Chemical Ecology of Carpophilus Beetles and Their Yeast Symbionts

Farrukh Baig

MSc (Hons.) Agriculture Entomology

Submitted in fulfillment of the requirements for the degree of

Doctor of Philosophy

School of Biology and Environmental Sciences

Science and Engineering Faculty

Queensland University of Technology

2020

Keywords

Almonds, attract and kill, Carpophilus, C. davidsoni, C. hemipterus, C. nr dimidiatus, Hanseniaspora guilliermondii, insects, integrated pest management, lure, olfaction, Pichia kluyveri, stone fruits, symbionts, Wickerhamomyces rabaulensis,

______ii Chemical ecology of Carpophilus beetles and their yeast symbionts

Abstract

Carpophilus beetles (Nitidulidae: Coleoptera) are serious pests of agricultural crops throughout the world. In Australia, Carpophilus populations in fruit orchards are managed through “attract and kill” strategies, which use an attractant odour comprised of the beetle’s aggregation pheromone together with a blend of volatiles that mimic fermenting fruits (known as the co-attractant). This thesis explores the chemical ecology underpinning the attraction of these beetles to fermenting odours, focusing on the mutualistic relationship between Carpophilus and a diversity of yeast species that occur in the beetles’ guts. The overarching aim of the thesis is to better understand the olfactory behaviour of this genus with a view to developing new and more powerful synthetic odours for attract and kill strategies.

The first experimental chapter focuses on the yeast-insect chemical ecology of two

Carpophilus species (C. davidsoni and C. hemipterus), which attack stone fruits in

Australia. Isolation and molecular identification of gut-associated yeast species in the two beetle species revealed that two yeasts, Pichia kluyveri and Hanseniaspora guilliermondii, were predominant. Attraction and oviposition bioassays in the laboratory demonstrated that both beetle species preferred fruit substrates inoculated with these yeasts over yeast-free fruit substrates, with odours from H. guilliermondii being preferred over P. kluyveri. By contrast, larval survival experiments showed that larvae performed better on fruit substrates inoculated with P. kluyveri compared to fruit substrates inoculated with H. guilliermondii, indicating the lesser-preferred yeast (by adults) was more suitable for larval development. In addition, when fed on a yeast growing on non-fruit substrate, C. davidsoni larvae were able to develop on either yeast whereas C. hemipterus larvae survived only on P. kluyveri. How these

______Chemical ecology of Carpophilus beetles and their yeast symbionts iii results may relate to behavioural and physiological adaptations in C. davidsoni for utilising fruits earlier in ripening, and resource partitioning between the two

Carpophilus species is discussed.

The second experimental chapter investigated whether volatiles emitted from P. kluyveri and H. guilliermondii could be used to improve on a commercially available co-attractant formulation that is used in attract and kill strategies for stone fruit attacking Carpophilus. Field trapping trials using live cultures of the two yeast species revealed that P. kluyveri trapped higher number of C. davidsoni compared to

H. guilliermondii. Based on GC-MS analysis of the two yeasts, the esters isoamyl acetate and 2-phenylethyl acetate from P. kluyveri (the more attractive yeast in the field) were evaluated in field trials by adding them individually or in combination to the commercial co-attractant. Trap catches of C. davidsoni were significantly increased when 2-phenylethyl acetate was added, compared to that of isoamyl acetate, or isoamyl acetate together with 2-phenylethyl acetate. The commercial co- attractant formulation (without adding yeast derived esters) with different concentrations of ethyl acetate (the only ester present in the co-attractant) were screened in two-choice bioassays in the laboratory, demonstrating no significant differences in preference by C. davidsoni adults if ethyl acetate was either removed or doubled in concentration. By contrast, field trials using the same three treatments

(standard, doubled, and zero concentration of ethyl acetate) revealed that the standard co-attractant trapped significantly higher numbers of C. davidsoni adults compared to the co-attractant without ethyl acetate or with twice the concentration.

The study demonstrated how using volatile compounds from yeasts that are ecologically associated with insect pests can result in more potent lures for use in integrated pest management strategies. The results also suggest that laboratory ______iv Chemical ecology of Carpophilus beetles and their yeast symbionts

experiments screening volatile compounds should be treated with caution when making inferences regarding attraction under field conditions.

In the third experimental chapter, protocols for gas chromatography coupled with electroantennographic detection (GC-EAD) were developed specifically for

Carpophilus beetles, enabling this technique to be used for the identification and selection of “behaviourally active” volatiles within complex odour blends.

Electrophysiological recordings were generated for C. davidsoni using GC-MS-FID-

EAD, testing at first simple blends of known kairomones or pheromones, and then more complex volatile blends produced by the yeast, P. kluyveri. Whilst clear antennal responses were obtained from pheromones, responses to kairomones required system optimisation involving a greater proportion (5-fold) of the GC effluent directed towards the antennae compared to the MS and FID detectors, and most importantly the use of dry as opposed to (commonly used) humidified air to entrain the eluting compounds towards the antennae. Successful GC-EAD recordings using odour extracts from P. kluyveri cultured on a fruit substrate suggest that this configuration could be employed for other pest Carpophilus species to enable rapid screening of fruit and microbial odours to find key volatile components.

The final experimental chapter is essentially a synthesis of all previous chapters, bringing together knowledge gained over the course of the thesis and applying it to the development of attract and kill for a newly discovered pest species of

Carpophilus beetle. Carpophilus near dimidiatus, has emerged over the last five years as a major pest of almonds, and is currently causing millions of dollars worth of damage to the almond kernels every year. There is currently no attract and kill effective against this pest, and the aim here was to develop a new co-attractant that

______Chemical ecology of Carpophilus beetles and their yeast symbionts v targets this species. Identification of C. near dimidiatus gut-associated yeasts revealed the predominant species to be Wickerhamomyces rabaulensis. In field testing of live yeast cultures, W. rabaulensis captured more beetles than traps baited with H. guilliermondii (isolated from stone fruit attacking Carpophilus species). GC-

MS analysis revealed both qualitative and quantitative differences between the odour profiles of the two yeast species. Having identified seven volatile compounds for a blend mimicking the odour of W. rabaulensis, detection by the insect antennae was confirmed for all volatiles using gas chromatography coupled with electroantennography (GC-EAD). Two-choice bioassays testing the W. rabaulensis synthetic blend against the commercially available lure used to control stone fruit attacking Carpophilus species showed that adult beetles preferred the W. rabaulensis blend. Field trials testing several formulations based on W. rabaulensis volatiles indicated that a modified version of the commercial lure containing two additional volatiles, isoamyl acetate and isobutyl acetate, was not only more attractive to C. nr. dimidiatus but caught fewer of a non-target species, C. hemipterus. The study has developed a new powerful attractant to be used as a synergistic co-attractant alongside beetle pheromones in attract and kill systems for monitoring and mass trapping C. nr. dimidiatus in almond orchards.

The outcomes and synergies of the four experimental chapters are discussed with regards to how they have advanced knowledge of Carpophilus chemical ecology, in terms of insect-microbe-plant tritrophic interactions, host selection theory, olfactory biology, and the application of this knowledge to more effective attract and kill lures.

______vi Chemical ecology of Carpophilus beetles and their yeast symbionts

Table of Contents

Keywords...... ii

Abstract ...... iii

Table of Contents ...... vii

List of Figures ...... ix

List of Tables ...... xi

Statement of Original Authorship ...... xii

Papers completed during candidature ...... xiii

Acknowledgements ...... xv

Chapter 1: General introduction ...... 18 1.1 Aims ...... 19 1.2 Literature Review ...... 21 1.3 Outline of Experimental Chapters ...... 33

Chapter 2: Yeasts influence host selection and larval fitness in two frugivorous Carpophilus beetle species ...... 37 2.1 Abstract ...... 38 2.2 Introduction ...... 38 2.3 Materials and Methods ...... 40 2.4 Results ...... 49 2.5 Discussion ...... 62

Chapter 3: Symbiotic yeasts and their volatile compounds as an attractant to improve trap catches of Carpophilus davidsoni (Coleoptera: Nitidulidae), an important pest of stone fruit orchards ...... 71 3.1 Abstract ...... 72 3.2 Introduction ...... 73 3.3 Materials and Methods ...... 74 3.4 Results ...... 79 3.4 Discussion ...... 85 3.5 Supplementary Material ...... 89

Chapter 4: Reduction of electro-physiological noise associated with effluent humidification enables first GC-EAD recordings from Carpophilus beetle ...... 91 4.1 Abstract ...... 92 4.1 Introduction ...... 93 4.2 Materials & Methods ...... 95

______Chemical ecology of Carpophilus beetles and their yeast symbionts vii

4.3 Results ...... 103 4.4 Discussion ...... 110

Chapter 5: A new lure for Carpophilus beetles attacking almonds using semiochemicals derived from a mutualistic yeast ...... 116 5.1 Abstract ...... 117 5.2 Introduction ...... 118 5.3 Materials and Methods ...... 120 5.4 Results ...... 129 5.5 Discussion ...... 136 5.6 Supplementary Material ...... 142

Chapter 6: General Discussion ...... 146

Appendices ...... 177 Appendix 1: Abstract of oral presentation relevant to this thesis that was presented in scientific conference ...... 177 Appendix 2: Adult C. hemipterus failed to discriminate between two yeast species in a two-choice static flow olfactometer ...... 178

______viii Chemical ecology of Carpophilus beetles and their yeast symbionts

List of Figures

Fig. 2.1 Carpophilus beetles collected from different ripening stages of stone fruits (RF_T = Ripe fruit on tree, ORF_T = Over-ripe fruit on tree, ORF_G = Over-ripe fruit on ground) ...... 48

Fig. 2.2 Phylogenetic relationships among type species of ascomycetous yeast genera and reference taxa determined from ML analysis using concatenated gene sequences for ITS1-ITS2 and D1/D2 regions of rRNA genes ...... 50

Fig. 2.3 Olfactory and oviposition responses of Carpophilus beetles to yeast inoculated peach agar substrate / sterile control ...... 52

Fig. 2.4 Carpophilus beetle larval development, pupal weight and survival to adulthood on yeast inoculated peach agar substrate (PAS) / sterile control ...... 55

Fig. 2.5 Carpophilus beetle larval development and survival to adulthood on yeast inoculated potato dextrose agar (PDA) / sterile control ...... 58

Fig. 2.6 Distinct odour profiles from yeasts collected by dynamic headspace sampling method ...... 59

Fig. 2.7 Distinct odour profiles from yeasts collected by SPME method and measured from gas chromatography-mass spectrometry (GC-MS) ...... 67

Fig. 3.1 Field trapping of Carpophilus beetles using different yeasts ...... 79

Fig. 3.2 Distinct odour profiles from yeasts collected by SPME method ...... 80

Fig. 3.3 Dual choice cage assays testing the influence of ethyl acetate ...... 81

Fig. 4.1 Ventral view of a live beetle (C. davidsoni) mounted in a pipette tip for electroantennography ...... 96

Fig. 4.2 EAG responses of female C. davidsoni to different chemical compounds ...... 102

Fig. 4.3 GC-EAD responses of C. davidsoni to headspace volatile compounds from commercial pheromone septa ...... 102

Fig. 4.4 GC-EAD responses (using humidified air) of C. davidsoni to headspace volatiles collected from co-attractant ...... 103

Fig. 4.5 Preferences of C. davidsoni with intact (top) or excised (bottom) antennae to the co-attractant (green) or water control (blue) in Y-tube olfactometer experiments ...... 104

______Chemical ecology of Carpophilus beetles and their yeast symbionts ix

Fig. 4.6 GC-EAD responses (using dry & humidified air) of C. davidsoni to headspace volatiles collected from the co-attractant ...... 105

Fig. 4.7 GC-EAD responses (using dry and humidified air) of C. davidsoni to headspace volatiles collected from the yeast, P. kluyveri ...... 107

Fig. 5.1 Phylogenetic relationships among type species of ascomycetous yeast genera and reference taxa determined from ML analysis using concatenated gene sequences for ITS1-ITS2 and D1/D2 regions of rRNA genes ...... 128

Fig. 5.2 Field trapping of C. nr dimidiatus in almonds using different yeasts as baits ...... 129

Fig. 5.3 Distinct odour profiles from yeasts ...... 131

Fig. 5.4 GC-EAD responses of C. nr dimidiatus to headspace volatile compounds collected from W. rabaulensis synthetic blend (WB) ...... 132

Fig. 5.5 Dual choice cage assays of C. nr dimidiatus using synthetic Carpophilus lure (CL) and synthetic blend of yeast, Wickerhamomyces rabaulensis, (WB) ...... 132

Fig. 5.6 Field trials using synthetic blends based on the yeast, Wickerhamomyces rabaulensis: (WB1x), increased concentration blend WB30x, commercial carpophilus lure (CL), and CL modified by adding yeast two Wr esters (CL+Esters) ...... 133

Supplementary Fig. 5.1 Distinct odour profiles from yeasts collected by SPME method and measured from gas chromatography-mass spectrometry (GC- MS) ...... 141

______x Chemical ecology of Carpophilus beetles and their yeast symbionts List of Tables

Table 2.1 Primers used in PCR ...... 41

Table 2.2 Composition of headspace of the three different treatments collected by dynamic headspace sampling method ...... 66

Table 2.3 Composition of the headspace of the three different treatments collected by SPME method ...... 68

Table 3.1 Wald chi-square test showing the effect treatments (Trt) across different weeks (Wk) on number of beetles trapped, and interaction between treatments and weeks is also presented (Trt × Wk) ...... 82

Table 3.2 Pairwise comparisons (Tukey test) of all formulations tested in the field ...... 82

Supplementary Table 3.1 Formulations of chemical lures used in field trials ...... 87 Supplementary Table 3.2 Composition of the headspace of the three different treatments collected by SPME method ...... 88

Table 4.1 Composition of the headspace of P. kluyveri yeast collected by dynamic headspace sampling (n = 5), and GC-EAD responses of C. davidsoni males and females ...... 108

Supplementary Table 5.1 Composition of different lures tested in field ...... 139

Supplementary Table 5.2 Composition of the headspace of the three different treatments used in attraction assays and collected by dynamic headspace sampling method ...... 140

Supplementary Table 5.3 Composition of the headspace of the three different treatments collected by SPME sampling method ...... 142

______Chemical ecology of Carpophilus beetles and their yeast symbionts xi Statement of Original Authorship

The work contained in this thesis has not been previously submitted to meet requirements for any award at this or any other higher education institution. To the best of my knowledge and belief, the thesis contains no material previously published or written by another person except where due reference is made.

Signature: QUT Verified Signature

Date: ______21/07/2020

______xii Chemical ecology of Carpophilus beetles and their yeast symbionts Papers completed during candidature

This thesis is submitted under the Queensland University of Technology rules of

“Thesis by monograph”.

At the time of final thesis submission (July 2020) these papers are:

Farrukh Baig, Kevin Farnier, Alex Piper, Robert Speight and Paul Cunningham.

2020. Yeasts influence host selection and larval fitness in two frugivorous

Carpophilus beetle species. Journal of Chemical Ecology. 1-13

(https://doi.org/10.1007/s10886-020-01167-5).

Farrukh Baig, Kevin Farnier and Paul Cunningham. 2020. Reduction of electro- physiological noise associated with effluent humidification enables first GC-EAD recordings from Carpophilus beetles. Insect Science (submitted).

Farrukh Baig, Kevin Farnier and Paul Cunningham. 2020. Symbiotic yeasts and their volatile compounds as an attractant to improve trap catches of Carpophilus davidsoni (Coleoptera: Nitidulidae): an important horticultural pest in Australia.

Journal of Economic Entomology (submitted).

Farrukh Baig, Kevin Farnier and Paul Cunningham. 2020. A new lure for

Carpophilus beetles attacking almonds using semiochemicals derived from a mutualistic yeast. Journal of Pest Science (submitted).

As senior author I was involved in designing and conducting all experiments, carried out analysis and wrote the first draft of all the papers. My co- authors assisted me in experimental designs, analysis and editing commensurate with that of normal postgraduate supervisory practice.

______Chemical ecology of Carpophilus beetles and their yeast symbionts xiii Papers are reformatted for the thesis, primarily through the use of consecutive numbering for sections and figures, and through the use of a combined reference list at the end of the thesis. Some additional illustrative figures, for example of experimental equipment and field sites, have also been included.

______xiv Chemical ecology of Carpophilus beetles and their yeast symbionts Acknowledgements

First, I thank God ‘The Most Beneficent and The Most Merciful’ for the grace and the strength that brought me through.

I express my sincere gratitude to my dear principal supervisor Paul Cunningham for his guidance, encouragement and patience in helping me to complete this project.

Thanks to him for always being there for me with all the complications that came with conducting the experiments as well as with writing. Without his kind support and guidance, completion of this project would have not been possible.

Special thanks go to Kevin Farnier, for being one of my best friends and colleague throughout this PhD journey. Although, he was not part of my official supervisory team, his contributions to this thesis were significant. This thesis would have not been possible without scientific and technical training that he provided during the last three years. I have learned a lot from his excellent guidance during these years.

Thanks to him for always taking the time whenever I needed his help. He has always judged me critically but positively. I have found him a very precise, intelligent and a true scientist.

I extend my appreciation to my associate supervisor Robert Speight for fruitful discussions as well as for his comments on manuscripts.

I would be amiss not to thank all members of Invertebrate and Weed Sciences group at Agriculture Victoria Research who had a hand in my project. Special thanks to

Danial Lai for providing assistance in the lab, helping me in setting up lab colonies of beetles and sometimes catering for my beetle demands. I am thankful to Alex

Piper for assisting me in yeast identification and culturing. Thanks to Mofakhar ______Chemical ecology of Carpophilus beetles and their yeast symbionts xv Hossain, David Madge, Blair Grossman, Caitlin Selleck, Stephen Tobin and Jessica

Henneken for their assistance in the field work. Also big thanks to Caitlin Selleck and Stephen Tobin for sorting field trap catches for me. I am also thankful to Lea

Rako and Linda Semeraro for their assistance in beetle identification.

I thank my parents for their moral support and prayers. I must appreciate the sacrifice of my wife ‘Saima’ for living as a single parent and raising our kids ‘Umer and Iman’ for the past three years. I’ve been missing all of you throughout my PhD. I do not know where I would be without her support and wisdom.

Lastly, I am grateful to Agriculture Victoria Research for providing excellent postgraduate research training environment at AgriBio, and Queensland University of Technology for providing PhD scholarship.

______xvi Chemical ecology of Carpophilus beetles and their yeast symbionts ______Chemical ecology of Carpophilus beetles and their yeast symbionts xvii

In Australia’s $10.2 billion horticultural industry, an estimated 154,148 tonnes of stone fruit and 113,516 tonnes of almonds are produced annually, with a gross value of $947.9 million in 2018 (Horticulture Innovation Australia, 2018). These high value crops are very susceptible to insect pests, which pose a severe threat to productivity and trade. Export of stone fruits is valued at $65 million, and almond exports are worth around $440 million (Horticulture Innovation Australia, 2018).

Increasing trends to reduce pesticide usage on fruits and vegetables, combined with the recent withdrawal of key insecticides that have for many years controlled insect pests in Australian horticulture, has led to a demand for sustainable, eco-friendly pest management strategies (James et al., 1993; McCallum et al., 2011). These integrated pest management (IPM) strategies represent a move away from stand-alone solutions and calendar spraying practices, and focus instead on developing a toolbox of complementary control methods that work together to reduce pest populations below levels of economic damage (Elliott et al., 1995). IPM relies implicitly on a sound knowledge of the behaviour and ecology of insect pests, and includes strategies of cultural control, biological control, accurate monitoring and forecasting of pest populations, and timely use of soft option targeted pesticides (Cook et al., 2007;

Kogan, 1998).

1.1 Aims

The overarching aim of this thesis is to better understand the chemical ecology of

Carpophilus beetles, a major pest of stone fruit and almonds, with a view to developing more effective “Attract and Kill” tools for monitoring and mass trapping these pests. Attract and Kill (A&K) is an environmentally friendly IPM strategy that uses attractants (frequently odours) to lure target pest species into killing traps (e.g. baited with insecticides, or sticky substrates). Developing more powerful and ______Chemical ecology of Carpophilus beetles and their yeast symbionts 19 targeted attractants would help in designing an A&K strategy that is not only effective but also cost competitive with pesticides (Leake, 2000). The research in this thesis focuses primarily on yeasts associated with the insect gut, studying the role of these yeasts in shaping the behavioural ecology and olfactory biology of three

Carpophilus pests in Australian orchard pests: two stone fruit pests, C. davidsoni and

C. hemipterus, and a newly discovered almond pest, which has been temporarily named C. near dimidiatus. Fruit fermentation odours, including those emitted by yeasts, have been known to be attractive to Carpophilus for some time (Miller &

Mrak, 1953; Nout & Bartelt, 1998), and form the basis of current A&K traps in stone fruit orchards (Bartelt & Hossain, 2006; Hossain et al., 2006). Further than this, however, little is known about how yeasts are associated with these beetles in nature, such as the diversity of yeast species associated with different species of

Carpophilus beetles, whether the yeasts have a mutualistic relationship with the beetles, which yeast volatile cues beetles detect and respond to, and from an applied perspective, whether new synthetic lures based on yeast odours could be developed for different Carpophilus species. A better understanding of the chemical ecology of

Carpophilus-yeast interactions could help improve the development of more effective A&K strategies to control these pests, as well as developing fundamental ecology theory on insect-microbe-plant interactions that may be important in elucidating the behavioural ecology of not only Carpophilus beetles but also of many other phytophagous insects.

The main objectives of this thesis are to:

1. Investigate the diversity of gut-associated yeasts in key pest Carpophilus

species

______20 Chemical ecology of Carpophilus beetles and their yeast symbionts

2. Explore how these yeasts influence beetle behaviour (adult olfaction) and

fitness (larval feeding and survival)

3. Develop new attractant blends based on volatile emissions of ecologically-

associated yeasts species, and evaluate trap efficacy against target

Carpophilus species in the field.

4. Develop electrophysiological odour screening (gas chromatography coupled

with electroantennography (GC-EAD)) for Carpophilus beetles.

5. Apply the knowledge gained throughout the thesis (yeast ID, behavioural

assays, electrophysiology, blend formulation, and field studies) to develop a

novel A&K lure for a Carpophilus species that poses a major threat to the

Australian almond industry.

1.2 Literature Review

1.2.1 Semiochemicals and integrated pest management

Chemical ecology is a field of interdisciplinary science that brings together biology and chemistry to focus on volatile chemical compounds used by living organisms to interact with one another. These ‘semiochemicals’ are behaviour-modifying communication chemicals, and can be categorised as pheromones (communication within species) or allelochemicals (communication between species).

Allelochemicals can further be divided into allomones (beneficial for sender), kairomones (beneficial for receiver) and synomones (beneficial for both sender and receiver) (Seybold et al., 2018).

Insects have been proven catastrophic numerous times to both agriculture and human health. Together with pathogens, insects are responsible for about one third of the losses of agricultural crops (Van Naters & Carlson, 2006). Semiochemicals have

______Chemical ecology of Carpophilus beetles and their yeast symbionts 21 been employed as tools in insect pest management for many years (Metcalf, 1994;

Smart et al., 2014), using insect pheromones and kairomones in (i) Attract and Kill

(A&K) systems for monitoring and mass trapping (Larsson & Svensson, 2009;

Witzgall et al., 2010), (ii) mating disruption, where large concentrations of insect pheromones are released to confuse one sex (usually males) and prevent mating

(Witzgall et al., 1999), (iii) repellents, which utilizes allomones that repel the insect pest (Hayes et al., 1994), and (iv) push-pull, a strategy which combines both repellent (push) and attractant (pull) cues (Cook et al., 2007). All these strategies rely on manipulating the behaviour of the target insect species, and thus a sound knowledge of the behavioural ecology, and especially olfactory biology, of the pest should underpin the development of new IPM tools based on semiochemistry.

1.2.2 Host selection and chemical ecology in herbivorous insects

Herbivorous insects and terrestrial plants represent more than half of all known species on earth (Futuyma & Agrawal, 2009; Schoonhoven et al., 2005). The intricate relationship between insects and plants has been the focus of innumerable studies, from understanding how insects have become adapted to utilising the plant species they feed on (Kariyat & Portman, 2016; Lu et al., 2016; Simpraga et al.,

2016; Wielkopolan & Obrepalska-Steplowska, 2016), to the sensory physiology and behaviours that govern host finding and host recognition (Bruce et al., 2005;

Ramaswamy, 1988; Visser, 1988) and evolutionary explanations for host choice

(Courtney et al., 1989; Jaenike, 1978). Yet, despite this wealth of research, there are still many examples where sensory physiology, behavioural ecology and evolutionary theory are unable to satisfactorily explain why insects make particular choices in the plants they prefer (Milet-Pinheiro et al., 2016; Sedivy et al., 2008).

______22 Chemical ecology of Carpophilus beetles and their yeast symbionts

In order to find suitable host plants, herbivorous insects rely on sensory information from their environment. Plant odours are unique signatures that identify plants to insect species, and an olfactory system that can recognise these odours against a complex odour background is highly desirable in the natural environment. Plant odours are made up of ratio-specific blends of volatile organic compounds (VOCs), produced as a result of secondary metabolism (Bruce et al., 2005; Schnee et al.,

2006; Simpraga et al., 2016). The insect olfactory system exhibits high sensitivity and specificity for certain volatiles, and insects are able to recognise and respond to pertinent host odour cues (host finding) with brief exposure and against high background noise, even from a considerable distance (Judd & Borden, 1989;

Knudsen et al., 2008; Schroeder & Hilker, 2008). Volatile cues are detected by odorant receptors (ORs), a divergent protein family expressed in olfactory receptor neuron (ORNs) inside sensilla on the antenna (Hallem & Carlson, 2006). ORNs send information to specific glomeruli in the primary processing centre of the insect brain, the antennal lobe (AL), where chemical information is translated into spatial patterns of excitation (Lei & Vickers, 2008). These patterns then relay information to the higher centres of the insect brain (mushroom bodies and lateral horn) via projection neurons (PN), and a behavioural response is elicited. Visual cues also play an important role in host finding in insect herbivores (Hausmann et al., 2004; Tanton,

1977), but are not covered in this review.

After alighting on a host plant, further information on host suitability can be obtained through non-volatile or low volatility chemical signals through contact or gustatory cues (Chapman & Sword, 1993; Mitchell, 1994). Insects perform characteristic post-alighting behaviours such as antennating, palpating, test biting and test feeding before accepting a plant as a host (Harrison, 1987). Subsequently, to

______Chemical ecology of Carpophilus beetles and their yeast symbionts 23 stimulate feeding in specialist herbivores, individual host-specific compounds can be sufficient (Larsen et al., 1992; Tallamy & Krischik, 1989), while in other species, blends of specific compounds are essential for host plant recognition (Muller &

Renwick, 2001; van Loon et al., 2002), which may be behaviourally inactive when presented individually, but display synergistic effects when presented together (Endo et al., 2004; Tamura et al., 2004).

Due to the relative immobility of larvae, particularly in early instars, oviposition behaviour and host choice of the adult female is an important determinant of offspring fitness (Auerbach & Simberloff, 1989; Faeth, 1985). Theory has, for many years, predicted that the selection of a host plant by females should be positively correlated with offspring performance, as implied by the “Mother-knows-best’ theory (Gripenberg et al., 2010) or preference-performance hypothesis (Jaenike,

1978), also termed as ‘the optimal-oviposition’ hypothesis (Thompson, 1988).

Whilst many studies have reported positive correlations between oviposition preference and larval performance (Craig et al., 1989; Gripenberg et al., 2010; Nylin

& Janz, 1993), negative linkages have also been reported (Refsnider & Janzen, 2010;

Scheirs & De Bruyn, 2002; Scheirs et al., 2000) and perhaps more may remain undocumented through biases in publishing towards positive trends. Other theories have been proposed to explain the lack of correlation between adult host choice and larval fitness. For example, the longevity of ovipositing females (and thus potential lifetime fecundity) may be increased by preferentially visiting host plants that provide adult feeding sites – this increased adult fitness may be at odds with offspring fitness (host substrate quality) in terms of recognizing an appropriate host plant for larval growth (Mayhew, 2001; Scheirs et al., 2000). Oviposition preferences may also be shaped by abiotic factors, for example the selection of

______24 Chemical ecology of Carpophilus beetles and their yeast symbionts

oviposition sites that protect developing offspring from harsh environments (Rahman et al., 2019a, 2019b). Consequently, shaping of host preference patterns may be determined by optimization of adult performance as well as offspring performance

(Mayhew, 2001). An alternative theory of ‘enemy free space’ proposes that insects benefit from laying on host plants that are not favoured by natural enemies, even when their nutritional value is inferior (Ballabeni et al., 2001; Sadek et al., 2010).

Insects may be able to create enemy free space through associations with microbes, such a yeasts: for example, in codling moth, Metschnikowia yeast not only contributes to the larval diet, but also reduces the incidence of detrimental fungal infestations in fruit (Witzgall et al., 2012). The information constraints hypothesis proposes that phytophagous insects may be confined in host plant selection because of their inability to process the amount of information from the environment (Levins

& MacArthur, 1969). If this hypothesis is borne out, then polyphagous species with large numbers of hosts might be expected to make poorer choices than species with fewer hosts (Cunningham, 2012; Egan & Funk, 2006; Janz, 2003).

1.2.3 Yeast-insect interactions and host selection

In recent years, the influence of microbial interactions in insect-plant relationships has been receiving considerable attention for its implications in understanding insect host choice. Microbes are ubiquitous, inhabiting different plant parts selected by ovipositing and feeding insects, such as flowers, fruits and leaf surfaces.

Consequently, microbes may be involved in insect-plant interactions in a variety of ways, giving rise to tritrophic associations (Jones, 1984), and insect-microbial interactions can be transient (Davis et al., 2013) or more symbiotic, where symbiotic interactions could be either pathogenic (Anke, 2011; Schueffler & Anke, 2014) or

______Chemical ecology of Carpophilus beetles and their yeast symbionts 25 mutualistic (Douglas, 2007; Hadapad et al., 2016) . Microbes such as yeasts and bacteria can be utilised by insects for feeding, development and oviposition (Becher et al., 2012; Hadapad et al., 2016; Narit & Anuchit, 2011; Witzgall et al., 2012), and insects may act as dispersal agents for these microbes (Ganter, 2006; Stamps et al.,

2012), giving rise to symbiotic associations (Gonzalez, 2014; Stefanini, 2018).

Yeasts, an important diverse class of fungi, are extensively distributed in both terrestrial and aquatic environments, and are found in a variety of niches (Kurtzman et al., 2011; Lachance, 2006). Yeast-insect interactions have been known for many years, but studies have been limited to particular ecological associations (Ganter,

2006). These interspecies associations are significant in yeast and insect evolution

(Herrera et al., 2010; Klepzig et al., 2009). In herbivorous insects, yeasts can play a vital role in host selection, and a variety of insects have been shown to use olfactory information provided by the volatile cues from yeasts (Buser et al., 2014; Davis et al., 2013; Witzgall et al., 2012).

Although yeasts emit characteristic volatiles, the biological activity of these volatiles

(and their contextual blends) in insect chemoreception differs with regard to insect species, habitat and environmental settings. In addition, individual insects in a species can vary in their responses to any volatile over time, for example depending on physiological state such as maturity and hunger (Papaj, 1986; Papaj & Rausher,

1987). Consequently, insects can elicit widely different responses to these microbial infochemicals and the role of any individual volatile, or odour, can only be defined in terms of the insect-plant system being studied. As with all semiochemicals, microbial volatiles may elicit attraction, deterrence or neutral responses. Fungal volatiles have been shown to act as insect repellents: volatile metabolites produced

______26 Chemical ecology of Carpophilus beetles and their yeast symbionts

by the ubiquitous fungus Penicillium expansum isolated from faeces and frass of pine weevil Hylobius abietis L. (Coleoptera: Curculionidae), elicit reduced host settling by conspecifics (Azeem et al., 2013). The volatile geosmine, emitted by a

Penicillium species, has been shown to be deterrent for fruit flies (Becher et al.,

2010). In domestic houseflies, Musca domestica, decreased oviposition rates have been demonstrated in response to volatiles produced by fungal species in the genera

Fusarium, Phoma, and Rhizopus, growing on chicken faeces (Lam et al., 2010). The phytopathogenic fungus, Botrytis cinerea, decreases both attraction and oviposition of grapevine moth Lobesia botrana Schiff. (Lepidoptera: Tortricidae), to healthy grapes (Tasin et al., 2012).

Studies on attraction to yeasts odours have focussed strongly on frugivorous insects, particularly where the insect feeds or lays its eggs on ripening or decomposing fruits.

Live cultures of the yeast species Metschnikowia pulcherrima, M. andauensis, M. hawaiiensis, M. lopburiensis, and Cryptococcus tephrensis attracted 93 different insect species representing 15 orders, in apple orchards (Andreadis et al., 2015). In wind tunnel bioassays, freshly peeled bananas inoculated with baker’s yeast

Saccharomyces cerevisiae lured more dried fruit beetles Carpophilus hemipterus than non-inoculated ones, though both banana substrates triggered more response than the yeast alone. GC-MS analysis of the headspace volatiles revealed a more complex volatile profile for yeast-inoculated banana than for aseptic banana and yeast only (Phelan & Lin, 1991). A synthetic odour, very close to the yeast- inoculated banana odour, prepared from a blend of ethyl acetate, acetaldehyde, 2- pentanol, and 3-methylbutanol evoked behavioural responses in these beetles (Phelan

& Lin, 1991). The yeast S. cerevisiae alone (i.e. without accompanying fruit volatiles) was found to be sufficient for attraction, oviposition and larval

______Chemical ecology of Carpophilus beetles and their yeast symbionts 27 development in the fruit fly Drosophila melanogaster (Becher et al., 2012; Witzgall et al., 2012). Chemical, behavioural and physiological experiments on the codling moth, Cydia pomonella (Tortricidae, Lepidoptera), have shown that yeast inoculated apples attracted more female moths than non-yeast apples, and similar trend was observed in their oviposition behaviour (Witzgall et al., 2012).

Yeast volatiles can play an important role in host location. The small hive beetle

(SHB), a nitidulid beetle pest of honeybee hives, has been found to be closely associated with the yeast Kodamaea ohmeri. This yeast has been isolated from both fermenting hive products and different developmental stages of SHB (Benda et al.,

2008; Leemon, 2012; Teal et al., 2007; Torto, Arbogast, et al., 2007; Torto, Boucias, et al., 2007). In field assays, yeast (Kodamaea ohmeri) based attractants have been found to be more effective than apple cider vinegar, a known SHB attractant (Nolan

IV & Hood, 2008). Similarly, the coffee bean weevil (CBW), Araecerus fasciculatus

(De Geer, 1775) (Coleoptera: Anthribidae), an important pest of stored products, is strongly attracted to fermenting yeast, Kluyveromyces lactis. GC-MS analysis determined eight volatile compounds produced by fermenting cultures that were not present in sterile malt extract media. Five of these VOCs elicited notable responses in Y-tube behavioral bioassays. Moreover, field trapping experiments revealed 2- phenylethanol and 2-phenylethyl acetate to be important for attraction of CBW

(Yang et al., 2016). Attraction to microbial volatiles, using 54 pure yeast and bacterial cultures, was examined for the sap beetle, Carpophilus humeralis, a pest of maize (Nout & Bartelt, 1998). The yeasts ranged from inactive to highly attractive, whereas no bacterial cultures attracted beetles above control levels. Yeast volatiles that have been found to be important for Carpophilus beetle attraction frequently include fermentation associated compounds (ethanol, acetaldehyde, 2-methyl-1-

______28 Chemical ecology of Carpophilus beetles and their yeast symbionts

propanol, 1-propanol, ethyl acetate, 3-methyl-1-butanol and 2-methyl-1-butanol); but also 3-hydroxy-2-butanone, which was not associated with fermentation (Nout &

Bartelt, 1998).

