Comparative Biochemistry and Physiology, Part A 192 (2016) 28–37

Contents lists available at ScienceDirect

Comparative Biochemistry and Physiology, Part A

journal homepage: www.elsevier.com/locate/cbpa

Impact of different temperatures on survival and energy metabolism in the Asian citrus psyllid, Diaphorina citri Kuwayama

Ibrahim El-Shesheny a,b, Faraj Hijaz a, Ibrahim El-Hawary b,IbrahimMesbahb, Nabil Killiny a,⁎ a Entomology and Nematology Department, Citrus Research and Education Center, IFAS, University of Florida, FL, USA b Department of Plant Protection, Faculty of Agriculture, Tanta University, Tanta, Egypt article info abstract

Article history: Temperature influences the life history and metabolic parameters of insects. Asian citrus psyllid (ACP), Received 4 May 2015 Diaphorina citri is a tropical and subtropical pest. ACP invaded new regions around the world and threatened Received in revised form 5 November 2015 the citrus industry as a vector for Huanglongbing (HLB) disease. ACP is widely distributed and can survive high Accepted 16 November 2015 (up to 45 °C) and low temperatures (as low as −6 °C). The precise mechanism of temperature tolerance in Available online 18 November 2015 ACP is poorly understood. We investigated adult survival, cellular energy balance, gene expression, and nucleo- Keyword: tide and sugar-nucleotide changes under the effect of different temperature regimes (0 °C to 45 °C with 5 °C in- Diaphorina citri tervals). The optimum temperatures for survival were 20 and 25 °C. Low temperatures of 0 °C and 5 °C caused Temperature tolerance 50% mortality after 2 and 4 days respectively, while one day at high temperature (40 °C and 45 °C) caused ATP more than 95% mortality. The lowest quantity of ATP (3.69 ± 1.6 ng/insect) and the maximum ATPase enzyme Nucleotide activities (57.43 ± 7.6 μU/insect) were observed at 25 °C. Correlation between ATP quantities and ATPase activity Adenylate energy charge was negative. Gene expression of hsp 70, V-type proton ATPase catalytic subunit A and ATP synthase α subunit AMP:ATP ratio matched these results. Twenty-four nucleotides and sugar-nucleotides were quantified using HPLC in ACP adults hsp 70 maintained at low, high, and optimum temperatures. The nucleotide profiles were different among treatments. ATPase The ratios between AMP:ATP and ADP:ATP were significantly decreased and positively correlated to adults sur- vival, whereas the adenylate energy charge was increased in response to low and high temperatures. Exploring energy metabolic regulation in relation with adult survival might help in understanding the physiological basis of how ACP tolerates newly invaded regions. © 2015 Elsevier Inc. All rights reserved.

1. Introduction Asian citrus psyllid (ACP) is a phloem sap-sucking insect that be- longs to superfamily Psylloidea and family Psyllidae. Its direct damage Citrus is one of the most economically important horticulture crops occurs by nymphs and adults feeding on the phloem sap, while the indi- in the world. Citrus grows within a wide strip of about ±40° latitude rect effects arise from accumulation of honeydew which coat the leaves of the equator (Gottwald, 2010). Citrus trees are attacked by wide vari- encouraging sooty mold to grow. However the most serious threat to eties of pests and pathogens such as mites, insects, nematodes, bacteria, citrus worldwide comes from its ability to transmit CLas bacterium viruses, and viroids that can severely affect the productivity of citrus (Garnier et al., 2000; Bové, 2006). Therefore, the spread of HLB mainly trees (Tirtawidjaja et al., 1965). Recently, the citrus industry is severely depends on the distribution and population size of ACP (Halbert and declining in many countries as a result of citrus greening disease, called Manjunath, 2004). also Huanglongbing (HLB) (Gottwald, 2010). HLB is caused by a Temperature has a great impact on the development of ACP popula- phloem-limited bacterium (Jagoueix et al., 1994). Three species of the tions (Aubert, 1987). ACP is native and widely distributed in southern bacterium, Candidatus Liberibacter asiaticus (CLas), africanus (CLaf), Asia (Grafton-Cardwell et al., 2006). The discovery of ACP in many and americanus (CLam) (Sagaram et al., 2009) have been identified as other tropical and subtropical regions such as Asian countries, the the causal agents for HLB. Both CLas and CLam are transmitted by the Indian subcontinent, African mainland, Near and Middle East, Arabian Asian citrus psyllid, Diaphorina citri (Kuwayama) (Hemiptera: Peninsula, North and South America has been reported (Gottwald Psyllidae) and located in Asia and Americas (Halbert and Manjunath, et al., 2007). In the USA, ACP was first found in Palm Beach County, Flor- 2004), while CLaf is transmitted by the African psyllid, Trioza erytreae ida, in June 1998 and by 2001, it had spread to 31 counties in Florida (Del Guercio) (Triozidae) in African countries (Aubert, 1987; Halbert (Halbert et al., 2002). Since then, ACP has invaded many states included and Manjunath, 2004; Gottwald, 2010). Alabama, Arizona, California, Florida, Georgia, Hawaii, Louisiana, Mississippi, South Carolina and Texas (Mead and Fasulo, 2010). ⁎ Corresponding author. Although some of these states have freezing events during the winter, E-mail address: nabilkilliny@ufl.edu (N. Killiny). cold stress did not significantly constraint ACP invasion. The ability of

http://dx.doi.org/10.1016/j.cbpa.2015.11.013 1095-6433/© 2015 Elsevier Inc. All rights reserved. I. El-Shesheny et al. / Comparative Biochemistry and Physiology, Part A 192 (2016) 28–37 29

