expression of components of the renin-angiotensin system in CD34+ cells from HF patients ...... 84

2-7 Pre-treatment of CD34+ cells with Ang-(1-7) enhances migratory capacity ...... 85

2-8 Pre-treatment of CD34+ cells with Ang-(1-7) improves nitric oxide bioavailability ...... 86

2-9 Pre-treatment of CD34+ cells with Ang-(1-7) reduces reactive oxygen species production ...... 86

2-10 Acetylation of human cardiac progenitor cells in response to Ang-(1-7) treatment ...... 87

2-11 The most significant protein network affected by Ang-(1-7) treatment identifies around fibronectin ...... 88

2-12 The second-most significant protein network affected by Ang-(1-7) treatment identifies around 60s ribosomal subunit, RhoA kinase, and actin ...... 89

2-13 Proteins in the EIF2 signaling pathway affected by Ang-(1-7) treatment ...... 90

2-14 Proteins in the epithelial adherens junctions pathway affected by Ang-(1-7) treatment ...... 91

2-15 Proteins in the calveolar-mediated endocytosis signaling pathway affected by Ang-(1-7) treatment ...... 92

3-1 Comparison of lysis methods for Lactobacillus paracasei ...... 127

3-2 Experimental design ...... 128

3-3 Determination of optimal fluorogenic substrate concentration for ACE2 activity assay ...... 129

3-4 Effects of lysozyme on ACE2 activity ...... 129

3-5 Lactobacillus paracasei gene expression in rat feces after single oral dose of L. paracasei ...... 130

3-6 Oral feeding of Lactobacillus paracasei attenuates MCT-induced PH ...... 131

3-7 Oral feeding of Lactobacillus paracasei attenuates MCT-induced changes in cardiac contractility ...... 131

3-8 Lactobacillus paracasei has no effect on cardiac function in control animals ... 132

3-9 Pseudomonas aeruginosa has no effect on cardiac function of control or MCT-challenged animals ...... 133

3-10 Oral feeding of Lactobacillus paracasei protects against MCT-induced cardiac fibrosis ...... 134

3-11 Oral feeding of Lactobacillus paracasei protects against MCT-induced pulmonary vascular remodeling ...... 135

3-12 Effects of oral feeding of Lactobacillus paracasei on MCT-induced increases in proinflammatory cytokines ...... 136

3-13 Principle coordinate analysis of gut microbiota composition ...... 137

3-14 Relative abundance plots display differences in abundance of OTUs at the species taxonomic ranking ...... 138

3-15 Increased intestinal permeability induced by MCT...... 139

3-16 Oral feeding of Lactobacillus paracasei prevents MCT-induced increases in villus length ...... 140

3-17 Oral feeding of Lactobacillus paracasei has no effect on MCT-induced reduction in goblet cells ...... 141

3-18 ACE activity in Lactobacillus paracasei ...... 142

3-19 ACE2 activity in Lactobacillus paracasei ...... 142

4-1 Ang-(1-7) expression construct...... 159

4-2 Growth curves for Lactobacillus paracasei in the presence of glycine...... 159

4-3 Comparison of lactate dehydrogenase (ldh) and surface (S)-layer protein (slp) promoters to drive expression of GFP in Lactobacillus paracasei...... 160

4-4 Comparison of serum Ang-(1-7) levels in mice fed with Lactobacillus paracasei-Ang-(1-7) or bioencapsulated Ang-(1-7) ...... 161

4-5 Oral feeding of Lactobacillus paracasei-Ang-(1-7) attenuates MCT-induced pulmonary hypertension ...... 162

4-6 Oral feeding of Lactobacillus paracasei-Ang-(1-7) attenuates MCT-induced changes in cardiac function...... 162

4-7 Oral feeding of Lactobacillus paracasei or LP-Ang-(1-7) protects against MCT-induced cardiac fibrosis ...... 163

4-8 Oral feeding of Lactobacillus paracasei -Ang-(1-7) protects against MCT- induced pulmonary vascular remodeling ...... 164

4-9 Effects of oral feeding of Lactobacillus paracasei or LP-Ang-(1-7) on MCT- induced increases in proinflammatory cytokines ...... 165

4-10 Effects of oral feeding of Lactobacillus paracasei or LP-Ang-(1-7) on RAS components in MCT-challenged animals ...... 166

4-11 Oral feeding of Lactobacillus paracasei-Ang-(1-7) reduces MCT-induced changes in villus length ...... 167

4-12 Oral feeding of Lactobacillus paracasei-Ang-(1-7) restores goblet cell number in MCT-challenged animals ...... 168

4-13 Comparison of Ang-(1-7) treatments on MCT-induced PH ...... 169

LIST OF ABBREVIATIONS

ACE Angiotensin converting enzyme

ACE2 Angiotensin converting enzyme 2

Ang I Angiotensin I

Ang II Angiotensin II

Ang-(1-7) Angiotensin-(1-7)

AT1R Angiotensin II type 1 receptor

AT2R Angiotensin II type 2 receptor

CFU Colony forming units

DIZE Diminazene aceturate

FITC Fluorescein isothiocyanate

GAPDH Glyceraldehyde-3-phosphate dehydrogenase

GFP Green fluorescence protein hCPC Human cardiac progenitor cells

HF Heart failure

HMGB1 High mobility group box 1

Iba-1 Ionized calcium-binding adapter molecule 1

IL-1β Interleukin-1β

IL-6 Interleukin-6

LV Left ventricle

MCT Monocrotaline mRNA Messenger ribonucleic acid

PEG Polyethylene glycol

PH Pulmonary hypertension qPCR Quantitative real-time polymerase chain reaction

rhACE2 Recombinant human angiotensin converting enzyme 2

RV Right ventricle

RVH Right ventricular hypertrophy

RVSP Right ventricular systolic pressure

SDF-1α Stromal cell-derived factor 1α

SEM Standard error of the mean

TGF-β Transforming growth factor beta

TNF-α Tumor necrosis factor alpha

14 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy

CARDIOPULMONARY PROTECTIVE ROLE OF PROBIOTICS AND THE ACE2/ANG- (1-7)/MAS AXIS OF THE RENIN-ANGIOTENSIN SYSTEM By Colleen Therese Cole Jeffrey

August 2017

Chair: Peter Sayeski Cochair: Mohan K. Raizada Major: Medical Sciences - Physiology and Pharmacology

Cardiopulmonary disease remains a leading cause of death globally and in the

United States. As such, research into effective therapies for cardiopulmonary disease is imperative. The studies in this dissertation have investigated novel approaches for treatment of two related cardiopulmonary diseases: heart failure (HF) and pulmonary hypertension (PH).

Current treatments for HF and PH focus on reducing symptoms and improving quality of life rather than treating the underlying causes of disease. To that end, it is well-known that the health of the cardiopulmonary systems is linked to the renin- angiotensin system (RAS) and that a balance between the vasodeleterious

(ACE/AngII/AT1R) and vasoprotective (ACE2/Ang-(1-7)/MasR) components of the RAS is critical for cardiopulmonary homeostasis. We propose that cardiopulmonary disease is a state of RAS imbalance, in which the vasodeleterious components outweigh the vasoprotective, and that augmentation of vasoprotective ACE2 and Ang-(1-7) would be beneficial to cardiopulmonary disease. Recent work showing a role for ACE2 in gut physiology led us to speculate that the therapeutic effects of RAS may be partially

mediated by actions on the gastrointestinal tract and/or gut microbiome. Furthermore, emerging data has demonstrated an association between gut microbiota dysbiosis and cardiopulmonary disease, suggesting that restoration of the gut microbiome may prove beneficial.

This project tested the hypotheses that (1) the protective RAS axis restores function in endothelial progenitor cells (EPCs) from HF patients; (2) oral feeding of the probiotic Lactobacillus paracasei (LP) attenuates symptoms of PH; and (3) genetic modification of LP to express Ang-(1-7) provides further benefit to PH therapy. We observed improved function in EPCs from HF patients following treatment with Ang-(1-

7). We also found that feeding with LP prevented the increases in right ventricular systolic pressure and hypertrophy that are characteristic of PH. This was associated with changes in inflammatory status and gut microbiota composition. Furthermore, feeding of LP expressing Ang-(1-7) provided additional protection against PH. The studies presented here highlight the importance of the protective RAS in cardiovascular disease, explore a role for gut microbiota in cardiopulmonary health, and introduce an innovative approach to target both the RAS and gut microbiota for treatment of cardiopulmonary disease.

CHAPTER 1 CARDIOPULMONARY DISEASE

Cardiopulmonary disease describes a group of disorders with a broad range of severity, which affects both the cardiovascular and pulmonary systems. These disorders are often chronic and progressive, and they can become extremely debilitating, as the heart and lungs are responsible for sustaining all other organs of the body. The following studies focus on two cardiopulmonary disorders that commonly co-exist in patients: heart failure (HF) and pulmonary hypertension (PH).

Heart Failure

HF is defined by the American Heart Association/American College of Cardiology guidelines as “a complex clinical syndrome that results from any structural or functional impairment of ventricular filling or ejection of blood”1. Ultimately, this affects the ability of the heart to supply sufficient blood and oxygen to meet the metabolic demand of peripheral tissues. Unfortunately, HF affects a major portion of the American population.

5.7 million Americans over the age of 20 are currently living with HF, and Americans older than 40 years of age have a 1 in 5 chance of developing HF over their lifetime2.

The increasing numbers of newly-diagnosed cases of HF and the costs associated with

HF management and hospitalizations are a result of an aging population, a projected increase in cases of HFrEF due to an increase in prevalence of cardiovascular risk factors in the population, and improved survival of patients with ischemic and nonischemic heart disease3. As of 2012, costs for the management and care for HF patients exceeded 30 billion dollars. With an increasing HF population, expected to surpass 8 million people in 20304, spending on HF is anticipated to rise 127% over the same period of time. Despite the high expenditures, unfortunately, the prognosis for HF

patients is poor, with only a 50% survival rate within five years of diagnosis 2. Thus, the development of novel strategies for improvement of quality of life and reduction in healthcare costs associated with HF is critical.

HF is a progressive condition that arises from any number of etiologies, including myocardial, pericardial, and valvular diseases, as well as cardiac conduction disorders.

In the process of diagnosing HF, it is imperative to determine whether an individual has systolic or diastolic HF, as the pathophysiology, and thus treatment, greatly differs.

Systolic HF, also called HF with reduced ejection fraction (HFrEF), is the result of impaired left ventricular (LV) contractility, that may be caused by either an ischemic or non-ischemic insult5. Approximately 50% of patients with symptomatic HF are diagnosed with HFrEF3, and the underlying etiology of 60-70% of these patients is coronary artery disease6. In comparison, diastolic HF, or HF with preserved ejection fraction (HFpEF), is usually associated with chronic hypertension or ischemic heart disease. Regardless of HF origin, patients will experience a range of symptoms, depending on their comorbidities and advancement of the disease. Physicians can determine the severity of disease by correlating the most commonly experienced symptoms of dyspnea and fatigue into categories within the New York Heart Association

(NYHA) Functional Classification system. This system spans patients who have cardiac disease but no symptoms or limitations in functional activity (NYHA Class I) to patients with severe limitations and symptoms at rest (NYHA Class IV).

The initiation of HF begins with a primary injury to the myocardium that reduces the pumping function of the heart or impairs ventricular relaxation or compliance (Figure

1-1). The injury may be the result of an abrupt event, such as a myocardial infarction

(MI) or viral myocarditis, or it may be a consequence of gradual changes to the myocardium, as is seen with left ventricular hypertrophy, infiltrative disease, or genetic conditions. This insult to the myocardium impairs the function of the ventricles and manifests as a reduction in cardiac output. The monitoring of cardiac output is performed by the baroreceptors in the carotid sinus, aortic arch, and right atrium, which can modulate the autonomic control of the heart via the sympathetic (SNS) and parasympathetic (PNS) nervous systems7. Once the change in cardiac output is detected, baroreceptor activity decreases, resulting in enhanced sympathetic output and decreased parasympathetic output. This stimulation of the SNS and downregulation of the PNS is the beginning of the neurohormonal cascade meant to bring the body back to cardiovascular homeostasis. First, increased sympathetic activity causes release of epinephrine and norepinephrine, neurotransmitters that bind β1 and β2 adrenoceptors on cardiomyocytes and the SA node of the heart8. This binding activates a signaling pathway that includes activation of adenylyl cyclase for formation of cyclic AMP which, in turn, activates protein kinase A (PK-A). PK-A phosphorylates the L-type calcium channels of the sarcoplasmic reticulum and increases cellular calcium9, which in the short-term acts to increase heart rate, improve myocardial contractility, and vasoconstrict peripheral vessels in order to increase blood pressure via improved cardiac output. Second, increased sympathetic outflow and reduced perfusion of the kidney activate the renin-angiotensin system (RAS). In this pathway, the juxtaglomerular cells of the kidney release renin, which converts Angiotensinogen to Angiotensin I (Ang

I). This is followed by the enzymatic activity of angiotensin converting enzyme (ACE) for metabolism of Ang I to Angiotensin II (Ang II). As the effector peptide of the RAS, Ang II

binds Angiotensin receptors and results in release of aldosterone from the adrenal cortex. This action of Ang II, in particular, stimulates the body to retain salt and water, enhances sympathetic nerve activity, and causes peripheral vasoconstriction, again resulting in increased blood pressure. Ang II also has effects on organs other than the adrenal cortex, and as a result of those interactions, long-term hyperactivation of the

RAS also contributes to increased oxidative stress and maladaptive cardiac remodeling via hypertrophy and fibrosis3. In one way or another, both of these pathways are mechanisms that respond to correct a reduction in blood pressure by increasing heart rate and contractility, as well as stimulating vasoconstriction and salt and water retention in the kidneys10. Collectively, these actions raise blood pressure and increase intravascular volume to help provide blood flow to vital organs. Initially, these actions are beneficial for maintaining cardiac homeostasis. However, with ongoing water retention coupled with reduced cardiac output, volume overload progresses, eventually resulting in pulmonary, abdominal, and/or peripheral edema as the intravascular pressure exceeds the osmotic pressure. This expansion of intravascular volume is sensed by the heart as an increase in intra-cardiac filling pressure, subsequently triggering the release of vasoactive peptides such as atrial natriuretic peptide (ANP) from the atria and brain natriuretic peptide (BNP) from the ventricles. Both ANP and

BNP bind natriuretic peptide receptor A (NPRA) in multiple tissues to generate the second messenger cyclic GMP, stimulating vasodilation, diuresis, and natriuresis3.

These actions are part of a compensatory mechanism by which the heart attempts to correct the effects of SNS overactivation. The overall consequence of these actions is a reduction in systemic vascular resistance, thereby lessening the preload and afterload

on the heart. In addition, ANP has also been shown to inhibit renin release from the kidney, prevent collagen synthesis in cardiac fibroblasts, prevent growth of multiple kidney, heart, and vascular cell types, and inhibit cardiac myocyte hypertrophy11. One last and less studied contributor to the development of HF is the inflammatory process.

Inflammatory cytokines in the serum, such as interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-α), are elevated in patients with HF. The origin of inflammation in HF is unknown, but others have hypothesized that it is initiated through injury to the myocardium, overactivity of the SNS, or activation of the immune system3.

Together, these mechanisms allow the heart to compensate for its initial ventricular dysfunction. However, long-term activity of these neurohormonal cascades leads to maladaptive remodeling of the heart, with cellular and biochemical changes that cause alterations in the overall cardiac structure and function. On a cellular level, cardiomyocytes become hypertrophic and undergo a shift towards apoptosis. The negative effects of this substantial loss of cardiomyocytes are compounded by the inability of endogenous progenitors to maintain sufficient cardiac repair12. Fibroblasts in the myocardium are also affected during HF. In response to myocardial injury, cardiac fibroblast number increases, by differentiation of cardiac fibroblasts into myofibroblasts, as well as by transformation of epicardial cells, endocardial cells, or circulating or bone marrow (BM)-derived cells13. All of these fibroblasts contribute to an overproduction of extracellular matrix proteins, most notably collagen. The resulting interstitial fibrosis is a consequence of both an accumulation of collagen fibers in the interstitium and a decrease in collagen quality5. In the presence of fibrosis, capillary density decreases, leading to hypoxic conditions that further affect cardiomyocyte survival5. All of these

microstructural changes culminate in remodeling of the ventricles, mostly observed as increased hypertrophy and stiffness. The activation of matrix metalloproteinases produces more alterations to ventricular structure, as the degradation of collagen allows for ventricular dilation and reduced stroke volume5. Unfortunately, this pathological cardiac remodeling further impairs ventricular function, which perpetuates this deleterious cycle, leading to progressive cardiac dysfunction and eventually to death.

Despite the devastation of this disorder and its impact on national health, no cure exists apart from the limited availability for heart transplants, which themselves require intensive management and pose significant medical challenges. Instead, clinical heart failure is managed through various pharmacological, interventional, and surgical treatments. Current treatment for HF includes lifestyle changes that target traditional risk factors such as smoking, hypertension, obesity, diabetes, and sleep apnea. In addition, medical therapies that target the major neurohormonal pathways are commonly prescribed. For example, beta blockers counteract the excessive sympathetic activity by competitively blocking the binding sites of epinephrine and norepinephrine on adrenergic beta receptors3. In addition, three classes of drugs are available to antagonize the RAS. ACE inhibitors (ACEi) and Ang II receptor blockers

(ARBs) both inhibit the detrimental actions of Ang II by preventing Ang II production or by obstructing the binding of Ang II to AT1R, respectively. The third class of RAS blocker, mineralcorticoid receptor antagonists, impedes the ability of aldosterone to bind its receptor, thus reducing water retention. Inhibition of these pathways affects a host of myocardial and systemic pathways which can stabilize and, in some cases, reverse negative cardiac remodeling3. If tolerated, HF patients are managed using a beta

blocker in combination with an ACEi/ARB. However, there are cases in which other medications are indicated. For African Americans and those not tolerant of beta blockers or ACEi/ARBs, vasodilation with hydralazine-long-acting nitrates in combination is indicated. There are other medications that are used sparingly and only in very specific circumstances. For example, sodium nitroprusside, which produces nitric oxide (NO), can be given intraveneously for relief of symptoms in acute decompensated HF. Vasopressin receptor antagonists, which promote loss of free water, are given for HF patients that have severe, persistent hyponatremia. Digoxin, a cardiac glycoside that increases myocardial contraction, may be used to provide symptom relief and control HF; however, in some populations it may actually increase mortality3. Lastly, inotropic agents can be used to increase cardiac output in patients with end-organ dysfunction as a bridge to ventricular assist device implant or heart transplant or as palliative therapy, though at a cost of increased risk of mortality3.

Concurrent with medical therapy, implantable cardioverter defibrillators are often used to prevent sudden cardiac death due to the increased risk of fatal arrhythmias. The development of these medical management strategies has certainly improved the survival of patients with HF. However, only a few of these drug classes are indicated in most patients, and some therapies are not well-tolerated by certain groups of patients.

In spite of the success of these therapies, HF remains a major cause of death from cardiovascular disease and a major drain on the economy. At some point, medical management is not effective any longer and more aggressive interventions are needed to prolong the life of the patient. Advanced therapy such as mechanical circulatory support as a destination therapy or bridge to transplant for patients for end-stage

disease is also available14. Although the preferred therapy is heart transplant, the wait list is often long, and transplantation comes with its own challenges such as risk of organ rejection and immunosuppression, the lifelong use of which increases risk of serious infection and even causes organ dysfunction. Collectively, these limitations to the current therapies demonstrate the urgency with which novel avenues for treatment of HF need to be identified – to reduce the burden of the disease on families and society and to enhance both the length and quality of life of those patients with HF.

Pulmonary Hypertension

PH is a rare and devastating disease of the pulmonary vasculature that is defined by a mean pulmonary arterial pressure of ≥25 mmHg at rest15. Due to the heterogeneous nature of etiologies that result in similar pathologies, it has been difficult to determine the true prevalence of PH. However, recent surveillance reported increases in both hospitalization and mortality rates due to PH, with death rates of 6.5 per 100,000 population in the United States in 2010 and an estimated 5 year mortality of

40% that is variable depending on the type of PH16. Unfortunately, PH diagnosis is often delayed, as the early symptoms of fatigue and shortness of breath are found in numerous other conditions16.

A multitude of clinical causes for PH exist, and the World Health Organization

(WHO) has classified them into five groups. Group 1 includes patients with pulmonary arterial hypertension (PAH), defined as those with mPAP ≥ 25 mmHg, pulmonary artery wedge pressure ≤ 15 mmHg, and pulmonary vascular resistance >3 Wood units17.

These patients may have idiopathic or heritable PAH, or they may have PAH as a result of connective tissue disease, HIV infection, portal hypertension, congenital heart disease, or drug/toxin effects. Notably, mutations in bone morphogenetic protein

receptor type 2 (BMPR2) account for approximately 75% of familial PAH cases, making it the most common genetic cause of PAH18. Group 2 patients have been diagnosed with PH secondary to left heart disease, such as LV systolic or diastolic dysfunction, valvular disease, or outflow tract obstruction. PH due to left heart disease is the most common cause of PH19. In Group 3, patients have PH due to lung disease or hypoxia.

These are a consequence of chronic obstructive pulmonary disease (COPD), interstitial lung disease, sleep-apnea, chronic high-altitude exposure, etc. Group 4 patients develop PH as a consequence of chronic blood clots in the lungs which may result from a variety of conditions, and thus is termed chronic thromboembolic pulmonary hypertension (CTEPH). Patients in Group 5 have PH as a result of unclear or multifactorial mechanisms, including hematologic, systemic, or metabolic disorders17.

Regardless of etiology, PH is a progressive disease in which narrowing of the pulmonary pre-capillary arterioles is followed by increases in pulmonary vascular resistance20. In turn, this high right ventricular (RV) afterload causes enlargement of the

RV as a compensatory mechanism to maintain normal blood flow (Figure 1-2). Over time, the RV undergoes maladaptive cardiac remodeling, which ultimately results in right heart failure and death21.

Mechanistically, increased pulmonary vascular resistance is a consequence of three major pathogenic factors: vasoconstriction, thrombosis, and vascular remodeling, with remodeling as the driving force behind the progressive nature of PH (Figure 1-2).

Vasoconstriction is marked by dysregulation of vasoactive factors such as prostacyclins, endothelin-1, and nitric monoxide15. Thrombosis may be a result of abnormalities in the clotting cascade, endothelial cells, or platelets20. Vascular remodeling is a complex

process that involves excessive proliferation of cells in all vascular layers, resistance to apoptosis, altered metabolism, and clonal expansion15. Remodeling may also be, in part, a result of transdifferentiation of endothelial cells to vascular smooth muscle cells22. The RAS also contributes to remodeling, as ACE expression is increased in pulmonary artery endothelial cells23, and Ang II stimulates hypertrophy and proliferation of vascular smooth muscle cells24. The role of inflammation in the pathobiology of vascular remodeling is emerging, with documented upregulation of inflammatory cytokines in addition to accumulation of inflammatory T and B lymphocytes and monocytes within the vessel wall of PH patients25. Collectively, these pathogenic processes lead to histologic features in the small peripheral pulmonary arteries that are shared by almost all forms of PH. Fibrosis of the tunica intima, proliferation and distal localization of vascular smooth muscle cells, and pulmonary arterial occlusion are pathological hallmarks of PH. End-stage PH is characterized by the formation of plexiform lesions via overproliferation of endothelial cells and vascular smooth muscle cell hypertrophy as well as the deposition of extracellular matrix and myofibroblasts from the tunica media into the intima, known as a neointima22.

Treatment options for PH patients have certainly improved over the last 20 years.

Despite this, only 13 therapies for PH exist today, many of which have become available over the last 5-10 years. In terms of patient management, patients with PH are counseled about general guidelines such as maintaining physical activity, preventing infection, and avoiding pregnancy. Supportive care is also provided to control patient symptoms. For example, because hypoxia is known to vasoconstrict the pulmonary artery, PH patients are maintained on oxygen therapy. Similarly, reduction of

intravascular volume with diuretics is used to reduce RV preload, which functions to minimize dilation of the RV and help control peripheral edema. Digoxin is utilized to improve cardiac function, but this data is based on studies in left heart disease and not in PH/right heart failure. Use of oral anticoagulation is controversial in all but Group 4 patients, as the data on its benefits are mixed17. Although these supportive care measures alleviate patient symptoms, none has been shown to improve morbidity or mortality. As far as actual disease management, the current treatments are limited in scope and largely target vasoconstriction pathways. For one, calcium channel blockers, vasodilators that act by inhibiting calcium influx into vascular smooth muscle cells, are commonly prescribed. In addition, drugs that enhance prostacyclin have been effective in promoting vasodilation, as well as inhibiting proliferation, thrombosis, and inflammation. In fact, epoprostenol, one such synthetic prostacyclin, is the only current treatment that has been shown to reduce mortality for PH. Agents that inhibit endothelin-1 or enhance NO are also methods by which to cause vasodilation17.

Recently, combination therapy of these drugs has been attempted with varying results17.

Despite the major progress that has been made in development of PH therapies over the last 20 years, there is still a lack of real, rigorously-tested, effective treatment options, and as a result, PH patients continue to die of right heart failure26.

Consequently, the need for innovation in generation of new therapies is urgent.

The WHO classification system categorizes patients based on the histology and pathophysiology of the underlying disease, and it was originally developed as a way to help clinicians sort through and make sense of the complex etiologies. It was assumed that patients within each group respond similarly to specific treatments, and thus, similar

medical therapies were prescribed for PAH27, supplemental oxygen was given to Group

3 patients with lung disease, etc. However, it is becoming more evident that whereas each etiology leads to the same end-point, there are diverse molecular pathways that drive the pathology of each disease28. For example, idiopathic and hereditary PH are both classified as PAH, but the molecular mechanisms behind the initiation of each disease could be quite different. Without taking the molecular mechanisms into account, the drug industry designed and marketed drugs that targeted a common feature of all

PH, namely vasoconstriction. The complexity of PH pathophysiology offers opportunity for development of treatments targeting alternate pathways, namely those that may be successful in preventing or reversing the vascular remodeling which is at the core of this disease29. Potential future therapies in the pipeline target inflammation, mitochondrial dysfunction, BMPR2 signaling, and iron deficiency29. In fact, current and recent clinical trials aim to mediate pulmonary inflammation and remodeling by antagonizing leukotriene B4 production (NCT02736149), reducing ROS and inflammation via suppression of NFκB (NCT02036970), preventing the ASK-1 kinase from stimulating inflammatory and fibrotic pathways (NCT02234141), and blocking the beta adrenergic receptors (NCT00964678)30. The benefits of pulmonary artery denervation are also being studied (NCT02525926). Nonetheless, the efficacy of these therapies has not yet been demonstrated, and further, it is likely that distinct molecular mechanisms of pathophysiology will impede widespread testing and success of these therapies.

Therefore, the expansion of therapeutic targets for treatment of PH is necessary.

Renin-Angiotensin System

Overview

The circulating RAS is a hormonal system that plays a prominent role in regulating blood pressure (BP) and maintaining fluid balance in the body31.Traditionally, the RAS has been viewed as a linear enzymatic pathway that culminates in the production of Angiotensin II (Ang II), a potent vasoconstrictor. This pathway begins with the secretion of angiotensinogen from the liver into the blood stream (Figure 1-3).

Renin, a peptidase secreted by the kidney, then cleaves angiotensinogen into

Angiotensin I (Ang I)32. Subsequently, the dipeptidyl-carboxypeptidase Angiotensin converting enzyme (ACE) expressed in the pulmonary endothelial cells of the lung produces Angiotensin II (Ang II) via cleavage of Ang I (Figure 1)33. Ang II exerts its actions via binding to two distinct G-protein coupled receptors: angiotensin type 1 receptor (AT1R) or angiotensin type 2 receptor (AT2R). In the case of BP regulation, low

BP triggers the release of renin from the kidney and sets in motion the eventual production of Ang II, which acts through AT1R to cause vasoconstriction and salt and water retention that all aid in raising BP. As previously mentioned, this RAS pathway is activated at the initiation of HF as a compensatory mechanism to maintain adequate cardiac output. These RAS components have been well-characterized, and for a number of years, the RAS was only considered for its endocrine role in volume control.

The recent discovery of several new RAS components has altered the way RAS is perceived in the field. Of particular significance was the identification of Angiotensin converting enzyme 2 (ACE2) 34,35, a monocarboxypeptidase which cleaves the carboxy terminal amino acid of Ang II to form Angiotensin-(1-7) [Ang-(1-7)]. Ang-(1-7) is a heptapeptide that acts through the seven transmembrane G-protein coupled receptor,

Mas36. The ability of ACE2 to counteract the effects of ACE by metabolism of Ang II led to the proposal that the RAS is composed of two opposing arms, with ACE, Ang II, and

AT1R representing the classical axis [ACE-Ang II-AT1R] and ACE2, Ang-(1-7), and Mas representing the counter-regulatory axis [ACE2-Ang-(1-7)-Mas] (Figure 1). Under physiological conditions, a balance exists between these two axes, which aids in maintenance of intravascular volume homeostasis.

Accumulating evidence suggests that apart from a circulating RAS, a local RAS exists at the tissue level, including the heart37, lungs38, kidney39, and brain40, among others41. RAS peptides produced locally can have autocrine, paracrine, or endocrine effects42. As with the circulating RAS, the opposing local RAS axes are balanced.

However, local overexpression of the classical RAS components [ACE-Ang II-AT1R] in organs and tissues promotes growth, differentiation, fibrosis, inflammation, and generation of reactive oxygen species (ROS) 43,44. On the other hand, overexpression of the counter-regulatory RAS components [ACE2-Ang-(1-7)-Mas] mediates anti- proliferative, anti-fibrotic, and anti-inflammatory effects45-47.

Angiotensin converting enzyme 2. In 2000, ACE2 was originally cloned as a human homologue of ACE by two independent groups34,35. The ACE2 gene found on the X chromosome encodes a 805 amino acid type 1 transmembrane protein. ACE2 contains an intracellular domain containing a putative signal peptide, a transmembrane domain, and a single extracellular metalloprotease zinc-binding catalytic site48. Whereas

ACE2 only has one catalytic site compared to the two sites of ACE18,49, it shares 42% identity with these domains. Also, ACE2 is a mono-carboxypeptidase, unlike ACE which has dipeptidyl carboxypeptidase activity. Additionally, the C-terminal domain of ACE2

shares 48% identity with the amino acid transporter protein, collectrin48. ACE2 can hydrolyze multiple peptides, but its peptidase activity depends on the presence of a Pro-

X-Pro motif followed by a hydrophobic or basic C-terminal residue50. Therefore, ACE2 prefers substrates such as Ang II (Pro-Phe), Ang I (Pro-Phe-His-Leu), and des-Arg9 bradykinin (Ser-Pro-Phe) rather than Ang-(1-7), Ang-(1-9), or bradykinin51. Of all ACE2 substrates, Ang-(1-7) is the most active product. Ang-(1-7) may be generated via hydrolysis of the decapeptide Ang I to Ang-(1-9), with subsequent cleavage by neutral endopeptidase (NEP) or ACE to form Ang-(1-7)51. Second, prolyl carboxypeptidase can form Ang-(1-7) from Ang II, and NEP can hydrolyze Ang I to Ang-(1-7). Lastly, Ang-(1-7) may be produced by direct conversion of the octapeptide Ang II to Ang-(1-7) by ACE2.

In fact, the high affinity of ACE2 for Ang II51 rather than Ang I suggests that the primary pathway for Ang-(1-7) formation is via ACE2 cleavage of Ang II (Figure 1-2).

The ACE2 transcript is found in most tissues, although usually at lower levels than ACE52, and the ACE2 protein is highly expressed in the heart, kidneys, testes, gastrointestinal tract, lungs, and brain53. ACE2 is predominantly found in the vascular endothelial cells and the renal tubular epithelial cells, but also on vascular smooth muscle cells34,54.

Angiotensin-(1-7) and Mas receptor. Ang-(1-7) is a heptapeptide formed in the heart, kidney, and brain primarily via cleavage of Ang II by ACE2, although it can also be produced by the actions of prolyl endopeptidase and NEP55. As previously mentioned, another pathway to Ang-(1-7) formation is the ACE2-mediated conversion of

Ang I to Ang-(1-9) followed by subsequent ACE-mediated cleavage of Ang-(1-9) to Ang-

(1-7). Major sites of Ang-(1-7) production are the heart, brain, and kidney56. The half-life

of Ang-(1-7) is approximately 30 minutes57, but its half-life in the plasma is only 9 seconds58. Most of Ang-(1-7) metabolism occurs by ACE in the lungs59. Ang-(1-7) activates downstream pathways via binding to Mas, a seven transmembrane G-protein coupled receptor highly expressed in the heart, kidney, brain, and testis and expressed at low levels in organs such as the liver, spleen, and skeletal muscle60. Predominantly,

Mas is found in the vascular endothelium60; however, in the heart, Mas is specifically found on cardiomyocytes, cardiac endothelial cells, and fibroblasts42. Whereas the majority of Ang-(1-7) cardiovascular actions occur through its interaction with Mas and downstream activation of G-proteins, it is also capable of exerting biologically relevant

61 effects via binding to AT2R . Recently, it has been shown that Ang-(1-7) can also activate AT1R; however, while Ang II binding of AT1R stimulates binding of G-proteins,

62 Ang-(1-7) interaction with AT1R recruits β-arrestin2 . This delineation between AT1R downstream signaling allows Ang II to have pathological effects and Ang-(1-7) to have

48 therapeutic effects. Interestingly, Mas receptor can bind to AT1R and induce

63 upregulation of AT1R levels . Presumably, there are other receptor interactions that have yet to be discovered.

Vasoprotective Renin-Angiotensin System in Cardiovascular Injury

Cardiac RAS. The contribution of the classical RAS components [ACE-Ang II-

AT1R] has been discussed above. Briefly, RAS is activated in response to low blood pressure, and it works to increase intravascular fluid volume via vasoconstriction and salt and water retention10. However, continued activity of these RAS components, and the increased levels of Ang II in particular, is pathogenic. Namely, overexpression of

ACE-Ang II-AT1R in the heart contributes to maladaptive remodeling of the heart by causing vasoconstriction, hypertrophy, proliferation, and inflammation64. The detrimental

effects of these molecules on the heart and vasculature have led them to be known as the vasodeleterious axis of the RAS.

In contrast to ACE actions, ACE2-mediated effects on cardiac and pulmonary tissues include vasodilation, anti-hypertrophy, anti-proliferation, and anti-fibrosis. These effects of ACE2 on the cardiovascular system have been studied using both ACE2 deletion and ACE2 overexpression or activation. For instance, ACE2 knockout (ACE2-

KO) mice displayed enhanced susceptibility to cardiac problems when subjected to chronic Ang II infusion or pressure overload65-67. Studies also revealed that ACE2-KO mice exhibited maladaptive cardiac remodeling in terms of increased ventricular hypertrophy65-67, excessive fibrosis66,67, heightened superoxide production66,67, upregulation of hypoxia-induced genes68, and decreased cardiac contractility65.

Likewise, Trask et al. 69 demonstrated that chronic ACE2 inhibition resulted in excessive accumulation of cardiac Ang II and worsening of ventricular remodeling in (mRen2)27 transgenic rats. Further, ACE2-KO mice have increased blood pressure at baseline 70.

In addition to the detrimental effects of loss of ACE2 on the heart, a report by Sahara et al.71 revealed that ACE2 deletion promoted the development of atherosclerosis and arterial neointima formation, highlighting the importance of ACE2 in conferring vascular protection. Conversely, overexpression or activation of ACE2 has demonstrated cardiovascular benefit. Our group has previously shown that ACE2 knock-in, intracardiac injection of lentiviral-ACE2, and administration of an ACE2 activator all rescued cardiac function following MI 72-74. Interestingly, both global ACE2 overexpression and activation led to a reduction in infarct size, whereas intracardiac

ACE2 had no effect. In addition, global ACE2 expression and activation reduced

inflammation in the heart. Studies by others have demonstrated that cardiac function is restored with recombinant or intracardial ACE2 treatment in models of chronic Ang II infusion66,75. Additionally, intramyocardial injection of adenovirus-ACE2 improved heart function and reduced myocardial fibrosis following MI76. Further, ACE2 treatment has been shown to enhance endothelial function77 and facilitate angiogenesis 78,79, as well as to act through the brain to improve baroreflex sensitivity80, reduce sympathetic outflow81, and decrease BP82-84, all of which promote cardiopulmonary health.

Collectively, these data suggest that ACE2 expression is essential for cardiovascular protection.

The cardiovascular protection of ACE2 may be explained by altered levels of the effector peptides, Ang II and Ang-(1-7). Specifically, ACE2 benefit can be attributed to

(1) the formation of Ang-(1-9) from Ang I, which removes Ang I as a substrate for ACE,

(2) the degradation of Ang II, which limits its deleterious actions, and (3) the formation of

Ang-(1-7), which itself has beneficial actions on the heart and lungs. Increased concentration of cardiac Ang II and reduced levels of myocardial Ang-(1-7) were observed in ACE2-KO mice65,67. These findings are consistent with previous reports illustrating that adenoviral-mediated overexpression oACE2 resulted in decreased ACE and Ang II in the myocardium76,85. It is well-established that aside from the benefits of

Ang II degradation, the formation of Ang-(1-7) is cardioprotective. Ang-(1-7) has demonstrated multiple beneficial effects on the cardiovascular system, including vasodilation and inhibition of arrhythmias, hypertension, and pathologic cardiac remodeling48. Further, Ang-(1-7) has been shown to act through the Mas receptor to mediate anti-proliferative, anti-fibrotic, antihypertrophic, anti-inflammatory, and positive

inotropic effects45-47,86. For example, Ang-(1-7) decreased cardiac inflammation via reduction of proinflammatory cytokines47. In vitro, Ang-(1-7) suppressed cardiomyocyte growth45, stimulated endothelial nitric oxide synthase87,88, inhibited collagen expression89,90, improved myocyte contraction86, and antagonized Ang II-induced proliferation and migration of vascular smooth muscle cells91. It is important to note that although ACE2 displays the ability to modulate blood pressure, the effects of Ang-(1-7) on blood pressure have been heterogeneous48. Most animal studies observed no effect of Ang-(1-7) on blood pressure, although Ang-(1-7) has been reported by other groups to cause both hypo- and hypertension. In humans, one study showed that Ang-(1-7) induced vasodilation in both control and hypertensive patients92. However, in a different study infusion of Ang-(1-7) had no effect on the blood pressure of healthy individuals93, although this was a very small study. Nonetheless, all of these Ang-(1-7) actions contribute to its positive influence on the cardiovascular system and its inhibition of pathologic cardiac remodeling.

The expression and function of the vasoprotective RAS components have been studied using models of cardiovascular disease. ACE2 is expressed in various cellular compartments of the heart including the cardiac endothelial cells and vascular smooth muscle cells, as well as in cardiomyocytes and fibroblasts94,95. It has been observed that the expression of ACE2 is highly regulated by pathological stimuli and tissue insult. In this regard, animal studies have revealed increased levels of ACE2 mRNA and protein following myocardial injury94,95. Consistent with these findings, Zisman et al.96 demonstrated that ACE2 protein and activity were significantly elevated in failing human hearts, resulting in increased Ang-(1-7) and decreased Ang II levels. ACE2 was also

found to be upregulated in idiopathic dilated and ischemic cardiomyopathies97.

However, due to the complexity of HF etiology, ACE2 expression in failing human hearts remains controversial94,98-100. Nonetheless, these observations suggest that an elevation in cardiac ACE2 levels could, at least initially, serve as a compensatory mechanism to impede progression of cardiovascular disease.

Clinically, the RAS is already the target of therapies for cardiovascular disease and HF. In fact, ACE inhibitors (ACEi) and angiotensin receptor blockers (ARB) are the first line of medical therapy for patients with hypertension101 and other cardiovascular diseases1, including HF. These agents are effective for BP lowering102, as well as for attenuation of ventricular remodeling, reduced incidence of MI, and prevention of the development of HF103. Despite these noted benefits of ACEi and ARBs, their inhibition of the RAS is not complete. Ang II levels remain elevated in about 50% of HF patients treated with ACEi, as a result of chymase activation42. As a consequence, HF patients continue to face progression of their disease and high morbidity and mortality rates.

Thus, it is necessary to develop novel therapeutics for treatment of cardiopulmonary diseases.

Circulating RAS. Traditionally, ACE2 has been thought of as a tissue-bound enzyme, but recent reports have detected and measured soluble ACE2 (sACE2) levels and activity in human blood. In comparison to healthy controls, patients with acute HF had increased serum ACE2 levels104. Unexpectedly, these patients also had significantly lower serum Ang-(1-7) concentration. This is in contrast to data showing that treatment with rhACE2 caused enhanced plasma Ang-(1-7) levels along with reduced plasma Ang II66. Furthermore, HF patients treated with ACE inhibitors also

exhibited increased levels of plasma Ang-(1-7)105. These inconsistencies may be a consequence of differences in human and animal manifestations of HF or a consequence of multiple etiologies. In fact, similar questions arise in measurement of sACE2 activity. sACE2 activity was found to be increased in patients with heart disease106-110, which positively correlated with disease severity106-108,110, end systolic diameter110, end diastolic diameter110, and infarct size109, whereas it correlated negatively with ejection fraction109,110. Interestingly, sACE2 activity was also elevated in hypertensive patients with impending HF110. One study correlated sACE2 activity to development of cardiovascular disease; sACE2 activity in hypertensive patients was significantly higher than in healthy volunteers, and sACE2 activity is further increased in

HFrEF patients compared to hypertensive individuals111. Thus, sACE2 could be a potential biomarker of cardiac dysfunction in patients with hypertension and HF.

However, recent work by Shao et al.112 appears to run counter to the idea that increased ACE2 activity is suggestive of worsening disease. This study found that a

50% increase in baseline sACE2 levels following intensive medical therapy in acutely decompensated HF patients was predictive of improved clinical outcomes.

Unfortunately, these measurements are inconsistent across studies, and as a result, the physiological relevance of sACE2 remains unknown. We speculate that these discrepancies may be due to differences in etiology, patient populations, disease stages, or medical therapies. While these disparities warrant further investigation, the current evidence is highly indicative of a cardioprotective role for ACE2 in humans and suggests that differential regulation of ACE2 may have important functional consequences in cardiovascular disease.

Vasoprotective Renin-Angiotensin System in Pulmonary Injury

The benefits of the RAS vasoprotective axis are not only limited to the cardiovascular system; studies over the past few years have highlighted the salutary effects of ACE2 and Ang-(1-7) on lung pathophysiology. ACE2 is expressed in the lung, specifically in the pulmonary endothelium, vasculature, and pneumocytes113. With regards to pulmonary disease, ACE2 came into prominence when it was identified as a functional receptor for the SARS coronavirus (SARS-CoV), the etiological agent of severe acquired respiratory syndrome (SARS)114. It has been observed that SARS infection reduces pulmonary ACE2 expression and also leads to lung failure and death.

This connection between ACE2 expression and lung pathophysiology is further supported by studies conducted on ACE2-KO mice, which demonstrated increased susceptibility to acute lung injury115. Numerous studies have since shown the effects of

ACE2 or Ang-(1-7) treatment on lung injuries. For instance, activation of ACE2 slowed progression of asthma by causing reductions in inflammation, interstitial fibrosis, and oxidative stress116. Treatment with Ang-(1-7) demonstrated similar effects on lung inflammation in models of asthma117 and chronic intermittent hypoxia118. In addition,

Ang-(1-7) reduced collagen production in human lung fibroblasts119 and prevented lung fibrosis in animals with diabetes120 and Acute Respiratory Distress Syndrome121. These studies highlight an emerging role for the vasoprotective RAS in lung protection.