Yeast species can differ in the benefits they convey, and this may have driven the evolution of insect preferences for particular yeast species. For example, in D. melanogaster, naturally associated nutritive yeast species Pichia toletana and

Metchnikowia pulcherrima were found to influence life history traits: P. toletana was favoured over M. pulcherrima by the flies, and enabled not only increased survival rate and decreased developmental time but also increased resistance to the pathogenic bacterium Pseudomonas stutzeri (Meshrif et al., 2016). In another study,

Drosophila-yeast associations of five different yeast species isolated from wild

Drosophila populations, were studied. Yeast strains were found to persist in

Drosophila gut and their persistence time varied according to the type of yeast strain, which may suggest that Drosophila vectors the yeasts under natural conditions

(Coluccio et al., 2008; Hoang et al., 2015).

Two yeast species, Hansenula capsulata and Pichia pini when associated with mountain pine beetles, Dendroctonus ponderosae, have been found to produce the anti-aggregation pheromone, verbenone, by utilising cis and trans verbenol produced by female beetles (Hunt & Borden, 1990). In this way, the yeasts regulate aggregation and prevent mass attack on a single host tree. Comparable mechanisms have been observed in other bark beetles: the spruce beetle and the yeast Candida nitophila (Leufvén et al., 1984) and southern pine beetle and mycangial fungi (Brand et al., 1976). The yeast like fungus, Aureobasidium pullulan, successfully attracted two global species of eusocial hymenopterans, western yellow jacket (Vespula

______Chemical ecology of Carpophilus beetles and their yeast symbionts 29 pensylvanica Saussure) and German yellow jacket (V. germanica F.), and these both wasps superficially vectored A. pullulan (Davis et al., 2012). These fungal volatiles may direct the foraging wasps to suitable food sources.

Yeasts are thus an important component of insect life history traits, mediating insect- plant interactions and shaping the evolution of insect behaviour. Volatiles from yeasts are relatively understudied compared to volatiles from bacteria or plants, but emerging research is clearly showing these microbes can have a profound effect on insect-plant associations.

The discovery that yeast odours are attractive to particular insect pest species has led to their exploitation in integrated pest management (IPM) programs as attractants in

Attract & Kill, monitoring and mass trapping strategies. Attract & Kill relies on the use of semiochemical attractants (El-Sayed et al., 2009) to target mainly flying insects such as Diptera, Coleoptera and Lepidoptera. Eventually, a better comprehension of yeast-insect associations may lead to the development of novel and more reliable IPM strategies.

1.2.4 Chemical ecology of Carpophilus beetles

Carpophilus (Coleoptera: Nitidulidae) is an ecologically diverse genus of fruit and grain feeding beetles throughout the world (Bartelt & Hossain, 2010; Hinton, 1945;

Marini et al., 2013; Myers, 2004). In Australia, at least 12 species of Carpophilus beetles have been identified of which three, Carpophilus davidsoni Dobson,

Carpophilus mutilatus Erichson and Carpophilus hemipterus (L.) are viewed as economically important pests predominantly of stone fruits (Bartelt & Hossain,

2006; Bartelt & James, 1994; Hetherington, 2005; Hossain et al., 2006; James et al.,

1994; James et al., 1995). Carpophilus davidsoni is native to Australia, while C. ______30 Chemical ecology of Carpophilus beetles and their yeast symbionts

hemipterus is an exotic and cosmopolitan insect pest (Walker, 2007). The host range of Carpophilus is very extensive. They have been associated with fresh fruit (Bartelt

& Hossain, 2006; Hoang et al., 2015; Hossain et al., 2006; James et al., 1997), rotten fruits (Hossain & Williams, 2003) corn (Dowd, 2000) and stored products (Dobson,

1954). A fourth, newly discovered pest species in Australia, temporarily named

Carpophilus near dimidiatus (pending its complete description and final classification), has recently been identified as a serious pest of almonds. Based on morphological and molecular methods, C. nr dimidiatus is considered to be closely related to, but sufficiently distinct from, C. dimidiatus, which is an exotic pest of stored grains (Hossain, 2018).

In Australian stone fruits, Carpophilus beetles are a major issue in the states of New

South Wales, Victoria and Queensland (Hetherington, 2005). The beetles are most active during spring, with a second peak in early summer (James et al., 1995).

Summer and spring rainfalls have a significant effect on population size of the beetles (James et al., 1997). Beetle survival has been observed on left over/dumped fruits near the orchards during the winter season (Hossain & Williams, 2003).

Survival of stone fruit Carpophilus species is highest at temperature ranges between

25-30°C, with larval stages more prone to change in temperature. Adult beetles lay small, cylindrical and whitish yellow eggs that usually take 2-3 days to hatch; larval development is completed within 12-25 days inside the fruits; and pupal period lasts from 6 to 12 days in soil (James & Vogele, 2000).

Carpophilus davidsoni, C. mutilatus and C. hemipterus attack the fruits and cause direct damage by chewing and entering the fruit near the pedicel (Bartelt & James,

1994; James et al., 1994; James et al., 1995). Indirect damage also occurs as these

______Chemical ecology of Carpophilus beetles and their yeast symbionts 31 beetles vector fungal spores of brown rot (Monilinia fructicola), which leads to rapid breakdown of the fruit (Hely et al., 1982), resulting in substantial fruit losses (Bartelt

& Hossain, 2006; Hoang et al., 2015; Hossain et al., 2006; James et al., 1996).

Carpophilus hemipterus generally prefers rotting fruits, but is also found in ripening fruits as a secondary invader after C. davidsoni infestation. Carpophilus (Urophorus) humeralis, an exotic species, has been caught in pheromone and food based traps in apricot orchards in NSW (James et al., 1993; McCallum et al., 2011). While, C. dimidiatus has been collected in field traps set for stored grain pests in NSW (Barrer,

1983).

Annual losses of up to 30% of stone fruit crops, due to Carpophilus beetles, have been reported in by growers (Hossain et al., 2000). Formerly, management of

Carpophilus beetles in stone fruits has been achieved by applying broad-spectrum insecticides near fruit harvesting. These pesticides were primarily intended to suppress Oriental fruit moth (Grapholita molesta) populations, but pheromone based control practices are now available to control this moth, with a resultant increase in

Carpophilus populations (James et al., 1994). Male produced Carpophilus aggregation pheromones, alongside host plant related attractants (known as “co- attractants”), are used in Attract and Kill (A&K) strategies for monitoring and mass- trapping Australian Carpophilus species (Bartelt & Hossain, 2006; Bartelt &

Hossain, 2010; Bartelt & James, 1994; Hossain et al., 2006; James et al., 1994).

A&K for Carpophilus beetle management is showing promise, but more potent attractants could greatly improve the effectiveness of traps. As yeasts are highly attractant to the flying beetles (Nolan IV & Hood, 2008; Nout & Bartelt, 1998), a better understanding of the role of yeast volatiles in attracting adult insects would be a significant step in the development of new A&K technologies.

______32 Chemical ecology of Carpophilus beetles and their yeast symbionts

Far less is known about Carpophilus species that attack almonds. Carpophilus near dimidiatus is a new and emerging pest of almonds that is a particular problem at the

“hull-split” stage of development. Recent evidence suggests that attractants developed for Carpophilus species in stone fruit are not very effective for C. near dimidiatus in almond orchards (Hossain, 2018). Being an emerging pest that causes significant losses to the almond industry, there is an urgent need to develop control strategies for this pest.

This PhD thesis aims to develop an understanding of the chemical ecology of yeast- insect interactions in Carpophilus beetles, with a view to developing new attractants to monitor and control these pests across a range of orchard crops. The focus is primarily on yeast odours and their influence on the olfactory behaviour of the different Carpophilus beetle species. Research chapters explore Carpophilus-yeast interactions in terms of insect behaviour, physiology, ecology, and neuroscience; employing and developing experimental techniques in yeast collection and identification, analytical volatile chemistry, electrophysiology, synthetic odour formulation, and field studies on insect trapping.

1.3 Outline of Experimental Chapters

There are four experimental chapters in this thesis (Chapters 2-5), each prepared as manuscripts for journal publication. Chapter 2 has been published in Journal of

Chemical Ecology, whilst Chapters 3-5 cannot as yet be submitted to journals as they contain intellectual property sensitive material that is currently being reviewed pending application for patents. Each experimental chapter represents a standalone piece of work, with relevant literature cited in the introduction and a detailed discussion. A final short chapter at the end of this thesis (Chapter 6) summarises the

______Chemical ecology of Carpophilus beetles and their yeast symbionts 33 overall findings of this work, seeking to avoid undue reiteration of previous discussion.

The first experimental chapter (Chapter 2) comprises a study on yeast-insect interactions in two species of Carpophilus beetles, C. davidsoni and C. hemipterus, which are pre-harvest pests in stone fruit orchards. From an ecological perspective, these two species are of interest as they have a similar host range (fruit species) but differ in their preferences for fruit ripening stage. The aim of this chapter is to explore the diversity of gut-associated yeasts of these two Carpophilus species and how naturally occurring yeasts influence larval survival and adult olfaction. Having isolated the yeast flora from the digestive tract of the two beetles, molecular methods are employed to identify yeasts to species level. Cage assays (olfactory choice and oviposition) are used to determine adult preferences for yeasts in the laboratory, and larval performance is assessed through feeding assays using yeast cultures growing on fruit and non-fruit substrates. Standard volatile collection and analytical methods are used to elucidate the volatile basis of species-species differences in beetle-yeast interactions. The results shed light on the role of ecologically-relevant yeast species in the behavioural ecology of Carpophilus beetles, and findings are discussed in the context of resource use between the two co-existing Carpophilus species.

Having discovered that species-specific volatile cues emitted by gut-associated yeasts influence attraction in C. davidsoni and C. hemipterus, Chapter 3 aimed to look at how this knowledge could be applied to improve the “host odour” synthetic co-attractant that is being used in A&K traps for monitoring and control of

Carpophilus beetles in stone fruit orchards. The study began with a field study setting out traps baited with live cultures of different yeast species identified in

______34 Chemical ecology of Carpophilus beetles and their yeast symbionts

Chapter 2, and recording the numbers of Carpophilus beetles caught. Further volatile analysis of odours produced by yeast cultures was performed, and new synthetic blends were formulated based on the relative concentration of volatiles emitted by the yeast species that was most attractive to beetles in the field. The results revealed discrepancies between lab and field behavioural assays, providing a cautionary note as to how much reliance we should place on lab-based behavioural trials when developing new attractant blends. More importantly, a more powerful attractant was developed, which could benefit the stone fruit industry.

Chapter 4 focused on the development of gas chromatography coupled with electroantennography (GC-EAD) technique for Carpophilus beetles. GC-EAD is a well-established tool for exploring volatile detection in the insect antennae, and for shortlisting the often considerable numbers of volatiles present in odours to those which elicit sensory responses. However, the technique had not yet been designed for Carpophilus beetles, and early pilot work revealed that this was most likely because techniques designed for other closely related insects (e.g. small hive beetle, red flour beetle) did not appear to work for Carpophilus beetles. This technical study developed new protocols for insect mounting, more robust analytical techniques like gas chromatography-mass spectrometry-flame ionization detector- electroantennography (GC-MS-FID-EAD) and uncovered an essential change in air delivery that enables antennal responses. Using this new method, electrophysiological recordings for C. davidsoni towards a range of odours are shown for the first time.

The final experimental chapter (Chapter 5) is essentially a synthesis of all previous chapters, bringing together new knowledge gained over the course of the PhD

______Chemical ecology of Carpophilus beetles and their yeast symbionts 35

(ecological theory, yeast ID, odour analysis, electrophysiology, blend formulation, lab and field assays) and applying this to a new species of Carpophilus beetle, C. near dimidiatus, for which there is an urgent need for a new A&K attractant. The study began by isolating yeast flora from the gut of adult beetles and identifying the yeasts to species level using molecular methods. Field testing of live cultures of different yeast species revealed the preferred yeast species of C. near dimidiatus.

Following volatile analysis of yeast odours, new synthetic blends were formulated based on relative concentrations of volatiles emitted by the preferred yeast species.

GC-EAD recordings were performed on selected key attractant volatile components from the synthetic blend, followed by testing of new synthetic blends in cage assays.

Field testing of prototype synthetic blends led to the successful development of a species-specific co-attractant for C. near dimidiatus.

______36 Chemical ecology of Carpophilus beetles and their yeast symbionts

2.1 Abstract

I explored how gut-associated yeasts influence olfactory behaviour and resource use in two pest species of Carpophilus beetle that co-exist in Australian stone fruits.

Molecular analysis of yeasts isolated from the gut of C. davidsoni (prefers ripe fruits) and C. hemipterus (prefers overripe and rotting fruits) revealed that the predominant species were Pichia kluyveri and Hanseniaspora guilliermondii. In olfactory attraction and oviposition trials, adult beetles preferred H. guilliermondii over P. kluyveri, and follow up GC-MS analysis revealed unambiguous differences between the odour profiles of these yeasts. In contrast to behavioural trials, larval feeding assays showed that fruit substrates inoculated with P. kluyveri yielded significantly faster development times, higher pupal mass, and a greater number of adult beetles, compared to H. guilliermondii—in other words, the lesser preferred yeast (by foraging adults) was more suitable for larvae survival. Moreover, whilst larvae of both species survived to adulthood when fed solely on P. kluyveri (i.e. without a fruit substrate), only larvae of C. davidsoni could develop on H. guilliermondii; and only

C. davidsoni reached adulthood feeding on a yeast-free fruit substrate. I discuss how these findings may relate to adaptations towards early colonising of fruits by C. davidsoni, enabling differences in resource use and potentially resource partitioning in the two beetles. More broadly, consideration of microbial interactions might help develop host selection theory. These results could pave the way to more powerful attractants to mass-trap and monitor Carpophilus pests in fruit orchards.

2.2 Introduction

Fruits offer animals a nutritional resource that changes rapidly in composition and quality as the fruit progresses through ripening to decay. Frugivorous insects feed

______38 Chemical ecology of Carpophilus beetles and their yeast symbionts

and develop on fruits at different ripening stages from underripe to rotting (Beaulieu et al., 2017; Becher et al., 2012), and foraging adults often show preferences for finding and utilising particular ripening stages (Atallah et al., 2014; Cunningham et al., 2016; Keesey et al., 2015) that may relate to host suitability for offspring development (Gripenberg et al., 2010; Thompson, 1988). Whilst microbial communities are now widely recognised as playing an important role in insect-plant interactions (Biere & Bennett, 2013; Douglas, 2013), the role of microbe interactions in shaping host preferences has had little attention.

In Australian stone fruit orchards, two polyphagous species of Carpophilus beetle,

C. davidsoni and C. hemipterus, co-exist on fruits, and can cause considerable damage through adult and larval feeding (James et al., 1997). Whilst C. davidsoni causes damage to ripening fruits (Hossain et al., 2009), C. hemipterus is a predominantly saprophagous species (Hossain & Williams, 2003). To date, the ecological and evolutionary explanations for differences in resources exploitation between these two species have not been investigated.

Beetles are known to have a close relationship with particular species of yeasts

(Stefanini, 2018), which they rely on for nutrition (Miller & Mrak, 1953), digestion

(Urbina et al., 2013) and location of food sources (Nout & Bartelt, 1998). Where the yeast provides adult beetles with food and oviposition substrates, interactions have been described as mutualistic (Hofstetter et al., 2015; Klepzig et al., 2009): the yeasts producing specific odours that serve as olfactory cues to the beetles; and, in return, the yeasts use the beetles as hosts (their guts providing a suitable internal environment for yeast survival) or as vectors for dispersal (Lachance et al., 2001;

Stefanini, 2018). In Carpophilus beetles, yeast baits and fermenting fruit odours are

______Chemical ecology of Carpophilus beetles and their yeast symbionts 39 commonly used in traps to monitor and mass trap these pests (Bartelt & Hossain,

2006; Mansfield & Hossain, 2004a), indicating that the beetles’ olfactory systems may be tuned to detect microbial odours associated with fermentation: yet surprisingly, little is known about how yeasts interact with these beetles in an ecological context. In drosophila fruit flies, by comparison, mutualistic relationships between gut-associated yeasts have been well studied (Becher et al., 2012; Quan &

Eisen, 2018), and flies show species-specific olfactory preferences for yeast species

(Scheidler et al., 2015; Starmer & Fogleman, 1986).

In this study, I aimed to explore how yeast-interactions influence host selection behaviour and resource use in the two fruit-attacking Carpophilus beetles, C. hemipterus and C. davidsoni. Focusing on beetle populations co-existing in stone fruits, my aim was to identify the predominant yeast species found within the beetle gut, determine adult insect olfactory and oviposition preferences towards different yeast species (adult preference), investigate qualitative and quantitative differences in yeast odours (as a basis for olfactory discrimination), and larval fitness developing on different yeasts (larval performance).

2.3 Materials and Methods

2.3.1 Insect Collection & Culturing

Carpophilus davidsoni and C. hemipterus were collected from a mixed stone fruit orchard at the Agriculture Victoria Research Station located in Tatura (Victoria,

Australia) in January and February, 2017. Live adult beetles were collected in sterile tubes (5 mL) from three different stages of infested fruits: ripe fruit on the tree, over- ripe fruit on the tree, and over-ripe fruit on the ground. A minimum of 15 infested fruits were chosen for each ripening stage. Potential infestation was determined by

______40 Chemical ecology of Carpophilus beetles and their yeast symbionts

the presence of a hole near the notch or stalk of the fruit, which is formed by burrowing Carpophilus. Beetles were collected directly from the fruit by gentle blowing air into the hole (to induce beetles to emerge from the infested fruit) and then immediately holding the open end of a sterile vial over the hole. Beetles were identified using a taxonomic key (Leschen & Marris, 2005).

Carpophilus beetles for culturing, were collected using commercial traps (Hossain et al., 2008) placed in a commercial peach orchard baited with a diet cup (30 mL plastic cup with 10 gm of brewer’s yeast diet). Brewer’s yeast diet (BYD) is commonly used in culture media for rearing of C. davidsoni and C. hemipterus beetles (Dowd, 1987; James & Vogele, 2000). The diet cups were collected on the following day and brought back to the laboratory for species identification. After separation, C. davidsoni and C. hemipterus colonies were maintained in an incubator

(25°C, 50-60 % RH and 15:9 light:dark photoperiod). All behavioural experiments were performed using these beetles, under similar environmental conditions.

2.3.2 Yeast Isolation, Identification & Culturing

2.3.2.1 Yeast extraction

Beetles were surface sterilized by immersing sequentially for 2-3 min in sodium hypochlorite, ethanol (95%), and 0.7% saline water. The saline water was then streaked onto potato dextrose agar (39 g/L PDA (Difco), 34 µL/mL chloramphenicol) and used as a negative control. The beetle’s abdomen was cut aseptically under a dissecting microscope, and transferred to a 1.5mL Eppendorf tube containing 25 µL saline solution (0.7%), where it was ground with a pestle made from sterile 20 µL pipette tips (Suh & Blackwell, 2004). The resultant solution was streaked onto the surface of PDA plates, and incubated at 25 °C for 3 to 7 days.

______Chemical ecology of Carpophilus beetles and their yeast symbionts 41

Re-streaking of a single yeast colony was performed until a pure single colony was obtained. Identified yeasts were stored at 4°C on individual PDA slants (Paul et al.,

2015) and at -80°C for long term storage.

2.3.2.2 DNA Extraction & PCR Amplification

DNA from the yeast was extracted using GC Prep protocol (Blount et al., 2016).

Two sets of primer pairs ITS1/ITS4 and NL1/NL4 (Table 2.1) were used to amplify internally transcribed spacer (ITS) region of rRNA genes and the D1/D2 domains of large ribosomal subunit (LSU) respectively (Kurtzman & Robnett, 1997; White et al., 1990). PCR was performed in a total reaction volume of 26 µL consisting of

Onetaq buffer 5 µL, 10mM dNTPs 0.5 µL, Onetaq 0.125 µL, and 0.5 µL of 10 µM each of the primers (ITS1/ITS4 and NL1/NL4), 2 µL of DNA template, and 17.38

µL of sterile distilled water. Amplifications were performed under the following conditions: an initial denaturing step of 10 min at 95°C, followed by 35 cycles of 30 s at 94°C, 45 s at 60°C, 60 s at 72°C and termination with a final extension step of 7 min at 72°C. PCR products were sequenced by Macrogen Inc., South Korea

(http://www.macrogen.com). Consensus sequences were edited manually using

Bioedit (Hall, 1999). Nucleotide sequences were deposited in GenBank with accession numbers MG813538- MG813547 and MG813554-MG813563. Tentative species assignments were made based on BLASTn alignments against the GenBank database (NCBI) with 99 to 100 % identity.

2.3.2.3 Phylogenetic Analysis

Isolates with identical sequences were collapsed to 9 different strains, which were then aligned with 40 taxonomically related type sequences retrieved from NCBI

Genbank database using the BLAST tool (Altschul et al., 1990). Sequence alignment ______42 Chemical ecology of Carpophilus beetles and their yeast symbionts

was performed using MUSCLE (Edgar, 2004). The evolutionary history was inferred

by using the Maximum Likelihood method based on the Kimura 2-parameter model

(Kimura, 1980). Phylogenetic analysis was performed and trees were calculated

using the MEGA7 software (Kandasamy et al., 2016; Kumar et al., 2016).

Table 2.1 Primers used in PCR

Gene Regions Primers Direction Sequence (5’-3’)

ITS1&ITS2 ITS1 Forward TCCGTAGGTGAACCTGCGG

ITS4 Reverse GCATATCAATAAGCGGAGGA

D1/D2 NL1 Forward GCATATCAATAAGCGGAGGAAAAG

NL4 Reverse GGTCCGTGTTTCAAGACGG

2.3.2.4 Yeast culturing

Yeasts were taken out from long term storage (-80°C), streaked on PDA plates, then

incubated for 48 h. A single yeast colony from culture plate was picked using 1 µL

sterile plastic inoculation loop and transferred to 15 mL falcon tube containing 2 mL

of liquid media [Sabouraud dextrose broth (SDB) prepared from 10gm/L proteose

peptone (Bacto) and 40gm/L dextrose sugar] to make high density starter cultures.

Falcon tubes (along with media only tubes as control) were placed in a shaking

incubator at 28°C for 24 h at 110 RPM. Larger volume yeast cultures of 50 mL were

started in 250 mL flasks by using 1 mL of inoculum from the starter culture. These

flasks (along with media only flasks as a control) were covered with sterile

aluminium foil and placed in the shaking incubator at 28°C for 72 h at 70 RPM: this

resulted in a high density yeast culture having an optical density (OD) of ≥ 2.9. ODs

were measured at 600 nm absorbance using three replicates, with sterile SDB as the

______Chemical ecology of Carpophilus beetles and their yeast symbionts 43 optical blank. These larger volume cultures were used in yeast volatile analysis and behavioural experiments.

2.3.3 Olfactory responses of adult C. hemipterus and C. davidsoni to different

yeast species

A three-choice trap assay was conducted to test the olfactory preferences of adult beetles to a fruit-based peach-agar substrate (PAS) inoculated with the yeasts P. kluyveri, H. guilliermondii, or sterile PAS used as a control. The PAS was prepared in an autoclave (121°C, 15 lbs pressure) using agar (15g/L) (Technical grade, Difco) and sterile pulped peach fruit (500g/L). Traps contained one of the three substrates, and consisted of 30mL plastic cups with lids into which a 20 µL pipette tip was inserted. The pipette tip was shortened by cutting 15 mm from each end, allowing beetles to enter the cup but preventing them from escaping. Twenty virgin females and males, 3-4 week old, were released into a Bugdorm cage (30 x 30 x 30 cm) containing traps with each of the three substrate treatments. Treatments were placed in a straight line in the centre of the cage, with 7 cm distance between each treatment in order to reduce beetles tendency to aggregate in the corners of the cage; a behaviour that negatively impacts their responsiveness to olfactory stimuli. The position of each treatment group (left, right, central) was rotated with each replicate

(N = 20 replicates for each beetle species).

Beetles were left undisturbed for 24 h under the same controlled environment conditions as previously described; and beetles caught in each trap were subsequently counted and sexed. The experiment was run over 2 days, using new insects in each replicate (totalling 400 males and 400 females for each species). After

______44 Chemical ecology of Carpophilus beetles and their yeast symbionts

each experiment, cages were wiped with 70% ethanol and air dried overnight before re-use.

2.3.4 Oviposition responses of adult C. hemipterus and C. davidsoni to

different yeast species

The set up for this experiment was the same as that used to examine the oviposition preferences of 3-4 week old mated females, except that the design of the traps was modified to allow beetles to freely enter and exit. This was achieved by piercing 4 equidistant holes around the sides of the cup and covering cups with a muslin cloth before sealing with a lid, such that the cloth was inside the top of the pot, but away from the substrate: beetles prefer to lay eggs in confined spaces, and readily oviposit through the muslin cloth. At the end of each 24 h experiment, the numbers of eggs were counted inside the pots (predominantly on the inside lid). The experiment was run over 2 days, using new batch of adults in each replicate. 400 females were tested for their responses in twenty replicates.

2.3.5 Larval survival and development on yeasts

I investigated the nutritional benefits of the two yeasts on each beetle species. Yeasts were grown on peach-agar substrate (PAS), thus providing beetle larvae with a fruit- yeast substrate. Treatment groups were set up as 30 mL plastic cups containing 15 mL of PAS inoculated with 500 µL of the selected yeast culture. These cups were then incubated at 25°C for 48 h prior to use in experiments. Treatment groups were

P. kluyveri, H. guilliermondi, sterile media (negative control), and brewer’s yeast diet (positive control).

______Chemical ecology of Carpophilus beetles and their yeast symbionts 45

Eggs collected from lab colonies of both beetle species were surface sterilized with

0.2 % sodium hypochlorite solution and subsequently rinsed with sterile distilled water. Next, eggs were incubated under colony rearing conditions for 24 h on sterile filter paper placed on PDA to check for microbial contamination. Due to persisting contaminations observed with C. davidsoni eggs, 1% sodium hypochlorite solution was used for surface sterilization without affecting egg hatching. Twenty newly hatched (first instar) larvae collected from PDA plates were transferred to each treatment cup. Cups were covered with sterile muslin cloth and lids perforated using an entomological pin; and then placed in controlled environment room (CER).

Larval performance on the substrate treatments was determined by: (i) developmental time to adulthood, (ii) pupal weight and (iii) survival to adulthood.

Cups were examined every 48 h and five randomly selected pupae were weighed together from each replicate (N = 15 replicates per treatment) to determine average pupal weight (only 5 pupae were used due to differences in survival of larvae in each treatment).

To investigate larval development on yeasts in the absence of fruit tissue, a second bioassay was carried out using the same design as above but using potato dextrose agar (PDA) alone as yeast culture and larval feeding substrate. Since yeast substrates were found to provide sufficient nutrition to enable larval development to adulthood in previous experiments, no positive control was included this time and, only survival to adulthood was measured (N = 15 replicates for each of the 3 treatments).

2.3.6 Yeast volatiles collection and analysis

Yeast substrate was prepared as described previously, using 30 mL plastic cups containing 15 mL of PAS streaked with yeast cultures, and incubated for 48 h at 25

______46 Chemical ecology of Carpophilus beetles and their yeast symbionts

ºC. Sterile PAS was used as a control. Volatiles were collected using dynamic headspace sampling method. Two cups from each treatment were placed in 3 L glass flasks. Air purified through a 500 mL gas wash bottle filled with activated charcoal

(8-20 mesh, Supelco, USA) was drawn into one end of the flask at 500 mL/min.

Volatiles were collected at an outlet on the opposite side of the flask using a Porapak

Q adsorbent phase (80 mesh, 100 mg, Supelco, USA) packed in a glass Pasteur pipette (4 mm inner diameter) and held in place between two silanized glass wool plugs. Collections were run for 8 hrs, after which volatiles were eluted from the

Porapak Q with 400 µL of dichloromethane (≧99.9% residue analysis, Sigma

Aldrich, Australia). For quantification purposes, 600 ng of n-octane (≧99%, purity;

Sigma Aldrich, Australia) and nonyl acetate (≧97% FCC grade, Sigma Aldrich,

Australia) used as internal standards were introduced in the sample by spiking 10 µL of a 60 ng/µL solution prepared in dichloromethane. Headspace volatile analysis was also performed by solid-phase microextraction (SPME) (DVB/CAR/PDMS, 50/30

µm fibre, Supelco) to detect early eluting compounds (covered by the solvent peak when using volatiles extracts in solvent). The needle of the SPME holder was inserted through aluminium foil covering the jar (same glass vessels as those used for dynamic headspace sampling) and the fibre exposed inside the jar for 10 min.

Sample desorption inside the gas chromatograph (GC) injector port was performed for 0.5 min in split mode (split ratio 300:1) and the fibre was reconditioned at 250°C for 10 min before reuse.

Liquid samples were analysed by GC-MS on an Agilent 7890A gas chromatograph coupled with an Agilent 5997B single quadrupole mass spectrometer equipped with a non-polar column DB-5MS (30 m × 0.25 mm × 0.25 µm). Helium was used as carrier gas. A 10 µl micro-syringe was used to manually inject 1.5 µL of each ______Chemical ecology of Carpophilus beetles and their yeast symbionts 47 sample. Injection was performed in split mode (split ratio 20:1) at 250°C. Initial oven temperature was set at 30 °C held for a minute before increasing at 10°C/min to

200°C, and then to 250°C at 20°C/min, and maintained for 2 minutes. Ionization was performed in EI mode (70 eV) and scan range was set between m/z: 35-550.

Quantification of different compounds was calculated based on the peak area of the internal standard nonyl acetate. Identification was achieved by comparing compounds mass spectra to that of a NIST14 mass spectral library, and confirmed using Kovats indices calculated on non-polar (DB-5MS) (Agilent).

2.3.7 Statistical Analysis

Data collected in insect collection from different ripening fruit stages, adult behaviour and larval development experiments failed to show a normal distribution

(Shapiro-Wilk Test, P < 0.05), therefore non-parametric Kruskal-Wallis test followed by Dunn’s posthoc test were used. Trap catches and egg counts from the two 3-choice trials were analysed using generalized linear model (GLM) with quasi-

Poisson error variance to compare the mean numbers. In the model for trap catches, the interaction between treatments and sex was not significant so sex was removed from the model. When significant effects were observed, the glht function in the multcomp package was used to perform Tukey’s HSD test for post hoc pairwise comparisons. To compare olfaction and oviposition preferences between C. davidsoni and C. hemipterus to sterile fruit substrate multiple pairwise post hoc test

(Tukey’s HSD test) was performed using the least square means in the emmeans package (Lenth, 2018). Oviposition preferences of both Carpophilus species to different treatments are presented as percentage, as this allows comparison between the two beetles independent of egg numbers which varied between the two species

______48 Chemical ecology of Carpophilus beetles and their yeast symbionts

because of higher fecundity of C. hemipterus compared to C. davidsoni.

Unresponsive individuals were not included in the analysis. All data analysis was carried out using R (V. 3.6.0) (Team, 2013).

Volatile analysis: Free statistical package PAST version 3.15 (Hammer et al., 2001) was used to analyse volatile data. Due to the large number of different compounds detected, only those volatiles were considered that found consistently and accounted for at least 1% of the chemical profile in any of the treatments. Non-metric multidimensional scaling (NMDS) based on a Bray-Curtis dissimilarity matrix was used for the ordination of quantities (variables) of shortlisted compounds.

Dissimilarities between treatments were tested using an analysis of similarity

(ANOSIM) test based on the similar type of matrix. Pairwise comparisons for the treatments were made using sequential Bonferroni corrections. Similarity percentage

(SIMPER) analysis was subsequently conducted to determine the compounds responsible for major differences in chemical profiles.

2.4 Results

2.4.1 Carpophilus species abundance and fruit development stage

Total number of beetles collected from different ripening stages of fruits (15 fruits /

2 ripening stage) were found to be significantly different (C. davidsoni:  (2) = 16.60;

2 C. hemipterus:  (2) = 28.13; P < 0.001, KW). Carpophilus davidsoni: Proportions of C. davidsoni collected from over-ripe fruits on ground (12 ± 4 %) were significantly lower than proportions of C. davidsoni collected from ripe fruits on tree

(42 ± 3 %) (P = 0.003) and over-ripe fruits on tree (46 ± 3 %) (P < 0.05).

Proportions of C. davidsoni collected from over-ripe fruits on tree were not significantly different from their proportions on ripe fruits on tree (P > 0.05) (Fig. ______Chemical ecology of Carpophilus beetles and their yeast symbionts 49

Fig. 2.1 Carpophilus beetles collected from different ripening stages of stone fruits (RF_T = Ripe fruit on tree, ORF_T = Over-ripe fruit on tree, ORF_G = Over-ripe fruit on ground). Number of infested fruits checked from each ripening stage was 15. Letters above bars indicate significant differences in number of beetle species collected from three ripening stages of fruits (P < 0.05; Dunn’s test). Results are presented in percent ± SE.

2.1). Carpophilus hemipterus: On the other hand, higher proportions of C. hemipterus were collected from over-ripe fruits on ground (96 ± 4 %) compared to the other two development stages of fruits (P < 0.05). Significantly lower proportions of C. hemipterus were collected from over-ripe fruit on tree compared to over-ripe fruit on the ground (4 ± 3 %, P < 0.05) and it was not significantly different from ripe fruit on tree (P > 0.05), where no C. hemipterus was found (Fig.

2.1).

______50 Chemical ecology of Carpophilus beetles and their yeast symbionts

2.4.2 Genetic diversity of gut-associated yeasts

In total, 39 yeasts were isolated from the two species of Carpophilus. All of the isolates were true yeasts (Ascomycota: Saccharomycetes). Phylogenetic analysis of

39 new LSU D1/D2 and ITS1-ITS2 regions of rRNA genes sequences among previously described exemplar taxa showed that yeasts often occurred in clusters, and were distributed in at least 5 clades throughout the phylogenetic tree (Fig. 2.2).

These isolates were assigned to 9 tentative species.

The most commonly isolated yeasts were from the genus Pichia, including P. kluyveri and P. kudriavzevii. The second most commonly isolated yeasts were from the genus Hanseniaspora and included H. guilliermondii, H. uvarum and H. opuntiae. Due to few nucleotide differences between species of the Hanseniaspora genus (Cadez et al., 2003), species identification for the three strains isolated from this genus is tentative. Several other ascomycetous yeast species isolated less consistently were in the genera Candida, Zygoascus and Meyerozyma. Isolates that could not be assigned to species level with high bootstrap values were assigned to genus only. Yeast species isolated from C. davidsoni and C. hemipterus were very similar. P. kluyveri was the most abundant species (28%) among all yeasts isolated, followed by H. guilliermondii (20%).

Based on their frequency in sampled Carpophilus beetles, the yeasts P. kluyveri and

H. guilliermondii were investigated further for their influence on Carpophilus larval development and adult behaviour.

2.4.3 Adult beetle responses to yeast odours

2.4.3.1 Carpophilus davidsoni

______Chemical ecology of Carpophilus beetles and their yeast symbionts 51

Olfactory response: In three-choice trap assays, beetles responded well to traps

(mean response = 71 ± 6 %). Trap catches were significantly different among treatments (F (2, 57) = 20.79, P < 0.001, GLM; Fig. 2.3a). The mean number of adults attracted to peach agar substrate inoculated with H. guilliermondii was significantly greater than that attracted to P. kluyveri inoculated substrate (Hg = 14.2 ± 0.95, Pk =

7.5 ± 0.78, P < 0.001) and sterile control (PAS = 6.5 ± 0.84, P < 0.001). There was no significant difference in attraction between peach agar substrate inoculated with

P. kluyveri and sterile control (P > 0.05).

______52 Chemical ecology of Carpophilus beetles and their yeast symbionts

Fig. 2.2 Phylogenetic relationships among type species of ascomycetous yeast genera and reference taxa determined from ML analysis using concatenated gene sequences for ITS1-ITS2 and D1/D2 regions of rRNA genes. Fellomyces penicillatus and Bullera albus were designated outgroup species. Coloured taxa names are isolates of this study. Tentative species ID is given as top match from BLASTn search. The percentage, after taxa name, is showing the abundance of yeast species. Bootstrap values > 50 are given at branch nodes (1000 replicates). The tree with the highest log likelihood (-2809.9468) is shown. A discrete Gamma distribution was used to model evolutionary rate differences among sites (4 categories (+G, parameter = 0.2134)). The analysis involved 51 nucleotide sequences. All positions containing gaps and missing data were eliminated. There was a total of 460 positions in the final dataset. Bar, 5% sequence difference.