ACP to establish in new regions could be explained by its temperature targets for RNA interference, which might reduce adult survival and tolerance especially in low temperature environment. Additionally, temperature tolerance (e.g. AMPK RNAi reduced Drosophila lifespan, global climate changes may help the tropical and subtropical insects Stenesen et al., 2013). In the current study, we hypothesized that the to colonize temperate regions. effect of temperature on ACP survival is due to an alteration in energy In temperate regions, for overwintering, insects tolerate cold via metabolism. In addition, although high and low temperatures decreased physiological and biochemical changes (Lee, 1989). Field observations ACP survival, we hypothesize that the mechanisms of energy metabo- and controlled studies showed that ACP adults can survive sub-zero lism change are different. To examine this hypothesis, we studied the (as low as −6 °C) temperatures for several hours (Ashihara, 2004; effect of different temperature on the ACP survival, energetic nucleotide Hall et al., 2011; Hall and Hentz, 2014). However, little is known about profile, ATPase activity, and gene expression of ATPase, ATP synthase, how ACP adults survive freezing or low temperature events (Hall et al, and nucleotide diphosphate kinase (NDPK). The data presented in the 2011). On the other hand, severe freeze is lethal to ACP and can prevent current study may lead to development of genetic tools and innovative its spread to northern area (Hall et al., 2011)Therapidcoldhardening strategies for ACP management, which could consequently limit the response may function to allow insects to enhance cold-tolerance in spread of the HLB disease. response to unexpected seasonal decreases in environmental tempera- ture (Czajka and Lee, 1990). The mechanism of heat and cold tolerance in ACP is poorly under- 2. Materials and methods stood. Studying the effects of different temperature treatments on the ACP survival, energy profile, ATPase activity, and the gene expression 2.1. Insect colonies of genes implicated in energy metabolism and insect response to tem- perature stress may lead to the development of genetic tools and inno- Asian citrus psyllid (ACP) adult colonies were maintained in cages ‘ ’ vative strategies for ACP population management. Understanding the on Valencia sweet orange trees in CLas-free controlled growth rooms mechanism by which ACP tolerates temperature changes will help in set at 25 ± 2 °C temperature, 60 ± 5% RH, and a 16:8 (L:D) photoperiod controlling this vector and subsequently limit the spread of the HLB (Skelley and Hoy, 2004). Originally insects were collected in 2000 from disease. citrus groves in Polk City, Florida. The exact cause of insect mortality following a heat treatment is not clear yet (Neven, 2000). Whether the death can be caused by a single 2.2. Survival assay under different temperature degrees event (i.e. breakdown of the mitochondria, disruption of cellular mem- branes, denaturation of proteins and: or nucleic acids), or as a sequence The survivals of ACP adults were examined at ten temperatures of the overall events remains to be tested (Neven, 2000). It is also not starting from 0 °C to 45 °C with 5 °C intervals. Temperature-controlled clear whether the drop in the heat rate at temperature above 40 °C is incubators were used. For each treatment, 15 ACP adults were released a protective mechanism (energy conservation) or inability to maintain on six to eight true leaves of ‘Valencia’ sweet orange seedlings. Seedlings enough ATP supply (Neven, 2000). A recent study on the effect of heat were covered with plastic cylindrical shaped containers (15 cm diame- on (ACP) showed that adults ACP cannot survive at 50 °C for more ter and 30 cm high). This cylinder was covered with mesh screen for than few minutes (Hall and Hentz, 2014). ACP adapted to long-term ex- ventilation and its bottom opening was slipped over the soil around posure to temperature higher than 27 °C was more heat-tolerant than the seedling. Furthermore the humidity and photoperiod were adjusted those exposed to cooler temperatures (Hall and Hentz, 2014). ACP as stated above. Adults were counted daily until 100% death or up to adults exposed to 42 °C increased their transcriptional activity of their 16 days. For all temperature treatments, four replicates were performed. heat-shock gene, hsp 70 (Marutani-Hert et al., 2010). Marutani-Hert et al. (2010) indicated that hsp 70 may play a role in response of ACP to heat stress. The hsps are a family of chaperones proteins that are 2.3. ATP quantification assay induced in cells after exposure to stressful conditions including heat and toxins (Feder and Hofmann, 1999). The hsps recognize and bind ACP adults were maintained as described above under five different to other non-native (denatured, not fully synthesized, folded, assem- temperatures (5, 15, 25, 35, 40 °C). Insects were collected after 24 h and bled, or secreted in incorrect place) proteins to minimize inappropriate kept at −80 °C until ATP extraction. Twenty-four adults from each tem- interactions between them (Feder and Hofmann, 1999). perature were taken and divided into eight replicates. Each group of On the other hand, low temperature is one of the significant chal- three adults was homogenized with 150 μl of ice-cold 5% perchloric lenges facing insects in cold regions (Teets and Denlinger, 2013). Low acid for 2 min in 1 ml tube. The samples were centrifuged at temperature may result in chilling injury in insects (Dollo et al., 2010). 10,000 rpm and 4 °C for 10 min. Supernatant was filtered through Although the exact mechanism behind chilling injury is not clear yet, 10,000 molecular weight cutoff membranes (Millipore, Bedford, MA) it is believed that chilling injury results from membrane damage caused and kept at −80 °C until analysis. by phase transition (Teets and Denlinger, 2013). Chilling injuries may The ATP assay was performed using ENLITEN® ATP kit (Promega, also reduce the rates of protein synthesis, increases production of free Madison, WI). Briefly, a 10 μl aliquot of the sample was mixed with radicals, and disrupts ion homeostasis and membrane potential (Dollo 7 μl of 1 M sodium carbonate (Na2CO3) for neutralization and the et al., 2010). In addition, chilling injury may cause neuromuscular inju- volume was adjusted to 100 μl using ATP-free water. One hundred ries and excessive thermoelastic stress (Dollo et al., 2010). Dollo et al. microliter of luciferase reagent, provided with the kit, was added to (2010) hypothesized that indirect chilling injury was linked to a short- the sample in 12 × 75 mm polypropylene test tubes (Fisher Scientific, age in ATP and suggested that insect exposure alternating pulses of high Pittsburg, PA) and the intensity of the emitted light was measured temperature allows it to regenerate ATP by the activation of ATP synthe- for 10 s using an Optocomp I luminometer (MGM Instruments). The sis. Colinet (2011) rejected the above assumption because cold did not standards included the same amounts of 5% perchloric acid and 1 M result in ATP depletion in tested insects. Colinet (2011) also suggested Na2CO3 to correct possible inhibition of light output. Set of ATP standard that ATP accumulation under cold stress might result from produc- concentrations were also prepared as described above and were used tion/consumption imbalance. for the standard curve. A blank containing all the components above Exploring energy metabolic regulation and expressions of energy- except ATP was used to determine the amount of background to be related genes of ACP adults exposed to different temperature regimes, subtracted from the sample and standard relative luminescence unit might reveal the mechanism by which ACP adults survive in hot and (RLU). Eight replicates from each treatment were analyzed and each cold weather. In addition, nucleotide pathways could be potential replicate was measured in triplicate. 30 I. El-Shesheny et al. / Comparative Biochemistry and Physiology, Part A 192 (2016) 28–37