Specifically, a growing body of work has focused on the importance of ACE2 and

Ang-(1-7) in PH and associated right HF. Decreased lung ACE2 expression122,123 and enzymatic activity124, along with increased circulating Ang II levels125, have been observed in PH. Additionally, reduction in circulating ACE2 and Ang-(1-7) levels has been observed in patients with PH from congenital HD126,127. Moreover, auto-antibodies

to ACE2 predisposed patients with connective tissue diseases to development of PH128.

These clinical findings suggest that enhancement of ACE2 could provide pulmonary protection. In this regard, animal studies have shown that enhancement of ACE2 is beneficial for treatment of PH. Lentiviral overexpression of ACE2 or Ang-(1-7) in the lungs attenuated PH lung and heart pathology in addition to reducing inflammation129,130. Administration of rhACE2 inhibited the hypoxia-mediated rise in pulmonary arterial pressure, suggesting its utility as a treatment for hypoxia-associated

PH131. rhACE2 also had favorable actions on the RV in pulmonary artery banding model of pressure overload132. Activation of ACE2 by XNT or diminazene aceturate (DIZE) prevented PH pathophysiology though reduction of inflammatory cytokines, recovery of autonomic nervous system imbalance, and improved function of angiogenic progenitor cells133-135. Oral feeding of ACE2 or Ang-(1-7) generated within plant chloroplasts attenuated PH and were associated with improved structural and functional changes in the right heart in both prevention and reversal studies124,129,130,132. Further, daily injections of Ang-(1-7) and its cyclic analog cAng-(1-7) prevented MCT-induced increases in right ventricular systolic pressure (RVSP)136. Currently, there is one ongoing clinical trial measuring the safety and efficacy of rhACE2 to patients with PAH

(NCT01884051). Taken together, these data suggest that ACE2 and Ang-(1-7) are protective against lung injury and that treatments targeting this enzyme might be effective in attenuating PH.

In this regard, the involvement of the RAS in vascular remodeling is well-studied, and specifically, evidence suggests that RAS is activated in PH. To this point, clinical studies using RAS antagonists for PH treatment have recorded mixed results137, and

they are currently contraindicated for PH patients due to their propensity to cause hypotension. However, the well-known involvement of RAS in the development of both

PH and HF supports further research into alternate methods by which to target RAS for treatment of cardiopulmonary disease.

Future Therapies for Cardiopulmonary Disease

Current therapies for cardiopulmonary disease focus on treating symptoms and have done little to address the underlying causes of disease. Because of this, the prognosis for patients diagnosed with HF and PH remains poor138. Research into alternate therapeutic targets, as well as novel delivery methods, are ongoing and imperative if our goal is to reduce the burden of cardiopulmonary disease on society and individuals.

Cell Therapy

Recent studies have investigated the safety and efficacy of various new treatments for cardiopulmonary disease, including those using pharmacological agents, gene therapy, and cell therapy. Among these, cell therapy has become particularly attractive because of its potential to regenerate damaged tissue. More specifically, autologous stem cell transfer has emerged as a leading method of cell therapy because it eliminates the possibility of an immune response by the host and the toxicity of immunosuppressive medications. Animal studies of cell regenerative potential in cardiopulmonary disease have been encouraging139-141, but the results of cardiac cell therapy in humans have been modest and inconsistent142. Indeed, many hurdles still exist before the promise of cell therapy in humans may be fully realized. For example, the impaired engraftment of the injected progenitor/stem cells in the hostile environment of the injured and inflamed tissue needs to be overcome. Additionally, a number of

technological questions need to be addressed, including what cell type is best, how many cells are needed, and how often cells should be given 143,144. Perhaps the largest limitation remains the fact that, often, progenitor cells in patients with cardiovascular disease are dysfunctional145, diminishing the potential benefits of autologous stem cell transfer. This investigation will address the root of this issue: the function of stem cells from patients with HF.

Endothelial progenitor cells. It is becoming increasingly evident that interplay between organs and circulating cells is critical for disease prevention. A number of cardiopulmonary disorders have documented imbalances in the circulating levels of reparative and inflammatory cells, which contribute to inflammation and impaired vascular repair. In recent years, numerous cell types, including BM-derived mononuclear cells, endothelial progenitor cells (EPC), BM- or adipose-derived mesenchymal stem cells (MSC), umbilical cord blood cells, and cardiac progenitor cells, have been evaluated for their potential to offer cardioprotection142. Of these, EPCs are especially promising because of their well-documented roles in vascular maintenance and repair146. The following evidence supports the investigation of EPC benefits in human heart disease: (i) EPCs are critical for promotion of neovascularization, cardiac repair, and cardiac function in animal models147,148; (ii) Endothelial dysfunction is an important contributor to impaired coronary circulation in HF145; (iii) Studies have uncovered an inverse correlation between endothelial dysfunction and circulating EPC number149; (iv) Patients with early HF or directly following an acute MI have increased

EPC numbers150-152, indicative of an endogenous compensatory mechanism for revascularization; (v) EPC numbers decline with progression of HF150; (vi) Circulating

EPCs independently and inversely predict mortality in patients with chronic HF153; (vii)

EPCs from patients with chronic ischemic cardiomyopathy are dysfunctional154. These data demonstrate a direct link between EPCs and HF and suggests that EPCs will be helpful in promoting vascularization following ischemia, thus showing promise in reducing the clinical pathology of HF.

Unfortunately, the identifying markers of EPCs are controversial, and the literature is muddled with studies utilizing various markers, including CD34, CD133, vascular endothelial growth factor 2 (KDR), CD31, and CD45 as single markers or in combination155,156. Asahara et al157 first showed that human CD34+ cells in a model of hind limb ischemia integrate into new capillaries and differentiate into endothelium, demonstrating their angiogenic capacity. Since then, studies of CD34+ cells in animal models of MI have highlighted the ability of this population to preserve heart function, increase capillary density in infarct, and decrease infarct size, collagen deposition, and cardiomyocyte apoptosis158,159. Most interestingly, these results were not recapitulated with cell fractions negative for CD34+ cells or containing fully differentiated endothelial cells. This suggests that CD34+ cells are superior for angiogenesis and regeneration of heart tissue. Furthermore, analysis of the relationship between circulating progenitor cells and cardiovascular disease risk has shown progenitor cells expressing surface

CD34+ antigen to best reflect risk of cardiovascular disease160. Intracoronary infusion of autologous CD34+ cells into patients with left ventricular dysfunction after MI resulted in positive changes in ejection fraction, infarct size, and length of time subjects remained alive161. Based on this evidence, we characterized the number and functionality of

CD34+ cells in HF.

Role of RAS in progenitor cell function. Progenitor cells, specifically EPCs, are vital for vascular endothelial repair162, and reduced numbers and function of EPCs have been observed in patients with cardiopulmonary disease150,154,163,164. The vasoprotective RAS has demonstrated a role in improving the number165 and function147,148 of progenitor cells under disease conditions. In fact, animals treated with the ACE2 activator, diminazene aceturate (DIZE), displayed increased circulating EPC levels, improved engraftment of cardiac progenitor cells into the heart, and decreased inflammatory cells in the infarcted heart73. DIZE also normalized the decrease in EPC proliferation and migration associated with MCT-induced PH135. Consistent with this, the

EPCs of patients with PH demonstrated a reduction in migratory potential in vitro, which was improved with DIZE treatment135. Similarly, genetic modification of BM-166 or umbilical cord blood-167 derived MSCs with ACE2 yielded cardiopulmonary protective effects. Work from our own group has demonstrated that nitric oxide (NO) production148 and vascular repair147,148 were significantly increased in BM-derived MSCs overexpressing ACE2 and Ang-(1-7). Additionally, we have shown that ACE2 priming of

EPCs not only enhanced their function147,148 but also increased their therapeutic efficacy to render protection against stroke148. Finally, treatment of diabetic animals with Ang-(1-

7) restored the ability of circulating progenitors to mobilize in response to ischemia168, promote angiogenesis169,170, and improve cardiac function170. Thus, ACE2 and Ang-(1-

7) are vital for the function and balance of circulating progenitor cells. We believe that improving the function of progenitor/stem cells through genetic modification of the vasoprotective RAS components may hold promise for treating cardiopulmonary disorders.

Gut Microbiota

Until recently, the contributions of the gut microbiome to human physiology have gone largely unnoticed. This is especially surprising because the human colon itself houses 100 trillion microorganisms171. The relationship between the gut microbes and intestinal epithelium is mutually beneficial, and beyond the obvious role for bacteria in nutrient metabolism, microbes modulate the human immune system, defend against pathogens, synthesize vitamins and amino acids, regulate brain behavior, and promote both enteric nerve function and angiogenesis172. Moreover, gut microbiota produce short chain fatty acids (SCFA), metabolites which act both as energy sources and signaling molecules173.

Gut anatomy and physiology. The gut performs crucial functions in that it allows nutrient absorption while also preventing infiltration of commensal bacteria and acting as a first line of defense against pathogen infections. Physically, the structure of alternating protruding villi with deep crypts provides increased surface area for absorption of nutrients, and the lining of the gut lumen forms a barrier made of distinct intestinal epithelial cells (IECs): nutrient-absorbing enterocytes, mucus-secreting Goblet cells, hormone-secreting enteroendocrine cells, and antimicrobial-secreting Paneth cells. IECs are polarized cells oriented with their apical membrane facing the gut lumen and the basolateral membrane in contact with the underlying lamina propria, a polarity maintained via stabilization by tight junctions and desmosomes. The health of this epithelial barrier is further sustained by proliferation of IECs, production of IgA, and expression of antimicrobial peptides174 in the Goblet cell-secreted mucus layer.

Composition of gut microbiota and effects of probiotics. The complex colonization of the intestine with microbes begins at birth, and its composition is

influenced by non-adjustable factors (genetics, age, geography) as well as adjustable factors (diet, medication)175. Because of the anaerobic nature of the intestine, the microbes of the gut are facultative or strict anaerobic bacteria from only five to seven phyla176, predominantly Firmicutes and Bacteroidetes172. Nevertheless, each individual has a distinct microbe composition that is subject to change over time175. Within an individual, the composition of bacteria communities differs along the length of the colon, and variances even exist in the microbial makeup of luminal- and mucosal-associated niches172.

Both the gut and the commensal microbes contribute to the maintenance of a stable intestinal bacterial community. It is crucial for the human host to recognize and respond to pathogens while simultaneously tolerating non-harmful bacteria. Likewise, it is in the best interest of the commensal bacteria to establish and maintain their intestinal niches. The IECs of the gut participate in this process by formation of a mucus layer, secretion of antimicrobial peptides, establishment of tight junction protein complexes, and use of microbe-associated molecular pattern recognition systems177. Surprisingly, the enteric nervous system has also demonstrated a role in defining the abundance and composition of gut microbiota178. Microbes, in turn, monitor each other via complex intercommunication systems which utilize metabolism, gene transfer, biofilm formation, or quorum sensing177.

Researchers are now finding that the composition of the gut microbiome is absolutely critical for human health. External pressures such as infection and antibiotic ingestion or internal pressures including defective host genetics can both lead to disequilibrium in the bacterial community known as dysbiosis177. Such imbalance in

microbiota can have effects on digestive and immunological functions179. In fact, dysbiosis of gut microbial communities has been associated with diseases including cancer, diabetes, obesity, inflammatory bowel disease, and allergies172, but for the majority of diseases, it is unknown if dysbiosis is causative or a consequence175.

Methods for restoration of normal microbiomes, including fecal microbiota transplantation or ingestion of prebiotics or probiotics, are increasingly being studied. In particular, probiotics have shown promise in treatment of disease, although their claims of microbiome restoration are inconsistent180,181. Most probiotics contain lactic acid- producing bacteria (LAB), such as Lactobacillus, Streptococcus, Bifidobacterium, or

Enterococcus sp.182. Probiotics are thought to work through competition for nutrients, upregulation of intestinal mucin genes, blockage of pathogen attachment sites, reduction of gut permeability, destruction of pathogens by bacteriocins, reduction of bacterial endotoxin levels in the blood, promotion of commensal bacterial growth by

SCFA production, and modulation of the host immune system through stimulation of phagocytosis by immune cells179,180. Moreover, recent studies have demonstrated the potential for the beneficial effects of probiotics to be further enhanced by genetic modification183.

Gut microbiota and cardiopulmonary disease. The gut microbiome is emerging as a critical player in health of the cardiopulmonary system. Reports by our group and others have drawn associations between intestinal dysbiosis and obesity184, type 2 diabetes184, and hypertension185, all of which are considered major risk factors for the development of cardiopulmonary disease186. Likewise, infants with congenital heart defects showed reduced total bacterial count as compared to healthy infants187, and

atherosclerotic plaques were found to house microbes188. Additionally, increased plasma levels of trimethylamine N-oxide, a metabolite of Firmicutes in the gut, are associated with higher risk of major adverse cardiovascular events176. Furthermore, our understanding of the link between the gut and lung is evolving. Changes in the ratio of beneficial to harmful bacteria in the gut positively influenced lung immunity and reduced inflammation189. Consistent with this, a healthy gut microbiota is protective against respiratory infection190. These data support the idea that a dysregulated gut microbiome contributes to or is a consequence of cardiopulmonary disease. It is thought that part of the negative effects of the altered gut microbiome on cardiopulmonary health may be a result of chronic low-grade inflammation that occurs following translocation of bacteria or bacterial metabolites across a leaky intestinal barrier176. Normally, tight junction proteins closely regulate paracellular permeability, which minimizes bacterial translocation and allows only select macromolecules to pass between cells191. However, defects in the tight junction complexes of the IECs can allow bacterial access into the human host179.

These findings are supported by clinical studies which suggest that consumption of probiotics improves cardiopulmonary health. Namely, probiotics have been reported to reduce BP192-199, decrease oxidative stress200-207, positively alter cholesterol concentrations192,193,208-210, and release ACE-inhibiting peptides211, all factors that affect the cardiopulmonary system. In addition, administration of probiotics has been successful in decreasing BP and delaying the development of HF in rats following MI212.

Oral probiotics can also regulate lung immune responses182, and administration of

SCFAs has been shown to attenuate allergic airway disease190. Together, these studies suggest that probiotics may have favorable effects on the heart and lungs.

Summary

Cardiopulmonary disease touches every corner of the globe, and its effects are felt by families, communities, and society as a whole. The costs for management and care of individuals with cardiopulmonary disease are astronomical and rising; despite the tremendous amount of money spent on treatments, for patients, the prognosis is grim. Thus, the investigation into novel targets for therapies is imperative. To this end, we propose to use innovative approaches to target both well-known and emerging contributors to the development of cardiopulmonary disease. The participation of RAS in the progression of these diseases is well-established, and therefore, we believe that therapies opposing the classical arm of this system will be beneficial. In addition, our knowledge of the role of the gut in cardiopulmonary-related diseases is evolving. In this regard, we believe that modulation of the gut microbiota may be protective. This dissertation will address the potential for the RAS and the gut microbiota to be inventive strategies for treatment of cardiopulmonary disease.

Figure 1-1. Pathophysiology of heart failure.

Figure 1-2. Pathophysiology of pulmonary hypertension.

Figure 1-3. Renin-angiotensin system.

CHAPTER 2 BENEFICIAL EFFECTS OF ANGIOTENSIN-(1-7) ON CD34+ CELLS FROM HEART FAILURE PATIENTS

Introduction

Heart failure (HF), a complex clinical condition in which cardiac output at late stages is insufficient for maintenance of the body’s metabolic requirements, remains a major cause of morbidity and mortality despite recent advances in the treatment of acute and chronic cardiac events213,214. Current treatments for HF are aimed at reducing the progression of the disease through medical management using pharmacotherapies including beta blockers, ACE inhibitors, Ang II receptor blockers (ARB), and antimineralcorticoids. In some instances, percutaneous or surgical interventions such as angioplasty, bypass surgery, and transplant may be necessary. Despite these therapies, the prognosis for patients diagnosed with HF is poor138. One new avenue for treatment of HF has been the investigation into use of cell therapy. Thus far, the clinical trial results have been inconsistent215, but these moderate results may be attributed to technological hurdles, including cell type, cell dose, cell survival, and timing of administration143,144. Perhaps the largest limitation remains the fact that, often, progenitor cells in patients with cardiovascular disease are dysfunctional145, minimizing the potential benefits of autologous stem cell transfer.

CD34+ hematopoietic stem cells have been studied in regards to their role in cardiac repair during HF. CD34+ cells, also known as endothelial progenitor cells

(EPCs), play a vital role in vascular maintenance146 and also function to provide paracrine support139 to injured vasculature and tissue. Other studies indicate that CD34+ cells can also promote neovascularization and participate in cardiac repair216. In humans, CD34+ cell numbers have been shown to increase directly following an acute

MI151 and CD34+ cells are elevated in patients with early HF. Together, these suggest the participation of CD34+ cells in an endogenous compensatory mechanism for revascularization. With the progression of HF, CD34+ numbers were observed to decline150. These differences in CD34+ cell number over time were further investigated.

In a study of circulating progenitors, CD34+ cells best correlated with cardiovascular risk160, and reduced circulating CD34+ cells have also been shown to predict adverse cardiovascular risk in patients with type 2 diabetes 217.In addition, studies have shown that CD34+/CD133+ cell function is decreased in ischemic cardiomyopathy154 and

CD34+ cell function is reduced in patients with vascular complications from diabetes218-

220. Collectively, this data suggests that CD34+ cells contribute to cardiovascular health and that their number and function may be decreased during disease states.

The RAS is crucial in regulating many physiological processes of the cardiovascular system, and as such, is an obvious target for treatment of cardiovascular disease. ACE produces Ang II, a small peptide which mediates its effects through the activation of either of its two receptors: AT1R or AT2R. Ang II can also be converted into Ang-(1-7) by ACE2 enzymatic activity, and Ang-(1-7) then exerts its actions via binding to the Mas receptor. Under normal physiologic conditions, a balance between the deleterious [ACE/Ang II/AT1R] and protective [ACE2/Ang-(1-7)/MasR] axes is critical for maintaining cardiovascular homeostasis. However, upregulation of the deleterious axis leads to vasoconstriction, hypertrophy, fibrosis and cardiac remodeling whereas upregulation of the protective components has vasodilatory, anti-hypertrophic, anti-proliferative, and anti-fibrotic effects221. These RAS axes have been shown to be imbalanced during HF, with increased Ang II and reduced Ang-(1-7) levels in the

plasma105 and elevated Ang II in failing human hearts105. Further, inhibition of the vasodeleterious axis through treatment with ACE inhibitors and ARBs222 or enhancement of the vasoprotective components ACE2 and Ang-(1-7) is cardioprotective46,47,72,77,89,130,223,224, underscoring the importance of the RAS as a target for HF treatment. As previously mentioned, ACE inhibitors and ARBs are commonly used in managing patients with HF; however, the continued expansion of HF warrants a new approach for targeting the RAS.

In this regard, the beneficial effects of Ang-(1-7) on progenitor cells are currently under investigation, and the outcomes thus far have been promising. Short term Ang-(1-

7) treatment increases levels of bone marrow-derived mesenchymal stem cells as well as the number of circulating EPCs in db/db mice 170. In addition, Ang-(1-7) facilitates proliferation of CD34+ and mononuclear cells in vitro165. Moreover, circulating Ang-(1-7) stimulates cardiac progenitor cells, thereby attenuating the development of HF169,225.

Our recent studies indicate that incubation with Ang-(1-7) results in enhanced vascular repair-relevant functions in diabetic CD34+ cells226. Furthermore, Ang-(1-7) reverses the vasoreparative dysfunction of CD34+ and bone marrow-derived cells from diabetic patients by stimulating nitric oxide (NO) bioavailability, reducing NADPH oxidase activity, improving migratory capacity, and restoring in vivo homing efficiency to ischemic areas147. These studies suggest that Ang-(1-7) may also provide similar benefit to CD34+ cells during HF.

Although alterations in the numbers of CD34+ progenitor cells have been implicated in patients with HF227, there is a paucity of information regarding the characteristics of these cells. Further, an increasing body of literature exists

documenting the benefits of Ang-(1-7) for normal and diabetic CD34+ cells, but the effects of Ang-(1-7) on CD34+ cells from HF patients is unknown. Therefore, in this study we have performed a detailed analysis of CD34+ progenitor cells isolated from patients with HF and have investigated the effects of Ang-(1-7) on these cells.

Methods

Patient Selection and Characterization

Peripheral blood was collected from New York Heart Association (NYHA) class

II-IV HF patients as well as from reference subjects (controls). This study was conducted under approval from the Institutional Review Board (IRB) of the University of

Florida. Participants gave written informed consent to participate in this study, and the study protocol conforms to the ethical guidelines of the 1975 Declaration of Helsinki.

Patients were consented to participate if they met the following criteria: older than 18 years of age, significant coronary artery disease (70% luminal diameter narrowing of at least one major coronary artery), left ventricular (LV) ejection fraction less than 45%, on maximal medical therapy for angina symptoms, and hemodynamically stable as defined by a systolic blood pressure greater than 80 mmHg. Patients were excluded from this study if they had atrial fibrillation, atrial flutter and/or uncontrolled arrhythmias, LV thrombus, platelet count M <100 k/mm3, white blood cells <2 k/mm3, stroke within 60 days of study enrollment, history of malignancy in the last five years, history of HIV,

Hepatitis B or C, or hepatic dysfunction as defined by AST (aspartate aminotransferase) and/or ALT (alanine aminotransferase) B 1.5 times the upper limit of normal. Pertinent characteristics of the patients are described in Table 2-1.

Isolation of Human CD34+ Cells from Peripheral Blood of HF and Control Donors

Peripheral blood (50-150 mL) was collected from patients and control donors using blood collection tubes with EDTA (Thermo Fisher Scientific, Waltham, MA, USA,

#265732). The blood was diluted 1:1 with 2% fetal bovine serum (FBS), which was subsequently carefully layered on top of Ficoll-Paque Plus (GE Healthcare, Little

Chalfont, United Kingdom; 17-1440-03) at a ratio of 1:2 (Ficoll:blood) in 50 mL disposable tubes. After density gradient centrifugation at room temperature in a swinging bucket rotor for 30 min at 2200 rpm, the buffy coat containing leukocytes was collected. Leukocytes were washed twice with buffer (2% FBS, 1 mM EDTA, PBS), and red blood cell contamination was removed by incubating with ammonium chloride solution (Stem Cell Technologies, Vancouver, Canada, #7850) on ice for 15 min.

Following two more washes, leukocytes were enriched for CD34+ cells by positive selection using human CD34+ cell enrichment kit (Stem Cell Technologies, #18056) per manufacturer instructions. In selected studies, CD34+ cells were maintained in culture in

Stem Span SFEM media (Stem Cell Technologies, #9600) supplemented with cytokine

0 cocktails (Stem Cell Technologies, #02697) in an incubator at 37 C with 5% CO2. It is critical to note that the amount of blood, and thus CD34+ cells, from each patient was highly variable and that the number of CD34+ cells from many patients was severely limited. As a result, we were not able to perform all experiments with all patient samples.

Quantification of CD34+ Cells from Whole Blood

This study was performed in collaboration with Dr. Sugata Hazra. Within 24 h of blood collection, 100 µL of blood from each donor was used to count CD34+ cells by BD

Procount progenitor cell enumeration kit (BD Biosciences, San Jose, CA, USA,

#340498) per manufacturer instructions. Briefly, 50 µL of blood from each donor was added to one tube with a reagent containing fluorchrome-labeled antibodies to CD34+, and 50 uL was added to another tube containing a control reagent to assess the amount of nonspecific antibody binding. After incubation in the dark for 15 min, the blood was lysed for 30 min and subsequently analyzed on a LSR II flow cytometer (BD

Biosciences). The data was analyzed by FCS Express (BD Biosciences) and plotted as number of CD34+ cells per µL of blood.

Colony Formation Assay

This study was performed in collaboration with Dr. Sugata Hazra. An equal number of leukocytes isolated from control and HF donors was suspended in Iscove’s

Modified Dulbecco’s Medium with 2% FBS followed by mixing with MethoCult medium

(Stem Cell Technologies, #H4434) and plating on 35 mm dishes with a blunt end

0 needle. The dishes were kept in an incubator at 37 C with 5% CO2, and the colonies were counted with an inverted microscope after ten days of incubation. Colonies were identified by comparing experimental colonies to the descriptions and images in the manufacturer protocol (Stem Cell Technologies). Burst-forming unit-erythroid (BFU-E) is a colony containing at least 200 erythroblasts in single or multiple clusters. Colony- forming unit-granulocyte, macrophage (CFU-GM) produces a colony with at least 40 granulocytes, macrophages or cells of both lineages. Colony-forming unit-granulocyte, erythroid, macrophage, megakaryocyte (CFU-GEMM) usually produces large colonies over 500 cells including erythroblasts and cells of at least two other recognizable lineages.

Cell Migration Assay

Cell migration was measured using the QCM Chemotaxis Migration Chamber

(Millipore, Billerica, MA, USA, #ECM512). Briefly, freshly isolated CD34+ cells were suspended in PBS, and 20,000 cells were placed in each well (in triplicate) of the top chamber. 100 nM stromal cell-derived factor 1α (SDF-1α, R&D Systems, Minneapolis,

MN, USA, #350-NS-010) or PBS was added to the bottom chamber. After incubation for

4 h at 370C, cells that had migrated to the bottom chamber were lysed, mixed with a fluorescent dye, transferred to a black 96 well plate, and quantified by measuring fluorescence at 480 nm excitation/520 nm emission with a spectrophometer

(SynergyMx multi-mode microplate reader, Biotek Instruments, Inc., Winooski, VT,

USA). Data was expressed as percentage increase in migration toward SDF-1α

(difference between PBS and SDF-1α wells). For determination of the effects of Ang-(1-

7) on migration, freshly isolated CD34+ cells were pretreated with 100 nM Ang-(1-7)

(Bachem, Bubendorf, Switzerland, #H-1715) for 1 h followed by washing via centrifugation to remove excess Ang-(1-7). Cells were then added to the migration chamber as detailed above.

Measurement of Nitric Oxide Production

NO levels in CD34+ cells were measured by fluorescence intensity of 4-amino-5- methylamino-2-difluorofluorescein diacetate (DAF-FM, Thermo Fisher Scientific, #D-

23844), which fluoresces upon interaction with NO. Briefly, 20,000 freshly isolated

CD34+ cells (in triplicate) were used for each treatment. CD34+ cells were incubated with 20 µM DAF-FM in Dulbecco’s PBS with Ca2+ and Mg2+ (Mediatech, Inc., Manassas,

VA, USA, #21-030-CV) supplemented with glucose (1 mg/mL) for 30 minutes in the dark followed by the addition of 1 mM L-arginine and stimulant (100 nM SDF-1α, 100 nM

Ang-(1-7), or untreated) for 30 min. After washing the cells to remove excess DAF-FM, fluorescence was measured at 485 nm (excitation) and 528 nm (emission) using a spectrophotometer (SynergyMx). Untreated cells were reported as basal NO production, and treated cells were reported as percentage increase in DAF-FM fluorescence between basal levels and SDF-1α or Ang-(1-7) treatments.

Measurement of Reactive Oxygen Species

Basal levels of reactive oxygen species (ROS) production were measured using dihyroethidium (DHE, Sigma-Aldrich, #D7008), which produces the fluorescent DNA intercalator ethidium after interaction with superoxide anions. Briefly, 20,000 freshly isolated CD34+ cells (in triplicate) were incubated with 5 uM DHE in Dulbecco’s PBS with Ca2+ and Mg2+ supplemented with 1 mg/mL glucose for 15 min in the dark. For measurement of ROS production following Ang-(1-7) treatment, Ang-(1-7) was subsequently added to some cells at a final concentration of 100 nM for 30 min, followed by washing of all cells twice and measurement of fluorescence at 488 nm

(excitation) and 585 nm (emission) using a spectrophotometer (SynergyMx). Untreated cells were reported as basal ROS production, and treated cells were reported as percentage increase in DHE fluorescence between basal levels and Ang-(1-7) treatment.

Gene Expression by Real Time RT-PCR

Total RNA was extracted from CD34+ cells with TRIzol (Life Technologies,

Carlsbad, CA, USA, #15596-018) per manufacturer protocol, and RNA purity was evaluated by 260/280 ratio measured with a spectrophotometer. 1 μg of total RNA was transcribed using iScript cDNA synthesis kit (Bio-Rad, Hercules, CA, USA, #170-8891) according to manufacturer instructions, and quantitative real-time polymerase chain

reaction (qPCR) was performed using ABI Master Mix (Applied Biosystems, Foster City,

CA, USA, #4305719). FAM-labeled primers (Applied Biosystems) were used: ACE

(Hs01104600_m1), ACE2 (Hs01085333_m1), MasR (Hs00267157_s1), AT2R

(Hs00169126_m1). All samples were normalized to 18s (Hs99999901_s1) cDNA. All cDNA samples were run in duplicate. qPCR was performed on an ABI 7500 Fast PCR

(Applied Biosystems) instrument for 40 cycles.

Acetylation of Human Cardiac Progenitor Cells

In order to study the in vitro effects of Ang-(1-7) on epigenetic and translational mechanisms, we used human cardiac progenitor cells (hCPCs). Dr. Yanfei Qi derived the hCPCs from an atrial tissue biopsy from a pediatric patient with congenital heart disease at the University of Florida (IRB #201200062). Following isolation of hCPCs, Dr.

Qi analyzed the cell population by FACS and confirmed that 93% of the population was c-kit+, a marker of CPCs 228. hCPCs were then cultured in mixed media [375 mL M199

(Thermo Fisher Scientific, #10-060-CV), 125 mL EBM-2 (Lonza, Basel, Switzerland,

#CC-3156)] supplemented with 10% FBS, 2% penicillin-streptomycin (Thermo Fisher

Scientific, #15140122), and 1% non-essential amino acid solution (Lonza, #13-114E)

0 and plated on fibronectin in an incubator at 37 C in 5% CO2. For the assay, hCPCs were plated in six well dishes, and cells underwent treatment once they were approximately 80% confluent. Cells were treated with 200 nM trichostatin A (TSA,

Sigma-Aldrich, #T1952) alone or in combination with 1 µM Ang-(1-7) for 10, 20, 40, or

60 minutes in an incubator at 370C. TSA is a histone deacetylase inhibitor that was used to bring acetylation measurements up to detectable levels. After treatment, wells were rinsed with cold PBS. Ice cold radioimmunoprecipitation assay (RIPA) buffer with protease inhibitors (Sigma-Aldrich, #P8340) was then added to each well, and cells

were scraped, transferred to 1.5 mL Eppendorf tubes, and frozen at -200C until use.

This protocol was repeated on two separate occasions for an n of 2.

Protein Quantification and Western Blot

The amount of protein in hCPC samples (treated with TSA alone or TSA plus

Ang-(1-7)) was quantified by Bio-Rad Protein Assay (Bio-Rad Laboratories, Hercules,

CA, USA, #500-0006). 15 µg of protein from each sample was mixed with loading buffer containing β-mercaptoethanol and loaded into a SDS-PAGE 4-20% gradient gel.

Proteins were transferred to nitrocellulose membrane (Bio-Rad Laboratories, #162-

0115) by wet transfer (100 V for 1.5 h). Membranes were subsequently blocked with 5% nonfat milk in Tris-buffered saline (TBS) with 0.1% Tween-20 (TBST) for 1 h at room temperature, followed by overnight incubation at 40C with various primary antibodies targeting histone H3 acetylation sites (rabbit polyclonal antibodies, Cell Signaling

Technology, Danvers, MA, USA, #9927S), including histone H3 lysine 9 (H3K9; diluted

1:5000), H3K18 (diluted 1:2000), and H3K27 (diluted 1:750). All histone H3 primary antibodies were diluted in 5% bovine serum albumin (BSA) in TBST. GAPDH (Sigma-

Aldrich, #G8795), used as a loading control, was diluted 1:2400 in 5% milk for 1 h at room temperature. Membranes were then washed with TBST three times for 5 min, followed by 1 h incubation with a secondary antibody conjugated to horseradish peroxidase diluted in 5% milk/TBST. Anti-rabbit secondary (GE Healthcare, #NA934V) was used at 1:7500 for H3K9, at 1:4000 for H3K18, and 1:2000 for H3K27. Anti-mouse secondary (GE Healthcare, #NA931V) was used at 1:3000 for GAPDH. Membranes were then subjected to a chemiluminescence detection system (PerkinElmer, Waltham,

MA, USA, #NEL10400EA) followed by exposure to autoradiography film (Denville

Scientific Inc., Holliston, MA, USA, #E3018). Densitometry was performed using GS-

800 (Bio-Rad, #170-7980), and data from two experiments was averaged and normalized to the 10 min time point.

Statistical Analyses

All results are presented as mean ± standard error of the mean (SEM). To compare between two groups, student’s t-test was done. For comparison between three or more groups, one way ANOVA followed by Tukey’s post-hoc test was performed.

The statistical analyses were performed using GraphPad Prism5 (GraphPad Software,

Inc. La Jolla, CA). P<0.05 was considered as significant.

Determination of Total Protein

Protein isolation and precipitation. hCPCs were treated with 100 nM Ang-(1-7) for 24 h, followed by two washes with ice cold PBS. Cells were lysed with buffer [8M urea, 2% Triton X-100, 100 mM dithiothreitol (DTT) in PBS] supplemented with protease inhibitors. Cells were scraped, transferred to Eppendorf tubes, and spun at 14,000 rpm for 15 min. Bio-Rad Protein Assay was performed on the supernatant to determine protein concentration. One replicate of each sample, using 150 µg protein each, was precipitated by adding one volume of 20% trichloroacetic acid (TCA) on ice for 1 h, followed by addition of four volumes of 100% cold acetone and incubation at -200C overnight. Samples were then spun at maximum speed for 20 min at 40C, and washed twice with ice cold 80% acetone. Pellet was left in a small volume of 80% acetone and stored at -800C until iTRAQ labeling.

Protein digest, iTRAQ labeling, and strong cation exchange fractionation.

Protein analysis with iTRAQ, high performance liquid chromatography (HPLC), and mass spectrometry were performed by the Interdisciplinary Center for Biotechnology at the University of Florida. Briefly, after protein precipitation, the pellet of each sample

was dissolved in 1% SDS, 100 mM triethylammonium bicarbonate, pH 8.5. The samples were reduced, alkylated, trypsin-digested and labeled using the iTRAQ Reagents

Multiplex kit according to manufacturer’s instructions (AB Sciex Inc., Foster City, CA,

USA). The samples T1 to T2 were labeled with iTRAQ tags 113 and 119, respectively.

After labeling, the samples were mixed and diluted into 0.1% trifluoricacetic acid, followed by loading on a MacroSpin Vydac C18 reverse phase minicolumn. The washing and elution were conducted following instructions from the manufacturer (The

Nestgroup Inc., USA). The eluates were dried down and dissolved in strong cation exchange (SCX) solvent A (25% v/v acetonitrile, 10 mM ammonium formate, pH 2.8).

The peptides were fractionated on an Agilent HPLC system 1100 using a polysulfoethyl

A column (2.1 x 100 mm, 5 µm, 300 Å, PolyLC, Columbia, MD, USA). Peptides were eluted at a flow rate of 200 µL/min with a linear gradient of 0–40% solvent B (25% v/v acetonitrile, 500 mM ammonium formate) over 120 min, followed by ramping up to

100% solvent B in 5 min and holding for 10 min. The absorbance at 280 nm was monitored, and a total of 12 fractions were collected.

Reverse phase nanoflow HPLC and tandem mass spectrometry. Each SCX fraction was lyophilized and redissolved in Solvent A (3% acetonitrile v/v, 0.1% acetic acid v/v) plus 0.01% trifluoroacetic acid. The peptides were loaded onto a C18 capillary trap cartridge (LC Packings) and then separated on a 15-cm nanoflow C18 column

(PepMap 75 µm id, 3 µmm, 100 A) (LC Packings) at a flow rate of 200 nL/min. Peptides were eluted from the HPLC column by a linear gradient from 3% solvent B (96.9% acetonitrile v/v, 0.1% acetic acid v/v) to 40% solvent B for 2 hours, followed by ramping up to 90% solvent B in 10 min. Peptides were sprayed into a LTQ Orbitrap XL mass

spectrometer (Thermo Fisher Scientific, Bremen, Germany), which was operated in a data-dependent acquisition mode where a MS scan followed by ten MS/MS scans of the highest abundance peptide ions were acquired in each cycle. Survey scan MS spectra

(from m/z 300 – 2000) were acquired in the orbitrap with resolution R=60,000 at m/z

400. MS/MS of the 10 most intense ions using HCD was acquired at 7500 at 400 m/z resolution with a 30,000 signal threshold, 5-ms activation time at 35 normalized collision energy, and dynamic exclusion enabled for 30 s with a repeat count of 1. Typical mass spectrometric conditions include a spray voltage of 2.2 kV, no sheath and auxiliary gas flow, a heated capillary temperature of 200 °C, a capillary voltage of 44 V, a tube lens voltage of 165 V, and an ion isolation width of 1.0 m/z.

Mass spectrometry data analysis. The MS/MS data was processed by a thorough search considering biological modifications against Uniprot fasta database

(downloaded on Jan 19, 2014) using the Paragon algorithm229 of ProteinPilot v2.0.1 software suite (AB Sciex Inc., USA). Fixed modification of methylmethanethiosulfatelabeled cysteine, fixed iTRAQ modification of free amine in the

N-terminus and lysine, and variable iTRAQ modifications of tyrosine were considered.

Parameters such as trypsin digestion, precursor mass accuracy and fragment ion mass accuracy are built-in settings of the software. The raw peptide identification results from the Paragon™ Algorithm were further processed by the ProGroup™ Algorithm. The

ProGroup Algorithm uses the peptide identification results to determine the minimal set of confident proteins. For each protein identification, two types of scores are reported, i.e., unused ProtScore and total ProtScore. The total ProtScore is a measurement of all the peptide evidence for a protein and is analogous to protein scores reported by other

protein identification software. The unused ProtScore is a measurement of all the peptides evidence for a protein that is not better explained by a higher ranking protein.

The Unused ProtScore prevents reuse of the same peptide evidence to support the detection of more than one protein. Thus, it is the real indicator of protein confidence.

The software calculates a percentage confidence which reflects the probability that the hit is a false positive, so that at the 99% confidence level, there is a false positive identification rate of 1%. The low confidence peptides do not identify a protein by themselves, but may support the presence of a protein identified using other peptides

229. Performing the search against a concatenated database containing both forward and reversed sequences allowed estimation of the false discovery level.

For protein relative quantification using iTRAQ, only MS/MS spectra unique to a particular protein and where the sum of the signal-to-noise ratio for all of the peak pairs greater than nine were used for quantification (software default settings, AB Sciex,

USA). To determine the effects of Ang-(1-7) treatment on changes in protein levels, the intensity of signal for each protein after 24 h of Ang-(1-7) treatment was divided by the signal intensity at baseline. The resulting fold changes were recorded and proteins up- or downregulated more than 1.5 fold were analyzed using Ingenuity Pathway Analysis

(IPA) software (Qiagen, Redwood City, CA, USA). The most significant canonical pathways were calculated by Fisher’s exact test right-tailed, and this significance represents the probability that molecules from our data associate with the canonical pathway rather than by random chance. Z-score assesses how well the observed and predicted up- and down-regulated patterns match. Representations of the top three canonical pathways were then generated, with proteins represented as nodes and the

line between them representing a biological relationship. Node shape denotes protein attributes such as enzyme, receptor, peptidase, cytokine, transcription factor, etc. Node color indicates the degree to which the protein is up- or downregulated; dark red is equivalent to more up-regulated, and dark green is equivalent to more downregulated.

The most significant protein networks were also identified, and representations of the top two networks were generated using the same node markings as described above.

Results

CD34+ Cells from HF Patients Exhibit Reduced Number, Impaired Migration, and Altered Colony-Forming Ability

In this study, we demonstrated that the absolute number of CD34+ cells in whole blood was reduced (p<0.05) by 47% in HF patients (2.98 ± 1.5 cells/µL blood) compared to that of controls (5.59 ± 0.5 cells/µL of blood). In addition, we observed a progressive reduction in number of CD34+ cells with increasing severity of HF (class II:

3.83 ± 0.86 cells/µL blood; class III: 2.69 ± 1.07 cells/µL blood; class IV: 1.28 ± 0.02 cells/µL blood; Figure 2-1). We then determined if there were differences in the ability of

CD34+ cells from HF patients to migrate and differentiate. HF patient CD34+ cells demonstrated 76% reduction in migratory response to SDF-1α compared to CD34+ cells from reference donors (9.71 ± 8.6 % increase towards SDF-1α in HF vs 40 ± 15.9 % increase towards SDF-1α in controls; p<0.05; Figure 2-2). Increasing severity of HF also appeared to have an effect on the ability of CD34+ cells to migrate towards SDF-1α in vitro, with the cells from class IV individuals having almost no migratory capabilities

(Figure 2-2). Further, isolation of mononuclear cells highlights alterations in the differentiation capabilities of CD34+ cells from HF patients in comparison to controls. HF patient mononuclear cells differentiated into 65% fewer BFU-E colonies (63 ± 3.6

colonies with control cells vs 22.7 ± 14.6 colonies with HF cells; p<0.05; Figure 2-3A) and substantially more CFU-GEMM colonies (3 ± 1 colonies with control cells vs 21.6 ±

17.3 colonies with HF cells; Figure 2-3B) compared to reference individuals. However, the number of observed CFU-GM colonies remained similar between reference and HF individuals (Figure 2-3C).

CD34+ Cells from HF Patients Demonstrate Aberrant Production of Nitric Oxide and Reactive Oxygen Species

Altered NO bioavailability and increased oxidative stress, both of which result in endothelial dysfunction, are well-studied in HF patients230. We investigated if these parameters are also affected in CD34+ cells from HF patients. Basal NO levels in CD34+ cells from HF patients were 34% lower than in control CD34+ cells (5192 ± 406.3 RFU in control vs 3448.4 ± 184.1 RFU in HF; p<0.001, Figure 2-4A). Because previous work has reported that SDF-1α-induced migration is dependent on NO synthesis231,232, we investigated if HF affects SDF-1α-induced NO production in CD34+ cells. NO bioavailability in response to SDF-1α was reduced by 56% in HF patient CD34+ cells

(47.7 ± 4.5 RFU in control vs 21.1 ± 12.5 RFU in HF; p<0.05, Figure 2-4B). Studies have shown that NO bioavailability is impaired by excessive generation of ROS233; thus, we measured ROS production. Basal levels of ROS tended to be 69% higher in CD34+ cells from HF patients compared to controls (1036.3 ± 184.6 RFU in control vs 1755.9 ±

874.7 RFU in HF; Figure 2-5).

CD34+ Cells from HF Patients Display Altered Renin-Angiotensin System Gene Expression

The involvement of the RAS in the development of cardiovascular disease is well known, and the recent discovery of beneficial components of the RAS has highlighted the concept that a balance between vasoprotective and vasodeleterious RAS

components is critical for the health of the cardiovascular system. Thus, we measured the gene expression of key members of the RAS. ACE, a central enzyme of the vasodeleterious RAS axis, was undetectable in control cells, but increased in CD34+ cells from HF patients (2-dCt: 1.66x10-4, Figure 2-6A). In contrast, expression of ACE2

(Control 2-dCt: 4.21x10-3 ± 1.8x10-3 vs HF 2-dCt: 8.26x10-4 ± 5.3x10-4, Figure 2-6B) and

Mas (Control 2-dCt: 6.97x10-5 ± 3.6x10-5 vs HF 2-dCt: 1.07x10-5 ± 6.9x10-6,Figure 2-6C), two important members of the vasoprotective axis RAS, was significantly reduced in

CD34+ cells isolated from HF patients compared with controls. In addition, expression of

AT2R, a receptor for Ang II, was significantly upregulated in the CD34+ cells from HF patients (Control 2-dCt: 4.03x10-6 ± 2.2x10-6 vs HF 2-dCt: 2.41x10-3 ± 7.4x10-4, Figure 2-

6D).