______Chemical ecology of Carpophilus beetles and their yeast symbionts 53

Oviposition response: Mean egg numbers laid by 20 females per trial was 35.85 ±

3.95. Females oviposition preferences was significantly influenced by different inoculated treatments (F (2, 57) = 19.13, P < 0.001, GLM). Females laid significantly more eggs on H. guilliermondii–inoculated PAS than on P. kluyveri–inoculated PAS

(Hg = 36 ± 2 %, Pk = 19 ± 2 %, P < 0.05) and sterile control (PAS = 15 ± 2 %, P <

0.001). Also, significantly more eggs were laid on peach agar substrate inoculated with P. kluyveri than sterile control (P < 0.001) (Fig. 2.3b).

2.4.3.2 Carpophilus hemipterus

Olfactory response: C. hemipterus responded well to yeast odours emitted from traps

(mean response = 89 ± 16 %). Beetle responses were significantly different to odours emitted from the different treatments (F (2, 57) = 127.78, P < 0.001, GLM; see Fig.

2.3c). Mean number of adults attracted to PAS inoculated with H. guilliermondii was significantly greater than that attracted to the same substrate inoculated with P. kluyveri (Hg = 23.85 ± 1.17, Pk = 9.3 ± 0.79, P < 0.001) and the sterile control (PAS

= 4.3 ± 0.48, P < 0.001). Significant difference in attraction were also found between

PAS inoculated with P. kluyveri and sterile control (P < 0.001).

Oviposition responses: Mean eggs laid by 20 females per trial was 224.05 ± 34.38, with significant differences in laying on inoculated treatments (F (2, 57) = 110.47, P <

0.001, GLM). Females showed significant preference for ovipositing on H. guilliermondii inoculated PAS over P. kluyveri inoculated PAS (Hg = 62 ± 2 %, Pk

= 30 ± 2 %, P < 0.001) and sterile control (PAS = 8 ± 1 %, P < 0.001) (Fig. 2.3d).

______54 Chemical ecology of Carpophilus beetles and their yeast symbionts

Fig. 2.3 Olfactory and oviposition responses of Carpophilus beetles to yeast inoculated peach agar substrate / sterile control. (a) Preference of adult C. davidsoni. (b) Proportion of eggs laid by female C. davidsoni on egg laying pots. (c) Preference of adult C. hemipterus. (d) Proportion of eggs laid by female C. hemipterus on egg laying pots. Hg = Hanseniaspora guilliermondii, Pk = Pichia kluyveri, PAS = sterile control. Error bar indicates standard error of mean (SEM). Different letters indicate statistical significance at P < 0.05, Tukey HSD test, N = 20.

2.4.3.3 Comparing olfaction and oviposition response between C. davidsoni and

C. hemipterus to sterile peach agar substrate (PAS)

Olfactory and oviposition response of C. davidsoni adults was significantly higher to sterile PAS (number of adults attracted = 131/565; Eggs laid = 15 ± 2 %) compared

______Chemical ecology of Carpophilus beetles and their yeast symbionts 55 to C. hemipterus (number of adults attracted = 51/714; Eggs laid = 8 ± 1 %) (P <

0.001).

2.4.4 Effect of yeasts on larval development

2.4.4.1 Carpophilus davidsoni

Larval survival on yeast-inoculated fruit substrate:

C. davidsoni larval development was significantly influenced by yeast inoculation

2 2 treatment (development time to adulthood;  (3) = 41.43, Pupal weight;  (3) = 37.47,

2 and number of larvae reaching adulthood;  (3) = 42.31; (P < 0.001, KW)) (Fig. 2.4 a-c). Larval development (Fig. 2.4a): Time to adulthood was significantly faster in the fruit substrate (peach-agar substrate) inoculated with P. kluyveri (Pk =

20.00±0.19 days) compared to H. guilliermondii (Hg = 24.27±0.20 days, P < 0.001) and the sterile control (PAS = 41.86 ± 0.16 days, P < 0.001). Developmental time on the standard rearing diet, brewer’s yeast diet (BYD), for Carpophilus (BYD =

20.27±0.20 days) was similar to that of P. kluyveri on fruit media (P > 0.05). Larval development time was also significantly different on H. guilliermondii inoculated media compared to the sterile control (P < 0.05). Pupal weight (Fig. 2.4b): Pupal weight was measured as the sum of 5 pupae from each replicate. Larvae developing on P. kluyveri inoculated media had significantly higher pupal weight (Pk =

14.78±0.43 mg / 5 pupae) compared to those on H. guilliermondii inoculated media

(Hg = 12.40±0.28 mg / 5 pupae) (P < 0.05). Pupal weight of larvae developing on brewer’s yeast diet (BYD = 16.04±0.25 mg / 5 pupae) was similar to that of larvae developing on P. kluyveri (P > 0.05). In half of the replicates [N = 7/15] larvae failed to develop on sterile PAS alone, and in the remaining replicates survival was low, with a mean of 1.43±0.11 (per 20 larvae) survived to adult stage. Numbers here were

______56 Chemical ecology of Carpophilus beetles and their yeast symbionts

too low to measure pupal weight. Survival to adulthood (Fig. 2.4c): The number of larvae that survived to adulthood followed the same trend as larval development time. Significantly higher number of larvae survived to adulthood on P. kluyveri inoculated media (Pk = 18.80±0.23 / 20 insects) compared to H. guilliermondii inoculated media (Hg = 13.60±0.30 / 20 insects) (P < 0.001) and sterile control (PAS

= 1.43±0.11 / 20 insects) (P < 0.001). Survival to adulthood was also significantly different between H. guilliermondii inoculated media and sterile control (P < 0.05).

Number of larvae reaching adulthood was not significantly different between brewer’s yeast diet (BYD = 19.47±0.13 / 20 insects) and P. kluyveri inoculated media (P > 0.05).

Larval survival on yeast cultured on potato dextrose agar (i.e., no fruit added to substrate): When larvae were reared on yeast-PDA media, yeast inoculation had a

2 significant influence on larval developmental time to adulthood ( (2) = 35.69, P <

2 0.001, KW) and number of larvae reaching adulthood ( (2) = 39.25, P < 0.001,

KW), indicating that beetles could survive on yeasts without the direct need for fruit nutrients. Larval development (Fig. 2.5a) C. davidsoni larval development time was faster on P. kluyveri (mean = 19.73±0.22 days) compared to H. guilliermondii (mean

= 22.87±0.60 days) (P < 0.05). No larvae survived on sterile PDA. Survival to adulthood (Fig. 2.5b): Number of larvae reaching to adulthood was also higher on P. kluyveri inoculated media (mean=7.40±0.62 / 20 insects) compared to H. guilliermondii inoculated media (mean=2.53±1.39 / 20 insects) (P = 0.003).

2.4.4.2 Carpophilus hemipterus

Larval survival on yeasts grown on fruit-based media:

As with C. davidsoni, C. hemipterus larval development was also significantly ______Chemical ecology of Carpophilus beetles and their yeast symbionts 57

Fig. 2.4 Carpophilus beetle larval development, pupal weight and survival to adulthood on yeast inoculated peach agar substrate (PAS) / sterile control. C. davidsoni: (a-c). C. hemipterus: (d-e). N = 15. Hg = Hanseniaspora guilliermondii, Pk = Pichia kluyveri, PAS = Control / peach agar substrate, BYD = Brewer’s yeast diet (positive control). Different letters indicate statistical significance at P < 0.05.

2 influenced by yeast inoculation treatments (time to adulthood;  (3) = 51.62, pupal

2 2 weight;  (3) = 50.99, and number of larvae reaching adulthood;  (3) = 53.42; (P <

0.001, KW)) (Fig. 2.4 d-f). Larval development time (Fig. 2.4d). Development time

to adulthood was significantly faster in P. kluyveri inoculated PAS (Pk = 17.93±0.21 ______58 Chemical ecology of Carpophilus beetles and their yeast symbionts

days) compared to H. guilliermondii inoculated PAS (Hg = 22.20±0.22 days) (P <

0.001) and the sterile control media (PAS)(P < 0.001). Larval development time on brewer’s yeast diet (BYD = 17.73±0.21 days) was similar to that of P. kluyveri on

PAS (P > 0.05). Unlike C. davidsoni, all C. hemipterus larvae failed to develop on the sterile control (fruit only media), indicating yeast might be essential for their development. Pupal weight (Fig. 2.4e): Larvae developing on P. kluyveri inoculated media had significantly higher pupal weight (Pk = 20.11±0.56 mg / 5 pupae) compared to those developing on H. guilliermondii inoculated media (Hg =

14.39±0.63 mg / 5 pupae) (P < 0.05) and sterile control (P < 0.001). Larvae developing on brewer’s yeast diet had similar pupal weight (mean = 22.28±0.34 mg /

5 pupae) to larvae developing on P. kluyveri inoculated media (P > 0.05). Survival to adulthood (Fig. 2.4f): The number of larvae reaching adulthood was significantly higher in P. kluyveri inoculated media (Pk = 17.93±0.43 / 20 insects) compared to H. guilliermondii inoculated media (Hg = 10.80±0.60 / 20 insects) (P < 0.05) and sterile control (P < 0.001). Number of larvae reaching to adulthood was not significantly different between brewer’s yeast diet (BYD = 19.73±0.12 / 20 insects) and P. kluyveri inoculated media (P > 0.05).

Larval survival on yeast culturing on PDA (i.e., no fruit added): Of the C. hemipterus larvae reared on yeast-PDA media, only larvae developing on P. kluyveri inoculated media were able to reach the adulthood. Yeast (P. kluyveri) inoculation

2 had a highly significant influence on larval developmental time to adulthood ( (2) =

2 41.89, P < 0.001, KW) and number of larvae reaching to adulthood ( (2) = 41.76, P

< 0.001, KW). Larval development (Fig. 2.5c): Larval development on P. kluyveri was completed in 20.67±0.25 days (mean) and was significantly different from H. guilliermondii and sterile control (P < 0.001). Survival to adulthood (Fig. 2.5d): ______Chemical ecology of Carpophilus beetles and their yeast symbionts 59

Fig. 2.5 Carpophilus beetle larval development and survival to adulthood on yeast inoculated potato dextrose agar (PDA) / sterile control. C. davidsoni: (a & b). C. hemipterus: (c & d). N = 15. Hg = Hanseniaspora guilliermondii, Pk = Pichia kluyveri, PDA = Control / Potato dextrose agar. Different letters indicate statistical significance at P < 0.05.

Number of larvae reaching to adulthood on P. kluyveri inoculated media was

10.87±0.58 days (mean) and was significantly different from H. guilliermondii and sterile control (P < 0.001).

2.4.5 Yeast volatile analysis

Multivariate analysis revealed significant differences among the headspace odour composition of the three treatments (Hg, Pk and PAS) (R = 0.99, P < 0.001;

ANOSIM), and between all treatment groups (PAS vs H. guilliermondii, P = 0.0237;

PAS vs P. kluyveri, P = 0.0264 and H. guilliermondii vs P. kluyveri, P = 0.0237;

Fig. 2.6b). Analysis of the headspace odour of peach-agar substrate (without yeasts) revealed high emissions of limonene, 2-phenylethyl alcohol, hexyl hexanoate, hexyl

______60 Chemical ecology of Carpophilus beetles and their yeast symbionts

Fig. 2.6 Distinct odour profiles from yeasts collected by dynamic headspace sampling method. (a) Representative odour profiles as measured from gas chromatography-mass spectrometry (GC-MS). Labelled peaks represent the volatiles that accounted for at least 1% of the chemical profile in any of the treatments (b) Non-metric Multidimensional Scaling (NMDS) plots of P. Kluyveri, H. guilliermondi and PAS (control/peach agar substrate) showing discrete clusters with ellipses at 95% confidence of interval.

______Chemical ecology of Carpophilus beetles and their yeast symbionts 61

2-methylbutanoate, 2-ethylhexyl butyrate, 5-heptyldihydro-2(3H)-Furanone, α- farnesene and 2-ethylhexyl 2-ethylhexanoate (Fig. 2.6a). While these compounds were found in all treatments their release rates varied in the presence of yeasts (e.g. limonene and phenylethyl alcohol).

Isoamyl acetate and hexyl acetate were present only in small quantities in the medium, but were markedly more abundant when the medium was treated with yeasts, while ethyl acetate, propyl acetate, isoamyl alcohol, isobutyl acetate, benzyl acetate and 2-phenylethyl acetate were present only in the media inoculated with the yeasts (Fig. 2.6a and Table 2.2) 3-methylpentanoic acid and 1-hexanol were produced only by H. guilliermondii yeast, while methionol acetate and 1-(3,4- dimethylphenyl) ethanone were exclusive to P. kluyveri yeasts.

SIMPER analysis revealed that approximately 88% of the dissimilarities between the two yeasts resided in the emissions of 7 compounds; namely isoamyl acetate

(~52%), 2-phenylethyl acetate (~15%), ethyl acetate (~14%), isobutyl acetate (~5%), isoamyl alcohol (~3%), propyl acetate (~1%) and hexyl acetate (~1%). In addition,

SPME analysis revealed the presence of; acetaldehyde and ethanol, early eluting compounds which were masked by the solvent peak in liquid dynamic headspace samples. Both of these compounds were produced by the PAS inoculated with either of the yeast species, but only ethanol was produced by sterile PAS. In sterile PAS amount of ethanol was almost similar to PAS inoculated with H. guilliermondii, but it was 13 times less in PAS inoculated with P. kluyveri. Some other compounds were also detected in the headspace of yeasts inoculated PAS (see Fig. 2.7 and Table 2.3).

2.5 Discussion

Yeasts clearly play a central role in the host selection behaviour and nutritional

______62 Chemical ecology of Carpophilus beetles and their yeast symbionts

ecology of Carpophilus beetles feeding on ripening and rotting fruit. In olfactory preference and oviposition assays, beetles exhibited significantly greater responses to yeast-inoculated peach substrates compared to yeast-free (sterile) peach substrates, and also beetle species-specific differences in host selection and larval survival with the presence (and absence) of different yeasts. By characterizing gut-associated yeast flora in both C. davidsoni and C. hemipterus collected from the same orchard environment, I explored potential differences in gut-yeast communities in wild insects, and then selected and tested key yeast species for their influence on adult beetle behaviour and larval survival. Both Carpophilus species were found to share a similar gut flora, composed of yeast species belonging to seven different genera, with a predominance of Pichia and Hanseniaspora. Hanseniaspora and Pichia are common fruit-associated yeasts (Janisiewicz et al., 2010; Vadkertiová et al., 2012), which are found in other beetles (Suh et al., 2005); and drosophilid (Bellutti et al.,

2018) and tephritid (Piper et al., 2017) fruit flies, and have been identified in studies on other Carpophilus beetles (Lachance & Bowles, 2002; Suh & Blackwell, 2004), including a previous study on C. hemipterus (Miller & Mrak, 1953). Carpophilus davidsoni has never been studied in this regard.

The predominance of P. kluyveri and H. guilliermondii (compared to other yeasts) in

Carpophilus adults may suggest yeast-insect coadaptation. P. kluyveri, the most frequently isolated yeast species in this study, is considered to be mutualistic in

Drosophila (Hamby et al., 2012; Vacek et al., 1979), where the fly larvae benefit by feeding on the yeast (Stamps et al., 2012), and the yeast benefits by using the fly for dispersal (Christiaens et al., 2014). Hanseniaspora guilliermondii, the second most abundant yeast species, has been isolated from Drosophila (Morais et al., 1992), but evidence for mutualism has not yet been demonstrated. Other Hanseniaspora

______Chemical ecology of Carpophilus beetles and their yeast symbionts 63 isolates closely related to H. opuntiae and H. uvarum were also isolated from the gut of Carpophilus in our study, but could not be unambiguously assigned to species level.

Yeast succession (the successive colonisation of a substrate by different yeast species) may play a significant role in determining how microbial communities interact with other trophic levels (Morais et al., 1995). Hanseniaspora are known to be early stage yeast communities (Batista et al., 2015; Morais et al., 1995), whereas

Pichia generally occur during later stages (Morais et al., 1995; Spencer et al., 1992).

Labelled as “killer yeast”, Pichia can exclude sensitive or intermediate stage yeasts

(Morais et al., 1995; Starmer et al., 1987). In this study, larvae of both Carpophilus species had improved development and survival on P. kluyveri compared to H. guilliermondii. However, C. davidsoni had improved survival on fruit substrates infested with H. guilliermondii (an early colonising species) compared to C. hemipterus. Moreover, only C. davidsoni could survive on H. guilliermondii in experiments using fruit-free agar substrates. Adaptations to utilising H. guilliermondii may give C. davidsoni a selective advantage in utilising fruits at an early stage of decomposition, allowing larvae to have a developmental “head start” over C. hemipterus, before both species utilise the more suitable P. kluyveri. I also found that C. hemipterus was unable to survive in the absence of microbial activity, whereas C. davidsoni exhibited poor survival (around 5 %) with development time around twice as long. This low survival of C. davidsoni on microbe-free substances could again imply physiological adaptations in C. davidsoni that could give it an advantage over C. hemipterus earlier on in fruit colonisation, for example enabling initial larval survival while yeasts inoculated into the fruit by the ovipositing adult proliferate. I did not explore possible adaptations in C. hemipterus that may give this

______64 Chemical ecology of Carpophilus beetles and their yeast symbionts

species a selective advantage over C. davidsoni in colonising overripe and rotting fruits, but a higher tolerance levels to ethanol, as is seen in D. melanogaster compared to D. simulans (McKenzie & Parsons, 1972), would be worth investigating.

In behavioural assays with adult insects I found that H. guilliermondii was preferred

(in both olfactory and oviposition trials) to P. kluyveri for both species, with yeast- free substrates being the least preferred. This higher attraction to yeast volatiles over fruit volatiles has been shown in Drosophila (Becher et al., 2012; Mori et al., 2017) and codling moth (Witzgall et al., 2012), where yeast volatiles promoted oviposition.

Although greater adult Carpophilus attraction to H. guilliermondii does not align with better larval survival, this lack of correlation between preference and performance is frequently the case in studies on adult insect host selection (Balagawi et al., 2013; Birke & Aluja, 2018); and there are several theories for why this may be the case (Ballabeni et al., 2001; Cunningham, 2012; Levins & MacArthur, 1969;

Scheirs et al., 2000). A build-up of volatiles within enclosed traps used in the experiment could also have influenced attraction: isoamyl acetate and 2-phenylethyl acetate were higher in P. kluyveri and can be repellent to insects at high concentrations (Stockel & Sureau, 1981b).

I found both qualitative and quantitative differences in volatile emissions of the two yeast odour profiles that may have accounted for the differences in attraction (Paiva

& Kiesel, 1985; Palanca et al., 2013). Common microbial volatiles acetaldehyde, ethanol, ethyl acetate, propyl acetate, isoamyl alcohol, 2-methyl-1-butanol, isobutyl acetate, isoamyl acetate, hexyl acetate, benzyl acetate and 2-phenylethyl acetate were present in both yeasts, but with significant quantitative differences in their emission

______Chemical ecology of Carpophilus beetles and their yeast symbionts 65 rates. Statistical analysis revealed that two volatiles, isoamyl acetate and 2- phenylethyl acetate, accounted for 70 % of dissimilarities between the two yeasts

(48× and 40× higher respectively, in P. kluyveri compared to H. guilliermondii). The concentration of particular “fruit” volatiles emanating from peach-agar media was also enhanced in the presence of yeasts: limonene was increased up to 42 % in P. kluyveri and 31 % in H. guilliermondii inoculated peach-agar compared to sterile media. Limonene biotransformation by microbes (including yeasts) has been previously described by Duetz et al. (2003). Terpenes including limonene may repel parasitoid wasps, providing enemy-free space for larval development (Billeter &

Wolfner, 2018; Dweck et al., 2013). Substrate-specific effects on yeast volatile production are essential for understanding how microbial-plant interactions influence insect behaviour in nature; and we found the volatiles produced by H. guilliermondii in this study differed from those produced in a study on fermenting apples

(Pietrowski et al., 2012).

When resources are limiting, evolution may drive adaptations that enable competing species to co-exist in the same ecological niche through the selective use of resources: a theory known as resource partitioning (MacArthur and Levins 1967;

Walter 1991). This study showed that the two beetle species have overlapping resource use (to the extent that both species were sometimes found in the same fruit), and also that C. davidsoni has adaptations that enable host selection and survival on fruits at an earlier stage—which at least partly explains differences in resource use.

Whether these behavioural and physiological traits were under selection as a direct result of interspecific competition, and thus indicate resource partitioning in its strict sense (Walter 1991), would require further study.

______66 Chemical ecology of Carpophilus beetles and their yeast symbionts

Given yeasts are an important, if not essential, nutrient source for feeding, development and oviposition in other frugivorous insects such as codling moth, and tephritid and drosophilid fruit flies (Becher et al., 2012; Ganter, 2006; Gonzalez,

2014; Piper et al., 2017; Stefanini, 2018; Witzgall et al., 2012), the interplay between yeasts, the substrates they colonise, and the insects that utilise them, should be built into host selection theory (Mayhew, 2001; Scheirs & De Bruyn, 2002; West &

Cunningham, 2002). For instance, in polyphagous insects that are yeast feeders, host choice might be under strong selection in favour of host plants that are suitable substrates for particular yeasts, rather than for the insect’s feeding on the fruit directly. This also has a bearing on host preference tests that are carried out in laboratory assays and used to test the “preference-performance” hypothesis

(Gripenberg et al., 2010; Thompson, 1988): larval performance in nature may be strongly influenced by yeasts (or other microbes) that are not present in laboratory assays.

Semiochemicals form the basis of many “attract and kill” strategies to mass trap and monitor insect pests (El-Sayed et al., 2006). In Carpophilus beetle attract and kill, the commercially available attractant is a synergistic mix of the beetle’s aggregation pheromone (Bartelt & Hossain, 2010) and yeast volatiles identified from brewer’s yeast, Saccharomyces cerevisiae (Bartelt and Hossain 2006; Nout and Bartelt 1998).

Tailoring relative concentrations of these volatiles to match those of ecologically important yeasts (in particular H. guilliermondii) could help develop a more powerful lure for attract and kill system of these beetles. Future work might also see gene technologies such as RNA interference applied to manipulating yeasts to enable a new generation of novel biopesticides (Murphy et al., 2016).

______Chemical ecology of Carpophilus beetles and their yeast symbionts 67

Table 2.2 Composition of headspace of the three different treatments collected by

dynamic headspace sampling method.

PAS Control PAS + PAS + P. kluyveri (n=5) H. guilliermondii (n=5) (n=5) Ret time Compounds KI* emission SE emission SE emission SE (min) rate rate rate (ng.hr-1) (ng.hr-1) (ng.hr-1) 5.48 Ethyl acetate 653 - - 617.4 139.0 770.4 164.0 6.53 Ethyl propanoate 716 - - 44.4 10.4 13.7 3.2 6.57 Propyl acetate 718 - - 58.0 12.9 74.8 15.0 6.87 Isoamyl alcohol 739 - - 153.8 26.6 39.6 9.9 7.48 Isobutyl acetate 773 - - 22.0 5.5 883.0 181.0 8.11 Butyl acetate 811 - - 22.3 5.1 79.9 14.7 8.49 Furfural 833 21.0 3.3 - - - - 8.58 3-Methylpentanoic acid 839 - - 29.7 14.9 - - 8.85 2-Hexen-1-ol 855 10.0 3.5 - - - - 9.05 1-Hexanol 867 - - 28.1 11.1 - - 9.19 Isoamyl acetate 875 3.1 1.1 275.3 54.1 13467.4 4897.6

10.79 Isoamyl propanoate 969 - - 5.5 1.0 46.1 8.3 10.82 Benzaldehyde 971 7.0 1.9 15.8 3.0 - - 11.19 Furfuryl acetate 992 - - 16.9 2.4 67.6 8.5

11.50 Hexyl acetate 1011 7.7 2.3 35.6 10.0 116.5 38.9 11.54 (Z)-2-Hexenyl acetate 1013 - - 0.9 0.4 47.2 20.0 11.94 D-Limonene 1037 36.0 9.1 47.2 10.9 51.0 9.1 13.32 Phenylethyl alcohol 1121 9.2 2.8 1.5 0.7 32.7 5.7 13.36 Methionol acetate 1124 - - - - 31.2 7.2 14.05 Benzyl acetate 1168 - - 45.5 14.3 20.7 5.3 14.39 Hexyl hexanoate 1190 5.1 2.5 2.7 1.8 7.0 2.4 15.08 Hexyl 2- 1236 16.6 6.7 11.9 4.4 25.6 10.9 methylbutanoate 15.46 2-Phenylethyl acetate 1262 - - 321.1 72.5 2060.9 421.9 15.65 1-(3,4-dimethylphenyl) 1275 - - - - 9.6 2.7 ethanone 16.28 2-Ethylhexyl butyrate 1319 8.8 1.5 9.4 1.8 12.6 2.6 16.82 2-Phenylethyl 1357 - - 11.0 4.8 73.8 12.5 propanoate 17.19 Hexyl hexanoate 1384 9.2 1.6 10.2 2.6 14.1 3.9 18.38 2(3H)-Furanone, 5- 1476 8.6 1.9 7.9 1.4 7.9 1.3 heptyldihydro- 18.70 Octyl ether 1501 9.8 1.5 9.3 1.3 11.8 2.2 18.79 α-Farnesene 1509 15.0 3.8 19.0 4.7 20.9 3.9 19.77 Ethyl dodecanoate 1593 - - 8.7 2.4 42.2 8.6 19.83 2-Ethylhexyl 2- 1598 14.4 2.1 16.7 3.7 20.6 3.2 Ethylhexanoate 20.77 Heptadecyl 3- 1693 8.8 1.1 - - 10.4 2.3 chloropropanoate *Retention indices calculated on a non-polar column (DB-5MS)

______68 Chemical ecology of Carpophilus beetles and their yeast symbionts

Fig. 2.7 Distinct odour profiles from yeasts collected by SPME method and measured from gas chromatography-mass spectrometry (GC-MS). Annotated peaks are presented in the table 3.

______Chemical ecology of Carpophilus beetles and their yeast symbionts 69

Table 2.3 Composition of the headspace of the three different treatments collected by SPME method.

PAS Control PAS + PAS + (n=2) H. guilliermondii P. kluyveri (n=3) (n=3)

Peak Retention Compounds Peak area SE Peak area SE Peak area SE No. time (%) (%) (%) 1 1.78 Acetaldehyde - - 4.6 2 1.8 0.4 2 1.88 Ethanol 39.9 10 39.8 3.3 2.9 0.3 3 2.63 Ethyl acetate - - 33.2 7.7 74.8 1.2

4 3.72 Propyl acetate - - 0.9 0.1 5 3.74 Propanoic acid, - - 4.8 0.2 - - ethyl ester 6 4.09 Isoamyl alcohol - - 4.4 0.5 - - 7 4.14 1-Butanol,2- - - 6.2 0.9 - - methyl- 8 4.66 Isobutyl acetate - - 7.8 0.8 9 6.54 1-Butanol,3- - - 2 0.1 8.4 0.2 methyl-, acetate 10 6.55 1-Butanol, 2-mthyl, - - 2.9 0.4 acetate 11 12.81 2-Phenylethyl - - 1.9 0.6 2 0.6 acetate

______70 Chemical ecology of Carpophilus beetles and their yeast symbionts

3.1 Abstract

Carpophilus davidsoni is an economically important insect pest of Australian stone fruit orchards. Current management practices include an attract and kill system, which utilises an attractant odour that combines the aggregation pheromone of male beetles with ‘co-attractant’ volatiles from fruit juice fermented with bakers’ yeast,

Saccharomyces cerevisiae. Here I explore whether volatiles emitted from two yeast species associated with C. davidsoni in nature, P. kluyveri and H. guilliermondii, could improve the effectiveness of the co-attractant. Field trials using live cultures of the two yeast species revealed that P. kluyveri trapped higher numbers of C. davidsoni compared to H. guilliermondii. Using GC-MS, I analysed volatile emissions of the two yeasts and selected two esters, isoamyl acetate and 2- phenylethyl acetate, from P. kluyveri (the more attractive yeast in the field) for further investigation. Attraction to these two esters was evaluated in the field by adding them individually or in combination to the co-attractant. Trap catches of C. davidsoni were significantly increased when 2-phenylethyl acetate was added, compared to that of isoamyl acetate, or isoamyl acetate together with 2-phenylethyl acetate. I also tested different concentrations of ethyl acetate (the only ester present in co-attractant) in two-choice bioassays in the laboratory, and found that C. davidsoni adults showed no difference in preference towards the commercial co- attractant if ethyl acetate was removed or doubled in concentration. By contrast, field trials using the same three treatments revealed that co-attractant trapped significantly higher numbers of C. davidsoni adults compared to the co-attractant without ethyl acetate or with twice concentration of ethyl acetate. This study reveals how using volatile compounds from microbes that are ecologically associated with insect pests can result in more potent lures for use in integrated pest management strategies, and

______72 Chemical ecology of Carpophilus beetles and their yeast symbionts

that results from laboratory experiments screening volatile compounds should be treated with caution when making inferences regarding attraction under field conditions.

3.2 Introduction

Carpophilus (Coleoptera: Nitidulidae) is an ecologically diverse genus of fruit and grain feeding beetles (Hinton, 1945; Marini et al., 2013; Myers, 2004). In Australia,

C. davidsoni and C. hemipterus are economically important pests of stone fruits, attacking ripening to late ripening stages of the fruit (Hossain et al., 2009; Hossain et al., 2006). Adult beetles cause direct damage by chewing and entering fresh fruit near the pedicel (James et al., 1994; James et al., 1995) and indirect damage through vectoring fungal spores and causing disease such as brown rot (Monilinia fructicola)

(Hely et al., 1982). Annual losses due to Carpophilus beetles have been reported as up to 30% of the crop (Hossain et al., 2000).

Management of Carpophilus beetles in stone fruits is currently achieved using

‘attract and kill’, an environmentally friendly IPM strategy that uses attractants

(frequently odours) to lure target pest species into killing traps (e.g. baited with insecticides, or sticky substrates) (Bartelt & Hossain, 2010; Gregg et al., 2018). The attractant in the trap is a combination of two odours, which work synergistically to attract male and female beetles: (i) a synthetic odour mimic of the male aggregation pheromone, and (ii) a ‘co-attractant’ derived from fermented peach juice (Bartelt &

Hossain, 2006; Bartelt & James, 1994). This co-attractant was developed on volatile emissions from peach juice fermented using baker’s yeast, Saccharomyces cerevisiae—a yeast species for which there is no evidence for an ecological association with Carpophilus beetles.

______Chemical ecology of Carpophilus beetles and their yeast symbionts 73

Studies on tephritid and drosophilid fruit flies have revealed that adult flies show olfactory preferences among odours of different gut-associated yeast species, which may arise through both qualitative and quantitative differences in yeast odour composition (Piper et al., 2017; Scheidler et al., 2015). Knowledge of the volatile compounds present in more attractive host odours could be used to develop novel attractants for attract and kill traps (Babcock et al., 2018; Kuhns et al., 2014). Here, I explore this further for stone fruit attacking Carpophilus by focusing on differential attraction to odours of two yeasts, Hanseniaspora guilliermondii and Pichia kluyveri, which I have recently shown to be abundant in the gut of stone fruit attacking Carpophilus (Baig et al., 2020). Laboratory assays revealed that adult beetles showed olfactory preferences between these yeasts (preferring H. guilliermondii), and also that the yeasts were important nutritional substrates for beetle larvae (Baig et al., 2020). In this study, I investigate behavioural responses of the adult beetles to live cultures of P. kluyveri and H. guilliermondii in the field, followed by volatile analysis using GC-MS, and the development and testing of a number of synthetic blends based on volatile differences. I also conducted laboratory and field assays that vary in the concentration of a common fruit volatile ethyl acetate (Lasekan et al., 2013) already present in the co-attractant, which provides a cautionary note regarding insect responses seen in the laboratory vs field conditions

(Cha et al., 2018; Knudsen et al., 2008).

3.3 Materials and Methods

3.3.1 Insects

For laboratory experiments, adult C. davidsoni (~ 25th generation) were obtained from a two year old continuous culture maintained on brewer’s yeast based diet

(Dowd, 1987; James & Vogele, 2000) in an incubator (25°C, 50-60 % RH and 15:9 ______74 Chemical ecology of Carpophilus beetles and their yeast symbionts

light:dark photoperiod). Behavioural experiments in the laboratory were performed under similar environmental conditions. Adult beetles were two to three weeks old when used in behavioural experiments, having been deprived of food for 24 h.

3.3.2 Chemicals

All chemicals except ethanol were purchased from Sigma Aldrich (Castle Hill,

NSW, Australia) with purities ranging from 98% to 99.5%. The commercially available co-attractant for Carpophilus beetles (CL hereafter) used in laboratory and field trials was prepared following Bartelt and Hossain (2006). CL is a blend of six compounds: acetaldehyde, ethanol, ethyl acetate, isobutanol, isoamyl alcohol and 2- methyl-1-butanol.

3.3.3 Field trials using live yeast cultures

Yeast species P. kluyveri and H. guilliermondii were selected for this study, having been shown to be the most abundant gut-associated yeast species in C. davidsoni and

C. hemipterus collected from stone fruits (Baig et al., 2020). Yeast species were cultured following methods described in Baig et al. (2020). Yeast traps: 50 mL of sterile sabouraud dextrose broth (SDB) in a 70 mL plastic container was inoculated with 5 mL of high-density yeast cultures of either P. kluyveri or H. guilliermondii.

Sterile SDB was used as a control lacking yeast odours. The plastic containers were then covered with muslin cloth, secured with a rubber band, and placed inside a

McPhail trap (BioTrap). The McPhail trap was modified such that the bottom of trap was levelled and hole was blocked with Blu-Tack to prevent trapped beetles from escaping. A cube (1 x 1 cm2) of 2,2-dichlorovinyl dimethyl phosphate (DDVP) insecticide (Killmaster zero, Barmac Industries Pty. Ltd., Queensland, Australia) was placed inside the trap to kill the trapped beetles.

______Chemical ecology of Carpophilus beetles and their yeast symbionts 75

Field trapping experiments comparing attraction of P. kluyveri, H. guilliermondii and sterile SDB were carried out in a commercial peach orchard (variety: Tatura 204) in

Northern Victoria (Bunbartha), Australia. Trials were conducted over three weeks in

March 2019, after fruit picking, although fallen rotting fruit were present on the ground. Traps (N = 20 per treatment) were hung on branches at a height of approximately 1.5 m, on every 7th tree along a row, with 1 m spacing between trees and 5 m between rows. Traps were arranged in randomized transects. Traps were serviced weekly by replacing the old yeast media with new media and collecting beetles.