2.4. ATPase activity assay The following program was used: T0 = 20% (v/v) E2; T5 = 25%; T10 = 35% (v/v) E2; T15 = 42% (v/v) E2; T18 = 44% (v/v) E2; T38 = ACP adults were maintained as described above under five different 44% (v/v) E2; T39 = 51% (v/v) E2; T52 = 57% (v/v) E2; T53 = 78% temperature regimes (5, 15, 25, 35, 40 °C). Insects were collected after (v/v) E2; T62 = 80% (v/v) E2; T65 = 85% (v/v) E2; and T70 = 20% 24 h and kept at −80 °C for later analysis. Forty adults from each treat- (v/v) E2. The flow rate of HPLC elution was carried out at 1 ml min−1, ment were taken and divided into eight replicates of five insects each in and the column was kept at 25 °C. Nucleotides and sugar-nucleotides 1 ml tubes. Psyllids were homogenized in 100 μlofTris-buffer(TB) were detected by absorbance at 260 nm. Each biological replicate was (10 mM tris-HCL, 150 mM NaCl, pH: 7.4). Samples were centrifuged at analyzed in duplicate. Nucleotides and sugar nucleotides used to gener- 10,000 rpm and 4 °C for 5 min. The supernatant was filtered through ate the standard mix are listed in Table 1. 10,000 dalton cutoff membranes. For phosphate washing, another 100 μl of TB was added to the retentate and the sample was centrifuged. 2.7. Gene expression analysis The washing step was repeated three times. The retentate was collected by pipet and the final reaction volume (RV) was adjusted to 50 μlwith The effects of different temperatures on heat shock 70 kDa protein- TB. A 20 μl assay buffer and 10 μl of 4 mM ATP standard provided with like (hsp 70), ATP synthase α subunit mitochondrial-like (ATP synthase QuantiChromTM ATPase/GTPase Assay Kit (Bioassay Systems, Hayward, A), nucleotide diphosphate kinase (NDPK) and V-type proton ATPase CA) was added to 20 μl of the final sample (enzyme volume (EV)) in catalytic subunit A (V-ATPase-V1a) genes in ACP adults were studied. 96-well plate. For determining the amount of background phosphate, Adults were maintained in each treatment as described above. Adult which already in the sample before reaction, 20 μlofeachsamplewas samples were collected after one and five days of exposure to different mixed with 20 μl assay buffer and 10 μl water (instead of ATP). The temperatures. For each treatment, five biological replicates of three plate was incubated at room temperature for 30 min for reaction adults were collected and kept at −20 °C. RNA extraction and gene (reaction time (t)). After that, a 200 μl malachite green reagent was expression was carried out as described by El-Shesheny et al. (2013). added and the plate was incubated for 30 min to react with free phos- Briefly, TriZol reagent was used for RNA extraction. ssDNA/RNA Clean phate produced by ATPase enzyme. Synergy HT multi-mode microplate & Concentrator™ (Zymo Research) was used for Single stranded RNA reader (Winooski, VT) was used to measure the intensity of the stable purification. The expression levels were determined using SYBR dark green color at 639 nm. The standard curve was made by incubating Green I based quantitative real time polymerase chain reaction 50 μl of phosphate standard (0, 7.5, 15, 30 and 50 mM) with 200 μl (RT-PCR). Samples were run in triplicate for each biological replicate. malachite green reagent for 30 min and measured as mentioned RT-PCR primers for the selected genes are shown in Table 2.Amplifica- above. All samples and standards were run in duplicate. The concentra- tion was performed with a Fast ABI 7500 real-time PCR system (Applied tion of produced free phosphate (Pi μM) was computed from the Biosystems). We normalized gene expression to Actin as a reference standard curve. ATPase enzyme activity was calculated according gene (endogenous gene) for comparing the relative gene expression to the following formula: Enzyme activity (U/L) = ([Pi](μM) × among treatments (Tiwari et al., 2011). [RV](μl)) / ([EV] (μl) × [t](min)). Pi is the free phosphate produced from ATP and calculated from the slandered curve. One unit of activity 2.8. Statistical analysis is defined as the amount of enzyme that catalyzes the production of 1 μmol of free phosphate per minute under the assay condition. Data were analyzed using Minitab® 16.1.0 software. Survival analy- sis was carried out using Kaplan Meier method. Because no significant 2.5. Total nucleotide and sugar-nucleotide extraction for HPLC analysis differences were found within each treatment the data were pooled to- gether. P values of Log-rank were used for statistic comparison among The effect of low temperature (5 °C) and high temperature (35 °C) in the survival curves. Analysis of variance (ANOVA) was performed on comparison with optimum temperature (20 °C) on 24 nucleotide and the mean percentages of daily death rate, ATP quantity, ATPase activity, sugar-nucleotide amounts in ACP adults were studied. ACP adults were maintained at the mentioned three temperatures. Samples fi Table 1 of ACP adults were collected after one day and ve days and kept List of energetic nucleotides and sugar-nucleotides used in high-performance anion- at −80 °C until extraction. One hundred and twenty ACP adults exchange chromatography analysis. from each treatment were divided into 4 replicates of 30 insect each. Nucleotide Abbreviation Perchloric acid was used for extracting nucleotides and sugar- nucleotides as described by Tomiya et al. (2001) with some modifica- Adenosine 5′-diphosphate ADP Adenosine 5′-monophosphate AMP tions. Briefly, the thirty ACP adults were homogenized with 100 μlof Adenosine 5′-triphosphate ATP ice-cold 5% perchloric acid using Knote pestle (Fisher Scientific, Beta-nicotinamide adenine dinucleotide hydrate NAD Pittsburg, PA). The samples were neutralized with 10 μlof10Npotassi- B-nicotinamide adenine dinucleotide phosphate, oxidized form NADP um hydroxide (KOH) and kept at −20 °C for 15 min. Samples were Cytidine 5′-monophosphate CMP Cytidine-5′-triphosphate CTP centrifuged at 10,000 rpm and 4 °C for 10 min. The supernatants were ′ fi Cytidine-5 -diphosphate CDP ltered through 10,000 dalton cutoff membranes (Millipore, Bedford, Flavin adenine dinucleotide FAD MA). After adjusting the pH to 7, the samples were centrifuged again Guanosine 5′-diphosphate GDP and the supernatant was kept in −20 °C until analysis. Guanosine 5′-diphosphate-beta-L-fucose GDP-Fuc Guanosine 5′-diphosphate-D-mannose GDP-Man Guanosine 5′-monophosphate GMP 2.6. Nucleotide analysis by HPLC Guanosine 5′-triphosphate GTP Inosine-5′-diphosphate IDP High-performance anion-exchange chromatography was carried Inosine-5′-monophosphate IMP out using an Agilent 1200 Series High Performance Liquid Chromatogra- Inosine-5′-triphosphate ITP ′ phy coupled to a diode array detector (HPLC-DAD) and a CarboPac PA- Uridine 5 -diphosphate UDP Uridine 5′-diphospho-D-galactose UDP-Gal 100 column (Dionex, Sunnyvale, CA). The following solvents were used Uridine 5′-diphospho-D-glucose UDP-Glc as eluents: 1 mM sodium hydroxide (E1) and 1 M sodium acetate in Uridine 5′-diphospho-n-acetyl-D-galactosamine UDP-GalNAc 1 mM sodium hydroxide (E2). A 20 μl of the ACP extract or a standard Uridine 5′-diphospho-n-acetyl-D-glucosamine UDP-GlcNAc mixture (50 ppm each) was injected into a CarboPac PA-100 column Uridine 5′-monophosphate UMP Uridine 5′-triphosphate UTP equilibrated with a mixture (80:20, v/v) of E1 and E2 elution buffers. I. El-Shesheny et al. / Comparative Biochemistry and Physiology, Part A 192 (2016) 28–37 31

Table 2 Primers used in gene expression for the selected genes in current study.

Gene Accession# Sequence Reference

hsp 70 XM_008482897 Forward CGGTTATTACTGTCCCCGC This study Reverse TTGAATCACCCCCAACAGAT ATP synthase A XP_008482039 Forward GGTATTCGTCCCGCTATCAA This study Reverse GGCAGATCCTACACGGGATA V-ATPase-V1A XP_008470205 Forward CGAACTGGTACGAGTGGGAT This study Reverse GGATACCAGGACCAAGCTCA NDPK (awd) ABG81980.1 Forward AGAGGACTTGTGGGAAACATC El-Shesheny et al. (2013) Reverse TGACAAGACCAGGGAAGAAAG Actin XP-008468690 Forward CCCTGGACTTTGAACAGGAA Tiwari et al. (2011) Reverse CTCGTGGATACCGCAAGATT

