THE ROLE OF THE TRANSCRIPTION FACTOR SLUG IN THE CUTANEOUS RESPONSE TO ULTRAVIOLET RADIATION EXPOSURE
DISSERTATION
Presented in Partial Fulfillment of the Requirements for
the Degree Doctor of Philosophy in the Graduate
School of The Ohio State University
By
Kimberly M. Newkirk, DVM, DACVP
* * * * *
The Ohio State University
2007
Dissertation Committee: Approved by Dr. Donna F. Kusewitt, Advisor
Dr. Michael D. Lairmore ______Advisor Dr. Carmen M.H. Colitz Graduate Program in Veterinary Biosciences Dr. Tatiana M. Oberyszyn
ABSTRACT
Slug is a member of the Snail family of zinc-finger transcription factors and has been implicated in epithelial-mesenchymal transformation (EMT). EMT occurs during embryonic development and wound healing, and contributes to the invasive behavior of neoplastic cells. Little is known about Slug expression and its function in normal adult tissue.
To study the impact of Slug in normal skin, we compared patterns of gene expression in epidermis from Slug null and wild type mice. Functional classification of genes with altered expression was consistent with a role for Slug in keratinocyte development and differentiation, proliferation, apoptosis, adhesion, motility, as well as angiogenesis and response to environmental stimuli. These functional categories all have important implications for skin homeostasis, wound healing, and carcinogenesis.
We then investigated the role of Slug in the response to ultraviolet radiation
(UVR). Although the extent of direct UVR-induced DNA damage was similar in both genotypes, Slug knockout mice did not develop the hallmarks of sunburn that were observed in wild type mice. Additionally, Slug knockout mice had markedly reduced dermal neutrophil infiltrates and epidermal hyperplasia post-UVR compared to wild type mice. The resistance of the knockout mice to the acute effects of UVR exposure could be explained, at least in part, by delayed and sometimes exaggerated cytokine expression in
ii these mice following UVR exposure. These findings indicated an important role for Slug in the acute inflammatory and proliferative responses of the skin to UVR exposure.
Since chronic inflammation is strongly linked to carcinogenesis, we next evaluated the role of Slug in the chronic UVR exposure and UVR-induced tumor formation. As compared to the wild type mice, the Slug null mice had less cutaneous inflammation, less epidermal proliferation, a lower tumor burden, and a tendency to develop fewer aggressive spindle cell tumors – which are believed to arise from EMT within squamous cell carcinomas. Furthermore, we identified decreased vimentin and increased E-cadherin expression in these tumors which suggested impaired EMT in the
Slug knockout mice, and therefore the potential for reduced invasive or metastatic capabilities. This study confirmed a role for Slug in skin carcinogenesis and EMT, but demonstrated that Slug is not required for the development or progression of UVR- induced skin tumors
Additionally, during the UVR carcinogenesis study, we identified a previously unreported condition of UVR-induced corneal degeneration in wild type mice.
Overall, our studies have demonstrated unexpected roles for Slug in epidermal homeostasis and the cutaneous inflammatory response and provided evidence for the role of Slug in skin carcinogenesis.
iii To Johnny, my Guardian Angel
iv ACKNOWLEDGMENTS
First and foremost, I would like to thank my advisor, Dr. Donna Kusewitt who has supported me from the beginning. She has patiently guided me through my research training, grant writing and dissertation, while giving me the freedom to pursue my own interests, including my pathology training.
I also wish to thank my dissertation committee: Dr. Michael Lairmore, Dr.
Carmen Colitz, Dr. Tatiana Oberyszyn and, of course, Dr. Donna Kusewitt for displaying a genuine passion for science, inspiring me and encouraging me to pursue a career in academia. I also want to thank Dr. Carmen Colitz and the rest of the ophthalmologists for instilling in me a love of ophthalmology.
Dr. Steve Weisbrode and Dr. Paul Stromberg were instrumental in my pathology training. They shared with me their persistent curiosity and thirst for knowledge, and will always be my mentors.
I am grateful and indebted to the members of Kusewitt and Colitz groups for making me feel like part of their family and for sharing their knowledge. To Dr. Heather
Chandler for serving as my sounding board for scientific, statistical, ethical and feline issues; as well as sharing her research experiences with me so that I can learn from them.
Thanks to Allison Parent, Curt Barden, Melissa DeLauter and Dr. Erin Brannick for their friendship, un-ending support, laughter, and help with everything from dog-sitting to
v immunohistochemistry. I extend my sincerest apologies to Dr. Stacey Fossey for not being available to guide her during her early days in the laboratory, and wish her the best of luck in her upcoming journey. Finally, Dr. Changsun Choi (Sunny) and Dr. Ping Lu must be acknowledged for provided countless answers and advice to help me through my struggles with science and math.
This work could not have been completed without the help of Anne Saulsbery,
Mary Ross and Alan Flechtner in the Histopathology Services within the Veterinary
College. Their meticulous and diligent work on my hundreds of slides was always on time and always of the highest quality.
I would also like to thank the University Laboratory Animal Resources for taking care of the mice that made this research possible. Dr. William Saville and Alan Bakaletz must also be acknowledged for their help with statistical analyses. Jeff Palatini was critical in helping me design and implement the microarray study.
The unrelenting support of my friends, the other pathology residents, and my family was essential to maintaining the sanity required to complete my training in a timely manner.
vi VITA
June 6, 1976 ...... Born – Guatemala City, Guatemala
1998 ...... BS in Animal Science, Cornell University
2002 ...... DVM, Virginia-Maryland Regional College of Veterinary Medicine
2002 – present ...... Graduate Research Associate The Ohio State University
FIELDS OF STUDY
Major Field: Veterinary Biosciences
vii TABLE OF CONTENTS
Page Abstract...... ii
Dedication...... iv
Acknowledgments...... v
Vita ...... vii
List of Figures ...... xi
List of Tables ...... xiii
Chapters
1. Introduction ...... 1
1.1 The Snail Family of Transcriptional Repressors ...... 1 1.2 Induction of Snail Family Transcription Factors...... 2 1.3 The Snail Family in Epithelial-Mesenchymal Transformation ...... 5 1.4 The Snail Family and Proliferation...... 10 1.5 The Snail Family and Apoptosis...... 11 1.6 The Snail Family and Development...... 15 1.7 The Snail Family and Carcinogenesis...... 18 1.8 The Snail Family and Angiogenesis...... 22 1.9 The Snail Family and Inflammation...... 23 1.10 Summary...... 24
2. Microarray Analysis Demonstrates a Role for Slug in Epidermal Homeostasis...... 25
2.1 Abstract...... 25 2.2 Introduction...... 26 2.3 Materials and Methods ...... 28 2.3.1 Mice ...... 28 2.3.2 Microarray Analysis ...... 28
viii 2.3.3 Data Analysis...... 30 2.3.4 Quantitative RT-PCR...... 31 2.3.5 Histology and Immunohistochemistry...... 32 2.4 Results and Discussion...... 34 2.4.1 Overview of Microarray Findings ...... 34 2.4.2 Development and Differentiation ...... 35 2.4.3 Proliferation and Apoptosis...... 38 2.4.4 Adhesion and Motility ...... 40 2.4.5 Angiogenesis ...... 43 2.4.6 Response to External Stimuli ...... 44 2.4.7 Miscellaneous ...... 46 2.5 Conclusions...... 47
3. The Acute Cutaneous Inflammatory Response is Attenuated in Slug Knockout Mice ...... 74
3.1 Abstract...... 74 3.2 Introduction...... 75 3.3 Materials and Methods ...... 76 3.3.1 UVR Exposure of Mice...... 76 3.3.2 Histology and Immunohistochemistry...... 77 3.3.3 Myeloperoxidase (MPO) Assay ...... 80 3.3.4 RNA Isolation...... 80 3.3.5 Quantitative RT-PCR...... 80 3.3.6 Cytokine Array ...... 81 3.3.7 Statistics ...... 82 3.4 Results and Discussion...... 82 3.4.1 Gross and Histologic Pathology ...... 82 3.4.2 DNA damage...... 84 3.4.3 Skin Thickness...... 84 3.4.4 Inflammation ...... 85 3.4.5 Cytokine Expression ...... 87 3.4.6 Apoptosis...... 88 3.5 Conclusions...... 88
4. The Role of Slug in Ultraviolet Radiation-Induced Carcinogenesis ...... 109
4.1 Abstract...... 109 4.2 Introduction...... 110 4.3 Materials and Methods ...... 112 4.3.1 Mice ...... 112 4.3.2 UVR Exposure...... 112 4.3.3 Histopathology ...... 113 4.3.4 Immunohistochemical and Histochemical Staining ...... 114 4.3.5 Morphometry...... 116
ix 4.3.6 Quantitative RT-PCR...... 117 4.3.7 Statistics ...... 117 4.4 Results ...... 118 4.4.1 Skin Thickness...... 118 4.4.2 Inflammation ...... 119 4.4.3 Tumor Development...... 120 4.4.4 Expression of Slug and Snail...... 121 4.4.5 Expression of Slug and Snail Targets...... 122 4.4.6 Immunohistochemical Characterization of the Spindle Cell Tumors ...... 124 4.5 Discussion...... 125 4.5.1 Slug and Epidermal Proliferation ...... 125 4.5.2 Slug and Cutaneous Inflammation ...... 125 4.5.3 Slug and Skin Carcinogenesis ...... 126 4.5.4 Slug Targets During EMT in Skin Tumors...... 128
5. Ultraviolet Radiation-Induced Corneal Degeneration in 129 Mice...... 143
5.1 Abstract...... 143 5.2 Introduction...... 144 5.3 Materials and Methods ...... 145 5.3.1 Study Design ...... 145 5.3.2 Ophthalmic Examination ...... 146 5.3.3 Histology and Immunohistochemistry...... 146 5.3.4 Statistical Analysis...... 147 5.4 Results ...... 147 5.4.1 Chronic UVR Exposure ...... 147 5.4.2 Acute UVR Exposure ...... 150 5.5 Discussion...... 150
6. Conclusions ...... 164
List of References...... 169
x LIST OF FIGURES
Figure Page
2.1 Technique for Isolating Epidermal Cells from the Skin ...... 49
2.2 Epidermal RNA Quality Analysis ...... 50
2.3 Immunohistochemical Detection of Keratin 8 in Untreated Skin ...... 51
3.1 Gross Appearance 96 hrs post-UVR (3MED) Exposure ...... 94
3.2 Histology Appearance of the Wild Type Skin Following UVR (3MED) Exposure...... 95
3.3 Histology Appearance of the Slug Knockout Skin Following UVR (3MED) Exposure...... 97
3.4 Immunohistochemical Detection of Cyclobutane Pyrimidine Dimers (CPDs) ..99
3.5 Skin Thickness...... 100
3.6 Neutrophil Infiltrates...... 101
3.7 Mast Cell Counts ...... 102
3.8 Immunohistochemical Detection of CD3 Positive Epidermal Cells ...... 103
3.9 Quantitative RT-PCR Detection of COX-2 mRNA in the UVR-exposed Epidermis ...... 104
3.10 UVR-induced Apoptosis ...... 105
4.1 Histologic Appearance of Tumors...... 131
4.2 Inflammatory Cells in Chronically UVR-Exposed Non-Tumor Skin ...... 132
4.3 Tumor Onset...... 134
xi 4.4 Tumor Burden ...... 135
4.5 Distribution of Tumor Types...... 136
4.6 Expression of Slug and Snail...... 137
4.7 Expression of Slug and Snail Targets ...... 138
4.8 Immunohistochemical Characterization of Spindle Cell Tumors ...... 140
5.1 Gross Images of 129 Mouse Eyes ...... 155
5.2 Slit Lamp Images of 129 Mouse Eyes ...... 156
5.3 Histopathology of the Corneas of 129 Mice ...... 158
5.4 Keratinocyte Numbers in the Corneas of 129 Mice ...... 159
5.5 Histopathology of the Lens of 129 Mice ...... 160
5.6 Immunohistochemistry for Cleaved Caspase 3 to Demonstrate Apoptotic Cells in 129 Mice 24 hrs After Exposure to UVR...... 162
5.7 Cleaved Caspase 3-positive Epithelial Cells in the Corneas of Mice Exposed to 3 MED UVR...... 163
xii LIST OF TABLES
Table Page
2.1. Altered Expression of Development and Differentiation-related Genes in Slug Knockout Epidermis ...... 52
2.2 Altered Expression of Proliferative and Apoptosis-related Genes in Slug Knockout Epidermis ...... 55
2.3 Altered Expression of Adhesion and Motility-related Genes in Slug Knockout Epidermis ...... 57
2.4 Altered Expression of Angiogenesis-related Genes in Slug Knockout Epidermis ...... 60
2.5 Altered Expression of Genes Related to Responses to External Stimuli in Slug Knockout Epidermis ...... 61
2.6 Miscellaneous Genes with Altered Expression in Slug Knockout Epidermis ....64
2.7 Confirmation of Microarray Findings by Quantitative RT-PCR ...... 73
3.1 Comparative Inflammatory Gene Expression Following UVR Exposure...... 107
4.1 Primer Sequences for Quantitative RT-PCR...... 141
4.2 Basic Tumor Data...... 142
xiii CHAPTER 1
INTRODUCTION
1.1 The Snail Family of Transcriptional Repressors
Slug is a member of the Snail family of zinc finger transcription factors. Other members of the family include Snail, Escargot, Worniu and Scratch (Come et al, 2004).
Snail family members, including Slug and the related Snail transcription factor, have
C2H2 type zinc fingers in the carboxy region which appear to function as the DNA binding elements (Hemavathy et al, Gene and MCB 2000; Manzanares et al, 2001;
Sefton et al, 1998; Come et al, 2004). Slug contains five zinc finger domains; the first domain appears to be non-functional, while the third and fourth are conserved among all
Snail superfamily proteins (Hemavathy et al, MCB 2000). These zinc fingers recognize the consensus sequence 5’- CAGGTG/5’-CACCTG and bind DNA to repress transcription of target genes (Hemavathy et al, Gene and MCB 2000; Manzanares et al,
2001; Moll et al, 1997; Come et al, 2004). Vertebrate Slug and Snail proteins also share a SNAG domain at the amino terminus, which is a stretch of 20 amino acids that does not bind DNA, but serves as a nuclear localization signal and confers transcriptional repressor activity (Hemavathy et al, Gene and MCB 2000; Grimes et al, 1996).
1 Transcriptional repression is mediated through the recruitment of histone deacetylases
(HDACs), HDAC1, HDAC2, mSin3A, which complex with the SNAG domain (Come et al, 2004). A variety of proteins otherwise unrelated to Snail superfamily proteins also contain SNAG domains, including homeo box protein Gsh-1, the insulinoma-associated zinc finger protein, and the Gfi-1 oncogene (Grimes et al, 1996). In addition, vertebrate
Slug genes contain a highly conserved Slug domain, a stretch of 29 amino acids located between the SNAG and zinc finger domains, which is a C-terminal binding protein
(CtBP) interaction motif (Hemavathy et al, MCB 2000; Sefton et al, 1998). The function of this region is uncertain, however, CtBP has been shown to bind oncoprotein E1A
(Hemavathy et al, Gene 2000), but the significance of this is unclear. Unlike Slug, Snail has a nuclear export (NES) sequence and shuttles from the nucleus/cytoplasm via CRM1 transporter. Phosphorylation of the NES facilitates translocation of Snail to the nucleus.
Generally, Snail is present in discrete foci in the nucleus – sites of active RNA splicing, whereas, Slug is homogenously distributed in the nucleus (Dominguez et al, 2003).
1.2 Induction of Snail Family Transcription Factors
Induction of Slug and Snail is poorly understood, however, adverse environmental conditions, like hypoxia and cell dispersion, have been shown to rapidly and transiently elevate endogenous Slug expression. This finding implies a surveillance role for Slug in rapidly signaling the onset of adverse conditions which may be evaded by rapid migration of cells to a niche more favorable for growth though Snail-mediated EMT
(Kurrey et al, 2005). Ultraviolet radiation (UVR) has also been shown to induce Slug expression both in vitro and in vivo (Hudson et al, 2007). This effect is due to the
2 activation of MAPK signaling pathways, particularly ERK, JNK and p38 (Hudson et al,
2007). MAPK cascades are also involved in the induction of Snail expression; Ras- mediated induction of the Snail promoter is dependent upon both MAPK and phophotidylinositol 3-kinase activities (PI3K) (Hudson et al, 2007). Activation of PI3K and its downstream mediator Akt have been shown to induce Snail expression (DeCraene et al, 2005).
Induction of Slug, via the ERK pathway, following epidermal growth factor receptor (EGFR) activation has also been reported (Conacci-Sorrell et al, 3003).
Activation of the EGFR has been implicated in processes in which Slug and Snail have also been implicated, including wound healing (Repertinger et al, 2004), tumor cell growth and invasion (Han and Wu, 2005), apoptosis (Danielson and Maihle, 2002), and cell proliferation (Lu et al, 2003). There are four types of EGF receptors, ErbB-1, ErbB-
2, ErbB-3, and ErbB-4, which regulate cell replication, movement and survival
(Danielson and Maihle, 2002). EGFR ligands (TGF-α, HB-EGF, amphiregulin, betacellulin, epiregulin, epigen) are synthesized as transmembrane precursors and must be cleaved by metalloproteases, and may be keratinocyte derived, resulting in autocrine proliferation (Takeda et al, 2004). Additionally, transactivation of the EGFR can occur via G-protein coupled receptor ligands (bradykinin, endothelin-1, IL-8, carbachol, lysophosphatidic acid, angiotensin II) which do not directly interact with the EGFR ectodomain (Takeda et al, 2004). EGFR signaling can act through the
RAS/RAF/MEK/MAPK, PLC-γ/PKC, PI3K/Akt, and JAK/STAT signaling cascades
(Takeda et al, 2004). EGFR activation causes tyrosine phosphorylation of β4 cytoplasmic domain of α6β4 (hemidesmosomes) by Fyn, which then disrupts the
3 hemidesmosomes (Takeda et al, 2004) and could contribute to increased cell motility and invasiveness seen following EGFR activation (Lu et al, 2003). EGF disrupts adherens junctions first by causing internalization of E-cadherin and β-catenin, and then later by increasing Snail expression which subsequently causes decreased expression of E- cadherin (Lu et al, 2003).