3.3.4 Yeast volatile analysis

High density yeast cultures were prepared as described in Baig et al. (2020) and 20 mL of yeast culture was used in 50 mL glass beakers for headspace sampling. Sterile

SDB was used as a control. Glass beakers containing yeast or SDB media were covered with aluminium foil and left for 10 min to allow headspace odours to reach equilibrium. Volatile analysis was performed by solid-phase microextraction

(SPME) (DVB/CAR/PDMS, 50/30 µm fibre, Supelco). The needle of the SPME holder was inserted through the aluminium foil, covering the beaker and the fibre was exposed inside the jar for 30 min. Sample desorption inside the gas chromatograph (GC) injector port was performed for 0.5 min in split mode (split ratio 100:1) and the fibre was reconditioned at 250°C for 10 min before reuse.

Samples were analysed by GC-MS on an Agilent 7890A Gas Chromatograph coupled with Agilent 5997B single quadrupole mass spectrometer equipped with a non-polar column SLB-5MS (30 m × 0.32 mm × 0.25 µm). Helium was used as carrier gas. Initial oven temperature was set at 30 °C held for a minute before increasing at 10°C/min to 200°C, and then to 250°C at 20°C/min and maintained for ______76 Chemical ecology of Carpophilus beetles and their yeast symbionts

3 minutes. Ionization was performed in EI mode (70 eV) and scan range was set between m/z: 35-550. Identification was achieved by comparing compounds mass spectra to that of a NIST14 mass spectral library.

3.3.5 Laboratory bioassays on ethyl acetate attraction

The influence of ethyl acetate present in the commercial CL was explored using dual choice cage assays. Three blends were compared: (i) the complete blend of CL, (ii)

CL with ethyl acetate removed from the blend (CL-EA), and (iii) two times the concentration of ethyl acetate in CL (CL+EA(2x)). Traps were assembled using 30 mL plastic cups, piercing 4 equidistance holes around the sides of the cup and one hole at the centre of lid. 15 mL of each treatment was used in each trap. Mixed populations of male and female C. davidsoni (100 in total) were released into a

Bugdorm cage (30 x 30 x 30 cm) containing traps with treatments. As beetles were observed aggregating in the corners of the cage, treatments were placed in a straight line in the centre of the cage, with 20 cm distance between both treatments. The position of each treatment group (left & right) was rotated in each replicate (N = 10 replicates). Beetles were left undisturbed for 24 h under controlled environment conditions, after which the numbers of beetles in each trap were counted. The experiment was run over 2 days, using new insects in each replicate (totalling 1000 beetles). After each experiment, cages were wiped with 70% ethanol and air-dried overnight before re-use.

3.3.6 Field trials testing modifications to the commercial co-attractant

For field trials, CL was modified by either using different concentrations of ethyl acetate (see above) or adding two esters from P. kluyveri yeast—isoamyl acetate and

2-phenylethyl acetate. Field trials were performed using the following six treatments; i) commercial carpophilus lure (CL), ii) CL without ethyl acetate (CL-EA), iii) CL ______Chemical ecology of Carpophilus beetles and their yeast symbionts 77 with two times concentration of ethyl acetate (CL-EA(2x)), iv) CL with isoamyl acetate (CL+IA), v) CL with 2-phenylethyl acetate (CL+PA) and vi) CL with isoamyl acetate and 2-phenylethyl acetate (CL+IA&PA). Detailed composition of each blend is provided in the supplementary material (Supplementary Table 3.1).

The concentrations of volatiles isoamyl acetate and 2-phenylethyl acetate in the synthetic blends were based on relative concentrations (compared against EA concentration) in P. kluyveri odour, as determined in Baig et al. (2020) with yeasts cultured on a peach substrate.

The modified co-attractant blends were tested in a commercial peach orchard

(variety: Tatura 204) in Invergordon, Northern Victoria, Australia. Treatments were arranged in a block with six randomized transects. Black funnel traps (23 x 17 cm,

Bioglobal, Queensland, Australia), held in a metal ring were fixed to a fence picket at the height of 1.5 m. A 1.5 cm cube of insecticide (DDVP) was placed inside the traps to kill captured beetles. 200 mL of lure was placed in an open 400 mL plastic container (9 cm diameter) and covered with mosquito netting to prevent beetle entry.

Distance between the traps was 18-20 m. Traps were serviced weekly by replacing the old lure solution with a new one and collecting beetles from the traps.

Experiments were run for five weeks. All field collected beetles were identified using a taxonomic key (Leschen & Marris, 2005).

3.3.7 Statistical Analysis

Trap catches were analysed as the mean number of beetles caught per week for each treatment (three weeks for yeast field trials and five weeks for modified co-attractant field trials) using lme4 package in GLMM with log link function, assuming a

Poisson error distribution (Bates et al., 2014). A model was constructed with the number of beetles trapped as the response variable, treatments as a fixed factor, and ______78 Chemical ecology of Carpophilus beetles and their yeast symbionts

weeks treated as a random factor. Interaction between treatments and weeks (Trt x

Wk) was carried out to assess the effect of different weeks on trap catches of beetles in the treatments. The significance of fixed factors was assessed using 2 Wald statistics. When significant effects were found, the pairwise comparisons for all treatments were made using Tukey multiple comparison test in ‘multcomp’ software package (Hothorn et al., 2008).

For dual choice cage bioassays, the null hypothesis that C. davidsoni showed no preference for either of the choices (i.e. a 50:50 response) was tested using the

Wilcoxon Signed Ranks (WSR) test. Unresponsive individuals were not included in the analysis. All data analysis were carried out using R software ver. 3.6.1 (Team,

2013).

Volatile analysis: Free statistical package PAST version 3.15 (Hammer et al., 2001) was used to analyse volatile data. Quantities of compounds were used as variables for ordination by non-metric multidimensional scaling (NMDS) based on a Bray-

Curtis dissimilarity matrix. An ANOSIM test using the same type of matrix was used to test for dissimilarities between treatments. Pairwise comparisons were made using sequential Bonferroni corrections. SIMPER analysis was subsequently performed to determine which compounds were responsible for major differences in chemical profiles.

3.4 Results

3.4.1 Field trials using live yeast cultures

A total of 3680 C. davidsoni beetles were captured in field trials over the period of three weeks. Treatment had a significant effect on the number of beetles trapped

(Fig. 3.1; Table 3.1). The total number of adults caught in Sabouraud dextrose broth

______Chemical ecology of Carpophilus beetles and their yeast symbionts 79

(SDB) inoculated with P. kluyveri was significantly greater than H. guilliermondii

(Pk = 105 ± 15, Hg = 65 ± 17, P < 0.001) and sterile broth traps (C = 13 ± 9, P <

0.001). Significant differences in attraction were also found between SDB inoculated with H. guilliermondii and the sterile broth control (P < 0.001).

3.4.2 Yeast volatile analysis

Analysis of the headspace odour of sabouraud dextrose broth (SDB) showed emission of two compounds, ethanol and 3-methyl butanal. 3-methyl butanal was present only in SDB, while ethanol was found in all treatments although the release rates varied in the presence of yeasts. Differences among the headspace odour composition of the three treatments (P. kluyveri, H. guilliermondii, SDB) were confirmed using multivariate analysis. Significant differences were found in the chemical profiles of the three treatments (R = 1, P < 0.001; ANOSIM), and between all treatment groups (P. kluyveri vs H. guilliermondii, P = 0.0264; P. kluyveri vs

SDB, P = 0.0237 and SDB vs H. guilliermondii, P = 0.0237; All P values used were

Bonferroni-corrected.)(Fig. 3.2, Supplementary Table 3.2).

SIMPER analysis revealed that approximately 59% of the dissimilarities between the two yeasts resided in the emissions of 7 compounds; namely ethyl acetate (~39%), isoamyl acetate (~39%), 2-phenylethyl acetate (~9%), ethanol (~9%), isobutyl acetate (~1%), propyl acetate (~1%) and ethyl propionate (~1%).

3.4.3 Laboratory assays investigating attraction to different concentrations of ethyl acetate

In dual choice trap assays comparing CL vs CL-EA (CL without ethyl acetate), beetles responded well to odours emitted from traps (mean adult responders per trial

= 71 ± 4 / 100). The percentage of adults attracted to CL-EA was not significantly

______80 Chemical ecology of Carpophilus beetles and their yeast symbionts

Fig. 3.1 Field trapping of Carpophilus beetles for a period of three weeks using different yeasts. Pk = Pichia kluyveri, Hg = Hanseniaspora guilliermondii, C = sterile broth (control). n = 20. Error bars indicate standard error of mean (SEM). Different letters indicate statistical significance at P <

different from CL (CL-EA = 54 ± 2 %; CL = 46 ± 2 %) (Z = 1.78, P > 0.05, WRS,

Fig. 3.3a). In dual choice trap assays comparing CL vs CL+EA(2x) (CL with twice concentration of ethyl acetate), beetles also responded well to odours emitted from traps (mean adult responders per trial = 73 ± 4 / 100). The percentage of adults attracted to CL+EA(2x) was not significantly different than CL (CL+EA(2x) = 49 ±

3 %; CL = 51 ± 3 %) (Z = 0.59, P > 0.05, WRS, Fig. 3.3b).

______Chemical ecology of Carpophilus beetles and their yeast symbionts 81

Fig. 3.2 Distinct odour profiles from yeasts collected by SPME method (a) Representative odour profiles as collected by SPME method and measured from gas chromatography-mass spectrometry (GC-MS). Annotated peaks are presented in Table 3.2 under supplementary information section. (b) Non-metric Multidimensional Scaling (NMDS) plots of P. kluyveri, H. guilliermondi and sabouraud dextrose broth (control) showing discrete clusters with ellipses at 95% confidence of interval.

______82 Chemical ecology of Carpophilus beetles and their yeast symbionts

3.4 Discussion

Baker’s yeast, Saccharomyces cerevisiae, plays a central role in attracting

Carpophilus beetles in field trapping programs (Bartelt & Hossain, 2006; Mansfield

& Hossain, 2004b; Phelan & Lin, 1991) as well as in attracting other pest insects such as Drosophila suzukii, Anopheles gambiae and Cimex lectularius (Iglesias et al., 2014; Singh et al., 2013; Smallegange et al., 2010). I show here that exploring the gut-associated yeasts found naturally in Carpophilus beetles, and examining and comparing the suites of volatiles they produce, can be used to develop new more powerful attractants for use in field monitoring and mass-trapping programmes for these fruit orchard pests.

In field trials using live yeast cultures I found that P. kluyveri baited traps caught significantly higher number of beetles compared to H. guilliermondii baited traps.

Preference for P. kluyveri over other yeasts has also been demonstrated for tephritid and drosophilid fruit flies (Piper et al., 2017; Scheidler et al., 2015). Interestingly, relative attraction towards the two yeast species in these field trials differed from a laboratory study where the same yeast species were tested in a two choice cage bioassay and H. guilliermondii was found to be more attractive (Baig et al., 2020).

These conflicting results between laboratory and field trials may be due to different substrates being used to culture the yeasts (a peach-based agar substrate in the lab study and sabouraud dextrose broth in this study), as yeast volatile production can be substrate specific (Van Lancker et al., 2008) and the volatile profiles in Baig et al.

(2020) were also different. Other factors such as build-up of volatiles within enclosed traps (Howse, 1999; Stockel & Sureau, 1981a), space between odour sources (traps), distance over which insects were attracted, the enclosed lab

______Chemical ecology of Carpophilus beetles and their yeast symbionts 85 environment, and background odours (Cha et al., 2012; Cha et al., 2014) might also have influenced these differing results.

Volatile analysis revealed qualitative and quantitative differences in volatile compounds emitted by the two yeasts that may have accounted for the differences in attraction (Paiva & Kiesel, 1985; Scheidler et al., 2015). Microbial volatiles ethyl propionate and isoamyl propionate were specific to H. guilliermondii, whereas acetaldehyde was only produced by P. kluyveri. Ethanol, ethyl acetate, propyl acetate, isobutyl acetate, isoamyl acetate and 2-phenylethyl acetate were common microbial volatiles present in both yeasts, but with significant quantitative differences in their emission rates. Statistical analysis revealed that four volatile compounds ethyl acetate, isoamyl acetate, 2-phenylethyl acetate and ethanol were responsible for 96% of the dissimilarities between the two yeast species. The concentrations of ethanol and isoamyl acetate, in P. kluyveri, were 30x and 3x higher respectively compared to that of H. guilliermondii, while concentrations of ethyl acetate and 2-phenylethyl acetate were 4.6x and 3.8x higher in H. guilliermondii compared to that of P. kluyveri.

Ethyl acetate is a common fruit ester associated with the ripening process (Lasekan et al., 2013) and is the only ester present in the commercial carpophilus lure. In laboratory assays investigating the influence of different concentrations of this volatile on attraction of C. davidsoni I found that adults not only failed to discriminate between the presence vs absence of ethyl acetate, they also failed to differentiate between normal vs higher concentrations of ethyl acetate in the co- attractant. Two-choice laboratory assays can sometimes fail to identify key attractants from a blend of volatile compounds (Cha et al., 2018); however contrary

______86 Chemical ecology of Carpophilus beetles and their yeast symbionts

to findings in the current study, D. melanogaster was able to differentiate between presence or absence of ethyl acetate under laboratory conditions (Christiaens et al.,

2014). This might imply that C. davidsoni does not discriminate this volatile to the same extent as D. melanogaster in an enclosed experimental arena. By contrast, when synthetic blend formulations with different concentrations of ethyl acetate were tested in the field, traps baited with a formulation without ethyl acetate and with increased concentration of ethyl acetate caught significantly less beetles compared to the original concentration in the co-attractant, indicating once again contradictory results in the olfactory responses seen in the field compared to laboratory assays, and reinforcing that caution must be applied to laboratory findings in particular when selecting volatiles for attracting insects in the field.

Field trials screening new formulations containing the esters isoamyl acetate and / or

2-phenylethyl acetate from P. kluyveri showed that traps where 2-phenylethyl acetate was added captured significantly more C. davidsoni compared to all other synthetic blends. 2-phenylethyl acetate is not only attractive to C. davidsoni but also plays a key role in attraction for other insects such as bark beetles (Brand et al., 1977), coffee been weevil (Yang et al., 2017) and drosophilid fruit flies (Baker et al., 2003).

By comparison, addition of isoamyl acetate, either alone or in combination with 2- phenylethyl acetate, captured significantly less beetles compared to co-attractant.

Although isoamyl acetate is an attractant for insects such as fruit flies and the small hive beetle (Christiaens et al., 2014; Teal et al., 2007; Torto, Arbogast, et al., 2007;

Torto, Boucias, et al., 2007) this volatile significantly reduced the attraction of C. davidsoni to the co-attractant when tested in combination with isobutyl acetate and propyl acetate (Bartelt & Hossain, 2006), suggesting that isoamyl acetate reduces the

______Chemical ecology of Carpophilus beetles and their yeast symbionts 87 attractivity of attractant lures. Both esters, 2-phenylethyl acetate and isoamyl acetate have been shown to be EAD active compounds for C. davidsoni (Chapter 4).

In conclusion, I demonstrated how novel attract and kill “co-attractant” formulations for Carpophilus beetles can be developed through studying the chemical ecology of gut-associated yeast symbionts of these pests. Although the controlled situations provided by laboratory studies can be invaluable in elucidating many aspects of insect olfaction, care should be taken when interpreting responses to volatile compounds in the context of developing attractant lures to be used in field trapping.

Future research may help in further improving the attractiveness of the lures developed in this study by using more effective dispensers that help to tailor the relative concentration of volatiles more closely to that of P. kluyveri, in addition to field testing other electrophysiologically active volatile compounds from P. kluyveri yeast that have been explored recently (Chapter 4).

______88 Chemical ecology of Carpophilus beetles and their yeast symbionts

3.5 Supplementary Material

Supplementary Table 3.1 Formulations of chemical lures used in field trials

Treatments Lure composition (per 100 mL) Acetaldehyde: 65.4 µL Ethanol : 44.3 ml Ethyl acetate: 104.4 µL Carpophilus lure (CL) Isobutanol: 33.8 µL Isoamyl alcohol: 74.1 µL 2-methyl-butanol: 24.4 µL Water: 55.4 mL Acetaldehyde: 65.4 µL Ethanol : 44.3 mL Carpophilus lure - Ethyl Isobutanol: 33.8 µL acetate Isoamyl alcohol: 74.1 µL (CL-EA) 2-methyl-butanol: 24.4 µL Water: 55.4 mL Acetaldehyde: 65.4 µL Ethanol : 44.3 mL Carpophilus lure + Ethyl Ethyl acetate: 208.8 µL acetate (2x) Isobutanol: 33.8 µL [CL+EA(2x)] Isoamyl alcohol: 74.1 µL 2-methyl-butanol: 24.4 µL Water: 55.4 mL Acetaldehyde: 65.4 µL Ethanol : 44.3 mL Ethyl acetate: 104.4 µL Carpophilus lure + Isobutanol: 33.8 µL Isoamyl acetate (CL + Isoamyl alcohol: 74.1 µL IA) 2-methyl-butanol: 24.4 µL *Isoamyl acetate: 142 µL Water: 55.4 mL Acetaldehyde: 65.4 µL Ethanol : 44.3 mL Ethyl acetate: 104.4 µL Carpophilus lure + 2- Isobutanol: 33.8 µL Phenylethyl acetate(CL + Isoamyl alcohol: 74.1 µL PA) 2-methyl-butanol: 24.4 µL *2-Phenylethyl acetate: 24 µL Water: 55.4 mL Acetaldehyde: 65.4 µL Ethanol : 44.3 mL Ethyl acetate: 104.4 µL Carpophilus lure + Isobutanol: 33.8 µL Isoamyl acetate & 2- Isoamyl alcohol: 74.1 µL Phenylethyl acetate(CL + 2-methyl-butanol: 24.4 µL IA & PA) *Isoamyl acetate: 124 µL *2-Phenylethyl acetate: 24 µL Water: 55.4 mL

* = VOCs from P. Kluyveri yeast ______Chemical ecology of Carpophilus beetles and their yeast symbionts 89

Chapter 4: Reduction of electro-physiological noise associated with effluent

humidification enables first GC-EAD recordings from Carpophilus

beetle

______Chemical ecology of Carpophilus beetles and their yeast symbionts 91

4.1 Abstract

Carpophilus beetles are diverse and widespread orchard pests attacking fruits at different ripening stages. Studies on the olfactory behaviour of these insects over the last few decades have led to the identification of attractant odours that are used in

“attract and kill” strategies to monitor and control pest populations. Existing lures that have been commercialised to date are derived from complex microbial odours combined with the insect’s aggregation pheromone, and were developed in the absence of electrophysiological data. While the unavailability of such data did not impede the discovery and identification of aggregation pheromones – discernible via direct comparisons of male and female beetle odours – the use of gas chromatography coupled with electroantennography (GC-EAD) could enable a far more effective means of screening food-derived odours, by identifying volatiles that are detected by the insect antennae. Here, the attraction of the stone fruit pest,

Carpophilus davidsoni, to its commercial lure composed of a food attractant (“co- attractant”) and synthetic pheromones was revisited using a GC-MS-FID-EAD (Gas

Chromatograph-Mass Spectrometer-Flame Ionization Detector-

Electroantennographic Detector) setup. Technical challenges that may have caused the current absence of electrophysiological recordings with these beetles, including insect preparation, and splitting and application of GC effluent, were addressed.

Effluent humidification, which is commonly used in GC-EAD, was identified as the main hindrance to obtain sufficiently high signal to noise ratio to observe responses with Carpophilus. Together, these method adjustments enabled the successful acquisition of GC-EAD data from volatile extracts produced by the yeast, Pichia kluyveri, which is commonly encountered in the C. davidsoni gut and produces odours that attract adult beetles. More broadly, this configuration proved effective

______92 Chemical ecology of Carpophilus beetles and their yeast symbionts

and will be useful for the screening of key components in other Carpophilus species and emphasizes the need to consider the ecological background of insects and their semiochemicals to adapt and optimise GC-EAD methods.

4.1 Introduction

Insects exhibit olfactory sensitivity and specificity to volatiles originating from their hosts or mates (Andersson et al., 2009; Touhara & Vosshall, 2009). Sixty years ago, electroantennography consisting of recording of temporal variations of the potential between the tip and base of insect antenna during exposure to a chemical stimulus was pioneered to assist with the identification of semiochemicals (Schneider, 1957).

The technique was later combined with gas chromatography (GC-EAD), proving to be a remarkable tool for identifying subsets of biologically active compounds from the myriad of VOCs produced by plants and insects (Arn et al., 1975; Olson et al.,

2017; Yang et al., 2019). Electroantennography has been used to elucidate fundamental aspects of odour detection by the peripheral nervous system, and to develop new and effective insect pest management strategies based on insect olfaction (Gregg et al., 2018; Seybold et al., 2018). In addition to enabling improved volatile selection for lures, the technique has proven to be effective at identifying by- products or contaminants responsible for a decrease in lure efficiency, and helping to prevent a misinterpretation of insect behaviour (Kuwahara et al., 1984; Schorkopf et al., 2019; Tamaki et al., 1979). Moreover, the ability to use mass spectrometry (MS) in combination with classical GC-EAD system has greatly increased efficiency of classical systems (Weissbecker et al., 2004).

Carpophilus beetles (Coleoptera: Nitidulidae) are important pests of ripening stone fruits (Hossain et al., 2006; James et al., 1997), corn (Dowd, 2000) and stored

______Chemical ecology of Carpophilus beetles and their yeast symbionts 93 products (Dobson, 1954). Commercially available lures for ‘attract and kill’ and the monitoring of Carpophilus beetles are composed of synthetic odours made from previously identified aggregation pheromones together with a synergistic “co- attractant” of ripening and/or decaying fruit odours (Bartelt, Carlson, et al., 1993;

Bartelt et al., 1990; Bartelt, Seaton, et al., 1993; Zilkowski et al., 1999). Although,

GC-EAD has been previously carried out with other nitidulids such as the small hive beetle (Aethina tumida), strawberry sap beetle (Stelidota geminata) and the oak wilt disease vector (Colopterus truncatus) (Cha et al., 2011; Cossé & Bartelt, 2000;

Komen et al., 2019); there is no record of electrophysiological studies having been undertaken with any species of Carpophilus, and the development of synthetic blends of volatiles used for both the pheromone and yeast volatiles has to date relied entirely on behavioural assays, volatile sampling and chemical analysis, followed by field testing (Bartelt & Hossain, 2006; Bartelt & James, 1994).

Consequently, there has been no information available on the detection of key attractant compounds in Carpophilus antennae. GC-EAD recordings can occasionally be technically challenging to obtain from insects such as beetles due to their hard cuticle, the shape of their antennae and location of their olfactory sensillae

(Kingsolver, 1991; Merivee et al., 2002; Merivee et al., 2000; Merivee et al., 1997;

Schiestl & Marion-Poll, 2002). The aim of this study was to investigate and adapt

GC-EAD methods to overcome technical challenges that may have rendered electrophysiological recordings on Carpophilus beetles inaccessible to date. The study focused on the native Australian stone fruit pest Carpophilus davidsoni, for which both aggregation pheromones and a co-attractant have previously been developed and commercialized. Potential improvements on the existing lure deriving

______94 Chemical ecology of Carpophilus beetles and their yeast symbionts

from electrophysiological data would be highly beneficial to Australian fruit growers

(Hossain et al., 2009; James et al., 1997).

In preliminary experiments, electroantennography using pulsed chemical stimuli was carried out to determine how the best contacts from intact live-mounted insects could be achieved. GC-MS-FID-EAD was then proof-tested using commercial aggregation pheromones as positive controls. In the apparent absence of responses to the co- attractant (kairomones) using the same setup, Y-tube experiments in which the beetle antennae were either left intact or excised were carried out to verify the detection of co-attractant constituents via olfactory receptors located on antennae. Following this, post-chromatographic odour delivery at the interface between the GC and the EAG was optimised to make antennal responses to co-attractant compounds visible, and the possible negative impact of effluent humidification (routinely used in GC-EAD) was explored. Lastly, the optimised GC-MS-FID-EAD interface was used to screen volatiles produced by the attractive yeast (P. kluyveri).

4.2 Materials & Methods

4.2.1 Insects

Adults of C. davidsoni were obtained from a two-year old lab colony established from wild adults collected from commercial stone fruit orchards, and maintained at

AgriBio Centre (Melbourne, Australia). Both larvae and adults were fed on brewer’s yeast diet, commonly used as a culture medium for C. davidsoni (Dowd, 1987;

James & Vogele, 2000). Prior to all experiments, newly emerged beetles were sexed and starved for 24 h in a controlled environment room (CER) 16 L:8 D photoperiod, set at 28 ± 1 °C (photophase) and 20 ± 1 °C (scotophase), 60 ± 5% R.H.

4.2.2 Chemicals, co-attractant and pheromones

______Chemical ecology of Carpophilus beetles and their yeast symbionts 95

All chemicals except ethanol were purchased from Sigma Aldrich (Castle Hill,

NSW, Australia) with purities ranging from 98% to 99.5%. Test chemicals for EAG recordings were common microbial volatiles selected from three different groups including aldehydes (acetaldehyde, benzaldehyde), alcohols (isoamyl alcohol, 2- methyl-1-butanol, 1-hexanol) and esters (ethyl acetate, ethyl propionate, butyl acetate, isobutyl acetate, propyl acetate, isoamyl acetate, hexyl acetate, 2-phenylethyl acetate and benzyl acetate). A fresh solution of beetle co-attractant composed of acetaldehyde, ethanol, ethyl acetate, isobutanol, isoamyl alcohol and 2-methyl butanol (the same composition as the commercial co-attractant, carpophilus catcha

A+B, Bugs for Bugs, Australia) was prepared in the lab following Bartelt and

Hossain (2006)

A commercially available “tri-species” mix loaded on rubber septa, containing seven aggregation pheromones; namely (2E.4E.6E)-5-ethyl-3-methyl-2,4,6-nonatriene,

(3E.5E.7E)-6-ethyl-4-methyl-3,5,7-decatriene, (2E.4E.6E.8E)-3,5,7-trimethyl-

2,4,6,8-undecatetraene, (2E.4E.6E.8E)-7-ethyl-3,5-dimethyl-2,4,6,8-undecatetraene,

(2E.4E.6E.8E)-7-ethyl-3,5-dimethyl-2,4,6,8-decatetraene, (2E.4E.6E.8E)-3,5,7- trimethyl-2,4,6,8-decatetraene, (3E.5E.7E)-5-ethyl-7-methyl-3,5,7-undecatriene, identified from three species of Carpophilus beetles; C. davidsoni (Bartelt & James,

1994), C. hemipterus (Bartelt et al., 1990) and C. mutilatus (Bartelt, Carlson, et al.,

1993); was purchased from Bugs for Bugs (Australia) and used in experiments to test and optimise GC-MS-FID-EAD methods.

4.2.3 Electroantennography

Ice-chilled insects were immobilised in a 200 µL plastic micropipette tip with a cotton plug, allowing only the head and a quarter of the thorax to protrude. The

______96 Chemical ecology of Carpophilus beetles and their yeast symbionts

pipette tip was cut in an angle to form a bevel, to ventrally expose the beetle while keeping the forelegs inside the pipette (Fig. 4.1). Glass capillary electrodes (id 0.86 mm, od 1.5 mm, L 75 mm) were prepared using an electrode puller (PC-100,

Narishige, Japan) filled with an electrolyte solution (0.1 N Potassium chloride (KCl),

2% Polyvinylpyrrolidinone (PVP), (Sigma Aldrich, Castle Hill, NSW, Australia) were fitted on a silver wire placed on the EAG probes via electrode holders (IRN-5,

Ockenfels Syntech GmbH, Germany). EAG and FID signals were recorded using an

IDAC-4 A/D converter acquisition system (Ockenfels Syntech GmbH, Germany).

The hardness of the beetle cuticle did not permit even the sharpest of glass electrodes to penetrate through any part of the head, including the eyes. Instead, the reference electrode was inserted via the interstitial space formed between the cuticle of the head and thorax (in the “neck” area) while an angled-cut recording electrode that fitted the capitate-shaped beetle antennae was used to firmly hold the antenna, with one side of the distal flagellum fully exposed to the GC effluent (Fig. 4.1).

Test synthetic compounds diluted (10µg/µL) in paraffin oil (Sigma Aldrich,

Australia) were applied on odour cartridges that consisted of a glass Pasteur pipette

(15 cm long, 6 mm id), containing a piece of filter paper (0.6 cm × 2 cm, Whatman

No. 1) loaded with 10µL of diluted stimulus. A stimulus controller (CS-55,

Ockenfels Syntech GmbH, Germany) was used to apply a continuous charcoal- filtered and humidified airflow (0.5 L/min) through a 5 mm diameter glass tube, situated 5 mm above the antenna. Test odours were delivered by applying a pulsed air flow “puff” (0.5 sec) through the odour cartridge connected to a small hole near the end of the tube (3 cm away from the hole to the outlet of the tube).

______Chemical ecology of Carpophilus beetles and their yeast symbionts 97

Fig. 4.1 Ventral view of a live beetle (C. davidsoni) mounted in a pipette tip for electroantennography. The cut pipette tip forms a bevel providing support to facilitate the insertion of the reference electrode (left) under the cuticle; while the capitate-shaped distal end of the antenna is moistened by the recording electrode (right).

A minimum interval of 30 sec between different stimulations was allowed for antenna recovery. Stimulation with odour cartridges loaded with paraffin oil only were used as procedural control. Three female C. davidsoni beetles were used for

EAG recordings. Data acquisition and analysis were carried out using GC-EAD software (v.1.2.5, 2014, Syntech, Kirchzarten, Germany).

4.2.4 GC-MS-FID-EAD

Chemical analysis and GC-EAD recordings with pheromones, co-attractant and yeast volatiles were conducted using a gas chromatograph (Agilent 7890A) coupled with an Agilent 5977B single quadrupole mass spectrometer, a flame ionization detector

(FID) and an electroantennograph (EAD, as described earlier). The GC was equipped with a non-polar column SLB-5MS (30 m × 0.32 mm × 0.25 µm) used as

______98 Chemical ecology of Carpophilus beetles and their yeast symbionts

analytical column connected to a CFT splitter plate (Capillary Flow Technology,

Agilent) and different sets of inert capillary restrictors that determined the effluent ratios directed towards different detectors and allowed the synchronization of their respective signals. Helium was used as carrier and make-up gas maintaining a constant flow towards the mass spectrometer at 1 mL /min (while the flow towards the other detectors varied with GC oven temperature ramp. Initially, a split ratio of

1:1:1 (MS:FID:EAD) was achieved by using a 2.4 m long inert capillary restrictor of

0.15 mm inner diameter from the splitter plate to the MS, and two 0.72 m long restrictors (id = 0.15 mm) to the EAD and FID. Preliminary tests revealed no mass discrimination across FID and mass spectrometer acquired chromatograms between the start and end of the GC methods, confirming an equal split of the analytes between all detectors regardless of the unequal flow between restrictors. The setup was later modified in order to direct more of the effluent toward the antenna using a

1:1:5 ratio. This was achieved by replacing the EAG restrictor with a 0.83 cm long one (0.25 mm id) and the FID restrictor with a 0.54 cm long one (0.15 mm id).

Carpophilus lure headspace was collected by solid-phase microextraction (SPME;

DVB/CAR/PDMS, 50/30 µm fibre, Supelco) in 300 ml glass vessels by placing 50 ml of commercial solution in 100 ml beaker for the co-attractant or two rubber commercial septa for pheromones sampling. In both instances, the equilibration time was 10 min and collection time (fibre exposed to headspace) was 30 min. SPME injection was performed at 270°C for 0.5 min in split mode (split ratio 100:1 for co- attractant and 10:1 for pheromones) and the fibres reconditioned before reuse. Yeast volatiles (sampled as described below) extract (one microlitre) was manually injected in splitless mode.

______Chemical ecology of Carpophilus beetles and their yeast symbionts 99

The oven temperature program started at 30° C maintained for 2 min, then increased at 10° C/min to 250° C held for 3 min. Ionization was performed in EI mode (70 eV) and scan range was set between m/z 35 and 550. A 50 cm long transfer line

(Ockenfels Syntech GmbH, Germany) was used to heat up the restrictor (capillary tube) directing the eluting compounds to the EAG at 250° C. Only the last 2 mm of the restrictor protruded from the end of the transfer line terminating inside a mixing glass tube where analytes were entrained towards the insect antenna as they eluted from the restrictor by a stream of purified air. The airstream was initially humidified by bubbling in a gas wash bottle filled with distilled water which was subsequently removed to test beetles EAD response with non-humidified air. Likewise, the inner diameter of the mixing tube (8 mm) later replaced for a narrower one (3.8 mm) to lessen the dilution of analyte in the air stream keeping the air velocity constant at 29 cm/sec throughout all experiments

EAG data were acquired using the same GC-EAD software as for EAG recordings.

The FID signal was simultaneously recorded by the GC-EAD software and the GC-

MS acquisition software (MassHunter 8, Agilent Technologies) while mass spectrometer-acquired chromatograms and mass spectral data were recorded using

MassHunter only. Identification of co-attractant, pheromone and yeast volatile compounds was achieved by comparing their mass spectra with a NIST14 mass spectral library, their retention times to authentic standards when available (co- attractant and pheromones) and confirmed using Kovats indices calculated using a nC8-nC20 standard solution on the same column and under the same chromatographic conditions. Yeast volatiles were quantified by comparison of compound peak areas with peak areas of internal standards. namely n-octane for

______100 Chemical ecology of Carpophilus beetles and their yeast symbionts

compounds eluting between 3 and 10 min and nonyl acetate for those eluting after 10 min.

A total of five beetles of each sex were tested in each trial using the co-attractant or pheromones, while three beetles of each sex were used to test the yeast odour extracts. Isoamyl acetate or ethyl hexanoate were used as positive controls to test the quality of the contact prior to starting GC-EAD recordings.

4.2.5 Y-tube olfactometer experiment

Since beetles failed to exhibit GC-EAD responses to constituents of the co- attractants, behavioural experiments were conducted to verify that sensilla mediating the detection of these compounds were located on the antennae and not on other organs. Beetle responses to co-attractant volatiles were tested using a Y-tube glass olfactometer (ID: 2cm, 10 cm stem and 7.5 cm choice arm length, 70° angle between arms) placed on a thick white paper sheet inclined at a 30° tilt angle, taking advantage of the insect’s natural negative geotaxis. Both arms of the Y-tube were connected via glass connectors and PTFE tubing to air-tight glass chambers (internal volume 300 mL) in which, 50 mL glass beakers containing either 20 mL of co- attractant or the same volume of water (control). Activated charcoal-filtered air was pumped into the two glass chambers and delivered through each arm of the Y-tube at an equal flow of 400 mL/min. The experimental arena was illuminated from above by dimmable fluorescent light tubes (Fititron, Weiss Gallenkamp, UK). Light intensity at both ends of the two arms of the Y-tube was measured and adjusted to

990 lux using a digital lux meter (LX-1010B) and homogenised using a sheet of UV- permitting diffusing white screen paper (Rosco 216, Germany). Assays were conducted using intact beetles and beetles from which antennae were excised using fine-pointed forceps on ice-anaesthetised individuals. Beetles were subsequently ______Chemical ecology of Carpophilus beetles and their yeast symbionts 101 allowed to recover for at least an hour prior testing. Individual beetles were released in the olfactometer main stem using feather light forceps and observed for 10 min.

Beetles that crossed the middle of either test arm (4 cm inside the arm; empirically designated as a non-return point) were considered to have made a choice while those that did not respond within 10 min were categorized as non-responders and excluded from the dataset. Thirty beetles of each sex were tested in each experiment (with and without antennae). The position of the odour sources was switched every five beetles to prevent any positional bias. Y-tube and glass connectors were replaced every ten insects and used glassware was soaked in water and decon 90 (detergent), rinsed with clean water, and oven baked for 8 h at 250°C before re-use.

