The Tissue Distribution of White Spot Syndrome Virus (WSSV)
Total Page：16
File Type：pdf, Size：1020Kb
Aquaculture Sci. 57（1），91－97（2009） The Tissue Distribution of White Spot Syndrome Virus (WSSV) in Experimentally Infected Kuruma Shrimp (Marsupenaeus Japonicus) as Assessed by Quantitative Real-Time PCR 1 1 1 1 Kanako ASHIKAGA , Tomoya KONO , Kohei SONODA , Yoichi KITAO , 1 1 1, Gunimala CHAKRABORTY , Toshiaki ITAMI and Masahiro SAKAI ＊ Abstract: White spot syndrome virus (WSSV) is a highly lethal, stress dependent virus belonging to the genus Whispovirus and the family Nimaviridae. Among the various crustaceans, shrimp species are the most susceptible to WSSV infection. In the current study, a quantitative real-time PCR method was established in order to quantify the levels of WSSV in various tissues of shrimp that had been experimentally infected using the immersion bioassay. Two different concentrations of viral inoculums (high and low concentration) were used in the infection procedure. Following infection, we detected WSSV in hemolymph and other tissues including the lymphoid organ, heart, stomach and gills. Although the tissue distribution between the groups exposed to either high or low concentrations of WSSV were found to be similar, the final viral load of the tissues correlated to the concentration of WSSV used in the initial exposure. An increased viral load was confirmed in the lymphoid organ, heart, stomach and gills 10 days following infection. In contrast, an increased concentration of WSSV-DNA in hemolymph was confirmed at only 4 days post-infection. Key words: Kuruma Shrimp; WSSV; Tissue Distribution; Real-Time PCR tentatively named as the causative virus of this Introduction outbreak, however it was later re-designated as the penaeid rod-shaped DNA virus (PRDV) Shrimp farming routinely suffers great pro- (Inouye et al. 1994; 1996; Momoyama et al. duction losses following disease outbreaks 1994). WSSV is a highly virulent shrimp patho- caused by viral infection (Flegel 1997; Spann gen that leads to 100% mortality within 7－10 and Lester 1997). Outbreaks of white spot days of an outbreak (Lightner 1996). In cul- syndrome virus (WSSV), yellow head virus tured penaeid shrimps, WSSV targets various (YHV) and infectious hypodermal and hemato- tissues of both ectodermal and mesodermal ori- poietic necrosis virus (IHHNV) have resulted in gins (Inouye et al 1994; Chang et al. 1996; Lo et catastrophic losses in aquaculture world-wide. al. 1996). The virus is transmitted either verti- WSSV was first detected in South East Asia in cally from infected bloodstocks to larvae or hor- approximately 1992 and is currently the most izontally via water or infected animals (Lo et al. serious viral pathogen effecting commercial 1967). Hence, the viral load in infected shrimp shrimp production. It has been reported that tissue is one of the most important factors an acute-viral disease outbreak resulted in more underlying the progression and transmission of than 80% mortality in farmed kuruma shrimps the disease. Although a considerable amount (Penaeus japonicus) in Japan in 1993. The rod- of research has focused on WSSV over the past shaped nuclear virus of P. japonicus (Rv-PJ) was ten years, very few disease control strategies Received July 29, 2008: Accepted December 15, 2008. 1 Faculty of Agriculture, University of Miyazaki, Gakuen Kibanadai nishi 1-1, Miyazaki 889-2192, Japan. ＊Corresponding author: Tel: 81-985-58-7219; Fax: 81-985-58-7219; E-mail: [email protected] 92 K. Ashikaga, T. Kono, K. Sonoda, Y. Kitao, G. Chakraborty, T. Itami and M. Sakai are currently available. tribute to the knowledge of tissue selection for Sustainability of the shrimp industry depends white spot syndrome disease diagnosis. largely on the maintenance of shrimp health through efficient disease control. Thus, early Materials and Methods disease diagnosis is crucial for the future suc- cess of shrimp farming. A wide range of diag- Viral inoculation preparation and immersion nostic methods has been developed for the bioassay detection and diagnosis of WSSV, some of which The inoculum was synthesized from WSSV are commercially available. These methods infected shrimp head that had been homog- include histological examination (Lightner 1996; enized in 3 ml of PBS. DNA was extracted Inouye et al. 1994), gene probes for use in dot- using the DNeasy Tissue kit (Qiagen,USA) and blots, in situ hybridization (Durand et al. 1996; quantified by Q-PCR to determine viral copy Nunan and Lightner 1997) and PCR (Wang et number. The Inoculum used for the immersion al. 1996; Nunan and Lightner 1997), quantitative bioassay was categorized into high (2.064× real-time PCR (Q-PCR: Durand and Lightner 1012/4 l) and low (2.064×1010/4 l) concentra- 2002) and the loop-mediated isothermal amplifi- tions, and the shrimp experimentally infected cation method (LAMP: Kono et al. 2004). via the immersion method using the two sets DNA based detection methods including