relative gene expressions and the mean concentrations of nucleotides under all tested temperatures had reduced survival rate compared to and sugar-nucleotides. ANOVA was followed by means separation ac- 20 °C and 25 °C. Log rank was used for comparing among survival cording to the Tukey method. Correlations between ATP quantity, curves. P value of log rank between ACP survival at 25 °C and 20 °C ATPase activity and ACP adults' daily death were calculated. Principal was 0.013 while P value between 25 °C and all other treatments was component analysis (PCA) was carried out using nucleotide and b0.001. However survival between 30 °C, 15 °C, and 10 °C was not sig- sugar-nucleotide amounts quantitated by HPLC to discriminate among nificantly different. There was no significant difference on the impact treatments. of 5 and 35 °C (P = 0.24) on ACP survival. Results showed that about 50% of ACP adults were able to tolerate low temperatures 0 °C and 3. Results 5 °C for 2 and 4 days respectively whereas one day at 40 °C or 45 °C was sufficient to kill 95% and 100% of adults respectively. Regression 3.1. Temperature affects the survival of ACP analysis showed that changes in temperature either toward higher or lower than 25 °C had a significant effect on log of daily death rate The survivorship of adult ACP under a wide range of different tem- (P = 0.004 and 0.003 respectively) (Fig. 1B). Furthermore, the slope of peratures from 0 °C to 45 °C with 5 °C intervals was studied. Survival log death rate of adults exposed to warmer temperatures was higher analysis using Kaplan Meier method showed considerable survival than exposed to cooler temperatures (b = 75 × 10−3 and 41 × 10−3 differences under different temperature regimes (Fig. 1A). The opti- respectively) (Fig. 1B). mum temperature for adult survival was 25 °C. ACP adults maintained 3.2. ATP quantification using enzymatic assay

ATP quantity was determined in ACP adults maintained in low (5 °C and 15 °C) and high (35 °C and 40 °C) in comparison with the optimum temperature (25 °C) (Fig. 2A). There were highly significant differences under studied temperatures (F =35.02,P b 0.01). The lowest quantity of ATP was found with the optimum temperature (3.69 ± 1.6 ng/in- sect). No significant difference in ATP was found between 25 °C and 15 °C (4.75 ± 1.6 ng/insect). ATP quantity was increased up to 7.53 ± 2.3 ng/insect under the effect of lower temperature of 5 °C, while the quantity increased up to 10.08 ± 3.1 ng/insect when the temperature was 35 °C. Under higher temperature of 40 °C the ATP quantity was 9.35 ± 1.2 ng/insect.

3.3. Total ATPase activity

The activity of ATPases was measured in ACP adults maintained under low and high in comparison with optimum temperature (Fig. 2B). ATPase enzyme activity significantly decreased with the in- crease of temperature (F = 14.7, P b 0.01). The maximum enzyme activ- ities observed were 60.24 ± 6.3 and 57.43 ± 7.6 μU/insect at 15 °C and 25 °C respectively. High temperature negatively affected the activity of ATPases. It decreased at 35 °C and 40 °C, to 35.75 ± 13.94 and 28.77 ± 13.04, respectively. At low temperatures (5 °C), the activity was 53.67 ± 7.9. Statistical analysis indicated that Pearson correlation (r) between ATP quantities and ATPase enzyme activities was negative and significantly high (r = −0.88, P b 0.05).

3.4. Nucleotide and sugar nucleotide quantification using HPLC

Twenty-four nucleotides and sugar-nucleotides in addition to three Fig. 1. Kaplan–Meier analysis of survival of D. citri exposed to ten different temperature unknown compounds were identified and quantified in ACP adults treatments (A) and regression analysis between the different temperatures and log daily maintained at three different temperatures, 5 °C, 20 °C, and 35 °C death rate of Diaphorina citri adults (B). Log-Rank was used to compare between survival curves, overall P value b 0.001. Survival curves that are combined with same letters do not (Table 3). The chromatograms of the standard mixture of the 24 nucle- have significant differences (P N 0.05). otides and sugar-nucleotides, a representative sample and the spectra of 32 I. El-Shesheny et al. / Comparative Biochemistry and Physiology, Part A 192 (2016) 28–37

a representative nucleotide are shown in Fig. 3. Four compounds includ- ing CDP, IDP, and FAD were below the limit of detection. UDP-GlcNAc and UDP-Gal were not detected in some samples. After one day of ACP exposure to 35 °C only nine compounds, NAD, UK1, AMP, UDP-GlcNAc, GMP, IMP, and UTP, were decreased signifi- cantly; however, GDP-Fuc and ATP were increased (Table 2). CMP, UDP-GalNAc, and ITP were increased more than 50% in comparison with ACP adults maintained in 20 °C. At 5 °C, only ATP was increased while AMP, UDP-GalNAc, CTP, GMP, UTP and GTP were decreased (Table 3). NADP and UDP-Gal were decreased and UDP-Glc, GDP and ITP were increased more than 25% than at 20 °C. After five days of exposure to low and high temperatures, more compounds were changed than after one day. Twelve and sixteen com- pounds were significantly changed at high and low temperature respec- tively. At high temperature, increases in UK3, NADP, UMP, UDP, ATP, GDP-Man, UTP and ITP and decreases in NAD, UK1, AMP and IMP in comparison with the optimum temperature were found (Table 2). At low temperature, NAD, UK1, UK2, AMP, UK3, UMP, UDP-GalNAc, UDP- Glc, GMP, IMP, GDP-Fuc, GDP-Man, and GTP were decreased while only three compounds including NADP, ATP, and UTP were increased.

3.5. Temperature alters cell energy charge

Although ADP quantities appeared to be constant and no differences were found among the treatments, the ratios of AMP:ATP and ADP:ATP were affected. These ratios were significantly decreased in response to Fig. 2. Effect of different temperature treatments (after one day exposure) on Diaphorina citri ATP content (A) and total ATPase enzyme activity (B). The box represents 75% of temperature either after one or five days of exposure to low or high the data values. (*) Outlier, (–)Median,(⊕) Mean, the upper and lower whisker extends temperature in compare with optimum temperature (Fig. 4A). More- to the highest and lowest data value within the limit. Boxes with same letters do not have over, these ratios positively correlated with adult survival (r ≥ +0.8). fi N signi cant differences (P 0.05). Note: ATPase activity here refers to the amount of ATPase The adenylate energy charge (AEC) was calculated (Fig. 4B). AEC sig- enzyme (protein) found in the ACP extracts after being exposed to different temperature fi fi treatments and not to the activity of this enzyme in alive ACP. ni cantly increased after one and ve days of adults exposed to low (0.42 ± 0.04 and 0.36 ± 0.03) and high (0.37 ± 0.03 and 0.37 ±

Table 3 Quantities of nucleotides and sugar-nucleotides in Diaphorina ciri adults (ng/insect) after one and five days of exposure to different temperatures.