4.2.6 Yeast volatiles collection

Pichia kluyveri, a common yeast isolated from the digestive tract of C. davidsoni

(Baig et al., 2020), and for which beetle attraction was previously demonstrated in the field (Chapter 3) was selected to test the GC-MS-FID-EAD system. Yeast culturing on a peach agar substrate and collection of volatiles by dynamic headspace sampling were performed following the methods described in Baig et al. (2020).

Briefly, yeast volatiles were entrained on Porapak Q adsorbent filters (200 mg) for 8 h and liquid odour extracts subsequently recollected in 400 µL of dichloromethane used to elute the compounds from the adsorbent phase. Concentrated yeast volatile extracts were obtained by combining ten extracts into one evaporated down to 150

µL under a gentle stream of nitrogen. n-Octane (≧99%, puriss.; Sigma Aldrich,

Australia) and nonyl acetate (≧97%, FCC grade, Sigma Aldrich, Australia) used as internal standards to estimate the emission rates of different compounds were added to the extracts in the form of 20µL of a mixture prepared in dichloromethane

______102 Chemical ecology of Carpophilus beetles and their yeast symbionts

(≧99.9% residue analysis, Sigma Aldrich, Australia) making for 100 ng of each compound.

4.2.7 Statistical analysis

The response of C. davidsoni (with and without antennae) to the treatment lure and control (water) was analysed using a binomial test, assuming a distribution ratio of

1:1 as the null-hypothesis. Data analysis was performed using SPSS statistics (v25,

Armonk, NY: IBM Corp.).

4.3 Results

4.3.1 EAG responses

The insects remained alive for several hours, which allowed testing of multiple stimuli in EAG and recording of up to five successive GC-EAD runs. Female C. davidsoni exhibited responses of varying amplitudes to different test compounds. Of all volatile constituents of the co-attractants (that elicited higher amplitude of responses) only two constituents, namely acetaldehyde and isobutyl acetate, elicited responses of similar amplitudes to the paraffin oil (control).

4.3.2 GC-EAD responses to aggregation pheromones and to the co-attractant

All seven pheromone compounds elicited GC-EAD responses, as did three additional pheromone by-products (Fig. 4.3). Responses were consistent regardless of the beetles’ sex. However, and in contrast to EAG results, no consistent and/or only small responses were observed in the GC-EAD run using the co-attractant (Fig. 4.4): this suggested that either (i) the GC-EAD lacked sensitivity, or (ii) detection of these compounds was via other organs, such as tarsi or palps.

______Chemical ecology of Carpophilus beetles and their yeast symbionts 103

Fig. 4.2 EAG responses of female C. davidsoni to different chemical compounds.

Fig. 4.3 GC-EAD responses (using humidified air) of C. davidsoni to headspace volatile compounds from commercial pheromone septa. 1 to 5) Unidentified. 6) 3,5,7-trimethyl-2,4,6,8- decatetraene. 7) 5-ethyl-7-methyl-3,5,7-undecatriene. 8) 3,5-dimethyl-7-ethyl-2,4,6,8- decatetraene. 9) 3,5,7-trimethyl,2E,4E,6E,8E-undecatetraene. 10) Unidentified

______104 Chemical ecology of Carpophilus beetles and their yeast symbionts

Fig. 4.4 GC-EAD responses (using humidified air) of C. davidsoni to headspace volatiles collected from co-attractant. 1) Acetaldehyde. 2) Ethanol. 3) Ethyl acetate. 4) Isobutanol. 5) Isoamyl alcohol. 6) 2-Methyl butanol.

4.3.3 Evidence of the role of antennae in orientation towards the co-attractant

To address the lack of GC-EAD responses to co-attractant components, Y-tube olfactometer assays were undertaken to verify the use of antennae in the detection of these compounds. Responsiveness of beetles with intact antennae was significantly higher than that of beetles with excised antennae (P < 0.001). No significant difference between male and female choices was observed across all experiments (P

> 0.05) and therefore data from both sexes were pooled. Beetles with intact antennae exhibited significantly greater preference for the co-attractant over the water control

(P = 0.003) while beetles with excised antennae did not discriminate between the co- attractant and the control (P = 0.267) (Fig. 4.5). Hence, the results suggested the presence of olfactory sensilla on the C. davidsoni antennae tuned to detection of co-

______Chemical ecology of Carpophilus beetles and their yeast symbionts 105 attractant volatiles, providing evidence that a lack of sensitivity in GC-EAD may be causing the absence of electrophysiological responses for compounds other than pheromones.

Fig. 4.5 Preferences of C. davidsoni with intact (top) or excised (bottom) antennae to the co-attractant (green) or water control (blue) in Y-tube olfactometer experiments. Middle bars in white represent Non-Responsive (NR) beetles. Sixty beetles were released individually and the number of beetles that made a choice is presented within the bars. ** = P < 0.01, ns = non-significant.

4.3.4 GC-EAD recordings of the co-attractant applied in non-humidified air

Having confirmed in behavioural assays that beetles use their antennae to detect co- attractant volatiles, the GC-EAD setup was identified as the main reason for the apparent absence of responses to co-attractant volatiles. The set up was modified in several ways: the split ratio between different detectors was increased in favour of the EAG (1:1:5 split instead of 1:1:1); a lower diameter mixing tube was used to carry GC effluent to insect antennae; and dry air was used instead of humidified air for the transport of the analytes to the antennae—this latter modification turned out to be the most important factor influencing sensitivity. In contrast to the results obtained with humidified air, all six compounds of the co-attractant elicited consistent and repeatable antennal responses when purified non-humidified air was

______106 Chemical ecology of Carpophilus beetles and their yeast symbionts

used to transport GC effluents (Fig. 4.6). This clearly demonstrated the negative impact of humidification on the sensitivity of GC-EAD recordings. Even responses to compounds of the co-attractant such as acetaldehyde and isobutyl acetate that were not visible in EAG experiments became detectable in the absence of humidity.

Fig. 4.6 GC-EAD responses (using dry & humidified air) of C. davidsoni to headspace volatiles collected from the co-attractant. 1) Acetaldehyde. 2) Ethanol. 3) Ethyl acetate. 4) Isobutanol. 5) Isoamyl alcohol. 6) 2-Methyl butanol.

4.3.5 GC-EAD using yeast extracts

______Chemical ecology of Carpophilus beetles and their yeast symbionts 107

Volatile analysis of P. kluyveri extracts revealed the presence of 20 main volatile compounds (Table 4.1) dominated by esters (80% of the profile) followed by alcohols (15%), and ketones (5%). The main components were isoamyl acetate

(42%), 2-phenylethyl acetate (19%), ethyl acetate (17%), isobutyl acetate (15%), and propyl acetate (2%).

Among these compounds, GC-EAD experiments revealed 14 antennally active volatiles, all eliciting consistent and repeatable antennal responses in male beetles.

However, females responded to fewer compounds than males, with six compounds; namely; isobutanol, isoamyl alcohol, 2-methyl butanol, isoamyl acetate, 2- furanmethanol acetate and ethyl octanoate not eliciting any response (Table 4.1).

More importantly, beetle responses were yet again only visible when purified dry air instead of humidified air was used to carry the GC effluents to the antennae (Fig.

4.7).

______108 Chemical ecology of Carpophilus beetles and their yeast symbionts

Fig. 4.7 GC-EAD responses (using dry and humidified air) of C. davidsoni to headspace volatiles collected from the yeast, P. kluyveri. 1) Ethyl acetate. 2) Isobutanol. 3). Propyl acetate. 4) Isoamyl alcohol. 5) 2-Methyl butanol. 6) Isobutyl acetate. 7) Butyl acetate. 8) Isoamyl acetate. 9) 2- Furanmethanol acetate. 10) γ-Caprolactone. 11) Phenylmethyl acetate. 12) Ethyl octanoate. 13) 2- Phenylethyl acetate. 14) 2-Phenylethyl propionate. IS=Internal standard, IS1 = n-octane, IS2 = Nonyl acetate.

______Chemical ecology of Carpophilus beetles and their yeast symbionts 109

The lack of incorporation of GC-EAD into these studies is somewhat surprising, considering how powerful this technique has been for the discovery of

“behaviourally active” volatiles in other insects (Schott et al., 2013). Although absence of such data may have not significantly impacted the discovery of

Carpophilus beetle pheromones, which are discernible via direct comparisons of male and female beetles headspaces, electrophysiology could be highly beneficial for the identification of synergistic kairomone attractants present in complex food odour mixtures (commonly referred to as a “co-attractant”). Carpophilus co-attractants have, to date, been developed solely on the basis of headspace analysis of decaying fruits or yeasts without insights into the insect’s selective sensitivity to compounds present in these odours. Consequently, chances of overlooking attractants occurring at low concentrations in these microbial odours are fairly high. In this study, electrophysiological recordings with C. davidsoni, a native pest of ripening fruits in

Australia, were successfully implemented to enable further study regarding detection and relative sensitivity to host (fruit / yeast) volatiles and pheromones.

The insect mounting method used for electrophysiological recordings developed here differs from that used in other studies. The toughness of the beetle’s cuticle is often problematic for the insertion of the reference electrode, which has led previous studies to either use decapitated insects (Cossé & Bartelt, 2000) or excised antennae

(Torto, Boucias, et al., 2007). Alternatively, electrolytically sharpened tungsten wire has been used to make a hole in beetle’s thorax before inserting the electrode

(Balakrishnan et al., 2017). These methods are less than ideal in that they negatively impact the quality of the contact and reduce the life of the antenna. Here, live mounts were preferred, using angled cut pipette tips to facilitate the penetration of the electrode through the neck region. This method enabled recordings from the same

______Chemical ecology of Carpophilus beetles and their yeast symbionts 111 insect for sometimes several hours, allowing for up to five consecutive GC-EAD runs. The only downside of using live mounts was the beetle’s tendency to move its antennae, causing loss of contact during GC-EAD recordings. However, allowing more time for the insect to settle after the insertion of the electrodes, and increasing the concentration of polyvinylpyrrolidinone (PVP) in the electrolyte solution, appeared to mitigate this problem. Another challenge resided in the position of olfactory sensilla commonly located on the distal part of the antennae flagellum

(Andersson et al., 2009; Kandasamy et al., 2019) causing recording electrodes to limit their exposure to the odorants (Bartlet et al., 2004; Komen et al., 2019). Here, angled cut recording glass electrode proved sufficient to support the antennae, at the same time maximising the exposure of olfactory sensilla to chemical stimuli.

Preliminary testing of the mounting method confirmed the detection of known host volatile attractants acetaldehyde, ethanol, ethyl acetate, 2-methyl-1-butanol, isoamyl alcohol, propyl acetate and 2-phenylethyl acetate (Bartelt & Hossain, 2006; Nout &

Bartelt, 1998; Zilkowski et al., 1999) by C. davidsoni. Interestingly, these compounds were previously shown to elicit EAG responses in the small hive beetle

(Torto, Boucias, et al., 2007; Torto et al., 2005), while responses to two propyl acetate and 2-phenylethyl acetate have not been previously reported in this genus.

Strong antennal responses elicited by the beetle’s aggregation pheromones were demonstrated by GC-MS-FID-EAD. Unlike the co-attractant, these responses were observed irrespective of the presence or absence of humidified air at the interface between the GC and the EAG. Strong response amplitudes evoked by pheromones most likely reflect the presence of greater numbers of pheromone receptors compared to receptors associated with host-related volatiles (Andersson et al., 2009)

______112 Chemical ecology of Carpophilus beetles and their yeast symbionts

or greater affinities of olfactory receptors for the pheromone compared to host related VOCs (Hansson et al., 1989; Law & Regnier, 1971; Subaharan et al., 2013).

Among all pheromones tested, only four were specific to C. davidsoni (Bartelt &

James, 1994). However, C. davidsoni antennae responded to all seven compounds present on the pheromone lure tested. This is not so surprising, considering that closely related beetles species were previously shown to share pheromones, while antennal responses to compounds presenting structural similarities with pheromones are not uncommon either (Cossé & Bartelt, 2000; Hansson et al., 1989; Zhao et al.,

2019). In addition, C. davidsoni responded to three by-products emanating from pheromone septa, demonstrating how GC-EAD could also help screening for impurities or potential by-products interferences. Pheromone by-products negatively affect the trap catches of target insect pests (Hardie et al., 1997). Impurities, even in trace amounts, can obscure an understanding of the relationship between ligands and receptors (Schorkopf et al., 2019).

The apparent absence of responses to kairomones exhibited by C. davidsoni in preliminary GC-EAD attempts begged the question as to whether these compounds are detected by olfactory receptors located on the antennae. Y-tube olfactometer assays combined with EAG recordings confirmed that this is the case, and suggested that greater concentrations of the odour ligands may be required to produce visible and consistent antennal responses in GC-EAD using kairomones compared to pheromones. The current study showed that successful GC-EAD recordings of C. davidsoni with kairomones can be obtained by i) changing the split ratio (1:1:5) between MS, FID and EAD from (1:1:1) to (1:1:5), so that greater concentrations of volatiles are directed post-chromatography to the EAD effluent, ii) minimizing in situ dilution of the effluent by employing a mixing tube of narrower diameter

______Chemical ecology of Carpophilus beetles and their yeast symbionts 113

(reduction of the volume of air used to carry the effluent toward the antenna, while keeping similar air velocity) and iii) using non-humidified airflow to direct chemical effluents onto the insect antenna. Most GC-EAD studies commonly use humidified air (Arn et al., 1975; Chen et al., 2019; Komen et al., 2019) as way to cool down the effluent exiting the GC-transfer line (Arn et al., 1975). However, the absence of humidity appeared in this instance to be crucial to eliciting EAD responses with

Carpophilus beetles. To my knowledge, this is the first report of a negative impact of effluent humidification in GC-EAD.

The possible reasons for an absence of antennal responses in C. davidsoni to non- pheromonal compounds with humidified air may be linked to the presence of hygroreceptors on the distal part of beetle’s antennae (Arbogast et al., 1972), which may have masked the responses of chemoreceptors thus causing a decrease of signal- to-noise ratio. Alternatively, Carpophilus beetle antennae may house hygroreceptors and chemoreceptors in the same sensillum (Bernard, 1974); hygroreceptors working antagonistically to chemoreceptors in a similar way to dry and moist receptors demonstrated in other insects (Altner & Loftus, 1985; Merivee et al., 2010)Antennal morphological and physiological studies on Carpophilus beetles are needed to further understand how the size, shape, and location of olfactory sensilla, and number of olfactory receptors compared to other receptors (e.g. hygro- and mechanoreceptors), influence their EAG responses.

GC-EAD runs involving P. kluyveri yeast odours showed that both male and female

C. davidsoni antennae responded to all predominant esters present in headspace of the yeast, except isoamyl acetate which was only detected by males (Fig. 4.7). Other differences in responses between males and females demonstrate a sexual

______114 Chemical ecology of Carpophilus beetles and their yeast symbionts

dimorphism in olfactory sensitivity to microbial volatiles. The ability to discern more complex odour blends in males compared to females concurs with existing knowledge on the ecology of these beetles that suggest that males play a crucial role in host finding (dispersal and foraging). This hypothesis aligns with the male emission of aggregation pheromones shortly after settling on a newly found host

(Hossain et al., 2006). Interestingly, males and females C. davidsoni both exhibited stronger responses to 2-phenylethyl acetate, the second most abundant volatile compound in the odour profile of P. kluyveri.

The GC-EAD recordings using P. kluyveri yeast confirm that the technical adjustments allow screening of complex odour blends in these insects. This will enable the discovery of new potential candidate attractants and fast-track the development of better lures. In addition, comparative GC-EAD studies across different Carpophilus species could lead to a better understanding of the evolution and specialization of their olfactory system. From an applied perspective, such knowledge could contribute to tailoring lures to better target pest species, thus preventing high catches of non-target species.

______Chemical ecology of Carpophilus beetles and their yeast symbionts 115

Chapter 5: A new lure for Carpophilus beetles attacking almonds using

semiochemicals derived from a mutualistic yeast

______116 Chemical ecology of Carpophilus beetles and their yeast symbionts

5.1 Abstract

Carpophilus near dimidiatus is an emerging threat to Australia’s billion dollar almond industry, with pest populations on the increase and no effective control measures in place. Attract and kill mass trapping is used to help control other

Carpophilus species which attack stone fruits, but the attractant lure that is central to this trapping strategy is ineffective against this almond attacking species. Here, knowledge of Carpophilus chemical ecology, specifically the mutualistic relationship between the beetles and their gut associated yeasts, is applied to developing a new attractant for C. near dimidiatus. Identification of C. near dimidiatus gut-associated yeasts revealed the predominant species to be

Wickerhamomyces rabaulensis. In field bioassays, traps baited with live cultures of

W. rabaulensis captured more beetles than traps baited with another yeast,

Hanseniaspora guilliermondii, isolated from stone fruit attacking Carpophilus species. GC-MS analysis revealed both qualitative and quantitative differences between the odour profiles of the two yeast species. Having identified seven volatile compounds for a blend mimicking the odour of W. rabaulensis, each of the volatiles were screened for detection by the insect antennae using gas chromatography coupled with electroantennography (GC-EAD) technique and found consistent EAD responses for all volatiles. Two choice bioassays testing the W. rabaulensis synthetic blend against a commercially available lure used to control stone fruit attacking

Carpophilus species showed that adult beetles preferred the W. rabaulensis blend.

Field trials testing several formulations based on W. rabaulensis volatiles indicated that a modified version of the commercial lure containing two additional volatiles, isoamyl acetate and isobutyl acetate, was not only more attractive to C. nr. dimidiatus but caught fewer of a non-target species, C. hemipterus. The study has

______Chemical ecology of Carpophilus beetles and their yeast symbionts 117 developed a new powerful attractant to be used as a synergistic “co-attractant” alongside beetle pheromones in attract and kill systems for monitoring and mass trapping C. nr. dimidiatus in almond orchards.

5.2 Introduction

Symbiotic relationships between microbes and insect communities can play an important role in insect-plant interactions (Douglas, 2011; Gonzalez, 2014; Shikano et al., 2017). Beetles are well known for their mutualistic associations with yeasts, including Carpophilus beetles (Miller & Mrak, 1953), bark beetles (Zhao et al.,

2019), and small hive beetles (Torto, Boucias, et al., 2007). Where yeast-insect interactions are mutualistic, yeasts often serve as food for adult and larval insects

(Baig et al., 2020; Herrera et al., 2010; Klepzig et al., 2009), producing species- specific volatiles that attract the adults (Scheidler et al., 2015). In return, the insect may act as a vector for dispersal of the yeast, and provide a suitable environment for yeast growth, such as with gut associated yeast species (Jackson & Nicolson, 2002;

Lachance et al., 2001; Stefanini, 2018). This yeast-insect interaction can potentially be exploited in controlling insect pests in “Attract and Kill” strategies (Davis et al.,

2013; El-Sayed et al., 2005; Hamby & Becher, 2016; Kuhns et al., 2014). For example, in a recent field study on yellowjacket wasps, gut-associated yeast species

Hanseniaspora uvarum and Lachancea thermotolerans, and synthetic blends based on yeast odour emissions, were attractive to western yellowjacket, Vespula pensylvanica (Babcock et al., 2019). Small hive beetles are known to vector a yeast,

Kodamaea ohmeri, which significantly increases trap catches of beetles when baited with pollen dough (Hayes et al., 2019; Torto, Arbogast, et al., 2007). In Carpophilus beetles, the model yeast Saccharomyces cerevisiae was used to develop a lure for stone fruit attacking species (Bartelt & Hossain, 2006), and in a recent study ______118 Chemical ecology of Carpophilus beetles and their yeast symbionts

volatiles from ecologically associated yeasts were shown to be more attractive to beetles than S. cerevisiae (Chapter 3).

In 2014/15, the Australian almond industry began to suffer severe losses from a species of Carpophilus beetle that differed from Carpophilus species attacking stone fruit and pome fruit crops. This newly identified insect was morphologically and genetically similar to another species, C. dimidiatus, and yet sufficiently dissimilar to be considered as a different species; and thus temporarily named Carpophilus near dimidiatus (Hossain, 2018) pending its complete description and final classification.

Carpophilus near dimidiatus attacks almonds at the “hull-split” stage, and damage to kernels can cause 5-10 % annual loss to almond industry. In 2018, Carpophilus damage was estimated to be over $11 million in Victoria alone, with the beetles present in almost 70 % of almond plantings (Hossain, 2018). Although other

Carpophilus species, C. davidsoni and C. hemipterus, also exist in almond orchards but only C. nr dimidiatus was found in the affected kernels (Hossain, 2018). Existing mass trapping “attract and kill” strategies designed for controlling Carpophilus species in stone fruit are not effective for C. near dimidiatus in almond orchards, most likely because the attractant lure that is central to this trapping strategy—a synergistic combination of beetle pheromones and “host odours” (referred to as the co-attractant) (Bartelt et al., 1992)—is ineffective against this almond attacking species (Hossain, 2018).

In previous work, isolation and identification of gut-associated yeasts in Carpophilus species, and subsequent analysis of the species-specific yeast volatiles, enabled the development of new, more powerful Carpophilus attractants (Baig et al.,

2020)(Chapter 3). Moreover, recently developed GC-linked electroantennography

______Chemical ecology of Carpophilus beetles and their yeast symbionts 119

(GC-EAD) has enabled rapid screening of odours for volatiles that are detected by the Carpophilus antennae (Chapter 4), enabling selection of behaviourally active volatiles for this genus. Here, all these techniques are brought together to develop a new yeast-volatile based co-attractant lure for C. nr dimidiatus.

5.3 Materials and Methods

5.3.1 Insect collection & culturing

Carpophilus near dimidiatus were collected from a commercial almond orchard in the Sunraysia region of southern Victoria, Australia. Live adult beetles were collected in sterile tubes (5 mL) from around 400 mummified nuts collected from trees and ground. Beetles were identified using a taxonomic key (Leschen & Marris,

2005).

Beetles for electrophysiological and laboratory behavioural experiments were obtained from a continuous colony (1 year old i.e. 13th generation), maintained on an almond-soymeal diet in an incubator (25°C, 50-60 % RH and 15:9 light:dark photoperiod). All behavioural experiments were performed under similar environmental conditions.

5.3.2 Yeast isolation, identification & culturing

Methods for yeast extraction from the beetle’s gut, yeast DNA extraction, PCR amplification, phylogenetic analysis and yeast culturing were as detailed in Baig et al. (2020). Nucleotide sequences were submitted to GenBank with accession numbers MG813548- MG813553.

5.3.3 Chemicals

______120 Chemical ecology of Carpophilus beetles and their yeast symbionts

Volatile mixtures for synthetic lures based on W. rabaulensis and the commercially available lure for Carpophilus beetles (carpophilus lure (CL)) (Bartelt & Hossain,

2006) were freshly prepared for behavioural experiments. All the chemicals (except ethanol), including acetaldehyde, ethyl acetate, isobutanol, isoamyl alcohol, 2- methyl-1-butanol, isoamyl acetate and isobutyl acetate were purchased from Sigma

Aldrich (Castle Hill, NSW, Australia) with purities ranging from 98% to 99.5%.

5.3.4 Field traps using live yeast cultures

Field trials assessing the attractiveness of different yeast species to adult

Carpophilus beetles were performed in a commercial almond orchard in Mildura, northwest Victoria, Australia. Treatments were arranged in randomized transects with a minimum of 16 m distance between traps. Traps were hung at height of 1.5-2 m on a single tree, in a row of non-pareil variety of almond (the preferred variety for

C. nr dimidiatus (Hossain, 2018)). The experiment was performed 4 weeks before the hull split stage of almonds, to ensure the presence of beetle activity in the orchard. Traps were serviced weekly by replacing the old yeast cultures with fresh cultures and collecting all trapped beetles for identification. Experiments were run for two weeks, for a total of 20 replicates per treatment.

Two yeast species were field-tested for their attractiveness to C. nr dimidiatus: (i)

Wickerhamomyces rabaulensis, which was isolated from the gut of C. nr dimidiatus, and (ii) Hanseniaspora guilliermondi, isolated from the gut of stone fruit attacking

Carpophilus species, C. davidsoni & C. hemipterus, and found to be highly attractive to these two beetle species in cage bioassays (Baig et al., 2020). Yeasts were revived from cryopreserved stocks stored in 30% glycerol at -80 °C, streaked on PDA plates, then incubated for 24 h. Diluted yeast cultures were incubated to high density

______Chemical ecology of Carpophilus beetles and their yeast symbionts 121 inoculums with similar optical densities. These inocula were cultured on sabouraud dextrose broth (SDB) prepared from 10gm/L proteose peptone (Bacto) and 40gm/L dextrose sugar. 5 mL sterile plastic vials were used to transfer the active yeast cultures to the orchard in a refrigeration box with ice packs.

Yeast traps: 50 mL of sterile SDB in a 70 mL plastic container was inoculated with 5 mL of high-density cultures of either yeast, and then containers were covered with muslin cloth secured with rubber band. Sterile SDB was used as a control. These treatment containers were placed inside a BioTrap (Broughton & Rahman, 2017), which is a McPhail trap design, and the bottom of the trap was levelled and blocked with Blu-Tack to prevent escape of trapped beetles. A cube (1 x 1 cm2) of 2,2- dichlorovinyl dimethyl phosphate (DDVP) insecticide (Killmaster zero, Barmac

Industries Pty. Ltd., Queensland, Australia) was placed inside the BioTrap to kill trapped beetles.

5.3.5 Volatile analysis

Yeast cultures were prepared (as detailed in Baig et al. (2020)) in a 30 mL glass beaker containing 15 mL of SDB inoculated with one yeast species and incubated for

72 h at 28 ºC. Sterile SDB was used as a control. Volatiles were collected using dynamic headspace and static headspace sampling methods. For dynamic headspace sampling, two cups from each treatment were placed in 3 L glass flasks. Air purified through a 500 mL gas wash bottle filled with activated charcoal (8-20 mesh,

Supelco, USA) was drawn into one end of the flask at 500 mL/min. Volatiles were collected at an outlet on the opposite side of the flask using a Porapak Q adsorbent phase (80 mesh, 100 mg, Supelco, USA) packed in a glass Pasteur pipette (4 mm inner diameter) and held in place between two silanized glass wool plugs.

______122 Chemical ecology of Carpophilus beetles and their yeast symbionts

Collections were run for 8 h, after which volatiles were eluted from the Porapak Q with 400 µL of dichloromethane (≧99.9% residue analysis, Sigma Aldrich,

Australia). For quantification purposes, 2 µg of n-octane (≧99%, purity; Sigma

Aldrich, Australia) and nonyl acetate (≧97% FCC grade, Sigma Aldrich, Australia) were used as internal standards, added to the samples by spiking 20 µL of a solution prepared earlier containing the two components in dichloromethane. For static headspace sampling, volatile analysis was performed using solid-phase microextraction (SPME) (DVB/CAR/PDMS, 50/30 µm fibre, Supelco) to detect early eluting components (covered by the solvent peak when using volatiles extracts in solvent). The needle of the SPME holder was inserted through aluminium foil covering the jar (as used for dynamic headspace sampling) and the fibre was exposed inside the jar for 30 min. Sample desorption inside the gas chromatograph (GC) injector port was performed for 0.5 min in split mode (split ratio 10:1) and the fibre was reconditioned at 250°C for 10 min before reuse. For SPME headspace sampling, one year old yeast cultures stored at -80 °C were used.

Samples obtained from dynamic headspace collection were analysed by GC-MS on an Agilent 7890A gas chromatograph coupled with Agilent 5997B single quadrupole mass spectrometer equipped with a non-polar column DB-5MS (30 m × 0.25 mm ×

0.25 µm). Helium was used as carrier gas. A micro-syringe was used to inject 1.5 µL of each sample. Injection was performed in split mode (split ratio 20:1) at 250°C.

Initial oven temperature was set at 30 °C held for a minute before increasing at

10°C/min to 200°C, and then to 250°C at 20°C/min, and maintained for 2 minutes.

Ionization was performed in EI mode (70 eV) and scan range was set between m/z:

35-550. Quantification was calculated by comparing peak areas of compounds eluting between 2.6 and 10 min with peak area of n-octane. Whereas the peak areas ______Chemical ecology of Carpophilus beetles and their yeast symbionts 123 of compounds eluting after 10 min were compared to that of nonyl acetate.

Identification was achieved by comparing compounds mass spectra to that of a

NIST14 mass spectral library, and confirmed using Kovats indices calculated on non-polar (DB-5MS) (Agilent). For the samples obtained from static headspace method, another non-polar column SLB-5MS (30 m × 0.32 mm × 0.25 µm) was used.

5.3.6 GC-EAD responses of C. nr dimidiatus to a synthetic blend based on W. rabaulensis

Gas chromatography coupled with mass spectrometer, flame ionization detector and electroantennographic detector (GCMS-FID-EAD) was used to measure electrophysiological activity in C. nr dimidiatus antennae towards volatiles present in the W. rabaulensis synthetic blend. GCMS-FID-EAD methods are described in

Chapter 4. The GC-MS set up was similar to that used for static headspace sampling of yeast broth, but with the electroantennograph detector (EAD) based on an IDAC-4

A/D converter acquisition system (Syntech) attached. A split injection mode (split ratio 10:1) was established and maintained at 270° C. The oven temperature programme was initiated at 30° C for 2 min, increased at 10° C/min to 250° C, and this temperature was held for 3 min. Ionization was performed in EI mode (70 eV) and scan range was set between m/z: 35-550. At the end of the analytical column, the column effluent was split between MS, FID and EAG in a 1:1:5 ratio respectively, using a CFT splitter plate (Capillary Flow Technology, Agilent) and inert capillary restrictors (to MS: id = 0.15mm, L = 2.396m; to FID: id = 0.15mm L = 0.540m; to

EAG: id = 0.25mm L = 0.0.833m). Helium was used as the make-up gas in constant flow towards the mass spectrometer (1 mL /min), while varying equally between the

______124 Chemical ecology of Carpophilus beetles and their yeast symbionts

other detectors. A 50 cm long transfer line (Ockenfels Syntech GmbH, Germany) was used to heat up the restrictor (capillary tube) directing the eluting compounds leaving the GC oven, towards the EAD. Only the last 2 mm of the restrictor was allowed to protrude from the end of the transfer line terminating inside a mixing glass tube (id 3.8 mm) where analytes were vertically entrained towards the insect antenna by a stream of purified dry air at 29 cm/sec. Data acquisition and analysis were carried out using the GC-EAD software (v.1.2.5, 2014, Syntech, Kirchzarten,

Germany).

Volatile collection and ID: 50 mL of a synthetic blend of W. rabaulensis, in an 80 mL glass beaker, was placed inside a glass chamber (300 mL). Equilibrium time was

10 min after sealing the chamber with parafilm. Headspace volatile collection was performed by solid-phase microextraction (SPME) (DVB/CAR/PDMS, 50/30 µm fibre, Supelco) as mentioned above. Identification of volatile compounds was achieved by comparing compounds mass spectra to that of a NIST14 mass spectral library, and confirmed using Kovats indices calculated on non-polar (SLB-5MS) column. Yeast volatile compounds were identified by calculating retention indices of

GC-FID peaks relative to n-alkanes on SLB-5MS column and confirmed by comparing with mass spectra and GC retention times of authentic standards on the same column.

Antennal preparation: Insects were prepared following the methods in Chapter 4 .

Ice-chilled insects were mounted in an angle-cut 200 µL plastic micropipette tip forming a bevel in which they were immobilised using a cotton plug, allowing only the head and a quarter of thorax to protrude through the tip. This way, the ventral side of the beetle could be exposed with the forelegs remaining inside the tip. Glass capillary electrodes (id 0.86 mm, od 1.5 mm, L 75 mm) were prepared using an ______Chemical ecology of Carpophilus beetles and their yeast symbionts 125 electrode puller (PC-100, Narishige, Japan) filled with an electrolyte solution (0.1 N

Potassium chloride (KCl), 2% Polyvinylpyrrolidinone (PVP), Sigma Aldrich, Castel

Hill, NSW, Australia) and fitted on a silver wire connected to an EAD setup (model,

Ockenfels Syntech GmbH, Germany) linked to an IDAC-4 A/D converter acquisition system (Ockenfels Syntech GmbH, Germany). Since the beetle cuticle hardness did not allow for even the sharpest glass electrodes to penetrate through any part of the head, including the eyes; the reference electrode was inserted via the interstitial space formed between the cuticle of the head and thorax (in the “neck area”) while the angled-cut recording electrode was made to fit the capitate-shaped beetles’ antennae keeping one side of the distal flagella completely exposed to the ambient air. A total of five beetles of each sex were tested. The set up was tested with isoamyl acetate or ethyl hexanoate, which are known to generate electroantennogram responses in these beetles (Chapter 4).

5.3.7 Attraction of C. nr dimidiatus to synthetic blends in dual choice cage assays

Dual choice cage assays were conducted in a controlled environment room (CER)

(28°C, 50-60 % RH and 15:9 light:dark photoperiod) using a synthetic blend based on W. rabaulensis (WB), and the commercial carpophilus lure (CL). The concentration of volatiles in WB mimicked the release rates from W. rabaulensis yeast broth. In a second synthetic WB blend, the concentration of each volatile was increased 10 times such that the absolute concentrations were similar to the commercial lure, CL. Traps were assembled using 30 mL plastic cups, piercing 4 equidistance holes around the sides of the cup and one hole at the centre of lid. 15 mL of each treatment was used in each trap. Two-week old mixed populations of male and female (100 in total) beetles, 48 h old and deprived of food, were released ______126 Chemical ecology of Carpophilus beetles and their yeast symbionts

into a Bugdorm cage (30 x 30 x 30 cm) containing traps with treatments. As beetles were observed aggregating in the corners of the cage, treatments were placed in a straight line in the centre of the cage, with 20 cm distance between each treatment.

The position of each treatment group (left & right) was rotated with each replicate (N

= 10 replicates). Beetles were left undisturbed for 48 h, after which the numbers of beetles in each trap were counted. The experiment was run over 2 days using new insects in each replicate (totalling 1000 beetles). After each experiment, cages were wiped with 70% ethanol and air-dried overnight before re-use.

5.3.8 Field traps using synthetic blends

Synthetic lures were tested in two commercial almond orchards (variety: Non-pareil) in Mildura, Victoria. Treatments were arranged in 6 randomized transects in each orchard. Black funnel traps (23 x 17 cm, Bioglobal, Queensland, Australia), held in a metal ring fixed to a metal fence picket at a height of 1.5 m from the ground were used. A cube (1.5 x 1.5 cm2) of insecticide (DDVP) was placed inside the traps to kill captured beetles. 200 mL of a co-attractant formulation was placed in an open

400 mL plastic container (9 cm diameter) covered with mosquito netting to prevent beetle entry. Distance between the traps was 30 m. Traps were serviced weekly, replacing the synthetic blend and collecting beetles. Experiments were run for four weeks. All field collected beetles were identified as mentioned above.

In field trials, the following four treatments (formulations) were tested. 1) W. rabaulensis synthetic blend (WB1x); 2) W. rabaulensis synthetic blend at 30 times concentrated (WB30x); 3) The commercial carpophilus lure (CL); 4) A modified CL

(CL+Esters), which included esters, isoamyl acetate and isobutyl acetate from treatment 2.

______Chemical ecology of Carpophilus beetles and their yeast symbionts 127

Description of each treatment is provided in supplementary material (see supplementary Table 5.1).

5.3.9 Statistical analysis

Trap counts were analysed as the mean number of beetles caught / week for each treatment. Data collected in field assays did not show a normal distribution (Shapiro-

Wilk test and skewness & kurtosis test, P < 0.05) and was overdispersed, therefore I used negative binomial generalised linear model using the glm.nb() function from the MASS package. I constructed a model using the number of beetles as the dependent variable, with treatments and orchards and their interaction (treatments × orchards) as explanatory variables. As there was no significant difference in number of beetles trapped between the two orchards, the data from the two orchards were combined. The significance of explanatory variables was assessed using 2 Wald statistics. When significant effects were found, post hoc pairwise comparisons were made using Tukey’s HSD test in ‘multcomp’ package. For dual choice cage bioassays, the null hypothesis that C. nr dimidiatus showed no preference for either of the choices (i.e., 50:50 response) was tested using the Wilcoxon Signed Ranks

(WSR) test. Unresponsive individuals were not included in the analysis. All data analysis was carried out using (R, v.3.6.0)(Team, 2013).