Ang-(1-7) Improves Migratory Ability, NO Bioavailability, and ROS Production of CD34+ Cells

We observed dysfunction in the repair functions of CD34+ cells from HF patients that was associated with an imbalance of components of the RAS. Thus, we were interested if incubation with Ang-(1-7), a peptide from the beneficial axis of the RAS, would restore the reparative capabilities of these cells. In fact, pretreatment of CD34+ cells with Ang-(1-7) improved the SDF-1α-induced migratory abilities of CD34+ cells from both controls (147% increase, Figure 2-7A) and HF (89% increase, Figure 2-7B) patients. In addition, pretreatment of CD34+ cells with Ang-(1-7) increased NO bioavailability by 6.8% in CD34+ cells from control individuals and 15.3% in (Figure 2-8) in those from HF patients. It is interesting to note that although basal NO levels were lower in HF patient CD34+ cells compared to controls (Figure 2-4A), CD34+ cells from

HF patients exhibited a more robust response to Ang-(1-7) treatment than did controls.

Further, we found that Ang-(1-7) treatment reduced superoxide production by 12% in

CD34+ cells from both HF patients and controls (Figure 2-9).

Ang-(1-7) Treatment Induces Alterations in Histone Acetylation and Protein Expression

The ability of Ang-(1-7) to enhance the function of CD34+ cells from both HF patients and control individuals raises the question of mechanism of action. We hypothesized that these alterations in function could be a result of epigenetic and/or translational changes. Given the difficulty in obtaining a significant number of CD34+ cells with which to perform multiple experiments with consistency, we decided to use hCPCs to address the question of Ang-(1-7) mechanism of action. We have previously shown that hCPCs, which are thought to promote cardioprotection, respond to Ang-(1-7) by exhibiting enhanced proliferative and tube-forming capabilities. Therefore, in hCPCs, we measured both histone H3 acetylation and protein expression following incubation with Ang-(1-7). In regards to histone acetylation, few differences in acetylation at histone H3 lysine 9 (H3K9) were seen between control and Ang-(1-7)-treated cells

(Figure 2-10A). However, acetylation at histone H3 lysine 18 (H3K18) trended to increase at all time points in Ang-(1-7)-treated cells compared to controls (10 min TSA:

1.0 vs 10 min TSA + Ang-(1-7): 1.445 ± 0.38; 20 min TSA: 0.843 ± 0.36 vs 20 min TSA

+ Ang-(1-7): 1.861 ± 0.34; 40 min TSA: 1.289 ± 0.22 vs 40 min TSA + Ang-(1-7): 3.521;

60 min TSA: 1.581 ± 0.11 vs 60 min TSA + Ang-(1-7): 3.132 ± 0.35; Figure 2-10B).

Additionally, the differences observed in the 40 and 60 min time points were greater than those seen at the earlier time points (173% and 98% increased above TSA alone, respectively). Interestingly, acetylation at histone H3 lysine 27 (H3K27) trended higher following Ang-(1-7) treatment at 10, 20, and 40 min, but appeared reduced compared to

controls at the 60 min point (10 min TSA: 1.0 vs 10 min TSA + Ang-(1-7): 1.652 ± 0.01;

20 min TSA: 0.912 ± 0.42 vs 20 min TSA + Ang-(1-7): 2.216 ± 0.30; 40 min TSA: 2.061

± 0.60 vs 40 min TSA + Ang-(1-7): 2.787; 60 min TSA: 4.147 ± 1.54 vs 60 min TSA +

Ang-(1-7): 2.417 ± 0.33; Figure 2-10C).

In order to measure changes in protein expression, we performed mass spectrometry analysis on human cardiac progenitor cells (hCPCs) incubated with Ang-

(1-7) for 24 h. We identified 453 proteins that were upregulated following Ang-(1-7) treatment, and 57 that were downregulated. The 29 proteins that were upregulated more than three fold and the 25 proteins that were downregulated more than three fold are listed in Table 2-2 and Table 2-3, respectively. The remaining proteins can be found listed in Appendix A-1. The two most significant protein networks identified around fibronectin [FN1] (Figure 2-11), and 60s ribosomal subunit, RhoA kinase, and actin

(Figure 2-12). The top ten statistically significant pathways (Table 2-4) include pathways such as eukaryotic initiation factor (EIF) 2 signaling, epithelial adherens junction signaling, caveolar-mediated endocytosis signaling, actin cytoskeleton signaling, and integrin signaling. Figure 2-13 shows the EIF2 signaling pathway, Figure 2-14 shows the epithelial adherens junctions pathway, and Figure 2-15 shows the calveolar- mediated endocytosis signaling pathway. The intensity of node color in each figure depicts the degree of upregulation (red) or downregulation (green). For example, EIF2γ is more highly upregulated (3.022 fold, dark red) than PP1c (1.729 fold, light red), and

40s ribosomal subunit is downregulated (3.687 fold, dark green).

Discussion

The novel findings of this study are as follows: (1) HF patients exhibit a reduction in absolute numbers of CD34+ cells compared with reference individuals, and patients

with advanced stages of HF have a more drastic reduction in CD34+ cell numbers; (2)

The migratory capacity of CD34+ cells is impaired in HF patients compared with reference controls, with a more dramatic reduction in migratory response associated with increasing severity of HF; (3) CD34+ cell dysfunction in HF patients is associated with altered capability to differentiate, reduced NO bioavailability, increased generation of ROS, and altered expression of key components of the RAS; and (4) Most importantly, pretreatment of CD34+ cells with Ang-(1-7) restores crucial functional capabilities (improved migration, increased NO bioavailability, and reduced ROS) of the dysfunctional CD34+ cells isolated from HF patients and controls. These findings greatly enhance our understanding of CD34+ progenitor cell dysfunction in HF. Furthermore, our findings suggest that Ang-(1-7) could be used as a potential therapeutic to improve progenitor cell dysfunction in HF patients.

Previous work has reported that the number of CD34+ cells is reduced in NYHA class III-IV HF patients compared to NYHA classes I-II, whereby NYHA class I patients actually showed an increased level of circulatory CD34+ cells above controls150.

Increased levels of CD34+ cells have also been reported in individuals in both NYHA class I or class II234. Our study corroborates these observations. In the present study, we did not have any patients in NYHA class I. However, we demonstrate here that the numbers of CD34+ cells in NYHA class II individuals are slightly higher compared to controls, whereas CD34+ cell numbers are significantly reduced in NYHA class III and class IV individuals. This reduction in CD34+ cell number may contribute to the progressive symptoms seen in HF. It is interesting to note that although we observed increased numbers of CD34+ cells in patients with NYHA class II HF, these cells

displayed a substantial reduction in migratory capacity (Figure 2-2). This may suggest that the rise in CD34+ cell number is in response to a reduction in CD34+ cell function.

Namely, the CD34+ cells are being overproduced in an attempt to make up for any loss in their functional capacity. Certainly, this is an idea that needs to be investigated further before any conclusions can be made.

In addition to deficiencies in cell number, bone marrow dysfunction is indicated in chronic HF patients, as observed by reduction in the number of several hematopoietic lineages such as BFU-E, CFU- erythroid (CFU-E) and CFU-megakaryocyte (CFU-M)235.

In the present study, we have demonstrated that number of BFU-E colonies formed by

CD34+ cells from patients with HF is reduced compared with reference individuals.

However, our colonies did not include CFU-E and CFU-M, and thus, we could not compare those. In looking at other lineages, we report similar numbers of CFU-GM colonies for HF and control donors as well as increased CFU-GEMM colonies arising from the CD34+ cells from HF patients. The enhanced differentiation capacity for certain lineages in CD34+ cells from individuals with HF could be attributed to the mixed patient cohort (NYHA classes II-III) that was utilized for the experiment. Thus, a reduction in colony numbers for patients with severe HF may be masked by the normal differentiation capacities of CD34+ cells from patients with less severe disease.

Additionally, our results could be complicated by the differing HF etiologies within each patient cohort.

Impaired migratory capacity of progenitor cells has been indicated in several diseases such as diabetes, hypertension and hypercholesterolemia148,236-238. In addition,

CD34/CD45/CD133/CXCR4 progenitor cells have demonstrated reduced migratory

capabilities five days following acute MI239. Also, CD34+/KDR+ cells from chronic HF patients had impaired migration240. Similarly, we investigated the migratory response towards SDF-1α of CD34+ cells in different classes of HF patients. Here, we provide direct evidence that progenitor cell migration is severely impaired in HF individuals.

Most strikingly, CD34+ cells from NYHA class IV patients show no response to SDF-1α.

This migratory dysfunction could be a result of a number of contributing factors. First,

SDF-1α is known to bind the CXCR4 receptor on CD34+ cells to facilitate their migration from the bone marrow241,242. Although there is no evidence thus far to suggest alterations in CXCR4 receptor expression during HF, the reduced migratory response of

CD34+ cells in HF could be due to reduced expression of CXCR4 receptors on CD34+ cells. Second, it is well established that endothelial nitric oxide synthase and NO play crucial roles in progenitor cell migration243 and NO donors are able to correct progenitor cell dysfunction244. As reduced NO bioavailability is evident in HF individuals245, we measured NO levels in the CD34+ cells. To our knowledge, the present data is the first to report that CD34+ cells from HF patients have reduced levels of basal NO and SDF-

1α-induced NO levels, which could affect the ability of CD34+ cells to migrate.

Interestingly, NO has been shown to regulate the transcription of CXCR4, a receptor for

SDF-1α246. Perhaps upregulation of CXCR4 is one mechanism by which NO donors enhance progenitor cell migration, and thus, how Ang-(1-7) may improve migration in

CD34+ cells. Third, increased oxidative stress leads to endothelial dysfunction in HF247 and also impairs progenitor cell function248. We demonstrate here that basal ROS levels are increased in CD34+ cells isolated from HF individuals, a finding that may explain reduced NO bioavailability in CD34+ cells249. In diabetes, the increase in superoxide

production results from dysfunctional eNOS regulation249, a finding that we would need to confirm in our study. Lastly, integrins, especially α4β1, and proteases such as MMP-2 and MMP-9 play a major role in progenitor cell migration from bone marrow250,251. Thus, alterations in protease activity or the interaction of integrins with cell adhesion molecules could also explain altered migration capacity. Additional experiments are needed to verify these possibilities in HF patient CD34+ cells.

Our study highlights the molecular changes in the RAS of CD34+ cells from HF patients that may underlie some of the HF pathologies. Previous studies have shown alterations in RAS components in the heart and brain during HF. Studies of animals with

HF show increased ACE in the heart47 and in regions of the brain252 Similarly, ACE expression is increased in human failing hearts98,100,253. Whereas measurement of ACE expression appears to be consistent, some controversies regarding ACE2 expression exist within clinical and animal studies. These inconsistencies may be attributed to differences in HF etiologies. For example, rats with HF have decreased ACE2 and Mas expression in the heart47. However, some clinical studies noted no changes in ACE2 expression in the myocardium of severe HF patients100, whereas others report upregulated ACE2 levels98,253,254. Regardless of differences, most studies corroborate the idea that levels of RAS components change during HF. In our study, we did not test the RAS expression in the heart, but we did detect an imbalance in the vasoprotective versus vasodeleterious axes of the RAS in CD34+ cells from HF patients. Specifically,

HF patient CD34+ cells exhibited increases in ACE and AT2R mRNA expression and decreases in the expression of ACE2 and Mas. This is consistent with a study suggesting that ACE2 expression is also decreased in CD34+ cells from diabetic

patients147. Interestingly, CD34+ cells from both HF and diabetic patients are dysfunctional and exhibit lower ACE2 expression. Whether the reduction in ACE2 is causative of CD34+ cell dysfunction remains to be investigated. Additionally, the link, if any, between altered RAS expression in the heart and CD34+ cells needs to be studied further.

The most critical part of our study is the demonstration that pretreatment of the

CD34+ cells with Ang-(1-7) partially corrects progenitor cell dysfunction. Several experimental observations have demonstrated that the protective ACE2/Ang-(1-7)/Mas axis has a beneficial role in cardiovascular function. In particular, Ang-(1-7) has anti- inflammatory255, antioxidant256, and vasodilatory properties257, and it is also associated with NO release258 and attenuation of oxidative stress259,260. Further, Ang-(1-7) improves cardiac function in different animal models of HF such as MI, cardiomyopathy and models with metabolic syndrome90,261-263, in addition to reducing development of HF after MI225. In addition, ACE2 overexpressing mice show cardioprotection against MI74.

In this case, our data suggest that the cardioprotective effects of Ang-(1-7) may be, in part, a result of its actions on CD34+ cells. Our group has previously demonstrated that

Ang-(1-7) restores the function of CD34+ cells from diabetic patients147.

It is worth noting that we observed benefits of Ang-(1-7) treatment despite a reduction in Mas receptor mRNA expression in CD34+ cells. Interestingly, our study is not the first to show effects of Ang-(1-7) treatment on CD34+ cells that have reduced

Mas mRNA expression147. Ang-(1-7) benefit may be through a number of mechanisms.

First, Mas is expressed, even at low levels, which would allow binding of Ang-(1-7) and downstream action. Second, we tested Mas mRNA prior to Ang-(1-7) treatment.

Therefore, it is possible that Ang-(1-7) stimulates the externalization of Mas. Previous studies do not support this hypothesis, as they have shown internalization of Mas by

Ang-(1-7) in HEK 293T cells264; however, this mechanism has not been studied in

CD34+ cells. Third, Ang-(1-7) may be acting via an alternate receptor. For example, others have shown that Ang-(1-7) can activate AT2R265-267, and there is even emerging evidence that Mas interacts with AT2R 268. Our observation of increased levels of AT2R in CD34+ cells makes this last scenario very probable.

These data raise the question: By what mechanism(s) is Ang-(1-7) beneficial?

For this, the analysis of Ang-(1-7) effects on histone H3 acetylation and protein expression have been enlightening. To our knowledge, our study is the first to report

Ang-(1-7) influence on histone H3 acetylation. The role of epigenetic modification of

DNA in HF is only emerging, but already, it is apparent that histone acetylation is a crucial factor. Histone acetylation is a means by which cells control gene expression.

Histone acetyltransferases (HATs) acetylate lysine amino acids on histone proteins, an action that decondenses the chromatin and allows for transcriptional activation. This process is counter-regulated by histone deacetylates (HDACs) that remove the acetyl groups, resulting in condensed chromatin and gene silencing. Studies have shown that acetylation is involved in the cardiac remodeling process269. Specifically, HDAC inhibition has been shown to inhibit hypertrophy, autophagy, apoptosis, fibrosis, and inflammation, while also improving contractility and myocardial performance after MI270.

Interestingly, Ang II has been shown to activate HDAC1 and HDAC2 in cardiac fibroblasts and induce their proliferation and migration271. Inhibition of these HDACs attenuates this proliferation and migration in addition to reducing MMP expression and

production of extracellular matrix proteins. Thus, it appears that at least some of the pathological activity of Ang II occurs via histone deacetylation, whereas our study suggests that Ang-(1-7) may act by enhancing acetylation. It is unknown whether this increase in acetylation is due to inhibition of HDACs or activation of HATs. Additionally, we can only speculate that Ang-(1-7) benefit may be partially via this mechanism; further studies need to be performed before a direct link can be made between Ang-(1-

7) effects on histone acetylation and effects on fibrosis, hypertrophy, etc. Moreover, epigenetic regulation is complicated, and Ang-(1-7) may affect various cell types differently.

Our study has also identified protein networks and biological pathways that are affected by Ang-(1-7) actions. One important protein network was found to be highly connected to fibronectin (Figure 2-11), although upregulation of fibronectin was minimal

(1.56 fold, Appendix A-1). Fibronectin, a glycoprotein, has been reported to play a role in pathological cardiomyocyte hypertrophy272. Interestingly, Ang II has been shown to stimulate fibronectin expression in the LV via direct action on non-myocytic cardiac cells273. We identified another protein network that had important ties to 60s ribosomal subunit, RhoA kinase, and actin, proteins also linked to hypertrophy. In general terms, increased ribosomal biogenesis, including that of the 60s subunit, is necessary for ramping up protein synthesis required for cardiac hypertrophy274. More specifically, Ang

II leads to enhanced ribosomal expression and protein synthesis in the LV275. In addition to ribosomal biogenesis, cardiac hypertrophy requires the organization of actin into myofibrils. In this regard, Ang II can directly stimulate actin expression in cardiomyocytes276 and also induce actin organization through activation of RhoA

kinase277. Ang II also acts through the RhoA/Rock pathway to induce migration and collagen synthesis of lung fibroblasts278, actions that can be suppressed by ACE2 and

Ang-(1-7). It seems contradictory to report that incubation with Ang-(1-7) resulted in upregulation of proteins such as fibronectin, RhoA, and actin, which have all been previously shown to increase with Ang II treatment. However, these studies may not be directly comparable, given differences in length of Ang II and Ang-(1-7) treatments as well as in vitro versus in vivo differences. Further, Ang-(1-7) may behave differently in the presence of Ang II or in diseased microenvironments. For example, Ang-(1-7) inhibits Ang II-induced RhoA stimulation, but Ang-(1-7) given alone activates RhoA278 via the Ang II receptor, AT1R. It is possible that these other conflicting results may be explained by the ability of Ang-(1-7) to act through AT1R. It is also entirely probable that

Ang-(1-7) affects cardiac progenitor cells differently than it does other cell types. We should also consider the possibility that some of the observed alterations in proteins may be induced by interactions between the hCPCs and the fibronectin on which the cells were cultivated.

Incubation with Ang-(1-7) also resulted in upregulation of proteins in particular signaling pathways, each of which has implications in cardiovascular health. For one,

EIF2 signaling is important in the endoplasmic reticulum stress response279 and in regulation of proinflammatory cytokine expression280, both of which are associated with development of heart disease281,282. For another, the epithelial adherens junction signaling promotes cell-cell adhesion, and reduction in expression of adherens junction proteins contributes to the pathology of HF283. Specifically, the proteins from this pathway that were identified as upregulated, such as F-actin, Tubulin, ARP2/3, are

members of the scaffold for junction proteins E-cadherin and nectin. Thus, these proteins allow for the formation of mature adherens junctions284, which are critical to maintaining normal cardiac function. Lastly, we discovered a connection between Ang-

(1-7) and caveolar-mediated endocytosis signaling. This is particularly interesting given previous data showing that the caveolae are important for signaling in the heart285.

Others have reported that reduced caveolin-1 is associated with cardiomyopathy and

PH286 and deficiency PTRF, a caveloae protein, results in cardiac dysfunction287.

Remarkably, we found that Ang-(1-7) treatment increases both caveolin-1 and PTRF expression. Perhaps regulation of caveolae is one mechanism by which Ang-(1-7) is beneficial to heart failure. This idea is supported by previous studies showing Ang-(1-7) stimulation of Mas receptor internalization, at least in part by caveolae264.

Collectively, this data suggests that manipulation of the RAS in CD34+ cells may enhance the function of progenitor cells for treatment of HF However, there are numerous caveats to this study that need to be addressed before such treatment may be possible. First, because it was a human study, our patients had a wide variety of etiologies and symptom severity. As a result, we collected different volumes of blood from each patient, at the discretion of their attending physician. Additionally, as we reported, patients presenting with more severe disease had fewer CD34+ cells.

Consequently, we were unable to have enough cells from each patient to run all of our experiments. Ideally, we would perform all experiments in all patients and subsequently compare those tests within the same individual. Secondly, because we had a limited number of patients, we combined migration, NO, and ROS data from all patients rather than separating according to NYHA classification. Having more patients in each

category would have allowed us to determine if these measures of dysfunction are progressive, and if dysfunction in any of these parameters precedes the dysfunction of the others. Third, one of the limitations of autologous stem cell transfer is the dysfunction of the patient cells. We have shown here that CD34+ cell function can be improved by incubation for Ang-(1-7). However, the amount of time cells spent incubated with Ang-(1-7) here was relatively short, and the parameters tested were in vitro. It remains to be seen what in vivo effects, if any, CD34+ cells treated in vitro would have. We may find that long-term overexpression of Ang-(1-7) in CD34+ cells has more potential as a therapy. Nevertheless, this investigation demonstrated that CD34+ cells demonstrate RAS imbalance in HF, consistent with studies of other tissues.

Furthermore, the discoveries made here will allow us to design treatments for HF that will enhance the endogenous repair capabilities of each individual.

Figure 2-1. Reduced number of CD34+ cells in HF patients. FACS analysis of the absolute number of CD34+ cells per µL of whole blood demonstrates reduced numbers of CD34+ cells of NYHA classes II-IV in comparison to reference controls (n=2-4/group). Data are presented as mean ± SEM. *p<0.05.

Figure 2-2. Reduced migratory capacity of CD34+ cells in HF patients. Migratory response of CD34+ cells towards stromal cell derived factor-1 (SDF-1α) measured by modified Boyden chamber assay reveals reduced migration of CD34+ cells of NYHA classes II-IV in comparison to reference controls (n=2- 7/group). 20,000 cells were seeded in each chamber. Data are presented as mean ± SEM. *p<0.05.

Figure 2-3. Altered colony-forming capability of CD34+ cells in HF patients. Quantification of A) BFU-E, B) CFU-GEMM, and C) CFU-GM colonies formed in semisolid medium demonstrate a reduction in the ability of CD34+ cells from HF patients (NYHA classes II-IV) to form BFU-E colonies in comparison to reference controls (n=3-5/group). Data are presented as mean ± SEM. *p<0.05.

Figure 2-4. Decreased nitric oxide bioavailability of CD34+ cells in HF patients. A) Basal (n=3-4/group) and B) Stromal cell-derived factor 1 α (SDF-1α)-induced nitric oxide (n=8-9/group) production assessed by DAF-FM fluorescence indicates reduced bioavailability of CD34+ cells from HF patients (NYHA classes II-IV) in comparison to reference controls. Data are presented as mean ± SEM. *p<0.05. RFU: relative fluorescence units.

Figure 2-5. Increased reactive oxygen species (ROS) production in CD34+ cells in HF patients. Basal ROS levels measured by DHE fluorescence demonstrate higher ROS production in CD34+ cells from HF patients (NYHA classes II-IV) in comparison to reference controls (n=4-5/group). Data are presented as mean ± SEM. RFU: relative fluorescence units. Data shows trend, but is non- significant.

Figure 2-6. Altered gene expression of components of the renin-angiotensin system in CD34+ cells from HF patients. Real time RT-PCR analysis of gene expression of A) ACE, B) ACE2, C) MasR, and D) AT2R indicates reduced expression of vasoprotective ACE2 and MasR and increased expression of ACE and AT2R in CD34+ cells from HF patients (NYHA classes II-IV) in comparison to reference controls (n=4-18/group). Data are presented as mean ± SEM. *p<0.05.

Figure 2-7. Pre-treatment of CD34+ cells with Ang-(1-7) enhances migratory capacity. Migratory response of CD34+ cells towards stromal cell derived factor-1α (SDF-1α) measured by modified Boyden chamber assay reveals improved migration of CD34+ cells from A) reference individuals and B) HF patients (NYHA classes II-IV) (n=3/group). Data are presented as mean ± SEM. *p<0.05.

Figure 2-8. Pre-treatment of CD34+ cells with Ang-(1-7) improves nitric oxide bioavailability. Nitric oxide production assessed by percentage increase in DAF-FM fluorescence between untreated and Ang-(1-7)-treated cells indicates increased nitric oxide bioavailability in CD34+ cells from reference controls and HF patients (NYHA classes II-IV) following Ang-(1-7) treatment (n=6-10/group). Data are presented as mean ± SEM. *p<0.05 vs untreated cells.

Figure 2-9. Pre-treatment of CD34+ cells with Ang-(1-7) reduces reactive oxygen species (ROS) production. ROS levels measured by percentage decrease in DHE fluorescence between untreated and Ang-(1-7)-treated cells demonstrate lower ROS production in CD34+ cells from reference controls and HF patients (NYHA classes II-IV) (n=5-8/group). Data are presented as mean ± SEM. *p<0.05 vs untreated cells.

Figure 2-10. Acetylation of human cardiac progenitor cells (hCPCs) in response to Ang- (1-7) treatment. hCPCs were treated with 200 nM trichostatin A (TSA) alone (blue) or in combination with 1 µM Ang-(1-7) (green) for 10, 20, 40, and 60 min. TSA was used to enhance the detection of changes in acetylation. After treatment, cells were harvested, proteins extracted, and SDS-PAGE used to separate proteins. Expression of A) H3K9, B) H3K18, and (C) H3K27 were detected by immunoblotting, using GAPDH as a loading control. Protein acetylation intensity was quantified by densitometry using ImageJ. Data is presented as relative fold change of acetylation level compared to GAPDH, normalized to the 10 min TSA time point. Data is expressed as mean ± SEM from two independent experiments. Data shows trends, but significance cannot be tested due to n = 2.

Figure 2-11. The most significant protein network affected by Ang-(1-7) treatment identifies around fibronectin [FN1] (indicated by blue star). Each node represents a protein, and the lines between nodes indicate protein relationships. The intensity of node color depicts the degree of upregulation (dark red: more highly upregulated, light red: less highly upregulated). Uncolored nodes have a relevance to this network, but were not differentially expressed in our study.

Figure 2-12. The second-most significant protein network affected by Ang-(1-7) treatment identifies around 60s ribosomal subunit, RhoA kinase, and actin [ACTB] (indicated by blue stars). Each node represents a protein, and the lines between nodes indicate protein relationships. The intensity of node color depicts the degree of up- (dark red) or down- (dark green) regulation. Uncolored nodes have a relevance to this network, but were not differentially expressed in our study

Figure 2-13. Proteins in the EIF2 signaling pathway affected by Ang-(1-7) treatment. Each node represents a protein, and the lines between nodes indicate protein relationships. The intensity of node color depicts the degree of up- (dark red) or down- (dark green) regulation. Uncolored nodes have a relevance to this network, but were not differentially expressed in our study. Green boxes highlight the names of various proteins that had altered expression in our study.

Figure 2-14. Proteins in the epithelial adherens junctions pathway affected by Ang-(1-7) treatment. Each node represents a protein, and the lines between nodes indicate protein relationships. The intensity of node color depicts the degree of up- (dark red) or down- (dark green) regulation. Uncolored nodes have a relevance to this network, but were not differentially expressed in our study. Green boxes highlight the names of various proteins that had altered expression in our study.

Figure 2-15. Proteins in the calveolar-mediated endocytosis signaling pathway affected by Ang-(1-7) treatment. Each node represents a protein, and the lines between nodes indicate protein relationships. The intensity of node color depicts the degree of up- (dark red) or down- (dark green) regulation. Uncolored nodes have a relevance to this network, but were not differentially expressed in our study. Green boxes highlight the names of various proteins that had altered expression in our study.

Table 2-1. Baseline characteristics of study participants HF Patients (n=31) Demographics Age, y, mean ± SEM 60.0 ± 1.9 (31) Male, n (%) 28 (90.3) Female, n (%) 3 (9.7) Race Caucasian, non-Hispanic, n (%) 30 (97) African American, non-Hispanic, n (%) 1 (3) New York Heart Association class II, n. (%) 18 (58.1) New York Heart Association class III-IV, n (%) 13 (41.9) Physical Examination Weight, kg, mean ± SEM (n) 88.2 ± 3.6 (30) Pulse, mean ± SEM (n) 71.0 ± 1.7 (30) Body mass index, mean ± SEM (n) 29.1 ± 1.1 (29) Systolic blood pressure, mm Hg, mean ± SEM (n) 112.7 ± 3.1 (30) Diastolic blood pressure, mm Hg, mean ± SEM (n) 68.7 ± 2.2 (30) Medical Risk Factors or Comorbidities Coronary artery disease, n (%) 24 (77.4) Ischemic cardiomyopathy, n (%) 23 (74.2) Hypertension, n (%) 20 (64.5) Diabetes mellitus, n (%) 8 (25.8) Myocardial infarction, n (%) 6 (19.3) Hyperlipidemia, n (%) 20 (64.5) Atrial fibrillation, n (%) 9 (29.0) Type of Treatment ACE inhibitor or angiotensin receptor blocker, n (%) 23 (74.2) β-Blocker, n (%) 29 (93.5) Mineralocorticoid receptor antagonist, n (%) 5 (16.1) Diuretic, n (%) 23 (74.2) Statin, n (%) 26 (83.9) Cardiac glycoside, n(%) 12 (38.7) Implantable cardioverter-defibrillator, n (%) 11 (35.5) Complete blood count White blood cells, thou/cu mm, mean ± SEM (n) 8.3 ± 0.6 (18) Hemoglobin, g/dL, mean ± SEM (n) 14.0 ± 0.3 (19) Hematocrit, %, mean ± SEM (n) 42.9 ± 0.9 (19) Platelets, thou/cu mm, mean ± SEM (n) 209.1 ± 14.6 (19) Basic Metabolic Panel Sodium, mmol/L, mean ± SEM (n) 139.0 ± 0.6 (24) Potassium, mmol/L, mean ± SEM (n) 3.9 ± 0.1 (24) Chloride, mmol/L, mean ± SEM (n) 100.8 ± 0.9 (24) Carbon Dioxide, mmol/L, mean ± SEM (n) 26.9 ± 1.0 (24) Urea Nitrogen, mg/dL, mean ± SEM (n) 18.7 ± 2.0 (24) Creatinine, mg/dL, mean ± SEM (n) 1.1 ± 0.1 (24) Glucose, mg/dL, mean ± SEM (n) 144.3 ± 21.0 (24)

Table 2-1. Continued HF Patients (n=31) Basic Metabolic Panel Calcium, mg/dL, mean ± SEM (n) 9.3 ± 0.1 (24) EGFR, mL/min/1.73M2, mean ± SEM (n) 58.3 ± 2.7 (24) Magnesium, mg/dL, mean ± SEM (n) 2.1 ± 0.0 (16) INR, mean ± SEM (n) 1.5 ± 0.1 (15) Abbreviations: ACE, Angiotensin converting enzyme; n, number of heart failure (HF) patients; (n), number of HF patients that had that particular lab result available; SEM, standard error of the mean.

Table 2-2. Proteins upregulated ≥ 3 fold after Ang-(1-7) treatment of hCPCs. UniProt Gene Name Fold Change Protein Name P00558 PGK1 4.574 Phosphoglycerate kinase 1 Q9Y2D5 AKAP2 4.303 A-kinase anchor protein 2 E7EMF1 ITGA2 3.629 Integrin alpha-2 P68032 ACTC1 3.586 Actin, alpha cardiac muscle 1 P27658 COL8A1 3.445 Collagen alpha-1(VIII) chain Q9UDY2 TJP2 3.365 Tight junction protein ZO-2 P07203 GPX1 3.356 Glutathione peroxidase 1 Q05682 CALD1 3.331 Caldesmon 3.296 UDP-N-acetylhexosamine pyrophosphorylase- Q3KQV9 UAP1L1 like protein 1 P04406 GAPDH 3.221 Glyceraldehyde-3-phosphate dehydrogenase 3.218 Secretory carrier-associated membrane protein O14828 SCAMP3 3 P08758 ANXA5 3.173 Annexin A5 P10620 MGST1 3.169 Microsomal glutathione S-transferase 1 P36578 RPL4 3.166 60S ribosomal protein P46778 RPL21 3.152 60S ribosomal protein Q562M3 ACT 3.119 Actin-like protein Q13439 GOLGA4 3.106 Golgin subfamily A member 4 P12956 XRCC6 3.093 X-ray repair cross-complementing protein 6 P36871 PGM1 3.084 Phosphoglucomutase-1 P04792 HSPB1 3.074 Heat shock protein beta-1 Q14847 LASP1 3.065 LIM and SH3 domain protein 1 H0Y827 FKBP10 3.060 Peptidylprolyl isomerase Q14315 FLNC 3.038 Filamin-C P41091 EIF2S3 3.023 Eukaryotic translation initiation factor 2 subunit 3 P14314 PRKCSH 3.014 Glucosidase 2 subunit beta P07900 HSP90AA1 3.004 Heat shock protein HSP 90-alpha CCT4 P50991 3.004 T-complex protein 1 subunit delta SOD2 P04179 2.995 Superoxide dismutase [Mn], mitochondrial TUBB P07437 2.983 Tubulin beta chain

Table 2-3. Proteins downregulated ≥ 3 fold after Ang-(1-7) treatment of hCPCs. UniProt Gene Name Fold Change Protein Name Q5JTD0 TJAP1 -3.167 Tight junction-associated protein 1 Q8IYU2 HACE1 -3.373 E3 ubiquitin-protein ligase HACE1 P17813 ENG -3.398 Endoglin Q9NX02 NLRP2 -3.414 NACHT, LRR and PYD domains-containing protein 2 P62847 RPS24 -3.687 40S ribosomal protein S24 Q00839 HNRNPU -3.863 Heterogeneous nuclear ribonucleoprotein U P05060 CHGB -3.898 Secretogranin-1 Q96K58 ZNF668 -3.942 Zinc finger protein 668 P55084 HADHB -4.107 Trifunctional enzyme subunit beta, mitochondrial Q8IXL6 FAM20C -4.193 Extracellular serine/threonine protein kinase FAM20C P18206 VCL -4.299 Heat shock protein beta-1 Q9HBG7 LY9 -4.525 T-lymphocyte surface antigen Ly-9 Q8IY18 SMC5 -4.590 Structural maintenance of chromosomes protein 5 Q5NDL2 EOGT -4.684 EGF domain-specific O-linked N- acetylglucosamine transferase Q16643 DBN1 -4.812 Drebrin P02788 LTF -4.825 Lactotransferrin P19827 ITIH1 -4.874 Inter-alpha-trypsin inhibitor heavy chain H1 Q9BW19 KIFC1 -5.019 Kinesin-like protein KIFC1 P04275 VWF -5.612 von Willebrand factor P22059 OSBP -6.310 Oxysterol-binding protein 1 P02768 ALB -7.927 Serum albumin P09913 IFIT2 -9.287 Interferon-induced protein with tetratricopeptide repeats 2 Q01995 TAGLN -10.63 Transgelin

Table 2-4. List of top ten most significantly altered canonical pathways. Ingenuity Canonical -log # of Molecules Pathways (p-value) molecules EIF2 Signaling 20.7 37 RPL24,RPL22,RPS23,RPS18,PPP1CB, EIF4A2,HSPA5,RPL7A,RPS4X,RPL7,R PS7,AKT1,MAP2K2,RPS20,RPS13,UB A52,RPL21,ACTC1,RPS24,PABPC1,R PL4,RPL3,ACTB,RPS10,EIF2S3,RPL9, RPL15,RPL8,WARS,RRAS2,HNRNPA1 ,EIF4A1,RPS27A,RPL5,RPL37,RPS25, RPS14 Epithelial Adherens 17.4 28 TUBA1B,MYH10,MYH9,MYL6,MYO7A, Junction Signaling ARPC5,MYH11,TUBB,AKT1,ACTR3,TU BB4A,VCL,ACTC1,ACTN1,ACTR2,TUB B3,LMO7,TUBB4B,ACTB,RRAS2,TUBB 6,CDC42,RHOA,ARPC2,ZYX,ACTN4,A CTG1,CTNND1 Caveolar-mediated 16.1 20 ITGB1,FLNB,ARCN1,ACTB,COPA,ITG Endocytosis A2,ITGA5,COPG2,COPB2,COPB1,CO Signaling PG1,ALB,ITGA3,FLNC,FLNA,ITGAV,C AV1,PTRF,ACTC1,ACTG1 Actin Cytoskeleton 15.6 32 MYH10,FN1,MYH9,MPRIP,MYL6,ARP Signaling C5,PPP1CB,TRIO,MYH11,ITGA3,ACT R3,MAP2K2,PPP1R12A,FLNA,EZR,VC L,ACTC1,ACTN1,ITGB1,ACTR2,ACTB,I TGA2,ITGA5,TTN,RRAS2,CDC42,CYFI P1,ARPC2,RHOA,ACTN4,ACTG1,MSN Sertoli Cell-Sertoli 14.1 27 SPTBN1,TUBA1B,MYO7A,TUBB,ITGA Cell Junction 3,TJAP1,AKT1,MAP2K2,TUBB4A,VCL, Signaling ACTC1,ACTN1,ITGB1,TUBB3,TJP2,TU BB4B,ACTB,ITGA2,ITGA5,RRAS2,TUB B6,CDC42,SPTAN1,ACTN4,ACTG1,A2 M,PRKAR1A Remodeling of 13.9 18 TUBA1B,ACTR2,TUBB3,TUBB4B,ACT Epithelial Adherens B,ARPC5,TUBB,ACTR3,TUBB6,ARPC2 Junctions ,ZYX,TUBB4A,ACTN4,VCL,ACTG1,AC TC1,ACTN1,CTNND1 Integrin Signaling 12.7 28 MPRIP,ARPC5,PPP1CB,ITGA3,AKT1,A CTR3,MAP2K2,PPP1R12A,ITGAV,CAV 1,VCL,ACTC1,VASP,ACTN1,ITGB1,AC TR2,ACTB,ITGA2,ITGA5,TTN,RRAS2, CDC42,RHOA,ARPC2,ZYX,ACTN4,AC TG1,CTTN

Table 2-4. Continued. Ingenuity Canonical -log # of Molecules Pathways (p-value) molecules Germ Cell-Sertoli 11.8 24 ITGB1,TUBA1B,TUBB3,TUBB4B,MYO7 Cell Junction A,ACTB,ITGA2,TUBB,ITGA3,AKT1,RR Signaling AS2,MAP2K2,TUBB6,CDC42,RHOA,ZY X,TUBB4A,ACTN4,VCL,ACTG1,A2M,A CTC1,ACTN1,CTNND1 Regulation of eIF4 10.9 22 ITGB1,PABPC1,RPS23,RPS18,ITGA2, and p70S6K RPS10,ITGA5,EIF2S3,EIF4A2,RPS4X, Signaling RPS7,ITGA3,AKT1,RRAS2,MAP2K2,R PS20,RPS13,EIF4A1,RPS27A,RPS25, RPS24,RPS14 RhoGDI Signaling 10.9 23 ITGB1,ACTR2,MYL6,ACTB,ARPC5,ITG A2,GDI2,ITGA5,GNAI2,GNB1,ITGA3,A CTR3,PPP1R12A,CDC42,ARPC2,RHO A,EZR,CD44,ARHGDIA,ACTG1,CDH13 ,ACTC1,MSN

CHAPTER 3 ORAL DELIVERY OF LACTOBACILLUS PARACASEI CONFERS PROTECTION AGAINST PULMONARY HYPERTENSION

Introduction

PH is a progressive and devastating disease marked by narrowing of the pulmonary vasculature that is defined by a mean pulmonary arterial pressure of ≥ 25 mmHg at rest15. This loss of luminal cross-section as a result of vasoconstriction, thrombosis, and vascular remodeling leads to increased pulmonary vascular resistance20. As a response to the high afterload, the RV enlarges to maintain normal blood flow. As the disease progresses, the heart is no longer able to compensate for the increased afterload, and the disease culminates in right heart failure and death.

Unfortunately, many symptoms of PH are similar to other conditions, and thus, the diagnosis is often delayed until the disease has progressed16. In addition, the current therapies for PH are limited; most treatments target the vasoconstriction component of

PH rather than vascular remodeling, which is a much larger factor in disease progression. Taken together, the prognosis for PH is poor16. Therefore, it is necessary to investigate novel targets for PH therapy.

In this regard, emerging evidence is solidifying a role for inflammation in PH. For one, the invasion of inflammatory cells such macrophages and lymphocytes into vessel walls, and specifically plexiform lesions has long been known288. In addition, an influx of cytotoxic T cells into plexiform lesions has been observed289. Interestingly, T cells, including Tregs, appear to be protective, as CD8+ T cell deficiency correlated with worse survival in patients with PAH290. This may occur by downregulation of macrophage- mediated inflammatory vascular remodeling291. Furthermore, increased inflammatory markers including macrophage inflammatory protein-1α, IL-1β, and IL-6 have been

reported292,293. Most recently, investigators have been paying attention to the association of PH with autoimmune disorders. For example, PH is known to development via manifestation of viral infections and collagen vascular diseases, both of which have links to autoimmunity294. In addition, 10-40% of patients with idiopathic

PH have been reported to have circulating autoantibodies to endothelial cells and fibroblasts295. These autoantibodies may be produced by B cells, which have been shown to be activated in idiopathic PAH patients296. These data coupled with the fact that experimental PH demonstrated that inflammation precedes vascular remodeling strongly point to an association between immunity and development of PH, in which alterations in immunity are causative.

The gut microbiota plays an important role in developing and maintaining the host immune system. Typically, commensal bacteria in the gut have mutually beneficial interactions with the intestinal epithelium and perform functions critical to the health of the host, including nutrient metabolism, pathogen defense, and modulation of the host immune system, among others. Changes to these commensal bacterial communities can allow the expansion of other bacterial species that may not be as beneficial to the host. This disequilibrium in the bacterial community, or dysbiosis, has previously been observed in diseases such as inflammatory bowel disease, cancer, and infectious diseases172. More recently, gut dysbiosis has been associated with cardiopulmonary and related metabolic disorders including hypertension, diabetes, obesity, lung inflammation, and allergies172,185,190.

Administration of probiotics for modulation of the gut microbiota in cardiopulmonary disease is an evolving concept. This idea is supported by previous

100

data indicating beneficial effects of probiotics on the cardiopulmonary system: 1)

Probiotics have been shown to regulate lung immune responses182 and decrease risk of asthma and respiratory infection190; 2) Oral administration of probiotic metabolites or diets that promote their generation attenuated allergic airway disease and protected against both emphysema and respiratory infection-induced pulmonary pathology190; and

3) Probiotics have demonstrated positive effects on systemic blood pressure192-199 and delayed development of HF in rats212. Therefore, we propose that modulating the gut microbiota by oral administration of a probiotic strain of bacteria will have beneficial effects on PH pathophysiology.

To that end, we have chosen the probiotic strain, Lactobacillus paracasei, to administer to PH rats. L. paracasei is a gram-positive facultative anaerobe found ubiquitously in the human gastrointestinal tract297 and is among the most commonly used probiotics298. L. paracasei has demonstrated the ability to stimulate the immune system299, modulate the physiology of the intestine300, and restore normal metabolism in a model of gastrointestinal disease301. Further, L. paracasei metabolites have shown anti-inflammatory properties302. We hypothesize that these positive actions of L. paracasei will be beneficial for treatment of PH.

Methods

Bacterial Culture and Lysis

Lactobacillus paracasei (American Type Culture Collection (ATCC), Manassas,

VA, USA, #27092) was cultured in de Man, Rogosa, and Sharpe (MRS) broth (Thermo

Fisher Scientific, #DF0881-17-5) at 370C for 16 h without shaking. Pseudomonas aeruginosa (ATCC, #27853) was cultured in Remel Tryptic Soy Broth (Thermo Fisher

Scientific, #R455052) at 370C for 16 h with shaking. To determine optimal lysis

101

conditions, L. paracasei was inoculated at 1% in MRS broth and incubated for 6, 18, or

24 h at 370C. 1 mL of cells + media from each sample at the completion of the time point was transferred into a 1.5 mL sterile Eppendorf tube. Samples from the 6 and 24 h time points were then incubated with 10 mg/mL lysozyme for 30 min at 370C, while the

18 h time point was not incubated with lysozyme. Next, 20 µL of each sample was mixed with 4X Laemmli sample buffer (#161-0737, Bio-Rad) containing 5% β- mercaptoethanol. Equal volume of each sample (approx. 25 µL) was run on SDS-PAGE gel (100 V for 1.5 h) and stained by incubation with Coomassie blue for 30 min followed by 20 min destaining with water (Figure 3-1). We observed a substantially larger amount of protein present in the L. paracasei grown for 6 h and incubated with lysozyme (Figure

3-1B) than in the cells grown for 24 h. Therefore, for all subsequent experiments, L. paracasei was grown for 6 h in MRS broth at 370C followed by lysis via 30 min incubation with 10 mg/mL lysozyme at 370C.