Other mediators have also been shown to induce Slug and Snail. TGF-β has been shown to induce Slug and Snail both in vivo and in vitro (DeCraene et al, 2005).
Hepatocyte growth factor (HGF) has also been shown to induce Snail expression
(Grotegut et al, 2006). Snail transcription may be induced by a variety of signaling pathways, including FGF-R, EGF-R, TGF-β-R, PTH-1R, Patched, and integrin linked kinase (ILK). Similarly, transcription of Slug may be induced by FGF-R, EGF-R, TGF-
β-R, Frizzled, and c-kit (DeCraene et al, 2005). Fibroblast growth factor (FGF), epidermal growth factor (EGF) transforming growth factor-β (TGF-β), and parathyroid hormone related peptide, as well as signaling through Shh, Wnt, and c-kit pathways, have been shown to enhance expression of Slug or Snail in a variety of cell types (DeCraene et al, 2005). The estrogen receptor indirectly results in transcriptional repression of human
Snail, by activating transcription of MTA3 (metastasis associated 1 family, member 3).
MTA3 forms a transcriptional corepressor complex containing histone deacetylase and has ATP-dependent chromatin remodeling functions, thereby utilizing chromatin modifications to regulate Snail expression (DeCraene et al, 2005).
The phosphorylation and subcellular distribution of Snail are controlled by cell attachment to the extracellular matrix (Dominguez et al, 2003). Snail has β-catenin-like destruction motifs, which get phosphorylated by GSK-3β; then E3 ubiquitin ligases (β-
4 TrCP1 and β-TrCP2) bind and target Snail for degradation. Through this mechanism,
GSK-3 promotes Snail degradation, and prevents its nuclear localization and interferes with its function as a transcription factor (Bachelder et al, 2005). Mutation of these destruction motifs in Snail makes it resistant to degradation and is associated with aggressive tissue invasion in vitro (Yook et al, 2005). Wnt and PI3K are endogenous inhibitors of GSK-3 (Bachelder et al, 2005) which prevent phosphorylation of the destruction motifs and result in accumulation and nuclear translocation of Snail (Yook et al, 2005; Bachelder et al, 2005). In the nucleus, Snail represses transcription of E- cadherin by binding directly to the E-box in the promoter region (Hemavathy et al, Gene
2000; Cano et al, 2000; Batlle et al, 2000); decreased expression of E-cadherin results in
EMT (Yook et al, 2005).
1.3 The Snail Family in Epithelial-Mesenchymal Transformation
Both Slug and Snail play roles in epithelial-mesenchymal transformation (EMT) occurring during embryogenesis (Carver et al, 2001). During development, the process of EMT involves the loss of cell: cell adhesion mediated by desmosomes and adherens junctions, increased secretion of extracellular matrix-degrading proteases, enhanced motility, loss of cytokeratin expression, and de novo expression of vimentin. Slug expression during development facilitates the release of cells from epithelial structures allowing them to migrate (Makinen and Stenback, 1998). Although Slug and Snail recognize and bind to the same consensus sequences, their transcriptional activity is not identical (Cano et al, 2000).
5 One mechanism by which Snail family members modulate EMT is by controlling the expression of intercellular adhesion proteins. E-cadherin is a cell-cell adhesion molecule which complexes with the actin cytoskeleton via cytoplasmic catenins to form and maintain intercellular junctions and polarization of epithelial cells (Yokoyama et al,
2001; Poser et al, 2001). Expression of E-cadherin can be disrupted by genetic mutations, hypermethylation of the promoter or by transcription repression (Conacci-
Sorrell et al, 2003). Transcriptional repression of E-cadherin is a characteristic event in
EMT and is also reported during tumor cell invasion (Conacci-Sorrell et al, 2003). E- cadherin has been proposed to be an invasion-suppressor gene, and its loss is associated with a poor clinical prognosis (Cano et al, 2000). Disruption of the E-cadherin-mediated adhesion system is an early event in the transition from non-invasive tumors to invasive malignant carcinomas (Birchmeier and Behrens, 1994; Perl et al, 1998). Both Slug and
Snail have been shown to repress E-cadherin expression and induce EMT.
Snail has been shown to bind E-boxes with a greater affinity and is more potent than Slug in decreasing E-cadherin expression (Bolos et al, 2003). This may explain the finding of normal levels of E-cadherin in the epidermis of Slug knockout mice
(manuscript in submission). It has been suggested that initial EMT-like behavior which requires very low levels of E-cadherin may be induced by Snail, and that maintenance of
EMT may be mediated by Slug and occurs in the presence of higher levels of E-cadherin
(Bolos et al, 2003). Alternatively, we suggest that Slug is an early event in EMT, and may act as a master switch, while Snail is necessary for full EMT. The increased potency of Snail, relative to Slug, is demonstrated by the evaluation of Slug and Snail expression in various murine epidermal keratinocyte cell lines that were classified as either invasive
6 or non-invasive. Snail was expressed by the invasive cell lines, but not by the non- invasive cell lines, while Slug was expressed in both types of cell lines (Cano et al,
2000). Slug alone is generally not sufficient to induce prolonged EMT, and Snail expression is required to maintain low levels of E-cadherin expression and EMT (Kurrey et al, 2005). Although it is likely that there is some redundancy between the functions of
Slug and Snail, Snail clearly regulates E-cadherin expression in mouse keratinocytes, while Slug plays an insignificant role in this process (Cano et al, 2000). This finding also helps explain the normal levels of E-cadherin seen in epidermal cells from Slug null mice (manuscript in submission).
Transfection of a rat bladder carcinoma NBT-II cell line with Slug results in relocalization of E-cadherin from cell-cell contact areas to a diffuse distribution on the cell surface (Savagner et al, 1997). Similarly, transfection of human colonic adenocarcinoma cells (SW480) by Slug resulted in transcription repression of the E- cadherin promoter and decreased E-cadherin expression. The loss of E-cadherin expression resulted in the transformation of the cells from an epithelial morphology to an extended fibroblastic shape, an event resembling EMT (Conacci-Sorrel et al, 2003).
Interestingly, there is no change in E-cadherin expression as detected by microarray analyses comparing Slug knockout epidermis to wild type epidermis (manuscript in submission).
Transfection of Snail into various epithelial cell lines (MCA3D, PDV, MDCK) results in decreased expression of E-cadherin, as well as the associated molecule, plakoglobin. These transfected epithelial cells also develop a more fibroblastic morphology with long membrane extensions (Cano et al, 2000). Transient transfection of
7 human primary melanocytes with Snail also results in decreased E-cadherin expression; likewise, antisense Snail induced re-expression of E-cadherin in these cells (Poser et al,
2001). Furthermore, in melanomas, hepatocellular carcinoma cells, gastric cancer, breast carcinomas and oral SCCs levels of Snail and E-cadherin expression are inversely correlated (Poser et al, 2001; Blanco et al, 2002; Yokoyama et al, 2001; Rosivatz et al,
2002; Miyoshi et al, 2004).
Cadherins may also act as negative regulators of Wnt signaling by keeping β- catenin bound to the membrane (Nelson and Nusse, 2004) and actin cytoskeleton
(Conacci-Sorrell et al, 2003). Cytoplasmic accumulation and the subsequent nuclear translocation of β-catenin controls Wnt signaling. In the nucleus, β-catenin acts as a co- factor with T cell factor/lymphoid enhancing factor (TCF/LEF) to induce target gene expression (Nelson and Nusse, 2004). Expression of E-cadherin prevents β-catenin signaling and nuclear translocation. In dense cell cultures of human colonic adenocarcinoma cell lines (SW480 cells), there’s increased E-cadherin expression, which confines β-catenin to the cytoplasm, resulting in decreased β-catenin/LEF/TCF signaling
(Conacci-Sorrell et al, 2003). Alternatively, sparse cultures had high levels of Slug expression, very low levels of E-cadherin expression, and high levels of β-catenin/TCF signaling (Conacci-Sorrel et al, 2003). Constitutive activation of β-catenin-LEF-1 results in increased transcription of c-myc and cyclinD1 to stimulate cell proliferation.
Activation of β-catenin has been shown to increase the expression of Slug, but not Snail
(Conacci-Sorrell et al, 2003). The other genes increased by β-catenin activation have been implicated in EMT (Conacci-Sorrell et al, 2003) and the development of a more invasive phenotype (Wong and Gumbiner, 2003) and include matrix metalloproteinases
8 (MMPs), ECM components, cell adhesion receptors (CD44), and uPAR (Conacci-Sorrell et al, 2003). As with Snail, phosphorylation of β-catenin by GSK-3β targets it for degradation, resulting in decreased expression of genes that regulate EMT (Bachelder et al, 2005). Similarly, inhibition of GSK-3β results in accumulation and nuclear translocation of β-catenin (Bachelder et al, 2005).
In addition to adherens function, Slug also modulates desmosomal function.
Constitutive expression of Slug in the rat NBT-II bladder carcinoma cell line stimulates desmosomal dissociation, cell spreading, and cell dispersion (Savagner et al, 1997).
Snail also directly suppresses the expression of other adhesive components including claudins and occludins, which form the apical tight junctions (TJ) in epithelial cells
(DeCraene et al, 2005).
It is well established that EMT occurs at wound margins, and thus, Slug has also been implicated in the cellular migration of both epidermal keratinocytes (Savagner et al,
2005) and in corneal epithelial cells (Chandler et al, 2006) during wound healing. Our studies demonstrate that Slug expression is induced in adult keratinocytes undergoing
EMT. Slug is expressed at the margins of healing wounds in vitro and in vivo and is associated with enhanced migration, a decrease in desmosome number and a redistribution of desmosomal proteins from the cell membrane to the cytoplasm
(Savagner et al, 2005). Furthermore, expression of exogenous Slug in cultured human keratinocytes enhances their ability to re-epithelialize wounds in vitro (Savagner et al,
2005). Improved re-epithelialization was not due to increased proliferation, as there was no change in BrdU incorporation and healing was not impaired by mitomycin C
9 treatment (Savagner et al, 2005). Additionally, these Slug-transfected cells were more elongate, had prominent lamellipodia and had fewer desmosomal attachments than control cells (Savagner et al, 2005).
1.4 The Snail Family and Proliferation
Proliferation is controlled by various upstream signaling pathways, including the previously mentioned receptor-tyrosine kinase (RTK)-dependent mitogen-activated protein kinase (MAPK) pathways known to induce Slug expression. The role of Slug and
Snail in cell proliferation has been demonstrated by microarray analysis of MDCK cells that overexpressed Slug or Snail. Cells expressing high levels of these Snail family members had altered expression of various growth factors (hepatoma derived growth factor, fibroblast growth factor-13 and -19, cyclin D1) and cyclin-dependent kinase inhibitors (p21Cip and p18) (Moreno-Bueno et al, 2006).
Furthermore, increased Slug expression reduces proliferation in cultured keratinocytes (Bolos et al, 2003; Turner et al, 2006), however, using an in vivo system, we have demonstrated decreased proliferation in the Slug knockout epidermis in response to both acute and chronic UVR exposure, as compared to wild type mice. These studies are described in Chapters 3 and 4 of this dissertation. Additionally, the expression of several genes known to control cell proliferation were found to be altered in epidermal cells from Slug knockout mice, including cyclins D2 and G2, as described in Chapter 2 of this dissertation. Expression of cyclins D2 and G2, which regulate cell cycle progression, was decreased in the Slug knockout epidermis, suggesting reduced basal levels of
10 proliferation This contrasted with findings from a previous study showing decreased keratinocyte proliferation without changes in cyclin D expression in response to enhanced Slug expression (Turner et al, 2006).
Snail has been shown to have an inhibitory effect on cell proliferation by decreasing expression of proliferating cell nuclear antigen (PCNA) (Park et al, 2005).
Similarly, increasing Snail has been shown to causes growth arrest through increased p21, which subsequently blocks G1/S transition (Vega et al, 2004). Increasing Slug also decreases the number of cells in S phase and prevents cell death (anti-apoptotic) (Vega et al, 2004). Because Snail and Slug appear to regulate both proliferation and cell migration, they may coordinate the frequently described suppression of proliferation in migrating cells at wound margins (Goren et al, 2006).
1.5 The Snail Family and Apoptosis
Microarray analysis of MDCK cells that overexpress Slug or Snail further demonstrated a role for both mediators in apoptosis (Moreno-Bueno et al, 2006). These
Slug-expressing cells had increased expression of GAS1 (growth arrest specific 1) and
MAZ (MYC-associated zinc finger protein), while CFLAR (Caspase 8 and FADD-like apoptosis regulator) expression was decreased (Moreno-Bueno et al, 2006).
Through gain- and loss-of-function experiments with an inducible form of Slug,
Slug was shown to have anti-apoptotic effects in the neural folds of whole mouse embryos (Tribulo et al, 2004). Slug has also been implicated in controlling apoptosis during murine mammary development, and involution. During ductal development, ducts arise as coherent cellular cords, and lumens develop from a controlled wave of
11 apoptosis within the cord. Another wave of apoptosis occurs in the mammary epithelium following weaning. It has been proposed that loss of Slug expression in these cells results in their apoptosis (Come et al, 2004).
Overexpression of Slug or Snail using an adenoviral vector in human breast carcinoma cells lines (MCF7) resulted in a modest decrease in p53 expression and prevented apoptosis induced by the DNA-damaging adriamycin (Kajita et al, 2004).
Additionally, these cells expressed decreased levels of the apoptotic nuclease DFF40,
BID, PIG8 and caspase 6, which are implicated in the apoptotic response (Kajita et al,
2004). Decreased expression of these pro-apoptotic mediators in response to Slug and
Snail may account for the cell survival following induction of DNA damage in these cells.
Similar results were seen in hematopoietic progenitor cells following gamma irradiation. Slug knockout mice had increased numbers of apoptotic cells in their bone marrow following irradiation (Inoue et al, 2002). Normally, Slug is upregulated by p53, following gamma-irradiation, and acts as a transcriptional repressor, directly antagonizing p53-mediated expression of Puma resulting in anti-apoptotic effects which contribute to increased cell survival (Wu et al, 2005). Puma, like Noxa, is a pro- apoptotic BH3 only protein which is a direct transcriptional target of p53 and is thought to be an effector molecule that connects p53 activation to the induction of apoptosis
(Shibue and Taniguchi, 2006). In the absence of Slug, the pro-apoptotic Puma prevails
(Wu et al, 2005). Interestingly, Noxa (PMAIP) was found to be increased 2.9 fold in normal epidermal cells from Slug knockout mice, suggesting a pro-apoptotic environment in the epidermis of these mice.
12 In acute pro-B cell leukemia, the oncoprotein E2A-HLF results in increased Slug expression which prevents apoptosis in these and other hematopoietic cells (Inoue et al,
2002; Kajita et al, 2004).
SCF activation of c-kit positive cells has also been shown to be required for the survival of hematopoietic stem cells following γ-irradiation. Since the anti-apoptotic
Snail family member, Slug, is a downstream target of SCF/c-kit signaling, it is proposed that induction of Slug expression plays a role in the survival of these cells (Perez-Losada et al, 2003). Activation of the c-kit receptor by stem cell factor (SCF) induces Slug expression, which has been postulated to control the migration and survival of c-kit positive cells (Perez-Losada et al, 2002). The hematopoietic stem cells of both Slug null and c-kit null mice have increased sensitivity to γ-irradiation induced death; loss of these cells results in the death of the mice (Perez-Losada et al, 2003).
The role of SCF/c-kit in promoting cell survival has also been demonstrated in erythroid precursors exposed to chemotherapeutic agents (Zeuner et al, 2003) and in
UVB-exposed keratinocytes and melanocytes (Hachiya et al, 2001). UVR has been shown to induce both Slug and Snail in human keratinocyte cultures as well as in mouse epidermal cells (Hudson et al, 2007). These findings suggest that some cells may acquire the ability to induced SCF/c-kit signaling as a protective mechanism against DNA damage, and Slug may mediate these protective effects (Catalano et al, 2004).
Furthermore, upon SCF stimulation, c-kit positive hematopoietic stem cells from
Slug null mice demonstrated impaired migration through Matrigel. Based on this finding, it is postulated that under the influence of SCF, c-kit positive cells would express Slug, thus promoting cell survival and allowing cells to migrate from their normal
13 environment. In the absence of SCF, however, these cells would undergo apoptosis because they have been deprived of the required external signal to maintain Slug expression (Perez-Losada et al, 2002).
Constitutive activation of c-kit has been demonstrated in some tumors, including acute myeloid leukemia, small cell lung cancer, gynecologic tumors, breast carcinoma, and colonic tumors derived from the interstitial cells of Cajal (Perez-Losada et al, 2002).
Constitutive activation of c-kit in these tumors could confer invasive properties (Perez-
Losada et al, 2002), and render them insensitive to radiation therapy (Perez-Losada et al,
2003). In fact, autocrine induction of Slug through SCF production and subsequent c-kit activation has been shown to contribute to the development of multidrug-resistant malignant mesothelioma cells (Catalano et al, 2004). Furthermore, high endogenous levels of Slug expression may promote tumorigenesis through the acquisition of resistance to apoptosis (Kurrey et al, 2005).
The mechanisms through which Slug prevents apoptosis are unclear. Slug has been shown to prevent apoptosis by increased expression of Bcl-2 and decreased expression of caspases 2, 3, 6, 7, and 9 (Tribulo et al, 2004). Others have been unable to identify any effect of Slug on pro- or anti-apoptotic Bcl-2 family members, bax and bcl-2, respectively (Catalano et al, 2004). In one breast cancer study, p53 levels changed relative to Slug, but in another study (Perez-Losada et al, 2003) using normal hematopoietic stem cells from Slug knockouts there was no change in p53 expressing in response to DNA damage – so the effects of Slug and Snail may be context dependent
(Kajita et al, 2004).