Volatile analysis: Free statistical package PAST version 3.15 (Hammer et al., 2001) was used to analyse volatile data. Due to the extensive number and diversity of compounds detected, only the most consistently found volatiles that accounted for at least 1% of the chemical profile of any of the treatments were considered. Quantities of shortlisted compounds were used as variables for ordination by non-metric multidimensional scaling (NMDS) based on a Bray-Curtis dissimilarity matrix.

______128 Chemical ecology of Carpophilus beetles and their yeast symbionts

ANOSIM using the same type of matrix was used to test for dissimilarities between treatments. Pairwise comparisons were made using sequential Bonferroni corrections. SIMPER analysis was subsequently performed to determine which compounds were responsible for major differences in chemical profiles.

5.4 Results

5.4.1 Yeast diversity in C. nr dimidiatus gut

In total, 12 yeast isolates from the guts of 12 individuals were characterized by sequencing their D1/D2 and ITS1-ITS2 regions of rRNA genes. Phylogenetic analysis of the 12 isolates with previously described exemplar taxa revealed that yeasts were distributed into 3 clades throughout the phylogenetic tree (Fig. 5.1). Two isolates were assigned to tentative species while one isolate was identified to genus level. The yeasts isolates were associated with two genera, Wickerhamomyces and

Candida. The most frequently isolated yeast species was Wickerhamomyces rabaulensis representing 84% of the total isolated yeast species. The other two yeast species, which were found less consistently, were Wickerhamomyces ciferrii and an unidentified Candida species. We selected the most prevalent species, W. rabaulensis, for further investigation.

5.4.2 Field traps using live yeast cultures

A total of 103 C. nr dimidiatus beetles were captured in the field traps baited with W. rabaulensis (Wr) or H. guilliermondii (Hg) yeast broths or a sterile broth (SDB)

2 control. Trap catches were significantly different among treatments (χ (2) = 46.1,

______Chemical ecology of Carpophilus beetles and their yeast symbionts 129

Fig. 5.1 Phylogenetic relationships among type species of ascomycetous yeast genera and reference taxa determined from ML (Maximum Likelihood) analysis using concatenated gene sequences for ITS1-ITS2 and D1/D2 regions of rRNA genes. Fellomyces penicillatus and Bullera albus were designated outgroup species. Coloured taxa names are isolates identified in this study. Tentative species ID is given as the top match from BLASTn search. The percentage after taxa name relates to the relative abundance of the yeast species [summed across all insects sampled]. Bootstrap values > 50 are given at branch nodes (1000 replicates). The tree with the highest log likelihood (-4736.5184) is shown. A discrete Gamma distribution was used to model evolutionary rate differences among sites (4 categories (+G, parameter = 0.2710)). The analysis involved 23 nucleotide sequences. All positions containing gaps and missing data were eliminated. There was a total of 810 positions in the final dataset. Bar, 20 % sequence difference.

______130 Chemical ecology of Carpophilus beetles and their yeast symbionts

P < 0.05; Fig. 5.2).

The mean number of adults caught using the W. rabaulensis broth was significantly greater than H. guilliermondii (Wr = 2.12 ± 0.5, Hg = 0.35 ± 0.1, P < 0.05) and sterile broth traps (SDB = 0.1 ± 0.06, P < 0.05). Differences in attraction were not significant between SDB inoculated with H. guilliermondii and sterile (P > 0.05).

Fig. 5.2 Field trapping of C. nr dimidiatus in almonds using different yeasts as baits. Wr = Wickerhamomyces rabaulensis, Hg = Hanseniaspora guilliermondii, SDB = sterile (Sabouraud dextrose) broth. N = 20 traps per treatment. Different letters indicate statistical significance at P < 0.05, Tukey HSD.

5.4.3 Volatile analysis

Analysis of the headspace odour of sabouraud dextrose broth (SDB) showed low emissions of a single compound, 1, 4-diethyl, benzene. This compound was found in all treatments although the emission rates varied in the presence of yeasts.

Differences in headspace odour composition among the three treatments (Wr, Hg, C)

______Chemical ecology of Carpophilus beetles and their yeast symbionts 131

were identified using multivariate analysis. Significant differences were found in the chemical profiles of the three treatments (R = 1, P < 0.001; ANOSIM), and between all treatment groups (W. rabaulensis vs H. guilliermondii, P = 0.0249; W. rabaulensis vs SDB, P = 0.0225 and SDB vs H. guilliermondii, P = 0.0246; all P values used were Bonferroni-corrected)(Fig. 5.3b). SIMPER analysis revealed that approximately 85% of the dissimilarities between the two yeasts resided in the emissions of 11 compounds; namely 3-methyl-1-butanol (~12%), 1-butanol, 3- methyl-, acetate (~11%), 2-methyl-1-butanol and isobutyl acetate (~9%), 2-methyl-

1-propanol (~8%), ethyl acetate (~7%), acetic acid, 2-phenylethyl ester (~6%), propanoic acid, ethyl ester and acetic acid, ethyl ester (~5%), 1-butanol, 2-methyl-, acetate and acetic acid, butyl ester (~4%) (Fig. 5.3a and Supplementary Table 5.2).

SPME analysis revealed emissions of acetaldehyde and ethanol, which were masked by the solvent peak in dynamic headspace collection. Both of these compounds were produced by the SDB inoculated with either of the yeast species, but only ethanol was produced by sterile SDB. Other compounds, including four esters (and notably ethyl acetate) were also detected in the headspace of W. rabaulensis yeast (see supplementary material; Fig 1 and Table 5.3).

5.4.4 GC-EAD responses of C. nr dimidiatus to volatiles in synthetic blends

Figure 5.4 displays representative GC-EAD recordings obtained from male and female C. nr dimidiatus antennae in response to the W. rabaulensis synthetic blend

(WB). All seven compounds present in the synthetic blend elicited consistent and repeatable responses in both sexes.

5.4.5 Attraction C. nr dimidiatus to synthetic blends in dual choice cage assays

______Chemical ecology of Carpophilus beetles and their yeast symbionts 133

In two-choice lab assays, over 50% of beetles responded to odours emitted from traps (mean adults responding per trial = 54 ± 2 / 100) (Fig. 5.5). The proportion of adults attracted to W. rabaulensis synthetic blend (WB) was significantly greater than to the commercial carpophilus lure (CL) (WB = 70 ± 2 %; CL = 30 ± 2 %) (Z =

2.81, P < 0.05, WSR).

Fig. 5.4 GC-EAD responses of C. nr dimidiatus to headspace volatile compounds collected from W. rabaulensis synthetic blend (WB). 1- Acetaldehyde. 2- Ethanol. 3- Isobutanol. 4- Isoamyl alcohol. 5- 2-Methyl butanol. 6- Isobutyl acetate. 7- Isoamyl acetate.

______134 Chemical ecology of Carpophilus beetles and their yeast symbionts

Fig. 5.5 Dual choice cage assays of C. nr dimidiatus using synthetic Carpophilus lure (CL) and synthetic blend of yeast, Wickerhamomyces rabaulensis, (WB). N = 10. Different letters indicate statistical significance at P < 0.05, WSR test.

5.4.6 Field trapping of beetles with synthetic blends

Field trapping experiments in almond orchards revealed significant differences in the

2 numbers of beetles trapped by the four synthetic blends (C. nr dimidiatus: χ (3) =

2 26.3, C. hemipterus: χ (3) = 283.7, P < 0.05; Fig. 5.6). Highest numbers of C. nr dimidiatus beetles were caught in the traps where two esters identified from W. rabaulensis headspace (isoamyl acetate and isobutyl acetate) were added to the commercial CL blend (CL+Esters), with mean catches being significantly different compared to the WB1x and CL (CL+Esters = 74 ± 11, CL = 32 ± 6, WB1x = 30 ± 6,

P < 0.05). Mean numbers of beetles trapped in CL+Esters were not significantly higher than WB30x (WB30x = 53 ± 11, P > 0.05).

The non-target (largely saprophagous) species, C. hemipterus, was trapped in higher numbers using the existing commercial lure (CL), with mean catches of C. hemipterus in CL significantly different compared to the three treatments based on

______Chemical ecology of Carpophilus beetles and their yeast symbionts 135

W. rabaulensis, which caught predominantly the target species, C. nr dimidiatus (CL

= 55 ± 12, WB30x = 8 ± 1, CL+Esters = 7 ± 1, WB1x = 0.7 ± 0.4, P < 0.05). The mean number of C. hemipterus trapped in WB30x and CL+Esters was not significantly different (P > 0.05), but both treatments had significantly higher mean numbers than WB1x (P < 0.05).

Fig. 5.6 Field trials using synthetic blends based on the yeast, Wickerhamomyces rabaulensis: (WB1x), increased concentration blend WB30x, commercial carpophilus lure (CL), and CL modified by adding yeast two Wr esters (CL+Esters). N = 12. Different letters indicate statistical significance at P < 0.05, Tukey’s HSD test.

5.5 Discussion

The model yeast species Saccharomyces cerevisiae, baker’s yeast, has had an admirable history in its application to insect trapping strategies (Babcock et al.,

2017; Guerenstein et al., 1995; Smallegange et al., 2010), either as a live culture, in a dried formulation, or in the development of synthetic odour blends (Babcock et al.,

2018; Bartelt & Hossain, 2006; Mansfield & Hossain, 2004b). The attractiveness of this yeast to many insects may, however, stems from a more precise system of odour communication that exists between insects and their yeast symbionts. Decoding this communication system in terms of the species-specific odour emissions by ______136 Chemical ecology of Carpophilus beetles and their yeast symbionts

ecologically associated yeasts and olfactory detection by the insects could lead to a new generation of insect attractants that are more powerful and better tailored to target a range of pest species, including flies, beetles, moths and wasps (Babcock et al., 2019; Hamby & Becher, 2016; Kuhns et al., 2014; Torto, Boucias, et al., 2007;

Witzgall et al., 2012).

In this study focusing on the almond pest, C. nr dimidiatus, gut-associated yeast flora differed from yeasts isolated from the digestive tract of Carpophilus beetles that are pests in stone fruit orchards (C. davidsoni and C. hemipterus) (Baig et al., 2020).

Wickerhamomyces, the most prevalent yeast genus associated with C. nr dimidiatus, was described only a decade ago (Kurtzman et al., 2008), and only a few species have to date been associated with the insect digestive tract (e.g. W. anomalus isolated from mosquitoes and W. mori isolated from wood boring insect larvae (Hui et al.,

2013; Ricci et al., 2011)). W. rabaulensis is a generalist yeast that has been associated with diverse resources including decaying wood (Lopes et al., 2018), faeces of African snails, watermelon, and rat liver (Kurtzman, 2011). This is the first study to report W. rabaulensis as an insect gut-associated yeast. Its presence in the gut of C. nr dimidiatus may result from this yeast being able to develop on the almond hull in a drier environment, which could benefit a mutualistic association with C. nr dimidiatus. This suggests that these yeast-insect associations in

Carpophilus are host plant specific, and that Carpophilus might be generalist grazers on many yeast species, with different preferences for, and performances on, these yeasts emerging much like the classically viewed host “hierarchies” in host selection theory.

______Chemical ecology of Carpophilus beetles and their yeast symbionts 137

Field traps using live yeast cultures of W. rabaulensis captured more C. nr dimidiatus than H. guilliermondii, a gut-associated yeast species in stone fruit attacking Carpophilus (Baig et al., 2020). In the third chapter which was on C. davidsoni, the most common yeast in the gut of this species, Pichia kluyveri, was found to be more attractive than H. guilliermondii, which was less common. Volatile analysis of the two yeast species revealed both qualitative and quantitative differences that may have accounted for the differences in olfactory preferences

(Paiva & Kiesel, 1985; Sanders, 1981). Qualitative differences between the two yeasts were found in emissions of isobutanol and 2-methyl-1-butanol in W. rabaulensis, and ethyl acetate, ethyl propionate, propyl acetate, propyl propionate, butyl acetate, 2-methylbutyl acetate, 2-acetoxy-3-butanone, isoamyl propionate, 2- furanmethanol acetate, phenylethyl alcohol, 2-phenylethyl acetate and 2-phenylethyl propionate in H. guilliermondii. Microbial volatiles acetaldehyde, ethanol, isoamyl alcohol, isobutyl acetate and isoamyl acetate were present in both yeasts, but with significant quantitative differences in their emission rates. Statistical analysis revealed that two volatile compounds, isoamyl alcohol and isoamyl acetate, accounted for 23% of dissimilarities between the two yeasts. Isoamyl alcohol was 17 times higher in W. rabaulensis compared to H. guilliermondii, while isoamyl acetate was 14 times higher in H. guilliermondii compared to W. rabaulensis.

Hanseniaspora guilliermondii is known to produce fewer alcohols and higher amounts of esters (Romano et al., 1992). The relative concentration of isoamyl alcohol to isoamyl acetate might be an important factor in host selection, with a higher relative concentration of isoamyl alcohol to isoamyl acetate being preferred by C. nr dimidiatus adults.

______138 Chemical ecology of Carpophilus beetles and their yeast symbionts

Seven volatiles present in the odour emissions of W. rabaulensis were used to develop a new synthetic attractant. Of these seven, five compounds; acetaldehyde, ethanol, isobutanol, isoamyl alcohol and 2- methyl-1-butanol; were common to S. cerevisiae fermented peach juice and are known attractants of C. davidsoni (Bartelt

& Hossain, 2006). Antennal responses (GC-EAD) of C. nr. dimidiatus to the synthetic blend of W. rabaulensis confirmed that all seven compounds were EAD- active: five compounds (ethanol, isobutanol, isoamyl alcohol, isobutyl acetate and isoamyl acetate) elicited strong responses, and two (acetaldehyde and 2-methyl-1- butanol) elicited weak responses. In my previous study, all of these seven compounds were also EAD-active in C. davidsoni beetles (Chapter 4). Moreover, five of the seven compounds, namely; acetaldehyde, ethanol, isobutanol, isobutyl acetate and isoamyl acetate were found to be EAD-active compounds in another nitidulid, the small hive beetle (Aethina tumida) (Torto, Boucias, et al., 2007; Torto et al., 2005). This indicates that these volatile compounds are common in different yeasts (Scheidler et al., 2015) and may induce electrophysiological activity in antennae across nitidulids. The insect olfactory system is capable of recognising (and discriminating among) relative concentrations of volatiles within an odour (Bruce et al., 2005), and this may be important in yeast-odour discrimination. With this in mind, and given differing volatilities of odour compounds, future focus on improving odour dispenser technologies to enable and maintain constant relative concentrations may give rise to improved and longer lasting carpophilus lures.

Comparing olfactory responses of C. nr dimidiatus in a dual choice cage assay revealed that the synthetic blend of W. rabaulensis captured twice as many beetles as the commercial co-attractant. These two blends differed in both quantitative (relative concentrations of volatile constituents) and qualitative (the presence of isoamyl- and

______Chemical ecology of Carpophilus beetles and their yeast symbionts 139 isobutyl acetate in W. rabaulensis and ethyl acetate in the co-attractant) factors, all or any of which could be responsible for the differences (Finch, 1978; Hao et al., 2013;

Sharma et al., 2008).

Three new synthetic co-attractants were formulated and tested against the commercially available co-attractant in the field. Among the formulations, two were based directly on W. rabaulensis odour (with a concentration of 1X and 30X), whilst the third was a modification of the commercial coattractant to include two esters

(isoamyl- and isobutyl acetates) identified in W. rabaulensis. This latter formulation proved to be the most effective at trapping C. nr dimidiatus, demonstrating that isoamyl acetate and isobutyl acetate can significantly improve trap catches of C. nr dimidiatus. Further work is needed to elucidate the attractiveness of each of these compounds independently. Isoamyl acetate is an important attractant for ovipositing adult fruit flies, for small hive beetles, and also acts as an alarm pheromone for honey bee workers (Revadi et al., 2015; Teal et al., 2007; Torto, Boucias, et al.,

2007). Interestingly, all three new synthetic lures caught significantly lower numbers of C. hemipterus (a non-target species) in the traps compared to the commercial co- attractant. As Wickerhamomyces yeasts are associated with early stages of fruits

(Vadkertiová et al., 2012) they may produce lower amounts of esters, making them less attractive to C. hemipterus (being a saprophagous insect preferring rotten fruits).

The modified co-attractant for C. nr dimidiatus developed in this study shows promise as an improved attractant to be used in mass trapping and monitoring strategies for this important pest in Australian almonds. As C. nr dimidiatus prefers to attack developing nuts at the hull split stage, ripening volatiles could also be explored as important synergists to improve attractant formulations; as has been

______140 Chemical ecology of Carpophilus beetles and their yeast symbionts

shown in D. suzukii and another almond pest, the navel orangeworm (Beck et al.,

2012; Walsh et al., 2011). Beetles in the genus Carpophilus show a far stronger attraction to lures comprised of a co-attractant used in combination with the beetle’s aggregation pheromone: the presence of both host and pheromone odours considered as having a synergistic effect on the insect’s olfactory system (Bartelt et al., 1992;

Hossain et al., 2006; James et al., 1994; James et al., 1996). The aggregation pheromone of C. nr dimidiatus has yet to be identified, and is the essential next step in developing a field effective attract and kill strategy for C. nr dimidiatus.

______Chemical ecology of Carpophilus beetles and their yeast symbionts 141

5.6 Supplementary Material

Supplementary Table 5.1 Composition of different lures tested in field.

Treatments Lure composition Acetaldehyde: 65.4 µl /100 ml Ethanol : 44.3 ml / 100 ml Ethyl acetate: 104.4 µL / 100 ml CL 2-methylpropan-1-ol: 33.8 µl /100ml Isopentyl alcohol: 74.1 µl / 100 ml 2-methyl-butanol: 24.4 µl /100 ml Water: 55.4 ml / 100 ml Acetaldehyde: 5.4 µl /100 ml Ethanol: 1.49 ml /100 ml 2-methylpropan-1-ol: 0.83 µl /100 ml Isopentyl alcohol: 3.53 µl /100 ml WB1x 2-methyl-butanol: 0.15 µl /100 ml Isoamyl acetate: 0.015 µl /100 ml Isobutyl acetate: 0.1 µL / 100 ml Water: 98.5 ml / 100 ml Acetaldehyde: 162 µl /100 ml Ethanol: 44.6 ml /100 ml 2-methylpropan-1-ol: 24.8 µl /100 ml Isopentyl alcohol: 105.8 µl /100 ml WB30x 2-methyl-butanol: 4.53 µl /100 ml Isoamyl acetate: 0.45 µl /100 ml Isobutyl acetate: 3 µL / 100 ml Water: 55.1 ml / 100 ml Acetaldehyde: 65.4 µl /100 ml Ethanol : 44.3 ml / 100 ml Ethyl acetate: 104.4 µL / 100 ml 2-methylpropan-1-ol: 33.8 µl /100ml CL + Esters Isopentyl alcohol: 74.1 µl / 100 ml 2-methyl-butanol: 24.4 µl /100 ml Isoamyl acetate: 0.45 µl /100 ml Isobutyl acetate: 3 µL / 100 ml Water: 55.4 ml / 100 ml

Supplementary Fig. 5.1 Distinct odour profiles from yeasts collected by SPME method and measured from gas chromatography-mass spectrometry (GC-MS). Annotated peaks are presented in the table 2.

______144 Chemical ecology of Carpophilus beetles and their yeast symbionts

Chapter 6: General Discussion

The research conducted in this thesis has enabled a better understanding of the chemical ecology of Carpophilus beetles and their association with symbiotic yeasts, and will lead to significant improvements in attract and kill systems not only for these beetles but for a range of horticultural pests. Through four experimental chapters, the research (i) developed fundamental knowledge in Carpophilus-yeast behavioural ecology (Chapter 2), (ii) applied this to designing and field testing new synthetic attractant blends (Chapter 3), (iii) developed electrophysiological volatile screening in Carpophilus for the first time (Chapter 4), and then (iv) synthesised new theory, analytical work, electrophysiology, and fieldwork in a final chapter to develop an attractant for a new Carpophilus species that is currently causing significant losses to the Australian almond industry (Chapter 5).

The first experimental chapter studied yeast-insect interactions in two beetle species

(C. davidsoni and C. hemipterus) that attack ripe stone fruits. Whilst C davidsoni prefers to attack ripening fruits, C. hemipterus prefers overripe and rotting fruit, and the aim of this study was to explore whether gut-associated yeasts play a role in this differing use of host resources. Molecular analysis of gut-associated yeasts showed no evidence for differences in the yeast species associated with the two beetle species, revealing a similar diversity of yeasts, with species, Pichia kluyveri and

Hanseniaspora guilliermondii most frequently present. However, adult and larval bioassays demonstrated key species-specific differences in terms of adult beetle preference for, and larval development on these yeasts. Results suggested that C. davidsoni may have behavioural and physiological adaptations for utilising fruits earlier in ripening compared to C. hemipterus, which may underpin host utilisation

______146 Chemical ecology of Carpophilus beetles and their yeast symbionts

on different fruit ripening stages and enable resource partitioning in these two species. These adaptations include improved larval performance on an earlier colonising yeast (H. guilliermondii), and a level of tolerance (larval survival) and choice (olfaction in adults) for yeast-free fruit substrates.

Having demonstrated that gut-associated yeasts vary in their attractiveness to

Carpophilus species, the thesis then went on to explore how this knowledge could be applied to improving the existing attract and kill system for stone fruit attacking

Carpophilus, for which the commercial co-attractant is based on fermenting fruit juice with bakers’ yeast, Saccharomyces cerevisiae (Bartelt & Hossain, 2006). First, the most attractive yeast (P. kluyveri) to Carpophilus beetles was identified through field trapping trials. GC-MS analysis was then performed and the differences in volatile profiles between more- and less- attractive yeasts was used to identify key volatile attractants and develop a new co-attractant (host volatile based blend). This new synthetic blend was more attractive to C. davidsoni than the currently available commercial co-attractant (based on S. cerevisiae), confirming that the design of attractant blends can be improved through studies on the chemical-ecology of gut- associated yeasts. The chapter also revealed contradictory findings in behavioural assays in the lab versus field trials, in terms of responses to whole yeast odours

(demonstrated in Chapters 2 and 3) and also for individual volatile compounds (ethyl acetate in chapter 3). Such discrepancies suggest that laboratory attraction assays should be treated with caution when making inferences regarding attraction under field conditions. These discrepancies might be due to factors such as different background odours in lab vs field bioassays (Cha et al., 2018) or the accumulation of odours within enclosed traps used in the lab experiments (Howse, 1999; Stockel &

Sureau, 1981a). At least for Carpophilus species, field trapping studies should be

______Chemical ecology of Carpophilus beetles and their yeast symbionts 147 regarded as a more effective way to select attractants and screen synthetic blends for attract and kill.

Since its invention over 40 years ago, gas chromatography coupled with electroantennography (GC-EAD) has remained the most widely used technique for detecting key “behaviourally active” volatile compounds from complex odours

(Moorhouse et al., 1969). Surprisingly, given the importance of attract and kill for

Carpophilus beetles, GC-EAD had not been developed prior to this thesis work.

Early pilot work using electrophysiology methods developed for other insects (e.g. flies, moths and honeybees) (Jönsson & Anderson, 1999; Scheidler et al., 2015;

Swanson et al., 2009) indicated why this may be so, as these techniques were unsuccessful at eliciting responses in Carpophilus beetles. Chapter four was therefore designed as a technical study on electrophysiology, seeking to develop a

GC-EAD protocol for Carpophilus beetles. Developments were made in terms of insect mounting technique, system optimisations (such as directing more GC effluent towards the antennae compared to the MS and FID detectors), and using a smaller diameter glass mixing tube. Most importantly, using dry as opposed to (commonly used) humidified air to carry the eluting compounds toward the antennae was found to be crucial to elicit responses in beetle antennae. Having developed new methods, repeatable responses were generated for both simple synthetic blends and natural

(yeast) odours. This new GC-EAD protocol could help in refining the existing co- attractant lures for other Carpophilus species, and also in the detection of pheromone compounds for the almond attacking Carpophilus species (C. near dimidiatus). The inability to achieve GC-EAD responses with humidified air might be due to the presence of hygroreceptors on the distal part of beetles’ antennae (Arbogast et al.,

1972), which may have masked the responses of chemoreceptors; or perhaps due to

______148 Chemical ecology of Carpophilus beetles and their yeast symbionts

the presence of hygroreceptors and chemoreceptors in the same sensillum (Bernard,

1974), where hygroreceptors might have been working antagonistically to chemoreceptors—similar to the way dry and moist receptors work antagonistically in insects such as the ground beetle Pterostichus oblongopunctatus (Altner & Loftus,

1985; Merivee et al., 2010). This might thus be a solution to a more general problem that could enable GC-EAD recordings from other insects where either no responses or very small or inconsistent responses were recorded previously.

The final experimental chapter (Chapter 5) was essentially a synthesis of all previous chapters, bringing together knowledge of ecological theory, experimental design, and technical expertise gained over the course of the PhD and applying this knowledge to a new species of Carpophilus beetle for which there is an urgent need to develop attract and kill. Carpophilus near dimidiatus is Australia’s most serious pest of almonds, incurring losses of around $20 million to almond industry during 2018-19.

In Chapter 5, a new synthetic attractant was developed using volatiles from a yeast species (W. rabaulensis) that was most abundant in the C. nr dimidiatus gut. This new synthetic lure not only attracted more C. nr dimidiatus in field trapping studies, but also attracted fewer non-target (non pest) Carpophilus. Development of this new co-attractant is a major step towards improved Carpophilus mass trapping in almonds. Future studies could focus on dispensing methods with improved longevity and quality (relative volatile concentrations) of odour emissions, along with trap height and spacing (density of traps per hectare). Most importantly, elucidation of the aggregation pheromone for this Carpophilus species, to work synergistically with the co-attractant, is required (although the current “tri-species” pheromone blend developed for stone-fruit attacking species does have some effect, if not optimal)

(Bartelt & Hossain, 2010).

______Chemical ecology of Carpophilus beetles and their yeast symbionts 149

The knowledge gained through this thesis has important implications in terms of our understanding of insect-microbe-plant tritrophic interactions. Although the initial discovery of yeast-insect interactions in Carpophilus beetles was back in 1953

(Miller & Mrak), this subject began to receive more attention after the findings of

Suh et al. (2005), who isolated hundreds of yeast species from the gut of various beetles species. Since then, several other studies have shown this close relationship between beetles and yeasts (Ganter, 2006; Stefanini, 2018). In this thesis,

Carpophilus beetles have been shown to possess species-specific traits in adult olfaction and larval nutrition that influence preference for, and performance on, different yeasts. When combined with the beetle’s ability to act as a vector for the yeast, this implies a mutualistic relationship between the beetles and their yeasts

(Gonzalez, 2014). The extent to which yeast-insect interactions are driven by the insects that vector the yeasts or by the plants that act as a substrate for the yeast could be explored further. The results of this thesis suggest that in Carpophilus beetles, yeast interactions are host plant dependent (c.f. a specific yeast species being associated with the beetle regardless of the host plant): for example, yeast flora in C. hemipterus and C. davidsoni were similar (same host plant, same yeasts), whilst a study on C. hemipterus collected from figs, showed different yeasts (different host plant, different yeasts) (Miller & Mrak, 1953). These results were similar to studies on Drosophila, where different yeast species were isolated from different Drosophila collected from different hosts (Ganter, 1988; Heed et al., 1976), which further strengthens the theory that it is the host plant that plays the key role in determining the diversity of yeast flora (Ganter et al., 1986). Yeast flora of stone fruit feeding beetles (C. davidsoni and C. hemipterus) are generalist yeasts that have been found in other insects such as drosophilids and tephritids (Hamby & Becher, 2016; Piper et

______150 Chemical ecology of Carpophilus beetles and their yeast symbionts

al., 2017), whereas Wickerhamomyces rabaulensis found in almond beetles (C. nr dimidiatus) is an extremely generalist yeast that has been associated with both plants and non-plants sources (Kurtzman, 2011; Lopes et al., 2018).

Given yeasts are an important, if not essential, nutrient source for feeding, development and oviposition in frugivorous insects such as codling moth, and tephritid and drosophilid fruit flies (Becher et al., 2012; Ganter, 2006; Gonzalez,

2014; Piper et al., 2017; Stefanini, 2018; Witzgall et al., 2012), the interplay between yeasts, the substrates they colonise, and the insects that utilise them, should be built into host selection theory (Mayhew, 2001; Scheirs & De Bruyn, 2002; West &

Cunningham, 2002). For instance, in polyphagous insects that are yeast feeders, host choice might be under strong selection in favour of host plants that are suitable substrates for particular yeasts, rather than for the insects feeding directly. This also has a bearing on classic preferences tests that are carried out in laboratory assays and used to test the “preference-performance” hypothesis (Gripenberg et al., 2010;

Thompson, 1988): larval performance in nature may be strongly influenced by yeasts

(or other microbes) that are not present in laboratory assays. Results from this thesis suggested that the more frequently isolated gut-associated yeast species (P. kluyveri) not only better supported larval development of Carpophilus beetles but also trapped higher number of adults in the field, indicating that adult C. davidsoni select the host

(yeast) which is better for their offspring. These results are in line with studies on

Drosophila flies (Becher et al., 2012; Bellutti et al., 2018) and moths (Witzgall et al.,

2012) where insects followed the preference-performance hypothesis (Jaenike,

1978); and suggest that in addition to plant volatiles, microbial volatiles also play an important role in the evolution of host selection behaviour of herbivorous insects.

______Chemical ecology of Carpophilus beetles and their yeast symbionts 151

Symbiotic yeast species have successfully been used to develop attract and kill traps for insect pests such as fruit flies (Cloonan et al., 2018; Hamby & Becher, 2016), wasps (Babcock et al., 2019) and the small hive beetle (Teal et al., 2007; Torto,

Arbogast, et al., 2007). This thesis has developed a number of yeast-derived synthetic blends that have considerable potential in improving commercially available co-attractants (synthetic “host plant” blends) for stone fruit attacking

Carpophilus species, and for developing a new co-attractant for Carpophilus species attacking Australian almonds. It also paves the way for new lures targeting other pest

Carpophilus, such as C. lugubris, C. humaralis, C. mutilatus and C. freemani

(Bartelt & Hossain, 2010; Marini et al., 2013), through exploring symbiotic yeast species and developing synthetic blends based on their EAD-active volatile compounds.

Attractant lures are not the only IPM technology that can take advantage of yeast- insect associations. Where adult insects feed on yeasts to acquire protein for egg development, this behaviour can be manipulated to incorporate an ingestible insecticide into an attractive yeast, as has been shown for the highly invasive pest, spotted wing drosophila, D. suzukii (Mori et al., 2017). Similarly, adding a pathogenic virus to the attractive yeast may provide a novel control method, as has been demonstrated for codling moth (Knight & Witzgall, 2013). Genetic modifications in the attractive yeast species can lead to the generation of novel biopesticides that reduce fitness of insect pests (Murphy et al., 2016). Additionally, attraction of beneficial insects such as predators and parasitoids to yeasts has implications for using yeasts to manipulate natural enemy populations in the field

(Sobhy et al., 2018; Vitanović et al., 2019).

______152 Chemical ecology of Carpophilus beetles and their yeast symbionts

Whilst Drosophila remains the classic model organism for studying insect olfaction, the importance of other model systems to provide a more wholistic view of the genetic, neurophysiological and behavioural mechanisms underpinning insect olfaction is undeniable (Haupt et al., 2010; Latorre-Estivalis et al., 2013). The new knowledge in Carpophilus beetle olfaction and behavioural ecology generated by this thesis lends itself ideally to becoming a “non-model system” for studying insect olfactory systems. With the advent of new genomic tools to enable studying olfactory genetics across a wider range of insects, a focus on Carpophilus beetles might make an interesting comparative system, being more primitive and having diverged long ago from flies (Kristensen, 1981), whilst having similar preference for key fruit and yeast volatiles. Such studies could also shed light on how sensory adaptations have evolved over time in Carpophilus, from rotten fruits in C. hemipterus, to ripening fruits in C. davidsoni, and ultimately to nuts in C. nr dimidiatus.

______Chemical ecology of Carpophilus beetles and their yeast symbionts 153

References

Uncategorized References Altner, H., & Loftus, R. (1985). Ultrastructure and function of insect thermo-and hygroreceptors. Annual Review of Entomology, 30(1), 273-295.

Altschul, S. F., Gish, W., Miller, W., Myers, E. W., & Lipman, D. J. (1990). Basic local alignment search tool. Journal of Molecular Biology, 215(3), 403-410.

Andersson, M. N., Larsson, M. C., & Schlyter, F. (2009). Specificity and redundancy in the olfactory system of the bark beetle Ips typographus: single-cell responses to ecologically relevant odors. Journal of Insect Physiology, 55(6), 556-567.

Andreadis, S. S., Witzgall, P., & Becher, P. G. (2015). Survey of arthropod assemblages responding to live yeasts in an organic apple orchard. Frontiers in Ecology and Evolution, 3. doi:10.3389/fevo.2015.00121

Anke, H. (2011). Insecticidal and nematicidal metabolites from fungi. In Industrial Applications (pp. 151-163): Springer.

Arbogast, R. T., Roppel, R. M., & Carthon, M. (1972). Hygroreceptors of adult sawtoothed grain beetles, Oryzaephilus surinamensis (L.)(Coleoptera, Cucujidae). Canadian Journal of Zoology, 50(8), 1147-1153.

Arn, H., Städler, E., & Rauscher, S. (1975). The electroantennographic detector—a selective and sensitive tool in the gas chromatographic analysis of insect pheromones. Zeitschrift für Naturforschung C, 30(11-12), 722-725.

Atallah, J., Teixeira, L., Salazar, R., Zaragoza, G., & Kopp, A. (2014). The making of a pest: the evolution of a fruit-penetrating ovipositor in Drosophila suzukii and related species. Proceedings of Royal Society B: Biological Sciences, 281(1781), 20132840.

Auerbach, M., & Simberloff, D. (1989). Oviposition site preference and larval mortality in a leaf-mining moth. Ecological Entomology, 14(2), 131-140. doi:10.1111/j.1365-2311.1989.tb00763.x

Azeem, M., Rajarao, G. K., Nordenhem, H., Nordlander, G., & Borg-Karlson, A. K. (2013). Penicillium expansum volatiles reduce pine weevil attraction to host plants. Journal of Chemical Ecology, 39(1), 120-128.

Babcock, T., Borden, J., Gries, R., Carroll, C., Moore, M., & Gries, G. (2018). Lachancea thermotolerans, a Yeast Symbiont of Yellowjackets, Enhances Attraction of Three Yellowjacket Species (Hymenoptera: Vespidae) to Fruit Powder. Environmental Entomology, 47(6), 1553-1559.

Babcock, T., Borden, J. H., Gries, R., Carroll, C., Lafontaine, J. P., Moore, M., & Gries, G. (2019). Inter‐kingdom signaling—symbiotic yeasts produce

______154 Chemical ecology of Carpophilus beetles and their yeast symbionts

semiochemicals that attract their yellowjacket hosts. Entomologia Experimentalis et Applicata, 167(3), 220-230.

Babcock, T., Gries, R., Borden, J., Palmero, L., Mattiacci, A., Masciocchi, M., . . . Gries, G. (2017). Brewer’s yeast, Saccharomyces cerevisiae, enhances attraction of two invasive yellowjackets (Hymenoptera: Vespidae) to dried fruit and fruit powder. Journal of Insect Science, 17(5), 91.