For maintenance of L. paracasei over the course of the feeding experiment, every afternoon, 20 mL of MRS broth (in two 15 mL tubes) was inoculated at 1% from the culture grown the previous day. These seed cultures allowed the cells to be propagated from day to day. Once inoculated, L. paracasei was grown for 16 h at 370C without shaking. On the evening before each feeding of L. paracasei (every other night),

1500 mL of MRS broth (in three 500 mL sterile bottles) were inoculated at 1% from L. paracasei seed cultures and cells were grown for 16 h at 370C. Directly prior to feeding, cells were transferred to plastic bottles, centrifuged at 8000 rpm for 10 min, pellets were washed with sterile PBS, followed by a final centrifugation for 10 min at 8000 rpm.

Supernatant was removed, and cells were resuspended in the remaining 3-5 mL of

102

PBS. For feeding of P. aeruginosa, this same process was repeated except TSB broth was used instead of MRS broth, and P. aeruginosa was incubated with shaking for 16 h.

Pulmonary Hypertension Experimental Design

All animal procedures were approved by the University of Florida Institutional

Animal Care and Use Committee and complied with the guidelines of the National

Institutes of Health. Rats were housed at 22-230C with a 12:12 hour light-dark cycle and free access to rat chow and water. L. paracasei dosage and feeding frequency was determined by one time gavage with either a low (5x108 CFU, n=2) or high (1x1010 CFU, n=3) dose of L. paracasei, followed by collection of feces at baseline and 3, 6, 15, 19,

24, 48, and 72 h. Amount of L. paracasei in the feces was measured by SYBR Green qPCR of DNA isolated from feces (see below). For all subsequent feedings, 1 mL L. paracasei or P. aeruginosa cells (1x1010 cells/mL) were immediately administered to the animals by oral gavage.

PH was induced in 8 week old Sprague-Dawley (SD) rats (Charles Rivers

Laboratories, Wilmington, MA, USA) by single subcutaneous injection of monocrotaline

(MCT, 50 mg/kg, Sigma-Aldrich, #37024). Control animals were injected with a similar volume of sterile saline. A subset of MCT rats were orally gavaged with L. paracasei or

P. aeruginosa (1x1010 CFU) every other day beginning one week prior to MCT administration and continuing for 21 days following MCT administration (Figure 3-2).

Each group had n = 10 rats.

Right Ventricular Systolic Pressure Measurement

Animals were anesthetized with a subcutaneous injection of ketamine (70 mg/kg)/xylazine (10 mg/kg)/acepromazine (2.5 mg/kg) mixture, and subsequently placed in a supine position, breathing room air. Next, right ventricular systolic pressure

103

(RVSP) was measured by inserting a fluid-filled silastic catheter into the right ventricle

(RV) via the right descending jugular vein. RVSP is a well-accepted surrogate marker of pulmonary arterial pressure. Data was recorded after stabilization of the tracing using a liquid pressure transducer, which relayed catheter readings to a signal transduction unit

(PowerLab, AD Instruments, Colorado Springs, CO, USA), The position of the catheter in the RV was confirmed by observing the waveform. The Chart program supplied with

PowerLab was used to obtain RVSP, +dP/dt, and –dP/dt. After RVSP was measured, blood was collected from the inferior vena cava using a 10 mL syringe, the rats were euthanized, and heart, lungs, and gut were harvested for subsequent analysis.

Hypertrophy and Histological Analysis

To measure right ventricular hypertrophy (RVH), the RV was separated from the left ventricle (LV) plus ventricular septum (S), and the wet weights were determined.

RVH was calculated by measuring the wet weight of the RV and LV plus S and expressing them as the ratio of RV/(LV+S). The RV was then fixed in 10% neutral buffered formalin for 24 h, embedded in paraffin, and stained with picrosirius red in order to analyze collagen content. 5-8 separate images were taken from non- overlapping regions of the RV, and interstitial fibrosis was quantified for each animal

(n=5-6 rats/group) using ImageJ (National Institutes of Health). These results were then averaged and analyzed for significance.

To look for lung pathology, the lungs were excised along with the trachea. The right primary bronchus was tied off and the four lobes of the right lung distal to the ligature were cut and snap frozen in liquid nitrogen. The left lung was inflated by perfusing PBS through the trachea followed by 4% paraformaldehyde, after which the left primary bronchus was tied off. The lungs were kept in 4% paraformaldehyde for 24

104

h, followed by replacement with PBS until processed. Paraffin-embedded lungs were then cut into 4 µm thick sections and stained for α-smooth muscle actin (1:600, Sigma-

Aldrich, #A5228) using the Vectastain Elite ABC Kit (Vector Laboratories, Burlingame,

CA, USA, #SK-6100), biotinylated anti-mouse IgG (rat adsorbed, Vector Laboratories,

#BA-2001), and DAB Peroxidase Substrate (Vector Laboratories, #SK-4100). To determine pulmonary medial wall thickness, external diameter and medial wall thickness were measured in vessels with an external diameter <50 µm. Five vessels were measured for each rat (n=4 rats/group), and the percent medial wall thickness was calculated: % medial wall thickness = [(medial thickness x 2)/external diameter] x 100.

To study gut pathology, the gut was harvested from the anesthetized animal.

First, the skin and abdominal wall were held at abdominal midline and pulled gently away from the abdominal cavity with a pair of forceps followed by cutting along the midline to expose the intestines. The cecum was identified, as was the ileum, which is the part of the small intestine directly preceding the cecum. A 4-5 cm segment of ileum was cut and transferred to a sterile petri dish containing sterile and RNase-free PBS. A new 10-mL syringe was filled with sterile PBS, and an RNase-free gavage needle was attached to it. Using clean forceps, the needle was inserted about half a centimeter in the anterior opening of the ileal segment, and the gut contents was flushed out, making sure not to apply too much pressure during the flushing. Sections were cut into 2 segments which were kept in 4% paraformaldehyde for 24 h followed by removal of paraformaldehyde and addition of PBS for storage until histological analysis. Next, the gut was evaluated for changes in morphology by observing paraffin-embedded sections of the ileum stained with hematoxylin-eosin (H&E). Villus length was measured from the

105

bottom of the crypt to the tip of the villus (n=5 rats/group). Goblet cell number/villus area was quantified (n=4-5 rats/group). ImageJ (National Institutes of Health) was used to measure length of villus, count number of goblet cells, and measure the area of each villus. All images were captured using an Olympus BX41 microscope with a digital camera DP71 (Olympus, Center Valley, PA), and all histological quantification was carried out by a third party unaware of group assignment.

Real-Time RT-PCR Analysis

Analysis of L. paracasei in fecal samples. For initial determination of L. paracasei dosage, following a single feeding of L. paracasei, DNA was isolated from

150 mg of feces from each sample/time point using the ZR Fecal DNA MiniPrep kit

(Zymo Research, Irvine, CA, USA, #D6010). Quantitative real-time polymerase chain reaction (qPCR) was performed with primers and reaction compositions previously reported by 303. A total reaction volume of 25 µL included 150 ng DNA, 12.5 µL of SYBR

Green PCR Master mix (Roche Diagnostics, Indianapolis, IN, USA, #4673484001), and

2 µM of each forward (ACATCAGTGTATTGCTTGTCAGTGAATAC) and reverse

(CCTGCGGGTACTGAGATGTTTC) primer. Reactions were run for 10 min at 950C, followed by 40 cycles of denaturing for 15 s at 950C, annealing for 30 s at 600C, and elongation for 30 s at 720C in a StepOnePlusTM Real-Time PCR System (Applied

Biosystems). A final elongation step was performed for 2 min at 720C. Data analysis was conducted with StepOne Software v2.3 (Applied Biosystems). Data were normalized to 16S (Forward: AGGATTAGATACCCTGGTA; Reverse:

CRRCACGAGCTGACGAC) and represented as fold change from baseline.

Analysis of proinflammatory cytokines in rat lungs. Total RNA was extracted from frozen lung tissue using TRIzol reagent (Life Technologies, #15596-018) according

106

to manufacturer instructions. RNA purity was evaluated by 260/280 ratio measured with a spectrophotometer. cDNA obtained using 1 µg sample RNA and High-Capacity cDNA

Reverse Transcription Kit (Applied Biosystems, #4368814) was amplified by qPCR in a

StepOnePlusTM Real-Time PCR System (Applied Biosystems). Taqman primers and universal PCR master mix (Applied Biosystems, #4304437) were used to determine gene expression levels of IL-1β (Rn00580432_m1), TGF-β (Rn00572010_m1), IL-6

(Rn01410330_m1), and HMGB1 (Rn02377062_g1). Data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH, Rn01775763_g1) cDNA and represented as fold change. All cDNA samples were run in duplicate.

Feces Collection and Bacterial Analysis

In a sterile environment, fecal samples were collected from control, MCT, and

MCT + LP rats 21 days after MCT injection and prior to euthanasia. Samples were collected by holding the base of the rat’s tail while allowing its front paws to stay in contact with the cage. Once the animal is held by its tail, it will likely defecate. At this point, a sterile Eppendorf tube was held next to the anus of the animal, and the feces dropped directly into the tube without touching the fecal pellet. Fecal samples were kept in labeled tubes on ice until they could be stored at -800C awaiting analysis.

DNA extraction and quantification. Bacterial DNA isolation and sequencing was performed by WrightLabs (Huntingdon, PA, USA). In short, the PowerFecal DNA

Isolation Kit (Mo Bio Laboratories, Inc., was used to purify microbial genomic DNA from the rat feces according to manufacturer instructions. Briefly, 0.25 g of feces was homogenized using a 2 mL bead beating tube, which lyses microbial cells. A silica spin column is used to capture DNA, and then DNA was washed and eluted in 50 µL of 10

107

mM Tris. Total DNA was quantified using Qubit 2.0 (Invitrogen) Fluorometer, with the dsDNA High Sensitivity option.

PCR amplification. Illumina iTag PCR was performed. Briefly, 25 µL of reaction volume for each sample included final concentrations of 1X PCR buffer, 0.8 mM dNTP’s, 0.625 U Taq, 0.2 M 515F forward primer, 0.2 M Illumina 806R reverse barcoded primer and approximately 10 ng of template DNA per reaction. The MJ

Research PTC-200 thermocycler (Bio-Rad) was used to perform PCR with the following cycle conditions: 980C for 3 min, 35 cycles of 980C for 1 min, 550C for 40 s, and 720C for 10 min. Once PCR was finished, the samples were stored at 40C until visualization on a 1% CYBRsafe E-gel (Life Technologies).

Library purification, verification, and sequencing. PCR products were pooled, purified from the gel using the Qiagen Gel Purification Kit (Qiagen, Frederick, MD,

USA), and quantified using the Qubit 2.0 Fluorometer. Samples were combined in equimolar amounts. Libraries were quality checked with the 2100 Bioanalyzer DNA

1000 chip (Aligent Technologies, Santa Clara, CA, USA) and stored at -200C until being shipped on dry ice to California State University (North Ridge, CA) for sequencing. The

Fragment Analyzer CE (Advanced Analytical Technologies Inc., Ames, IA) verified the size of the library pools, followed by quantification with the Qubit High Sensitivity dsDNA kit (Life Technologies). Pools were diluted to a final concentration of 1 nM and a 10% spike of PhiX V3 library (Illumina, San Diego, CA, USA), and then denatured for 5 min in equal volume of 0.1 N NaOH, followed by further dilution to 12 pM in Illumina’s HT1 buffer. This pool was then loaded on an Illumina MiSeq V2 300 cycle kit cassette with

16S rRNA library sequencing primers and set for 150 base, paired-end reads.

108

Quality filtering and OTU picking. The following protocol was performed by Dr.

Elaine Sumners. Sequences were trimmed at a length of 150 base pairs and quality filtered at an expected error of less than 0.05% using CLC Genomics Workbench 9.5.4.

After quality filtering, reads were analyzed using the CLC Genomics Workbench 9.5.4 software package. Chimeric sequences were identified using CLC Genomics

Workbench 9.5.4. A total of 845225 sequences were obtained after quality filtering and chimera checking. Three samples were excluded due to low number of reads to leave

4-6 animals per group remaining for analysis. Open reference operational taxonomic units (OTUs) were picked using the CLC Genomics Workbench 9.5.4 algorithm, and taxonomy assignment was performed using the Greengenes 16S rRNA gene database

(13-5 release, 97%)304. Reference-based and de novo OTU clustering were performed using a minimum occurance of 2 and a similarity percentage of 97%, and 2,680 OTUs were subsequently identified. Assigned taxonomy were organized into a BIOM formatted OTU table, which was summarized within CLC Genomics Workbench 9.5.4.

Alpha and beta diversity analysis. The following analysis was performed by Dr.

Elaine Sumners. Individual (within-sample) microbial diversity (alpha) rarefaction curves were generated within the CLC Genomics Workbench 9.5.4 sequence analysis package using an unrarified OTU table. Multiple rarefactions were conducted on sequences across all samples from minimum depth of 0 sequences, to a maximum depth of 48,000 sequences, with a step size of 4,800 sequences/sample for 15 iterations. Alpha rarefactions were then collated and plotted using Chao1 and observed species richness metrics. Community (between-sample) similarity (beta diversity) was measured. For this, we applied the Bray-Curtis dissimilarity index, which considers bacterial taxon

109

presence and abundance, but also the unweighted Unifrac distance analysis (CLC

Genomics Workbench 9.5.4) which takes into account the phylogenetic distances

(relatedness) of the bacterial taxa but not their abundance. Principal coordinate analysis

(PCoA) was applied on the resulting distance matrices and two-dimensional plots were generated using CLC Genomics Workbench 9.5.4 software. Significant differences in β- diversity among treatment groups were calculated using permutational multivariate analysis of variance.

Taxonomic comparisons. The following analysis was performed by Dr. Elaine

Sumners. Assigned taxonomy were organized into a BIOM formatted OTU table, which was summarized within CLC Genomics Workbench 9.5.4. Bar plots were generated from summarized taxonomy outputs, in which the five most abundant phyla were displayed, with all remaining taxa grouped in an “other ” category. OTUs that were not classified at the kingdom taxonomic rank were discarded. Relative abundances were organized in a table format, and were plotted in Microsoft Excel.

FITC-dextran Permeability Assay

Control and MCT rats (n=4/group) were fasted overnight to allow for stomach emptying. Following this fasting, Fluorescein isothiocyanate (FITC)-labeled dextran (4 kD, Sigma-Aldrich, #FD4-1G) was fed by oral gavage (44 mg/100 g body weight prepared as 100 mg/1 mL). Blood was collected via sublingual draw 4 h after feeding.

FITC accumulation in the blood was measured using a spectrophotometer (SynergyMx, excitation: 490 nm, emission: 520 nm). Data were quantified using a standard curve with serial dilutions and represented as mean ± SEM.

110

ACE and ACE2 Activity

Enzymatic activity of ACE and ACE2 was measured using continuous cleavage of fluorometric substrates specific for each enzyme in the presence of inhibitors for the enzyme not being tested. ACE2 substrate titration was performed by incubating recombinant human ACE2 (R&D Systems, #933-ZN-010) with 10 µM, 20 µM, 30 µM, 40

µM, 50 µM, 60 µM, 70 µM of ACE2 substrate [Mca-APK(Dnp)-OH] (Enzo Life Sciences,

Farmingdale, NY, USA, #BML-P163-0001) in order to determine the optimal amount of fluorogenic substrate (20 µM, Figure 3-3). We observed a linear increase in rhACE2 activity with increasing amount of ACE2 substrate. We decided to use 20 µM of ACE2 substrate for the remainder of our experiments, as it was the lowest concentration of substrate that displayed a reasonable signal.

The protein concentration of the L. paracasei lysate was determined by Bio-Rad

Protein Assay (Bio Rad Laboratories). For quantification of ACE2 activity, 30 µg of bacterial lysate or water (negative control) was incubated in black flat-bottomed 96-well plates in a 100 µL mixture of 1 µM captopril (ACE inhibitor), 20 µM ACE2 fluorogenic substrate, and ACE2 buffer (1 M NaCl, 75 mM Tris HCl, pH 7.5, 50 µM ZnCl2) for 4 h at

370C in a spectrophotometer. To determine the effects of lysozyme on ACE2 activity, the same mixture as above was used, with the exception that recombinant human

ACE2 (1:99 dilution) was used in place of bacterial lysate (Figure 3-4). We observed that incubation with lysozyme did not change the ability of ACE2 activity to be detected.

This confirms that lysozyme can be used for bacterial lysis without having effect on measurement of ACE2 activity. For quantification of ACE activity, a 100 µL mixture of 5

µM MLN-4760 (ACE2 inhibitor), ACE2 buffer, and 20 µM ACE [Mca-RPPGFSAFK(Dnp)-

OH] (R&D Systems, #ES005) was incubated for 4 h at 370C in a spectrophotometer. For

111

both ACE and ACE2 activity assays, fluorescence at 320 nm (excitation) and 405 nm

(emission) was measured once every minute with a spectrophotometer (SynergyMx) over the course of the four hour incubation. Relative fluorescence units (RFU) were calculated using readings from minutes 30-180 and subtracting the first reading from each subsequent reading. All samples were run in duplicate, and data was graphed using the average of the duplicate readings.

Measurement of Angiotensin-(1-7)

30 µg of L. paracasei lysate was incubated (in triplicate) in the presence or absence of 10 mM Ang II for 30 min at 370C. 50 µL sample (in duplicate) was then subjected to Ang-(1-7) ELISA (Peninsula Laboratories International, San Carolos, CA,

USA, #S-1330) as per manufacturer instructions. Briefly, sample was incubated with antiserum for 1 h. Subsequently, biotinylated tracer was added for incubation overnight followed by mixing with streptavidin-HRP. Ang-(1-7) levels were calculated by comparing to a standard curve of tetramethylbenzidine color change at 650 nm measured by spectrophotometer (SynergyMx).

Statistical Analysis

All data are expressed as mean ± SEM. Number of animals for each experiment is indicated in the figure legends. GraphPad Prism 6 (GraphPad, La Jolla, CA, USA) was used for all analyses and for graph generation. Data were analyzed for outliers using Grubbs’ test, and the remaining data were subjected to one-way analysis of variants (ANOVA) followed by Tukey’s multiple comparisons test, with p<0.05 considered statistically significant.

112

Results

Oral Feeding of Lactobacillus paracasei Prevents Development of Monocrotaline- Induced Pulmonary Hypertension.

In order to determine the amount and frequency of bacteria fed, rats were orally gavaged one time with a low (5x108 CFU) or high (1x1010 CFU) dose of L. paracasei, and L. paracasei levels were measured in fecal samples at various time points. Animals fed the low dose showed L. paracasei in the feces almost immediately (12.12 ± 8.07 fold change at 3 h, Figure 3-5A; Table 3-1), with the highest levels of L. paracasei in the feces at 15 h (539.55 ± 266.69 fold change from baseline). By 48 h, L. paracasei levels had almost returned to those at baseline. High dose feeding resulted in a similar pattern of L. paracasei detection in feces, but with substantially higher L. paracasei levels in the feces. Specifically, eight hours following administration of the high dose, L. paracasei levels peaked (59.36 x 105 ± 34.9 x 104 fold change from baseline) and remained very high through 24 h (37.9 x 103 ± 340.62 fold change; Figure 3-5B). Even at 48 and 72 h after feeding, 257 and 79 times more L. paracasei, respectively, was found in the feces compared to baseline. Thus, for subsequent experiments, we decided to feed a high dose (1x1010 CFU) of L. paracasei once every 48 h.

Oral gavage of L. paracasei (1 x 1010 CFU) was performed every other day, beginning one week prior to MCT administration and continuing for three weeks after administration (Figure 3-2). MCT-challenged animals showed substantial increases in

RVSP (26.6 ± 1.1 mmHg in control vs 75.8 ± 3.9 mmHg in MCT, p<0.05, Figure 3-6A) and RV hypertrophy [RV/(LV+S), 0.26 ± 0.01 in control vs 0.61 ± 0.03 in MCT, p<0.05,

Figure 3-6B] in comparison to controls. These changes were associated with elevated

+dP/dt (2070.3 ± 87.3 in control vs 3133.5 ± 268.9 in MCT, p<0.05, Figure 3-7A) and

113

–dP/dt (-1390.5 ± 41.7 in control vs -2685.8 ± 146.1 in MCT, p<0.05, Figure 3-7B). Oral feeding of L. paracasei attenuated MCT-induced increases in RVSP (26%) and RVH

(20%). In addition, L. paracasei feeding reduced +dP/dt to control levels, but had no effect on –dP/dt.

We next tested if the effects of the L. paracasei feeding extend to control animals and if other bacterial strains would cause similar changes in cardiac function and hemodynamics. L. paracasei feeding to control animals confirmed that L. paracasei did not change cardiac function (Figure 3-8). Furthermore, feeding of the pathogenic

Psuedomonas aeruginosa illustrated that ingestion of P. aeruginosa has no effect on cardiac function in either control or MCT-challenged animals (Figure 3-9), suggesting that the benefits of feeding L. paracasei are not universal to all bacteria.

PH is associated with structural changes in the heart and lungs. MCT animals exhibited a 159% increase in RV fibrosis (4.47 ± 0.4% area in control vs 11.57 ± 0.6% area in MCT; Figure 3-10) and 29% increase in pulmonary vessel wall thickness (11.3 ±

0.7% medial wall thickness in control vs 14.65 ± 0.9% medial wall thickness in MCT;

Figure 3-11). In contrast, oral feeding of L. paracasei to MCT animals prevented MCT- induced changes in cardiac fibrosis (56%) and pulmonary vessel wall thickness (12%).

Oral Feeding of Lactobacillus paracasei Is Associated with Reduction in Proinflammatory Cytokines.

Because probiotics have been shown to reduce systemic inflammation305, we hypothesized that feeding of L. paracasei would inhibit the production of proinflammatory cytokines. Analysis of proinflammatory cytokines in the lungs revealed enhanced inflammatory status in MCT animals, as measured by increased gene expression of interleukin (IL)-1β (0.87 ± 0.1 fold change in control vs 25.1 ± 17.7 fold

114

change in MCT; p<0.05; Figure 3-12A), high mobility group box 1 (HMGB1) (1.03 ± 0.1 fold change in control vs 97.5 ± 77.9 fold change in MCT; p<0.05; Figure 3-12B), transforming growth factor (TGF)-β (0.99 ± 0.07 fold change in control vs 462.5 ± 431.5 fold change in MCT; p<0.05; Figure 3-12C), and IL-6 (1.05 ± 0.3 fold change in control vs 17.4 ± 4.9 fold change in MCT; p<0.05; Figure 3-12D). Feeding with L. paracasei prevented MCT-induced elevations in IL-1β, HMGB1, and TGF-β, but had no effect on

IL-6.

Monocrotaline-Induced Dysbiosis and Gut Pathology Are Altered by Oral Feeding of Lactobacillus paracasei

Mounting evidence supports a role for the gut microbiota and intestinal epithelium in maintaining body homeostasis. As previously mentioned, recent work in this area has demonstrated that alterations in gut microbiota and intestinal barrier are associated with multiple disease states172,190,306. In the current study, we compared the microbiota associated with control, MCT, and MCT + LP groups by 16S ribosomal DNA sequencing and subsequent bioinformatics analysis of fecal DNA collected three weeks after MCT injection. The distance between the fecal samples of the three groups was calculated using weighted UniFrac analyses, and three-dimensional scatterplots were generated by Principle Component Analysis (PCoA, Figure 3-13) for visualization. This method demonstrates a remarkable clustering of control and MCT + LP groups that appears to be separated from the MCT group. We next asked which genera of bacteria may have contributed to this altered microbiota composition. Whereas no differences in β-diversity exist between control and MCT animals, MCT animals fed with L. paracasei exhibited significant differences in gut microbial composition in comparison to MCT animals

(p=0.014, Figure 3-14). Analysis of OTU abundance indicates trends to differences

115

between groups. For example, whereas the genera Bacteroides have relative abundance of 13 and 14% in control and MCT + LP groups, respectively, it is only 4% in

MCT animals. In contrast, MCT animals contain much higher abundance of the order

Bacteroidales (27%) in comparison to control (13%) and MCT + LP (3%), (Figure 3-14).

More specifically, we identified two species of Ruminococcus that were decreased in

MCT animals compared to both control and MCT + LP groups.

In terms of the intestinal barrier, we measured the integrity of the intestinal wall via quantification of plasma FITC-dextran and found that MCT animals had increased gut permeability (control: 147.5 ± 20.9 ng/mL vs MCT: 298.3 ± 11.4 ng/mL, Figure 3-

15). Given these alterations in gut health, we determined if PH animals also had intestinal inflammation by looking for changes in the epithelial cell layer, namely villus length and goblet cell number. We observed an increase in ileal villus length (Figure 3-

16) and a reduction in goblet cell number (Figure 3-17) in MCT animals, indicative of intestinal inflammation. Feeding with L. paracasei prevented the increase in ileal villus length, but had no effect on goblet cell number.

Lactobacillus paracasei Contains ACE and ACE2 Enzymatic Activity

We have established that oral feeding of L. paracasei is beneficial for MCT- induced PH. However, the question of how L. paracasei is protective still remains. In our initial characterization of L. paracasei, we measured the enzymatic activity of two enzymes known to have effects on the cardiopulmonary system: ACE and ACE2. We discovered that L. paracasei contains both ACE (Figure 3-17) and ACE2 (Figure 3-18A) activity, the latter of which results in increased levels of the beneficial peptide Ang-(1-7)

(Figure 3-18B). These data suggest that one mechanism by which L. paracasei works could be through generation of the vasoprotective RAS peptide Ang-(1-7).

116

Discussion

The major findings of this study are as follows: 1) Oral administration of L. paracasei attenuates the heart and lung pathology associated with PH; 2) L. paracasei feeding causes a reduction in lung inflammatory status; 3) PH is associated with profound gut pathology and microbial dysbiosis; 4) Oral administration of L. paracasei improves intestinal epithelial cell health and alters the composition of gut microbiota.

These findings suggest that probiotic L. paracasei may be an effective therapy for PH.

Injection of MCT, a pyrrolizidine alkaloid derived from the seeds of Crotalaria spectabilis plant, is a long-used and well-characterized model of PH307. Despite its wide use, the mechanism by which MCT induces PH is not well understood. In the liver, MCT is metabolized into dehydromonocrotaline (MCTP), in a reaction that depends on the actions of cytochrome P450307. It is thought that MCTP causes damage to pulmonary endothelial cells, which then triggers pulmonary arteriole inflammation and remodeling308. These processes may be a result of disrupted intracellular membrane trafficking and subsequent activation of factors that promote proliferation, oppose apoptosis, and deregulate NO signaling. In addition, inflammation and remodeling could be activated by activation of Smad and disregulation of BMP signaling309. However, questions have arisen regarding whether MCT toxicity is solely a consequence of pulmonary injury, or if its effects on the heart and liver also contribute to the pathology307. Irrespective of mechanism, the MCT model is characterized by enhanced endothelial cell apoptosis and changes in pulmonary arterial smooth muscle cell growth, namely increased proliferation and decreased apoptosis308. Further, infiltration of inflammatory cells such as macrophages, dendritic cells, and mast cells is a key contributor to MCT-induced vascular remodeling, and thus, PH development308. MCT

117

advantages as a model for PH include its reproducibility, low cost, and technical simplicity. However, it does not completely recapitulate human PH, as rats do not develop plexiform lesions, and it appears to mimic mild PH rather than the severe disease that is observed in humans308. One of the most important criticisms of the MCT model is that over 30 different interventions have been purported to prevent and even reverse its damage310, which suggests that its acute nature may not be translatable to human PH. It is important to keep these points in mind before drawing lofty conclusions from our study. We have demonstrated here the ability of probiotic bacteria to reduce lung inflammation and prevent vascular remodeling and may have identified a crucial link between the gut and lung. It will be critical to recapitulate our findings in other animal models of PH, including chronic hypoxia and genetic models such as BMPR2 knock-out mice.

The MCT-induced changes in lung proinflammatory cytokines we observed in our study highlight the contribution of inflammation to the development of PH. In fact, this involvement of cytokines and inflammatory cells in PH pathogenesis has been extensively researched by others. Studies have shown that inflammatory cells, including

T and B lymphocytes, macrophages, dendritic cells, and mast cells, localize to pulmonary vascular lesions289,311 and further, that the perivascular inflammation score correlates with the thickness of the intima plus media of the artery wall312. In addition, proinflammatory cytokines have been implicated in development of PH pathophysiology.

In PH patients, cytokines including IL-1β, IL-6, IL-8, MCP-1, and TNF-α were elevated in the serum311. Similarly, increased levels of IL-1α313, IL-1β313, TGF- β314, IL-6314, and

TNF-α305 have been reported in the lungs of animals with PH, observations that are

118

corroborated by our current study. Cytokines are known to have actions on pulmonary vascular cells, namely increased proliferation, exaggerated contractility, and enhanced migration and differentiation311. Given such actions, it is likely that cytokines directly affect vascular remodeling. Indeed, we saw increases in lung cytokines and pulmonary vessel remodeling in MCT animals that were both attenuated by L. paracasei feeding.

Unfortunately, vascular remodeling is one major cause of PH that has yet to be targeted in humans. However, treatments targeting inflammatory pathways in animal models have been successful in reversing advanced vascular remodeling311 and in preventing the progression of PH311,313. These data point to inflammation as a driver of vascular remodeling in PH and suggest that oral feeding of L. paracasei may be beneficial via reduction of inflammatory status and thus, inhibition of vessel remodeling.

To our knowledge, these data are the first to implicate the gut in the pathogenesis of PH, although its specific contributions have not yet been identified. Our current study identified changes both in the intestinal epithelial barrier and in gut microbiota composition in MCT animals. Under physiologic conditions, the intestinal epithelium and the microbiota work together to maintain a mutually beneficial relationship, wherein the microbes use the host diet for energy and in turn, provide essential nutrients for the host. In addition, the microbiota is absolutely critical for proper development and modulation of the host immune system. Any disruption to the

“physical” epithelial barrier or the “functional” immunological microbe barrier can be detrimental to the host. These negative alterations in barrier function can be abrupt or gradual, although little is known about what initiates the dysfunction315. In our study, we observed that PH animals had changes in the epithelium, including increased villus

119

length and decreased numbers of goblet cells, both indicators of intestinal inflammation316. While the reduction in goblet cell number has been well-established in inflammation, questions remain concerning the changes in villus length. For example, severity of intestinal inflammation in the mouse has been associated with enhanced regeneration and proliferation of epithelial cells in the small intestine, and thus, elongated crypts and villi316. However, other studies have reported blunting of or no change in villus length in response to various disease models317,318. These inconsistencies may be a result of different gut reactions to different diseases. It will be important to investigate the molecular mechanisms of MCT-induced elongation of villi by studying changes in proliferation or apoptosis. Additionally, what is the functional consequence of this elongation or is it simply a symptom of the disease? This same question can be asked in regards to the goblet cells. The reduction in goblet cells suggests that the mucus layer may also be reduced, although we did not measure the mucus layer directly. The mucus layer is crucial for maintaining a barrier that encourages the growth of commensal rather than pathogenic bacteria. Changes in the mucus barrier alone may be enough to alter the microbiota and intestinal epithelium.

However, it is difficult to say whether alterations in microbiota are a cause or consequence of the disease, and whether these changes preceded or were subsequent to the pathology of the intestinal epithelium, all critical questions to be answered in the future.

We can speculate on the mechanism(s) by which L. paracasei feeding attenuates

PH pathology. The general benefits of probiotics appear to be strain dependent, but regardless, all probiotic effects arise either by interaction with the host or with the gut

120

microbiota. These effects may be due to the ability of beneficial bacteria to promote the non-immunologic gut defense barrier, produce bioactive or regulatory peptides, or improve the intestinal immunologic barrier. In regards to the physical intestinal barrier, studies in multiple disease models have reported changes in gut microbiota and intestinal permeability306,319-321. In our study, we observed PH animals to have both alterations in gut microbiota composition and increases in gut permeability, as measured by plasma levels of FITC-dextran. Administration of probiotics can alter the microecology of the gut, which is consistent with the current study. We report here that

PH animals fed with L. paracasei exhibit a microbiota composition significantly different from PH animals. The enrichment profile of these microbes provides several clues to their implications in the disease process. For example, we observed that MCT animals had a reduction in the genera Bacteroides compared to both control and MCT + LP groups. Bacteroides are anaerobic gram-negative rods of the Bacteroidetes phylum that are commonly found in the human gut322. They are interesting genera in that they have roles both as commensal and pathogenic bacteria. When in the gut, they have a beneficial relationship with the host, directly modulating gut function, but once they are outside of the gut they can cause significant pathology322. In particular, Bacteroides fragilis modulates immune function, as their polysaccharide production causes activation of CD4+ T helper cells322. In addition, Bacteroides thetaiotaomicron has been shown to regulate the expression of host genes involved in fortification of the mucosal barrier and production of angiogenic factors323. Fascinatingly, B. thetaiotaomicron even increases the mRNA expression of RegIIIγ, a bactericidal lectin that leads to killing of gram-positive bacteria via its binding to peptidoglycan324. On the other hand, studies

121

have shown Bacteroides to be pathogenic. Whereas these effects are largely seen once

Bacteroides is outside of the intestinal tract, some Bacteroides fragilis has also been implicated in destroying host enzymes on the brush border of microvillus and producing an enterotoxin that destroys tight junctions in intestinal epithelium322. In our study, the loss of Bacteroides in MCT animals may suggest that the MCT gut has lost some of these beneficial effects of Bacteroides. In addition, the increased permeability of the

MCT gut could allow Bacteroides to enter the blood stream, at which point, Bacteroides could become pathogenic. Its pathogenicity has been seen in other models of gut inflammation, including inflammatory bowel disease, ulcerative colitis, and Crohn’s disease322.

Whereas we observed no significant differences between any genera, we did identify two species of Ruminococcus that were significantly decreased in MCT animals compared to both control and MCT + LP animals. Although there are no studies to date regarding the species we detected, we can speculate about the implications of these changes. Ruminococcus, in the Firmicutes phylum, are a collection of obligate anaerobes which are commonly found in the gut microbiota of healthy infants, but significantly reduced in the guts of malnourished infants325,326. In addition, having a greater abundance of Rumiococcus in the gut may reduce susceptibility to acquisition of viral infections327. Ruminococcus have also been negatively correlated to childhood obesity and atopy328; however, another study demonstrated Ruminococcus to be significantly associated with obese Japanese adults 329, suggesting that the implications of Ruminococcus in the gut may change with age. Overall, these data suggest that

Ruminococcus may be part of a favorable gut microbiota profile, which may be an effect

122

of its ability to reduce the oxidative state of the gut330, stimulate mucin production and degradation331, or produce the bacteriocin, ruminococcin A332. These characteristics of

Ruminococcus may contribute to the beneficial effects of L. paracasei feeding on PH.

The consequence of these microbial alterations could be multifactorial. First, changing gut microbes has been shown to normalize the increase in intestinal permeability333. Second, the altered gut microbiome could reflect the interactions of the probiotic with other bacterial populations. For example, following its introduction into the gut, Lactobacillus can compete with potentially pathogenic bacteria for nutrients and niche while also stimulating the growth of indigenous lactic acid bacteria that will also compete with pathogens334. As mentioned earlier, other benefits of probiotics may be accomplished through bioactive or regulatory peptides. Specifically, probiotic metabolites such as short chain fatty acids (SCFA) have demonstrated protection to a number of diseases. Their beneficial effects may be due to blood pressure reducing properties335, alterations of colonic contraction336,337, or inhibition of pathogen adherence and growth via ability to decrease lumen pH334. Additionally, extensive research on Lactobacillus demonstrates that it produces ACE-inhibiting peptides, and further, that small doses of these peptides have the capability to minimize remodeling of resistance arteries and the cardiac ventricles338. This is consistent with data from our study suggesting that L. paracasei benefits may be linked to its production of Ang-(1-7) via ACE2 cleavage of Ang II. This study is the first to report expression and enzymatic activity of ACE2 in any bacterial strain. We propose that the ability of L. paracasei to mitigate PH results from the contributions of its ACE2 activity, in addition to improvement of the gut barrier and production of bioactive peptides.

123

One final and major means by which L. paracasei administration may mediate attenuation of PH pathophysiology is via modulation of the immune system. As discussed previously, inflammation is a crucial contributor to the development of PH.

Likewise, the necessity of indigenous microflora to development of a healthy immune system is well established. Thus, the benefits of L. paracasei administration may be due, in part, to its ability to impact immunity. Numerous studies have demonstrated the effects of Lactobacillus on innate and adaptive immunity. Strains of Lactobacillus have been shown to influence production of cytokines by intestinal epithelial cells339-341, stimulate IgA secretion to improve mucosal immunity342, activate phagocytosis and macrophage production343, modulate levels and function of Tregs344-348, and induce maturation of dendritic cells344,345,349. Interestingly, we found that administration of L. paracasei influenced inflammatory cytokine production in the lungs. Whether this is a consequence of reduced systemic inflammation will need to be investigated.

These actions of Lactobacillus on immunity likely affect systemic inflammation, which in itself may diminish PH pathology. However, mounting evidence also supports a link between the gut and lungs. For example, individuals with chronic lung diseases often also have chronic intestinal disease350,351. Additionally, alterations in gut microbiota composition has been associated with increased risk of lung diseases including allergic airway disease352 and asthma353,354, and depletion or absence of gut microbiota leads to worse outcomes after respiratory infection. Moreover, structural changes in the intestinal mucosa have been observed in individuals with asthma355.

Conversely, oral administration of probiotics result in reduced incidence of asthma354, protection against respiratory infections356-358, and improved resistance to

124

pneumonia359. Oral feeding of the beneficial microbial metabolite SCFAs is beneficial in allergic airway disease360 and bacterial361 or viral362 pulmonary infection. Likewise, a diet that promotes generation of SCFAs was protective against lung inflammation and emphysema363. Despite all of these associations between the gut microbiota and the lungs, little evidence exists to establish a direct connection, as studies of these kinds are technically challenging. However, studies have demonstrated that both gut and lung

Bacteroidaceae levels were enhanced with ingestion of a high fiber diet360. Further, gut bacteria have been shown to be physically capable of transferring to the lungs through aspiration364 and even via translocation during disease states if the intestinal epithelial barrier has been compromised365. While this lung-gut connection is only beginning to emerge, these studies indicate the potential for L. paracasei to attenuate lung pathology either through immunomodulatory actions on systemic inflammation or by direct interaction with the lungs.

This current study is the first to investigate a role for the gut in pathophysiology and treatment of PH. These data are enlightening, but raise many more questions. For example, it is unknown how long the effects of the probiotic will last without continual feeding or what effects the feeding would have on prolonging animal survival. We also note that it is unclear whether L. paracasei has direct beneficial effects on the heart or if the attenuation in cardiac pathology is secondary to L. paracasei-induced improvement in lung injury. In addition, this work only investigated the ability of L. paracasei to prevent progression of PH; in order to surpass the benefits of the current therapies for

PH, this treatment should be capable of reversing PH lung pathology, at least in part.

Furthermore, to expand our knowledge of the link between the gut and the lungs, more

125

studies on both of their microbiomes need to be completed, including determining location of L. paracasei colonization of the gut. Lastly, the MCT model of PH is an inflammatory model; thus, the effects of L. paracasei administration on other models of

PH should be investigated in order to determine its effectiveness for other PH etiologies.

Similarly, given the differences in functions between probiotic strains, it would be prudent to compare the efficacy of L. paracasei to other probiotic strains, both singly and in combination. It is likely that combinations of probiotics with non-redundant functions may have the most benefit for cardiopulmonary disease. Answering these questions will allow the field to move forward with the study of probiotics for treatment of

PH patients.

126

A B C

Figure 3-1. Comparison of lysis methods for Lactobacillus paracasei. L. paracasei was grown for (A) 18 hrs in the absence of lysozyme or for (B) 6 hrs or (C) 24 hrs in the presence of lysozyme, followed by equal loading by volume onto an SDS-PAGE gel and staining with Coomassie blue.

127

Figure 3-2. Experimental design. SD: Sprague-Dawley rats.

128

Figure 3-3. Determination of optimal fluorogenic substrate concentration for ACE2 activity assay. Recombinant ACE2 protein was incubated with 10 µM, 20 µM, 30 µM, 40 µM, 50 µM, 60 µM, 70 µM fluorogenic substrate for 1 h. RFU: relative fluorescence units. rhACE2: recombinant human ACE2.

Figure 3-4. Effects of lysozyme on ACE2 activity. Recombinant ACE2 protein with or without 10 mg/mL lysozyme was incubated with 20 µM fluorogenic substrate for 30 min. RFU: relative fluorescence units; rhACE2: recombinant human ACE2.

129

Figure 3-5. Lactobacillus paracasei gene expression in rat feces after single oral dose of L. paracasei. A) 5x108 CFU (low, n=2) or B) 1x1010 CFU (high, n=3) dose of L. paracasei. Fecal samples were collected at baseline and then 3, 6, 15, 19, 24, 28, and 72 h after L. paracasei administration. SYBR green qPCR was performed, and L. paracasei levels were first normalized to 16S expression and subsequently reported as fold change from baseline.

130

Figure 3-6. Oral feeding of Lactobacillus paracasei (LP) attenuates MCT-induced PH. A) Right ventricular systolic pressure (RVSP) of MCT-challenged SD rats untreated or fed with LP. Control rats were not fed with LP. B) Measurement of RV hypertrophy, calculated as the ratio of RV weight to left ventricle (LV) plus interventricular septum weight [RV/(LV+S)]. Data are mean ± SEM and were assessed by 1-way ANOVA followed by Tukey’s multiple comparisons test. *p<0.05 vs control; #p<0.05 vs MCT. n=6-8 animals/group.

Figure 3-7. Oral feeding of Lactobacillus paracasei (LP) attenuates MCT-induced changes in cardiac contractility. Measurement of A) +dP/dt and B) -dP/dt in MCT-challenged SD rats untreated or fed with LP. Control rats were not fed with LP. Data are mean ± SEM and were assessed by 1-way ANOVA followed by Tukey’s multiple comparisons test. *p<0.05 vs control; #p<0.05 vs MCT. n=6-8 animals/group.

131

Figure 3-8. Lactobacillus paracasei (LP) has no effect on cardiac function in control animals. A) Right ventricular systolic pressure (RVSP) of SD rats untreated (control) or fed with LP. B) Measurement of RV hypertrophy, calculated as the ratio of RV weight to left ventricle (LV) plus interventricular septum (S) weight [RV/(LV+S)]. Measurement of C) +dP/dt and D) -dP/dt. Data are mean ± SEM and were assessed by 1-way ANOVA followed by Tukey’s multiple comparisons test. n=5-6 animals/group.

132

Figure 3-9. Pseudomonas aeruginosa has no effect on cardiac function of control or MCT-challenged animals. Control or MCT-challenged SD rats were fed P. aeruginosa or saline. A) Right ventricular systolic pressure (RVSP). B) Measurement of RV hypertrophy, calculated as the ratio of RV weight to left ventricle (LV) plus interventricular septum (S) weight [RV/(LV+S)]. Measurement of C) +dP/dt and D) -dP/dt. Data are mean ± SEM and were assessed by 1-way ANOVA followed by Tukey’s multiple comparisons test. n=2-5 animals/group.

133

Figure 3-10. Oral feeding of Lactobacillus paracasei (LP) protects against MCT-induced cardiac fibrosis. Deposition of interstitial collagen in the right ventricle and quantification of % fibrotic area in MCT-challenged SD rats untreated or fed with LP. Control rats were not fed with LP. n=3-6 animals/group and 6-12 images/animal analyzed. Data are mean ± SEM and were assessed by 1-way ANOVA followed by Tukey’s multiple comparisons test. *p<0.05 vs control; #p<0.05 vs MCT.