No. Compounds RT One day Five days

5C° 20C° 35C° P value 5 C° 20 C° 35 C° P value

1 NAD 1.75 269.52 ± 52.16ab 302.55 ± 73.58a 192.65 ± 12.77b 0.01 228.09 ± 5.27b 256.95 ± 4.43a 129.44 ± 20.18c 0.00 ⁎ ab a b c a b 2 UK1 3.47 39.00 ± 12.95 57.39 ± 17.76 28.52 ± 10.77 0.01 26.45 ± 5.25 44.23 ± 2.57 33.86 ± 3.93 0.00 3 CMP 3.53 4.72 ± 1.36a 5.73 ± 2.63a 12.42 ± 8.40a 0.04 3.57 ± 0.82a 2.81 ± 0.32a 3.38 ± 0.95a 0.23 ⁎ a a a b a ab 4 UK2 5.41 82.69 ± 22.21 93.25 ± 32.12 81.67 ± 10.01 0.66 71.88 ± 1.33 88.33 ± 6.21 79.97 ± 8.10 0.00 5 AMP 8.67 213.34 ± 33.90b 308.75 ± 24.87a 212.36 ± 25.50b 0.00 160.08 ± 5.15c 247.59 ± 16.15a 182.34 ± 2.41b 0.00 ⁎ a a a c b a 6 UK3 9.79 357.81 ± 105.69 358.54 ± 27.70 396.69 ± 37.97 0.53 329.69 ± 42.18 437.07 ± 42.31 565.74 ± 52.07 0.00 7 NADP 12.96 87.57 ± 22.64a 118.50 ± 71.59a 114.65 ± 67.67a 0.64 48.57 ± 4.71a 41.42 ± 2.41b 53.23 ± 3.76a 0.01 8 CDP 13.85 ND ND ND ND ND ND 9 UMP 17.61 14.47 ± 3.04a 18.63 ± 7.59a 23.07 ± 9.04a 0.15 3.22 ± 0.61c 6.21 ± 0.93b 8.68 ± 0.96a 0.00 10 UDP-GalNAc 20.60 7.88 ± 2.10b 13.68 ± 2.33ab 20.18 ± 8.48a 0.01 2.33 ± 0.32b 5.12 ± 1.47a 5.03 ± 1.48a 0.00 11 UDP-GlcNAc 21.70 9.25 ± 1.39c 131.62 ± 9.12a 53.75 ± 17.97b 0.00 ND ND 87.19 ± 81.54 12 ADP 23.41 66.74 ± 12.33a 68.59 ± 4.54a 84.36 ± 25.53a 0.17 42.65 ± 2.85b 45.82 ± 8.60ab 52.97 ± 8.08a 0.05 13 CTP 24.07 52.86 ± 7.71b 77.53 ± 10.62a 81.58 ± 22.07a 0.01 69.16 ± 13.83a 75.82 ± 6.32a 75.28 ± 33.19a 0.84 14 UDP-Gal 24.38 21.85 ± 10.85a 40.25 ± 17.12a 33.09 ± 10.64a 0.11 ND 55.16 ± 9.67 b 107.72 ± ±38.98 a 0.04 15 UDP-Glc 26.14 103.94 ± 83.89a 73.50 ± 18.24ab 22.64 ± 0.09b 0.04 96.14 ± 4.45b 133.14 ± 16.72a 122.97 ± 14.32a 0.00 16 GMP 28.08 38.32 ± 3.35c 62.45 ± 4.58a 47.45 ± 4.23b 0.00 32.11 ± 4.76b 51.72 ± 4.46a 49.64 ± 2.62a 0.00 17 IMP 34.57 59.03 ± 6.42a 59.15 ± 16.24a 41.64 ± 7.72b 0.02 54.16 ± 6.53b 62.60 ± 3.59a 31.71 ± 4.18c 0.00 18 UDP 43.46 258.68 ± 73.00a 223.32 ± 1.31a 246.90 ± 73.03a 0.62 421.06 ± 72.18b 403.57 ± 100.87b 631.33 ± 173.29a 0.01 19 GDP-Fuc 45.34 157.56 ± 25.46b 182.20 ± 27.12b 275.34 ± 54.23a 0.00 109.29 ± 15.78b 317.46 ± 55.94a 378.44 ± 80.04a 0.00 20 ATP 48.14 144.31 ± 18.50a 84.85 ± 2.71c 106.84 ± 3.69b 0.00 80.93 ± 13.87b 49.28 ± 8.86c 97.96 ± 10.13a 0.00 21 GDP-Man 49.80 25.98 ± 2.27a 31.26 ± 8.42a 26.39 ± 9.66a 0.45 24.82 ± 2.36c 60.12 ± 17.82b 88.28 ± 17.78a 0.01 22 UTP 56.85 162.03 ± 32.21b 262.44 ± 1.96a 105.59 ± 16.31c 0.00 109.98 ± 9.84a 72.60 ± 10.08b 115.55 ± 11.93a 0.00 23 GDP 57.55 136.89 ± 37.41a 91.73 ± 48.10a 88.41 ± 59.67a 0.22 41.23 ± 14.71a 42.48 ± 17.29a 45.60 ± 8.30a 0.84 24 IDP 59.09 ND ND ND ND ND ND 25 FAD 62.11 ND ND ND ND ND ND 26 GTP 63.03 245.06 ± 14.97b 299.75 ± 48.83a 284.13 ± 29.48ab 0.05 259.60 ± 54.00b 327.97 ± 34.07a 295.98 ± 28.39ab 0.03 27 ITP 67.02 62.78 ± 22.68a 36.97 ± 12.66a 74.42 ± 46.86a 0.15 44.04 ± 12.07b 34.64 ± 15.99b 93.42 ± 31.29a 0.00

Data in table represent means ± standard deviation. Numbers that are followed by the same letters in the same row under one and five days do not have significant differences (P b 0.05). P-value indicates the presence/absence of significant differences at a significance level of 5% when comparing compounds between temperature treatments. RT: Retention Time. ND: non detected compounds. UK: unknown compound. I. El-Shesheny et al. / Comparative Biochemistry and Physiology, Part A 192 (2016) 28–37 33

Fig. 3. High performance anion exchange chromatograms of nucleotides and sugar-nucleotides in Diaphorina citri adults exposed to 20 °C (representative sample) (A), and standard mix (B). Representative UV spectra of AMP nucleotide standard show a maximum wavelength at 260 nm (C).

0.02) in comparison with optimum temperature (0.26 ± 0.02 and 0.21 ± 0.03) (P b 0.001) respectively.

3.6. ACP-nucleotide profile reflects the surrounding temperature

Principal component analysis was performed in order to visualize the structure of data and describe ACP adults' nucleotide and sugar- nucleotide changes under different temperature conditions. The eigen- values and the percent of the variation accounted by each eigenvalue sug- gested that using two principal components was appropriate. The first two principal components after one and five days of exposure to temper- ature accounted 49.36% and 68.38% of the total variation respectively. The score plots and the factor loading plots of the first two principal compo- nents were generated (Fig. 5). PCA score plot showed that ACP adults maintained in low, high, and optimum temperature had quite different nucleotide and sugar-nucleotide profiles and could be distinguished from each other either after one or five days of exposure to these temper- atures (Fig. 5A, B). Data points from low or high temperature were clustered separately and were distinct from the control group. The PCA results (Fig. 5) also showed that ATP was higher in ACP maintained at low and high temperatures, whereas AMP was higher in ACP psyllids maintained at the optimum temperature. In addition, correlation matrix for and five days showed that ATP was negatively correlated with AMP (r ≤ 0.64; P b 0.05).