14 In contrast to Slug, Snail has been shown to repress pro-apoptotic genes in the
DNA damage response pathway. Decreasing Snail causes increased apoptosis with increased p53, Bid, PIG8, caspases 6, DFF40, and Mst4 (Kajita et al, 2004).
A role for Slug in the regulation of apoptosis has also been shown in hepatocytes.
TGF-β induces apoptosis of fetal rat hepatocytes by inducing oxidative stress with decreased bcl-xl expression and mitochondrial release of cytochrome c (Valdes et al,
2002). A small population of TGF-β exposed fetal rat hepatocytes, however, has been shown to survive and undergo EMT. In this scenario TGF-β-induced EMT and subsequent cell survival, are associated with increased expression of Snail, active AKT and bcl-xl (Valdes et al, 2002) with activation of MEK/ERK and PI3K/Akt survival pathways (Vega et al, 2004). Thus, EMT protects fetal rat hepatocytes from TGF-β- induced apoptosis (Valdes et al, 2002; Vega et al, 2004).
1.6 The Snail Family in Development
Slug and Snail play distinct roles during development as is shown by spatial and temporal differences in their patterns of expression (Sefton et al, 1998). Additionally, while Snail expression is essential for normal embryonic development, embryos homozygous for an inactive Slug allele (in which the zinc finger region of the gene is replaced by the β-galactosidase gene) and embryos homozygous for the complete loss of the Slug protein coding region develop an altered phenotype. Slug knockouts are small, but viable, with minor craniofacial defects, pigmentary alterations, macrocytic anemia, and increased apoptosis in the thymic cortex (Perez-Losada et al, 2002; Mukhtar and
Elmets, 1996; Jiang et al, 1998). The growth retardation has been attributed to the
15 occurrence of macrocytic anemia in some mice. Eyelid malformations and gonadal abnormalities have been reported in the Slug knockout mice (Come et al, 2004).
Additionally the Slug knockout mice are born at lower than the expected frequency, are apparently infertile and develop long curled claws. Abnormalities in the Slug knockout mice resemble those seen in mice with mutations in the genes encoding the c-kit receptor and its ligand, stem cell factor. Interestingly, c-kit positive cells from Slug knockout mice show markedly reduced migratory capabilities in response to stem cell factor, which may be related to the loss of Slug expression which is normally induced by c-kit activation (Perez-Losada et al, 2002). Slug has been shown to be involved in the development of Leydig, melanocyte and hematopoietic cell lineages (Perez-Losada et al,
2002).
Melanoblasts originate from pluripotent neural crest cells and expression of Slug in these cells facilitates their migration to their final destinations (Perez-Losada et al,
2002). Some Slug knockout mice have abnormal pigmentation patterns (Perez-Losada et al, 2002) that resemble the human conditions piebaldism (Murakami et al, 2005) and
Waardenburg disease (Sanchez-Martin et al, 2002). Seventy-five percent of human cases of piebaldism are due to mutations in the c-kit receptor, and it has been postulated that
Slug mutations may contribute to the development of human piebaldism, however in a study of 22 affected individuals from various countries, no Slug mutations were identified (Murakami et al, 2005). Homozygous Slug deletions have been shown to occur in humans with Waardenburg disease, a rare syndrome characterized by pigmentary abnormalities and sensorineural deafness (Sanchez-Martin et al, 2002).
16 In the adult, Slug is expressed in the basal layers of stratified and pseudostratified epithelia of normal adult mice, including the skin, oral mucosa, esophagus, stomach, rectum, cervix and trachea. High levels of Slug expression occur in cartilage, renal glomeruli, lung, ovary and uterus. Variable Slug expression may be seen in fibroblast and stromal smooth muscle cells in many tissues (Parent et al, 2004).
The findings we report in Chapter 2 of this dissertation demonstrate an important role for Slug in epidermal differentiation and homeostasis. In our microarray study, we found a number of genes important in keratinocyte differentiation had altered expression in Slug knockout epidermis, including keratins 8 and 18, as well as caspase 14. Keratins 8 and 18 are the first keratins expressed during embryogenesis (Chisholm and Houliston,
1987). Although not normally expressed in the adult epidermis, they are often aberrantly expressed in squamous cell carcinomas (Hendrix et al, 1996; Oshima et al, 1996; Larcher et al, 1996). Expression of exogenous keratin 8 in a variety of cell lines results in anchorage-independent growth, shortened doubling times, increased invasive and migratory capabilities (Chu et al, 1996), and apoptosis resistance in vitro (Gilbert et al,
2001), as well as enhanced metastasis in vivo (Raul et al, 2004). Enhanced keratin 8 expression in Slug knockout epidermis was consistent with previous studies showing that expression of Slug RNAi in a mammary epithelial cell line increases keratin 8 (and keratin 19) expression, while enhanced expression of Slug in these cells reduces expression of these keratins (Tripathi et al, BBRC 2005). Others have reported decreased expression of the epithelial genes keratin 18 and N-cadherin, and increased expression of the mesenchymal genes vimentin and fibronectin in response to increased Slug expression (Come et al, 2004). Similarly, a study using human colon cancer cell lines
17 demonstrated decreased expression of the epithelial genes keratin 18 and mucin1 following ectopic expression of Snail (Guaita et al, 2004). Caspase 14 expression was also increased in the Slug null epidermis, and has been implicated in keratinocyte differentiation and formation of the stratum corneum in adult skin (Alibardi et al, 2005).
It is expressed almost exclusively in the stratum corneum, and, unlike other caspases, does not play a role in apoptosis (Lippens et al, 2000).
1.7 The Snail Family and Carcinogenesis
Malignancies may be viewed as taking advantage of normal developmental EMT and exploit it to aid in their survival and spread. Certain poorly differentiated carcinomas have been found to recapitulate these changes; these tumors lose desmosomes and adherens junctions, express vimentin, acquire a spindle cell phenotype, overexpress proteases, and become highly motile. EMT-like events have been reported to occur in humans during the progression of carcinomas of the colon (Shiori et al, 2006; Bellovin et al, 2006), pancreas (Yang et al, 2006; Hofer et al, 2004), liver (Gotzmann et al, 2006), endometrium (Kyo et al, 2006), prostate (Luo et al, 2006), ovaries (Rosano et al, 2006), breast (Jechlinger et al, 2006), and in SCCs (Taki et al, 2006). These changes are associated with enhanced invasive and metastatic potential (Carver et al, 2001;
DiGiovanni, 1998; Grimes et al, 1996; Iyer and Leong, 1992; Mazzaluppo et al, 2002). In some cases the occurrence of EMT or the expression of factor implicated in EMT has been strongly associated with a poor prognosis (Bellovin et al, 2006; Shiori et al, 2006;
Kyo et al, 2006). Genes implicated in developmental EMT are repeatedly being implicated in carcinogenesis and tumor progression (Kang and Massague, 2004).
18 Xenotransplantation of MDCK cells overexpressing Slug or Snail into BALB/c nude mice demonstrate different morphologies. Snail expressing cells formed undifferentiated spindle cell tumors without evidence of epithelial differentiation
(Moreno-Bueno et al, 2006). In contrast, Slug expressing cells show areas of glandular differentiation which are surrounded by proliferating, malignant undifferentiated spindle cells; these tumors were consistent with a diagnosis of carcinosarcomas (Moreno-Bueno et al, 2006). In both the Slug and Snail over-expressing tumors, neoplastic spindle cells lacked E-cadherin and β-catenin expression, had intense N-cadherin, p120, vimentin and
SPARC expression, and had strong nuclear expression of ID3. The epithelial cells from the tumors formed by the Slug-expressing MDCK cells maintained membrane staining of
E-cadherin, β-catenin and p120, with less intense N-cadherin, vimentin and ID3 staining than the spindle cells in these tumors (Moreno-Bueno et al, 2006). The differences in morphology reported in this study are consistent with the findings we report in Chapter 4, that UVR-induced cutaneous spindle cell tumors express high levels of Snail, while epithelial tumors express high levels of Slug. These findings also support the proposal that EMT occurs in two phases. The first phase is thought to be induced by Slug and including desmosomal dissolution, cell spreading, and initiation of cell separation. The second phase of EMT may be induced by FGF-1 and is characterized by intermediate filament conversion and cell motility (Savagner et al, 1997).
Another group had similar findings, and reported that Snail-transfected canine kidney epithelial cells (MDCK cells) which have decreased E-cadherin expression, demonstrate increased motility and invasion in in vitro assays, and increased tumor growth in an athymic nu/nu xenograft model (Cano et al, 2000). The increased
19 invasiveness seen in these cells suggests that in addition to regulating cell adhesion, ectopic expression of Snail also affects other genes involved in motility and migration
(Cano et al, 2000).
Snail and Slug are both active at the invasive front of mouse skin tumors and in human breast and colon carcinomas (Comijn et al, 2001; Christofori, 2006; Conacci-
Sorrell et al, 2003; Birchmeier, 2005). In human tumors, aberrant expression of Slug or
Snail is associated with invasive growth potential which is attributed to decreased expression of genes involved in cell-cell adhesion, particularly E-cadherin, occludins and claudins (Kajita et al, 2004). In a murine MIN model, treatment with antisense Snail resulted in increased E-cadherin expression, fewer tumors, increased apoptosis and decreased proliferation (Roy et al, 2004). Additionally, increased expression of Snail is a common event in melanoma cell lines, and is associated with loss of E-cadherin expression (Poser et al, 2001). We are currently evaluating the role of Slug and Snail in canine melanomas.
Both Slug and Snail have been implicated in mammary carcinogenesis in humans
(Tripathi et al, JBC 2005). Normal mammary epithelium expresses high levels of Slug, and low levels of Snail (Come et al, 2004). Slug has been shown to specifically bind the promoter and negatively regulate expression of the tumor suppressor protein BRCA2.
Loss of BRCA2 promotes cell survival and is strongly associated with the development of breast carcinomas (Tripathi et al, JBC 2005). Snail expression has been shown to inversely correlate with the grade of differentiation of human breast carcinomas (Blanco et al, 2002). In infiltrating ductal carcinomas, Snail expression was associated with the presence of lymph node metastases, while all Snail-negative infiltrative ductal
20 carcinomas lacked lymph node metastases (Blanco et al, 2002). Similarly, another group demonstrated high levels of both Slug and Snail in infiltrating ductal breast carcinomas that had lymph node metastases (Come et al, 2006). These data further demonstrates the role for Snail in the induction of the invasive and migratory phenotype in epithelial cells, and identifies it as a marker of metastatic potential (Blanco et al, 2002). Many of these changes are also associated with decreased E-cadherin expression; hypermethylation of the E-cadherin promoter has been reported to correlate with loss of E-cadherin expression in breast carcinomas (Nass et al, 2000). Mutation of the c-kit receptor has also been described in breast carcinomas (Hines et al, 1995).
Although in most cases, the high levels of Slug and Snail in neoplastic cells are associated with low levels of E-cadherin expression, it has been proposed that the adhesive functions of E-cadherin may not be important in preventing metastasis, but that
E-cadherin suppresses invasion in an adhesion-independent manner (Wong and
Gumbiner, 2003).
Expression of MMPs is also suggested to promote invasive behavior by carcinomas. One group demonstrated that Snail increased MMP-2 expression in squamous cell carcinoma cell lines and speculated that the suppression of E-cadherin expression by Snail resulted in the intra-nuclear accumulation of β-catenin/TCF4 which increased expression of MT1-MMP which activated MMP-2. The increased MMP-2 expression in these squamous cell carcinoma cell lines was associated with increased invasiveness in a Matrigel assay (Yokoyama et al, 2003). Furthermore, transfection of
HCC cell lines with Snail results in decreased E-cadherin expression, increased expression of MT1-MMP and MMP-1, 2, 7. These cells also developed a more
21 fibroblastic phenotype and invasive activity increased 10-fold (Miyoshi et al, 2004). In human hepatocellular carcinomas, Snail expression was significantly higher in tumors from patients with intra-hepatic metastases and invasion of the portal vein. In these patients, the development of vascular invasion and metastasis was attributed to increased expression of MMPs, particularly MT1-MMP. In this study, patients with high levels of tumoral Snail expression also had shorter recurrence-free survival times (Miyoshi et al,
2005). We have reported increased TIMP-3 expression in the epidermal cells of Slug null mice (manuscript in submission). Human lung adenocarcinoma cell lines transfected with Slug had markedly increased tumor growth in a murine SCID xenograft model than did control cells, and the resulting tumors also expressed increased levels of MMP-2 and had decreased E-cadherin staining (Shih et al, 2005).
Some UVR-induced SCC in mice undergo EMT and evolve into aggressive spindle cell carcinomas that resemble fibrosarcomas. These neoplastic cells lose desmosomes, adherens junctions and cytokeratin expression (Hudson et al, 2007). Using a UVR-induced skin carcinogenesis model, we have demonstrated a decreased tumor burden in Slug knockout mice compared to their wild type counterparts, as reported in
Chapter 4 of this dissertation.
1.8 The Snail Family and Angiogenesis
Both Slug and Snail have also been implicated in angiogenesis. Angiogenesis is critical to both normal wound healing and to the development of metastases. In a murine
SCID angiogenesis assay using a human lung adenocarcinoma cell line transfected with a
Slug expression vector, there were increased microvessel counts in the Matrigel plugs
22 containing cells that overexpressed Slug (Shih et al, 2005). Similarly, MDCK cells that overexpress Snail induce angiogenesis of the host stromal tissues in in vivo transplantation assays using BALB/c nude mice (Peinado et al, 2004).
The earliest marker of developing endothelial cells is Flk-1(VEGF-A) which plays a crucial role in vasculogenesis and angiogenesis. Embryonic stem cells lacking
Flk-1, which fail to differentiate into endothelial cells, have been shown to express 3-5 time less Slug than control embryonic stem cells (Zippo et al, 2004). Additionally, Slug was increased during angiogenesis in the ovarian corpora lutea of C57BL6 mice treated with pregnant mare’s serum gonadotrophin to induce follicular maturation, followed by treatment with human chorionic gonadotrophin to induce the luteal phase (Zippo et al,
2004). Hepatocyte growth factor (HGF) which has a well established role in the development of angiogenesis has also been shown to induce Snail expression (Grotegut et al, 2006).
Recently, using a microarray analysis, Moreno-Bueno et al. also reported a role for the Snail family of transcription factors in angiogenesis by demonstrating increased expression of VEGF and other angiogenic mediators in MDCK cells that overexpressed
Slug (Moreno-Bueno et al, 2006). Our recent findings using microarray to compare gene expression in the epidermis of Slug null and wild type mice also support a role for Slug in controlling angiogenesis, as detailed in Chapter 2 of this dissertation.
1.9 The Snail Family and Inflammation
Perez-Losada et al. (2002) investigated the role of Slug in various hematopoietic cell lines using Slug knockout mice. They found that in Slug knockout mice there are
23 normal numbers of T cells in the peripheral blood, however, the thymus is atrophied with increased numbers of apoptotic bodies. Although many of the mice had macrocytic anemia, the B cell, mast cells and myeloid lineages are unaffected by the absence of Slug
(Perez-Losada et al, 2002).
Recently, we were the first to discover a role for Slug in modulating the cutaneous inflammatory response to UVR, as detailed in Chapters 3 of this dissertation. These findings suggest an important but hitherto unknown function for Slug in the skin.
1.10 Summary
Slug and Snail are critical in modulating EMT during embryonic development.
However, these transcription factors also play critical roles in carcinogenesis and wound healing in the adult, processes that involve EMT-like changes in epidermal cell morphology and behavior. The Snail family of transcription factors appear to control adhesion, motility, proliferation, and apoptosis in adult epithelial cells, and to have a role in angiogenesis. The studies reported in this dissertation have 1) identified genes in the unperturbed adult epidermis that are directly or indirectly regulated by Slug (Chapter 2);
2) revealed an unexpected role for Slug in modulating the acute inflammatory response to
UVR (Chapter 3); and 3) verified a role for Slug in skin carcinogenesis in vivo (Chapter
4). Moreover, during the course of these studies, previously unreported eye lesions in wild type 129 mice were identified and documented. Taken together, our findings indicate a critically important role for Slug in epidermal homeostasis, cutaneous inflammation, and skin carcinogenesis and suggest potential targets of Slug regulation that may be important in these processes.
24 CHAPTER 2
MICROARRAY ANALYSIS DEMONSTRATES A ROLE FOR SLUG IN
EPIDERMAL HOMEOSTASIS
2.1 Abstract
Slug (Snai2) is a member of the Snail family of zinc-finger transcription factors with regulatory functions in development, tissue morphogenesis, and tumor progression.
Little is known about Slug in normal adult tissue; however a role for Slug in the skin was suggested by our previous observations of Slug expression in normal murine keratinocytes and Slug induction at wound margins. To study the impact of Slug in the skin, we compared patterns of gene expression in epidermis from Slug null and wild type mice. A total of 139 genes had significantly increased, and 109 genes had significantly decreased expression in Slug knockout epidermis. Altered expression of selected genes in
Slug knockout epidermis was validated by real time PCR and immunohistochemistry.
Previously reported Slug targets were identified, in addition to several novel proteins, including cytokeratins, adhesion molecules, and extracellular matrix components.
Functional classification of altered gene expression was consistent with a role for Slug in keratinocyte development and differentiation, proliferation, apoptosis, adhesion, motility,
25 as well as angiogenesis and response to environmental stimuli. These results highlight the utility of genetic models to study the in vivo impact of regulatory factors in unperturbed skin and suggest that Slug has significant activities in the adult epidermis.