134

Figure 3-11. Oral feeding of Lactobacillus paracasei (LP) protects against MCT-induced pulmonary vascular remodeling. Medial wall thickness of pulmonary arterioles (<50 µm) as measured by staining for α-smooth muscle actin in MCT- challenged SD rats untreated or fed with LP. Control rats were not fed with LP. n=4 animals/group and 5 vessels/animal analyzed. Data are mean ± SEM and were assessed by 1-way ANOVA followed by Tukey’s multiple comparisons test. *p<0.05 vs control; #p<0.05 vs MCT.

135

Figure 3-12. Effects of oral feeding of Lactobacillus paracasei (LP) on MCT-induced increases in proinflammatory cytokines. Relative change in mRNA levels of lung proinflammatory cytokines A) interleukin (IL)-1β, B) high mobility group box 1 (HMGB1), C) transforming growth factor (TGF)-β, and D) IL-6 in MCT- challenged SD rats untreated or fed with LP. Control rats were not fed with LP.. dCt values were assessed for significance by 1-way ANOVA followed by Tukey’s multiple comparisons test, and data are represented as mean fold change ± SEM. *p<0.05 vs control. n=5-9 animals/group.

136

Figure 3-13. Principle coordinate analysis of gut microbiota composition. Fecal samples were collected from control (n=5), MCT (n=4), and MCT + L. paracasei (LP) (n=6) groups and bacterial 16S ribosomal DNA was amplified and sequenced to analyze the composition of microbial communities. Each axis percentage describes how much variation that one dimension accounts for.

137

Figure 3-14. Relative abundance plots display differences in abundance of OTUs at the species taxonomic ranking. Fecal samples were collected from control (n=5), MCT (n=4), and MCT + L. paracasei (LP) (n=6) groups and bacterial 16S ribosomal DNA was amplified and sequenced to analyze the composition of microbial communities. The bars are colored by Phylum (Firmicutes: blue; Verrucomicrobia: green; Bacteroidetes: orange). PERMANOVA (D_0.5 Unifrac) analysis detected significant difference between MCT and MCT + LP groups (p=0.014).

138

Figure 3-15. Increased intestinal permeability induced by MCT. Accumulation of FITC- dextran in the plasma was measured in SD rats untreated (control) or injected with MCT, four weeks after injection. Data are mean ± SEM and were assessed by Student t test. *p<0.007 vs control; n=6 animals/group.

139

Figure 3-16. Oral feeding of Lactobacillus paracasei (LP) prevents MCT-induced increases in villus length. H&E staining for visualization of villi/crypts in the ileum of the small intestine in MCT-challenged SD rats untreated or fed with LP. Control rats were not fed with LP. n=4-5 animals/group and 2-3 images/animal analyzed. Bracket indicates length of villus (including crypt). Data are mean ± SEM and were assessed by 1-way ANOVA followed by Tukey’s multiple comparisons test. *p<0.05 vs control.

140

Figure 3-17. Oral feeding of Lactobacillus paracasei (LP) has no effect on MCT- induced reduction in goblet cells. H&E staining for visualization of goblet cells in the ileum of the small intestine in MCT-challenged SD rats untreated or fed with LP. Control rats were not fed with LP. n=4-5 animals/group and 2-3 images/animal analyzed. Arrow indicates goblet cell. Data are mean ± SEM and were assessed by 1-way ANOVA followed by Tukey’s multiple comparisons test. *p<0.05 vs control.

141

Figure 3-18. ACE activity in Lactobacillus paracasei (LP). LP was grown for 6 hrs and lysed via 30 min incubation with 10 mg/mL lysozyme at 370C. 30 µg of lysate or water (negative control) was incubated with 20 µM fluorogenic substrate for 35 min. RFU: relative fluorescence units.

Figure 3-19. ACE2 activity in Lactobacillus paracasei (LP). A) LP was grown for 6 h and lysed via 30 min incubation with 10 mg/mL lysozyme at 370C. 30 µg of lysate or water (negative control) was incubated with 20 µM fluorogenic substrate. B) Ang-(1-7) levels from LP incubated (in triplicate) in the presence or absence of 10 mM Ang II for 30 min was measured via ELISA. RFU: relative fluorescence units.

142

Table 3-1. qPCR analysis of Lactobacillus paracasei levels in feces following one time oral gavage of L.paracasei in rats Time point (h) Low-Dose (fold change ± SEM) High-Dose (fold change ± SEM) 0 1.21 ± 0.69 1.91 ± 1.41 3 12.12 ± 8.07 0.74 ± 0.48 6 8.89 ± 1.88 97.86 ± 93.5 8 --- 59.36 x 105 ± 34.9 x 104 15 539.55 ± 266.69 18.74 x 104 ± 16.3 x 103 19 41.93 50.5 x 103 ± 15.2 x 103 24 87.7 37.9 x 103 ± 340.62 48 0.58 ± 0.14 256.85 ± 190.18 72 4.21 ± 1.91 78.9 ± 61.19 Low-Dose = 5 x 108 CFU of L.paracasei. High-Dose = 1 x 1010 CFU of L.paracasei., SEM: standard error of the mean, CFU: colony forming units.

143

CHAPTER 4 GENETICALLY MODIFIED LACTOBACILLUS PARACASEI FOR ORAL DELIVERY OF ANGIOTENSIN-(1-7) CONFERS PROTECTION AGAINST PULMONARY HYPERTENSION

Introduction

PH is a vascular disease characterized by loss of luminal cross-section of the pulmonary arteries resulting from vasoconstriction, thrombosis, and vessel remodeling20. These changes to the pulmonary vasculature increase the load on the right ventricle, and have devastating consequences on the heart over time. The symptoms of PH such as dyspnea and fatigue are similar to those found in other conditions, and as a result, the disease has often progressed before a diagnosis is made16. Further, the therapies that currently exist for PH are very limited in scope, with a strong emphasis on supportive care. In fact, most existing PH treatments involve reducing vasoconstriction, which is only a small component of disease development.

Consequently, the prognosis for individuals diagnosed with PH is poor, and only 34% of those diagnosed with PH survive more than five years post-diagnosis16. Thus, it is critical to develop novel targets for treatment of PH.

In this regard, the importance of the renin-angiotensin system (RAS) in PH and associated right heart failure is emerging. Specifically, ACE, Ang II, and AT1R have been shown to be involved in development of PH125. However, inhibition of these components has not been as beneficial as originally hoped, and in fact, they are currently contraindicated in PH patients due to their propensity to cause hypotension.

The discovery of ACE2, a homolog of ACE, has reimagined the role of the RAS in PH.

ACE2, expressed in the lungs113, metabolizes Ang II into Ang-(1-7). This reduction in

Ang II simultaneous with the production of vasoactive Ang-(1-7) allows for concurrent

144

downregulation of deleterious Ang II actions and upregulation of protective Ang-(1-7) actions.

Previous studies have reported that reductions in ACE2 and Ang-(1-7) levels are associated with many lung diseases in humans125-127. However, overexpression or activation of ACE2 has demonstrated cardiopulmonary effects in animal models. For example, lung overexpression of ACE2 or Ang-(1-7) via lentivirus attenuated MCT- induced heart and lung pathology129,130. This is consistent with data showing rhACE2 to be protective against rises in pulmonary arterial pressure131. Further, ACE2 enzymatic activation reduced PH pathophysiology via reduction of inflammation and improved function of angiogenic progenitor cells133-135. Most recently, our group has engineered bioencapsulated ACE2 and Ang-(1-7), in which these proteins are generated within plant chloroplasts124. Oral administration of bioencapsulated ACE2 or Ang-(1-7) improved structural and functional changes in the lungs and right heart in both prevention and reversal studies. This data indicate that oral administration of ACE2 or

Ang-(1-7) may be successful for treatment of PH. However, there are challenges with using plants as a delivery system, including regulatory hurdles, contamination of non- transgenic crops for consumption by humans, and the potential for genetically- engineered material to accumulate in animals.

We propose to use the probiotic bacteria Lactobacillus paracasei as a delivery system for ACE2 and Ang-(1-7). Many probiotic strains are already used as dietary supplements, and others have demonstrated safety and efficiency in clinical trials.

Specifically, L. paracasei has shown benefit in reducing symptoms of constipation366, atopic dermatitis367, and improvement in antibody response to antigens368. In this

145

regard, others have recently begun to utilize bacteria as vectors for delivery of proteins

369 for treatment of cancer and inflammatory bowel diseases (de Moreno de LeBlanc-

26064086), among other clinical applications183,370.

We have previously shown that administration of the probiotic L. paracasei attenuates PH pathology, including a reduction in remodeling of pulmonary arteriole walls (Chapter 3). While we found L. paracasei feeding to be beneficial, it did not completely reverse the changes induced by MCT. Thus, we believe we can use L. paracasei as a starting point for development of an innovative PH therapy. We hypothesize that delivery of certain beneficial proteins via L. paracasei would be an effective treatment for PH. We propose to use L. paracasei to target the RAS, a system known to have effects on the development of PH.

Methods

Plasmids and Construction of Recombinant Plasmid

Ang-(1-7) contained in the plasmid L_SP-mCTB-FC was synthesized by

Genscript. pTRKH3-ldhGFP (Addgene, plasmid #27170) and pTRKH3-slpGFP

(Addgene, plasmid #27168) were gifts from Michela Lizier.

The Ang-(1-7) fragment flanked by Asc1-Sph1 was cloned from L_SP-mCTB-FC into the multiple cloning site of the intermediate cloning vector pBS (Addgene). From there, Ang-(1-7) was cloned into pTRKH3-ldhGFP or pTRKH3-slpGFP using digestion with Sal1-BamH1. The final expression vector included a promoter (LDH: lactose dehydrogenase or SLP: surface-layer protein), a Usp45 secretion signal, and cholera toxin B fused to Ang-(1-7) separated with a furin cleavage site (Figure 4-1). The promoter region was present to drive expression of the construct. The Usp45 is a signal peptide that permits the secretion of the construct. The resulting protein is a fusion of

146

cholera toxin B and human Ang-(1-7). The cholera toxin B region allows for uptake of the protein into the enterocytes via its binding to the GM1 receptor. It is important to note that this subunit B of the cholera toxin is only responsible for binding and has no toxic effects. Once taken up into the enterocytes, Ang-(1-7) is released via intracellular cleavage by furin, an endoprotease.

Bacterial Culture and Electroporation

L. paracasei cells were cultured in MRS broth at 370C for 16 h without shaking.

Before making cells competent, L. paracasei was cultured in the presence of 0.5 and

1% glycine to confirm that glycine did not largely inhibit cell growth (Figure 4-2). Next, plasmids pTRKH3-ldhGFP, pTRKH3-slpGFP, and pTRKH3-ldh-Ang-(1-7) were used to transform L. paracasei (27092, ATCC) using the method proposed by Welker et al.371.

Briefly, cells were made competent by growth in MRS broth (Thermo Fisher Scientific,

#DF0881-17-5) supplemented with 1% glycine at 370C without shaking for 6-8 h followed by multiple washes with cold sterile water and a final resuspension in 30%

PEG. Prior to electroporation, cells were treated with cold sterile distilled water for 30 min and suspended in cold sterile 30% PEG. Plasmid DNA (200 ng/transformation) was mixed with 100 µL cells in a sterile 0.2 cm gap electroporation cuvette. Electroporation was performed with a Bio-Rad Gene Pulser II electroporation device using the following conditions: 25 µF capacitance, 400 Ω, and 12.5 kV/cm. Cells were recovered in 0.5 M sucrose in MRS broth for 4 h at 370C and subsequently plated on MRS agar containing

5 µg/mL erythromycin (Thermo Fisher Scientific, #BP920-25) for overnight incubation.

Colonies were picked, inoculated in MRS broth with antibiotic, and incubated for 6 h, followed by visualization of GFP fluorescence of clones containing pTRKH3-ldh-GFP or pTRKH3-slp-GFP at 40X and oil immersion (Figure 4-3) using an Olympus BX41

147

microscope with a digital camera DP71 (Olympus, Center Valley, PA). Visual comparison of GFP fluorescence in L. paracasei with pTRKH3-ldh-GFP or pTRKH3-slp-

GFP indicates that LDH is a more robust promoter, thus, for all future experiments, L. paracasei with pTRKH3-ldh-GFP [LP-GFP] or L. paracasei with pTRKH3-ldh-Ang-(1-7)

[LP-Ang-(1-7)] was used.

Prior to oral feeding, L. paracasei (LP), LP-GFP, and LP-Ang-(1-7) were inoculated at 1% in MRS broth at 370C for 16 h without shaking. LP-GFP and LP-Ang-

(1-7) were cultured in MRS broth supplemented with 5 µg/mL erythromycin. Cells were centrifuged at 8000 rpm, and pellets were washed with sterile PBS buffer. Cells were immediately administered to the animals by oral gavage.

Measurement of Angiotensin-(1-7)

This study was performed in collaboration with Dr. Amrisha Verma in Dr.

Quihong Li’s lab. Two month old C57 male type mice (n=3/group) were orally gavaged with 1010 CFU of LP-Ang-(1-7) every day for 5 days or 15 mg of plant Ang-(1-7) every other day for five days. After five days, serum was collected and 50 µL sample (in duplicate) was then subjected to Ang-(1-7) ELISA (Peninsula Laboratories International,

#S-1330) as per manufacturer instructions. Briefly, sample was incubated with antiserum for 1 h. Subsequently, biotinylated tracer was added for incubation overnight followed by mixing with streptavidin-HRP. Ang-(1-7) levels were calculated by comparing to a standard curve of tetramethylbenzidine color change at 650 nm measured by spectrophotometer (SynergyMx).

Pulmonary Hypertension Experimental Design

All animal procedures were approved by the University of Florida Institutional

Animal Care and Use Committee and complied with the guidelines of the National

148

Institutes of Health. Rats were housed at 22-230C with a 12:12 hour light-dark cycle and free access to rat chow and water. PH was induced in 8 week old Sprague-Dawley (SD) rats (Charles Rivers Laboratories) by single subcutaneous injection of monocrotaline

(MCT, 50 mg/kg, Sigma-Aldrich). Control animals were injected with a similar volume of sterile saline. MCT rats were orally gavaged with LP, LP-GFP, or LP-Ang-(1-7) (1x1010

CFU) every other day beginning one week prior to MCT administration and continuing for three weeks following MCT administration.

Right Ventricular Systolic Pressure Measurement

RVSP was performed as previously described (Chapter 3). Briefly, animals were anesthetized with a subcutaneous injection of ketamine (70 mg/kg)/xylazine (10 mg/kg)/acepromazine (2.5 mg/kg) mixture, and RVSP was measured by inserting a fluid-filled silastic catheter into the RV via the right descending jugular vein. The position of the catheter in the RV was confirmed by observing the waveform. Catheter readings were relayed to a pressure transducer interfaced with a signal transduction unit

(PowerLab), and the Chart program supplied with PowerLab was used to obtain RVSP,

+dP/dt, and –dP/dt.

Hypertrophy and Histological Analysis

Organ harvesting and histological analysis was performed as previously described (Chapter 3). Briefly, right ventricular hypertrophy (RVH) was calculated by measuring the wet weight of the RV and the left ventricle (LV) plus ventricular septum

(S) and expressing them as the ratio of RV/(LV+S). The RV was then fixed in 10% neutral buffered formalin, embedded in paraffin, and stained with picrosirius red in order to analyze collagen content. 5-8 separate images were taken from non-overlapping regions of the RV, and interstitial fibrosis was quantified for each animal by using

149

ImageJ (National Institutes of Health). These results were then averaged and analyzed for significance. To look for lung pathology, the left lung was inflated using PBS followed by 10% neutral buffered formalin. Paraffin-embedded lungs were then cut into 4 µm thick sections and stained for α-smooth muscle actin (1:600, Sigma-Aldrich; A5228) using the Vectastain Elite ABC Kit (Vector Labs; SK-6100), biotinylated anti-mouse IgG

(rat adsorbed, Vector Labs; BA-2001), and DAB Peroxidase Substrate (Vector Labs;

SK-4100). To determine pulmonary medial wall thickness, vessels with an external diameter <50 µm were measured. Five vessels were measured for each rat (n=4 rats/group), and the percent medial wall thickness was calculated: % medial wall thickness = [(medial thickness x 2)/external diameter] x 100. To evaluate the gut for changes in morphology, paraffin-embedded sections of the ileum stained with hematoxylin-eosin (H&E) were observed. Villus length was measured from the bottom of the crypt to the tip of the villus (n=5 rats/group). Goblet cell number/villus area was quantified (n=4-5 rats/group). Images were captured using an Olympus BX41 microscope with a digital camera DP71 (Olympus, Center Valley, PA), and all histological quantification was carried out by a third party unaware of group assignment.

Real-Time RT-PCR Analysis

qPCR was performed as previously described (Chapter 3). Total RNA was extracted from frozen lung tissue using TRIzol reagent (Life Technologies, #15596-018) according to manufacturer instructions. RNA purity was evaluated by 260/280 ratio measured with a spectrophotometer. cDNA obtained using 1 µg sample RNA and High-

Capacity cDNA Reverse Transcription Kit (Applied Biosystems, #4368814) was amplified by qPCR in a StepOnePlusTM Real-Time PCR System (Applied Biosystems).

Taqman primers and universal PCR master mix (Applied Biosystems, #4304437) were

150

used to determine gene expression levels of IL-1β (Rn00580432_m1), TGF-β

(Rn00572010_m1), IL-6 (Rn01410330_m1), and HMGB1 (Rn02377062_g1), ACE

(Rn00561094_m1), ACE2 (Rn01416297_m1). Data were normalized to GAPDH

(Rn01775763_g1) cDNA and represented as fold change. All cDNA samples were run in duplicate.

Statistical Analysis

All data are expressed as mean ± SEM. Number of animals for each experiment is indicated in the figure legends. GraphPad Prism 6 was used for all analyses and for graph generation. Data were analyzed for outliers using Grubbs’ test, and the remaining data were subjected to one-way ANOVA followed by Tukey’s multiple comparisons test, with p<0.05 considered statistically significant.

Results

Oral Feeding of LP-Ang-(1-7) Attenuates Monocrotaline-Induced Pulmonary Hypertension.

To confirm the ability of LP-Ang-(1-7) to secrete Ang-(1-7), we measured serum

Ang-(1-7) levels in mice fed one dose of LP-Ang-(1-7). LP-Ang-(1-7) feeding resulted in increased serum Ang-(1-7) [0.25 ng/mL in unfed control vs 1.5 ng/mL in LP-Ang-(1-7);

Figure 4-4]. Feeding of LP-Ang-(1-7) produced serum Ang-(1-7) levels comparable to levels detected with feeding of bioencapsulated Ang-(1-7) [Plant-A], which our lab has used previously124.

Our previous studies have suggested that oral administration of L. paracasei (LP) is capable of reducing PH pathology. We next tested if feeding PH animals with LP-Ang-

(1-7) would have additional positive effects. Oral gavage of LP, LP-GFP, and LP-Ang-

(1-7) (1 x 1010 CFU) was performed every other day, beginning one week prior to MCT

151

administration and continuing for three weeks after administration (Figure 3-2). MCT- challenged animals exhibited substantial increases in RVSP (26.6 ± 1.1 mmHg in control vs 75.8 ± 3.9 mmHg in MCT, p<0.05, Figure 4-5A) and RV hypertrophy

[RV/(LV+S), 0.26 ± 0.01 in control vs 0.61 ± 0.03 in MCT, p<0.05, Figure 4-5B] in comparison to controls. Oral feeding of LP reduced the MCT-induced increases in

RVSP (26%) and RVH (20%), but both parameters remained significantly different from controls. However, oral administration of LP-Ang-(1-7) resulted in profound reductions in

RVSP and RVH (43% and 33%, respectively) to levels similar to those of controls.

MCT animals also exhibited negative changes in cardiac contractility, namely elevated +dP/dt (2070.3 ± 87.3 mmHg/s in control vs 3133.5 ± 268.9 mmHg/s in MCT, p<0.05, Figure 4-6A) and decreased –dP/dt (-1390.5 ± 41.7 mmHg/s in control vs

-2685.8 ± 146.1 mmHg/s in MCT, p<0.05, Figure 4-6B). LP had minimal effects on

+dP/dt (11% reduction) and virtually no change in –dP/dt. However, administration of

LP-Ang-(1-7) restored +dP/dt to control levels (Control: 2070 ± 95 mmHg/s; LP-A: 2060

± 119 mmHg/s) and improved –dP/dt by 21%.

PH is associated with structural changes in the heart and lungs. MCT animals exhibited a 159% increase in RV fibrosis (4.47 ± 0.4% area in control vs 11.57 ± 0.6% area in MCT; Figure 4-7) and 29% increase in pulmonary vessel wall thickness (11.3 ±

0.7% wall thickness in control vs 14.65 ± 0.9% wall thickness in MCT; Figure 4-8). In contrast, oral feeding of LP and LP-Ang-(1-7) to MCT animals prevented both MCT- induced cardiac fibrosis and increased vessel wall thickness. LP-Ang-(1-7) had more profound effects on vessel wall thickness than did feeding of LP alone.

152

Oral Feeding of LP-Ang-(1-7) Is Associated with Alterations in Proinflammatory Cytokines and the Renin-Angiotensin System.

We previously established that LP feeding causes a reduction in the inflammatory status of the lungs (Chapter 3). Thus, we tested if feeding of LP-Ang-(1-7) would have additional effects on proinflammatory cytokines. As seen previously, analysis of proinflammatory cytokines in the lungs revealed enhanced inflammatory status in MCT animals, namely increased gene expression of IL-1β (0.87 ± 0.1 fold change in control vs 25.1 ± 17.7 fold change in MCT; p<0.05; Figure 4-9A), HMGB1

(1.03 ± 0.1 fold change in control vs 97.5 ± 77.9 fold change in MCT; p<0.05; Figure 4-

9B), TGF-β (0.99 ± 0.07 fold change in control vs 462.5 ± 431.5 fold change in MCT; p<0.05; Figure 4-9C), and IL-6 (1.05 ± 0.3 fold change in control vs 17.4 ± 4.9 fold change in MCT; p<0.05; Figure 4-9D). As expected, administration of LP and LP-Ang-

(1-7) prevented MCT-induced elevations in IL-1β, HMGB1, and TGF-β, but had no effect on IL-6.

Previous work provides evidence of RAS imbalance in PH, and we believe that restoring this balance would be beneficial for PH. Therefore, we were interested in testing whether feeding of LP-Ang-(1-7) to the body would change expression of RAS components. Analysis of RAS in the lung demonstrated that MCT did not induce any differences in levels of RAS enzymes, ACE and ACE2 (Figure 4-10). Oral administration of LP and LP-Ang-(1-7) significantly reduced ACE levels in comparison to controls.

While not significant, feeding of LP-Ang-(1-7) showed a trend toward 6 fold greater levels of ACE2. When looking at the ACE2/ACE ratio, LP and LP-Ang-(1-7) feeding trended toward a higher ACE2/ACE ratio, although it was non-significant. It is worth

153

noting that, despite its insignificance, feeding with LP-GFP did produce trends in ACE expression that were different than feeding of LP alone.

LP-Ang-(1-7) Prevents Monocrotaline-Induced Gut Pathology

Mounting evidence supports a role for the gut microbiota and intestinal epithelium in maintaining body homeostasis. We previously showed that MCT induces changes in the intestinal epithelial cell layer, namely increased villus length and decreased goblet cell number (Figure 3-17), both indicative of intestinal inflammation. We assessed these parameters in the current study and observed LP feeding slightly reduced villus length

(Figure 4-11), but did not improve goblet cell number (Figure 4-12). However, feeding with LP-Ang-(1-7) restored the villus to control lengths and completely prevented the

MCT-induced loss of goblet cells.

Discussion

The major findings of this study are: 1) Oral administration of LP-Ang-(1-7) is more effective at attenuating MCT-induced pathophysiology than feeding of LP alone; 2)

LP-Ang-(1-7) may modulate RAS levels in the lung; 3) Oral feeding of LP-Ang-(1-7) has profound effects on prevention of MCT-induced gut inflammation. Collectively, these findings suggest that LP-Ang-(1-7) provides enhanced cardiopulmonary protection against PH via synergistic effects of L. paracasei and Ang-(1-7).

We propose that L. paracasei and Ang-(1-7) act via separate mechanisms, but the sum of their actions has important consequences for inhibition of processes that would otherwise potentiate the progression of PH. Comparison of which parameters were similar in LP- and LP-Ang-(1-7)-fed animals can be helpful in delineating which effects are a result of L. paracasei actions and which may be a consequence of Ang-(1-

7). Administration of LP-Ang-(1-7) was not different from LP feeding in terms of cardiac

154

fibrosis and lung inflammation, indicating that L. paracasei is likely the driver behind those reductions. On the other hand, LP-Ang-(1-7) feeding showed greater improvements in inhibition of vascular remodeling and gut inflammation, as well as increased ACE2 expression in the lung, suggesting that Ang-(1-7) contributes through these processes. However, the mechanisms underlying these beneficial effects are unknown. We have previously discussed the ways in which L. paracasei feeding may be beneficial to PH (Chapter 3), including production of bioactive peptides, improvement in the intestinal epithelial barrier, and modulation of immunity. Here, we hypothesize that the benefits of Ang-(1-7) likely are attributed to the actions of circulating Ang-(1-7), Ang-

(1-7) in the gut, or both. First, Wang et al.225 determined that circulating rather than cardiac Ang-(1-7) provided cardioprotection after MI. This study ascribed the benefits of circulating Ang-(1-7) to proliferation of EPCs and stimulation of cardiac progenitor cells, but could also partly be a result of Ang-(1-7) anti-fibrotic and anti-hypertrophic actions.

Indeed, we observed here that animals fed LP-Ang-(1-7) exhibited elevated plasma

Ang-(1-7) levels, consistent with a systemic role for Ang-(1-7). Moreover, oral administration of LP-Ang-(1-7) also increased ACE2 levels in the lung, adding to evidence that Ang-(1-7) may regulate ACE2 expression372. This elevated ACE2 contributed to an increase in ACE2/ACE ratio, which implies that the RAS has been shifted toward vasoprotection. Interestingly, this enhanced expression of ACE2 in the lung is not accompanied by increased ACE2 activity (data not shown). Second, the benefits of LP-Ang-(1-7) feeding may be partially a consequence of Ang-(1-7) actions in the gut. We observed that LP-Ang-(1-7) administration caused profound reduction in gut inflammation, and thus, an improvement in intestinal epithelial health. These effects are

155

far greater than any seen with feeding of LP alone. Thus, these data indicate that the benefits of Ang-(1-7), at least in part, are a result of actions on the gut.

The question then becomes: how does improvement of gut inflammatory status affect PH pathology? First, Ang-(1-7) could have direct anti-inflammatory or anti- proliferative actions on the gut. Khajah et al. observed amelioration of intestinal inflammation following daily injections of Ang-(1-7)373, in part through down-regulation of colonic Ang II expression. On the other hand, Ang-(1-7) may be acting through regulation of ACE2 expression in the gut. ACE2 is very highly expressed in the small intestine374 on the luminal surface of the IECs and has both enzymatic (traditional) and non-enzymatic roles. Upregulation of ACE2 could lead to further production of Ang-(1-7) via its enzymatic activity, which in itself could be beneficial. Alternately, upregulation of

ACE2 could enhance the function of non-enzymatic ACE2 as an amino acid transporter.

The non-enzymatic functions of ACE2 have been shown to be crucial for preventing intestinal inflammation and maintaining a healthy microbiome via production of antimicrobial peptides375. Thus, increased levels of gut ACE2 could restore gut microbiota and in turn, reduce systemic inflammation that contributes to vascular remodeling and progression of PH. Interestingly, one study using Ang-(1-7) injection revealed a reduction in RVSP with minimal reduction in pulmonary arteriole wall thickness136. This supports the idea that the extra benefits of LP-Ang-(1-7) versus LP for reduction of pulmonary artery wall thickness may be attributed to the actions of Ang-(1-

7) on the gut rather than circulating Ang-(1-7).

The utility of Ang-(1-7) expression in a probiotic as a novel therapy for PH only exists if its treatment provides comparable or enhanced results when compared to other

156

Ang-(1-7) therapies. A side-by-side comparison of the current study and our previous studies with bioencapsulated Ang-(1-7) and ACE2 activation by DIZE indicates that oral administration of LP-Ang-(1-7) is equally beneficial in terms of reduction of RVSP and

RVH. This comparison, though useful for general purposes, does have caveats. For one, these treatments were not performed simultaneously, and therefore cannot be concluded with certainty due to potential differences in animals, batch of MCT, etc.

Additionally, the animals fed with LP-Ang-(1-7) were euthanized three weeks after MCT injection, whereas animals from the other two studies were euthanized four weeks after

MCT injection. It is possible that the effectiveness of LP-Ang-(1-7) would be different given further advancement of the disease.

The results of this experiment are exciting, but certainly have limitations. For LP-

Ang-(1-7) to continue to be a viable option for PH therapy, a number of issues need to be addressed. As previously mentioned, it is necessary to compare LP-Ang-(1-7) administration directly to feeding of bioencapsulated Ang-(1-7) to determine if it has equal or enhanced benefit. Moreover, in terms of pulmonary vessel remodeling, LP-

GFP behaved similarly to LP-Ang-(1-7) instead of LP. This indicates that we need to confirm that the positive effects seen in this parameter are a consequence of Ang-(1-7) rather than off-target effects of the expression vector. Lastly, this study should be repeated with a Mas inhibitor to elucidate which effects result from L. paracasei and which are derived from Ang-(1-7). Finally, for this study to be truly translatable, L. paracasei needs to constitutively express Ang-(1-7). This should likely be done using

CRISPR technology. Regardless, the current study serves as a proof-of-concept that probiotics may provide a low-cost means of delivering beneficial peptides. Specifically,

157

we have demonstrated that genetically modified L. paracasei expressing Ang-(1-7) may prove to be an effective therapy for cardiopulmonary disease.

158

Figure 4-1. Ang-(1-7) expression construct. LDH: lactose dehydrogenase; CTB: cholera toxin B.

Figure 4-2. Growth curves for Lactobacillus paracasei in the presence of glycine. L. paracasei was grown in MRS broth in the presence of 0.5% and 1% glycine without shaking at 370C, and OD 600 was taken every 30 min.

159

LP-pTRKH3-ldhGFP LP-pTRKH3-slpGFP

40X

oil

Figure 4-3. Comparison of lactate dehydrogenase (ldh) and surface (S)-layer protein (slp) promoters to drive expression of GFP in Lactobacillus paracasei. L. paracasei was electroporated with pTRKH3-ldh-GFP or pTRKH3-slp-GFP and plated on MRS media supplemented with 5 µg/mL erythromycin. Colonies from each plate were grown in MRS broth (5 µg/mL erythromycin) for 6 hrs at 370C without shaking, followed by screening for GFP fluorescence at 40x and oil immersion.

160

Figure 4-4. Comparison of serum Ang-(1-7) levels in mice fed with Lactobacillus paracasei-Ang-(1-7) [LP-A] or bioencapsulated Ang-(1-7) [Plant-A]. Oral feeding of increases levels of serum Ang-(1-7). Mice (n=3) were fed one dose of LP-A or Plant-A, and serum was collected five days later. LP-A induces similar levels of Ang-(1-7) in the serum as Plant-A. Experiment was performed by Dr. Amrisha Verma in Dr. Quihong Li’s lab.

161

Figure 4-5. Oral feeding of Lactobacillus paracasei-Ang-(1-7) [LP-A] attenuates MCT- induced pulmonary hypertension. A) Right ventricular systolic pressure (RVSP) of MCT-challenged SD rats untreated or fed with L. paracasei [LP], LP-GFP [LP-G], or LP-A. Control rats were untreated. B) Measurement of RV hypertrophy, calculated as the ratio of RV weight to left ventricle (LV) plus interventricular septum weight [RV/(LV+S)]. Data are mean ± SEM and were assessed by 1-way ANOVA followed by Tukey’s multiple comparisons test. *p<0.05 vs control; #p<0.05 vs MCT. n=6-8 animals/group.

Figure 4-6. Oral feeding of Lactobacillus paracasei-Ang-(1-7) [LP-A] attenuates MCT- induced changes in cardiac function. Measurement of C) +dP/dt and D) -dP/dt of MCT-challenged SD rats untreated or fed with L. paracasei [LP], LP-GFP [LP-G], or LP-A. Control rats were untreated. Data are mean ± SEM and were assessed by 1-way ANOVA followed by Tukey’s multiple comparisons test. *p<0.05 vs control; #p<0.05 vs MCT. n=6-8 animals/group.

162

Figure 4-7. Oral feeding of Lactobacillus paracasei [LP] or LP-Ang-(1-7) [LP-A] protects against MCT-induced cardiac fibrosis. Deposition of interstitial collagen in the right ventricle and quantification of % fibrotic area in MCT-challenged SD rats untreated or fed with LP, LP-GFP [LP-G], or LP-A. Control rats were untreated. n=3-6 animals/group and 6-12 images/animal analyzed. Data are mean ± SEM and were assessed by 1-way ANOVA followed by Tukey’s multiple comparisons test. *p<0.05 vs control; #p<0.05 vs MCT.

163

Figure 4-8. Oral feeding of Lactobacillus paracasei -Ang-(1-7) [LP-A] protects against MCT-induced pulmonary vascular remodeling. Medial wall thickness of pulmonary arterioles (<50 µm) as measured by staining for α-smooth muscle actin in MCT-challenged SD rats untreated or fed with LP, LP-GFP [LP-G], or LP-A. Control rats were untreated. n=4 animals/group and 5 vessels/animal analyzed. Data are mean ± SEM and were assessed by 1-way ANOVA followed by Tukey’s multiple comparisons test. *p<0.05 vs control; #p<0.05 vs MCT.

164

Figure 4-9. Effects of oral feeding of Lactobacillus paracasei [LP] or LP-Ang-(1-7) [LP- A] on MCT-induced increases in proinflammatory cytokines. Relative change in mRNA levels of lung proinflammatory cytokines in MCT-challenged SD rats untreated or fed with LP, LP-GFP [LP-G], or LP-A. Control rats were untreated. A) interleukin (IL)-1β, B) transforming growth factor (TGF)-β, C) high mobility group box 1 (HMGB1), and D) IL-6. dCt values were assessed for significance by 1-way ANOVA followed by Tukey’s multiple comparisons test. Data are mean fold change ± SEM. *p<0.05 vs control. n=5-9 animals/group.

165

Figure 4-10. Effects of oral feeding of Lactobacillus paracasei [LP] or LP-Ang-(1-7) [LP- A] on RAS components in MCT-challenged animals. Relative change in mRNA levels of RAS in the lung in MCT-challenged SD rats untreated or fed with LP, LP-GFP [LP-G], or LP-A. Control rats were untreated. A) ACE, B) ACE2, C) ACE2/ACE ratio. dCt values were assessed for significance by 1- way ANOVA followed by Tukey’s multiple comparisons test. Data are mean fold change ± SEM. *p<0.05 vs control. n=5-9 animals/group.

166

Figure 4-11. Oral feeding of Lactobacillus paracasei-Ang-(1-7) [LP-A] reduces MCT- induced changes in villus length. H&E staining for visualization of villus in the ileum in MCT-challenged SD rats untreated or fed with L. paracasei [LP], LP- GFP [LP-G], or LP-A. Control rats were untreated. n=4-5 animals/group and 2-3 images/animal analyzed. Bar indicates length of villus (including crypt). Data are mean ± SEM and were assessed by 1-way ANOVA followed by Tukey’s multiple comparisons test. *p<0.05 vs control; #p<0.05 vs MCT.

167

Figure 4-12. Oral feeding of Lactobacillus paracasei-Ang-(1-7) [LP-A] restores goblet cell number in MCT-challenged animals. H&E staining for visualization of goblet cells in the ileum of the small intestine of MCT-challenged SD rats untreated or fed with L. paracasei [LP], LP-GFP [LP-G], or LP-A. Control rats were untreated. n=4-5 animals/group and 2-3 images/animal analyzed. Arrows indicate goblet cells. Data are mean ± SEM and were assessed by 1- way ANOVA followed by Tukey’s multiple comparisons test. *p<0.05 vs control; #p<0.05 vs MCT.

168

Figure 4-13. Comparison of Ang-(1-7) treatments on MCT-induced PH. We compared right ventricular systolic pressure (RVSP) and right ventricular hypertrophy (RVH) in our current study Lactobacillus paracasei –Ang-(1-7) [LP-Ang-(1-7)] and previous studies of bioencapsulated Ang-(1-7) [Plant Ang-(1-7)] and ACE2 activation by diminazene aceturate [DIZE]. The difference between MCT and MCT + treatment was calculated from mean data recorded by each study.

169

CHAPTER 5 CONCLUSIONS

This project investigated the contributions of the RAS and gut microbiota to cardiopulmonary disease as well as the potential of each to be a target for future therapies. Specifically, we tested the following hypotheses: 1) In HF patients, imbalance in the RAS contributes to the dysfunction of EPCs, which can be restored by overexpression of the vasoprotective RAS; 2) Oral feeding of the probiotic bacterial strain Lactobacillus paracasei protects against development of PH pathology; 3) Oral administration of L. paracasei overexpressing Ang-(1-7) attenuates pathophysiology of

PH.

In Chapter 2, we observed that HF patients have reduced number and function of

CD34+ cells. For example, CD34+ cells from HF patients exhibited impaired ability to differentiate, migrate, and produce NO, while simultaneously displaying enhanced generation of damaging ROS. Analysis of mRNA expression in CD34+ cells indicates that their dysfunction may be a result of imbalanced RAS components. Therefore, incubation of CD34+ cells with Ang-(1-7) improved migration, NO bioavailability, and

ROS generation. This data indicate that targeting the vasoprotective RAS in CD34+ cells may be a means of restoring their function prior to autologous stem cell transfer, thereby enhancing their in vivo repair capabilities. In addition, the beneficial effects of

Ang-(1-7) on progenitor cells may occur via acetylation of histone H3 or alteration in protein expression. Specifically, our data suggest that Ang-(1-7) may have effects on proteins in signaling pathways such as EIF2, adherens junctions, or caveolar-mediated endocytosis. Further investigation into these pathways is necessary before meaningful conclusions can be made.

170

In Chapter 3, we fed MCT-challenged rats with L. paracasei, a probiotic bacterial strain. We observed a significant increase in blood pressure in MCT animals, along with other PH pathology, including increased pulmonary arterial wall thickness, altered ventricular contractility, and increased lung inflammation. Administration of L. paracasei attenuated all of these parameters, except that it did not reduce IL-6 mRNA in the lung.

We also discovered a substantial gut pathology that was present in MCT animals. For example, MCT animals exhibited a slight increase in villus length, along with a severe decline in the number of mucus-secreting goblet cells. These changes in the gut were associated with alterations in the gut microbiota. MCT animals displayed a reduction in the Bacteroides genera and a significant decrease in two species of Ruminococcus.

Whereas we speculated on how these changes may affect the intestinal composition, more study is required before we can fully understand their functional implications.

Nonetheless, our study demonstrated that oral administration of the probiotic L. paracasei has benefits to PH pathophysiology, and as such, may be useful as a therapy for PH.

In Chapter 4, MCT animals were orally administered L. paracasei expressing

Ang-(1-7) [LP-Ang-(1-7)]. This overexpression of Ang-(1-7) significantly attenuated

MCT-induced changes in heart structure and function. In addition, LP-Ang-(1-7) prevented the increase in pulmonary artery wall thickness. Like feeding of L. paracasei alone (Chapter 3), LP-Ang-(1-7) reduced the lung inflammatory status, with the exception of IL-6. This was accompanied by significant reductions in lung ACE mRNA expression by both LP and LP-Ang-(1-7), and a trend to increased ACE2 mRNA expression, suggesting the involvement of the RAS in their beneficial mechanisms.

171

Further, the gut pathology induced by MCT was significantly reversed by treatment with

LP-Ang-(1-7), but not with L. paracasei alone, implying that Ang-(1-7) has significant effects on the gut. This study serves as a proof of concept that modulation of the RAS via probiotic bacteria could be a novel therapeutic for treatment of PH.

Together, this dissertation demonstrates an important role for the vasoprotective

RAS axis as a therapy for cardiopulmonary disease. Additionally, we have shown evidence that the gut is involved in the disease process; whether it is a cause or consequence is a question that remains to be studied. Regardless, a two-pronged approach for treatment of cardiopulmonary disease, in which the gut microbiota and

RAS are targeted simultaneously, provides promise for the future of therapy for cardiopulmonary diseases.