of viral concentration for a period of 2.5 h. A LAMP and PCR are useful given their high sensi- total of 40 shrimps were used for each immer- tivity, however they fail to detect single copies of sion. Throughout the experiments, shrimps a viral genome in the infected tissue. Such detec- were fed with commercial pellets and sampling tion is crucial for the successful development was undertaken at 1, 4, 10 and 14 days post- of specific pathogen-free shrimp breeding pro- infection. Hemolymph, gills, lymphoid organ, grams. Therefore, quantitative analysis of viral heart and stomach tissues were collected from copy numbers by Q-PCR may provide potential the treated shrimp (5 shrimp for each tissue) to for efficient and rapid diagnosis. Q-PCR has compare differences in WSSV load. been previously utilized for the quantification of numerous human viruses including the herpes DNA extraction simplex virus (Ryncarz et al. 1999), Epstein-Barr Various organs including heart, lymphoid virus (Kimura et al. 1999), human cytomegalovi- organ, stomach and gills were removed from the rus (Nistche et al. 1999), hepatitis B virus (Cane infected shrimp and DNA extracted using the et al. 1999) and human immunodeficiency virus DNeasy kit (Qiagen, USA). For hemolymph, (Lewin et al. 1999). DNA extraction was undertaken using the blood In the current study, we describe the genomicprep mini spin kit (GE Healthcare, UK) development of a Q-PCR method for the esti- according to the manufacturer’s instructions. mation of WSSV levels in various tissues Following extraction, the concentration of total of experimentally infected kuruma shrimp DNA in the tissue samples was estimated using (Peneaus japonicus). Among cultured peneaid a spectrophotometer. shrimps, the kuruma shrimp is the most important commercial species found in Japan Q-PCR primers and probes and Southern China. Using a known WSSV The sequence of Q-PCR primers and TaqMan inoculum, shrimps were challenged through an MGB probes (PE Applied Biosystems, USA) used immersion bioassay and the WSSV content in for the detection of WSSV were selected from different tissues at various time intervals after specific regions of the WSSV genome sequence infection determined. The aim of the present (GenBank Acc. No. AF369029). The primer pair study was to analyze the viral load in various tis- (WSSV- Fw: TGGAACAAAAGATGCTGCTCAA sues of kuruma shrimp in order to understand and WSSV-Rv: TGCGGGTCGTCGTCGAATTGT) the tissue specificity of the virus and thus, con- generated a 59 bp amplicon. The TaqMan MGB Quantiative Real-time PCR Detection in the Tissues of WSSV Infected Shrimp 93 probe (AGAATGTGGATCTTGGGC) spanned a computer, resulting in the determination of from nucleotide 212－231 of the WSSV genomic the parameter CT. The log plot of the initial sequence and was synthesized and labeled with target copy number for a set of standards (dif- the fluorescent dye 5-carboxyfluoroscein. ferent dilutions of the WSSV innocula) vs CT was determined on a straight-line plot (standard PCR conditions curve). The process of calculating CT, involved TaqMan assay was carried out using TaqMan the preparation of a standard curve and deter- Universal PCR Master Mix containing AmpliTaq mining starting copy number for samples using Gold DNA polymerase, AmpErase UNG, dNTPs GeneAmp 5700 Sequence Detection software. with dUTP and optimized buffer components A t-test was used to statistically compare the (PE Applied Biosystems, USA). A 100-ng ali- means with a defined confidence percentage of quot of DNA was added to a PCR mixture con- different WSSV virus copy number values. taining 2.25μl of each primer and 2.25μl of TaqMan MGB probe in a final volume of 25μl. Results Amplification was performed using the following program: 2 min reaction for AmpErase uracil- Specificity and sensitivity of the Q-PCR method N-glycosylase (UNG) at 50℃ and activation of A standard curve (CT) was constructed (see the AmpliTaq for 10 min at 95℃, followed by 40 Fig. 1a) in order to estimate the actual number cycles of 15 s at 95℃ and 1 min at 60℃. of infectious WSSV particles in shrimp tissues. To determine the sensitivity of the test, we found Data analysis that this method was able to detect dilutions The sensitivity of the Q-PCR assay was ranging from 1.0×104 to 1.0×1010 copies/ml of determined by testing genomic DNA pre- WSSV (Fig. 1b). pared from serial dilutions (1.0×104 to 1.0× 1010 copies/ml) of WSSV. The relationship Quantification of WSSV- DNA from shrimp fol- between viral DNA concentration and the time lowing high viral exposure following virus-exposure was established using With the exception of hemolymph, a rela- analysis of variance (ANOVA). The baseline tively high copy number of approximately 1.0 6 and threshold cycle (CT) were defined using ×10 copies/μg of WSSV DNA was observed Fig. 1. Sensitivity test for WSDV a. Standard curve made with three replicates of each four dilutions and the value of slope, intercept and correlation.