2.2 Introduction
The first member of the Snail family of transcription factors, Snail, was identified twenty years ago in Drosophila. Vertebrates have three Snail family genes: Snail1
(Snail), Snail2 (Slug) and Snail3 (Smuc). The Snail family transcription factors are recognized regulators of epithelial-mesenchymal transformation (EMT) in development, and there is increasing evidence that these zinc finger transcription factors also regulate
EMT during tumor progression and metastasis (Nieto et al, 1994; Sefton et al, 1998;
Savagner et al, 1997, 2001; Nieto, 2002; Hemavathy et al., Gene 2000; Shook and Keller,
2003; Barrallo-Gimeno and Nieto, 2005). It has also been suggested that Snail family members more broadly regulate cell movement and adhesion rather than EMT per se
(Barrallo-Gimeno and Nieto, 2005). Snail is essential for early embryogenesis and Snail null mutants die at gastrulation (Sefton et al, 1998). In contrast, Slug null mice are viable and reproduce, despite some abnormalities including small body size, reduced fertility, minor craniofacial defects, pigmentary alterations, macrocytic anemia, and increased apoptosis in the thymic cortex (Jiang et al, 1998; Perez-Losado et al, 2002). Smuc null mice have not been generated, but Smuc expression patterns in the developing embryo suggest a role for the protein in the developing skeletal muscle and thymus (Zhuge et al,
2005). Thus, although Snail family members collectively direct morphogenesis during development, they play distinct functional roles in the embryo. Despite evidence that
26 Snail and Slug modulate EMT during embryonic development and tumor progression
(Sefton et al, 1998; Moreno-Bueno et al, 2006), little is known about potential functions for these proteins in normal adult tissues.
Our previous studies provided evidence for involvement of Slug in the maintenance of adult epidermis and in cutaneous wound healing (Savagner et al, 2005;
Parent et al, 2004). In adult skin, Slug is expressed in hair follicles and the interfollicular epithelium adjacent to hair follicles (Parent et al, 2004). Furthermore, Slug expression is enhanced at the margins of healing wounds in vitro, ex vivo and in vivo; expression of
Slug coincides with keratinocyte emigration from the wound margin; and keratinocyte outgrowth is impaired in skin explants derived from Slug null mice (Savagner et al,
2005). Ectopic Slug expression in cultured human keratinocytes causes EMT-like alterations in cell morphology and behavior, including increased cell spreading, desmosomal disruption at wound margins, and accelerated reepithelialization (Savagner et al, 2005). Other investigators have shown that increased Slug expression in cultured keratinocytes also results in decreased expression of the adhesion molecules E-cadherin and integrins α3, β1, and β4 (Turner et al, 2006). Taken together, these findings suggest that Slug performs important functions in normal adult epidermis and highlight the need to define Slug-controlled transcriptional programs in the skin.
This study identified candidate genes regulated by Slug using comparative gene array analysis of epidermis isolated from Slug null and wild type littermates. Differences in gene expression patterns between wild type and Slug null epidermis indicated a role for Slug in keratinocyte differentiation, cell adhesion and motility, proliferation and apoptosis, angiogenesis, and response to external stimuli, processes important in
27 epidermal homeostasis, cutaneous wound healing, and skin carcinogenesis. These results support a regulatory role for Slug in normal adult tissue, in addition to its previously reported roles in modulating developmental processes and cancer progression.
2.3 MATERIALS AND METHODS
2.3.1 Mice
Mice employed in these studies were generated by Dr. Thomas Gridley (Jackson
Laboratory, Bar Harbor, ME) (Jiang et al, 1998). In these mice, the zinc finger region of the Slug gene has been replaced by a β-galactosidase gene, resulting in the formation of a
Slug-β-galactosidase fusion protein. The Slug portion of this protein is non-function since it lacks the zinc finger region; however the β-galactosidase portion is fully functional.
For each microarray analysis, two wild type 129 and two homozygous Slug knockout 12-week-old female mice were employed. The mice were euthanized by carbon dioxide inhalation, shaved with electric clippers, and depilated with Nair. Dorsal skin was removed and immediately frozen as 3 x 4 cm strips in liquid nitrogen for later RNA isolation. Additional skin samples were fixed in formalin for routine histopathology.
2.3.2 Microarray Analysis
The epidermis was vigorously scraped from frozen skin samples, using a scalpel blade. Samples were placed in Trizol (Invitrogen, Carlsbad, CA), then homogenized and processed as recommended by the supplier. This technique isolates primarily keratinocytes with small numbers of Langerhans cells and intraepidermal dendritic cells
28 that are resident in the epidermis. Wild type and knockout samples were processed simultaneously. Skin was fixed in formalin after scraping and examined histologically to confirm that the epidermis was completely removed (Fig 2.1).
RNA samples were purified using an RNeasy Mini Kit (Qiagen, Valencia, CA).
RNA quality was verified by the Microarray Unit (MAU) at The Ohio State University
Comprehensive Cancer Center (OSUCCC), which performed subsequent microarray analysis. High quality RNA was consistently isolated using this technique (Fig 2.2). For each microarray analysis, two wild type and two knockout total RNA samples were pooled based on molar quantity and were submitted to the OSUCCC-MAU for further processing to ensure highly standardized techniques. Reverse transcription was performed using 8 ug total RNA, a T7-(dT)24 primer, and Superscript II reverse transcriptase (Invitrogen, Carlsbad, CA). Second strand cDNA synthesis was performed using Escherichia coli DNA polymerase I, DNA ligase and RNase H (Invitrogen,
Carlsbad, CA). The resulting double-stranded cDNA was cleaned using the cDNA
GeneChip Sample Cleanup Module (Affymetrix, Santa Clara, CA). In vitro transcription was carried out using biotin-labeled ribonucleotides and T7 RNA polymerase. The resulting cRNA was purified using the IVT cRNA GeneChip Sample Cleanup Module
(Affymetrix, Santa Clara, CA). After the labeled cRNA was fragmented at 95o C for 35 min, hybridization was performed in a buffer consisting of 150 µl of hybridization buffer
(Affymetrix, Santa Clara, CA), 30 µg of herring sperm DNA, 60 µg of acetylated BSA,
40 µl of cRNA, and biotinylated control oligonucleotides at 45o C for 16 h with rotation to the Gene Chip Mouse Genome 430 2.0 Array. After washing in an Affymetrix Fluidics station, the arrays were stained with streptavidin R-phycoerythrin (Vector) and scanned
29 with an HP-laser scanner (Affymetrix, Santa Clara, CA) to produce data files containing raw pixel intensities. The entire microarray analysis was repeated twice more for a total of three independent analyses. Thus our data represented RNA from six wild type and six knockout mice.
2.3.3 Data analysis
The raw intensity files from the scanner were initially processed with the program
MicroArray Suite, version 5 (MAS5) from Affymetrix. This software was used to generate probe-pair level data (CEL files) and probe-set level data (CHP files). The CEL files from MAS5 were processed with RMAExpress version 0.3 (Bolstad BM, University of California, Berkeley, CA) to obtain background-subtracted, quantile-normalized expression values for each probe. The CHP files generated were of two types. The first type of CHP file (CHP-1) was a single-chip analysis yielding Present, Marginal, or
Absent calls for all probe sets. The second type of CHP file (CHP-2) was a two-chip comparative analysis which compared all pair-wise combinations of each of the three WT and knockout replicates and yielded Increased, Decreased or No Change calls for each probe set. The call results in these two files were used to filter the list of potential probes.
To eliminate probes showing little change across all of the arrays, the list of probes contained on the microarray chips was subjected to two levels of filtration based on the calls in the CHP files. The first elimination step used the single-chip analyses to eliminate any probe which did not have at least two Present calls in either the wild type or Slug knockout group. Next, the comparative CHP files were used to eliminate any probes which did not have at least six Increased or six Decreased calls out of the 9 pair-wise comparisons. The probes passing this second filter became the final list for the RMA
30 (Robust Multichip Average) data files. Filtered RMA expression values were analyzed with a two-sample, equal variance t-test comparing Slug knockout to wild type signals. P values less than or equal to 0.05 were considered significant. Bonferroni’s correction
(Motulsky, 1995) was applied to each p value to obtain an adjusted p value for to identify differentially expressed probes with high statistical significance.
With the help of DAVID Bioinformatic Resources 2006 (National Institute of
Allergy and Infectious Diseases, National Institutes of Health) (Dennis et al, 2003),
Affymetrix database, and relevant publications, the genes that were significantly altered based on the basic T-test were categorized by known function. Un-named genes were excluded from this categorization.
2.3.4 Quantitative RT-PCR
Total RNA from the Slug knockout and wild type mice that remained following microarray analysis was used to confirm microarray results by real-time quantitative PCR
(Table 2.7). For analyses performed at The Ohio State University (Slug, Keratin 8, Gli1,
Gli2) 5 ug pooled total RNA was treated with DNaseI (Ambion, Austin, TX), and cDNA was produced by reverse transcription of 500 ng of this RNA using Superscript II
(Invitrogen, Carlsbad, CA) and oligo(dT) primers, as directed by the manufacturer.
Quantitative RT-PCR was performed using the primer sets shown in Table 2.1. The
Brilliant SYBR Green QPCR mix (Stratagene, Cedar Creek, TX) was used as directed with 100 nM of each primer in an MX3000P Real-Time PCR System (Stratagene, Cedar
Creek, TX). Fifty cycles of 94° C (30 sec), 60° C (30 sec), and 72° C (30 sec) were performed. RNA concentrations were calculated using the LinReg PCR program which uses four points in the best linear region of amplification to determine starting mRNA
31 concentration and PCR efficiency for each sample (Ramakers et al, 2003). GAPDH was used as an internal standard to account for efficiency of reverse transcription and amplification. Expression values for each primer set were normalized to GAPDH values.
Reactions were performed in triplicate.
For analysis performed at the University of New Mexico, College of Pharmacy
(Keratin 18, Snf1, angiomotin, tenascin C), cDNA was made using the ABI High
Capacity cDNA archive kit as directed (Applied Biosystems, Foster City, CA). Taqman master mix, primers and probes (see Table 1) were obtained from Applied Biosystems and used as directed. Samples were run and analyzed using the 7900HT Real-Time PCR
System (Applied Biosystems). The ∆Ct was determined by subtracting the average Ct for
GAPDH (normalizing gene) from the average of the Ct for the gene of interest. The relative expression in knockout versus wild type samples was then determined using the
∆∆Ct method. The efficiency of amplification of all primer and probe sets was verified to be near 100%.
2.3.5 Histology and immunohistochemistry
Skin from the six wild type and six Slug knockout mice used for RNA isolation was fixed in neutral buffered formalin, embedded in paraffin, sectioned at 4 µm, and mounted on glass slides; these slides were stained with hematoxylin and eosin or used for immunohistochemistry. Specimens for immunohistochemistry were deparaffinized and dehydrated, then pre-treated with DakoCytomation target retrieval solution (Dako,
Carpinteria, CA) using the Biocare Digital Decloaking Chamber (Biocare, Concord, CA) and heated to 125° C for 30 sec for antigen retrieval. Peroxidase blocking was performed with a 3% peroxidase solution for 5 min. A protein block (DakoCytomation Serum-free
32 Protein Block, Carpinteria, CA) was applied for 10 min. Staining was carried out with the following primary antibodies: a monoclonal IgG2a, kappa light chain rat anti-mouse keratin 8 (Developmental Studies Hybridoma Bank, University of Iowa Department of
Biological Sciences, Ames, IA) diluted 1:250, CD3 (Dako, Carpinteria, CA, Cat #
A0452) diluted 1:100, and Ki67 (Dako, Carpinteria, CA, Cat # M7249) diluted 1:100.
Primary antibodies were diluted in DakoCytomation Antibody Diluent (Dako,
Carpinteria, CA) and applied to the slides for 30 min. Sections were incubated with secondary antibodies (biotinylated rabbit anti-rat and biotinylated rabbit anti-rat mouse adsorbed (Vector, Burlingame, CA) diluted 1:200 in Serum-free Protein Block) for 30 min, followed by a 30-min incubation with ABC reagent (Vector R.T.U. Vectastain Elite
ABC, Burlingame, CA), a 5-min incubation with chromagen (DakoCytomation Liquid
DAB Substrate, Carpinteria, CA), and hematoxylin counterstaining. Rinses were performed using DakoCytomation Wash Buffer (Dako, Carpinteria, CA). The slides were then dehydrated and cover-slipped.
Epidermal thickness was determined using an ocular micrometer. Six different fields were measured at a magnification of 600x, and then the values from each mouse were averaged.
CD3 positive cells had strong cytoplasmic staining. CD3 positive cells were counted in the epidermis of six different 400x fields. In each of these fields, the total number of epidermal cells was also counted, and the number of CD3 positive epidermal cells was expressed as a percent of the total epidermal cells. These numbers were
33 averaged for each genotype and then compared. Ki67-positive cells have strong nuclear staining and were quantified as described for CD3 staining. Results were compared using the t test; p values of < 0.05 were considered significant.
2. 4 RESULTS AND DISCUSSION
2.4.1 Overview of microarray findings
By directly comparing gene expression patterns in the epidermis of Slug knockout and wild type mice, we were able to gain considerable insight into the impact of this transcription factor on skin structure and function. Our novel approach to identifying potential targets of a transcription factor in vivo did not rely on commonly employed methods of artificially enhancing or abrogating gene expression in cultured cells. Since
RNA was isolated from unperturbed skin of viable mice, the levels of expression determined were very likely to be biologically relevant. Moreover, the use of wild type and knockout mice on identical genetic backgrounds minimized strain-dependent differences in gene expression. Our RNA isolation technique removed virtually all epidermis from the skin (Fig 1) and yielded large amounts of very high quality RNA (Fig
2.2). PCR amplification to increase sample size was thus not required, eliminating a potential source of variability and enhancing our ability to generate very consistent replicate microarray assays.
We identified 139 different named genes with significantly increased expression in Slug knockout compared to wild type epidermis and 109 different genes with significantly decreased expression (Tables 2.1-2.6). These findings indicate that Slug expression directly or indirectly exerts repressive or inductive influence on gene
34 regulation. Using quantitative RT-PCR or immunohistochemistry, we verified altered levels of gene expression for a number of these genes (Table 2.7; Fig 2.3). Functional classification of genes with significantly altered expression in Slug knockout epidermis supported roles for Slug in development and differentiation, proliferation and apoptosis, adhesion and motility, angiogenesis and, unexpectedly, the response to external stimuli.
Morphologic differences between Slug knockout and wild type epidermis reflected some of the roles indicated for Slug by our microarray results. Our findings suggest that Slug controls the expression of a wide variety of genes important for epidermal homeostasis, cutaneous wound healing, and skin carcinogenesis.
For 146 of the 248 genes displaying significant differences in expression between
Slug knockout and wild type epidermis, we were able to examine the 1000 bases upstream from the transcription start site (Tables 2.1-2.6). Of these genes, only 80 (55%) contained one or more canonical Snail family binding sites (CAGGTG or CACCTG)
(Hemavathy et al, Gene 2000). Of the genes with Slug binding sites in the promoter, 36 showed decreased and 44 showed increased expression in Slug knockout compared to wild type epidermis. Thus many of the genes we identified were unlikely to be directly repressed by Slug.
2.4.2 Development and differentiation
In keeping with the known role of Slug in embryogenesis, the absence of Slug was associated with changes in expression of a variety of other genes related to development and differentiation (Table 2.1). Widespread alteration in developmental
35 gene expression in Slug knockout epidermis indicated substantial crosstalk among different signaling pathways important during embryogenesis and epidermal differentiation.
Gli1 and Gli2 expression was increased in the knockout epidermis by 8.5-fold and
3.4-fold, respectively; increased expression of these genes in knockout epidermis was confirmed by quantitative RT-PCR (Table 2.7). Gli1 and Gli2 are zinc finger transcription factors that mediate sonic hedgehog signaling to regulate cell-cell interactions during embryogenesis (Lewis et al, 2001). Mice transgenic for Gli1 or Gli2 spontaneously develop basal cell carcinomas (Sheng et al, 2002; Nilsson et al, 2000).
Despite increased levels of Gli1 and Gli2, no basal cell carcinomas occurred either in ultraviolet radiation-exposed or unexposed Slug knockout mice during a long-term skin carcinogenesis study (manuscript in preparation). This may be because expression of patched homolog 1 (Ptch1), a hedgehog receptor, was also increased (1.7-fold) in Slug knockout epidermis. Patched 1 is a tumor suppressor that likely acts as a ‘gatekeeper’ to block cell cycle progression and tumor formation (Adolphe et al, 2006). Loss of patched
1 expression results in constitutive activation of the sonic hedgehog pathway, Gli dysregulation, and basal cell carcinoma formation (Mancuso et al, 2004; Adolphe et al,
2006). Additionally, there was approximately 2-fold increased expression of homeobox genes D8, D9, D10 (Hoxd8, 9, 10) in Slug knockout epidermis; homeobox genes play critical roles in determining cell fate and position during development, thus serving as master regulators of embryogenesis and differentiation (Myers et al, 2002). Expression of
SNF-like kinase (Snfl1k), which plays a role in muscle differentiation and cardiogenesis
(Stephenson et al, 2004; Ruiz et al, 1994), was decreased 4.8-fold in Slug knockout
36 epidermis, while expression of brain expressed gene 1 (Bex1), a tumor suppressor gene in malignant gliomas (Foltz et al, 2006), was enhanced almost 6-fold. The role of these genes in the skin is not known.