172

APPENDIX: ANG-(1-7)-INDUCED ALTERATIONS IN PROTEIN EXPRESSION IN HUMAN CARDIAC PROGENITOR CELLS

Table A-1. Proteins downregulated ≥ -1.5 and < -3 fold after Ang-(1-7) treatment of hCPCs. Uniprot Gene Name Fold Change Protein Name O95260 ATE1 -1.522 Arginyl-tRNA--protein transferase 1 O00622 CYR61 -1.684 Protein CYR61 P40227 CCT6A -1.749 T-complex protein 1 subunit zeta P01008 SERPINC1 -1.749 Antithrombin-III Q9UP95 SLC12A4 -1.762 Solute carrier family 12 member 4 P36955 SERPINF1 -1.769 Pigment epithelium-derived factor P01023 A2M -1.775 Alpha-2-macroglobulin P02790 HPX -1.809 Hemopexin P02787 TF -1.816 Serotransferrin P10809 HSPD1 -1.838 60 kDa heat shock protein, mitochondrial P35613 BSG -1.876 Basigin P25705 ATP5A1 -1.891 T-complex protein 1 subunit theta O75962 TRIO -1.954 Triple functional domain protein Q9H6D7 HAUS4 -2.006 HAUS augmin-like complex subunit 4 O15392 BIRC5 -2.119 Baculoviral IAP repeat-containing protein 5 Q9UBF2 COPG2 -2.158 Coatomer subunit gamma-2 Q9UJ99 CDH22 -2.190 Cadherin-22 Q8NHQ9 DDX55 -2.265 ATP-dependent RNA helicase DDX55 Q8NI35 PATJ -2.302 InaD-like protein L0R547 SLC35A5 -2.308 Alternative protein SLC35A5 P02765 AHSG -2.387 Alpha-2-HS-glycoprotein Q96KP4 CNDP2 -2.401 Cytosolic non-specific dipeptidase P12110 COL6A2 -2.402 Collagen alpha-2(VI) chain Q562W8 ACT -2.428 Actin-like protein P14209 CD99 -2.435 CD99 antigen Q9NRW4 DUSP22 -2.437 Dual specificity protein phosphatase 22 P58107 EPPK1 -2.476 Epiplakin P0CJ79 ZNF888 -2.529 Zinc finger protein 888 Q9NXS3 KLHL28 -2.565 Kelch-like protein 28 O75170 PPP6R2 -2.571 Serine/threonine-protein phosphatase 6 regulatory subunit 2 Q9UJX2 CDC23 -2.704 Cell division cycle protein 23 homolog F5H2P7 ZNF26 -2.743 Zinc finger protein 26 P14867 GABRA1 -2.834 Gamma-aminobutyric acid receptor subunit alpha-1

173

Table A-2. Proteins upregulated ≥ 1.5 and < 3 fold after Ang-(1-7) treatment of hCPCs. UniProt Gene Name Fold Change Protein Name P50991 CCT4 2.995 T-complex protein 1 subunit delta P04179 SOD2 2.983 Superoxide dismutase [Mn], mitochondrial P07437 TUBB 2.951 Tubulin beta chain O43242 PSMD3 2.942 26S proteasome non-ATPase regulatory subunit 3 P02795 MT2A 2.940 Metallothionein-2 P62917 RPL8 2.922 60S ribosomal protein L8 P50990 CCT8 2.912 T-complex protein 1 subunit theta P00441 SOD1 2.906 Superoxide dismutase P14174 MIF 2.900 Macrophage migration inhibitory factor O43747 AP1G1 2.893 AP-1 complex subunit gamma-1 P31946 YWHAB 2.893 14-3-3 protein beta/alpha P61981 YWHAG 2.893 14-3-3 protein gamma P16298 PPP3CB 2.889 Serine/threonine-protein phosphatase 2B catalytic subunit beta isoform Q04446 GBE1 2.867 1,4-alpha-glucan-branching enzyme Q9C037 TRIM4 2.860 E3 ubiquitin-protein ligase TRIM4 Q16654 PDK4 2.840 [Pyruvate dehydrogenase (acetyl- transferring)] kinase isozyme 4, mitochondrial P07996 THBS1 2.835 Thrombospondin-1 Q12768 KIAA0196 2.828 WASH complex subunit strumpellin Q9UBQ0 VPS29 2.823 Vacuolar protein sorting-associated protein 29 P62158 CALM1 2.815 Calmodulin Q9NY33 DPP3 2.799 Dipeptidyl peptidase 3 Q15293 RCN1 2.794 Reticulocalbin-1 Q562R4 ACT 2.793 Actin-like protein Q9GZT9 EGLN1 2.790 Egl nine homolog 1 P10644 PRKAR1A 2.784 cAMP-dependent protein kinase type I- alpha regulatory subunit Q9UJU6 DBNL 2.784 Debrin-like protein Q15370 ELOB 2.783 Elongin-B Q01518 CAP1 2.783 Adenylyl cyclase-associated protein 1 O60522 TDRD6 2.769 Tudor domain-containing protein 6 P07237 P4HB 2.767 Protein disulfide-isomerase H0Y3Z3 P4HB 2.767 Protein disulfide-isomerase P63261 ACTG1 2.750 Actin, cytoplasmic 2 Q562R1 ACTBL2 2.750 Beta-actin-like protein 2

174

Table A-2. Continued UniProt Gene Name Fold Change Protein Name A0AVT1 UBA6 2.747 Ubiquitin-like modifier-activating enzyme 6 P62873 GNB1 2.744 Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-1 Q16881 TXNRD1 2.712 Thioredoxin reductase 1, cytoplasmic P23588 EIF4B 2.711 Eukaryotic translation initiation factor 4B Q02809 PLOD1 2.710 Procollagen-lysine,2-oxoglutarate 5- dioxygenase 1 P26641 EEF1G 2.707 Elongation factor 1-gamma Q6S8J3 POTEE 2.703 POTE ankyrin domain family member E P09651 HNRNPA1 2.702 Heterogeneous nuclear ribonucleoprotein A1 Q15008 PSMD6 2.697 26S proteasome non-ATPase regulatory subunit 6 P11717 IGF2R 2.689 Cation-independent mannose-6- phosphate receptor Q12841 FSTL1 2.677 Follistatin-related protein 1 P36507 MAP2K2 2.676 Dual specificity mitogen-activated protein kinase kinase 2 Q12884 FAP 2.657 Prolyl endopeptidase FAP P62269 RPS18 2.653 40S ribosomal protein S18 P09622 DLD 2.648 Dihydrolipoyl dehydrogenase, mitochondrial P13645 KRT10 2.641 Keratin, type I cytoskeletal 10 P26038 MSN 2.636 Moesin Q9Y4K0 LOXL2 2.624 Lysyl oxidase homolog 2 Q16658 FSCN1 2.594 Fascin P46777 RPL5 2.594 60S ribosomal protein L5 Q16891 IMMT 2.594 MICOS complex subunit MIC60 P04844 RPN2 2.592 Dolichyl-diphosphooligosaccharide-- protein glycosyltransferase subunit 2 Q53GG5 PDLIM3 2.584 PDZ and LIM domain protein 3 P68371 TUBB4B 2.577 Tubulin beta-4B chain Q8N6N5 TUBB2C 2.577 Tubulin beta chain Q13509 TUBB3 2.577 Tubulin beta-3 chain P04350 TUBB4A 2.577 Tubulin beta -4a chain Q2NKY5 TUBB6 2.577 Tubulin beta chain Q9BUF5 TUBB6 2.577 Tubulin beta-6 chain P04075 ALDOA 2.573 Fructose-bisphosphate aldolase A P19367 HK1 2.573 Hexokinase-1 Q14527 HLTF 2.566 Helicase-like transcription factor

175

Table A-2. Continued. UniProt Gene Name Fold Change Protein Name Q9Y6G9 DYNC1LI1 2.552 Cytoplasmic dynein 1 light intermediate chain 1 O00154 ACOT7 2.551 Cytosolic acyl coenzyme A thioester hydrolase P07195 LDHB 2.543 L-lactate dehydrogenase B chain P40926 MDH2 2.538 Malate dehydrogenase, mitochondrial P55290 CDH13 2.538 Cadherin-13 Q9Y4L1 HYOU1 2.537 Hypoxia up-regulated protein 1 Q9UHD8 SEPT9 2.535 Septin-9 Q13813 SPTAN1 2.532 Spectrin alpha chain, non-erythrocytic 1 P08648 ITGA5 2.529 Integrin alpha-5 Q00610 CLTC 2.526 Clathrin heavy chain 1 Q8WV99 ZFAND2B 2.521 AN1-type zinc finger protein 2B Q8NBS9 TXNDC5 2.519 Thioredoxin domain-containing protein 5 P41252 IARS 2.514 Isoleucine--tRNA ligase, cytoplasmic Q9UN86 G3BP2 2.511 Ras GTPase-activating protein-binding protein 2 P17812 CTPS1 2.510 CTP synthase 1 P35580 MYH10 2.510 Myosin-10 P37802 TAGLN2 2.506 Transgelin-2 Q9C0A0 CNTNAP4 2.496 Contactin-associated protein-like 4 P35247 SFTPD 2.495 Pulmonary surfactant-associated protein D Q6PIU2 NCEH1 2.495 Neutral cholesterol ester hydrolase 1 Q9Y678 COPG1 2.489 Coatomer subunit gamma-1 P68363 TUBA1B 2.488 Tubulin alpha-1B chain P54136 RARS 2.479 Arginine-tRNA ligase, cytoplasmic P11142 HSPA8 2.478 Heat shock cognate 71 kDa protein Q14192 FHL2 2.474 Four and a half LIM domains protein 2 C9J634 PDHB 2.471 Pyruvate dehydrogenase E1 component subunit beta, mitochondrial Q15942 ZYX 2.468 Zyxin Q07955 SRSF1 2.464 Serine/arginine-rich splicing factor 1 Q5VT97 SYDE2 2.453 Rho GTPase-activating protein SYDE2 P69849 NOMO3 2.451 Nodal modulator 3 P42566 EPS15 2.449 Epidermal growth factor receptor substrate 15 E7ERH1 TNS1 2.445 Tensin-1 P30101 PDIA3 2.442 Protein disulfide-isomerase A3 P58743 SLC26A5 2.427 Prestin

176

Table A-2. Continued. UniProt Gene Name Fold Change Protein Name P21796 VDAC1 2.426 Voltage-dependent anion-selective channel protein 1 P45880 VDAC2 2.426 Voltage-dependent anion-selective channel protein 2 O15511 ARPC5 2.421 Actin-related protein 2/3 complex subunit 5 Q86TE4 LUZP2 2.415 Leucine zipper protein 2 Q9BRA2 TXNDC17 2.403 Thioredoxin domain-containing protein 17 P28066 PSMA5 2.401 Proteasome subunit alpha type-5 P52907 CAPZA1 2.401 F-actin-capping protein subunit alpha-1 P54577 YARS 2.395 Tyrosine--tRNA ligase, cytoplasmic P61160 ACTR2 2.392 Actin-related protein 2 Q8WUP2 FBLIM1 2.390 Filamin-binding LIM protein 1 P39656 DDOST 2.390 Dolichyl-diphosphooligosaccharide-- protein glycosyltransferase 48 kDa subunit H7BZ51 GTF3A 2.378 Transcription factor IIIA Q5VU43 PDE4DIP 2.378 Myomegalin P78371 CCT2 2.377 T-complex protein 1 subunit beta Q9Y3B3 TMED7 2.376 Transmembrane emp24 domain- containing protein 7 P62424 RPL7A 2.373 60S ribosomal protein L7a P20810 CAST 2.367 Calpastatin P35749 MYH11 2.367 Myosin-11 P33176 KIF5B 2.362 Kinesin-1 heavy chain Q92890 UFD1L 2.362 Ubiquitin fusion degradation protein 1 homolog P16070 CD44 2.361 CD44 antigen O95782 AP2A1 2.359 AP-2 complex subunit alpha-1 P16615 ATP2A2 2.357 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Q99733 NAP1L4 2.354 Nucleosome assembly protein 1-like 4 Q9HCM3 KIAA1549 2.351 UPF0606 protein KIAA1549 P98082 DAB2 2.345 Disabled homolog 2 P09972 ALDOC 2.340 Fructose-bisphosphate aldolase C Q8WZ42 TTN 2.337 Titin O15427 SLC16A3 2.335 Monocarboxylate transporter 4 P06748 NPM1 2.332 Nucleophosmin P20073 ANXA7 2.330 Annexin A7 P00387 CYB5R3 2.325 NADH-cytochrome b5 reductase 3

177

Table A-2. Continued. UniProt Gene Name Fold Change Protein Name Q9UHB6 LIMA1 2.320 LIM domain and actin-binding protein 1 O60664 PLIN3 2.316 Perilipin-3 O43776 NARS 2.313 Asparagine--tRNA ligase, cytoplasmic Q14204 DYNC1H1 2.308 Cytoplasmic dynein 1 heavy chain 1 P38606 ATP6V1A 2.304 V-type proton ATPase catalytic subunit A Q8IVF2 AHNAK2 2.298 Protein AHNAK2 P21589 NT5E 2.285 5'-nucleotidase P14678 SNRPB 2.283 Small nuclear ribonucleoprotein- associated proteins B and B' P05023 ATP1A1 2.281 Sodium/potassium-transporting ATPase subunit alpha-1 Q9NVA2 SEPT11 2.280 Septin-11 P55786 NPEPPS 2.280 Puromycin-sensitive aminopeptidase Q15436 SEC23A 2.275 Protein transport protein Sec23A D3DTX7 COL1A1 2.272 Collagen, type I, alpha 1, isoform CRA_a P62070 RRAS2 2.267 Ras-related protein R-Ras2 Q13740 ALCAM 2.265 CD166 antigen P31930 UQCRC1 2.263 Cytochrome b-c1 complex subunit 1, mitochondrial O60763 USO1 2.261 General vesicular transport factor p115 P30536 TSPO 2.260 Translocator protein P13667 PDIA4 2.256 Protein disulfide-isomerase A4 Q01813 PFKP 2.251 ATP-dependent 6-phosphofructokinase, platelet type P52565 ARHGDIA 2.249 Rho GDP-dissociation inhibitor 1 Q9Y6M7 SLC4A7 2.247 Sodium bicarbonate cotransporter 3 Q02952 AKAP12 2.247 A-kinase anchor protein 12 P55072 VCP 2.246 Transitional endoplasmic reticulum ATPase Q6NYC8 PPP1R18 2.244 Phostensin P61927 RPL37 2.241 60S ribosomal protein L37 Q9UHL4 DPP7 2.233 Dipeptidyl peptidase 2 Q494V2 CFAP100 2.233 Cilia- and flagella-associated protein 100 Q8TEQ0 SNX29 2.232 Sorting nexin-29 P13674 P4HA1 2.228 Prolyl 4-hydroxylase subunit alpha-1 Q5VSQ6 P4HA1 2.228 Procollagen-proline, 2-oxoglutarate 4- dioxygenase (Proline 4-hydroxylase), alpha polypeptide I variant

178

Table A-2. Continued. UniProt Gene Name Fold Change Protein Name P62937 PPIA 2.227 Peptidyl-prolyl cis-trans isomerase A P23284 PPIB 2.227 Peptidyl-prolyl cis-trans isomerase B P61586 RHOA 2.218 Transforming protein RhoA P55795 HNRNPH2 2.211 Heterogeneous nuclear ribonucleoprotein H2 P52597 HNRNPF 2.211 Heterogeneous nuclear ribonucleoprotein F P08962 CD63 2.207 CD63 antigen P15151 PVR 2.204 Poliovirus receptor Q9NS87 KIF15 2.204 Kinesin-like protein KIF15 Q9H4A4 RNPEP 2.195 Aminopeptidase B P62701 RPS4X 2.191 40S ribosomal protein S4, X isoform Q16186 ADRM1 2.191 Proteasomal ubiquitin receptor ADRM1 Q8IUD2 ERC1 2.190 ELKS/Rab6-interacting/CAST family member 1 P21333 FLNA 2.187 Filamin-A P35579 MYH9 2.182 Myosin-9 P26640 VARS 2.179 Valine--tRNA ligase Q99439 CNN2 2.176 Calponin-2 Q15417 CNN3 2.176 Calponin-3 P51911 CNN1 2.176 Calponin-1 Q9H853 TUBA4B 2.172 Putative tubulin-like protein alpha-4B B5ME19 EIF3CL 2.169 Eukaryotic translation initiation factor 3 subunit C-like protein O95340 PAPSS2 2.165 Bifunctional 3'-phosphoadenosine 5'- phosphosulfate synthase 2 P05141 SLC25A5 2.163 ADP/ATP translocase 2 O15479 MAGEB2 2.162 Melanoma-associated antigen B2 P05556 ITGB1 2.159 Integrin beta-1 O43491 EPB41L2 2.157 Band 4.1-like protein 2 Q96EY7 PTCD3 2.156 Pentatricopeptide repeat domain- containing protein 3, mitochondrial P31327 CPS1 2.154 Carbamoyl-phosphate synthase [ammonia], mitochondrial Q6P2Q9 PRPF8 2.150 Pre-mRNA-processing-splicing factor 8 O60506 SYNCRIP 2.148 Heterogeneous nuclear ribonucleoprotein Q P06756 ITGAV 2.145 Integrin alpha-V O75563 SKAP2 2.142 Src kinase-associated phosphoprotein 2 P51665 PSMD7 2.138 26S proteasome non-ATPase regulatory subunit 7

179

Table A-2. Continued. UniProt Gene Name Fold Change Protein Name Q8NCX0 CCDC150 2.137 Coiled-coil domain-containing protein 150 Q7Z6Z7 HUWE1 2.137 E3 ubiquitin-protein ligase HUWE1 P21980 TGM2 2.137 Protein-glutamine gamma- glutamyltransferase 2 O14558 HSPB6 2.135 Heat shock protein beta-6 P41250 GARS 2.134 Glycine-tRNA ligase P13639 EEF2 2.133 Elongation factor 2 O60565 GREM1 2.132 Gremlin-1 Q9BTV4 TMEM43 2.128 Transmembrane protein 43 P61158 ACTR3 2.127 Actin-related protein 3 P22692 IGFBP4 2.124 Insulin-like growth factor-binding protein 4 Q15582 TGFBI 2.122 Transforming growth factor-beta- induced protein ig-h3 O95487 SEC24B 2.117 Protein transport protein Sec24B P05089 ARG1 2.114 Arginase-1 P61026 RAB10 2.110 Ras-related protein Rab-10 Q96RQ1 ERGIC2 2.110 Endoplasmic reticulum-Golgi intermediate compartment protein 2 Q5JRX3 PITRM1 2.104 Presequence protease, mitochondrial Q8IWW8 ADHFE1 2.103 Hydroxyacid-oxoacid transhydrogenase, mitochondrial P05121 SERPINE1 2.102 Plasminogen activator inhibitor 1 P14625 HSP90B1 2.101 Endoplasmin P18124 RPL7 2.100 60S ribosomal protein L7 P11021 HSPA5 2.097 78 kDa glucose-regulated protein P32119 PRDX2 2.096 Peroxiredoxin-2 O14773 TPP1 2.096 Tripeptidyl-peptidase 1 P23381 WARS 2.095 Tryptophan-tRNA ligase, cytoplasmic P11940 PABPC1 2.093 Polyadenylate-binding protein 1 P53621 COPA 2.086 Coatomer subunit alpha H0Y2S9 MPRIP 2.084 Myosin phosphatase Rho-interacting protein Q6NZI2 PTRF 2.076 Polymerase I and transcript release factor O00193 SMAP 2.076 Small acidic protein P51659 HSD17B4 2.071 Peroxisomal multifunctional enzyme type 2 P15559 NQO1 2.070 NAD(P)H dehydrogenase [quinone] 1 P48681 NES 2.069 Nestin

180

Table A-2. Continued. UniProt Gene Name Fold Change Protein Name P63167 DYNLL1 2.058 Dynein light chain 1, cytoplasmic P53618 COPB1 2.057 Coatomer subunit beta P12109 COL6A1 2.057 Collagen alpha-1 (VI) chain Q96D15 RCN3 2.052 Reticulocalbin-3 P08240 SRPRA 2.051 Signal recognition particle receptor subunit alpha P07339 CTSD 2.044 Cathepsin D P01579 IFNG 2.042 Interferon gamma Q9Y696 CLIC4 2.039 Chloride intracellular channel protein 4 E7EVA0 MAP4 2.038 Microtubule-associated protein Q16822 PCK2 2.037 Phosphoenolpyruvate carboxykinase [GTP], mitochondrial P25325 MPST 2.035 3-mercaptopyruvate sulfurtransferase P35998 PSMC2 2.033 26S protease regulatory subunit 7 Q09028 RBBP4 2.030 Histone-binding protein RBBP4 P23634 ATP2B4 2.029 Plasma membrane calcium-transporting ATPase4 P53985 SLC16A1 2.028 Monocarboxylate transporter 1 P98095 FBLN2 2.027 Fibulin-2 C9J9E2 CAMKV 2.026 CaM kinase-like vesicle-associated protein P30042 C21orf33 2.026 ES1 protein homolog, mitochondrial O60716 CTNND1 2.021 Catenin delta-1 O14787 TNPO2 2.020 Transportin-2 P22314 UBA1 2.016 Ubiquitin-like modifier-activating enzyme 1 P62263 RPS14 2.008 40S ribosomal protein S14 P48444 ARCN1 2.003 Coatomer subunit delta Q8WWI1 LMO7 2.001 LIM domain only protein 7 P20618 PSMB1 2.000 Proteasome subunit beta type-1 Q9BS26 ERP44 1.995 Endoplasmic reticulum resident protein 44 P42765 ACAA2 1.993 3-ketoacyl-CoA thiolase, mitochondrial P26006 ITGA3 1.991 Integrin alpha-3 Q9BYZ2 LDHAL6B 1.988 L-lactate dehydrogenase A-like 6B P14868 DARS 1.982 Aspartate--tRNA ligase, cytoplasmic Q07065 CKAP4 1.980 Cytoskeleton-associated protein 4 Q03252 LMNB2 1.980 Lamin-B2 Q9P0L0 VAPA 1.980 Vesicle-associated membrane protein- associated protein A

181

Table A-2. Continued. UniProt Gene Name Fold Change Protein Name P31749 AKT1 1.974 RAC-alpha serine/threonine-protein kinase P00167 CYB5A 1.971 Cytochrome b5 Q9H0U3 MAGT1 1.971 Magnesium transporter protein 1 Q6DD88 ATL3 1.969 Atlastin-3 Q14247 CTTN 1.967 Src substrate cortactin Q9NZN4 EHD2 1.961 EH domain-containing protein 2 Q7KZF4 SND1 1.958 Staphylococcal nuclease domain- containing protein 1 P61978 HNRNPK 1.957 Heterogeneous nuclear ribonucleoprotein K P09382 LGALS1 1.954 Galectin-1 P43243 MATR3 1.942 Matrin-3 Q8N4X5 AFAP1L2 1.941 Actin filament-associated protein 1-like 2 Q16181 SEPT7 1.929 Septin-7 O75534 CSDE1 1.927 Cold shock domain-containing protein E1 Q99536 VAT1 1.927 Synaptic vesicle membrane protein VAT-1 homolog Q7L576 CYFIP1 1.926 Cytoplasmic FMR1-interacting protein 1 P29692 EEF1D 1.925 Elongation factor 1-delta U3KQK0 HIST1H2BN 1.923 Histone H2B P12814 ACTN1 1.921 Alpha-actinin-1 P02511 CRYAB 1.916 Alpha-crystallin B chain P60709 ACTB 1.916 Actin, cytoplasmic 1 Q562Z4 ACT 1.916 Actin-like protein Q8WUH6 TMEM263 1.915 Transmembrane protein 263 Q6Y7W6 GIGYF2 1.912 PERQ amino acid-rich with GYF domain-containing protein 2 Q9NR12 PDLIM7 1.911 PDZ and LIM domain protein 7 Q12906 ILF3 1.909 Interleukin enhancer-binding factor 3 O75874 IDH1 1.908 Isocitrate dehydrogenase [NADP] cytoplasmic P11047 LAMC1 1.908 Laminin subunit gamma-1 O60493 SNX3 1.904 Sorting nexin-3 Q8N7Z5 ANKRD31 1.900 Putative ankyrin repeat domain- containing protein 31 Q15363 TMED2 1.898 Transmembrane emp24 domain- containing protein 2 P60660 MYL6 1.898 Myosin light polypeptide 6

182

Table A-2. Continued. UniProt Gene Name Fold Change Protein Name O75381 PEX14 1.896 Peroxisomal membrane protein PEX14 Q8N5H7 SH2D3C 1.894 SH2 domain-containing protein 3C Q96CX2 KCTD12 1.892 BTB/POZ domain-containing protein KCTD12 Q01082 SPTBN1 1.887 Spectrin beta chain, non-erythrocytic 1 P60953 CDC42 1.871 Cell division control protein 42 homolog Q13620 CUL4B 1.865 Cullin-4B Q9Y617 PSAT1 1.864 Phosphoserine aminotransferase Q96HC4 PDLIM5 1.854 PDZ and LIM domain protein 5 Q99747 NAPG 1.854 Gamma-soluble NSF attachment protein Q9ULV4 CORO1C 1.847 Coronin-1C P47985 UQCRFS1 1.846 Cytochrome b-c1 complex subunit Rieske, mitochondrial P23246 SFPQ 1.845 Splicing factor, proline- and glutamine- rich P46821 MAP1B 1.844 Microtubule-associated protein 1B Q58FG0 HSP90AA5P 1.844 Putative heat shock protein HSP 90- alpha A5 Q01780 EXOSC10 1.842 Exosome component 10 P62633 CNBP 1.841 Cellular nucleic acid-binding protein P11766 ADH5 1.839 Alcohol dehydrogenase class-3 C9JEQ8 GTPBP10 1.838 GTP-binding protein 10 O75369 FLNB 1.831 Filamin-B P32969 RPL9 1.827 60S ribosomal protein L9 P62851 RPS25 1.823 40S ribosomal protein S25 P62995 TRA2B 1.820 Transformer-2 protein homolog beta P46783 RPS10 1.818 40S ribosomal protein S10 Q6DEN2 DPYSL3 1.817 DPYSL3 protein P49257 LMAN1 1.804 Protein ERGIC-53 Q14157 UBAP2L 1.803 Ubiquitin-associated protein 2-like P08195 SLC3A2 1.803 4F2 cell-surface antigen heavy chain Q8WZA9 IRGQ 1.801 Immunity-related GTPase family Q protein O00571 DDX3X 1.799 ATP-dependent RNA helicase DDX3X P61619 SEC61A1 1.798 Protein transport protein Sec61 subunit alpha isoform 1 P35268 RPL22 1.797 60S ribosomal protein L22 O43865 AHCYL1 1.794 Adenosylhomocysteinase 2 P83731 RPL24 1.791 60S ribosomal protein L24 Q53GN4 WDR1 1.789 WD repeat domain 1, isoform CRA_a

183

Table A-2. Continued. UniProt Gene Name Fold Change Protein Name O75083 WDR1 1.789 WD repeat-containing protein 1 P13693 TPT1 1.782 Translationally-controlled tumor protein Q05DA4 P4HA2 1.782 p4HA2 protein O95433 AHSA1 1.780 Activator of 90 kDa heat shock protein ATPase homolog 1 Q9UK76 HN1 1.777 Hematological and neurological expressed 1 protein Q13838 DDX39B 1.772 Spliceosome RNA helicase DDX39B P06733 ENO1 1.768 Alpha-enolase O14617 AP3D1 1.765 AP-3 complex subunit delta-1 P61604 HSPE1 1.763 10 kDa heat shock protein, mitochondrial P61163 ACTR1A 1.761 Alpha-centractin Q27J81 INF2 1.757 Inverted formin-2 Q99623 PHB2 1.753 Prohibitin-2 P17987 TCP1 1.750 T-complex protein 1 subunit alpha F5GWP8 KRT17 1.750 Keratin, type I cytoskeletal 17 Q8NC51 SERBP1 1.749 Plasminogen activator inhibitor 1 RNA- binding protein P07858 CTSB 1.741 Cathepsin B O14974 PPP1R12A 1.740 Protein phosphatase 1 regulatory subunit 12A O95456 PSMG1 1.737 Proteasome assembly chaperone 1 P02452 COL1A1 1.736 Collagen alpha-1(I) chain Q08211 DHX9 1.735 ATP-dependent RNA helicase A Q16739 UGCG 1.732 Ceramide glucosyltransferase Q00341 HDLBP 1.732 Vigilin Q03135 CAV1 1.731 Caveolin-1 P62140 PPP1CB 1.729 Serine/threonine-protein phosphatase PP1-beta catalytic subunit P52943 CRIP2 1.728 Cysteine-rich protein 2 Q562T8 ACT 1.724 Actin-like protein P25686 DNAJB2 1.719 DnaJ homolog subfamily B member 2 P60174 TPI1 1.718 Triosephosphate isomerase P10768 1.715 S-formylglutathione hydrolase Q14151 SAFB2 1.714 Scaffold attachment factor B2 P02545 LMNA 1.713 Prelamin-A/C P07355 ANXA2 1.711 Annexin A2 P27797 CALR 1.707 Calreticulin P29401 TKT 1.706 Transketolase P61313 RPL15 1.699 60S ribosomal protein L15

184

Table A-2. Continued. UniProt Gene Name Fold Change Protein Name Q8TCJ2 STT3B 1.695 Dolichyl-diphosphooligosaccharide-- protein glycosyltransferase subunit STT3B Q8NB91 FANCB 1.693 Fanconi anemia group B protein P04004 VTN 1.687 Vitronectin P49755 TMED10 1.673 Transmembrane emp24 domain- containing protein 10 P60866 RPS20 1.669 40S ribosomal protein S20 Q13616 CUL1 1.668 Cullin-1 Q92598 HSPH1 1.667 Heat shock protein 105 kDa P62314 SNRPD1 1.664 Small nuclear ribonucleoprotein Sm D1 P50454 SERPINH1 1.664 Serpin H1 Q9NUQ6 SPATS2L 1.662 SPATS2-like protein Q08379 GOLGA2 1.658 Golgin subfamily A member 2 P61956 SUMO2 1.654 Small ubiquitin-related modifier 2 P46063 RECQL 1.653 ATP-dependent DNA helicase Q1 Q9Y608 LRRFIP2 1.652 Leucine-rich repeat flightless-interacting protein 2 P06744 GPI 1.650 Glucose-6-phosphate isomerase P35637 FUS 1.649 RNA-binding protein FUS O43143 DHX15 1.644 Pre-mRNA-splicing factor ATP- dependent RNA helicase DHX15 P50552 VASP 1.641 Vasodilator-stimulated phosphoprotein Q9NRX5 SERINC1 1.639 Serine incorporator 1 P39023 RPL3 1.637 60S ribosomal protein L3 P47756 CAPZB 1.635 F-actin-capping protein subunit beta Q96AG4 LRRC59 1.635 Leucine-rich repeat-containing protein 59 P43686 PSMC4 1.634 26S protease regulatory subunit 6B P15311 EZR 1.634 Ezrin P11117 ACP2 1.629 Lysosomal acid phosphatase P62979 RPS27A 1.625 Ubiquitin-40S ribosomal protein S27a P62987 UBA52 1.625 Ubiquitin-60S ribosomal protein L40 Q16851 UGP2 1.620 UTP--glucose-1-phosphate uridylyltransferase P06576 ATP5B 1.618 ATP synthase subunit beta, mitochondrial P49588 AARS 1.615 Alanine-tRNA ligase, cytoplasmic P14866 HNRNPL 1.613 Heterogeneous nuclear ribonucleoprotein L Q14697 GANAB 1.612 Neutral alpha-glucosidase AB

185

Table A-2. Continued. UniProt Gene Name Fold Change Protein Name P60842 EIF4A1 1.608 Eukaryotic initiation factor 4A-I Q14240 EIF4A2 1.608 Eukaryotic initiation factor 4A-II Q5TGL8 PXDC1 1.604 PX domain-containing protein 1 P09936 UCHL1 1.601 Ubiquitin carboxyl-terminal hydrolase isozyme L1 P43307 SSR1 1.599 Translocon-associated protein subunit alpha P31939 ATIC 1.598 Bifunctional purine biosynthesis protein PURH P05783 KRT18 1.592 Keratin, type I cytoskeletal 18 P35606 COPB2 1.588 Coatomer subunit beta P53634 CTSC 1.581 Dipeptidyl peptidase 1 P49368 CCT3 1.579 T-complex protein 1 subunit gamma Q06830 PRDX1 1.568 Peroxiredoxin-1 P62266 RPS23 1.566 40S ribosomal protein S23 P12955 PEPD 1.564 Xaa-Pro dipeptidase P10599 TXN 1.563 Thioredoxin P47897 QARS 1.561 Glutamine--tRNA ligase B7ZLE5 FN1 1.561 FN1 protein P19823 ITIH2 1.555 Inter-alpha-trypsin inhibitor heavy chain H2 P62191 PSMC1 1.551 26S protease regulatory subunit 4 Q13402 MYO7A 1.545 Unconventional myosin-VIIa P62081 RPS7 1.537 40S ribosomal protein S7 J3KMX5 RPS13 1.536 40S ribosomal protein S13 P50395 GDI2 1.536 Rab GDP dissociation inhibitor beta P23142 FBLN1 1.532 Fibulin-1 O14880 MGST3 1.531 Microsomal glutathione S-transferase 3 Q969X5 ERGIC1 1.524 Endoplasmic reticulum-Golgi intermediate compartment protein 1 P19971 TYMP 1.520 Thymidine phosphorylase O15144 ARPC2 1.520 Actin-related protein 2/3 complex subunit 2 P04264 KRT1 1.520 Keratin, type II cytoskeletal 1 O15050 TRANK1 1.512 TPR and ankyrin repeat-containing protein 1 P04843 RPN1 1.507 Dolichyl-diphosphooligosaccharide-- protein glycosyltransferase subunit 1 Q8WX93 PALLD 1.505 Palladin P04899 GNAI2 1.503 Guanine nucleotide-binding protein G(i) subunit alpha-2

186

Table A-2. Continued. UniProt Gene Name Fold Change Protein Name O60701 UGDH 1.502 UDP-glucose 6-dehydrogenase P12111 COL6A3 1.500 Collagen alpha-3(VI) chain

187

LIST OF REFERENCES

1. WRITING COMMITTEE MEMBERS, Yancy CW, Jessup M, et al. 2013 ACCF/AHA guideline for the management of heart failure: A report of the american college of cardiology foundation/american heart association task force on practice guidelines. Circulation. 2013;128(16):e240-327. doi: 10.1161/CIR.0b013e31829e8776 [doi].

2. Writing Group Members, Mozaffarian D, Benjamin EJ, et al. Executive summary: Heart disease and stroke statistics--2016 update: A report from the american heart association. Circulation. 2016;133(4):447-454. doi: 10.1161/CIR.0000000000000366 [doi].

3. Selim A, Zolty R, Chatzizisis YS. The evolution of heart failure with reduced ejection fraction pharmacotherapy: What do we have and where are we going? Pharmacol Ther. 2017. doi: S0163-7258(17)30091-8 [pii].

4. Mozaffarian D, Benjamin EJ, Go AS, et al. Heart disease and stroke statistics--2015 update: A report from the american heart association. Circulation. 2015;131(4):e29-322. doi: 10.1161/CIR.0000000000000152 [doi].

5. Tanai E, Frantz S. Pathophysiology of heart failure. Compr Physiol. 2015;6(1):187- 214. doi: 10.1002/cphy.c140055 [doi].

6. King M, Kingery J, Casey B. Diagnosis and evaluation of heart failure. Am Fam Physician. 2012;85(12):1161-1168. doi: d10228 [pii].

7. Hartupee J, Mann DL. Neurohormonal activation in heart failure with reduced ejection fraction. Nat Rev Cardiol. 2017;14(1):30-38. doi: 10.1038/nrcardio.2016.163 [doi].

8. Buu NT, Hui R, Falardeau P. Norepinephrine in neonatal rat ventricular myocytes: Association with the cell nucleus and binding to nuclear alpha 1- and beta-adrenergic receptors. J Mol Cell Cardiol. 1993;25(9):1037-1046. doi: S0022282883711168 [pii].

9. Kamp TJ, Hell JW. Regulation of cardiac L-type calcium channels by protein kinase A and protein kinase C. Circ Res. 2000;87(12):1095-1102.

10. Jackson G, Gibbs CR, Davies MK, Lip GY. ABC of heart failure. pathophysiology. BMJ. 2000;320(7228):167-170.

11. Pandey KN. Guanylyl cyclase/natriuretic peptide receptor-A signaling antagonizes phosphoinositide hydrolysis, ca(2+) release, and activation of protein kinase C. Front Mol Neurosci. 2014;7:75. doi: 10.3389/fnmol.2014.00075 [doi].

12. Kubo H, Jaleel N, Kumarapeli A, et al. Increased cardiac myocyte progenitors in failing human hearts. Circulation. 2008;118(6):649-657. doi: 10.1161/CIRCULATIONAHA.107.761031 [doi].

188

13. Fan D, Takawale A, Lee J, Kassiri Z. Cardiac fibroblasts, fibrosis and extracellular matrix remodeling in heart disease. Fibrogenesis Tissue Repair. 2012;5(1):15-1536-5- 15. doi: 10.1186/1755-1536-5-15 [doi].

14. McMurray JJ, Pfeffer MA. Heart failure. Lancet. 2005;365(9474):1877-1889. doi: S0140-6736(05)66621-4 [pii].

15. Huber LC, Bye H, Brock M, Swiss Society of Pulmonary Hypertension. The pathogenesis of pulmonary hypertension--an update. Swiss Med Wkly. 2015;145:w14202. doi: 10.4414/smw.2015.14202 [doi].

16. George MG, Schieb LJ, Ayala C, Talwalkar A, Levant S. Pulmonary hypertension surveillance: United states, 2001 to 2010. Chest. 2014;146(2):476-495. doi: 10.1378/chest.14-0527 [doi].

17. Badlam JB, Bull TM. Steps forward in the treatment of pulmonary arterial hypertension: Latest developments and clinical opportunities. Ther Adv Chronic Dis. 2017;8(2-3):47-64. doi: 10.1177/2040622317693218 [doi].

18. Soubrier F, Chung WK, Machado R, et al. Genetics and genomics of pulmonary arterial hypertension. J Am Coll Cardiol. 2013;62(25 Suppl):D13-21. doi: 10.1016/j.jacc.2013.10.035 [doi].

19. Guazzi M, Borlaug BA. Pulmonary hypertension due to left heart disease. Circulation. 2012;126(8):975-990. doi: 10.1161/CIRCULATIONAHA.111.085761 [doi].

20. Humbert M, Morrell NW, Archer SL, et al. Cellular and molecular pathobiology of pulmonary arterial hypertension. J Am Coll Cardiol. 2004;43(12 Suppl S):13S-24S. doi: 10.1016/j.jacc.2004.02.029 [doi].

21. Bogaard HJ, Abe K, Vonk Noordegraaf A, Voelkel NF. The right ventricle under pressure: Cellular and molecular mechanisms of right-heart failure in pulmonary hypertension. Chest. 2009;135(3):794-804. doi: 10.1378/chest.08-0492 [doi].

22. Chan SY, Loscalzo J. Pathogenic mechanisms of pulmonary arterial hypertension. J Mol Cell Cardiol. 2008;44(1):14-30. doi: S0022-2828(07)01237-0 [pii].

23. Morrell NW, Atochina EN, Morris KG, Danilov SM, Stenmark KR. Angiotensin converting enzyme expression is increased in small pulmonary arteries of rats with hypoxia-induced pulmonary hypertension. J Clin Invest. 1995;96(4):1823-1833. doi: 10.1172/JCI118228 [doi].

24. Morrell NW, Upton PD, Kotecha S, et al. Angiotensin II activates MAPK and stimulates growth of human pulmonary artery smooth muscle via AT1 receptors. Am J Physiol. 1999;277(3 Pt 1):L440-8.

189

25. Voelkel NF, Tamosiuniene R, Nicolls MR. Challenges and opportunities in treating inflammation associated with pulmonary hypertension. Expert Rev Cardiovasc Ther. 2016;14(8):939-951. doi: 10.1080/14779072.2016.1180976 [doi].

26. Grinnan D, Bogaard HJ, Grizzard J, et al. Treatment of group I pulmonary arterial hypertension with carvedilol is safe. Am J Respir Crit Care Med. 2014;189(12):1562- 1564. doi: 10.1164/rccm.201311-2025LE [doi].

27. Ryan JJ, Thenappan T, Luo N, et al. The WHO classification of pulmonary hypertension: A case-based imaging compendium. Pulm Circ. 2012;2(1):107-121. doi: 10.4103/2045-8932.94843 [doi].

28. Gurtu V, Michelakis ED. A paradigm shift is needed in the field of pulmonary arterial hypertension for its entrance into the precision medicine era. Circ Res. 2016;119(12):1276-1279. doi: CIRCRESAHA.116.309689 [pii].

29. Simonneau G, Hoeper MM, McLaughlin V, Rubin L, Galie N. Future perspectives in pulmonary arterial hypertension. Eur Respir Rev. 2016;25(142):381-389. doi: 10.1183/16000617.0084-2016 [doi].

30. Tsai H, Sung YK, de Jesus Perez V. Recent advances in the management of pulmonary arterial hypertension. F1000Res. 2016;5:2755. doi: 10.12688/f1000research.9739.1 [doi].

31. Hall JE. Historical perspective of the renin-angiotensin system. Mol Biotechnol. 2003;24(1):27-39. doi: 10.1385/MB:24:1:27.

32. Patel KP, Schultz HD. Angiotensin peptides and nitric oxide in cardiovascular disease. Antioxid Redox Signal. 2013;19(10):1121-1132. doi: 10.1089/ars.2012.4614 [doi].

33. Skeggs LT,Jr, Kahn JR, Shumway NP. The preparation and function of the hypertensin-converting enzyme. J Exp Med. 1956;103(3):295-299.

34. Donoghue M, Hsieh F, Baronas E, et al. A novel angiotensin-converting enzyme- related carboxypeptidase (ACE2) converts angiotensin I to angiotensin 1-9. Circ Res. 2000;87(5):E1-9.

35. Tipnis SR, Hooper NM, Hyde R, Karran E, Christie G, Turner AJ. A human homolog of angiotensin-converting enzyme. cloning and functional expression as a captopril- insensitive carboxypeptidase. J Biol Chem. 2000;275(43):33238-33243. doi: 10.1074/jbc.M002615200 [doi].

36. Santos RA, Simoes e Silva AC, Maric C, et al. Angiotensin-(1-7) is an endogenous ligand for the G protein-coupled receptor mas. Proc Natl Acad Sci U S A. 2003;100(14):8258-8263. doi: 10.1073/pnas.1432869100 [doi].

190

37. De Mello WC, Frohlich ED. On the local cardiac renin angiotensin system. basic and clinical implications. Peptides. 2011;32(8):1774-1779. doi: 10.1016/j.peptides.2011.06.018 [doi].

38. Marshall RP. The pulmonary renin-angiotensin system. Curr Pharm Des. 2003;9(9):715-722.

39. Ferrao FM, Lara LS, Lowe J. Renin-angiotensin system in the kidney: What is new? World J Nephrol. 2014;3(3):64-76. doi: 10.5527/wjn.v3.i3.64 [doi].

40. Wright JW, Harding JW. Brain renin-angiotensin--a new look at an old system. Prog Neurobiol. 2011;95(1):49-67. doi: 10.1016/j.pneurobio.2011.07.001 [doi].

41. Leung PS. Local RAS. Adv Exp Med Biol. 2010;690:69-87. doi: 10.1007/978-90- 481-9060-7_5 [doi].

42. Patel VB, Zhong JC, Grant MB, Oudit GY. Role of the ACE2/angiotensin 1-7 axis of the renin-angiotensin system in heart failure. Circ Res. 2016;118(8):1313-1326. doi: 10.1161/CIRCRESAHA.116.307708 [doi].

43. Paul M, Poyan Mehr A, Kreutz R. Physiology of local renin-angiotensin systems. Physiol Rev. 2006;86(3):747-803. doi: 10.1152/physrev.00036.2005.

44. Ferrario CM. Cardiac remodelling and RAS inhibition. Ther Adv Cardiovasc Dis. 2016;10(3):162-171. doi: 10.1177/1753944716642677 [doi].

45. Tallant EA, Ferrario CM, Gallagher PE. Angiotensin-(1-7) inhibits growth of cardiac myocytes through activation of the mas receptor. Am J Physiol Heart Circ Physiol. 2005;289(4):H1560-6. doi: 10.1152/ajpheart.00941.2004.

46. Grobe JL, Mecca AP, Mao H, Katovich MJ. Chronic angiotensin-(1-7) prevents cardiac fibrosis in DOCA-salt model of hypertension. Am J Physiol Heart Circ Physiol. 2006;290(6):H2417-23. doi: 01170.2005 [pii].

47. Qi Y, Shenoy V, Wong F, et al. Lentivirus-mediated overexpression of angiotensin- (1-7) attenuated ischaemia-induced cardiac pathophysiology. Exp Physiol. 2011;96(9):863-874. doi: 10.1113/expphysiol.2011.056994; 10.1113/expphysiol.2011.056994.

48. Jiang F, Yang J, Zhang Y, et al. Angiotensin-converting enzyme 2 and angiotensin 1-7: Novel therapeutic targets. Nat Rev Cardiol. 2014;11(7):413-426. doi: 10.1038/nrcardio.2014.59 [doi].

49. Bernstein KE, Martin BM, Edwards AS, Bernstein EA. Mouse angiotensin-converting enzyme is a protein composed of two homologous domains. J Biol Chem. 1989;264(20):11945-11951.

191

50. Guy JL, Jackson RM, Acharya KR, Sturrock ED, Hooper NM, Turner AJ. Angiotensin-converting enzyme-2 (ACE2): Comparative modeling of the active site, specificity requirements, and chloride dependence. Biochemistry. 2003;42(45):13185- 13192. doi: 10.1021/bi035268s [doi].

51. Vickers C, Hales P, Kaushik V, et al. Hydrolysis of biological peptides by human angiotensin-converting enzyme-related carboxypeptidase. J Biol Chem. 2002;277(17):14838-14843. doi: 10.1074/jbc.M200581200 [doi].

52. Harmer D, Gilbert M, Borman R, Clark KL. Quantitative mRNA expression profiling of ACE 2, a novel homologue of angiotensin converting enzyme. FEBS Lett. 2002;532(1-2):107-110. doi: S0014579302036402 [pii].

53. Shell L, Davenport DJ, Barber DL, Chickering W. Generalized skeletal involvement of a hematopoietic tumor in a dog. J Am Vet Med Assoc. 1989;194(8):1077-1078.

54. Crackower MA, Sarao R, Oudit GY, et al. Angiotensin-converting enzyme 2 is an essential regulator of heart function. Nature. 2002;417(6891):822-828. doi: 10.1038/nature00786 [doi].

55. Santos RA, Ferreira AJ, Verano-Braga T, Bader M. Angiotensin-converting enzyme 2, angiotensin-(1-7) and mas: New players of the renin-angiotensin system. J Endocrinol. 2013;216(2):R1-R17. doi: 10.1530/JOE-12-0341 [doi].