3.7. Gene expression

Fig. 4. Cellular energy balance in Diaphorina citri adults exposed to low or high tempera- tures. The ratios of AMP:ATP and ADP:ATP (A) and adenylate energy charge (B) after The expressions of hsp 70, ATP synthase subunit alpha mitochondrial- one and five days. Bars represent means ± standard deviation. like (ATP synthase α subunit), nucleotide diphosphate kinase (NDPK), 34 I. El-Shesheny et al. / Comparative Biochemistry and Physiology, Part A 192 (2016) 28–37

Fig. 5. Score plot and loading plot of principal component analysis for nucleotides and sugar-nucleotide in Diaphorina citri adults exposed to different temperatures for one day (a) and five days (b). and V-type proton ATPase catalytic subunit A (V-ATPase) were calculated able to tolerate low temperatures of 0 °C and 5 °C for several days. as relative amounts to the amount at the optimum temperature (25 °C) While at warmer temperatures of 40 °C and 45 °C, one day of exposure (Fig. 6). After one and five days, the relative amounts of hsp 70 and was sufficient to reach 95% and 100% mortality respectively. The slope of NDPK were increased gradually with the increase of temperature. The log death rate of adults exposed to warmer temperatures was higher fold changes at 35 °C were 1.5 and 2 after one day and five days respec- than that exposed to cooler temperatures (b = 75 × 10−3 and tively. ATP synthase α subunit relative expression was increased with 41 × 10−3 respectively). This finding indicates that ACP adults tolerate the increase or decrease of the temperature. An opposite observation low temperature and can survive mild freeze (≥5 °C) that lasts for few was found for V-type proton ATPase catalytic subunit A. hours. In agreement with our result, Hall et al. (2011) also showed that adults of ACP can survive after being exposed to low temperature 4. Discussion (~−6 °C) for several hours. ACP originated in tropical and subtropical regions and was first recorded in Florida in June 1998, then recently in- In the current study, we investigated the effect of different tempera- vaded many southern US states (Halbert et al., 2002; Mead and Fasulo, ture treatments on Asian citrus psyllid adult survival, gene expressions 2010). During the year, Florida State has a wide range of temperatures and nucleotide and sugar-nucleotide profile. ACP adults were able to and sometimes many freezing events (http://fawn.ifas.ufl.edu/data/ survive in a wide range of temperatures. The optimum temperature reports/). Our result showed that at least 50% of the ACP adult can for adult ACP survival was 25 °C and 20 °C. In a previous study, it survive at 0 and 5 °C for 1 day, this result indicated that ACP adults was found that the temperature of 25 °C was the most suitable for can survive during the freezes in Florida since they last for only few ACP population growth (Liu and Tsai, 2000). ACP adults seem to be hours. I. El-Shesheny et al. / Comparative Biochemistry and Physiology, Part A 192 (2016) 28–37 35

Fig. 6. Relative expression levels of hsp 70, ATP synthase A, V-ATPase,andNDPK/awd genes in Diaphorina citri adults 72 h after exposure to different temperatures for one or five days. Ct values were first normalized to the endogenous control gene Actin followed by normalization to the treatment giving the lowest gene expression using the 2−ΔΔCT method. Standard deviations were calculated based on three independent experiments, each with three technical replicates.

Here we hypothesize that ACP adults can survive after exposure to did not result from the same mechanism. The increase in ATP at high low temperatures better than high temperatures because enzyme dena- temperature was either caused by the denaturation of ATPase enzymes turation at low temperature is minimal. To investigate this hypothesis, or the suppression of ATPase gene expression. However, the negative we investigated ACP energy metabolism maintained at different correlation between the expression levels of hsp 70 and ATPase activity temperature treatments. ATP contents at different temperatures were supports the denaturation of ATPase. The expressional levels of hsp significantly affected. Although both low and high temperatures in- 70 at high temperatures were higher than those at lower temperatures, creased the ATP amounts in ACP, the observed increase in ATP amounts which indicates that protein denaturation at high temperatures was 36 I. El-Shesheny et al. / Comparative Biochemistry and Physiology, Part A 192 (2016) 28–37 higher than at low temperatures. On the other hand, our results showed can elongate Caenorhabditis elegans nematode lifespan (Apfeld et al., that the increase in ATP amounts in ACP maintained at low temperature 2004; Curtis et al., 2006). In insects, heterozygous mutations of AMP was caused by the reduction in ATPase activity (in alive psyllids) and biosynthetic enzymes extended Drosophila lifespan which depends did not result from ATPase denaturation. ATPase activity in ACP extract upon increased AMP:ATP and ADP:ATP ratios and AMPK. Also, transgen- from adults exposed to high temperature was reduced compared to ic expression of AMPK in Drosophila adult fat body or adult muscle, key that from psyllids kept at 25 °C, whereas no difference in ATPase activity metabolic tissues, extended lifespan, while silencing the AMPK by RNAi was observed between ACP extract from psyllids kept at 5 °C and those reduced lifespan (Stenesen et al., 2013). kept at 25 °C. The accumulation of ATP in ACP exposed to low and high Nucleotide-diphosphate kinase (NDPK) catalyzes the exchange of temperature could also result, at least in part, from the activation of ATP phosphate group between different nucleotide diphosphates and main- synthase. High temperature (N40 °C) may affect enzymes' confirmation tains the balance between different triphosphate nucleotide concentra- and consequently alters their activities (Neven, 2000). In agreement tions. For instance, it converts GTP produced from the Krebs cycle to ATP with our results, Marutani-Hert et al. (2010) also showed that ACP adults (Berg et al., 2002). In fact, NDPK is also called abnormal wing disc exposed to 42 °C increased their transcriptional activity of their hsp 70. (AWD) and contributes to wing formation in insects. Silencing awd- ex The induction of hsp 70 in ACP after exposure to high temperature is an pression by RNAi in the nymphal stages results on deformed wings in indication of protein denaturation. adults of Diaphorina citri (El-Shesheny et al, 2013). Our result showed It has been shown that the activities of various mitochondrial en- that NDPK expression was increased at higher temperatures. This find- zymes were reduced during winter season (Joanisse and Storey, ing is in agreement with Jiang et al (2010) who showed that AWD might 1994a,b). Activities of citrate synthase, NAD isocitrate dehydrogenase contribute to temperature tolerance of Antheraea pernyi. and glutamate dehydrogenase in tephritid fly Eurosta solidaginis were The decrease in AMP:ATP and ADP:ATP was associated with ACP lowest between November and March (Joanisse and Storey, 1994a,b). death. The mechanism by which temperature shortens the life span of The Na+ K+-ATPase enzyme activity overwinter profile of larvae of ACP can be hypothesized as follows: First, high and low temperatures E. solidaginis was reduced in cold winter and then increased in April increase the level of ATP in the cells of ACP by denaturation and deacti- (McMullen and Storey, 2008). Freeze‐tolerant (E. solidaginis)and vation of ATPase enzyme, respectively. The increase in ATP level will freeze‐avoiding (Epiblema scudderiana) insects showed greatly reduced lead to a decrease in AMP/ATP and ADP/AMP ratios. The decrease in sarco(endo)plasmic Ca2+‐ATPase activity over the winter season and AMP:ATP and ADP:ATP ratios will lead to a decrease in AMPK activity the cold‐exposed larvae of freeze‐avoiding (E. scudderiana) showed a (Hardie, 2011). The inactivation of AMPK or the decrease in its activity