Baig, F., Farnier, K., Piper, A. M., Speight, R., & Cunningham, J. P. (2020). Yeasts influence host selection and larval fitness in two frugivorous Carpophilus beetle species. Journal of Chemical Ecology, 1-13. doi:https://doi.org/10.1007/s10886-020-01167-5

Baker, T. C., Zhu, J., & Park, K.-C. (2003). USA. Patent No. 6,543,181 B1.

Balagawi, S., Drew, R. A., & Clarke, A. R. (2013). Simultaneous tests of the preference-performance and phylogenetic conservatism hypotheses: is either theory useful? Arthropod-Plant Interactions, 7(3), 299-313.

Balakrishnan, K., Holighaus, G., Weißbecker, B., & Schütz, S. (2017). Electroantennographic responses of red flour beetle Tribolium castaneum Herbst (Coleoptera: Tenebrionidae) to volatile organic compounds. Journal of Applied Entomology, 141(6), 477-486.

Ballabeni, P., Wlodarczyk, M., & Rahier, M. (2001). Does enemy-free space for eggs contribute to a leaf beetle's oviposition preference for a nutritionally inferior host plant? Functional Ecology, 15(3), 318-324. doi:10.1046/j.1365- 2435.2001.00529.x

Barrer, P. (1983). A field demonstration of odour-based, host-food finding behaviour in several species of stored grain insects. Journal of Stored Products Research, 19(3), 105-110.

Bartelt, R. J., Carlson, D. G., Vetter, R. S., & Baker, T. C. (1993). Male-produced aggregation pheromone of Carpophilus mutilatus (Coleoptera: Nitidulidae). Journal of Chemical Ecology, 19(1), 107-118.

Bartelt, R. J., Dowd, P. F., Plattner, R. D., & Weisleder, D. (1990). Aggregation pheromone of driedfruit beetle, Carpophilus hemipterus wind-tunnel bioassay and identification of two novel tetraene hydrocarbons. Journal of Chemical Ecology, 16(4), 1015-1039.

Bartelt, R. J., Dowd, P. F., Vetter, R. S., Shorey, H. H., & Baker, T. C. (1992). Responses of Carpophilus hemipterus (Coleoptera: Nitidulidae) and other sap beetles to the pheromone of C. hemipterus and host-related coattractants in California field tests. Environmental Entomology, 21(5), 1143-1153.

Bartelt, R. J., & Hossain, M. S. (2006). Development of synthetic food-related attractant for Carpophilus davidsoni and its effectiveness in the stone fruit orchards in southern Australia. Journal of Chemical Ecology, 32(10), 2145- 2162. doi:10.1007/s10886-006-9135-7

______Chemical ecology of Carpophilus beetles and their yeast symbionts 155

Bartelt, R. J., & Hossain, M. S. (2010). Chemical ecology of Carpophilus sap beetles (Coleoptera: Nitidulidae) and development of an environmentally friendly method of crop protection. Terrestrial Arthropod Reviews, 3(1), 29-61.

Bartelt, R. J., & James, D. G. (1994). Aggregation pheromone of australian sap beetle, Carpophilus davidsoni (Coleoptera: nitidulidae). Journal of Chemical Ecology, 20(12), 3207-3219.

Bartelt, R. J., Seaton, K. L., & Dowd, P. F. (1993). Aggregation pheromone of Carpophilus antiquus (Coleoptera: Nitidulidae) and kairomonal use of C. lugubris pheromone by C. antiquus. Journal of Chemical Ecology, 19(10), 2203-2216.

Bartlet, E., Blight, M. M., Pickett, J. A., Smart, L. E., Turner, G., & Woodcock, C. M. (2004). Orientation and feeding responses of the pollen beetle, Meligethes aeneus, to candytuft, Iberis amara. Journal of Chemical Ecology, 30(5), 913- 925.

Bates, D., Maechler, M., Bolker, B., & Walker, S. (2014). lme4: Linear mixed- effects models using Eigen and S4. R package version, 1(7), 1-23.

Batista, N. N., Ramos, C. L., Ribeiro, D. D., Pinheiro, A. C. M., & Schwan, R. F. (2015). Dynamic behavior of Saccharomyces cerevisiae, Pichia kluyveri and Hanseniaspora uvarum during spontaneous and inoculated cocoa fermentations and their effect on sensory characteristics of chocolate. LWT- Food Science and Technology, 63(1), 221-227.

Beaulieu, M., Franke, K., & Fischer, K. (2017). Feeding on ripening and over- ripening fruit: interactions between sugar, ethanol and polyphenol contents in a tropical butterfly. Journal of Experimental Biology, 220(17), 3127-3134.

Becher, P. G., Bengtsson, M., Hansson, B. S., & Witzgall, P. (2010). Flying the fly: long-range flight behavior of Drosophila melanogaster to attractive odors. Journal of Chemical Ecology, 36(6), 599-607.

Becher, P. G., Flick, G., Rozpędowska, E., Schmidt, A., Hagman, A., Lebreton, S., . . . Thompson, K. (2012). Yeast, not fruit volatiles mediate Drosophila melanogaster attraction, oviposition and development. Functional Ecology, 26(4), 822-828. doi:10.1111/j.1365-2435.2012.02006.x

Beck, J. J., Higbee, B. S., Light, D. M., Gee, W. S., Merrill, G. B., & Hayashi, J. M. (2012). Hull split and damaged almond volatiles attract male and female navel orangeworm moths. Journal of Agricultural and Food Chemistry, 60(33), 8090-8096.

Bellutti, N., Gallmetzer, A., Innerebner, G., Schmidt, S., Zelger, R., & Koschier, E. H. (2018). Dietary yeast affects preference and performance in Drosophila suzukii. Journal of Pest Science, 91(2), 651-660.

Benda, N. D., Boucias, D., Torto, B., & Teal, P. (2008). Detection and characterization of Kodamaea ohmeri associated with small hive beetle

______156 Chemical ecology of Carpophilus beetles and their yeast symbionts

Aethina tumida infesting honey bee hives. Journal of Apicultural Research, 47(3), 194-201.

Bernard, J. (1974). Étude électrophysiologique de récepteurs impliqués dans l'orientation vers l'hôte et dans l'acte hématophage chez un Hémiptère, Triatoma infestans. These. Univ. Rennes, France,

Biere, A., & Bennett, A. E. (2013). Three‐way interactions between plants, microbes and insects. Functional Ecology, 27(3), 567-573.

Billeter, J.-C., & Wolfner, M. F. (2018). Chemical Cues that Guide Female Reproduction in Drosophila melanogaster. Journal of Chemical Ecology, 44(9), 750-769.

Birke, A., & Aluja, M. (2018). Do mothers really know best? Complexities in testing the preference-performance hypothesis in polyphagous frugivorous fruit flies. Bulletin of Entomological Research, 108(5), 674-684.

Blount, B. A., Driessen, M. R., & Ellis, T. (2016). GC Preps: Fast and Easy Extraction of Stable Yeast Genomic DNA. Scientific Reports, 6.

Brand, J., Bracke, J., Britton, L., Markovetz, A., & Barras, S. (1976). Bark beetle pheromones: Production of verbenone by a mycangial fungus of Dendroctonus frontalis. Journal of Chemical Ecology, 2(2), 195-199.

Brand, J., Schultz, J., Barras, S., Edson, L., Payne, T., & Hedden, R. (1977). Bark beetle pheromones: enhancement of Dendroctonus frontalis (Coleoptera: Scolytidae) aggregation pheromone by yeast metabolites in laboratory bioassays. Journal of Chemical Ecology, 3(6), 657-666.

Broughton, S., & Rahman, T. (2017). Evaluation of lures and traps for male and female monitoring of Mediterranean fruit fly in pome and stone fruit. Journal of Applied Entomology, 141(6), 441-449.

Bruce, T. J. A., Wadhams, L. J., & Woodcock, C. M. (2005). Insect host location: a volatile situation. Trends in Plant Science, 10(6), 269-274. doi:http://dx.doi.org/10.1016/j.tplants.2005.04.003

Buser, C. C., Newcomb, R. D., Gaskett, A. C., & Goddard, M. R. (2014). Niche construction initiates the evolution of mutualistic interactions. Ecology Letters, 17(10), 1257-1264.

Cadez, N., Poot, G. A., Raspor, P., & Smith, M. T. (2003). Hanseniaspora meyeri sp. nov., Hanseniaspora clermontiae sp. nov., Hanseniaspora lachancei sp. nov. and Hanseniaspora opuntiae sp. nov., novel apiculate yeast species. International Journal of Systematic and Evolutionary Microbiology, 53(5), 1671-1680.

Cha, D. H., Adams, T., Rogg, H., & Landolt, P. J. (2012). Identification and field evaluation of fermentation volatiles from wine and vinegar that mediate attraction of spotted wing drosophila, Drosophila suzukii. Journal of Chemical Ecology, 38(11), 1419-1431. doi:10.1007/s10886-012-0196-5 ______Chemical ecology of Carpophilus beetles and their yeast symbionts 157

Cha, D. H., Adams, T., Werle, C. T., Sampson, B. J., Adamczyk Jr, J. J., Rogg, H., & Landolt, P. J. (2014). A four‐component synthetic attractant for Drosophila suzukii (Diptera: Drosophilidae) isolated from fermented bait headspace. Pest Management Science, 70(2), 324-331.

Cha, D. H., Loeb, G. M., Linn, C. E., & Roelofs, W. L. (2011). Electrophysiological and behavioral identification of a volatile blend involved in host location of female strawberry sap beetle, Stelidota geminata. Entomologia Experimentalis et Applicata, 140(2), 153-162.

Cha, D. H., Loeb, G. M., Linn Jr, C. E., Hesler, S. P., & Landolt, P. J. (2018). A multiple-choice bioassay approach for rapid screening of key attractant volatiles. Environmental Entomology, 47(4), 946-950.

Chapman, R. F., & Sword, G. (1993). The importance of palpation in food selection by a polyphagous grasshopper (Orthoptera, Acrididae). Journal of Insect Behavior, 6(1), 79-91. doi:10.1007/bf01049149

Chen, L., Li, Y.-Y., & Shao, K.-M. (2019). A Practical Technique for Electrophysiologically Recording from Lamellated Antenna of Scarab Beetle. Journal of Chemical Ecology, 1-10.

Christiaens, J. F., Franco, L. M., Cools, T. L., De Meester, L., Michiels, J., Wenseleers, T., . . . Verstrepen, K. J. (2014). The Fungal Aroma Gene ATF1 Promotes Dispersal of Yeast Cells through Insect Vectors. Cell Reports, 9(2), 425-432. doi:10.1016/j.celrep.2014.09.009

Cloonan, K. R., Abraham, J., Angeli, S., Syed, Z., & Rodriguez-Saona, C. (2018). Advances in the chemical ecology of the spotted wing drosophila (Drosophila suzukii) and its applications. Journal of Chemical Ecology, 44(10), 922-939.

Coluccio, A. E., Rodriguez, R. K., Kernan, M. J., & Neiman, A. M. (2008). The yeast spore wall enables spores to survive passage through the digestive tract of Drosophila. PLoS One, 3(8), e2873.

Cook, S. M., Khan, Z. R., & Pickett, J. A. (2007). The use of push-pull strategies in integrated pest management. Annual Review of Entomology, 52.

Cossé, A. A., & Bartelt, R. J. (2000). Male-produced aggregation pheromone of Colopterus truncatus: structure, electrophysiological, and behavioral activity. Journal of Chemical Ecology, 26(7), 1735-1748.

Courtney, S. P., Chen, G. K., & Gardner, A. (1989). A general model for individual host selection. Oikos, 55-65.

Craig, T. P., Itami, J. K., & Price, P. W. (1989). A strong relationship between oviposition preference and larval performance in a shoot‐galling sawfly. Ecology, 70(6), 1691-1699.

______158 Chemical ecology of Carpophilus beetles and their yeast symbionts

Cunningham, J. P. (2012). Can mechanism help explain insect host choice? Journal of Evolutionary Biology, 25(2), 244-251. doi:10.1111/j.1420- 9101.2011.02435.x

Cunningham, J. P., Carlsson, M. A., Villa, T. F., Dekker, T., & Clarke, A. R. (2016). Do fruit ripening volatiles enable resource specialism in polyphagous fruit flies? Journal of Chemical Ecology, 42(9), 931-940.

Davis, T. S., Boundy-Mills, K., & Landolt, P. J. (2012). Volatile emissions from an epiphytic fungus are semiochemicals for eusocial wasps. Microbial Ecology, 64(4), 1056-1063.

Davis, T. S., Crippen, T. L., Hofstetter, R. W., & Tomberlin, J. K. (2013). Microbial volatile emissions as insect semiochemicals. Journal of Chemical Ecology, 39(7), 840-859. doi:10.1007/s10886-013-0306-z

Dobson, R. M. (1954). The species of Carpophilus Stephens (Col. Nitidulidae) associated with stored products. Bulletin of Entomological Research, 45(2), 389-402.

Douglas, A. E. (2007). Symbiotic microorganisms: untapped resources for insect pest control. Trends in Biotechnology, 25(8), 338-342. doi:10.1016/j.tibtech.2007.06.003

Douglas, A. E. (2011). Lessons from studying insect symbioses. Cell Host & Microbe, 10(4), 359-367.

Douglas, A. E. (2013). Microbial brokers of insect-plant interactions revisited. Journal of Chemical Ecology, 39(7), 952-961.

Dowd, P. F. (1987). A labor-saving method for rearing the driedfruit beetle (Coleoptera: Nitidulidae) on pinto bean-based diet. Journal of Economic Entomology, 80(6), 1351-1353.

Dowd, P. F. (2000). Dusky sap beetles (Coleoptera: Nitidulidae) and other kernel damaging insects in Bt and non-Bt sweet corn in Illinois. Journal of Economic Entomology, 93(6), 1714-1720.

Duetz, W., Bouwmeester, H., Van Beilen, J., & Witholt, B. (2003). Biotransformation of limonene by bacteria, fungi, yeasts, and plants. Applied Microbiology and Biotechnology, 61(4), 269-277.

Dweck, H. K., Ebrahim, S. A., Kromann, S., Bown, D., Hillbur, Y., Sachse, S., . . . Stensmyr, M. C. (2013). Olfactory preference for egg laying on citrus substrates in Drosophila. Current Biology, 23(24), 2472-2480.

Edgar, R. C. (2004). MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research, 32(5), 1792-1797.

Egan, S. P., & Funk, D. J. (2006). Individual advantages to ecological specialization: insights on cognitive constraints from three conspecific taxa. Proceedings of the Royal Society of London B: Biological Sciences, 273(1588), 843-848. ______Chemical ecology of Carpophilus beetles and their yeast symbionts 159

El-Sayed, A., Heppelthwaite, V., Manning, L., Gibb, A., & Suckling, D. (2005). Volatile constituents of fermented sugar baits and their attraction to lepidopteran species. Journal of Agricultural and Food Chemistry, 53(4), 953-958.

El-Sayed, A., Suckling, D., Wearing, C., & Byers, J. (2006). Potential of mass trapping for long-term pest management and eradication of invasive species. Journal of Economic Entomology, 99(5), 1550-1564.

El-Sayed, A. M., Suckling, D. M., Byers, J. A., Jang, E. B., & Wearing, C. H. (2009). Potential of “lure and kill” in long-term pest management and eradication of invasive species. Journal of Economic Entomology, 102(3), 815-835. doi:10.1603/029.102.0301

Elliott, N., Farrell, J., Gutierrez, A., van Lenteren, J. C., Walton, M., & Wratten, S. (1995). Integrated pest management: Springer Science & Business Media.

Endo, N., Abe, M., Sekine, T., & Matsuda, K. (2004). Feeding stimulants of Solanaceae-feeding lady beetle, Epilachna vigintioctomaculata (Coleoptera : Coccinellidae) from potato leaves. Applied Entomology and Zoology, 39(3), 411-416. doi:10.1303/aez.2004.411

Faeth, S. H. (1985). Host leaf selection by leaf miners: interactions among three trophic levels. Ecology, 66(3), 870-875.

Finch, S. (1978). Volatile plant chemicals and their effect on host plant finding by the cabbage root fly (Delia brassicae). Entomologia Experimentalis et Applicata, 24(3), 350-359.

Futuyma, D. J., & Agrawal, A. A. (2009). Macroevolution and the biological diversity of plants and herbivores. Proceedings of the National Academy of Sciences of the United States of America, 106(43), 18054-18061. doi:10.1073/pnas.0904106106

Ganter, P. F. (1988). The vectoring of cactophilic yeasts by Drosophila. Oecologia, 75(3), 400-404.

Ganter, P. F. (2006). Yeast and invertebrate associations. In C. A. Rosa & P. G. bor (Eds.), The Yeast Handbook – Biodiversity and Ecophysiology of Yeasts (pp. 303–370). Heidelber: Springer.

Ganter, P. F., Starmer, W. T., Lachance, M.-A., & Phaff, H. J. (1986). Yeast communities from host plants and associated Drosophila in Southern Arizona: new isolations and analysis of the relative importance of hosts and vectors on comunity composition. Oecologia, 70(3), 386-392.

Gonzalez, F. (2014). Symbiosis between yeasts and insects. Crop Production Science, 3.

Gregg, P. C., Del Socorro, A. P., & Landolt, P. J. (2018). Advances in attract-and- kill for agricultural pests: beyond pheromones. Annual Review of Entomology, 63, 453-470. ______160 Chemical ecology of Carpophilus beetles and their yeast symbionts

Gripenberg, S., Mayhew, P. J., Parnell, M., & Roslin, T. (2010). A meta‐analysis of preference–performance relationships in phytophagous insects. Ecology Letters, 13(3), 383-393.

Guerenstein, P., Lorenzo, M., Núñez, J., & Lazzari, C. (1995). Baker's yeast, an attractant for baiting traps for Chagas' disease vectors. Experientia, 51(8), 834-837.

Hadapad, A. B., Prabhakar, C. S., Chandekar, S. C., Tripathi, J., & Hire, R. S. (2016). Diversity of bacterial communities in the midgut of Bactrocera cucurbitae (Diptera: Tephritidae) populations and their potential use as attractants. Pest Management Science, 72(6), 1222-1230. doi:10.1002/ps.4102

Hall, T. A. (1999). BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucliec Acids Symposium Series, 41, 95-98.

Hallem, E. A., & Carlson, J. R. (2006). Coding of odors by a receptor repertoire. Cell, 125(1), 143-160.

Hamby, K. A., & Becher, P. G. (2016). Current knowledge of interactions between Drosophila suzukii and microbes, and their potential utility for pest management. Journal fo Pest Science, 89(3), 621-630. doi:10.1007/s10340- 016-0768-1

Hamby, K. A., Hernandez, A., Boundy-Mills, K., & Zalom, F. G. (2012). Associations of yeasts with spotted-wing drosophila (Drosophila suzukii; Diptera: Drosophilidae) in cherries and raspberries. Applied and Environmental Microbiology, 78(14), 4869-4873. doi:10.1128/AEM.00841- 12

Hammer, Ř., Harper, D., & Ryan, P. (2001). PAST: Paleontological Statistics software package for education and data analysis. Palaeontologia Electronica, 4(1), 9.

Hansson, B. S., Pers, J. N. V. D., & Löfqvist, J. (1989). Comparison of male and female olfactory cell response to pheromone compounds and plant volatiles in the turnip moth, Agrotis segetum. Physiological Entomology, 14(2), 147- 155.

Hao, H., Sun, J., & Dai, J. (2013). Dose-dependent behavioral response of the mosquito Aedes albopictus to floral odorous compounds. Journal of Insect Science, 13(1), 127.

Hardie, J., Peace, L., Pickett, J. A., Smiley, D. W., Storer, J. R., & Wadhams, L. J. (1997). Sex pheromone stereochemistry and purity affect field catches of male aphids. Journal of Chemical Ecology, 23(11), 2547-2554.

Harrison, G. D. (1987). Host-plant discrimination and evolution of feeding preference in the colorado potato beetle Leptinotarsa decemlineata.

______Chemical ecology of Carpophilus beetles and their yeast symbionts 161

Physiological Entomology, 12(4), 407-415. doi:10.1111/j.1365- 3032.1987.tb00767.x

Haupt, S. S., Sakurai, T., Namiki, S., Kazawa, T., & Kanzaki, R. (2010). Olfactory information processing in moths. In The neurobiology of olfaction: CRC Press/Taylor & Francis.

Hausmann, C., Samietz, J., & Dorn, S. (2004). Visual orientation of overwintered Anthonomus pomorum (Coleoptera : Curculionidae). Environmental Entomology, 33(5), 1410-1415.

Hayes, J. L., Strom, B. L., Roton, L. M., & Ingram, L. L. (1994). Repellent properties of the host compound 4-allylanisole to the southern pine beetle. Journal of Chemical Ecology, 20(7), 1595-1615.

Hayes, R. A., Amos, B. A., Rice, S. J., Baker, D. K., & Leemon, D. M. (2019). Behavioural responses of the small hive beetle to volatile components of fermenting honeybee hive products. Entomologia Experimentalis et Applicata, 167(9), 784-793.

Heed, W. B., Starmer, W. T., Miranda, M., Miller, M. W., & Phaff, H. J. (1976). An analysis of the yeast flora associated with cactiphilic Drosophila and their host plants in the Sonoran Desert and its relation to temperate and tropical associations. Ecology, 57(1), 151-160.

Hely, P. C., Pasfield, G., & Gellatley, J. G. (1982). Insect pests of fruit and vegetables in NSW: Department of Agriculture, New South Wales.

Herrera, C. M., Canto, A., Pozo, M. I., & Bazaga, P. (2010). Inhospitable sweetness: nectar filtering of pollinator-borne inocula leads to impoverished, phylogenetically clustered yeast communities. Proceedings of Royal Society B: Biological Sciences, 277(1682), 747-754.

Hetherington, S. (2005). Integrated pest and disease management of Australian Summerfruit (A. Munroe Ed.). Orange, New South Wales 2800: New South Wales Department of Primary Industries (DPI), Australia.

Hinton, H. (1945). A monograph of the beetles associated with stored products. Volume 1. A monograph of the beetles associated with stored products. Volume 1.

Hoang, D., Kopp, A., & Chandler, J. A. (2015). Interactions between Drosophila and its natural yeast symbionts-Is Saccharomyces cerevisiae a good model for studying the fly-yeast relationship? PeerJ, 3, e1116. doi:10.7717/peerj.1116

Hofstetter, R. W., Dinkins-Bookwalter, J., Davis, T. S., & Klepzig, K. D. (2015). Symbiotic associations of bark beetles. In Bark Beetles (pp. 209-245): Elsevier.

Horticulture Innovation Australia, H. (2018). Australian Horticulture Statistics Handbook 2017/18. Retrieved from

______162 Chemical ecology of Carpophilus beetles and their yeast symbionts

http://horticulture.com.au/resource/australian-horticulture-statistics- handbook/ accessed on 31/07/2019

Hossain, M. (2018). Management of Carpophilus Beetle in Almonds. Retrieved from Horticulture Innovation Australia, Sydney NSW 2000:

Hossain, M., Mansfield, C., & Brown, C. (2000). Control of Carpophilus spp. by using an aggregation pheromone. Australian Fresh Stone Fruit Quarterly, 2, 13-14.

Hossain, M., Rettke, M., Williams, D., & Hossain, A. (2009). Predominant Carpophilus spp. (Coleoptera: Nitidulidae) associated with damaged apricot fruit on trees. General and Applied Entomology, 38, 43-48.

Hossain, M., & Williams, D. (2003). Phenology of Carpophilus beetle populations (Coleoptera: Nitidulidae, Carpophilus spp.) in a fruit dump in northern Victoria. Australian Journal of Experimental Agriculture, 43(10), 1275-1279.

Hossain, M. S., Bartelt, R. J., Hossain, M. A., Williams, D. G., & Chandra, S. (2008). Longevity of pheromone and co‐attractant lures used in attract‐and‐ kill stations for control of Carpophilus spp. Entomologia experimentalis et applicata, 129(2), 148-156.

Hossain, M. S., Williams, D. G., Mansfield, C., Bartelt, R. J., Callinan, L., & Il’ichev, A. L. (2006). An attract‐and‐kill system to control Carpophilus spp. in Australian stone fruit orchards. Entomologia Experimentalis et Aapplicata, 118(1), 11-19.

Hothorn, T., Bretz, F., & Westfall, P. (2008). Simultaneous inference in general parametric models. Biometrical Journal: Journal of Mathematical Methods in Biosciences, 50(3), 346-363.

Howse, P. E. (1999). Insect attractant. USA. Patent No. 5,900,244.

Hui, F.-L., Chen, L., Chu, X.-Y., Niu, Q.-H., & Ke, T. (2013). Wickerhamomyces mori sp. nov., an anamorphic yeast species found in the guts of wood-boring insect larvae. International Journal of Systematic and Evolutionary Microbiology, 63(3), 1174-1178.

Hunt, D., & Borden, J. (1990). Conversion of verbenols to verbenone by yeasts isolated from Dendroctonus ponderosae (Coleoptera: Scolytidae). Journal of Chemical Ecology, 16(4), 1385-1397.

Iglesias, L. E., Nyoike, T. W., & Liburd, O. E. (2014). Effect of trap design, bait type, and age on captures of Drosophila suzukii (Diptera: Drosophilidae) in berry crops. Journal of Economic Entomology, 107(4), 1508-1518.

Jackson, S., & Nicolson, S. W. (2002). Xylose as a nectar sugar: from biochemistry to ecology. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology, 131(4), 613-620.

______Chemical ecology of Carpophilus beetles and their yeast symbionts 163

Jaenike, J. (1978). On optimal oviposition behavior in phytophagous insects. Theoretical Population Biology, 14(3), 350-356.

James, D. G., Bartelt, R. J., & Faulder, R. J. (1994). Attraction of Carpophilus spp.(Coleoptera: Nitidulidae) to synthetic aggregation pheromones and host- related coattractants in Australian stone fruit orchards: Beetle phenology and pheromone dose studies. Journal of Chemical Ecology, 20(11), 2805-2819.

James, D. G., Bartelt, R. J., Faulder, R. J., & Taylor, A. (1993). Attraction of australian Carpophilus spp (coleoptera, nitidulidae) to synthetic pheromones and fermenting bread dough. Journal of the Australian Entomological Society, 32, 339-345.

James, D. G., Bartelt, R. J., & Moore, C. J. (1996). Mass-trapping of Carpophilus spp.(Coleoptera: Nitidulidae) in stone fruit orchards using synthetic aggregation pheromones and a coattractant: Development of a strategy for population suppression. Journal of Chemical Ecology, 22(8), 1541-1556.

James, D. G., Faulder, R. J., & Bartelt, R. J. (1995). Fauna and Seasonal Abundance of Carpophilus spp.(Coleoptera: Nitidulidae) in Four Stone Fruit Growing Regions of Southeastern Australia as Determined by Pheromone‐trapping. Australian Journal of Entomology, 34(4), 327-333.

James, D. G., Faulder, R. J., Vogele, B., Bartelt, R. J., & Moore, C. J. (1997). Phenology of Carpophilus spp.(Coleoptera: Nitidulidae) in stone fruit orchards as determined by pheromone trapping: implications for prediction of crop damage. Austral Entomology, 36(2), 165-173.

James, D. G., & Vogele, B. (2000). Development and survivorship of Carpophilus hemipterus (L.), Carpophilus mutilatus Erichson and Carpophilus humeralis (F.)(Coleoptera: Nitidulidae) over a range of constant temperatures. Australian Journal of Entomology, 39(3), 180-184.

Janisiewicz, W., Kurtzman, C., & Buyer, J. (2010). Yeasts associated with nectarines and their potential for biological control of brown rot. Yeast, 27(7), 389-398.

Janz, N. (2003). The cost of polyphagy: oviposition decision time vs error rate in a butterfly. Oikos, 100(3), 493-496.

Jones, C. G. (1984). Microorganisms as mediators of plant resource exploitatioin by insect herbivores. In P. W. Price, C. N. Slobodchikoff, & W. S. Gaud (Eds.), A New Ecology: Novel approaches to interactive systems (1st ed., pp. 53-99). New York: Wiley-Interscience

Jönsson, M., & Anderson, P. (1999). Electrophysiological response to herbivore‐ induced host plant volatiles in the moth Spodoptera littoralis. Physiological Entomology, 24(4), 377-385.

______164 Chemical ecology of Carpophilus beetles and their yeast symbionts

Judd, G., & Borden, J. (1989). Distant olfactory response of the onion fly, Delia antiqua, to host‐plant odour in the field. Physiological Entomology, 14(4), 429-441.

Kandasamy, D., Gershenzon, J., Andersson, M. N., & Hammerbacher, A. (2019). Volatile organic compounds influence the interaction of the Eurasian spruce bark beetle (Ips typographus) with its fungal symbionts. The International Society of Microbial Ecology Journal, 1.

Kandasamy, D., Gershenzon, J., & Hammerbacher, A. (2016). Volatile organic compounds emitted by fungal associates of conifer bark beetles and their potential in bark beetle control. Journal of Chemical Ecology, 42(9), 952- 969.

Kariyat, R. R., & Portman, S. L. (2016). Plant-herbivore interactions: Thinking beyond larval growth and mortality. American Journal of Botany, 103(5), 789-791. doi:10.3732/ajb.1600066

Keesey, I. W., Knaden, M., & Hansson, B. S. (2015). Olfactory specialization in Drosophila suzukii supports an ecological shift in host preference from rotten to fresh fruit. Journal of Chemical Ecology, 41(2), 121-128. doi:10.1007/s10886-015-0544-3

Kimura, M. (1980). A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution, 16(2), 111-120.

Kingsolver, J. M. (1991). Adult beetles (Coleoptera). In Insect and mite pests in food: an illustrated key. (Vol. 655, pp. 75-94). USA: US Department of Agriculture.

Klepzig, K. D., Adams, A., Handelsman, J., & Raffa, K. (2009). Symbioses: a key driver of insect physiological processes, ecological interactions, evolutionary diversification, and impacts on humans. Environmental Entomology, 38(1), 67-77.

Knight, A. L., & Witzgall, P. (2013). Combining mutualistic yeast and pathogenic virus—a novel method for codling moth control. Journal of Chemical Ecology, 39(7), 1019-1026.

Knudsen, G. K., Bengtsson, M., Kobro, S., Jaastad, G., Hofsvang, T., & Witzgall, P. (2008). Discrepancy in laboratory and field attraction of apple fruit moth Argyresthia conjugella to host plant volatiles. Physiological Entomology, 33(1), 1-6. doi:10.1111/j.1365-3032.2007.00592.x

Kogan, M. (1998). Integrated pest management: historical perspectives and contemporary developments. Annual Review of Entomology, 43(1), 243-270.

Komen, E., Murungi, L. K., & Irungu, J. (2019). Behavioral response of the small hive beetle, Aethina tumida (Coleoptera: Nitidulidae) to volatiles of Apicure®, a plant-based extract. AAS Open Research, 2.

______Chemical ecology of Carpophilus beetles and their yeast symbionts 165

Kristensen, N. P. (1981). Phylogeny of insect orders. Annual Review of Entomology, 26(1), 135-157.

Kuhns, E. H., Tribuiani, Y., Martini, X., Meyer, W. L., Peña, J., Hulcr, J., & Stelinski, L. L. (2014). Volatiles from the symbiotic fungus Raffaelea lauricola are synergistic with Manuka lures for increased capture of the Redbay ambrosia beetle Xyleborus glabratus. Agricultural and Forest Entomology, 16(1), 87-94.

Kumar, S., Stecher, G., & Tamura, K. (2016). MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Molecular Biology and Evolution, 33(7), 1870-1874.

Kurtzman, C., Fell, J. W., & Boekhout, T. (2011). The yeasts: a taxonomic study: Elsevier.

Kurtzman, C., & Robnett, C. (1997). Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5'end of the large- subunit (26S) ribosomal DNA gene. Journal of clinical microbiology, 35(5), 1216-1223.

Kurtzman, C. P. (2011). Wickerhamomyces Kurtzman, Robnett & Basehoar-Powers (2008). In J. W. F. T. B. C. P. Kurtzman (Ed.), The Yeasts, a Taxonomic Study (5th ed., pp. 899-917). Amsterdam: Elsevier.

Kurtzman, C. P., Robnett, C. J., & Basehoar-Powers, E. (2008). Phylogenetic relationships among species of Pichia, Issatchenkia and Williopsis determined from multigene sequence analysis, and the proposal of Barnettozyma gen. nov., Lindnera gen. nov. and Wickerhamomyces gen. nov. FEMS Yeast Research, 8(6), 939-954.

Kuwahara, Y., Mori, N., Yamada, S., & Nemoto, T. (1984). Evaluation of bombykol as the sex pheromone of Bombyx mandarina (Lepidoptera: Bombycidae). Applied Entomology and Zoology, 19(2), 265-267.

Lachance, M.-A. (2006). Yeast biodiversity: how many and how much? In Biodiversity and ecophysiology of yeasts (pp. 1-9): Springer.

Lachance, M.-A., & Bowles, J. M. (2002). Metschnikowia arizonensis and Metschnikowia dekortorum, two new large-spored yeast species associated with floricolous beetles. FEMS Yeast Research, 2(2), 81-86.

Lachance, M.-A., Starmer, W. T., Rosa, C. A., Bowles, J. M., Barker, J. S. F., & Janzen, D. H. (2001). Biogeography of the yeasts of ephemeral flowers and their insects. FEMS Yeast Research, 1(1), 1-8.

Lam, K., Tsang, M., Labrie, A., Gries, R., & Gries, G. (2010). Semiochemical- mediated oviposition avoidance by female house flies, Musca domestica, on animal feces colonized with harmful fungi. Journal of Chemical Ecology, 36(2), 141-147.

______166 Chemical ecology of Carpophilus beetles and their yeast symbionts

Larsen, L. M., Nielsen, J. K., & Sorensen, H. (1992). Host plant recognition in monophagous weevils - specialization of ceutorhynchus inaffectatus to glucosinolates from its host plant hesperis matronalis. Entomologia Experimentalis et Applicata, 64(1), 49-55.

Larsson, M. C., & Svensson, G. P. (2009). Pheromone monitoring of rare and threatened insects: exploiting a pheromone–kairomone system to estimate prey and predator abundance. Conservation Biology, 23(6), 1516-1525.

Lasekan, O., Khatib, A., Juhari, H., Patiram, P., & Lasekan, S. (2013). Headspace solid-phase microextraction gas chromatography–mass spectrometry determination of volatile compounds in different varieties of African star apple fruit (Chrysophillum albidum). Food Chemistry, 141(3), 2089-2097.

Latorre-Estivalis, J. M., Lazzari, C. R., Guarneri, A. A., Mota, T., Omondi, B. A., & Lorenzo, M. G. (2013). Genetic basis of triatomine behavior: lessons from available insect genomes. Memórias do Instituto Oswaldo Cruz, 108, 63-73.

Law, J. H., & Regnier, F. E. (1971). Pheromones. Annual review of biochemistry, 40(1), 533-548.

Leake, A. (2000). The development of integrated crop management in agricultural crops: comparisons with conventional methods. Pest Management Science, 56(11), 950-953.

Leemon, D. (2012). In-hive fungal biocontrol of small hive beetle. Rural Industries Research and Development Corporation Publication no. 12/012, Canberra, Australia. In.

Lei, H., & Vickers, N. (2008). Central processing of natural odor mixtures in insects. Journal of Chemical Ecology, 34(7), 915-927.

Lenth, R. (2018). Emmeans: Estimated marginal means, aka least-squares means. R package version, 1(1).

Leschen, R., & Marris, J. (2005). Carpophilus (Coleoptera: Nitidulidae) of New Zealand with notes on Australian species. Landcare Research Contract Report: LCO405/153, 1-40.