A number of genes important in keratinocyte differentiation displayed altered expression in Slug knockout epidermis. One of the genes with very significantly increased expression (more than 35-fold) in the knockout epidermis was keratin 8 (Krt2-
8), which encodes an intermediate filament expressed in simple epithelium throughout the body (Owens et al, 2003). Microarray findings were confirmed by quantitative RT–
PCR (Table 7) and immunohistochemistry (Fig 2.3). Enhanced keratin 8 expression in
Slug knockout epidermis was consistent with previous studies showing that expression of
Slug RNAi in a mammary epithelial cell line increases keratin 8 expression, while enhanced expression of Slug in these cells reduces keratin 8 expression (Tripathi et al,
2005). The keratin 8 promoter contains an E-box to which Slug binds to repress transcription (Tripathi et al, 2005). Expression of keratin 18, which is often paired with keratin 8, was also increased (23-fold) in knockout epidermis; since keratin 8 and 18 expression was elevated to a similar extent, they may also be complexed in knockout epidermis. Keratins 8 and 18 are the first keratins expressed during embryogenesis
(Chisholm and Houliston, 1987), and although not normally expressed in the adult epidermis, they are often aberrantly expressed in squamous cell carcinomas (Hendrix et al,, 1996; Larcher et al, 1992; Oshima et al,, 1996). Expression of exogenous keratin 8 in a variety of cell lines results in anchorage-independent growth, shortened doubling times, increased invasive and migratory capabilities (Chu et al,, 1996), and apoptosis resistance in vitro (Gilbert et al,, 2001), as well as enhanced metastasis in vivo (Raul et
37 al,, 2004). Differences in epidermal differentiation indicated by our microarray results were reflected in significantly decreased epidermal thickness in knockout compared to wild type skin (7.38 um ± 0.99 versus 8.91 um ± 1.67, p = 0.016 by the t test).
2.4.3 Proliferation and apoptosis
Slug is known to be antiapoptotic in hematopoietic cells (Inukai et al, 1999; Come et al, 2004), while increased Slug expression reduces proliferation in cultured keratinocytes (Turner et al, 2006; Bolos et al, 2003). Proliferation and apoptosis share some upstream signaling pathways, including receptor-tyrosine kinase-dependent mitogen-activated protein kinase pathways known to induce Slug expression.
Expression of the growth factor epithelial mitogen (Epgn) was increased in Slug knockout epidermis (5.7-fold) (Table 2.2). Epgn is a member of the EGF superfamily and a low affinity ligand for ErbB receptors that promotes the growth of epithelial cells.
(Strachan et al, 2001; Kochupurakkal et al, 2005). Expression of several genes that regulate growth factor availability were altered in Slug knockout epidermis. Insulin-like growth factor binding protein 3 (Igfbbp3) was decreased 2.6-fold in knockout epidermis.
Igfbp3 has been shown to be highly expressed by the transit amplifying population of cells in the epidermis (Edmondson et al, 2005). On the other hand, expression of insulin- like growth factor binding protein 2 (Igfbp2) was increased 2.1-fold in knockout epidermis; this gene is ordinarily not expressed in the epidermis (van Kleffens et al,
1998). Expression of transforming growth factor-β-3 (Tgfb3), which is widely involved in development and differentiation, was enhanced 1.9-fold in Slug knockout epidermis,
38 while expression of latent transforming growth factor-β binding protein 1 (Ltbp1), which functions as a local regulator of TGF-β deposition and signaling (Sterner-Kock et al,
2002), was decreased 1.8-fold.
Expression of cyclins D2 and G2 (Ccnd2, Ccng2), which regulate cell cycle progression, was decreased by 1.3 and 1.4-fold, respectively, in the Slug knockout epidermis, suggesting modestly reduced basal levels of proliferation. This contrasted with findings from a previous study showing decreased keratinocyte proliferation without changes in cyclin D expression in response to enhanced Slug expression (Turner et al,
2006). Moreover, it has been proposed that Snail blocks cell cycle progression through
G1/S by repressing cyclin D transcription (Vega et al, 2004). Quantitation of Ki-67- positive cells in the epidermis did not reveal a significant difference between wild type and knockout epidermis (12.04 ± 3.32 versus 16.08 ± 7.07, p = 0.112 using the t test), indicating no substantial decrease in basal proliferative activity in Slug null epidermis.
Interactions of regulators of apoptosis are complex and it is the net balance of pro- and anti-apoptotic factors that determines cell fate. Expression of phorbol-12-myristate-
13-acetate-induced protein 1 (Pmaip1), also known as Noxa, was increased almost 3-fold in the knockout epidermis. Noxa is a pro-apoptotic member of the Bcl-2 family; its expression is increased by p53-dependent or independent mechanisms in response to cellular stress, DNA damage, or growth factor deprivation (Jullig et al, 2006). Noxa interacts with anti-apoptotic members of the Bcl-2 family, resulting in release of cytochrome c from the mitochondria and subsequent activation of downstream caspases
(Jullig et al, 2006). Another key regulator of apoptotic responses, Puma, was previously shown to be regulated by Slug in hematopoietic cells (Wu et al, 2005). Secreted
39 Ly6/Plaur domain containing 1 (Slurp1) was increased 1.8-fold in the knockout epidermis. Slurp1 is a secreted protease that has been shown to play a role in maintaining the integrity of keratinocytes in the epidermis (Mastrangeli et al, 2003). Slurp1 appears to act through keratinocyte nicotinic acetylcholine receptors to increase expression of caspase 3 and 8 to have a pro-apoptotic function (Arredondo et al, 2005). Mutations in the Slurp1 gene lead to a variety of skin and nail abnormalities in humans (Fischer et al,
2001). Increased expression of both Noxa and Slurp1 suggested increased susceptibility to apoptosis in the knockout epidermis. This supported previous data suggesting that Slug has anti-apoptotic functions (Inukai et al, 1999; Come et al, 2004).
2.4.4 Adhesion and motility
Previous studies have shown a prominent role for Slug and Snail in modulating cell: cell and cell: substrate adhesion by controlling expression of components of adherens junctions, desmosomes, and tight junctions (Savagner et al, 1997; Savagner et al, 2005). Thus, it was not surprising that we identified altered expression of such genes in Slug knockout epidermis (Table 2.3). Alpha-like 1 catenin (Ctnnal1) expression was decreased almost 4-fold in knockout epidermis. Ctnnal1 is similar to α-catenin (Zhang et al, 1998), which functions in cell adhesion and signaling by anchoring adherens junctions to the cytoskeleton (Pappas and Rimm, 2006). No E-box region has been identified in the Ctnnal1 promoter region. This contrasted with findings for β-catenin, another component of adherens junctions. Expression of β catenin in a number of cell types has been shown to be directly repressed by Slug and Snail through binding to an E-box in the promoter. Our study did not identify altered expression of β-catenin in unperturbed Slug knockout epidermis.
40 In Slug knockout epidermis, there was 1.4-fold decreased expression of integrin
α6 (Itga6) compared to wild type epidermis. Integrin α6 pairs with integrin β4 to form part of the hemidesmosome. A recent report described decreased integrin β4 expression in response to enhanced Slug expression, but did not evaluate α6 expression (Turner et al,
2006). Both components of the hemidesmosome, integrins α6 and β4, have E-boxes in their promoter regions (Turner et al, 2006). Thus, the finding that the two integrin genes may be oppositely regulated by Slug was unexpected. Other integrins with E-boxes are
α2, α6, αv, α5, α3, β1, and β4. Expression of none of these was significantly altered in
Slug knockout epidermis, although expression of integrins α3, β1 and β4 was decreased following induction of Slug expression in human epidermal keratinocytes (Turner et al,
2006).
Altered expression of other genes encoding proteins important in cell: cell and cell: substrate adhesion was observed in Slug knockout epidermis. CD44 expression was increased more than 2-fold in Slug-null epidermis. In the skin, CD44 is important in regulation of keratinocyte proliferation in response to external stimuli, as well as in the maintenance of hyaluronate homeostasis (Kaya et al, 1997). Binding of CD44 to hyaluronan in the extracellular matrix stimulates keratinocyte differentiation
(Bourguignon et al, 2006). Others have shown increased CD44 expression in melanoma metastases, but decreased expression in squamous cell carcinoma metastases (Rosel et al,
1997).
In addition to differences in cell-associated adhesion molecules, there were marked differences in expression of extracellular matrix (ECM) components between wild type and Slug knockout epidermis. Some of these ECM components play important
41 roles in EMT and have clear implications for the role of Slug in modulating EMT.
Expression of tenascin C (Tnc) was significantly increased in the knockout epidermis
(6.1-fold) (Lightner, 1994). Increased tenascin C expression has been reported to occur during wound healing and skin carcinogenesis (Ogawa et al, 2005) and to be associated with induction of EMT by TGF-β in mouse mammary epithelial cells (Maschler et al,
2004). Periostin (Postn) expression was increased by more than 5-fold in Slug knockout epidermis. Ectopic expression of periostin in tumorigenic but non-metastatic human embryonic kidney (HEK) 293T cells results in increased adhesion, migration and invasion; thus, periostin fosters EMT and contributes to the metastatic potential of tumors. Enhanced expression of tenascin C and periostin in Slug knockout epidermis was unexpected, given that these ECM components enhance EMT, while the absence of Slug expression would be expected to suppress EMT.
Additional ECM components with altered gene expression in Slug-null epidermis included tenascin XB (Tnxb, decreased 2.4-fold), agrin (Agrn, decreased 2.1-fold), α type
IV procollagens (Col4a5 and Col4a6, decreased 1.5 and 1.9-fold, respectively), thrombospondin 2 (Thbs2, decreased 1.4 fold), cartilage oligomeric matrix protein
(Comp, increased 1.6-fold), and nephronectin (Npnt, increased 1.5-fold). The role of these ECM components in skin homeostasis is largely unknown.
Slug expression has been associated with enhanced keratinocyte motility, and we detected significant differences between wild type and Slug knockout epidermis in expression of several genes that modulate actin function. Expression of rho GTPase activating protein 25 (Arhgap25) was decreased 2-fold in Slug knockout epidermis.
RhoGAP family proteins, encoded by Arhgap family genes, are negative regulators of rho
42 family GTPases, which are implicated in the actin remodeling processes essential for determining cell polarity and promoting cell migration (Katoh and Katoh, 2004).
Additional actin-modifying proteins with significantly decreased expression in Slug knockout epidermis included calmin (Clmn) and scinderin (Scin), both decreased 1.9- fold. Scinderin is a member of the gelsolin superfamily of actin filament severing proteins; another member of this superfamily, gelsolin, has previously been shown to be regulated by Snail (Tanaka et al, 2006). Expression of profilin 2 (Pfn2), which modulates actin polymerization (Yarmola and Bubb, 2006), was increased 1.8-fold in Slug null epidermis. Overall, Slug knockout epidermis appeared to have a gene expression profile consistent with a less motile phenotype than wild type epidermis. It is important to note that, because we examined gene expression in unperturbed skin, we may have failed to detect inducible Slug-controlled genes involved in cell migration during cutaneous wound healing and squamous cell carcinoma progression.
2.4.5 Angiogenesis
We saw significant differences between wild type and Slug knockout epidermis in expression levels for a number of modulators of angiogenesis (Table 2.4). The c-fos induced growth factor (Figf), also known as vascular endothelial growth factor D (Vegfd)
(Marconcini et al, 1999), was expressed at substantially decreased levels (3.2-fold) in
Slug knockout epidermis. Vegfd phosphorylates the vascular endothelial growth factor receptor 3 to induce pro-angiogenic effects (Marconcini et al, 1999; Baldwin et al, 2001).
Expression of another inducer of angiogenesis, Smoc2 (Rocnik et al, 2006), was also decreased (3.8-fold) in the knockout mice. Reduction of Vegfd and Smoc2 expression suggested a potentially reduced angiogenic response during wound healing or tumor
43 development in Slug knockout mice. These findings were in keeping with a previous report of increased expression of angiogenic mediators such as vascular endothelial growth factor by MDCK cells expressing elevated levels of Slug (Moreno-Bueno et al,
2006). On the other hand, expression of two pro-angiogenic factors was increased in Slug knockout epidermis. Expression of angiomotin (Amot) was increased 5.6-fold in Slug- null epidermis, and angiopoietin 1 (Ang1) expression was increased 2.1-fold (Tammela et al, 2005). Systemic delivery of an adenoviral vector encoding Ang1 complexed to the stabilizer cartilage oligomeric matrix protein (Comp) improved cutaneous wound healing in diabetic mice (Cho et al, 2006). Interestingly, expression of Comp was also increased in the knockout epidermis (1.6-fold).
2.4.6 Response to external stimuli
The epidermis forms an important barrier between the body and the external environment, thus it might be expected to express a wide variety of molecules involved in protective responses to environmental insults. In keeping with this expectation, we observed altered expression of genes encoding molecules related to inflammatory and immune responses, response to oxidative stress, and metabolism of xenobiotics (Table
2.5).
Expression of several interleukin (IL) receptors differed significantly between
Slug knockout and wild type mice, with more than 3-fold decreased expression of receptors for IL-20 and IL-22. IL-20 and IL-22 are members of IL-10 family of cytokines, but, unlike IL-10, both are pro-inflammatory (Rich and Kupper, 2001;
Boniface et al, 2005). IL-20 can be synthesized by keratinocytes in response to interferon-γ or other products from activated T-cells and functions to regulate
44 keratinocyte proliferation and differentiation and cutaneous inflammation (Rich and
Kupper, 2001). IL-22 induces keratinocyte migration and proliferation, but decreases expression of genes associated with keratinocyte differentiation (Boniface et al, 2005).
Although our microarray studies were conducted using material highly enriched for keratinocyte RNA, other cell types present in the epidermis contributed at least small amounts of RNA. Such non-keratinocyte cell types included intraepidermal dendritic T cells (λδ T cells) and Langerhans cells. Some of our results may thus be related to differences in gene expression in these immune cells rather than in keratinocytes. For example, expression of the zeta chain of CD3 (Tcrz), an important component of T cell receptor signaling, was decreased 1.7-fold in Slug knockout epidermis. In addition, expression of both the λ and δ chains of the T cell receptor (Tcrg and Tcrd) was decreased approximately 2.3-fold in the Slug knockout epidermis, suggesting that there were fewer λδ T cells in the knockout than in wild type epidermis. These λδ T cells play an important role in innate immunity in the skin, exhibiting anti-tumor and immunoregulatory activity (Girardi, 2006). Mice lacking λδ T cells have been shown to have increased susceptibility to cutaneous carcinogenesis (Girardi et al, 2001). In keeping with these findings, immunohistochemical staining for CD3 revealed decreased numbers of T cells in the epidermis of Slug knockout and wild type mice (3.77 ± 2.16 versus 4.7 ±
0.86): however, this difference was not significant (p = 0.199 by the t test). Interferon regulatory factor 4 (Irf4) expression was decreased more than 3-fold in the knockout epidermis; Irf4 has been shown to be critical for the development of dendritic cells
(Suzuki et al, 2004).
45 Expression of member 1 of the sulfotransferase family 5A (Sult5a1) was decreased by 4.3-fold in Slug knockout epidermis. Sulfotransferases catalyze the transfer of a sulfonate group from 3'-phosphoadenosine 5'-phosphosulfate (Alnouty and Klaassen,
2006). Sult5a1 is expressed widely in all tissues (Alnouty and Klaassen, 2006), but there is little reported on its functional significance in the epidermis. Expression of the cytochrome P450 CYP2B10 (Cyp2b10) was increased 2-fold in knockout epidermis.
CYP2B10, like other cytochrome enzymes, can detoxify or activate chemical carcinogens
(Honkakoski and Negishi, 1997).
2.4.7 Miscellaneous
Expression of a number of genes that encode proteins important in membrane transport, intracellular trafficking, and metabolism differed significantly between wild type and Slug knockout epidermis (Table 2.6). For most of these genes, the implications of altered expression for epidermal homeostasis, cutaneous wound healing, and skin carcinogenesis was unclear. An interesting exception was aquaporin 3 (Aqp3), expression of which was increased in knockout epidermis by 1.7-fold. Aquaporin 3 is a channel that transports water and glycerol and is found primarily in the basal layer of the epidermis
(Zheng and Bollinger Bollag, 2003; Hara-Chikuma and Verkman, 2005). Mice deficient in Aqp3 have reduced hydration of the stratum corneum, decreased skin elasticity, and impaired cutaneous wound healing (Zheng and Bollinger Bollag, 2003; Hara-Chikuma and Verkman, 2005).
46 2.5 CONCLUSIONS
Using the novel approach of comparing in vivo gene expression profiles in the epidermis of wild type and Slug knockout mice, we were able to identify a number of biologically relevant putative targets of Slug regulation. In a number of cases, the microarray findings and their functional implications were substantiated by quantitative
RT-PCR, immunohistochemistry, or morphometry. Our studies provided valuable insight into the complex patterns of Slug-dependent gene expression in the epidermis and highlighted some of the mechanisms by which Slug may influence epidermal homeostasis, wound healing, and carcinogenesis. Likely targets of Slug regulation included both previously and newly identified genes. Developmental genes with altered expression included members of the sonic hedgehog and homeobox pathways, in keeping with the previously identified role of Slug in embryogenesis. The Slug-null epidermis expressed particularly high levels of keratins 8 and 18, indicating a role for Slug in epidermal differentiation. Alterations in expression of genes regulating proliferation and apoptosis, such as growth factors and related genes, cyclins, and Noxa, suggested a role for Slug in keratinocyte turnover. Altered expression of a number of genes encoding cell- associated and ECM adhesion molecules showed that Slug modulates keratinocyte adhesion in sessile as well as migrating keratinocytes. Our data also indicated a potential role for Slug in cutaneous angiogenesis. A novel role for Slug in modulating the epidermal response to the external environment was suggested by altered basal expression of genes encoding interleukin receptors, T-cell receptors, and a P450 in Slug
47 knockout epidermis. The presence of E-boxes in the promoters of some genes with decreased expression in Slug knockout epidermis identified putative direct targets of Slug regulation.
48
Figure 2.1: Technique for Isolating Epidermal Cells from the Skin. Untreated wild type
(A) and Slug knockout (B) skin; (C) wild type and (D) Slug knockout skin after the epidermis has been scraped off, leaving the underlying dermis intact. Bar = 30µm.
49
Figure 2.2: Epidermal RNA Quality Analysis. Gel image (A) and graphs (B) demonstrating the high quality RNA isolated from the epidermis of wild type and Slug knockout mice.
50
Figure 2.3: Immunohistochemical Detection of Keratin 8 in Untreated Skin. (A) There is no Keratin 8 staining in the wild type epidermis, (B) whereas scattered cells in the Slug knockout epidermis have positive staining for Keratin 8. Bar = 20µm.