3.2‐fold increase in Km ATP (McMullen et al., 2010). ATP content of chilled will activate NDPK that uses ATP to produce other nucleotides in order aphids was almost doubled in comparison with the non-chilled aphid to maintain cellular homeostasis (Onyenwoke et al., 2012). Fail to main- after one day of chilling. (Hochachka, 1986; Knight et al., 1986). The tain cellular homeostasis and the decrease in AMPK activity will disrupt increase in ATP contents in ACP maintained at lower temperature in many aspects of cellular function including mitochondrial biogenesis this study indicated that the ATPase enzyme activity in alive ACP was and disposal, autophagy, cell polarity and cell growth and proliferation also reduced. Because low temperatures did not result in significant dam- (Hardie, 2011). In conclusion, the disturbance of the cell homeostasis age to ATPase, ATPase activity in alive psyllids that were exposed to low causes cell death and may shorten the lifespan of ACP. Psyllids exposed temperatures is expected to increase once the temperature increases. to low temperature are expected to maintain their homeostasis when In addition to the enzymatic assay, HPLC confirmed that ATP amount their environmental temperature increases. On the other hand, psyllids was increased in response to the high and low temperatures. Scaraffia that were exposed to high temperatures may not recover due to the de- and Gerez de Burgos (2000) showed that the capacity of thoracic mus- naturation of their ATPase enzyme. cles of Dipetalogaster maximus to phosphorylate glucose is higher at Because insects, in this study, were transferred from one tempera- 37 °C than 20 °C, due to the activation of hexokinase (HK) by increasing ture to another directly without any acclimation, the survival of ACP ATP. The regulatory action of temperature on HK would increase glyco- adults in their normal environment could be slightly higher than what lytic activity and stimulate ATP production. The ADP:ATP and AMP:ATP was observed in this study. In fact, previous studies showed that heat ratios are common as a measurement of cellular energy. However, and cold acclimation can increase ACP tolerance to heat and cold (Hall AMP:ATP ratio tend to change with and even greater than ADP:ATP et al., 2011; Hall and Hentz, 2014). It is also possible that the energy ratio due to the active adenylate kinases (AMPK), which catalyze metabolism under gradual change in temperature “real world” could ADP ↔ ATP and AMP (Hardie and Hawley, 2001). Therefore, the be slightly different from the results obtained in this study. AMP:ATP ratio could be used instead of, or in addition to, ADP:ATP to In conclusion, high temperature treatments were more lethal to ACP monitor cell energy. Furthermore, the activity of many metabolic en- adults than low temperature treatments. The high death rate at high zyme responses to AMP:ATP ratios as glycogen phosphorylase and 6- temperatures could result from enzyme and protein denaturation. The phosphofructo-1-kinase in muscle, which are activated by increasing reduction in ATPase activity and the increase in the expressional levels AMP:ATP, switching on two catabolic pathways (i.e., glycogenolysis of hsp 70 in extracts from ACP adults exposed to high temperatures con- and glycolysis) (Hardie, 2011). In our study, the ratios between firmed that denaturation was occurring at high temperature. On the AMP:ATP and ADP:ATP were significantly decreased when ACP exposed other hand, our results showed that enzyme denaturation was not sig- to low and high temperature and the adenylate energy charge (AEC) nificant at low temperatures because there was no significant decrease was significantly higher after one and five days compared with opti- in ATPase enzyme activity or increase in the expressional levels of hsp mum temperature. Homeostasis and the maintenance of adenosine de- 70 at high temperatures. Because enzymes' denaturation was minimal rivative levels are vital for normally processed cellular metabolism in ACP adults exposed to low temperature, their enzyme activity is (Hardie, 2003). ACP adults' survival under the effect of different temper- expected to increase once the temperature increases and they also are atures was positively correlated with AMP:ATP and ADP:ATP ratios and expected to survive. negatively with AEC. ADP and ATP are formed from AMP (Hardie, 2003). AMP is synthesized by two parallel enzymatic processes, the de novo and the salvage AMP biosynthesis pathways (Rolfes, 2006). Acknowledgments Increased AMP:ATP or ADP:ATP ratios activate AMPK (Xiao et al., 2011). Interestingly, the lifespan of some organisms was linked to cellu- This work was funded from University of Florida, IFAS, Citrus Initia- lar adenosine derivative balances. In yeast, AMP biosynthesis and tive (program #2199). We thank our lab members for the technical as- AMP:ATP and ADP:ATP ratios have impact on the longevity (Matecic sistance and the useful discussion. Ibrahim El-Shesheny was supported et al., 2010). Increased AMPK activity due to increased AMP:ATP ratio with a scholarship from the Egyptian government. I. El-Shesheny et al. / Comparative Biochemistry and Physiology, Part A 192 (2016) 28–37 37