56. Ferrario CM, Trask AJ, Jessup JA. Advances in biochemical and functional roles of angiotensin-converting enzyme 2 and angiotensin-(1-7) in regulation of cardiovascular function. Am J Physiol Heart Circ Physiol. 2005;289(6):H2281-90. doi: 00618.2005 [pii].

57. Petty WJ, Miller AA, McCoy TP, Gallagher PE, Tallant EA, Torti FM. Phase I and pharmacokinetic study of angiotensin-(1-7), an endogenous antiangiogenic hormone. Clin Cancer Res. 2009;15(23):7398-7404. doi: 10.1158/1078-0432.CCR-09-1957 [doi].

58. Yamada K, Iyer SN, Chappell MC, Ganten D, Ferrario CM. Converting enzyme determines plasma clearance of angiotensin-(1-7). Hypertension. 1998;32(3):496-502.

59. Allred AJ, Diz DI, Ferrario CM, Chappell MC. Pathways for angiotensin-(1---7) metabolism in pulmonary and renal tissues. Am J Physiol Renal Physiol. 2000;279(5):F841-50.

60. Bader M, Alenina N, Andrade-Navarro MA, Santos RA. MAS and its related G protein-coupled receptors, mrgprs. Pharmacol Rev. 2014;66(4):1080-1105. doi: 10.1124/pr.113.008136 [doi].

61. Bosnyak S, Jones ES, Christopoulos A, Aguilar MI, Thomas WG, Widdop RE. Relative affinity of angiotensin peptides and novel ligands at AT1 and AT2 receptors. Clin Sci (Lond). 2011;121(7):297-303. doi: 10.1042/CS20110036 [doi].

192

62. Nicklin SA. A novel mechanism of action for angiotensin-(1-7) via the angiotensin type 1 receptor. Hypertension. 2016;68(6):1342-1343. doi: HYPERTENSIONAHA.116.08215 [pii].

63. Canals M, Jenkins L, Kellett E, Milligan G. Up-regulation of the angiotensin II type 1 receptor by the MAS proto-oncogene is due to constitutive activation of gq/G11 by MAS. J Biol Chem. 2006;281(24):16757-16767. doi: M601121200 [pii].

64. Mehta PK, Griendling KK. Angiotensin II cell signaling: Physiological and pathological effects in the cardiovascular system. Am J Physiol Cell Physiol. 2007;292(1):C82-97. doi: 10.1152/ajpcell.00287.2006.

65. Yamamoto K, Ohishi M, Katsuya T, et al. Deletion of angiotensin-converting enzyme 2 accelerates pressure overload-induced cardiac dysfunction by increasing local angiotensin II. Hypertension. 2006;47(4):718-726. doi: 01.HYP.0000205833.89478.5b [pii].

66. Zhong J, Basu R, Guo D, et al. Angiotensin-converting enzyme 2 suppresses pathological hypertrophy, myocardial fibrosis, and cardiac dysfunction. Circulation. 2010;122(7):717-28, 18 p following 728. doi: 10.1161/CIRCULATIONAHA.110.955369 [doi].

67. Bodiga S, Zhong JC, Wang W, et al. Enhanced susceptibility to biomechanical stress in ACE2 null mice is prevented by loss of the p47(phox) NADPH oxidase subunit. Cardiovasc Res. 2011;91(1):151-161. doi: 10.1093/cvr/cvr036 [doi].

68. Gaddam RR, Chambers S, Bhatia M. ACE and ACE2 in inflammation: A tale of two enzymes. Inflamm Allergy Drug Targets. 2014;13(4):224-234. doi: IADT-EPUB-61371 [pii].

69. Trask AJ, Groban L, Westwood BM, et al. Inhibition of angiotensin-converting enzyme 2 exacerbates cardiac hypertrophy and fibrosis in ren-2 hypertensive rats. Am J Hypertens. 2010;23(6):687-693. doi: 10.1038/ajh.2010.51 [doi].

70. Gurley SB, Allred A, Le TH, et al. Altered blood pressure responses and normal cardiac phenotype in ACE2-null mice. J Clin Invest. 2006;116(8):2218-2225. doi: 10.1172/JCI16980 [doi].

71. Sahara M, Ikutomi M, Morita T, et al. Deletion of angiotensin-converting enzyme 2 promotes the development of atherosclerosis and arterial neointima formation. Cardiovasc Res. 2014;101(2):236-246. doi: 10.1093/cvr/cvt245 [doi].

72. Der Sarkissian S, Grobe JL, Yuan L, et al. Cardiac overexpression of angiotensin converting enzyme 2 protects the heart from ischemia-induced pathophysiology. Hypertension. 2008;51(3):712-718. doi: 10.1161/HYPERTENSIONAHA.107.100693; 10.1161/HYPERTENSIONAHA.107.100693.

193

73. Qi Y, Zhang J, Cole-Jeffrey CT, et al. Diminazene aceturate enhances angiotensin- converting enzyme 2 activity and attenuates ischemia-induced cardiac pathophysiology. Hypertension. 2013;62(4):746-752. doi: 10.1161/HYPERTENSIONAHA.113.01337 [doi].

74. Qi YF, Zhang J, Wang L, et al. Angiotensin-converting enzyme 2 inhibits high- mobility group box 1 and attenuates cardiac dysfunction post-myocardial ischemia. J Mol Med (Berl). 2016;94(1):37-49. doi: 10.1007/s00109-015-1356-1 [doi].

75. Huentelman MJ, Grobe JL, Vazquez J, et al. Protection from angiotensin II-induced cardiac hypertrophy and fibrosis by systemic lentiviral delivery of ACE2 in rats. Exp Physiol. 2005;90(5):783-790. doi: expphysiol.2005.031096 [pii].

76. Zhao YX, Yin HQ, Yu QT, et al. ACE2 overexpression ameliorates left ventricular remodeling and dysfunction in a rat model of myocardial infarction. Hum Gene Ther. 2010;21(11):1545-1554. doi: 10.1089/hum.2009.160 [doi].

77. Loot AE, Roks AJ, Henning RH, et al. Angiotensin-(1-7) attenuates the development of heart failure after myocardial infarction in rats. Circulation. 2002;105(13):1548-1550.

78. Rodgers KE, Roda N, Felix JE, Espinoza T, Maldonado S, diZerega G. Histological evaluation of the effects of angiotensin peptides on wound repair in diabetic mice. Exp Dermatol. 2003;12(6):784-790.

79. Oudit GY, Liu GC, Zhong J, et al. Human recombinant ACE2 reduces the progression of diabetic nephropathy. Diabetes. 2010;59(2):529-538. doi: 10.2337/db09- 1218; 10.2337/db09-1218.

80. Yamazato M, Ferreira AJ, Yamazato Y, et al. Gene transfer of angiotensin- converting enzyme 2 in the nucleus tractus solitarius improves baroreceptor heart rate reflex in spontaneously hypertensive rats. J Renin Angiotensin Aldosterone Syst. 2011;12(4):456-461. doi: 10.1177/1470320311412809 [doi].

81. Xiao L, Gao L, Lazartigues E, Zucker IH. Brain-selective overexpression of angiotensin-converting enzyme 2 attenuates sympathetic nerve activity and enhances baroreflex function in chronic heart failure. Hypertension. 2011;58(6):1057-1065. doi: 10.1161/HYPERTENSIONAHA.111.176636 [doi].

82. Yamazato M, Yamazato Y, Sun C, Diez-Freire C, Raizada MK. Overexpression of angiotensin-converting enzyme 2 in the rostral ventrolateral medulla causes long-term decrease in blood pressure in the spontaneously hypertensive rats. Hypertension. 2007;49(4):926-931. doi: 01.HYP.0000259942.38108.20 [pii].

83. Feng Y, Xia H, Cai Y, et al. Brain-selective overexpression of human angiotensin- converting enzyme type 2 attenuates neurogenic hypertension. Circ Res. 2010;106(2):373-382. doi: 10.1161/CIRCRESAHA.109.208645 [doi].

194

84. Sriramula S, Cardinale JP, Lazartigues E, Francis J. ACE2 overexpression in the paraventricular nucleus attenuates angiotensin II-induced hypertension. Cardiovasc Res. 2011;92(3):401-408. doi: 10.1093/cvr/cvr242 [doi].

85. Dong B, Yu QT, Dai HY, et al. Angiotensin-converting enzyme-2 overexpression improves left ventricular remodeling and function in a rat model of diabetic cardiomyopathy. J Am Coll Cardiol. 2012;59(8):739-747. doi: 10.1016/j.jacc.2011.09.071 [doi].

86. Zhang X, Cheng HJ, Zhou P, et al. Cellular basis of angiotensin-(1-7)-induced augmentation of left ventricular functional performance in heart failure. Int J Cardiol. 2017. doi: S0167-5273(16)33227-2 [pii].

87. Sampaio WO, Souza dos Santos RA, Faria-Silva R, da Mata Machado LT, Schiffrin EL, Touyz RM. Angiotensin-(1-7) through receptor mas mediates endothelial nitric oxide synthase activation via akt-dependent pathways. Hypertension. 2007;49(1):185-192. doi: 01.HYP.0000251865.35728.2f [pii].

88. Dias-Peixoto MF, Santos RA, Gomes ER, et al. Molecular mechanisms involved in the angiotensin-(1-7)/mas signaling pathway in cardiomyocytes. Hypertension. 2008;52(3):542-548. doi: 10.1161/HYPERTENSIONAHA.108.114280 [doi].

89. Grobe JL, Mecca AP, Lingis M, et al. Prevention of angiotensin II-induced cardiac remodeling by angiotensin-(1-7). Am J Physiol Heart Circ Physiol. 2007;292(2):H736- 42. doi: 10.1152/ajpheart.00937.2006.

90. Giani JF, Munoz MC, Mayer MA, et al. Angiotensin-(1-7) improves cardiac remodeling and inhibits growth-promoting pathways in the heart of fructose-fed rats. Am J Physiol Heart Circ Physiol. 2010;298(3):H1003-13. doi: 10.1152/ajpheart.00803.2009 [doi].

91. Zhang F, Ren X, Zhao M, Zhou B, Han Y. Angiotensin-(1-7) abrogates angiotensin II-induced proliferation, migration and inflammation in VSMCs through inactivation of ROS-mediated PI3K/akt and MAPK/ERK signaling pathways. Sci Rep. 2016;6:34621. doi: 10.1038/srep34621 [doi].

92. Sasaki S, Higashi Y, Nakagawa K, Matsuura H, Kajiyama G, Oshima T. Effects of angiotensin-(1-7) on forearm circulation in normotensive subjects and patients with essential hypertension. Hypertension. 2001;38(1):90-94.

93. Plovsing RR, Wamberg C, Sandgaard NC, et al. Effects of truncated angiotensins in humans after double blockade of the renin system. Am J Physiol Regul Integr Comp Physiol. 2003;285(5):R981-91. doi: 10.1152/ajpregu.00263.2003 [doi].

195

94. Burrell LM, Risvanis J, Kubota E, et al. Myocardial infarction increases ACE2 expression in rat and humans. Eur Heart J. 2005;26(4):369-75; discussion 322-4. doi: ehi114 [pii].

95. Cohen-Segev R, Francis B, Abu-Saleh N, et al. Cardiac and renal distribution of ACE and ACE-2 in rats with heart failure. Acta Histochem. 2014. doi: S0065- 1281(14)00235-9 [pii].

96. Zisman LS, Keller RS, Weaver B, et al. Increased angiotensin-(1-7)-forming activity in failing human heart ventricles: Evidence for upregulation of the angiotensin- converting enzyme homologue ACE2. Circulation. 2003;108(14):1707-1712. doi: 10.1161/01.CIR.0000094734.67990.99 [doi].

97. Burrell LM, Harrap SB, Velkoska E, Patel SK. The ACE2 gene: Its potential as a functional candidate for cardiovascular disease. Clin Sci (Lond). 2013;124(2):65-76. doi: CS20120269 [pii].

98. Goulter AB, Goddard MJ, Allen JC, Clark KL. ACE2 gene expression is up-regulated in the human failing heart. BMC Med. 2004;2:19. doi: 10.1186/1741-7015-2-19 [doi].

99. Kittleson MM, Minhas KM, Irizarry RA, et al. Gene expression analysis of ischemic and nonischemic cardiomyopathy: Shared and distinct genes in the development of heart failure. Physiol Genomics. 2005;21(3):299-307. doi: 00255.2004 [pii].

100. Batlle M, Roig E, Perez-Villa F, et al. Increased expression of the renin-angiotensin system and mast cell density but not of angiotensin-converting enzyme II in late stages of human heart failure. J Heart Lung Transplant. 2006;25(9):1117-1125. doi: S1053- 2498(06)00335-4 [pii].

101. van Vark LC, Bertrand M, Akkerhuis KM, et al. Angiotensin-converting enzyme inhibitors reduce mortality in hypertension: A meta-analysis of randomized clinical trials of renin-angiotensin-aldosterone system inhibitors involving 158,998 patients. Eur Heart J. 2012;33(16):2088-2097. doi: 10.1093/eurheartj/ehs075 [doi].

102. Gavras H, Brunner HR, Turini GA, et al. Antihypertensive effect of the oral angiotensin converting-enzyme inhibitor SQ 14225 in man. N Engl J Med. 1978;298(18):991-995. doi: 10.1056/NEJM197805042981803 [doi].

103. Konstam MA. Angiotensin converting enzyme inhibition in asymptomatic left ventricular systolic dysfunction and early heart failure. Eur Heart J. 1995;16 Suppl N:59- 64.

104. Hisatake S, Kiuchi S, Kabuki T, Oka T, Dobashi S, Ikeda T. Serum angiotensin- converting enzyme 2 concentration and angiotensin-(1-7) concentration in patients with acute heart failure patients requiring emergency hospitalization. Heart Vessels. 2017;32(3):303-308. doi: 10.1007/s00380-016-0877-z [doi].

196

105. Basu R, Poglitsch M, Yogasundaram H, Thomas J, Rowe BH, Oudit GY. Roles of angiotensin peptides and recombinant human ACE2 in heart failure. J Am Coll Cardiol. 2017;69(7):805-819. doi: S0735-1097(16)37407-1 [pii].

106. Epelman S, Tang WH, Chen SY, Van Lente F, Francis GS, Sen S. Detection of soluble angiotensin-converting enzyme 2 in heart failure: Insights into the endogenous counter-regulatory pathway of the renin-angiotensin-aldosterone system. J Am Coll Cardiol. 2008;52(9):750-754. doi: 10.1016/j.jacc.2008.02.088.

107. Epelman S, Shrestha K, Troughton RW, et al. Soluble angiotensin-converting enzyme 2 in human heart failure: Relation with myocardial function and clinical outcomes. J Card Fail. 2009;15(7):565-571. doi: 10.1016/j.cardfail.2009.01.014.

108. Wang Y, Moreira Mda C, Heringer-Walther S, et al. Plasma ACE2 activity is an independent prognostic marker in chagas' disease and equally potent as BNP. J Card Fail. 2010;16(2):157-163. doi: 10.1016/j.cardfail.2009.09.005 [doi].

109. Ortiz-Perez JT, Riera M, Bosch X, et al. Role of circulating angiotensin converting enzyme 2 in left ventricular remodeling following myocardial infarction: A prospective controlled study. PLoS One. 2013;8(4):e61695. doi: 10.1371/journal.pone.0061695 [doi].

110. Uri K, Fagyas M, Manyine Siket I, et al. New perspectives in the renin-angiotensin- aldosterone system (RAAS) IV: Circulating ACE2 as a biomarker of systolic dysfunction in human hypertension and heart failure. PLoS One. 2014;9(4):e87845. doi: 10.1371/journal.pone.0087845 [doi].

111. Uri K, Fagyas M, Kertesz A, et al. Circulating ACE2 activity correlates with cardiovascular disease development. J Renin Angiotensin Aldosterone Syst. 2016;17(4):1470320316668435. Print 2016 Oct. doi: 1470320316668435 [pii].

112. Shao Z, Shrestha K, Borowski AG, et al. Increasing serum soluble angiotensin- converting enzyme 2 activity after intensive medical therapy is associated with better prognosis in acute decompensated heart failure. J Card Fail. 2013;19(9):605-610. doi: 10.1016/j.cardfail.2013.06.296 [doi].

113. Ferreira AJ, Murca TM, Fraga-Silva RA, Castro CH, Raizada MK, Santos RA. New cardiovascular and pulmonary therapeutic strategies based on the angiotensin- converting enzyme 2/angiotensin-(1-7)/mas receptor axis. Int J Hypertens. 2012;2012:147825. doi: 10.1155/2012/147825 [doi].

114. Li W, Moore MJ, Vasilieva N, et al. Angiotensin-converting enzyme 2 is a functional receptor for the SARS coronavirus. Nature. 2003;426(6965):450-454. doi: 10.1038/nature02145 [doi].

197

115. Imai Y, Kuba K, Penninger JM. The discovery of angiotensin-converting enzyme 2 and its role in acute lung injury in mice. Exp Physiol. 2008;93(5):543-548. doi: 10.1113/expphysiol.2007.040048 [doi].

116. Dhawale VS, Amara VR, Karpe PA, Malek V, Patel D, Tikoo K. Activation of angiotensin-converting enzyme 2 (ACE2) attenuates allergic airway inflammation in rat asthma model. Toxicol Appl Pharmacol. 2016;306:17-26. doi: 10.1016/j.taap.2016.06.026 [doi].

117. Magalhaes GS, Rodrigues-Machado MG, Motta-Santos D, et al. Angiotensin-(1-7) attenuates airway remodelling and hyperresponsiveness in a model of chronic allergic lung inflammation. Br J Pharmacol. 2015;172(9):2330-2342. doi: 10.1111/bph.13057 [doi].

118. Lu W, Kang J, Hu K, et al. Angiotensin-(1-7) inhibits inflammation and oxidative stress to relieve lung injury induced by chronic intermittent hypoxia in rats. Braz J Med Biol Res. 2016;49(10):e5431-431X20165431. doi: 10.1590/1414-431X20165431 [doi].

119. Zhou JP, Tang W, Feng Y, et al. Angiotensin-(1-7) decreases the expression of collagen I via TGF-beta1/Smad2/3 and subsequently inhibits fibroblast-myofibroblast transition. Clin Sci (Lond). 2016;130(21):1983-1991. doi: CS20160193 [pii].

120. Papinska AM, Soto M, Meeks CJ, Rodgers KE. Long-term administration of angiotensin (1-7) prevents heart and lung dysfunction in a mouse model of type 2 diabetes (db/db) by reducing oxidative stress, inflammation and pathological remodeling. Pharmacol Res. 2016;107:372-380. doi: 10.1016/j.phrs.2016.02.026 [doi].

121. Zambelli V, Bellani G, Borsa R, et al. Angiotensin-(1-7) improves oxygenation, while reducing cellular infiltrate and fibrosis in experimental acute respiratory distress syndrome. Intensive Care Med Exp. 2015;3(1):44-015-0044-3. Epub 2015 Feb 27. doi: 10.1186/s40635-015-0044-3 [doi].

122. Li G, Liu Y, Zhu Y, et al. ACE2 activation confers endothelial protection and attenuates neointimal lesions in prevention of severe pulmonary arterial hypertension in rats. Lung. 2013;191(4):327-336. doi: 10.1007/s00408-013-9470-8 [doi].

123. Yuan YM, Luo L, Guo Z, Yang M, Ye RS, Luo C. Activation of renin-angiotensin- aldosterone system (RAAS) in the lung of smoking-induced pulmonary arterial hypertension (PAH) rats. J Renin Angiotensin Aldosterone Syst. 2015;16(2):249-253. doi: 10.1177/1470320315576256 [doi].

124. Shenoy V, Kwon KC, Rathinasabapathy A, et al. Oral delivery of angiotensin- converting enzyme 2 and angiotensin-(1-7) bioencapsulated in plant cells attenuates pulmonary hypertension. Hypertension. 2014. doi: HYPERTENSIONAHA.114.03871 [pii].

198

125. de Man FS, Tu L, Handoko ML, et al. Dysregulated renin-angiotensin-aldosterone system contributes to pulmonary arterial hypertension. Am J Respir Crit Care Med. 2012;186(8):780-789. doi: 10.1164/rccm.201203-0411OC [doi].

126. Dai H, Gong Y, Xiao Z, Guang X, Yin X. Decreased levels of serum angiotensin-(1- 7) in patients with pulmonary arterial hypertension due to congenital heart disease. Int J Cardiol. 2014;176(3):1399-1401. doi: 10.1016/j.ijcard.2014.08.021 [doi].

127. Dai HL, Guo Y, Guang XF, Xiao ZC, Zhang M, Yin XL. The changes of serum angiotensin-converting enzyme 2 in patients with pulmonary arterial hypertension due to congenital heart disease. Cardiology. 2013;124(4):208-212. doi: 10.1159/000346884 [doi].

128. Takahashi Y, Haga S, Ishizaka Y, Mimori A. Autoantibodies to angiotensin- converting enzyme 2 in patients with connective tissue diseases. Arthritis Res Ther. 2010;12(3):R85. doi: 10.1186/ar3012 [doi].

129. Yamazato Y, Ferreira AJ, Hong KH, et al. Prevention of pulmonary hypertension by angiotensin-converting enzyme 2 gene transfer. Hypertension. 2009;54(2):365-371. doi: 10.1161/HYPERTENSIONAHA.108.125468 [doi].

130. Shenoy V, Ferreira AJ, Qi Y, et al. The angiotensin-converting enzyme 2/angiogenesis-(1-7)/mas axis confers cardiopulmonary protection against lung fibrosis and pulmonary hypertension. Am J Respir Crit Care Med. 2010;182(8):1065-1072. doi: 10.1164/rccm.200912-1840OC; 10.1164/rccm.200912-1840OC.

131. Kleinsasser A, Pircher I, Treml B, et al. Recombinant angiotensin-converting enzyme 2 suppresses pulmonary vasoconstriction in acute hypoxia. Wilderness Environ Med. 2012;23(1):24-30. doi: 10.1016/j.wem.2011.09.002 [doi].

132. Johnson JA, West J, Maynard KB, Hemnes AR. ACE2 improves right ventricular function in a pressure overload model. PLoS One. 2011;6(6):e20828. doi: 10.1371/journal.pone.0020828 [doi].

133. Ferreira AJ, Shenoy V, Yamazato Y, et al. Evidence for angiotensin-converting enzyme 2 as a therapeutic target for the prevention of pulmonary hypertension. Am J Respir Crit Care Med. 2009;179(11):1048-1054. doi: 10.1164/rccm.200811-1678OC [doi].

134. Rigatto K, Casali KR, Shenoy V, Katovich MJ, Raizada MK. Diminazene aceturate improves autonomic modulation in pulmonary hypertension. Eur J Pharmacol. 2013;713(1-3):89-93. doi: 10.1016/j.ejphar.2013.04.017 [doi].

199

135. Shenoy V, Gjymishka A, Jarajapu YP, et al. Diminazene attenuates pulmonary hypertension and improves angiogenic progenitor cell functions in experimental models. Am J Respir Crit Care Med. 2013;187(6):648-657. doi: 10.1164/rccm.201205-0880OC; 10.1164/rccm.201205-0880OC.

136. Breitling S, Krauszman A, Parihar R, Walther T, Friedberg MK, Kuebler WM. Dose- dependent, therapeutic potential of angiotensin-(1-7) for the treatment of pulmonary arterial hypertension. Pulm Circ. 2015;5(4):649-657. doi: 10.1086/683696 [doi].

137. Maron BA, Leopold JA. The role of the renin-angiotensin-aldosterone system in the pathobiology of pulmonary arterial hypertension (2013 grover conference series). Pulm Circ. 2014;4(2):200-210. doi: 10.1086/675984 [doi].

138. Bleumink GS, Knetsch AM, Sturkenboom MC, et al. Quantifying the heart failure epidemic: Prevalence, incidence rate, lifetime risk and prognosis of heart failure the rotterdam study. Eur Heart J. 2004;25(18):1614-1619. doi: 10.1016/j.ehj.2004.06.038.

139. Jackson KA, Majka SM, Wang H, et al. Regeneration of ischemic cardiac muscle and vascular endothelium by adult stem cells. J Clin Invest. 2001;107(11):1395-1402. doi: 10.1172/JCI12150.

140. Orlic D, Kajstura J, Chimenti S, et al. Mobilized bone marrow cells repair the infarcted heart, improving function and survival. Proc Natl Acad Sci U S A. 2001;98(18):10344-10349. doi: 10.1073/pnas.181177898.

141. Orlic D, Kajstura J, Chimenti S, Bodine DM, Leri A, Anversa P. Transplanted adult bone marrow cells repair myocardial infarcts in mice. Ann N Y Acad Sci. 2001;938:221- 9; discussion 229-30.

142. Nigro P, Bassetti B, Cavallotti L, Catto V, Carbucicchio C, Pompilio G. Cell therapy for heart disease after 15 years: Unmet expectations. Pharmacol Res. 2017. doi: S1043-6618(16)31000-3 [pii].

143. Shah VK, Shalia KK. Stem cell therapy in acute myocardial infarction: A pot of gold or pandora's box. Stem Cells Int. 2011;2011:536758. doi: 10.4061/2011/536758.

144. Choi SH, Jung SY, Kwon SM, Baek SH. Perspectives on stem cell therapy for cardiac regeneration. advances and challenges. Circ J. 2012;76(6):1307-1312.

145. Bank AJ, Lee PC, Kubo SH. Endothelial dysfunction in patients with heart failure: Relationship to disease severity. J Card Fail. 2000;6(1):29-36.

146. Li DW, Liu ZQ, Wei J, Liu Y, Hu LS. Contribution of endothelial progenitor cells to neovascularization (review). Int J Mol Med. 2012;30(5):1000-1006. doi: 10.3892/ijmm.2012.1108; 10.3892/ijmm.2012.1108.

200

147. Jarajapu YP, Bhatwadekar AD, Caballero S, et al. Activation of the ACE2/angiotensin-(1-7)/mas receptor axis enhances the reparative function of dysfunctional diabetic endothelial progenitors. Diabetes. 2013;62(4):1258-1269. doi: 10.2337/db12-0808; 10.2337/db12-0808.

148. Chen J, Xiao X, Chen S, et al. Angiotensin-converting enzyme 2 priming enhances the function of endothelial progenitor cells and their therapeutic efficacy. Hypertension. 2013;61(3):681-689. doi: 10.1161/HYPERTENSIONAHA.111.00202 [doi].

149. Werner N, Wassmann S, Ahlers P, et al. Endothelial progenitor cells correlate with endothelial function in patients with coronary artery disease. Basic Res Cardiol. 2007;102(6):565-571. doi: 10.1007/s00395-007-0680-1.

150. Valgimigli M, Rigolin GM, Fucili A, et al. CD34+ and endothelial progenitor cells in patients with various degrees of congestive heart failure. Circulation. 2004;110(10):1209-1212. doi: 10.1161/01.CIR.0000136813.89036.21.

151. Massa M, Rosti V, Ferrario M, et al. Increased circulating hematopoietic and endothelial progenitor cells in the early phase of acute myocardial infarction. Blood. 2005;105(1):199-206. doi: 10.1182/blood-2004-05-1831.

152. Wojakowski W, Tendera M, Michalowska A, et al. Mobilization of CD34/CXCR4+, CD34/CD117+, c-met+ stem cells, and mononuclear cells expressing early cardiac, muscle, and endothelial markers into peripheral blood in patients with acute myocardial infarction. Circulation. 2004;110(20):3213-3220. doi: 10.1161/01.CIR.0000147609.39780.02.

153. Koller L, Hohensinner P, Sulzgruber P, et al. Prognostic relevance of circulating endothelial progenitor cells in patients with chronic heart failure. Thromb Haemost. 2016;116(2):309-316. doi: 10.1160/TH16-01-0051 [doi].

154. Heeschen C, Lehmann R, Honold J, et al. Profoundly reduced neovascularization capacity of bone marrow mononuclear cells derived from patients with chronic ischemic heart disease. Circulation. 2004;109(13):1615-1622. doi: 10.1161/01.CIR.0000124476.32871.E3.

155. Timmermans F, Plum J, Yoder MC, Ingram DA, Vandekerckhove B, Case J. Endothelial progenitor cells: Identity defined? J Cell Mol Med. 2009;13(1):87-102. doi: 10.1111/j.1582-4934.2008.00598.x; 10.1111/j.1582-4934.2008.00598.x.

156. Yoder MC. Defining human endothelial progenitor cells. J Thromb Haemost. 2009;7 Suppl 1:49-52. doi: 10.1111/j.1538-7836.2009.03407.x; 10.1111/j.1538- 7836.2009.03407.x.

157. Asahara T, Murohara T, Sullivan A, et al. Isolation of putative progenitor endothelial cells for angiogenesis. Science. 1997;275(5302):964-967.

201

158. Kocher AA, Schuster MD, Szabolcs MJ, et al. Neovascularization of ischemic myocardium by human bone-marrow-derived angioblasts prevents cardiomyocyte apoptosis, reduces remodeling and improves cardiac function. Nat Med. 2001;7(4):430- 436. doi: 10.1038/86498.

159. Kawamoto A, Tkebuchava T, Yamaguchi J, et al. Intramyocardial transplantation of autologous endothelial progenitor cells for therapeutic neovascularization of myocardial ischemia. Circulation. 2003;107(3):461-468.

160. Fadini GP, de Kreutzenberg SV, Coracina A, et al. Circulating CD34+ cells, metabolic syndrome, and cardiovascular risk. Eur Heart J. 2006;27(18):2247-2255. doi: 10.1093/eurheartj/ehl198.

161. Quyyumi AA, Vasquez A, Kereiakes DJ, et al. PreSERVE-AMI: A randomized, double-blind, placebo-controlled clinical trial of intracoronary administration of autologous CD34+ cells in patients with left ventricular dysfunction post STEMI. Circ Res. 2017;120(2):324-331. doi: 10.1161/CIRCRESAHA.115.308165 [doi].

162. Zhang M, Malik AB, Rehman J. Endothelial progenitor cells and vascular repair. Curr Opin Hematol. 2014;21(3):224-228. doi: 10.1097/MOH.0000000000000041 [doi].

163. Fritzenwanger M, Lorenz F, Jung C, et al. Differential number of CD34+, CD133+ and CD34+/CD133+ cells in peripheral blood of patients with congestive heart failure. Eur J Med Res. 2009;14(3):113-117.

164. Junhui Z, Xingxiang W, Guosheng F, Yunpeng S, Furong Z, Junzhu C. Reduced number and activity of circulating endothelial progenitor cells in patients with idiopathic pulmonary arterial hypertension. Respir Med. 2008;102(7):1073-1079. doi: 10.1016/j.rmed.2007.12.030 [doi].

165. Heringer-Walther S, Eckert K, Schumacher SM, et al. Angiotensin-(1-7) stimulates hematopoietic progenitor cells in vitro and in vivo. Haematologica. 2009;94(6):857-860. doi: 10.3324/haematol.2008.000034 [doi].

166. He H, Liu L, Chen Q, et al. Mesenchymal stem cells overexpressing angiotensin- converting enzyme 2 rescue lipopolysaccharide-induced lung injury. Cell Transplant. 2014. doi: content-CT-1206_He_et_al2 [pii].

167. Liu F, Gao F, Li Q, Liu Z. The functional study of human umbilical cord mesenchymal stem cells harbouring angiotensin-converting enzyme 2 in rat acute lung ischemia-reperfusion injury model. Cell Biochem Funct. 2014;32(7):580-589. doi: 10.1002/cbf.3054 [doi].

168. Vasam G, Joshi S, Thatcher SE, Bartelmez SH, Cassis LA, Jarajapu YP. Reversal of bone marrow mobilopathy and enhanced vascular repair by angiotensin-(1-7) in diabetes. Diabetes. 2017;66(2):505-518. doi: 10.2337/db16-1039 [doi].

202

169. Singh N, Vasam G, Pawar R, Jarajapu YP. Angiotensin-(1-7) reverses angiogenic dysfunction in corpus cavernosum by acting on the microvasculature and bone marrow- derived cells in diabetes. J Sex Med. 2014;11(9):2153-2163. doi: 10.1111/jsm.12620 [doi].

170. Papinska AM, Mordwinkin NM, Meeks CJ, Jadhav SS, Rodgers KE. Angiotensin- (1-7) administration benefits cardiac, renal and progenitor cell function in db/db mice. Br J Pharmacol. 2015. doi: 10.1111/bph.13225 [doi].

171. Sender R, Fuchs S, Milo R. Revised estimates for the number of human and bacteria cells in the body. PLoS Biol. 2016;14(8):e1002533. doi: 10.1371/journal.pbio.1002533 [doi].

172. Hill DA, Artis D. Intestinal bacteria and the regulation of immune cell homeostasis. Annu Rev Immunol. 2010;28:623-667. doi: 10.1146/annurev-immunol-030409-101330 [doi].

173. Rios-Covian D, Ruas-Madiedo P, Margolles A, Gueimonde M, de Los Reyes- Gavilan CG, Salazar N. Intestinal short chain fatty acids and their link with diet and human health. Front Microbiol. 2016;7:185. doi: 10.3389/fmicb.2016.00185 [doi].

174. Abreu MT. Toll-like receptor signalling in the intestinal epithelium: How bacterial recognition shapes intestinal function. Nat Rev Immunol. 2010;10(2):131-144. doi: 10.1038/nri2707 [doi].

175. von Martels JZ, Sadaghian Sadabad M, Bourgonje AR, et al. The role of gut microbiota in health and disease: In vitro modeling of host-microbe interactions at the aerobe-anaerobe interphase of the human gut. Anaerobe. 2017;44:3-12. doi: S1075- 9964(17)30001-X [pii].

176. Singh V, Yeoh BS, Vijay-Kumar M. Gut microbiome as a novel cardiovascular therapeutic target. Curr Opin Pharmacol. 2016;27:8-12. doi: 10.1016/j.coph.2016.01.002 [doi].

177. Ohland CL, Jobin C. Microbial activities and intestinal homeostasis: A delicate balance between health and disease. Cell Mol Gastroenterol Hepatol. 2015;1(1):28-40. doi: 10.1016/j.jcmgh.2014.11.004 [doi].

178. Rolig AS, Mittge EK, Ganz J, et al. The enteric nervous system promotes intestinal health by constraining microbiota composition. PLoS Biol. 2017;15(2):e2000689. doi: 10.1371/journal.pbio.2000689 [doi].

179. Drisko JA, Giles CK, Bischoff BJ. Probiotics in health maintenance and disease prevention. Altern Med Rev. 2003;8(2):143-155.

203

180. McFarland LV. Use of probiotics to correct dysbiosis of normal microbiota following disease or disruptive events: A systematic review. BMJ Open. 2014;4(8):e005047-2014- 005047. doi: 10.1136/bmjopen-2014-005047 [doi].

181. Kristensen NB, Bryrup T, Allin KH, Nielsen T, Hansen TH, Pedersen O. Alterations in fecal microbiota composition by probiotic supplementation in healthy adults: A systematic review of randomized controlled trials. Genome Med. 2016;8(1):52-016- 0300-5. doi: 10.1186/s13073-016-0300-5 [doi].

182. Mortaz E, Adcock IM, Folkerts G, Barnes PJ, Paul Vos A, Garssen J. Probiotics in the management of lung diseases. Mediators Inflamm. 2013;2013:751068. doi: 10.1155/2013/751068 [doi].

183. Ou B, Yang Y, Tham WL, Chen L, Guo J, Zhu G. Genetic engineering of probiotic escherichia coli nissle 1917 for clinical application. Appl Microbiol Biotechnol. 2016;100(20):8693-8699. doi: 10.1007/s00253-016-7829-5 [doi].

184. Serino M, Luche E, Chabo C, Amar J, Burcelin R. Intestinal microflora and metabolic diseases. Diabetes Metab. 2009;35(4):262-272. doi: 10.1016/j.diabet.2009.03.003 [doi].

185. Yang T, Santisteban MM, Rodriguez V, et al. Gut dysbiosis is linked to hypertension. Hypertension. 2015;65(6):1331-1340. doi: 10.1161/HYPERTENSIONAHA.115.05315 [doi].

186. Galassi A, Reynolds K, He J. Metabolic syndrome and risk of cardiovascular disease: A meta-analysis. Am J Med. 2006;119(10):812-819. doi: S0002- 9343(06)00280-4 [pii].

187. Ellis CL, Bokulich NA, Kalanetra KM, et al. Probiotic administration in congenital heart disease: A pilot study. J Perinatol. 2013;33(9):691-697. doi: 10.1038/jp.2013.41 [doi].

188. Koren O, Spor A, Felin J, et al. Human oral, gut, and plaque microbiota in patients with atherosclerosis. Proc Natl Acad Sci U S A. 2011;108 Suppl 1:4592-4598. doi: 10.1073/pnas.1011383107 [doi].

189. Lin CS, Chang CJ, Lu CC, et al. Impact of the gut microbiota, prebiotics, and probiotics on human health and disease. Biomed J. 2014;37(5):259-268. doi: 10.4103/2319-4170.138314 [doi].

190. Budden KF, Gellatly SL, Wood DL, et al. Emerging pathogenic links between microbiota and the gut-lung axis. Nat Rev Microbiol. 2017;15(1):55-63. doi: 10.1038/nrmicro.2016.142 [doi].

204

191. Elshaer D, Begun J. The role of barrier function, autophagy, and cytokines in maintaining intestinal homeostasis. Semin Cell Dev Biol. 2017;61:51-59. doi: S1084- 9521(16)30256-7 [pii].

192. Agerholm-Larsen L, Raben A, Haulrik N, Hansen AS, Manders M, Astrup A. Effect of 8 week intake of probiotic milk products on risk factors for cardiovascular diseases. Eur J Clin Nutr. 2000;54(4):288-297.

193. Kawase M, Hashimoto H, Hosoda M, Morita H, Hosono A. Effect of administration of fermented milk containing whey protein concentrate to rats and healthy men on serum lipids and blood pressure. J Dairy Sci. 2000;83(2):255-263. doi: S0022- 0302(00)74872-7 [pii].

194. Naruszewicz M, Johansson ML, Zapolska-Downar D, Bukowska H. Effect of lactobacillus plantarum 299v on cardiovascular disease risk factors in smokers. Am J Clin Nutr. 2002;76(6):1249-1255.

195. Seppo L, Jauhiainen T, Poussa T, Korpela R. A fermented milk high in bioactive peptides has a blood pressure-lowering effect in hypertensive subjects. Am J Clin Nutr. 2003;77(2):326-330.

196. Aihara K, Kajimoto O, Hirata H, Takahashi R, Nakamura Y. Effect of powdered fermented milk with lactobacillus helveticus on subjects with high-normal blood pressure or mild hypertension. J Am Coll Nutr. 2005;24(4):257-265. doi: 24/4/257 [pii].

197. Dong JY, Szeto IM, Makinen K, et al. Effect of probiotic fermented milk on blood pressure: A meta-analysis of randomised controlled trials. Br J Nutr. 2013;110(7):1188- 1194. doi: 10.1017/S0007114513001712 [doi].

198. Chen Y, Liu W, Xue J, et al. Angiotensin-converting enzyme inhibitory activity of lactobacillus helveticus strains from traditional fermented dairy foods and antihypertensive effect of fermented milk of strain H9. J Dairy Sci. 2014. doi: S0022- 0302(14)00565-7 [pii].

199. Khalesi S, Sun J, Buys N, Jayasinghe R. Effect of probiotics on blood pressure: A systematic review and meta-analysis of randomized, controlled trials. Hypertension. 2014;64(4):897-903. doi: 10.1161/HYPERTENSIONAHA.114.03469 [doi].

200. Lin MY, Yen CL. Reactive oxygen species and lipid peroxidation product- scavenging ability of yogurt organisms. J Dairy Sci. 1999;82(8):1629-1634. doi: S0022- 0302(99)75391-9 [pii].

201. Lin MY, Chang FJ. Antioxidative effect of intestinal bacteria bifidobacterium longum ATCC 15708 and lactobacillus acidophilus ATCC 4356. Dig Dis Sci. 2000;45(8):1617- 1622.

205

202. Kullisaar T, Zilmer M, Mikelsaar M, et al. Two antioxidative lactobacilli strains as promising probiotics. Int J Food Microbiol. 2002;72(3):215-224.

203. Kullisaar T, Songisepp E, Mikelsaar M, Zilmer K, Vihalemm T, Zilmer M. Antioxidative probiotic fermented goats' milk decreases oxidative stress-mediated atherogenicity in human subjects. Br J Nutr. 2003;90(2):449-456. doi: S0007114503001466 [pii].

204. Songisepp E, Kals J, Kullisaar T, et al. Evaluation of the functional efficacy of an antioxidative probiotic in healthy volunteers. Nutr J. 2005;4:22. doi: 1475-2891-4-22 [pii].

205. Wang YC, Yu RC, Chou CC. Antioxidative activities of soymilk fermented with lactic acid bacteria and bifidobacteria. Food Microbiol. 2006;23(2):128-135. doi: S0740- 0020(05)00030-4 [pii].

206. Jarvenpaa S, Tahvonen RL, Ouwehand AC, Sandell M, Jarvenpaa E, Salminen S. A probiotic, lactobacillus fermentum ME-3, has antioxidative capacity in soft cheese spreads with different fats. J Dairy Sci. 2007;90(7):3171-3177. doi: S0022- 0302(07)71765-4 [pii].

207. Mikelsaar M, Zilmer M. Lactobacillus fermentum ME-3 - an antimicrobial and antioxidative probiotic. Microb Ecol Health Dis. 2009;21(1):1-27. doi: 10.1080/08910600902815561 [doi].

208. Agerholm-Larsen L, Bell ML, Grunwald GK, Astrup A. The effect of a probiotic milk product on plasma cholesterol: A meta-analysis of short-term intervention studies. Eur J Clin Nutr. 2000;54(11):856-860.

209. Xiao JZ, Kondo S, Takahashi N, et al. Effects of milk products fermented by bifidobacterium longum on blood lipids in rats and healthy adult male volunteers. J Dairy Sci. 2003;86(7):2452-2461. doi: S0022-0302(03)73839-9 [pii].

210. Wang Y, Xu N, Xi A, Ahmed Z, Zhang B, Bai X. Effects of lactobacillus plantarum MA2 isolated from tibet kefir on lipid metabolism and intestinal microflora of rats fed on high-cholesterol diet. Appl Microbiol Biotechnol. 2009;84(2):341-347. doi: 10.1007/s00253-009-2012-x [doi].

211. Ramchandran L, Shah NP. Proteolytic profiles and angiotensin-I converting enzyme and alpha-glucosidase inhibitory activities of selected lactic acid bacteria. J Food Sci. 2008;73(2):M75-81. doi: 10.1111/j.1750-3841.2007.00643.x [doi].

212. Gan XT, Ettinger G, Huang CX, et al. Probiotic administration attenuates myocardial hypertrophy and heart failure after myocardial infarction in the rat. Circ Heart Fail. 2014;7(3):491-499. doi: 10.1161/CIRCHEARTFAILURE.113.000978 [doi].

206

213. Writing Group Members, Mozaffarian D, Benjamin EJ, et al. Executive summary: Heart disease and stroke statistics--2016 update: A report from the american heart association. Circulation. 2016;133(4):447-454. doi: 10.1161/CIR.0000000000000366 [doi].

214. Kemp CD, Conte JV. The pathophysiology of heart failure. Cardiovasc Pathol. 2012;21(5):365-371. doi: 10.1016/j.carpath.2011.11.007 [doi].

215. Poglajen G, Vrtovec B. Stem cell therapy for chronic heart failure. Curr Opin Cardiol. 2015;30(3):301-310. doi: 10.1097/HCO.0000000000000167 [doi].

216. Mackie AR, Losordo DW. CD34-positive stem cells: In the treatment of heart and vascular disease in human beings. Tex Heart Inst J. 2011;38(5):474-485.