51
d nue i ont C
s i m r de pi E
kout noc K ug l S n i
s ne e G d e t a l e r - on i t a i nt e r e f f i D d n a
nt e opm l ve e D
of on i s s e r xp E d e r e t l A
1. 2.
e l ab T
52
d nue i ont C
. d e u n i t on c 1 2. e l ab T
53
d. e i
. e ppl a bl a l i on i t va c a e
r r o not c
s s a ’ w
oni e r r nc e que onf e B s
r n e he ot w
e om
pr nc .
e d r e he e t f u
f t n i di t
ha t
nt on s a c e t c i a 1 f c 2.
gni e ndi i l I S
- ab - 1 2 T
54
d nue i ont C
s i m r de i p E
kout noc K
ug l S n i
s ne e G d e t a l e r - s i os popt A
nd a
on i t a r e f i ol r P
of on i s s e r xp E d e r e t l A
2. 2.
e l ab
T 55
. e bl a l i va a
not
s a w
e nc que e s
r e ot
. om d pr e u he n t i t t on ha t c
s 2 e t 2. a
c e l ndi ab I
T -
1
56
d e nu i ont C
s i m r de pi E
kout noc K ug l S
n i
s ne e G d e t a l e r - y t i l i ot M nd a on i s dhe A
of on i s s e r xp E d e r e t l A
3. 2.
e l ab T
57
d nue i ont C
. d e u n i t on c 3 2. e l ab T
58
d. e i
. e ppl a bl a l i on i t va c a e
r r o not c
s s a ’ w
oni e r r nc e que onf e B s
r n e he ot w
e om
pr nc .
e d r e he e t f u
f t n i di t ha
t
nt s on a e c t c i a 3 f c 2.
gni e ndi i l I S
- ab - 1 2 T
59
s i m r de pi E
kout noc K ug l S
n i
d. s e i
ne . e e ppl G a bl a d l i e on t i t a va l c a e e
r r - r s o i not c s
s s a ne ’ w
oni e oge r r nc e ngi A que
onf e B s of
r n e on i he ot s w s
e e om r pr nc xp
e E r he e t d f
f e t r di e ha
t t l
nt s A a e
t c i a f 4. c 2.
gni ndi i e l I S
- - ab 1 2 T
60
d nue i ont C
s i m r de pi E
kout noc K ug l S
n i
i ul m i t S
l na r e xt E o t
s e pons s e R o t d e t a l e R
s ne e G
of on i s s e r xp E d e r e t l A
5. 2.
e l ab
T 61
d nue i ont C
. d e u n i t on c 5 2. e l ab
T
62
d. e i
. e ppl a bl a l i on i t va c a e
r r o not c
s s a ’ w
oni e r r nc e que onf e B s
r n e he ot w
e om pr nc
e r
. he e t f d
f t e u di ha n t i
nt t s a e t c on i a f c c 5 gni ndi i 2.
I S e
- l - 1 2 ab
T 63
d nue i ont C
s i m r de pi E
kout noc K ug l S n i on i s s e r xp E d e r e t l A h t i w
s ne e G
ous ne a l l e c s i M
6. 2.
e l ab
T
64
d nue i ont C
. d e u n i t on c 6 2. e l ab T
65
d nue i ont C
. d e u n i t on c
6 2. e l ab T
66
d nue i ont C
. d e u n i t on c
6 2. e l ab T
67
d nue i ont C
. d e u n i t on c
6 2. e l ab T
68
d nue i ont C
. d e u n i t on c
6 2. e l ab T
69
d nue i ont C
. d e u n i t on c
6 2. e l ab T
70
d nue i ont C
. d e u n i t on c
6 2. e l ab T
71
. e bl a l i va a
not
s a w
e nc que e s
r e ot
om . d pr e u he n t i
t t ha on t c
s 6 e t a 2.
c e l ndi I ab
- T
1
72
Gene Primers Ratio Slug Performance knockout/ wild site type expression GAPDH ACCCAGAAGACTGTGGATGG 11 OSU2 CACATTGGGGGTAGGAACAC Slug GATGTGCCCTCAGGTTTGAT 0 OSU ACACATTGCCTTGTGTCTGC Gli1 ACTAGGGGGCTACAGGAGGA 5.41 OSU ACCTGGACCCCTAGCTTCAT Gli2 CTCAGCCATCTCAGGACACA 6.98 OSU CAAAGGCTCAGGCTGGATAC Krt1-8 ATCGAGATCACCACCTACCG 1052.36 OSU TGAAGCCAGGGCTAGTGAGT Krt1-18 ABI Mm01601706.g1 1024.00 UNM3
Snf1 ABI Mm00440317.m1 -1.154 UNM
Angiomotin ABI Mm00462731.m1 8.00 UNM
Tenascin C ABI Mm00495662.m1 9.19 UNM
Table 2.7. Confirmation of Microarray Findings by Quantitative RT-PCR
1- All values normalized to GAPDH prior to ratio calculations.
2- The Ohio State University.
3- University of New Mexico.
4- Negative sign indicates that expression of this gene was decreased in the knockout.
73 CHAPTER 3
THE ACUTE INFLAMMATORY RESPONSE IS ATTENUATED IN SLUG
KNOCKOUT MICE
3.1 Abstract
We previously reported ultraviolet radiation (UVR) induction of Slug, a member of the Snail family of zinc finger transcription factors, in the epidermis of mice; we now report that Slug knockout mice are, unexpectedly, more resistant to sunburn than wild type mice. There was a marked difference between the cutaneous inflammatory response in the skin of Slug knockout and wild type mice at times from 12 hours to 1 week following exposure to 3 minimal erythemal doses of UVR. Although the extent of UVR- induced DNA damage was similar in both genotypes, Slug knockout mice did not show the immediate increase in skin thickness attributable to inflammation observed in wild type mice. Decreased skin thickening was reflected in markedly reduced dermal neutrophil infiltrates in Slug knockout mice. Surprisingly, there were as many or more intraepidermal T cells and dermal mast cells in the UVR-exposed skin of Slug knockout mice as in the skin of similarly exposed wild type mice. Differences in cutaneous cytokine expression following a single dose of UVR appeared to account for at least
74 some differences between the genotypes in cutaneous response. Despite the reported anti-apoptotic role for Slug in some cell types, we observed decreased UVR-induced apoptosis in Slug knockout compared to wild type epidermis. Our findings indicate an unexpected but important role for Slug in the acute inflammatory response of the skin to
UVR exposure.
3.2 Introduction
Slug belongs to the Snail family of transcription factors and is known to modulate epithelial-mesenchymal transformation (EMT) (Carver et al, 2001). EMT is a shift in cellular morphology characterized by the transformation of anchored epithelial cells into migratory cells with a fibroblastic phenotype (Carver et al, 2001). EMT occurs normally during embryogenesis and is involved in neural crest cell migration and limb bud formation (Carver et al, 2001). Changes resembling EMT occur in the adult skin in keratinocytes at wound margins (Savagner et al, 2005) and in UVR-induced squamous cell carcinomas (SCC) (Hudson et al, 2007). Slug has been shown to control these EMT- like events in adult keratinocytes both in vivo and ex vivo (Savagner et al, 2005). Slug also appears to play an important role in skin homeostasis, as indicated by Slug expression in normal adult epidermis (Parent et al, 2004) and by substantial differences in basal gene expression between Slug knockout and wild type skin (manuscript in submission).
The initial inflammatory response of the skin to ultraviolet (UVR) irradiation is vasodilation of cutaneous blood vessels resulting in erythema and edema. This is closely followed by keratinocyte apoptosis and inflammatory cell infiltration (Clydesdale et al,
75 2001). The magnitude and time course of these events depends upon the type and dose of
UVR delivered. We previously demonstrated dose-dependent UVR induction of Slug in keratinocytes (Hudson et al, 2007). In addition, by identifying altered expression of various immunomodulatory factors in the untreated epidermis of Slug null mice, we were the first to suggest a potential role for Slug in the epidermal inflammatory response
(manuscript in submission). In the present report, we document a marked difference between the inflammatory response of Slug knockout and wild type skin to UVR and provide evidence that this difference can be attributed, at least in part, to differences in the production of immunomodulatory factors by UVR-exposed epidermis.
3.3 Materials and Methods
3.3.1 UVR Exposure of Mice
The mice used in this study were wild type mice and homozygous Slug knockout mice on a 129 background. Mice employed in these studies were generated and initially described by Dr. Thomas Gridley (Jackson Laboratory, Bar Harbor, ME) (Jiang et al,
1998). In these mice, the zinc finger region of the Slug gene has been replaced by a β- galactosidase gene, resulting in the production of a Slug-β-galactosidase fusion protein
(Jiang et al, 1998). The Slug portion of this protein is non-functional since it lacks the zinc finger region, however the β-galactosidase portion of the protein is fully functional.
Two females and one male 10-12 wk-old mice of each genotype comprised each group, except the 12 and 24 hrs time points which had six female and one male mouse per group.
76 UVR was obtained from Kodacel-filtered Westinghouse FS-40 lamps that emitted wavelengths between 280 and 400 nm with a peak at 313 (primarily UV-B). Based on determinations of skin thickness, 1600 J/m2 represented one minimal erythemal dose
(MED). For UVR exposures, the mice were shaved with electric clippers and depilated using Nair hair remover. Forty-eight hours later, the skin thickness of each mouse was measured. Skin thickness was determined by measuring the thickness of a skin tent with digital calipers in three different areas of the back; these individual values were then averaged. Mice were exposed to 3 MED of UVR. At 12, 24, 48, 72, and 96 hours and one wk post-UVR, skin thickness measurements were obtained immediately prior to carbon dioxide asphyxiation. After euthanasia, samples of skin were frozen in liquid nitrogen for
RNA isolation and myeloperoxidase measurement and fixed in 10% neutral buffered formalin for histologic analysis.
3.3.2 Histology and Immunohistochemistry
Formalin-fixed samples were embedded in paraffin, sectioned at 4-5 µm thickness, and stained with hematoxylin and eosin. Neutrophil counts were obtained by counting the number of neutrophils in six different 400x fields of dermis. Neutrophils in epidermal pustules and areas of dermal necrosis were excluded. Acid fast staining
(Sheehan and Hrapchak, 1980) was used to identify dermal mast cells. Mast cell counts were obtained by counting the number of mast cells in six different 400x fields of dermis.
Immunohistochemistry was performed as follows for cleaved caspase 3 and CD3 antigens: Slides were deparaffinized and re-hydrated. Antigen retrieval was performed with DakoCytomation Target Retrieval Solution (Carpinteria, CA, USA) and the Biocare
Digital Decloaking Chamber (Concord, CA, USA) by heating under pressure to 125o C
77 for 30 sec followed by cooling in the chamber to 90o C and on the bench top for 10 min.
Immunohistochemical staining was performed using the Dako Autostainer. Slides were rinsed with water, then treated for 5 min with 3% hydrogen peroxide and with protein block (DakoCytomation Serum-free Protein Block) for 10 min. Slides were incubated for
30 min with primary antibody diluted in DakoCytomation Antibody Diluent with
Background Reducing Components. Slides were incubated for 30 min with secondary antibody (Vector biotinylated goat-anti-rabbit antibody; Burlingame, CA, USA) diluted
1:200 in antibody diluent and for 30 min with ABC reagent (Vector R.T.U. Vectastain
Elite ABC). Slides were then incubated for 5 min in DakoCytomation Liquid DAB
Substrate, counter-stained with hematoxylin, dehydrated, and coverslipped. Rinses were performed using DakoCytomation Wash Buffer (Tris-Buffered Saline/Tween 20).
Antibodies included anti-cleaved caspase 3 (Cell Signaling, 1:200) and anti-CD3 (Dako, diluted 1:100). Cells positive for cleaved caspase 3 or CD3 had cytoplasmic staining. For immunohistochemical detection of p53, antigen retrieval was performed by steaming for
20 min in 1X Antigen Unmasking Solution (Vector), followed by a 20 min cool down step. Blocking was performed with 1x casein (Vector) for 30 min at room temperature.
Slides were incubated for 1.5 hrs with primary antibody (NCL-p53-CM5p Rabbit
Polyclonal, Novocastra) diluted 1:300 in 1x casein, for 30 min at room temperature with the secondary antibody (LINK Biotinylated AntiRabbit Immunoglobulins, Biogenex), and for 30 min at room temperature with ABC elite (LABEL Peroxidase conjugated streptavidin, Biogenex) then DAB (DAB Peroxidase substrate kit, Vector) for 6 min at room temperature. A final distilled water rinse was performed before counterstaining with Mayer’s Hematoxylin for 1 min, dehydrating, and cover slipping. All rinses were
78 performed with Tris-buffered saline/Tween-20 (TBST). Cells positive for p53 had strong nuclear staining. For cleaved caspase 3, CD3 and p53, positive cells were counted in the epidermis of six different 400x fields. In each of these fields, the total number of epidermal cells was also counted, and the number of positive epidermal cells was expressed as a percent of the total epidermal cells.
For detection of cyclobutane pyrimidines dimers (CPDs), slides were deparrafinized and then hydrated to water. Antigen unmasking was performed by incubating slides in proteinase K (QIAGEN DNeasy kit, diluted 1:300 in PBS) for 25 min at 37˚C, followed by a water rinse. Slides were then incubated in RNase A (USB, dilute to 5ug/ml in PBS) for 20 min at 37˚C, followed by a PBS rinse. Blocking was performed with 3% hydrogen peroxide for 5 min and then with MOM Blocking reagent for one hr at room temperature. Slides were pre-incubated in the MOM antibody diluent for 5 min prior to a 2 hour room temperature incubation with primary antibody (anti-thymine dimmer100ug/200ul, cln KTM53, Cat# MC-062, Kamiya Biomedical Company, Seattle,
WA) diluted 1:50 in MOM diluent. Secondary antibody (MOM biotinylated secondary antibody) was applied to the slides for 10 min at room temperature. Slides were then incubated for 30 min at room temperature with ABC elite (LABEL Peroxidase conjugated streptavidin, Biogenex), then DAB (DAB Peroxidase substrate kit, Vector) for 5 min at room temperature before a final rinse with water. Slides were counterstained with Eosin Y (diluted to 25% in 100% ethanol), then rinsed with 95% ethanol, dehydrated, and coverslipped. Unless otherwise indicated, rinses were performed with
PBS. Cyclobutane pyrimidine dimer-positive cells had strong nuclear staining.
79 3.3.3 Myeloperoxidase (MPO) assay
For MPO analysis, two 5 mm skin punches were placed in 1.25 ml of 0.5% hexadecyltrimethylammonium bromide (HTAB) in 50 mM potassium phosphate buffer, pH 6.0 prior to homogenization. Samples were then sonicated for 10 seconds, frozen in liquid nitrogen and then thawed at 37oC in a water bath; this was repeated three times followed by a final sonication step. The samples were then centrifuged for 30 min at
13,000 rpm and the supernatant was removed and allowed to come to room temperature.
Ten ul of supernatant were then added to 290 ul substrate (50 mM phosphate buffer pH
6.0 with 0.167 mg/ml o-dianisidine dihydrochloride and 0.0005% H2O2).
Myeloperoxidase activity was then measured using a microplate reader, at a wavelength of 450 nm for 5 min.
3.3.4 RNA Isolation
For RNA isolation, the epidermis was vigorously scraped from frozen skin samples, using a scalpel blade. Samples were placed in Trizol (Invitrogen Carlsbad, CA), then homogenized and processed as recommended by the manufacturer. Skin was fixed in 10% neutral buffered formalin after scraping and examined histologically to confirm that the epidermis was completely removed. This technique isolates primarily keratinocytes with small numbers of Langerhans cells and intraepidermal dendritic cells that are resident in the epidermis. Wild type and knockout samples were processed simultaneously. High quality RNA was consistently isolated using this technique.
3.3.5 Quantitative RT-PCR
Total RNA from the Slug knockout and wild type mice was used for real-time quantitative PCR. Five ug pooled total RNA was treated with DNaseI (Ambion, Austin,
80 TX), and cDNA was produced by reverse transcription of 500 ng of RNA using
Superscript II (Invitrogen, Carlsbad, CA) and oligo(dT) primers, as directed by the manufacturer. Quantitative reverse transcription-polymerase chain reaction (RT-PCR) was performed using the primer sets shown in Table 1. The Brilliant SYBR Green QPCR mix (Stratagene) was used as directed with 100 nM of each primer in an MX3000P Real-
Time PCR System (Stratagene). Fifty cycles of 94° C (30 seconds), 60° C (30 seconds), and 72° C (30 seconds) were performed. RNA concentrations were calculated using the
LinReg PCR program, which uses 4 points in the best linear region of amplification to determine starting mRNA concentration and PCR efficiency for each sample (Ramakers et al, 2003). GAPDH (Forward sequence: TGA TGA CAT CAA GAA GGT GAA C;
Reverse sequence: ATG GCC TTA CAT GGC CTC CAA GG) was used as an internal standard to account for efficiency of reverse transcription and amplification. Expression values for COX-2 (Forward sequence: CCC CCA CAG TCA AAG ACA CT; Reverse sequence: GGT TCT CAG GGA TGT GAG GA) were normalized to GAPDH values.
For all analyses, three separate PCR runs were performed and averaged.
3.3.6 Cytokine Array
The epidermal RNA was then purified using the RNeasy kit (QIAGEN). cRNA was then made and purified using SuperArray kits. Two female cRNA samples for each time point were pooled and applied to each membrane, and then hybridized by incubating overnight at 60oC. Following the appropriate washings, detection was performed and images were captured using a CCD (charged couple device) camera. The captured images were then analyzed by the GEArray Expression Analysis Suite software (SuperArray
Biosciences Corporation). Average spot intensity was determined by taking the total
81 density and dividing by the number of pixels, and then spot intensity was normalized relative to the housekeeping genes (GAPDH, ribosomal protein 27a, beta-2 microglobulin, heat shock protein 1-beta, and peptidylprolyl isomerase A). Background was reduced globally; the total density value per area within the grid but outside of grid capture was used as the background correction value. A spot was considered "Absent" if the average density of the spot was less than 1.5 times of the mean value of the local backgrounds of the lower 75 percentile of all non-bleeding spots. All other spots are considered “Present”. Three arrays were performed for each genotype at both 12 hours and 24 hours post-UVR; representing a total of six female mice of each genotype at each time point.