References Jiang, D.F., Liu, Y.Q., Li, X.S., Shi, S., L., 2010. Characterization of the Antheraea pernyi abnormal wing disc gene that may contribute to its temperature tolerance. Afr. – Apfeld, J., O'Connor, G., McDonagh, T., DiStefano, P.S., Curtis, R., 2004. The AMP-activated J. Biotechnol. 9, 7372 7378. protein kinase AAK-2 links energy levels and insulin-like signals to lifespan in Joanisse, D.R., Storey, K.B., 1994a. Mitochondrial enzymes during overwintering in two – C. elegans. Genes Dev. 18, 3004–3009. species of cold-hardy gall insects. Insect Biochem. Mol. Biol. 24, 145 150. fi Ashihara, W., 2004. Survival of Asian citrus psyllid, Diaphorina citri Kuwayama adults Joanisse, D.R., Storey, K.B., 1994b. Enzyme activity pro les in an overwintering population fl under winter temperature conditions in central and south Kyushu. Jpn. J. Appl. of freeze-tolerant larvae of the gall y Eurosta solidaginis. J. Comp. Physiol. B. 164, – Entomol. Zool. 48, 207–211. 247 255. Aubert, B., 1987. Trioza erytreae Del Guercio and Diaphorina citri Kuwayana (Homoptera Knight, J.D., Bale, J.S., Franks, F., Mathias, S.F., Baust, J.G., 1986. Insect cold hardiness: – Psylloidea), the two vectors of citrus greening disease: biological aspects and possible supercooling points and prefreeze mortality. Cryo Letters 7, 194 203. – control strategies. Fruits 42, 149–162. Lee, R.E., 1989. Insect cold-hardiness: to freeze or not to freeze. Bioscience 39, 308 313. Berg, J.M., Tymoczko, J.L., Stryer, L., 2002. Biochemistry — 5th edition. WH. Liu, Y.H., Tsai, J.H., 2000. Effects of temperature on biology and life table parameters of the Bové, J.M., 2006. Huanglongbing: a destructive, newly-emerging, century-old disease of Asian citrus psyllid, Diaphorina citri Kuwayama (Homoptera: Psyllidae). Ann. Appl. – citrus. J. Plant Pathol. 88, 7–37. Biol. 137, 201 216. Colinet, H., 2011. Disruption of ATP homeostasis during chronic cold stress and recovery Marutani-Hert, M., Hunter, W.B., Hall, D.G., 2010. Gene response to stress in the Asian – in the chill susceptible beetle (Alphitobius diaperinus). Comp. Biochem. Physiol. A Mol. citrus psyllids (Hemiptera: Psyllidae). Fla. Entomol. 93, 519 525. Integr. Physiol. 160, 63–67. Matecic, M., Smith, D.L., Pan, X., Maqani, N., Bekiranov, S., Boeke, J.D., Smith, J.S., 2010. A Curtis, R., O'Connor, G., DiStefano, P.S., 2006. Aging networks in Caenorhabditis elegans: microarray-based genetic screen for yeast chronological aging factors. PLoS Genet. AMP-activated protein kinase (aak-2) links multiple aging and metabolism path- 6, e1000921. ways. Aging Cell 5, 119–126. McMullen, D.C., Storey, K.B., 2008. Mitochondria of cold hardy insects: responses to cold Czajka, M.C., Lee Jr., R.E., 1990. Rapid cold-hardening response protecting against cold and hypoxia assessed at enzymatic, mRNA and DNA levels. Insect Biochem. Mol. – shock injury in Drosophila melanogaster. J. Exp. Biol. 148, 245–254. Biol. 38, 367 373. Dollo, V.H., Yi, S.X., Lee Jr., R.E., 2010. High temperature pulses decrease indirect chilling McMullen, D.C., Ramnanan, C.J., Storey, K.B., 2010. In coldhardy insects, seasonal, temper- injury and elevate ATP levels in the flesh fly, Sarcophaga crassipalpis. Cryobiology ature, and reversible phosphorylation controls regulate sarco/endoplasmic reticulum – 60, 351–353. Ca-ATPase (SERCA). Physiol. Biochem. Zool. 83, 677 686. El-Shesheny, I., Hajeri, S., El-Hawary, I., Gowda, S., Killiny, N., 2013. Silencing abnormal Mead, F.W., Fasulo, T.R., 2010. Asian Citrus Psyllid, Diaphorina citri Kuwayama (Insecta: wing disc gene of the Asian citrus psyllid, Diaphorina citri disrupts adult wing Hemiptera: Psyllidae). Entomology and Nematology Department, Florida Cooperative development and increases nymph mortality. PLoS One 8, e65392. Extension Service, Institute of Food and Agricultural Sciences, University of Florida Feder, M.E., Hofmann, G.E., 1999. Heat-shock proteins, molecular chaperones, and the (Publication EENY-033). stress response: evolutionary and ecological physiology. Annu. Rev. Physiol. 61, Neven, L.G., 2000. Physiological responses of insects to heat. Postharvest Biol. Technol. 21, – 243–282. 103 111. Garnier, M., Jagoueix-Eveillard, S., Cornje, H.F., Le Roux, P.R., Bové, J.M., 2000. Genomic Onyenwoke, R.U., Forsberg, L.J., Liu, L., Williams, T., Alzate, O., Brenman, J.E., 2012. AMPK characterization of a Liberibacter present in an ornamental rutaceous tree, directly inhibits NDPK through a phosphoserine switch to maintain cellular homeo- – Calodendrum capense, in the Western Cape province of South Africa. Proposal of stasis. Mol. Biol. Cell 23, 381 389. ‘Candidatus Liberibacter africanus subsp. capensis’. Int. J. Syst. Evol. Microbiol. 50, Rolfes, R.J., 2006. Regulation of purine nucleotide biosynthesis: in yeast and beyond. – 2119–2125. Biochem. Soc. Trans. 34, 786 790. Gottwald, T.R., 2010. Current epidemiological understanding of citrus huanglongbing. Sagaram, U.M., DeAngelis, K.M., Trivedi, P., Andersen, G.L., Lu, S., Wang, N., 2009. Bacterial Annu. Rev. Phytopathol. 48, 119–139. diversity analysis of huanglongbing pathogen-infected citrus, using phylochiparrays Gottwald, T.R., da Graça, J.V., Bassanezi, R.B., 2007. Citrus huanglongbing: and 16s rRNA gene clone library sequencing. Appl. Environ. Microbiol. 75, – the pathogen, its epidemiology, and impact. Plant Health Prog. (http://www. 1566 1574. fi plantmanagementnetwork.org/sub/php/review/2007/huanglongbing/). Scaraf a, P.Y., Gerez de Burgos, N.M., 2000. Effects of temperature and pH on hexokinase fl Grafton-Cardwell, E.E., Godfrey, K.E., Michaels, M.E., Childers, C.C., Stansly, P.A., 2006. from the ight muscles of Dipetalogaster maximus (Hemiptera: Reduviidae). J. Med. – Asian citrus psyllid. University of California Division of Agriculture and Natural Re- Entomol. 37, 689 694. sources, Oakland (Publication 8205). Skelley, L.H., Hoy, M.A., 2004. A synchronous rearing method for the Asian citrus psyllid – Halbert, S.E., Manjunath, K.L., 2004. Asian citrus psyllids (Sternorrhyncha: Psyllidae) and and its parasitoids in quarantine. Biol. Control 29, 14 23. greening disease of citrus: a literature review and assessment of risk in Florida. Fla. Stenesen, D., Suh, J.M., Seo, J., Yu, K., Lee, K.S., Kim, J.S., Min, K.J., Graff, J.M., 2013. Dietary Entomol. 87, 330–353. adenine controls adult lifespan via adenosine nucleotide biosynthesis and AMPK, and fi – Halbert, S.E., Niblett, C.L., Manjunath, K.L., Lee, R.F., Brown, L.G., 2002. Establishment of regulates the longevity bene t of caloric restriction. Cell Metab. 17, 101 112. two new vectors of citrus pathogens in Florida. Proc. Int. Soc. Citriculture IX Congress. Teets, N.M., Denlinger, D.L., 2013. Physiological mechanisms of seasonal and rapid – ASHS Press, Alexandria, VA, pp. 1016–1017. cold-hardening in insects. Physiol. Entomol. 38, 105 116. Hall, D.G., Hentz, M.G., 2014. Asian citrus psyllid (Hemiptera: Liviidae) tolerance to heat. Tirtawidjaja, S., Hadiwidjaja, T., Lasheen, A.M., 1965. Citrus vein phloem degeneration Ann. Entomol. Soc. Am. 107, 641–649. virus, a possible cause of citrus chlorosis in Java. Proc. Am. Soc. Hortic. Sci. 86, – Hall, D.G., Wenninger, E.J., Hentz, M.G., 2011. Temperature studies with the Asian citrus 235 243. psyllid, Diaphorina citri: cold hardiness and temperature thresholds for oviposition. Tiwari, S., Gondhalekar, A.D., Mann, R.S., Scharf, M.E., Stelinski, L.L., 2011. Characterization fi J. Insect Sci. 11, 1–15. of ve CYP4 genes from Asian citrus psyllid and their expression levels in Candidatus – Hardie, D.G., 2003. Minireview: the AMP-activated protein kinase cascade: the key sensor Liberibacter asiaticus-infected and uninfected psyllids. Insect Mol. Biol. 20, 733 744. of cellular energy status. Endocrinology 144, 5179–5183. Tomiya, N., Ailor, E., Lawrence, S.M., Betenbaugh, M.J., Lee, Y.C., 2001. Determination Hardie, D.G., 2011. AMP-activated protein kinase an energy sensor that regulates all of nucleotides and sugar-nucleotides involved in protein glycosylation by high- aspects of cell function. Genes Dev. 25, 1895–1908. performance anion-exchange chromatography: sugar nucleotide contents in cultured – Hardie, D.G., Hawley, S.A., 2001. AMP-activated protein kinase: the energy charge insect cells and mammalian cells. Anal. Biochem. 293, 129 137. hypothesis revisited. Bioessays 23, 1112–1119. Xiao, B., Sanders, M.J., Underwood, E., Heath, R., Mayer, F.V., Carmena, D., Jing, C., Walker, Hochachka, P.W., 1986. Defense strategies against hypoxia and hypothermia. Science 231, P.A., Eccleston, J.F., Haire, L.F., Saiu, P., Howell, S.A., Aasland, R., Martin, S.R., Carling, D., 234–241. Gamblin, S.J., 2011. Structure of mammalian AMPK and its regulation by ADP. Nature – Jagoueix, S., Bove´, J.M., Garnier, M., 1994. The phloem-limited bacterium of greening dis- 472, 230 233. ease of citrus is a member of alpha subdivision of Proteobacteria. Int. J. Syst. Bacteriol. 44, 379–386.