217. Fadini GP, Rigato M, Cappellari R, Bonora BM, Avogaro A. Long-term prediction of cardiovascular outcomes by circulating CD34+ and CD34+CD133+ stem cells in patients with type 2 diabetes. Diabetes Care. 2017;40(1):125-131. doi: 10.2337/dc16- 1755 [doi].

218. Bhatwadekar AD, Yan Y, Stepps V, et al. miR-92a corrects CD34+ cell dysfunction in diabetes by modulating core circadian genes involved in progenitor differentiation. Diabetes. 2015;64(12):4226-4237. doi: 10.2337/db15-0521 [doi].

219. Jarajapu YP, Hazra S, Segal M, et al. Vasoreparative dysfunction of CD34+ cells in diabetic individuals involves hypoxic desensitization and impaired autocrine/paracrine mechanisms. PLoS One. 2014;9(4):e93965. doi: 10.1371/journal.pone.0093965 [doi].

220. Hazra S, Stepps V, Bhatwadekar AD, et al. Enhancing the function of CD34(+) cells by targeting plasminogen activator inhibitor-1. PLoS One. 2013;8(11):e79067. doi: 10.1371/journal.pone.0079067 [doi].

221. Katovich MJ, Grobe JL, Raizada MK. Angiotensin-(1-7) as an antihypertensive, antifibrotic target. Curr Hypertens Rep. 2008;10(3):227-232.

222. Chavey WE, Hogikyan RV, Van Harrison R, Nicklas JM. Heart failure due to reduced ejection fraction: Medical management. Am Fam Physician. 2017;95(1):13-20. doi: d12850 [pii].

223. Grobe JL, Der Sarkissian S, Stewart JM, Meszaros JG, Raizada MK, Katovich MJ. ACE2 overexpression inhibits hypoxia-induced collagen production by cardiac fibroblasts. Clin Sci (Lond). 2007;113(8):357-364. doi: CS20070160 [pii].

207

224. Hernandez Prada JA, Ferreira AJ, Katovich MJ, et al. Structure-based identification of small-molecule angiotensin-converting enzyme 2 activators as novel antihypertensive agents. Hypertension. 2008;51(5):1312-1317. doi: 10.1161/HYPERTENSIONAHA.107.108944; 10.1161/HYPERTENSIONAHA.107.108944.

225. Wang Y, Qian C, Roks AJ, et al. Circulating rather than cardiac angiotensin-(1-7) stimulates cardioprotection after myocardial infarction. Circ Heart Fail. 2010;3(2):286- 293. doi: 10.1161/CIRCHEARTFAILURE.109.905968 [doi].

226. Singh N, Joshi S, Guo L, et al. ACE2/ang-(1-7)/mas axis stimulates vascular repair-relevant functions of CD34+ cells. Am J Physiol Heart Circ Physiol. 2015;309(10):H1697-707. doi: 10.1152/ajpheart.00854.2014 [doi].

227. Van Craenenbroeck EM, Denollet J, Paelinck BP, et al. Circulating CD34+/KDR+ endothelial progenitor cells are reduced in chronic heart failure patients as a function of type D personality. Clin Sci (Lond). 2009;117(4):165-172. doi: 10.1042/CS20080564 [doi].

228. Beltrami AP, Barlucchi L, Torella D, et al. Adult cardiac stem cells are multipotent and support myocardial regeneration. Cell. 2003;114(6):763-776. doi: S0092867403006871 [pii].

229. Shilov IV, Seymour SL, Patel AA, et al. The paragon algorithm, a next generation search engine that uses sequence temperature values and feature probabilities to identify peptides from tandem mass spectra. Mol Cell Proteomics. 2007;6(9):1638-1655. doi: T600050-MCP200 [pii].

230. Bauersachs J, Widder JD. Endothelial dysfunction in heart failure. Pharmacol Rep. 2008;60(1):119-126.

231. Kuhlmann CR, Schaefer CA, Reinhold L, Tillmanns H, Erdogan A. Signalling mechanisms of SDF-induced endothelial cell proliferation and migration. Biochem Biophys Res Commun. 2005;335(4):1107-1114. doi: S0006-291X(05)01674-8 [pii].

232. Cherla RP, Ganju RK. Stromal cell-derived factor 1 alpha-induced chemotaxis in T cells is mediated by nitric oxide signaling pathways. J Immunol. 2001;166(5):3067-3074.

233. Ritchie RH, Drummond GR, Sobey CG, De Silva TM, Kemp-Harper BK. The opposing roles of NO and oxidative stress in cardiovascular disease. Pharmacol Res. 2017;116:57-69. doi: S1043-6618(16)31339-1 [pii].

234. Nonaka-Sarukawa M, Yamamoto K, Aoki H, et al. Circulating endothelial progenitor cells in congestive heart failure. Int J Cardiol. 2007;119(3):344-348. doi: S0167-5273(06)01046-1 [pii].

208

235. Wright DE, Bowman EP, Wagers AJ, Butcher EC, Weissman IL. Hematopoietic stem cells are uniquely selective in their migratory response to chemokines. J Exp Med. 2002;195(9):1145-1154.

236. Vasa M, Fichtlscherer S, Aicher A, et al. Number and migratory activity of circulating endothelial progenitor cells inversely correlate with risk factors for coronary artery disease. Circ Res. 2001;89(1):E1-7.

237. Tepper OM, Galiano RD, Capla JM, et al. Human endothelial progenitor cells from type II diabetics exhibit impaired proliferation, adhesion, and incorporation into vascular structures. Circulation. 2002;106(22):2781-2786.

238. Ii M, Takenaka H, Asai J, et al. Endothelial progenitor thrombospondin-1 mediates diabetes-induced delay in reendothelialization following arterial injury. Circ Res. 2006;98(5):697-704. doi: 01.RES.0000209948.50943.ea [pii].

239. Fortunato O, Spinetti G, Specchia C, Cangiano E, Valgimigli M, Madeddu P. Migratory activity of circulating progenitor cells and serum SDF-1alpha predict adverse events in patients with myocardial infarction. Cardiovasc Res. 2013;100(2):192-200. doi: 10.1093/cvr/cvt153 [doi].

240. Van Craenenbroeck EM, Hoymans VY, Beckers PJ, et al. Exercise training improves function of circulating angiogenic cells in patients with chronic heart failure. Basic Res Cardiol. 2010;105(5):665-676. doi: 10.1007/s00395-010-0105-4 [doi].

241. Lataillade JJ, Domenech J, Le Bousse-Kerdiles MC. Stromal cell-derived factor-1 (SDF-1)\CXCR4 couple plays multiple roles on haematopoietic progenitors at the border between the old cytokine and new chemokine worlds: Survival, cell cycling and trafficking. Eur Cytokine Netw. 2004;15(3):177-188.

242. Zaruba MM, Franz WM. Role of the SDF-1-CXCR4 axis in stem cell-based therapies for ischemic cardiomyopathy. Expert Opin Biol Ther. 2010;10(3):321-335. doi: 10.1517/14712590903460286 [doi].

243. Aicher A, Heeschen C, Mildner-Rihm C, et al. Essential role of endothelial nitric oxide synthase for mobilization of stem and progenitor cells. Nat Med. 2003;9(11):1370- 1376. doi: 10.1038/nm948 [doi].

244. Segal MS, Shah R, Afzal A, et al. Nitric oxide cytoskeletal-induced alterations reverse the endothelial progenitor cell migratory defect associated with diabetes. Diabetes. 2006;55(1):102-109.

245. Mohri M, Egashira K, Tagawa T, et al. Basal release of nitric oxide is decreased in the coronary circulation in patients with heart failure. Hypertension. 1997;30(1 Pt 1):50- 56.

209

246. Zhang Y, Wittner M, Bouamar H, Jarrier P, Vainchenker W, Louache F. Identification of CXCR4 as a new nitric oxide-regulated gene in human CD34+ cells. Stem Cells. 2007;25(1):211-219. doi: 2006-0468 [pii].

247. Sharma R, Davidoff MN. Oxidative stress and endothelial dysfunction in heart failure. Congest Heart Fail. 2002;8(3):165-172.

248. Case J, Ingram DA, Haneline LS. Oxidative stress impairs endothelial progenitor cell function. Antioxid Redox Signal. 2008;10(11):1895-1907. doi: 10.1089/ars.2008.2118 [doi].

249. Guzik TJ, Mussa S, Gastaldi D, et al. Mechanisms of increased vascular superoxide production in human diabetes mellitus: Role of NAD(P)H oxidase and endothelial nitric oxide synthase. Circulation. 2002;105(14):1656-1662.

250. Caiado F, Dias S. Endothelial progenitor cells and integrins: Adhesive needs. Fibrogenesis Tissue Repair. 2012;5:4-1536-5-4. doi: 10.1186/1755-1536-5-4 [doi].

251. Hoover-Plow J, Gong Y. Challenges for heart disease stem cell therapy. Vasc Health Risk Manag. 2012;8:99-113. doi: 10.2147/VHRM.S25665 [doi].

252. Wei SG, Yu Y, Weiss RM, Felder RB. Endoplasmic reticulum stress increases brain MAPK signaling, inflammation and renin-angiotensin system activity and sympathetic nerve activity in heart failure. Am J Physiol Heart Circ Physiol. 2016;311(4):H871-H880. doi: 10.1152/ajpheart.00362.2016 [doi].

253. Wang J, Li N, Gao F, Song R, Zhu S, Geng Z. Balance between angiotensin converting enzyme and angiotensin converting enzyme 2 in patients with chronic heart failure. J Renin Angiotensin Aldosterone Syst. 2015;16(3):553-558. doi: 10.1177/1470320315576257 [doi].

254. Ohtsuki M, Morimoto S, Izawa H, et al. Angiotensin converting enzyme 2 gene expression increased compensatory for left ventricular remodeling in patients with end- stage heart failure. Int J Cardiol. 2010;145(2):333-334. doi: 10.1016/j.ijcard.2009.11.057 [doi].

255. Zheng Y, Tang L, Huang W, et al. Anti-inflammatory effects of ang-(1-7) in ameliorating HFD-induced renal injury through LDLr-SREBP2-SCAP pathway. PLoS One. 2015;10(8):e0136187. doi: 10.1371/journal.pone.0136187 [doi].

256. Pernomian L, Gomes MS, Restini CB, de Oliveira AM. MAS-mediated antioxidant effects restore the functionality of angiotensin converting enzyme 2-angiotensin-(1-7)- MAS axis in diabetic rat carotid. Biomed Res Int. 2014;2014:640329. doi: 10.1155/2014/640329 [doi].

210

257. Brosnihan KB, Li P, Tallant EA, Ferrario CM. Angiotensin-(1-7): A novel vasodilator of the coronary circulation. Biol Res. 1998;31(3):227-234.

258. Heitsch H, Brovkovych S, Malinski T, Wiemer G. Angiotensin-(1-7)-stimulated nitric oxide and superoxide release from endothelial cells. Hypertension. 2001;37(1):72-76.

259. Gwathmey TM, Pendergrass KD, Reid SD, Rose JC, Diz DI, Chappell MC. Angiotensin-(1-7)-angiotensin-converting enzyme 2 attenuates reactive oxygen species formation to angiotensin II within the cell nucleus. Hypertension. 2010;55(1):166-171. doi: 10.1161/HYPERTENSIONAHA.109.141622 [doi].

260. Zhang Y, Liu J, Luo JY, et al. Upregulation of angiotensin (1-7)-mediated signaling preserves endothelial function through reducing oxidative stress in diabetes. Antioxid Redox Signal. 2015. doi: 10.1089/ars.2014.6070 [doi].

261. Giani JF, Burghi V, Veiras LC, et al. Angiotensin-(1-7) attenuates diabetic nephropathy in zucker diabetic fatty rats. Am J Physiol Renal Physiol. 2012;302(12):F1606-15. doi: 10.1152/ajprenal.00063.2012 [doi].

262. Marques FD, Ferreira AJ, Sinisterra RD, et al. An oral formulation of angiotensin- (1-7) produces cardioprotective effects in infarcted and isoproterenol-treated rats. Hypertension. 2011;57(3):477-483. doi: 10.1161/HYPERTENSIONAHA.110.167346 [doi].

263. Singh K, Singh T, Sharma PL. Beneficial effects of angiotensin (1-7) in diabetic rats with cardiomyopathy. Ther Adv Cardiovasc Dis. 2011;5(3):159-167. doi: 10.1177/1753944711409281 [doi].

264. Gironacci MM, Adamo HP, Corradi G, Santos RA, Ortiz P, Carretero OA. Angiotensin (1-7) induces MAS receptor internalization. Hypertension. 2011;58(2):176- 181. doi: 10.1161/HYPERTENSIONAHA.111.173344 [doi].

265. Walters PE, Gaspari TA, Widdop RE. Angiotensin-(1-7) acts as a vasodepressor agent via angiotensin II type 2 receptors in conscious rats. Hypertension. 2005;45(5):960-966. doi: 01.HYP.0000160325.59323.b8 [pii].

266. Liu Y, Li B, Wang X, et al. Angiotensin-(1-7) suppresses hepatocellular carcinoma growth and angiogenesis via complex interactions of angiotensin II type 1 receptor, angiotensin II type 2 receptor and mas receptor. Mol Med. 2015;21:626-636. doi: 10.2119/molmed.2015.00022 [doi].

267. Yousif MH, Benter IF, Diz DI, Chappell MC. Angiotensin-(1-7)-dependent vasorelaxation of the renal artery exhibits unique angiotensin and bradykinin receptor selectivity. Peptides. 2017;90:10-16. doi: S0196-9781(17)30033-5 [pii].

211

268. Villela D, Leonhardt J, Patel N, et al. Angiotensin type 2 receptor (AT2R) and receptor mas: A complex liaison. Clin Sci (Lond). 2015;128(4):227-234. doi: 10.1042/CS20130515 [doi].

269. Wang Y, Miao X, Liu Y, et al. Dysregulation of histone acetyltransferases and deacetylases in cardiovascular diseases. Oxid Med Cell Longev. 2014;2014:641979. doi: 10.1155/2014/641979 [doi].

270. DiSalvo TG. Epigenetic regulation in heart failure: Part II DNA and chromatin. Cardiol Rev. 2015;23(6):269-281. doi: 10.1097/CRD.0000000000000074 [doi].

271. Somanna NK, Valente AJ, Krenz M, et al. Histone deacetyltransferase inhibitors trichostatin A and mocetinostat differentially regulate MMP9, IL-18 and RECK expression, and attenuate angiotensin II-induced cardiac fibroblast migration and proliferation. Hypertens Res. 2016;39(10):709-716. doi: 10.1038/hr.2016.54 [doi].

272. Konstandin MH, Volkers M, Collins B, et al. Fibronectin contributes to pathological cardiac hypertrophy but not physiological growth. Basic Res Cardiol. 2013;108(5):375- 013-0375-8. Epub 2013 Aug 4. doi: 10.1007/s00395-013-0375-8 [doi].

273. Crawford DC, Chobanian AV, Brecher P. Angiotensin II induces fibronectin expression associated with cardiac fibrosis in the rat. Circ Res. 1994;74(4):727-739.

274. Hannan RD, Luyken J, Rothblum LI. Regulation of ribosomal DNA transcription during contraction-induced hypertrophy of neonatal cardiomyocytes. J Biol Chem. 1996;271(6):3213-3220.

275. Beinlich CJ, Baker KM, White GJ, Morgan HE. Control of growth in the neonatal pig heart. Am J Physiol. 1991;261(4 Suppl):3-7.

276. Clement S, Pellieux C, Chaponnier C, Pedrazzini T, Gabbiani G. Angiotensin II stimulates alpha-skeletal actin expression in cadiomyocytes in vitro and in vivo in the absence of hypertension. Differentiation. 2001;69(1):66-74. doi: S0301-4681(09)60419- 9 [pii].

277. Aoki H, Izumo S, Sadoshima J. Angiotensin II activates RhoA in cardiac myocytes: A critical role of RhoA in angiotensin II-induced premyofibril formation. Circ Res. 1998;82(6):666-676.

278. Meng Y, Li T, Zhou GS, et al. The angiotensin-converting enzyme 2/angiotensin (1-7)/mas axis protects against lung fibroblast migration and lung fibrosis by inhibiting the NOX4-derived ROS-mediated RhoA/rho kinase pathway. Antioxid Redox Signal. 2015;22(3):241-258. doi: 10.1089/ars.2013.5818 [doi].

212

279. Todd DJ, Lee AH, Glimcher LH. The endoplasmic reticulum stress response in immunity and autoimmunity. Nat Rev Immunol. 2008;8(9):663-674. doi: 10.1038/nri2359 [doi].

280. Shrestha N, Bahnan W, Wiley DJ, Barber G, Fields KA, Schesser K. Eukaryotic initiation factor 2 (eIF2) signaling regulates proinflammatory cytokine expression and bacterial invasion. J Biol Chem. 2012;287(34):28738-28744. doi: 10.1074/jbc.M112.375915 [doi].

281. Azfer A, Niu J, Rogers LM, Adamski FM, Kolattukudy PE. Activation of endoplasmic reticulum stress response during the development of ischemic heart disease. Am J Physiol Heart Circ Physiol. 2006;291(3):H1411-20. doi: 01378.2005 [pii].

282. Gullestad L, Ueland T, Vinge LE, Finsen A, Yndestad A, Aukrust P. Inflammatory cytokines in heart failure: Mediators and markers. Cardiology. 2012;122(1):23-35. doi: 10.1159/000338166 [doi].

283. dos Santos DO, Blefari V, Prado FP, et al. Reduced expression of adherens and gap junction proteins can have a fundamental role in the development of heart failure following cardiac hypertrophy in rats. Exp Mol Pathol. 2016;100(1):167-176. doi: 10.1016/j.yexmp.2015.12.009 [doi].

284. Baum B, Georgiou M. Dynamics of adherens junctions in epithelial establishment, maintenance, and remodeling. J Cell Biol. 2011;192(6):907-917. doi: 10.1083/jcb.201009141 [doi].

285. Insel PA, Patel HH. Membrane rafts and caveolae in cardiovascular signaling. Curr Opin Nephrol Hypertens. 2009;18(1):50-56. doi: 10.1097/MNH.0b013e3283186f82 [doi].

286. Navarro G, Borroto-Escuela DO, Fuxe K, Franco R. Potential of caveolae in the therapy of cardiovascular and neurological diseases. Front Physiol. 2014;5:370. doi: 10.3389/fphys.2014.00370 [doi].

287. Taniguchi T, Maruyama N, Ogata T, et al. PTRF/cavin-1 deficiency causes cardiac dysfunction accompanied by cardiomyocyte hypertrophy and cardiac fibrosis. PLoS One. 2016;11(9):e0162513. doi: 10.1371/journal.pone.0162513 [doi].

288. Tuder RM, Groves B, Badesch DB, Voelkel NF. Exuberant endothelial cell growth and elements of inflammation are present in plexiform lesions of pulmonary hypertension. Am J Pathol. 1994;144(2):275-285.

289. Groth A, Vrugt B, Brock M, Speich R, Ulrich S, Huber LC. Inflammatory cytokines in pulmonary hypertension. Respir Res. 2014;15:47-9921-15-47. doi: 10.1186/1465- 9921-15-47 [doi].

213

290. Edwards AL, Gunningham SP, Clare GC, et al. Professional killer cell deficiencies and decreased survival in pulmonary arterial hypertension. Respirology. 2013;18(8):1271-1277. doi: 10.1111/resp.12152 [doi].

291. Gerasimovskaya E, Kratzer A, Sidiakova A, Salys J, Zamora M, Taraseviciene- Stewart L. Interplay of macrophages and T cells in the lung vasculature. Am J Physiol Lung Cell Mol Physiol. 2012;302(10):L1014-22. doi: 10.1152/ajplung.00357.2011 [doi].

292. Humbert M, Monti G, Brenot F, et al. Increased interleukin-1 and interleukin-6 serum concentrations in severe primary pulmonary hypertension. Am J Respir Crit Care Med. 1995;151(5):1628-1631. doi: 10.1164/ajrccm.151.5.7735624 [doi].

293. Fartoukh M, Emilie D, Le Gall C, Monti G, Simonneau G, Humbert M. Chemokine macrophage inflammatory protein-1alpha mRNA expression in lung biopsy specimens of primary pulmonary hypertension. Chest. 1998;114(1 Suppl):50S-51S. doi: S0012- 3692(15)48029-8 [pii].

294. Nicolls MR, Taraseviciene-Stewart L, Rai PR, Badesch DB, Voelkel NF. Autoimmunity and pulmonary hypertension: A perspective. Eur Respir J. 2005;26(6):1110-1118. doi: 26/6/1110 [pii].

295. Cohen-Kaminsky S, Hautefort A, Price L, Humbert M, Perros F. Inflammation in pulmonary hypertension: What we know and what we could logically and safely target first. Drug Discov Today. 2014;19(8):1251-1256. doi: 10.1016/j.drudis.2014.04.007 [doi].

296. Ulrich S, Taraseviciene-Stewart L, Huber LC, Speich R, Voelkel N. Peripheral blood B lymphocytes derived from patients with idiopathic pulmonary arterial hypertension express a different RNA pattern compared with healthy controls: A cross sectional study. Respir Res. 2008;9:20-9921-9-20. doi: 10.1186/1465-9921-9-20 [doi].

297. Corcoran BM, Stanton C, Fitzgerald GF, Ross RP. Survival of probiotic lactobacilli in acidic environments is enhanced in the presence of metabolizable sugars. Appl Environ Microbiol. 2005;71(6):3060-3067. doi: 71/6/3060 [pii].

298. Chiang SS, Pan TM. Beneficial effects of lactobacillus paracasei subsp. paracasei NTU 101 and its fermented products. Appl Microbiol Biotechnol. 2012;93(3):903-916. doi: 10.1007/s00253-011-3753-x [doi].

299. Ibnou-Zekri N, Blum S, Schiffrin EJ, von der Weid T. Divergent patterns of colonization and immune response elicited from two intestinal lactobacillus strains that display similar properties in vitro. Infect Immun. 2003;71(1):428-436.

300. Martin FP, Wang Y, Sprenger N, et al. Probiotic modulation of symbiotic gut microbial-host metabolic interactions in a humanized microbiome mouse model. Mol Syst Biol. 2008;4:157. doi: 10.1038/msb4100190 [doi].

214

301. Martin FP, Verdu EF, Wang Y, et al. Transgenomic metabolic interactions in a mouse disease model: Interactions of trichinella spiralis infection with dietary lactobacillus paracasei supplementation. J Proteome Res. 2006;5(9):2185-2193. doi: 10.1021/pr060157b [doi].

302. Zagato E, Mileti E, Massimiliano L, et al. Lactobacillus paracasei CBA L74 metabolic products and fermented milk for infant formula have anti-inflammatory activity on dendritic cells in vitro and protective effects against colitis and an enteric pathogen in vivo. PLoS One. 2014;9(2):e87615. doi: 10.1371/journal.pone.0087615 [doi].

303. Stsepetova J, Sepp E, Kolk H, Loivukene K, Songisepp E, Mikelsaar M. Diversity and metabolic impact of intestinal lactobacillus species in healthy adults and the elderly. Br J Nutr. 2011;105(8):1235-1244. doi: 10.1017/S0007114510004770 [doi].

304. DeSantis TZ, Hugenholtz P, Larsen N, et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl Environ Microbiol. 2006;72(7):5069-5072. doi: 72/7/5069 [pii].

305. Kim KC, Lee JC, Lee H, Cho MS, Choi SJ, Hong YM. Changes in caspase-3, B cell leukemia/lymphoma-2, interleukin-6, tumor necrosis factor-alpha and vascular endothelial growth factor gene expression after human umbilical cord blood derived mesenchymal stem cells transfusion in pulmonary hypertension rat models. Korean Circ J. 2016;46(1):79-92. doi: 10.4070/kcj.2016.46.1.79 [doi].

306. Yang T, Santisteban MM, Rodriguez V, et al. Gut dysbiosis is linked to hypertension. Hypertension. 2015;65(6):1331-1340. doi: 10.1161/HYPERTENSIONAHA.115.05315 [doi].

307. Gomez-Arroyo JG, Farkas L, Alhussaini AA, et al. The monocrotaline model of pulmonary hypertension in perspective. Am J Physiol Lung Cell Mol Physiol. 2012;302(4):L363-9. doi: 10.1152/ajplung.00212.2011 [doi].

308. Maarman G, Lecour S, Butrous G, Thienemann F, Sliwa K. A comprehensive review: The evolution of animal models in pulmonary hypertension research; are we there yet? Pulm Circ. 2013;3(4):739-756. doi: 10.1086/674770 [doi].

309. Ramos M, Lame MW, Segall HJ, Wilson DW. Monocrotaline pyrrole induces smad nuclear accumulation and altered signaling expression in human pulmonary arterial endothelial cells. Vascul Pharmacol. 2007;46(6):439-448. doi: S1537-1891(07)00027-4 [pii].

310. Stenmark KR, Meyrick B, Galie N, Mooi WJ, McMurtry IF. Animal models of pulmonary arterial hypertension: The hope for etiological discovery and pharmacological cure. Am J Physiol Lung Cell Mol Physiol. 2009;297(6):L1013-32. doi: 10.1152/ajplung.00217.2009 [doi].

215

311. Rabinovitch M, Guignabert C, Humbert M, Nicolls MR. Inflammation and immunity in the pathogenesis of pulmonary arterial hypertension. Circ Res. 2014;115(1):165-175. doi: 10.1161/CIRCRESAHA.113.301141 [doi].

312. Stacher E, Graham BB, Hunt JM, et al. Modern age pathology of pulmonary arterial hypertension. Am J Respir Crit Care Med. 2012;186(3):261-272. doi: 10.1164/rccm.201201-0164OC [doi].

313. Voelkel NF, Tuder RM, Bridges J, Arend WP. Interleukin-1 receptor antagonist treatment reduces pulmonary hypertension generated in rats by monocrotaline. Am J Respir Cell Mol Biol. 1994;11(6):664-675. doi: 10.1165/ajrcmb.11.6.7946395 [doi].

314. Haga S, Tsuchiya H, Hirai T, Hamano T, Mimori A, Ishizaka Y. A novel ACE2 activator reduces monocrotaline-induced pulmonary hypertension by suppressing the JAK/STAT and TGF-beta cascades with restored caveolin-1 expression. Exp Lung Res. 2015;41(1):21-31. doi: 10.3109/01902148.2014.959141 [doi].

315. Bischoff SC, Barbara G, Buurman W, et al. Intestinal permeability--a new target for disease prevention and therapy. BMC Gastroenterol. 2014;14:189-014-0189-7. doi: 10.1186/s12876-014-0189-7 [doi].

316. Erben U, Loddenkemper C, Doerfel K, et al. A guide to histomorphological evaluation of intestinal inflammation in mouse models. Int J Clin Exp Pathol. 2014;7(8):4557-4576.

317. Santisteban MM, Qi Y, Zubcevic J, et al. Hypertension-linked pathophysiological alterations in the gut. Circ Res. 2017;120(2):312-323. doi: 10.1161/CIRCRESAHA.116.309006 [doi].

318. Peuhkuri K, Vapaatalo H, Korpela R. Even low-grade inflammation impacts on small intestinal function. World J Gastroenterol. 2010;16(9):1057-1062.

319. Konig J, Wells J, Cani PD, et al. Human intestinal barrier function in health and disease. Clin Transl Gastroenterol. 2016;7(10):e196. doi: 10.1038/ctg.2016.54 [doi].

320. Kelly JR, Kennedy PJ, Cryan JF, Dinan TG, Clarke G, Hyland NP. Breaking down the barriers: The gut microbiome, intestinal permeability and stress-related psychiatric disorders. Front Cell Neurosci. 2015;9:392. doi: 10.3389/fncel.2015.00392 [doi].

321. Carding S, Verbeke K, Vipond DT, Corfe BM, Owen LJ. Dysbiosis of the gut microbiota in disease. Microb Ecol Health Dis. 2015;26:26191. doi: 10.3402/mehd.v26.26191 [doi].

322. Wexler HM. Bacteroides: The good, the bad, and the nitty-gritty. Clin Microbiol Rev. 2007;20(4):593-621. doi: 20/4/593 [pii].

216

323. Hooper LV, Wong MH, Thelin A, Hansson L, Falk PG, Gordon JI. Molecular analysis of commensal host-microbial relationships in the intestine. Science. 2001;291(5505):881-884. doi: 10.1126/science.291.5505.881 [doi].

324. Cash HL, Whitham CV, Behrendt CL, Hooper LV. Symbiotic bacteria direct expression of an intestinal bactericidal lectin. Science. 2006;313(5790):1126-1130. doi: 313/5790/1126 [pii].

325. Sagheddu V, Patrone V, Miragoli F, Puglisi E, Morelli L. Infant early gut colonization by lachnospiraceae: High frequency of ruminococcus gnavus. Front Pediatr. 2016;4:57. doi: 10.3389/fped.2016.00057 [doi].

326. Favier CF, Vaughan EE, De Vos WM, Akkermans AD. Molecular monitoring of succession of bacterial communities in human neonates. Appl Environ Microbiol. 2002;68(1):219-226.

327. Rodriguez-Diaz J, Garcia-Mantrana I, Vila-Vicent S, et al. Relevance of secretor status genotype and microbiota composition in susceptibility to rotavirus and norovirus infections in humans. Sci Rep. 2017;7:45559. doi: 10.1038/srep45559 [doi].

328. Tun HM, Konya T, Takaro TK, et al. Exposure to household furry pets influences the gut microbiota of infant at 3-4 months following various birth scenarios. Microbiome. 2017;5(1):40-017-0254-x. doi: 10.1186/s40168-017-0254-x [doi].

329. Kasai C, Sugimoto K, Moritani I, et al. Comparison of the gut microbiota composition between obese and non-obese individuals in a japanese population, as analyzed by terminal restriction fragment length polymorphism and next-generation sequencing. BMC Gastroenterol. 2015;15:100-015-0330-2. doi: 10.1186/s12876-015- 0330-2 [doi].

330. Million M, Tidjani Alou M, Khelaifia S, et al. Increased gut redox and depletion of anaerobic and methanogenic prokaryotes in severe acute malnutrition. Sci Rep. 2016;6:26051. doi: 10.1038/srep26051 [doi].

331. Crost EH, Tailford LE, Le Gall G, Fons M, Henrissat B, Juge N. Utilisation of mucin glycans by the human gut symbiont ruminococcus gnavus is strain-dependent. PLoS One. 2013;8(10):e76341. doi: 10.1371/journal.pone.0076341 [doi].

332. Dabard J, Bridonneau C, Phillipe C, et al. Ruminococcin A, a new lantibiotic produced by a ruminococcus gnavus strain isolated from human feces. Appl Environ Microbiol. 2001;67(9):4111-4118.

333. Mennigen R, Bruewer M. Effect of probiotics on intestinal barrier function. Ann N Y Acad Sci. 2009;1165:183-189. doi: 10.1111/j.1749-6632.2009.04059.x [doi].

217

334. Ohashi Y, Ushida K. Health-beneficial effects of probiotics: Its mode of action. Anim Sci J. 2009;80(4):361-371. doi: 10.1111/j.1740-0929.2009.00645.x [doi].

335. Miyamoto J, Kasubuchi M, Nakajima A, Irie J, Itoh H, Kimura I. The role of short- chain fatty acid on blood pressure regulation. Curr Opin Nephrol Hypertens. 2016;25(5):379-383. doi: 10.1097/MNH.0000000000000246 [doi].

336. Yajima T. Contractile effect of short-chain fatty acids on the isolated colon of the rat. J Physiol. 1985;368:667-678.

337. Choi CH, Chang SK. Alteration of gut microbiota and efficacy of probiotics in functional constipation. J Neurogastroenterol Motil. 2015;21(1):4-7. doi: 10.5056/jnm14142 [doi].

338. Fuglsang A, Rattray FP, Nilsson D, Nyborg NC. Lactic acid bacteria: Inhibition of angiotensin converting enzyme in vitro and in vivo. Antonie Van Leeuwenhoek. 2003;83(1):27-34.

339. Delcenserie V, Martel D, Lamoureux M, Amiot J, Boutin Y, Roy D. Immunomodulatory effects of probiotics in the intestinal tract. Curr Issues Mol Biol. 2008;10(1-2):37-54.

340. Kim YG, Ohta T, Takahashi T, et al. Probiotic lactobacillus casei activates innate immunity via NF-kappaB and p38 MAP kinase signaling pathways. Microbes Infect. 2006;8(4):994-1005. doi: S1286-4579(05)00400-4 [pii].

341. Izumo T, Izumi F, Nakagawa I, Kitagawa Y, Shibata H, Kiso Y. Influence of lactobacillus pentosus S-PT84 ingestion on the mucosal immunity of healthy and salmonella typhimurium-infected mice. Biosci Microflora. 2011;30(2):27-35. doi: 10.12938/bifidus.30.27 [doi].

342. Galdeano CM, Perdigon G. The probiotic bacterium lactobacillus casei induces activation of the gut mucosal immune system through innate immunity. Clin Vaccine Immunol. 2006;13(2):219-226. doi: 13/2/219 [pii].

343. Isolauri E, Sutas Y, Kankaanpaa P, Arvilommi H, Salminen S. Probiotics: Effects on immunity. Am J Clin Nutr. 2001;73(2 Suppl):444S-450S.

344. Kwon HK, Lee CG, So JS, et al. Generation of regulatory dendritic cells and CD4+Foxp3+ T cells by probiotics administration suppresses immune disorders. Proc Natl Acad Sci U S A. 2010;107(5):2159-2164. doi: 10.1073/pnas.0904055107 [doi].

345. Yang J, Ren F, Zhang H, Jiang L, Hao Y, Luo X. Induction of regulatory dendritic cells by lactobacillus paracasei L9 prevents allergic sensitization to bovine beta- lactoglobulin in mice. J Microbiol Biotechnol. 2015;25(10):1687-1696. doi: 10.4014/jmb.1503.03022 [doi].

218

346. Tiittanen M, Keto J, Haiko J, Matto J, Partanen J, Lahteenmaki K. Interaction with intestinal epithelial cells promotes an immunosuppressive phenotype in lactobacillus casei. PLoS One. 2013;8(11):e78420. doi: 10.1371/journal.pone.0078420 [doi].

347. Park JS, Joe I, Rhee PD, Jeong CS, Jeong G. A lactic acid bacterium isolated from kimchi ameliorates intestinal inflammation in DSS-induced colitis. J Microbiol. 2017. doi: 10.1007/s12275-017-6447-y [doi].

348. Lin WH, Wu CR, Lee HZ, et al. Induced apoptosis of Th2 lymphocytes and inhibition of airway hyperresponsiveness and inflammation by combined lactic acid bacteria treatment. Int Immunopharmacol. 2013;15(4):703-711. doi: 10.1016/j.intimp.2012.10.025 [doi].

349. Perdigon G, Vintini E, Alvarez S, Medina M, Medici M. Study of the possible mechanisms involved in the mucosal immune system activation by lactic acid bacteria. J Dairy Sci. 1999;82(6):1108-1114. doi: S0022-0302(99)75333-6 [pii].

350. Roussos A, Koursarakos P, Patsopoulos D, Gerogianni I, Philippou N. Increased prevalence of irritable bowel syndrome in patients with bronchial asthma. Respir Med. 2003;97(1):75-79.

351. Rutten EP, Lenaerts K, Buurman WA, Wouters EF. Disturbed intestinal integrity in patients with COPD: Effects of activities of daily living. Chest. 2014;145(2):245-252. doi: 10.1378/chest.13-0584 [doi].

352. Russell SL, Gold MJ, Hartmann M, et al. Early life antibiotic-driven changes in microbiota enhance susceptibility to allergic asthma. EMBO Rep. 2012;13(5):440-447. doi: 10.1038/embor.2012.32 [doi].

353. van Nimwegen FA, Penders J, Stobberingh EE, et al. Mode and place of delivery, gastrointestinal microbiota, and their influence on asthma and atopy. J Allergy Clin Immunol. 2011;128(5):948-55.e1-3. doi: 10.1016/j.jaci.2011.07.027 [doi].

354. Arrieta MC, Stiemsma LT, Dimitriu PA, et al. Early infancy microbial and metabolic alterations affect risk of childhood asthma. Sci Transl Med. 2015;7(307):307ra152. doi: 10.1126/scitranslmed.aab2271 [doi].

355. Vieira WA, Pretorius E. The impact of asthma on the gastrointestinal tract (GIT). J Asthma Allergy. 2010;3:123-130. doi: 10.2147/JAA.S10592 [doi].

356. Wu S, Jiang ZY, Sun YF, et al. Microbiota regulates the TLR7 signaling pathway against respiratory tract influenza A virus infection. Curr Microbiol. 2013;67(4):414-422. doi: 10.1007/s00284-013-0380-z [doi].

219

357. Vieira AT, Rocha VM, Tavares L, et al. Control of klebsiella pneumoniae pulmonary infection and immunomodulation by oral treatment with the commensal probiotic bifidobacterium longum 5(1A). Microbes Infect. 2016;18(3):180-189. doi: 10.1016/j.micinf.2015.10.008 [doi].

358. Kawahara T, Takahashi T, Oishi K, et al. Consecutive oral administration of bifidobacterium longum MM-2 improves the defense system against influenza virus infection by enhancing natural killer cell activity in a murine model. Microbiol Immunol. 2015;59(1):1-12. doi: 10.1111/1348-0421.12210 [doi].

359. Gauguet S, D'Ortona S, Ahnger-Pier K, et al. Intestinal microbiota of mice influences resistance to staphylococcus aureus pneumonia. Infect Immun. 2015;83(10):4003-4014. doi: 10.1128/IAI.00037-15 [doi].

360. Trompette A, Gollwitzer ES, Yadava K, et al. Gut microbiota metabolism of dietary fiber influences allergic airway disease and hematopoiesis. Nat Med. 2014;20(2):159- 166. doi: 10.1038/nm.3444 [doi].

361. Bernard H, Desseyn JL, Bartke N, et al. Dietary pectin-derived acidic oligosaccharides improve the pulmonary bacterial clearance of pseudomonas aeruginosa lung infection in mice by modulating intestinal microbiota and immunity. J Infect Dis. 2015;211(1):156-165. doi: 10.1093/infdis/jiu391 [doi].

362. Kishino E, Takemura N, Masaki H, Ito T, Nakazawa M. Dietary lactosucrose suppresses influenza A (H1N1) virus infection in mice. Biosci Microbiota Food Health. 2015;34(4):67-76. doi: 10.12938/bmfh.2015-005 [doi].

363. Tomoda K, Kubo K, Dairiki K, et al. Whey peptide-based enteral diet attenuated elastase-induced emphysema with increase in short chain fatty acids in mice. BMC Pulm Med. 2015;15:64-015-0059-2. doi: 10.1186/s12890-015-0059-2 [doi].

364. Bassis CM, Erb-Downward JR, Dickson RP, et al. Analysis of the upper respiratory tract microbiotas as the source of the lung and gastric microbiotas in healthy individuals. MBio. 2015;6(2):e00037-15. doi: 10.1128/mBio.00037-15 [doi].

365. Dickson RP, Singer BH, Newstead MW, et al. Enrichment of the lung microbiome with gut bacteria in sepsis and the acute respiratory distress syndrome. Nat Microbiol. 2016;1(10):16113. doi: 10.1038/nmicrobiol.2016.113 [doi].

366. Riezzo G, Orlando A, D'Attoma B, et al. Randomised clinical trial: Efficacy of lactobacillus paracasei-enriched artichokes in the treatment of patients with functional constipation--a double-blind, controlled, crossover study. Aliment Pharmacol Ther. 2012;35(4):441-450. doi: 10.1111/j.1365-2036.2011.04970.x [doi].

220

367. Wang IJ, Wang JY. Children with atopic dermatitis show clinical improvement after lactobacillus exposure. Clin Exp Allergy. 2015;45(4):779-787. doi: 10.1111/cea.12489 [doi].

368. Maruyama M, Abe R, Shimono T, Iwabuchi N, Abe F, Xiao JZ. The effects of non- viable lactobacillus on immune function in the elderly: A randomised, double-blind, placebo-controlled study. Int J Food Sci Nutr. 2016;67(1):67-73. doi: 10.3109/09637486.2015.1126564 [doi].

369. Tangney M. Gene therapy for cancer: Dairy bacteria as delivery vectors. Discov Med. 2010;10(52):195-200.

370. Kumar M, Yadav AK, Verma V, et al. Bioengineered probiotics as a new hope for health and diseases: An overview of potential and prospects. Future Microbiol. 2016;11(4):585-600. doi: 10.2217/fmb.16.4 [doi].

371. Welker DL, Hughes JE, Steele JL, Broadbent JR. High efficiency electrotransformation of lactobacillus casei. FEMS Microbiol Lett. 2015;362(2):1-6. doi: 10.1093/femsle/fnu033 [doi].

372. Shi Y, Lo CS, Padda R, et al. Angiotensin-(1-7) prevents systemic hypertension, attenuates oxidative stress and tubulointerstitial fibrosis, and normalizes renal angiotensin-converting enzyme 2 and mas receptor expression in diabetic mice. Clin Sci (Lond). 2015;128(10):649-663. doi: 10.1042/CS20140329 [doi].

373. Khajah MA, Fateel MM, Ananthalakshmi KV, Luqmani YA. Anti-inflammatory action of angiotensin 1-7 in experimental colitis. PLoS One. 2016;11(3):e0150861. doi: 10.1371/journal.pone.0150861 [doi].

374. Gembardt F, Sterner-Kock A, Imboden H, et al. Organ-specific distribution of ACE2 mRNA and correlating peptidase activity in rodents. Peptides. 2005;26(7):1270-1277. doi: S0196-9781(05)00021-5 [pii].

375. Hashimoto T, Perlot T, Rehman A, et al. ACE2 links amino acid malnutrition to microbial ecology and intestinal inflammation. Nature. 2012;487(7408):477-481. doi: 10.1038/nature11228 [doi].

221

BIOGRAPHICAL SKETCH

Colleen Cole Jeffrey was born in Erie, Pennsylvania in 1983 and grew up on a dairy farm in Cambridge Springs, Pennsylvania, along with her four younger siblings.

She attended Cambridge Springs Elementary and High School and graduated as

Valedictorian in 2001. She then attended Gannon University, where she majored in biology and secondary education. After graduating summa cum laude in 2005, Colleen was a long term substitute teacher for an eighth grade life science class at Iroquois High

School and for the junior high gifted program at Cambridge Springs and Saegertown

High Schools, as well as a daily substitute teacher in a variety of subjects for those schools. During that time, she also had an internship with the Student Conservation

Association as an outdoor recreation planner at Kofa National Wildlife Refuge in Yuma,

Arizona, where she developed a wildlife education curriculum, performed educational outreach for elementary school children, and participated in refuge projects such as tracking mountain lions, removing invasive species, and providing support to the bighorn sheep population. Colleen entered graduate school at the University of Notre

Dame in the fall of 2007, where she studied mitotic checkpoints in the laboratory of Dr.

Kevin Vaughan. While at Notre Dame, Colleen met Randy Jeffrey, and shortly after earning her Master of Science in Cellular and Molecular Biology in the spring of 2011,

Colleen and Randy were married and moved to Gainesville, FL. Colleen performed summer research for Dr. Hideko Kasahara, and then entered the Interdisciplinary

Program in Biomedical Sciences at the University of Florida. She was honored to join the lab of Dr. Mohan Raizada in the Department of Physiology and Functional

Genomics and to be able to perform translational research in the field of cardiovascular disease. She was funded for two years by a predoctoral fellowship grant from the

222

Greater Southwest Affiliate of the American Heart Association. Colleen completed her

Ph.D. dissertation in spring 2017, and will be an Assistant Professor at Lake Erie

College of Osteopathic Medicine in Erie, Pennsylvania beginning in September 2017.

Over the course of graduate school at the University of Florida, Colleen and

Randy have had three children: Amelia in 2012, Adeline in 2014, and Samuel in 2016.

Of all of the jobs Colleen has had, she most enjoys being a wife and mother.

223