3.3.7 Statistics
One-tailed t tests were performed on skin thickness, MPO, and immunohistochemistry data. Significance was determined by a P value less than or equal to 0.05.
3.4 Results and Discussion
3.4.1 Gross and histologic pathology
At all time points following UVR exposure, the wild type mice, but rarely the knockout mice had evidence of sunburns, which were characterized by increased redness, and scaling and peeling of the skin. Twelve, 24 and 48 hrs following UVR exposure, the wild type mice had moderate to marked erythema and dermal edema, while the knockout mice had minimal to mild erythema and dermal edema. By 72 to 96 hrs the areas of
82 erythema on the wild type mice had progressed to areas of hyperkeratosis or ulceration with serocellular crust formation (Figure 3.1); these areas were not apparent in the knockout mice. One week following the UVR exposure, the large areas of dermal necrosis on the wild type mice had begun to resolve.
Histologically, the unexposed epidermis of the knockout mice is significantly thinner that that of the wild type mice as measured from hematoxylin and eosin stained sections using an ocular micrometer (7.38 um ± 0.99 versus 8.91 um ± 1.67, p = 0.016 by the t test). The changes observed histologically following UVR exposure mirrored those observed grossly and are presented in Figures 3.2 and 3.3. At 12 hrs post-exposure, there are early neutrophil infiltrates in the dermis of the wild type mice (Figure 3.2B), which were not apparent in the knockout mice (Figure 3.3B), however both genotypes had minimal keratinocyte apoptosis and hyperkeratosis. Similarly, at 24 hrs there was a dense neutrophilic infiltrate in the wild type mice (Figure 3.2C), which was not apparent in the knockout mice (Figure 3.3C). Both genotypes had evidence of keratinocyte apoptosis at 24 hrs post-UVR, however, minimal epidermal hyperplasia was only evident in the wild type epidermis. At 48 hrs there was marked loss of keratinocytes in both the wild type (Figure 3.2D) and KO (Figure 3.3D) mice reflecting widespread apoptosis.
Changes seen in the skin of the wild type mice at 72 hrs were similar to those seen at 96 hrs post exposure (Figures 3.2E,F,G). At these time points, however, there was considerable variability in the epidermal changes observed across the back of each mouse. In some areas there is complete loss of epidermal keratinocytes with necrosis and suppuration of the exposed superficial dermis (Figure 3.2 G), whereas moderate to marked epidermal hyperplasia was noted in other areas (Figure 3.2F). Skin from the
83 knockout mice lacked these large areas of epidermal ulceration and suppuration and consisted only of minimal to mild epidermal hyperplasia is present throughout the epidermis (Figure 3.3E,F). One week following UVR there is marked epidermal hyperplasia in the wild type mice (Figure 3.2H). Re-epithelialization with undermining of the necrotic superficial dermis is also present. Mild to moderate epidermal hyperplasia is present throughout the KO mouse epidermis (Figure 3.3G).
3.4.2 DNA damage
Despite the difference in cutaneous response to UVR, there was no apparent difference in the severity of direct UVR-induced DNA damage, as indicated by immunohistochemical staining for cyclobutane pyrimidine dimers (CPDs) at 12 (Figure
3.4) and 24 hours post-exposure.
3.4.3 Skin thickness
UVR-induced dermal edema was evaluated by measuring skin thickness. Since the unexposed skin of the Slug knockout mice is significantly thinner than that of the wild type mice (0.82 mm ± 0.31 versus 1.03 mm ± 0.12, p = 0.021 by the t test), data were analyzed as the percent change in skin thickness. In all mice, skin thickness increased in response to UVR at time points more than 24 hrs after UVR exposure.
Knockout mice had consistently thinner skin than wild type mice at all time points, and this difference was statistically significant at early (12 and 24 hrs) and late (96 hrs and 1 wk) time points (Figure 3.5A). Based on comparison with histopathology findings, the early changes in skin thickness represent inflammation, while later changes reflect the effect of epidermal scaling and hyperkeratosis and dermal necrosis with resultant loss of skin flexibility. At 1 wk after UVR exposure, the difference in skin thickness may also
84 reflect epidermal hyperplasia, which was much more prominent in wild type than Slug knockout skin. This was shown by significantly increased numbers of epidermal cells per
400x field in wild type compared to Slug knockout skin at 1 wk after exposure (Figure
3.5B) and was consistent with our previous finding of delayed expression of keratin 6, a marker of epidermal hyperplasia, in the skin of Slug knockout versus wild type mice
(Hudson et al, 2007).
3.4.4 Inflammation
Evaluation of the acute inflammatory response to UVR in these mice included quantitation of the numbers of neutrophils, mast cells and CD3 positive cells, as well as evaluation of myeloperoxidase (MPO) activity and COX-2 mRNA expression. UVR stimulated a pronounced and persistent influx of neutrophils into the dermis in both genotypes. At all time points, however, fewer neutrophils were present in the dermis of the knockout skin compared to the wild type mice (Figure 3.6A). The difference between neutrophil numbers in the two genotypes was significant at 12, 24, 48, and 72 hrs post-
UVR. Myeloperoxidase activity, an indicator of neutrophil activation, was also enhanced after UVR exposure, with values in wild type mice significantly higher than in Slug knockout mice at 12, 72, 96 hrs and 1 wk after UVR (Figure 3.6B) exposure.
Although increased numbers of mast cells were noted in the unexposed skin of
Slug knockout mice compared to wild type mice, this difference was not significant
(Figure 3.7). Following UVR exposure, mast cell numbers in the knockout skin were significantly different from mast cell numbers in wild type skin only at 24 hrs post-UVR, when the numbers were increased in Slug knockout mice. Mast cells are resident immune cells in the dermis and have an important role in mediating UVR-induced inflammation
85 (Clydesdale et al, 2001). Although there was little difference in mast cell numbers in the dermis of UVR exposed Slug knockout and wild type mice, these data do not address the functional capabilities of these mast cells, which may differ between the two genotypes.
In wild type mice there was a progressive decrease in the number of CD3 positive intraepidermal T cells from 12-48 hrs post-exposure (Figure 3.8). A similar trend was not seen in the skin of Slug knockout mice; indeed, the number of intraepidermal T cells in Slug knockout mice was significantly higher than in wild type mice at 24 and 48 hrs time points. In a previous microarray study, we found that expression of mRNA encoding zeta chain of the CD3 antigen was decreased 1.7-fold in the untreated Slug knockout epidermis (manuscript in submission). In keeping with these findings, immunohistochemical staining for CD3 revealed decreased numbers of T cells in the unexposed epidermis of Slug knockout and wild type mice (3.77 ± 2.16 versus 4.7 ±
0.86), although this difference was not significant (p = 0.199 by t test). Our microarray study also demonstrated decreased expression of both the delta and gamma chains of the
T cell receptor in the untreated Slug knockout epidermis, suggesting that there were fewer delta-gamma T cells in the knockout than in wild type epidermis (manuscript in submission).
To further evaluate the inflammatory response in the wild type and knockout mice following a single UVR exposure, we compared COX-2 mRNA expression by quantitative RT-PCR (Figure 3.9). UVR induction of COX-2 mRNA has been previously reported in the skin of mice based on microarray analysis (Madson et al, 2006). COX-2 induction results in the production of prostaglandins that modulate diverse manifestations of inflammation including vascular permeability, fever, and blood flow (Lee et al, 2003).
86 COX-2 has previously been shown to increase Snail expression (Dohadwala et al, 2006), and Snail has been shown to repress the transcription of prostaglandin dehydrogenase
(PGDH), the enzyme which inactivates the major effector of COX-2 activity, prostaglandin E2 (PGE2) (Mann et al, 2006). There was no difference in COX-2 mRNA expression in unexposed or UVR-exposed skin after 12, 24, 48, or 72 hrs of Slug knockout versus wild type mice. At 96 h after UVR exposure, there was a significant difference between the genotypes in COX-2 expression, with a second peak of COX-2 expression in wild type epidermis that was lacking in Slug knockout epidermis. This second peck of COX-2 expression likely corresponds to the areas of dermal necrosis seen in some of the wild type mice at this time point.
3.4.5 Cytokine Expression
Since epidermally produced cytokines are major mediators of the acute inflammatory response, a focused cytokine array was performed to further define and help explain the differences seen between the wild type and knockout mice following acute UVR exposure. Of the 111 cytokines represented on the arrays, only 20 genes were found to be consistently expressed in at least 1 of the 4 experimental groups (Table 3.1).
The major alteration in expression pattern was delayed gene expression in Slug knockout mice. Thus expression of 14 genes was observed at 12 hrs post-UVR in wild type but not
Slug knockout epidermis, but the genes were expressed in knockout epidermis by 24 hrs post-UVR. By 24 hrs after exposure, one of these genes was not expressed in either genotype, while expression of the other genes varied from equivalent to (4 genes) or higher than (9 genes) that in wild type epidermis. This pattern suggested a delayed inflammatory response to UVR in the Slug knockout mice. Genes with this pattern of
87 expression included several chemokines (Ccl4, Cxcl2, Cxcl4), interleukins (Il1b, Il12a,
Il12b, Il18), interleukin receptors (Il12r2, Il6st), and other immunomodulators (Mif,
Tollip, Spp1). Only 5 genes were preferentially expressed in Slug knockout epidermis.
These included 3 chemokines (Ccl2, Ccl8, Ccl19) and interleukin receptor (Il10rb).
3.4.6 Apoptosis
P53-dependent keratinocyte apoptosis is a prominent feature of sunburn (Kulms et al, 1999) and can be responsible for the release of pro-inflammatory substances (van
Oosten et al, 2000; Sander et al, 2004). Slug is reported to have anti-apoptotic effects
(Kajita et al, 2004; Inoue et al, 2002), however, the relationship between Slug and p53 is complex. We show here that there is no difference in baseline expression of p53 protein in the untreated epidermis from wild type and Slug knockout mice. There was a dramatic increase in p53 protein levels at times up to 96 hrs post-UVR in both the wild type and the knockout mice (Figure 3.10A), but there was no difference between the genotypes in the numbers of p53-positive epidermal cells at any time point. As expected, numbers of cleaved caspase 3-positive cells reflected the numbers of p53-positive cells (Figure
3.10B) and was associated with morphologic evidence of apoptosis (Kulms et al, 1999).
A significant difference in numbers of cleaved caspase 3-positive cells between wild type and Slug knockout epidermis was seen only at 12 hrs after UVR exposure, suggesting a somewhat delayed apoptotic response in Slug epidermis.
3.5 Conclusions
88 Although some hematopoietic abnormalities have been in reported in Slug null mice (Perez-Losada et al, 2002), by exposing these mice to acute UVR, this is the first report investigating the functional effects of these abnormalities.
The acute response to UVR seen in the wild type129 mice in this study began with increased p53 protein expression and COX-2 mRNA expression at 12 and 24 hrs, followed by peak caspase 3 expression at 48 hrs and the onset of epidermal ulceration and subsequent proliferative response after 72 hrs. Dermal edema and inflammatory cell infiltrates were prominent by 24 hrs post-exposure. Although the degree of UV-induced
DNA lesions are similar between the Slug knockout and the wild type mice, the Slug knockout mice were defective in many of these responses to acute UVR exposure. The
Slug knockout mice had decreased dermal edema, neutrophil infiltrates, COX-2 expression, proliferative responses, as well as altered cytokine profiles and apoptotic responses. Having previously reported UVR-induction of Slug in the murine epidermis, we now suggest that the complex events occurring in the skin following acute UVR exposure are regulated in part by Slug expression.
We have previously reported delayed expression of Keratin 6 (K6) in the epidermis of the Slug knockout mice relative to the wild type mice (Hudson et al, 2007).
Keratin 6 is a marker of proliferation and differentiation (Ramirez et al, 1998) and implies a delayed proliferation and differentiation response in the Slug knockout mice following UVR exposure. Decreased proliferation in the absence of Slug was confirmed in the current study by finding significantly decreased numbers of epidermal cells 1 wk post-UVR in the knockout mice.
89 Additionally, following UVR exposure significantly decreased dermal edema and neutrophil infiltrates were noted in the Slug null mice. Additionally, there was decreased
COX-2 expression in these mice during the latter phases of the response. In contrast, however, significantly more dermal mast cells were present in the Slug knockout mice at
24 hrs following a single dose of UVR. Following UVR exposure of the skin, mast cells are thought to release histamine which, in turn, leads to the production of prostaglandins and other inflammatory mediators (Clydesdale et al, 2001). The relationship of this finding to the attenuated inflammatory response seen in the knockout mice is unclear and functional characterization of the mast cells from the Slug knockout mice is ongoing.
Significantly increased numbers of epidermal CD3 positive cells were also detected in the
Slug null mice, however, this finding actually reflects a failure of UV-induced depletion of CD3 positive cells, as was observed in the wild type mice.
Given the obvious relationship between cytokines and the inflammatory response, cytokine expression profiles were compared in these mice following UVR exposure. In a previous microarray study comparing the unexposed epidermis of wild type and Slug knockout mice, we found a more than 3-fold decrease in the expression of interleukin receptors 20 and 22 between Slug knockout and wild type mice (manuscript in submission). In the current study, however, the Il20 and 22 receptors were not represented on the array system employed, furthermore, neither Il20 nor Il22 were expressed following acute UVR exposure. The microarray study also demonstrated a
1.7-fold decrease in expression of the type II, Il1 receptor (Il1r2) (manuscript in submission). Similarly, in the current study, expression of IL1r2 was deficient at 12 hrs post-UVR, however, expression had increased by 24 hrs such that it exceeded that of the
90 wild type mice. The microarray study did not highlight any other baseline differences in the expression of the cytokines which were elicited following UVR exposure in the current study. Many of the cytokines identified as differing in expression between UVR- exposed wild type and Slug knockout epidermis are produced by keratinocytes and are
UVR-inducible in the skin, for instance, Il1b (Griswold et al, 2001; Madson et al, 2006;
Scordi and Vincek, 2000), Il12 (Enk et al, 1996), Spp1 (Madson et al, 2006), Cxcl2
(Madson et al, 2006), and C3 (Terui et al, 2000). Moreover, many of these genes play important roles in recruiting inflammatory cells to UVR-exposed skin. Altered expression of neutrophil chemoattractants Il1b and the CXC chemokines (Borish and
Steinke, 2003) in the UVR-exposed Slug knockout epidermis may explain the diminished neutrophil response seen in these mice. Il1b expression has been reported following
UVR exposure of CD1 mice (Madson et al, 2006) and BALB/c mice (Scordi and Vincek,
2000; Griswold et al, 1991), and is proposed to be the initiating event in the inflammatory response to UVR (Griswold et al, 1991). The CXC family of chemokines is primarily chemotactic for neutrophils (Borish and Steinke, 2003), hence, the absence and delayed expression Cxcl2 and Cxcl4 in the Slug knockout mice may help explain the attenuated neutrophil infiltrate in these mice. In addition to impaired recruitment of neutrophils, impaired endothelial adhesion and extravasation may have contributed to the attenuated neutrophil infiltrates seen in the Slug knockout mice. Both Ccl19 (Borish and
Steinke, 2003) and integrin alpha M (Itgam, CD11b, MAC1) (Wang et al, 2005) had altered expression profiles in the Slug knockout mice and are important for the firm adhesion and transmigration of leukocytes at sites of inflammation.
91 UV-induced apoptosis is p53-dependent (Matsumura and Ananthaswamy, 2004) but is also modulated by reactive oxygen species, DNA damage, triggering of cell-death receptors, autocrine release of death ligands, or mitochondrial damage with subsequent cytochrome c release (Sander et al, 2004). This study found that the absence of Slug did not affect p53 protein expression following UVR exposure. Previous reports on the relationship between Slug and p53 are mixed. There is a Slug binding site in the p53 promoter region, and overexpression of Slug or Snail using an adenoviral vector in human breast carcinoma cells lines (MCF7) resulted in a modest decrease in p53 mRNA and protein expression and prevented apoptosis induced by the DNA-damaging adriamycin (Kajita et al, 2004). Anti-apoptotic effects of Slug were also reported following gamma-irradiation of Slug knockout mice, which resulted in increased numbers of apoptotic cells in the bone marrow of Slug knockout mice relative to their wild type counterparts (Inoue et al, 2002). It was postulated that gamma-irradiation induces p53 expression, which increases Slug, which antagonizes p53-mediated expression of the pro-apoptotic BH3 only protein, Puma (Shibue and Taniguchi, 2006;
Wu et al, 2005). Expression of Slug, therefore, decreases Puma expression, resulting in anti-apoptotic effects that contribute to increased cell survival; in the absence of Slug, however, the pro-apoptotic Puma prevails (Wu et al, 2005). In contrast, another study found no change in DNA damage-induced p53 expression in normal hematopoietic stem cells from Slug knockout mice (Kajita et al, 2004). The interactions between p53 and
Slug are likely context dependent.
Caspase 3 is an effector caspase which mediates many of the cellular events that result in apoptosis (Tribulo et al, 2004). In this study, immunohistochemical detection of
92 cleaved caspase 3 was used to highlight apoptotic keratinocytes, and revealed a significant decrease in UV-induced apoptosis in the Slug null mice 12 hrs following UVR exposure. Since Slug is purported to have anti-apoptotic functions (Inoue et al, 2002),
this observation was surprising and deserves further investigation. At later time points, however, there was no difference in cleaved caspase 3 immunoreactivity, suggesting that
Slug may only serve to delay the onset of UVR-induced apoptosis.