Leufvén, A., Bergström, G., & Falsen, E. (1984). Interconversion of verbenols and verbenone by identified yeasts isolated from the spruce bark beetle Ips typographus. Journal of Chemical Ecology, 10(9), 1349-1361.

Levins, R., & MacArthur, R. (1969). An hypothesis to explain the incidence of monophagy. Ecology, 50(5), 910-911.

Lopes, M. R., Lara, C. A., Moura, M. E., Uetanabaro, A. P. T., Morais, P. B., Vital, M. J., & Rosa, C. A. (2018). Characterisation of the diversity and physiology of cellobiose-fermenting yeasts isolated from rotting wood in Brazilian ecosystems. Fungal Biology, 122(7), 668-676.

______Chemical ecology of Carpophilus beetles and their yeast symbionts 167

Lu, J., Robert, C. A. M., Lou, Y. G., & Erb, M. (2016). A conserved pattern in plant- mediated interactions between herbivores. Ecology and Evolution, 6(4), 1032-1040. doi:10.1002/ece3.1922

Mansfield, C., & Hossain, M. (2004a). The attractiveness of different fermenting food odours to'Carpophilus' spp.(Coleoptera: Nitidulidae). Gen Appl Ent, 33, 41-44.

Mansfield, C., & Hossain, M. (2004b). The attractiveness of different fermenting food odours to'Carpophilus' spp.(Coleoptera: Nitidulidae). General and Applied Entomology: The Journal of the Entomological Society of New South Wales, 33, 41-44.

Marini, F., Mutinelli, F., Montarsi, F., Cline, A. R., Gatti, E., & Audisio, P. (2013). First report in Italy of the dusky sap beetle, Carpophilus lugubris, a new potential pest for Europe. Journal of Pest Science, 86(2), 157-160.

Mayhew, P. J. (2001). Herbivore host choice and optimal bad motherhood. Trends in Ecology & Evolution, 16(4), 165-167. doi:10.1016/s0169-5347(00)02099-1

McCallum, E. J., Cunningham, J. P., Lucker, J., Zalucki, M. P., De Voss, J. J., & Botella, J. R. (2011). Increased plant volatile production affects oviposition, but not larval development, in the moth Helicoverpa armigera. Journal of Experimental Biology, 214(Pt 21), 3672-3677. doi:10.1242/jeb.059923

McKenzie, J., & Parsons, P. (1972). Alcohol tolerance: an ecological parameter in the relative success of Drosophila melanogaster and Drosophila simulans. Oecologia, 10(4), 373-388.

Merivee, E., Must, A., Luik, A., & Williams, I. (2010). Electrophysiological identification of hygroreceptor neurons from the antennal dome-shaped sensilla in the ground beetle Pterostichus oblongopunctatus. Journal of Insect Physiology, 56(11), 1671-1678.

Merivee, E., Ploomi, A., Rahi, M., Bresciani, J., Ravn, H. P., Luik, A., & Sammelselg, V. (2002). Antennal sensilla of the ground beetle Bembidion properans Steph.(Coleoptera, Carabidae). Micron, 33(5), 429-440.

Merivee, E., Ploomi, A., Rahi, M., Luik, A., & Sammelselg, V. (2000). Antennal sensilla of the ground beetle Bembidion lampros Hbst (Coleoptera, Carabidae). Acta Zoologica, 81(4), 339-350.

Merivee, E., Rahi, M., & Luik, A. (1997). Distribution of olfactory and some other antennal sensilla in the male click beetle Agriotes obscurus L.(Coleoptera: Elateridae). International Journal of Insect Morphology and Embryology, 26(2), 75-83.

Meshrif, W. S., Rohlfs, M., & Roeder, T. (2016). The Effect of Nutritive Yeasts on the Fitness of the Fruit Fly Drosophila melanogaster (Diptera: Drosophilidae). African Entomology, 24(1), 90-99. doi:10.4001/003.024.0090

______168 Chemical ecology of Carpophilus beetles and their yeast symbionts

Metcalf, L. (1994). Role of kairomones in integrated pest management. Phytoparasitica, 22(4), 275-279.

Milet-Pinheiro, P., Herz, K., Dötterl, S., & Ayasse, M. (2016). Host choice in a bivoltine bee: how sensory constraints shape innate foraging behaviors. BMC Ecology, 16(1), 1.

Miller, M., & Mrak, E. (1953). Yeasts associated with dried-fruit beetles in figs. Applied Microbiology, 1(4), 174.

Mitchell, B. (1994). The chemosensory basis of host-plant recognition in Chrysomelidae. In Novel aspects of the biology of Chrysomelidae (pp. 141- 151): Springer.

Moorhouse, J., Yeadon, R., Beevor, P., & NESBITT, B. F. (1969). Method for use in studies of insect chemical communication. Nature, 223(5211), 1174-1175.

Morais, P., Rosa, C., Mendoncahagler, L., & Hagler, A. (1992). Apiculate yeasts with high growth temperatures isolated from Drosophila in Rio-De-Janeiro, RJ, Brazil. Revista De Microbiologia, 23(3), 163-166.

Morais, P. B., Martins, M. B., Klaczko, L. B., Mendonça-Hagler, L. C., & Hagler, A. N. (1995). Yeast succession in the Amazon fruit Parahancornia amapa as resource partitioning among Drosophila spp. Applied and Environmental Microbiology, 61(12), 4251-4257.

Mori, B. A., Whitener, A. B., Leinweber, Y., Revadi, S., Beers, E. H., Witzgall, P., & Becher, P. G. (2017). Enhanced yeast feeding following mating facilitates control of the invasive fruit pest Drosophila suzukii. Journal of Applied Ecology, 54(1), 170-177.

Muller, C., & Renwick, J. A. A. (2001). Different phagostimulants in potato foliage for Manduca sexta and Leptinotarsa decemlineata. Chemoecology, 11(1), 37- 41. doi:10.1007/pl00001830

Murphy, K. A., Tabuloc, C. A., Cervantes, K. R., & Chiu, J. C. (2016). Ingestion of genetically modified yeast symbiont reduces fitness of an insect pest via RNA interference. Scientific Reports, 6, 22587. doi:10.1038/srep22587

Myers, L. (2004). Sap Beetles (of Florida), Nitidulidae (Insecta: Coleoptera: Nitidulidae). EDIS, 2004(12).

Narit, T., & Anuchit, C. (2011). Attraction of Bactrocera cucurbitae and B. papayae (Diptera: Tephritidae) to the Odor of the Bacterium Enterobacter cloacae. Philippine Agricultural Scientist, 94(1), 83-87.

Nolan IV, M. P., & Hood, W. M. (2008). Comparison of two attractants to small hive beetles, Aethina tumida, in honey bee colonies. Journal of Apicultural Research, 47(3), 229-233.

______Chemical ecology of Carpophilus beetles and their yeast symbionts 169

Nout, M. J. R. a., & Bartelt, R. J. (1998). Attraction of a flying nitidulid (Carpophilus humeralis) to volatiles produced by yeasts grown on sweet corn and a corn-based medium. Journal of Chemical Ecology, 24(7), 1217-1239.

Nylin, S., & Janz, N. (1993). Oviposition preference and larval performance in Polygonia c‐album (Lepidoptera: Nymphalidae): the choice between bad and worse. Ecological Entomology, 18(4), 394-398.

Olson, J. F., Vers, L. M. V., Moon, R. D., & Kells, S. A. (2017). Two compounds in bed bug feces are sufficient to elicit off‐host aggregation by bed bugs, Cimex lectularius. Pest Management Science, 73(1), 198-205.

Paiva, M. R., & Kiesel, K. (1985). Field responses of Trypodendron spp.(Col., Scolytidae) to different concentrations of lineatin and α‐pinene. Zeitschrift Für Angewandte Entomologie, 99(1‐5), 442-448.

Palanca, L., Gaskett, A. C., Gunther, C. S., Newcomb, R. D., & Goddard, M. R. (2013). Quantifying variation in the ability of yeasts to attract Drosophila melanogaster. PLoS One, 8(9), e75332. doi:10.1371/journal.pone.0075332

Papaj, D. R. (1986). Interpopulation differences in host preference and the evolution of learning in the butterfly, Battus philenor. Evolution, 518-530.

Papaj, D. R., & Rausher, M. (1987). Genetic differences and phenotypic plasticity as causes of variation in oviposition preference in Battus philenor. Oecologia, 74(1), 24-30.

Paul, J. S., Tiwari, K., & Jadhav, S. (2015). Long term preservation of commercial important fungi in glycerol at 4 C. International Journal of Biological Chemistry, 9(2), 79-85.

Phelan, P. L., & Lin, H. (1991). Chemical characterization of fruit and fungal volatiles attractive to dried-fruit beetle, Carpophilus hemipterus (L.)(Coleoptera: Nitidulidae). Journal of Chemical Ecology, 17(6), 1253- 1272.

Pietrowski, G. d. A. M., dos Santos, C. M. E. r., Sauer, E., Wosiacki, G., & Nogueira, A. (2012). Influence of fermentation with Hanseniaspora sp. yeast on the volatile profile of fermented apple. Journal of Agriculture and Food Chemistry, 60(39), 9815-9821.

Piper, A. M., Farnier, K., Linder, T., Speight, R., & Cunningham, J. P. (2017). Two gut-associated yeasts in a tephritid fruit fly have contrasting effects on adult attraction and larval survival. Journal of Chemical Ecology, 43(9), 891-901.

Quan, A. S., & Eisen, M. B. (2018). The ecology of the Drosophila-yeast mutualism in wineries. PLoS One, 13(5), e0196440.

Rahman, M. M., Zalucki, M. P., & Furlong, M. J. (2019a). Diamondback moth egg susceptibility to rainfall: effects of host plant and oviposition behavior. Entomologia Experimentalis et Applicata, 167(8), 701-712.

______170 Chemical ecology of Carpophilus beetles and their yeast symbionts

Rahman, M. M., Zalucki, M. P., & Furlong, M. J. (2019b). Host-Plant Specific Feeding Relationships and Insect Developmental Stage Modulate the Impact of Rainfall on Diamondback Moth Larvae. Environmental Entomology, 48(6), 1442-1451.

Ramaswamy, S. B. (1988). Host Finding and Feeding in Adult Phytophagous Insects Host finding by moths: Sensory modalities and behaviours. Journal of Insect Physiology, 34(3), 235-249. doi:http://dx.doi.org/10.1016/0022- 1910(88)90054-6

Refsnider, J. M., & Janzen, F. J. (2010). Putting eggs in one basket: ecological and evolutionary hypotheses for variation in oviposition-site choice. Annual Review of Ecology, Evolution and Systematics, 41, 39-57.

Revadi, S., Vitagliano, S., Rossi Stacconi, M. V., Ramasamy, S., Mansourian, S., Carlin, S., . . . Rota‐Stabelli, O. (2015). Olfactory responses of Drosophila suzukii females to host plant volatiles. Physiological Entomology, 40(1), 54- 64.

Ricci, I., Damiani, C., Scuppa, P., Mosca, M., Crotti, E., Rossi, P., . . . Ballarini, P. (2011). The yeast Wickerhamomyces anomalus (Pichia anomala) inhabits the midgut and reproductive system of the Asian malaria vector Anopheles stephensi. Environmental Microbiology, 13(4), 911-921.

Romano, P., Suzzi, G., Comi, G., & Zironi, R. (1992). Higher alcohol and acetic acid production by apiculate wine yeasts. Journal of Applied Bacteriology, 73(2), 126-130.

Sadek, M. M., Hansson, B. S., & Anderson, P. (2010). Does risk of egg parasitism affect choice of oviposition sites by a moth? A field and laboratory study. Basic and Applied Ecology, 11(2), 135-143.

Sanders, C. (1981). Release rates and attraction of PVC lures containing synthetic sex attractant of the spruce budworm, Choristoneura fumiferana (Lepidoptera: Tortricidae). The Canadian Entomologist, 113(2), 103-111.

Scheidler, N. H., Liu, C., Hamby, K. A., Zalom, F. G., & Syed, Z. (2015). Volatile codes: Correlation of olfactory signals and reception in Drosophila-yeast chemical communication. Scientific Reports, 5, 14059. doi:10.1038/srep14059

Scheirs, J., & De Bruyn, L. (2002). Integrating optimal foraging and optimal oviposition theory in plant–insect research. Oikos, 96(1), 187-191.

Scheirs, J., De Bruyn, L., & Verhagen, R. (2000). Optimization of adult performance determines host choice in a grass miner. Proceedings of the Royal Society B: Biological Sciences, 267(1457), 2065-2069.

Schiestl, F., & Marion-Poll, F. (2002). Detection of physiologically active flower volatiles using gas chromatography coupled with electroantennography. In Analysis of taste and aroma (pp. 173-198): Springer.

______Chemical ecology of Carpophilus beetles and their yeast symbionts 171

Schnee, C., Kollner, T. G., Held, M., Turlings, T. C. J., Gershenzon, J., & Degenhardt, J. (2006). The products of a single maize sesquiterpene synthase form a volatile defense signal that attracts natural enemies of maize herbivores. Proceedings of the National Academy of Sciences of the United States of America, 103(4), 1129-1134. doi:10.1073/pnas.0508027103

Schneider, D. (1957). Electrophysiological investigations of chemo- and mechanoreceptors of the antenna of silk moth Bombyx mori L. Journal of Comparative Physiology, 40(1), 8-41.

Schoonhoven, L. M., Van-Loon, J. J. A., & Dicke, M. (2005). Insect‑Plant Biology. Oxford: Oxford University Press.

Schorkopf, D. L. P., Molnár, B. P., Solum, M., Larsson, M. C., Millar, J. G., Kárpáti, Z., & Dekker, T. (2019). False positives from impurities result in incorrect functional characterization of receptors in chemosensory studies. Progress in Neurobiology, 101661.

Schott, M., Wehrenfennig, C., Gasch, T., & Vilcinskas, A. (2013). Insect antenna- based biosensors for in situ detection of volatiles. In Yellow Biotechnology II (pp. 101-122): Springer.

Schroeder, R., & Hilker, M. (2008). The relevance of background odor in resource location by insects: A behavioral approach. Bioscience, 58(4), 308-316. doi:10.1641/b580406

Schueffler, A., & Anke, T. (2014). Fungal natural products in research and development. Natural Product Reports, 31(10), 1425-1448.

Sedivy, C., Praz, C. J., Müller, A., Widmer, A., & Dorn, S. (2008). Patterns of host‐ plant choice in bees of the genus Chelostoma: The constraint hypothesis of host‐range evolution in bees. Evolution, 62(10), 2487-2507.

Seybold, S. J., Bentz, B. J., Fettig, C. J., Lundquist, J. E., Progar, R. A., & Gillette, N. E. (2018). Management of western North American bark beetles with semiochemicals. Annual Review of Entomology, 63, 407-432.

Sharma, K. R., Seenivasagan, T., Rao, A., Ganesan, K., Agarwal, O., Malhotra, R., & Prakash, S. (2008). Oviposition responses of Aedes aegypti and Aedes albopictus to certain fatty acid esters. Parasitology Research, 103(5), 1065- 1073.

Shikano, I., Rosa, C., Tan, C.-W., & Felton, G. W. (2017). Tritrophic interactions: microbe-mediated plant effects on insect herbivores. Annual Review of Phytopathology, 55, 313-331.

Simpraga, M., Takabayashi, J., & Holopainen, J. K. (2016). Language of plants: Where is the word? Journal of Integrative Plant Biology, 58(4), 343-349. doi:10.1111/jipb.12447

______172 Chemical ecology of Carpophilus beetles and their yeast symbionts

Singh, N., Wang, C., & Cooper, R. (2013). Effect of trap design, chemical lure, carbon dioxide release rate, and source of carbon dioxide on efficacy of bed bug monitors. Journal of Economic Entomology, 106(4), 1802-1811.

Smallegange, R. C., Schmied, W. H., van Roey, K. J., Verhulst, N. O., Spitzen, J., Mukabana, W. R., & Takken, W. (2010). Sugar-fermenting yeast as an organic source of carbon dioxide to attract the malaria mosquito Anopheles gambiae. Malaria Journal, 9(1), 292.

Smart, L., Aradottir, G., & Bruce, T. (2014). Role of semiochemicals in integrated pest management. In Integrated Pest Management (pp. 93-109): Elsevier.

Sobhy, I. S., Baets, D., Goelen, T., Herrera-Malaver, B., Bosmans, L., Van den Ende, W., . . . Lievens, B. (2018). Sweet scents: nectar specialist yeasts enhance nectar attraction of a generalist aphid parasitoid without affecting survival. Frontiers in Plant Science, 9, 1009.

Spencer, D. M., Spencer, J., De Figueroa, L., & Heluane, H. (1992). Yeasts associated with rotting citrus fruits in Tucumán, Argentina. Mycological Research, 96(10), 891-892.

Stamps, J. A., Yang, L. H., Morales, V. M., & Boundy-Mills, K. L. (2012). Drosophila regulate yeast density and increase yeast community similarity in a natural substrate. PLoS One, 7(7), e42238. doi:10.1371/journal.pone.0042238

Starmer, W. T., & Fogleman, J. C. (1986). Coadaptation of Drosophila and yeasts in their natural habitat. Journal of Chemical Ecology, 12(5), 1037-1055.

Starmer, W. T., Ganter, P. F., Aberdeen, V., Lachance, M.-A., & Phaff, H. J. (1987). The ecological role of killer yeasts in natural communities of yeasts. Canadian Journal of Microbiology, 33(9), 783-796.

Stefanini, I. (2018). Yeast‐insect associations: It takes guts. Yeast, 35(4), 315-330. doi:10.1002/yea.3309

Stockel, J., & Sureau, F. (1981a). Monitoring for the Angoumois grain moth in corn. In Management of insect pests with semiochemicals (pp. 63-73): Springer.

Stockel, J., & Sureau, F. (1981b). Monitoring for the Angoumois grain moth in corn. In E. Mitchell (Ed.), Management of insect pests with semiochemicals (pp. 63-73): Springer Boston MA.

Subaharan, K., Kumar, A., & Ganiger, P. (2013). Electrophysiological responses of chafer beetle, Holotrichia serrata (F.)(Coleoptera: Scarabaeidae). Journal of the Saudi Society of Agricultural Sciences, 12(2), 155-159.

Suh, S.-O., & Blackwell, M. (2004). Three new beetle-associated yeast species in the Pichia guilliermondii clade. FEMS Yeast Research, 5(1), 87-95.

______Chemical ecology of Carpophilus beetles and their yeast symbionts 173

Suh, S.-O., McHUGH, J. V., Pollock, D. D., & Blackwell, M. (2005). The beetle gut: a hyperdiverse source of novel yeasts. Mycological Research, 109(3), 261- 265.

Swanson, J. A., Torto, B., Kells, S. A., Mesce, K. A., Tumlinson, J. H., & Spivak, M. (2009). Odorants that induce hygienic behavior in honeybees: identification of volatile compounds in chalkbrood-infected honeybee larvae. Journal of Chemical Ecology, 35(9), 1108-1116.

Tallamy, D. W., & Krischik, V. A. (1989). Variation and function of cucurbitacins in cucurbita - an examination of current hypotheses. American Naturalist, 133(6), 766-786. doi:10.1086/284952

Tamaki, Y., Noguchi, H., Sugie, H., Sato, R., & Kariya, A. (1979). Minor components of the female sex-attractant pheromone of the smaller tea tortrix moth (Lepidoptera: Tortricidae): isolation and identification. Applied Entomology and Zoology, 14(1), 101-113.

Tamura, Y., Hattori, M., Konno, K., Kono, Y., Honda, H., Ono, H., & Yoshida, M. (2004). Triterpenoid and caffeic acid derivatives in the leaves of ragweed, Ambrosia artemisiifolia L. (Asterales : Asteraceae), as feeding stimulants of Ophraella communa LeSage (Coleoptera : Chrysomelidae). Chemoecology, 14(2), 113-118. doi:10.1007/s00049-004-0269-1

Tanton, M. (1977). Response to food plant stimuli by larvae of the mustard beetle Phaedon cochleariae. Entomologia Experimentalis et Applicata, 22(2), 113- 122.

Tasin, M., Knudsen, G. K., & Pertot, I. (2012). Smelling a diseased host: grapevine moth responses to healthy and fungus-infected grapes. Animal Behaviour, 83(2), 555-562.

Teal, P. E., Torto, B., Tumlinson III, J. H., & Boucias, D. G. (2007). US Patent: 20060141904. USDA.

Team, R. C. (2013). R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. http://www.R- project.org/.

Thompson, J. N. (1988). Evolutionary ecology of the relationship between oviposition preference and performance of offspring in phytophagous insects. Entomologia Experimentalis et Applicata, 47(1), 3-14.

Torto, B., Arbogast, R. T., Alborn, H., Suazo, A., Van Engelsdorp, D., Boucias, D., . . . Teal, P. E. (2007). Composition of volatiles from fermenting pollen dough and attractiveness to the small hive beetle Aethina tumida, a parasite of the honeybee Apis mellifera. Apidologie, 38(4), 380-389.

Torto, B., Boucias, D. G., Arbogast, R. T., Tumlinson, J. H., & Teal, P. E. (2007). Multitrophic interaction facilitates parasite-host relationship between an

______174 Chemical ecology of Carpophilus beetles and their yeast symbionts

invasive beetle and the honey bee. Proc Natl Acad Sci U S A, 104(20), 8374- 8378. doi:10.1073/pnas.0702813104

Torto, B., Suazo, A., Alborn, H., Tumlinson, J. H., & Teal, P. E. (2005). Response of the small hive beetle (Aethina tumida) to a blend of chemicals identified from honeybee (Apis mellifera) volatiles. Apidologie, 36(4), 523-532.

Touhara, K., & Vosshall, L. B. (2009). Sensing odorants and pheromones with chemosensory receptors. Annual Review of Physiology, 71, 307-332.

Urbina, H., Schuster, J., & Blackwell, M. (2013). The gut of Guatemalan passalid beetles: a habitat colonized by cellobiose-and xylose-fermenting yeasts. Fungal Ecology, 6(5), 339-355.

Vacek, D. C., Starmer, W. T., & Heed, W. B. (1979). Relevance of the ecology of citrus yeasts to the diet of Drosophila. Microb. Ecol., 5(1), 43-49.

Vadkertiová, R., Molnárová, J., Vránová, D., & Sláviková, E. (2012). Yeasts and yeast-like organisms associated with fruits and blossoms of different fruit trees. Canadian Journal of Microbiology, 58(12), 1344-1352.

Van Lancker, F., Adams, A., Delmulle, B., De Saeger, S., Moretti, A., Van Peteghem, C., & De Kimpe, N. (2008). Use of headspace SPME-GC-MS for the analysis of the volatiles produced by indoor molds grown on different substrates. Journal of Environmental Monitoring, 10(10), 1127-1133. van Loon, J. J. A., Wang, C. Z., Nielsen, J. K., Gols, R., & Qiu, Y. T. (2002). Flavonoids from cabbage are feeding stimulants for diamondback moth larvae additional to glucosinolates: Chemoreception and behaviour. Entomologia Experimentalis et Applicata, 104(1), 27-34.

Van Naters, W. v. d. G., & Carlson, J. R. (2006). Insects as chemosensors of humans and crops. Nature, 444(7117), 302.

Visser, J. H. (1988). Host Finding and Feeding in Adult Phystophagous Insects Host- plant finding by insects: Orientation, sensory input and search patterns. Journal of Insect Physiology, 34(3), 259-268. doi:http://dx.doi.org/10.1016/0022-1910(88)90056-X

Vitanović, E., Aldrich, J. R., Winterton, S. L., Boundy-Mills, K., Lopez, J. M., & Zalom, F. G. (2019). Attraction of the Green Lacewing Chrysoperla comanche (Neuroptera: Chrysopidae) to Yeast. Journal of Chemical Ecology, 45(4), 388-391.

Walker, K. (2007). Australian sap beetle (Carpophilus davidsoni) Updated on 6/14/2007 Available online: PaDIL - http://www.padil.gov.au Accessed on 07/07/207.

Walsh, D. B., Bolda, M. P., Goodhue, R. E., Dreves, A. J., Lee, J., Bruck, D. J., . . . Zalom, F. G. (2011). Drosophila suzukii (Diptera: Drosophilidae): invasive pest of ripening soft fruit expanding its geographic range and damage potential. Journal of Integrated Pest Management, 2(1), G1-G7. ______Chemical ecology of Carpophilus beetles and their yeast symbionts 175

Weissbecker, B., Holighaus, G., & Schütz, S. (2004). Gas chromatography with mass spectrometric and electroantennographic detection: analysis of wood odorants by direct coupling of insect olfaction and mass spectrometry. Journal of Chromatography A, 1056(1-2), 209-216.

West, S. A., & Cunningham, J. P. (2002). A general model for host plant selection in phytophagous insects. Journal of Theoretical Biology, 214(3), 499-513. doi:10.1006/jtbi.2001.2475

White, T. J., Bruns, T., Lee, S., & Taylor, J. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR protocols: a guide to methods and applications, 18(1), 315-322.

Wielkopolan, B., & Obrepalska-Steplowska, A. (2016). Three-way interaction among plants, bacteria, and coleopteran insects. Planta, 244(2), 313-332. doi:10.1007/s00425-016-2543-1

Witzgall, P., Bäckman, A.-C., Svensson, M., Koch, U., Rama, F., El-Sayed, A., . . . Löfqvist, J. (1999). Behavioral observations of codling moth, Cydia pomonella, in orchards permeated with synthetic pheromone. BioControl, 44(2), 211-237.

Witzgall, P., Kirsch, P., & Cork, A. (2010). Sex pheromones and their impact on pest management. Journal of Chemical Ecology, 36(1), 80-100.

Witzgall, P., Proffit, M., Rozpedowska, E., Becher, P. G., Andreadis, S., Coracini, M., . . . Knight, A. (2012). "This is not an apple"-yeast mutualism in codling moth. Journal of Chemical Ecology, 38(8), 949-957. doi:10.1007/s10886- 012-0158-y

Yang, L., Hu, X. P., Allan, S., Alborn, H., & Bernier, U. R. (2019). Electrophysiological and Behavioral Responses of the Kudzu Bug, Megacopta cribraria (Hemiptera: Plataspidae) to Volatile Compounds from Kudzu and Soybean Plants. Journal of Agricultural and Food Chemistry.

Yang, S., Mei, X.-D., Zhang, X.-F., Li, Y.-F., She, D., Zhang, T., & Ning, J. (2016). Attraction of Coffee Bean Weevil, Araecerus fasciculatus, to Volatiles from the Industrial Yeast Kluyveromyces lactis. Journal of Chemical Ecology, 1-8.

Yang, S., Mei, X.-D., Zhang, X.-F., Li, Y.-F., She, D., Zhang, T., & Ning, J. (2017). Attraction of Coffee Bean Weevil, Araecerus fasciculatus, to Volatiles from the Industrial Yeast Kluyveromyces lactis. Journal of Chemical Ecology, 43(2), 180-187.

Zhao, T., Ganji, S., Schiebe, C., Bohman, B., Weinstein, P., Krokene, P., . . . Unelius, C. R. (2019). Convergent evolution of semiochemicals across Kingdoms: bark beetles and their fungal symbionts. The International Society Microbial Ecology Journal, 13(6), 1535.

______176 Chemical ecology of Carpophilus beetles and their yeast symbionts

Zilkowski, B. W., Bartelt, R. J., Blumberg, D., James, D. G., & Weaver, D. K. (1999). Identification of host-related volatiles attractive to pineapple beetle Carpophilus humeralis. Journal of Chemical Ecology, 25(1), 229-252.

Appendices

Appendix 1: Abstract of oral presentation relevant to this thesis that was presented in scientific conference

Conference: Australian Entomological Society Conference

48th AGM and Scientific Conference, Terrigal, New South Wales, Australia

September 17-20, 2017

Oral Presentation: The role of yeast odours in Carpophilus spp. (Coleoptera: Nitidulidae) attraction to stonefruits

Baig, F.(1,2), Hossain, S. M.(2) and Cunningham, J.P.(2,1)

1Queensland University of Technology, Brisbane, QLD 4000, Australia

2Department of Economic Development, Jobs, Transport and Resources, Agribio, Melbourne VIC 3083, Australia

Abstract

Several Carpophilus spp. are considered key pests of ripening fruits in Australia.

These beetles cause direct damage by chewing and entering the fruit, and indirect damage as a vector for diseases such as brown rot (Monilinia fructicola), which leads to rapid breakdown of the fruit and renders it unsellable for domestic and

______Chemical ecology of Carpophilus beetles and their yeast symbionts 177 international markets. Our study isolated several species of yeast from the gut of adult beetles of C. hemipterus (which prefers rotting fruit) and C. davidsoni (which prefers ripe fruit on the tree), and subsequently investigated the role of two of the most prevalent yeasts, Pichia kluyveri and Hanseniaspora guilliermondii, on adult attraction and larval survival. Results are presented from experiments using a static flow two-choice olfactometer to investigate preferences for yeast odours, analysis of volatiles in yeast odours (GC-MS), electrophysiological (electroantennogram) responses to yeast volatiles, adult female fecundity upon yeast feeding, and larval survival trials on different yeast species. Understanding the ecological context of these yeast-insect interactions could assist the formulation of attractants to be used in trapping and monitoring Carpophilus beetles in a range of orchard crops.

Appendix 2: Adult C. hemipterus failed to discriminate between two yeast species in a two-choice static flow olfactometer

Olfactometer: The relative attractiveness of C. hemipterus adults to odours from different yeast species was investigated using a newly devised static-flow two choice olfactometer (Fig. 2). Each olfactometer was assembled using two different size pipette tip boxes (Aerosol Barrier Tips box, Interpath Services®) without racks, the upper box (1000 µl pipette tip box without lid) and the lower box (200 µl pipette tip box with lid). Upper box acted as a “release arena”, with a 4.4 cm diameter hole at its bottom centre, covered with fine mesh to allow aeration. This upper box was placed in an inverted position over the transparent lid of lower box, which served as floor of “release arena”. To avoid possible visual effects, the transparent lid was covered with light grey paper from underside. Inside the lower box, there were two

30 mL plastic cups with lids acting as a “choice cups” connected to the release arena by two 8.5 mm diameter holes spaced at 6 cm apart that had been drilled into lid of

______178 Chemical ecology of Carpophilus beetles and their yeast symbionts

lower box. Two 1000 µl pipette tips acted as a connector between release arena floor and choice cups. These tips were cut from top (2.1cm) and bottom (1.7cm). Then these tips were affixed into holes of release arena so that 0.25 cm top of the tip protruding from release arena to avoid falling down of beetles into traps accidently.

And it was also made sure that the choice cups are air tight after inserting pipette tips into their lids. The utility of these static-flow olfactometers lies in the fact that once adult beetles make their choice and enters into one of the choice cups containing an attractive substrate, they are unable to pass back through to the release arena and their choice can be easily and accurately recorded.

Substrates: Peach Agar Media (PAM) was prepared to examine attraction of C. hemipterus to the two most prevalent yeast species, Pichia kluyveri and

Hanseniaspora guilliermondii, extracted from beetles gut. Yellow peaches were surface sterilised by immersion into 80% ethanol for 15 min followed by rinsing with 100% sodium hypochlorite and sterile distilled water, before making into a pulp. Peach pulp (250 g), RO water (250 mL) and agar (7.5 g) was used to make 500 mL of PAM. The PAM was autoclaved, and ampicillin (500 µL/500 mL of PAM) was added as an antibacterial agent. 15 mL (~6.5gm) of PAM was used in each cup.

For each yeast species, 30 PAM cups were streaked with half loopful of yeast using

1 µL inoculating loop and incubated at 25°C for 48 h.

Olfactometer tests: 20 adult beetles were released into the arena and thereby exposed to the two-choice set up. The lid was closed and sealed with autoclave tape to avoid beetles escaping. Olfactometers were housed in a controlled environment room

(CER) at 25°C, 60±5% RH, and leaving adults to make a choice over a 6 h period.

______Chemical ecology of Carpophilus beetles and their yeast symbionts 179

Fig. 1- Schematic diagram of dual-choice olfactometer At the end of the experiment trap catches were recorded and beetles were sexed.

Choice cups were discarded, and the olfactometers were washed in detergent and water, rinsed with 70% ethanol, and air dried overnight before re-use.

Choice experiments were conducted in a single run with 15 replicates. In total, 1200 adult beetles (male + female) were tested for their response to different treatments using 60 olfactometers, testing the following dual-choice combinations of odour treatments:

1. Pichia kluyveri vs PAM (Y1 vs C)

2. Hanseniaspora guilliermondi vs PAM (Y2 vs C)

3. P. kluyveri vs H. guilliermondi (Y1 vs Y2)

4. Sterile PAM vs Blank (C vs B)

______180 Chemical ecology of Carpophilus beetles and their yeast symbionts

Statistical Analysis

Data collected in adult behaviour experiment did not show a normal distribution

(Shapiro-Wilk Test and skewness & kurtosis test, P < 0.05), therefore non- parametric tests were used to analyse this data. For dual choice olfactometer bioassays, the null hypothesis that C. hemipterus showed no preference for either of the choices (i.e., 50:50 response) was tested using the Wilcoxon Signed Ranks

(WSR) test. Unresponsive individuals were not included in the analysis. The distribution of males and females caught in each treatment cup of olfactometer was analysed using WSR test. SPSS Statistics 23 software package was used for data analysis.

Results

Adult beetle responses to yeast odours

Olfactory response:

In dual choice trap assays, beetles responded well to odours emitted from traps

(mean adult responders per trial = 214.75±16.35 / 300). Results are displayed in

Figure 5. Adult attraction (males and females combined) (Fig. 5a): Number of adults attracted to peach agar media inoculated with PK was significantly higher than sterile control (PK = 10.2±0.62; C = 4.5±0.70) (PK vs C: Z = -3.25, P < 0.05, WSR) and similar trend was observed to media inoculated with HG against control (HG =

11±0.8; C = 5±1) (HG vs C: Z = -3.07; P < 0.05, WSR). When both yeast were offered against each other, response of beetles to either of the yeasts was not significantly different (HG = 5.8±0.8; PK = 4.9±0.9) (HG vs PK: Z = -0.77, P >

0.05, WSR). Significantly higher number of adults response to sterile control against blank was observed (C = 4.1±1; PK = 1.9±0.5) (C vs B: Z = -3.41, P > 0.05, WSR). ______Chemical ecology of Carpophilus beetles and their yeast symbionts 181

The mean number of males and females tested per trial was 133±7.49 and 167±7.49 respectively. A greater number of females responded to trap odours compared to males (mean females per trial = 145±13, mean males per trial = 70±6.5) (Z = -6.23,

P < 0.05, WSR). Males attraction (Fig. 5b): Peach agar media inoculated with HG attracted significantly more males compared to sterile control (HG = 3.73±0.39; C =

1.8±0.30) (Z = -2.53, P < 0.05, WSR). Males response was not significantly different when both yeasts were presented against each other (HG = 2.4±0.5; PK = 1.46±0.39)

(HG vs PK: Z = -1.17, P > 0.05, WSR). Similarly, media inoculated with PK did not attract significant number of males compared to control (PK = 2.2±0.38; C =

1.5±0.3) (PK vs C: Z = -0.86, P > 0.05, WSR). Females attraction (Fig. 5c): Females showed slightly different trend in attraction to yeast odours than males. Number of females attracted to peach agar media inoculated with PK was significantly higher than sterile control (PK = 8±0.40; C = 3±0.50) (PK vs C: Z = -3.30, P < 0.05, WSR) and similar trend was observed to media inoculated with HG against control (HG =

7.33±0.63; C = 3±0.50) (HG vs C: Z = -3.11; P < 0.05, WSR). However, response of females, like males, was not significantly different when both yeasts presented against each other (HG = 3.4±0.6; PK = 3.6±0.4) (HG vs PK: Z = -0.24, P > 0.05,

WSR).

______182 Chemical ecology of Carpophilus beetles and their yeast symbionts