This report highlights the role of Slug in the development of acute inflammatory, apoptotic, and proliferative response to UVR exposure. Although further investigations are warranted, it is tempting to speculate that therapeutic ablation of epidermal Slug expression could attenuate the effects of sun exposure, and ultimately decrease tumor formation – this effect would be crucial to sun sensitive individuals, like those with xeroderma pigmentosa and transplant patients.
93
Figure 3.1: Gross Appearance 96 hours post-UVR (3MED) Exposure. The wild type mouse on the left has extensive erythema, dermal edema, as well as scaling and peeling of the skin, while there is only mild cutaneous erythema of the knockout mouse.
94
Continued
Figure 3.2: Histologic Appearance of Wild Type Skin Following UVR (3MED)
Exposure. Unexposed wild type (WT) skin (A). 12 hrs post-exposure of the WT there
95 Figure 3.2 continued. are mild neutrophil infiltrates (B). By 24 hrs post-UVR, there were marked neutrophil infiltrates in the WT skin (C). At 48 hrs there is almost complete apoptosis of the epidermal keratinocytes (D). 72 hrs following UVR there was moderate epidermal hyperplasia of the WT skin (E). At 96 hrs following UVR exposure of the WT mice, lesions varied from moderate/marked epidermal hyperplasia (F) to complete loss of the epidermis with necrosis and suppuration of the exposed superficial dermis (G). By 1 wk post-exposure there is marked epidermal hyperplasia in the WT mice (H).
96
Continued
Figure 3.3: Histologic Appearance of Slug Knockout Skin Following UVR (3MED)
Exposure. Unexposed Slug knockout (KO) skin (I). There were minimal neutrophil
97 Figure 3.3 continued. infiltrates apparent 12 hrs (J) and 24 hrs (K) following
UVR exposure of the KO mice. By 48 hrs there is almost complete apoptosis of the keratinocytes in the KO epidermis (L). Epidermal hyperplasia increased from 72 hrs
(M), to 96 hrs (N) and 1 wk (O) post-exposure of the KO mice.
98
Figure 3.4: Immunohistochemical Detection of Cyclobutane Pyrimidines Dimers
(CPDs). (A) Control skin has no positive staining for CPDs. (B, C) Both the wild type and knockout mice have abundant positive nuclear staining for CPDs at 12 hours post-
UVR exposure. 99
Figure 3.5: Skin Thickness. (A) Skin thickness as measured with digital calipers.
Data represents the percent change in skin thickness relative to pre-UVR skin thickness measurement. Skin thickness was consistently decreased in the Slug knockout mice. (B)
Skin thickness as measured by counting the number of epidermal cells in six hematoxylin and eosin stained 400x fields, demonstrated a decreased proliferative response in the Slug knockout mice at 12 hrs and 1 wk following UVR exposure. * p < 0.05.
100
Figure 3.6: Neutrophil infiltrates. (A) The average number of neutrophils present in the dermis, as determined by counting the number of neutrophils in 6 hematoxylin and eosin stained 400x fields. Neutrophil infiltrates peaked in both the wild type and Slug knockout mice at 24 hrs post-UVR exposure, but were markedly decreased in the Slug null mice. (B) Average myeloperoxidase activity, as determined from two 5 mm skin punches, further demonstrated decreased neutrophil infiltrates in the Slug knockout mice.
* p < 0.05.
101
Figure 3.7: Mast cell counts. The average number of mast cells in each of 6 acid-fast stained 400x fields was determined for each mouse, and demonstrated significantly more mast cells were present in the dermis of Slug knockout mice at 24 hrs post-UVR. * p <
0.05.
102
Figure 3.8: Immunohistochemical Detection of CD3 Positive Epidermal Cells. The percent of CD3 positive cells in the epidermis was determined in each of six 400x fields for each mouse. Numbers of CD3 positive cells progressively decreased in the wild type mice, following the single exposure to UVR, this decrease was not seen in the knockout mice, and at 24 and 48 hrs post-exposure there were significantly more CD3 positive cells in the knockout epidermis. * p< 0.05.
103
Figure 3.9: Quantitative RT-PCR Detection of COX-2 mRNA in the UVR-exposed
Epidermis. By 12 hrs post-UVR, COX-2 expression had increased dramatically in both the wild type and Slug knockout mice, however, at 96 hrs, there was significantly more
COX-2 expression in the wild type mice, as compared to the Slug knockout mice. COX-
2 expression values are normalized to GAPDH expression. * p < 0.05.
104
Continued
Figure 3.10: UVR-induced Apoptosis. (A) Immunohistochemical detection of p53.
Expression of p53 increased dramatically following UVR exposure and then progressively decreased. No significant differences in expression were observed between the wild type and Slug knockout mice. (B) Immunohistochemical detection of cleaved
105 Figure 3.10 continued. significantly decreased in the Slug knockout mice at 12 hrs post-UVR exposure. In both the Slug knockouts and the wild type mice, cleaved caspase
3 immunoreactivity peaks at 48 hrs following UVR exposure. For both p53 and caspase
3, the percent of positive cells in the epidermis was determined in each of six 400x fields for each mouse. * p< 0.05.
106
Relative Expression Level 12 hrs 24 hrs Gene KO WT KO/ KO WT KO/ Gene Name Symbol WT WT Pattern Integrin alpha M Itgam 0 0.01 - 0 0 - Higher in WT at 12 hrs, not expressed at 24 hrs C-C chemokine Ccl4 0 0.19 - 0 0 - Higher in WT at ligand 4 12 hrs, same at Interleukin 1 β Il1b 0.86 1.05 -1.22 1 1.04 -1.04 24 hrs Interleukin 12 α Il12a 0 0.56 - 0.6 0.59 1.01 Macrophage Mif 0.75 1.03 -1.37 1 0.95 1.05 migration inhibitory factor C-X-C chemokine Cxcl2 0.2 0.75 -3.85 0.75 0.53 1.41 Higher in WT at ligand 2 12 hrs, higher in C-X-C chemokine Cxcl4 0 0.35 - 0.78 0.46 1.7 KO at 24 hrs ligand 4 Interleukin 12 β Il12b 0.45 0.95 -2.13 0.76 1.65 -2.17 Interleukin 18 Il18 0 0.66 - 0.72 0 - Interleukin 1 Il1r2 0.3 1.02 -3.33 0.58 0.43 1.35 receptor, type II Interleukin 6 signal Il6st 0 0.28 - 0.62 0 - transducer Toll interacting Tollip 0.4 0.67 -1.67 0.98 0 - protein Secreted Spp1 0 0.54 - 0.66 0 - phosphoprotein 1 Fc receptor, IgE, γ Fcer1g 0.58 0.78 -1.35 0.84 0.41 2.05
Continued
Table 3.1: Comparative inflammatory gene expression following UVR exposure
107 Table 3.1 continued
Relative Expression Level 12 hrs 24 hrs Gene KO/ KO/ Gene Name Symbol KO WT WT KO WT WT Pattern C-C Ccl2 0 0 - 0.27 0 - Not chemokine expressed ligand 2 at 12 hrs, C-C Ccl8 0 0 - 0.72 0 - higher in chemokine KO at 24 ligand 8 hrs Interleukin 10 Il10rb 0 0 - 0.34 0 - receptor β Complement C3 0.57 0.46 1.23 0.68 0.22 3.04 Higher in component 3 KO at 12 hrs and 24 hrs C-C Ccl19 0.54 0.37 1.45 0 0 - Higher in chemokine KO at 12 ligand 19 hrs, not expressed at 24 hrs Fc receptor, Fcgr1 0.71 0.56 1.25 0.66 1.64 -2.5 Higher in IgG KO at 12 hrs, higher in WT at 24 hrs
108 CHAPTER 4
SLUG PLAYS A ROLE IN UVR-INDUCED SKIN CARCINOGENESIS
4.1 Abstract
Slug modulates epithelial mesenchymal transformation (EMT), the conversion of sessile epithelial cells attached to adjacent cells and to the basement membrane into dissociated and motile fibroblastic cells. Epithelial-mesenchymal transformation occurs during development, wound healing, and carcinoma progression. Using Slug null mice, we evaluated the role of Slug in ultraviolet radiation (UVR)-induced skin carcinogenesis.
In chronically UVR-exposed, non-tumor skin from the Slug knockout mice, inflammation and epidermal proliferation were decreased compared to wild type skin. Slug null mice had a consistently lower tumor burden than wild type mice. Additionally, the knockout mice had a tendency to develop fewer aggressive spindle cell tumors, believed to arise from squamous cell carcinomas that have undergone EMT, than wild type mice. No metastases were observed in either the wild type or Slug knockout mice. Using quantitative RT-PCR and immunohistochemistry, we showed that the spindle cell tumors in the Slug knockout mice demonstrated impaired EMT, as shown by decreased vimentin
109 and increased E-cadherin expression. This study confirms a role for Slug in EMT, but demonstrates that Slug is not required for the development or progression of UVR- induced skin tumors.
4.2 Introduction
The process of epithelial-mesenchymal transformation (EMT) occurs at several stages of embryonic development, including gastrulation and neural crest cell migration
(Carver et al, 2001). EMT is characterized by loss of cell:cell adhesion mediated by desmosomes and adherens junctions, increased secretion of extracellular matrix- degrading proteases, enhanced motility, loss of cytokeratin expression, and de novo expression of vimentin (Makinen and Stenback, 1998). Neoplastic cells may recapitulate these normal developmental processes, exploiting them to foster tumor growth and spread. Certain poorly differentiated carcinomas have been found to lose desmosomes and adherens junctions, express vimentin, acquire a spindle cell phenotype, overexpress proteases, and become highly motile; these changes are associated with enhanced invasive and metastatic potential (Carver et al, 2001; DiGiovanna, 1998; Grimes et al,
1996; Iyer and Leong, 1992; Mazzalupo et al, 2002). Dysregulation of genes important in developmental EMT has been implicated in these EMT-like processes (Kang and
Massague, 2004).
Two members of the Snail family of zinc- finger transcription factors, Slug and
Snail, play roles in developmental EMT (Carver et al, 2001). Slug and Snail recognize and bind to the same DNA sequence; however, their transcriptional activities are not identical (Cano et al, 2000; Hemavathy et al, Gene 2000), and they play distinct roles
110 during development, as shown by spatial and temporal differences in their patterns of expression (Sefton et al, 1998). Additionally, although Snail expression is essential for normal embryonic development, Slug knockout embryos are viable (Jiang et al, 1998).
Slug knockout mice are small, with minor craniofacial defects, pigmentary alterations, macrocytic anemia, and increased apoptosis in the thymic cortex (Perez-Losado et al,
2002; Mukhtar and Elmets, 1996; Jiang et al, 1998). Slug also appears to induce EMT- like events in adult epithelial cells. Constitutive expression of Slug in a rat bladder epithelial cell line in vitro causes dissociation of desmosomes, increased cell spreading, and cell dispersion (Krunic et al, 1998). Our previous studies indicated that Slug expression is induced in keratinocytes undergoing EMT: Slug is expressed at the margins of healing wounds in vitro and in vivo, and expression of exogenous Slug in keratinocytes enhances their ability to re-epithelialize wounds in vitro (Savagner et al, 2005).
Expression of Slug in keratinocytes is associated with enhanced migration, decreased desmosome number, redistribution of desmosomal proteins from the cell membrane to the cytoplasm, and decreased integrin expression (Savagner et al, 2005; Turner et al,
2006; manuscript in submission).
The final stage of malignant progression in murine epidermal carcinogenesis involves the evolution from squamous cell carcinoma (SCC) to the highly aggressive spindle cell tumor (Pons et al, 2005). This transition from epithelial to spindle cell morphology resembles EMT and has been associated with epigenetic alterations, including E-cadherin methylation, demethylation of the Snail promoter, and a global decrease in DNA methylation (Fraga et al, 2004). We have shown that UVR exposure induces Slug and Snail expression in the epidermis of mice (Hudson et al, 2007).
111 Persistent elevation of these mediators in response to chronic UVR exposure may promote the progression of UVR-induced SCC through their ability to modulate cell adhesion, motility, proliferation, and apoptosis (Hudson et al, 2007). To test this hypothesis, we examined the contribution of Slug to the development of UVR-induced nonmelanoma skin tumors in a mouse model. We are the first to directly evaluate the contribution of Slug to the de novo development of tumors in response to a complete carcinogen. Slug-null mice developed skin tumors in response to chronic UVR exposure, demonstrating that Slug expression is not required for skin carcinogenesis. However, the
Slug knockout mice had a lower tumor burden and developed fewer aggressive spindle cell tumors than wild type mice. Additionally, the spindle cell tumors in Slug knockout mice had a more epithelial expression profile than those in wild type mice.
4.3 Materials and Methods
4.3.1 Mice
Inbred 129 mice utilized for this study have been described previously (Jiang et al, 1998). In these mice, the β-galactosidase gene has been inserted into the Slug gene, resulting in the production of a fusion protein lacking Slug activity. Twenty wild type and 20 Slug knockout mice were included in the study. Thirteen of the mice in each group were females and 7 were males. Mice were obtained from a breeding colony maintained at the Ohio State University.
4.3.2 UVR Exposure
UVR was provided by Kodacel-filtered Westinghouse FS-40 lamps that emitted wavelengths between 280 and 400 nm, with a peak at 313. Based on determinations of
112 skin thickness, 1600 J/m2 represented 1 minimal erythemal dose (MED). Beginning at
10-12 weeks of age, the mice were exposed to 3200 J/m2 (2 MED) of UVR 3 times a week for 50 weeks. Forty-eight hours prior to the first UVR dose, the mice were shaved and excess hair was removed using Nair. Immediately before the first UVR exposure, skin thickness was determined by measuring the thickness of a skin tent with digital calipers in three different areas of the back; these individual values were then averaged.
Skin thickness was measured prior to every UVR exposure for the first 2 weeks, then once weekly until week 42, when most mice had developed tumors. Once tumors were noted, tumor size and location were monitored weekly. Mice with tumors exceeding 1 cm were removed early from the study. All remaining mice were sacrificed at week 50 by carbon dioxide asphyxiation.
4.3.3 Histopathology
Immediately after death, samples of non-tumor skin, the entirety of each tumor less than 3 mm in diameter, and half of each tumor larger than 3 mm in diameter were fixed in 10% neutral buffered formalin. The right inguinal lymph node, cervical lymph nodes, thymus, spleen, mesenteric lymph nodes, liver, kidneys, heart and lung of each mouse were also fixed for histologic examination. Formalin-fixed samples were embedded in paraffin, sectioned at 4-5 µm thickness, and stained with hematoxylin and eosin.
Tumors identified grossly were classified based on their histologic appearance as hyperplasia, papillomas, micro-invasive squamous cell carcinomas (miSCC), squamous cell carcinomas (SCC), spindle cell tumors, or anaplastic tumors (Figure 4.1 A-L).
Hyperplastic lesions were focal areas of increased epidermal thickness, without
113 significant dysplasia, exophytic growth or hyperkeratosis. Since these hyperplastic lesions were not true neoplasms, they were excluded from further consideration. A papilloma was defined as a focal area of increased epidermal thickness with an exophytic growth pattern, hyperkeratosis, and minimal dysplastic change. MiSCC were similar to papillomas, except there was evidence of penetration of the basement membrane with microinvasion of the basal layer of cells into the surrounding stroma; these tumors remained confined to the dermis. SCC demonstrated extensive invasion into the dermis and often invaded the panniculus carnosus. Neoplastic epithelial cells in SCC were frequently dysplastic, and keratin pearls were present. Spindle cell tumors varied in their extent of invasion but demonstrated loss of the epithelial phenotype; most neoplastic cells had a spindleoid morphology and keratinization was not observed. Anaplastic tumors also varied in their extent of invasion; cells were markedly atypical with frequent karyomegaly and numerous mitotic figures.
4.3.4 Immunohistochemical and Histochemical Staining
Formalin-fixed paraffin-embedded tissue specimens were sectioned at 4 µm and mounted on glass slides. The specimens were de-paraffinized and rehydrated, then pre- treated with Dako (Dako, Carpinteria, California, USA) target retrieval solution using the
Biocare Digital Decloaking Chamber (Biocare Medical, Concord, California, USA) and heated to 125° C for 30 seconds for antigen retrieval. Peroxidase blocking was performed with a 3% peroxidase solution for five minutes. Serum-free protein block (Dako,
Carpinteria, California, USA) was applied for ten minutes. Primary antibodies included polyclonal rabbit anti-CD3 (Dako, Carpinteria, California, USA) diluted 1:100, monoclonal rat anti-mouse keratin 8 (K8) (Developmental Studies Hybridoma Bank,
114 University of Iowa Department of Biological Sciences, Ames, Iowa, USA) diluted 1:250, monoclonal rat anti-mouse anti-Ki67 (Dako, Carpinteria, California, USA) diluted 1:200, and rabbit anti-mouse keratin 14 (K14) (Covance Research Products, Berkeley,
California, USA) diluted 1:10,000. All antibodies were diluted in Dako antibody diluent
(Dako, Carpinteria, California, USA) and applied to the slides for 30 minutes. Sections were incubated with biotinylated secondary antibody (rabbit anti-rat, anti-mouse, or anti- rat) (Vector Laboratories, Burlingame, California, USA) diluted 1:200 in serum-free protein block for 30 minutes, followed by a 30-minute incubation with ABC reagent
(Vector R.T.U. Vectastain Elite ABC, Vector Laboratories, Burlingame, California,
USA), a 5-minute incubation with chromagen (Liquid DAB substrate, Dako, Carpinteria,
California, USA), and hematoxylin counterstaining. Rinses were performed using Dako wash buffer (Carpinteria, California, USA). The slides were then dehydrated and cover- slipped.
For E-cadherin staining, slide preparation, antigen retrieval and blocking were performed as previously described. The biotinylated goat anti-mouse E-cadherin (R&D
Biosystems, Minneapolis, Minnesota, USA, Cat # BAF748) diluted with Dako antibody diluent (Dako, Carpinteria, California, USA) to 15 ug/ml, then applied to the slides for 30 minutes. Chromogen development, couterstaining, dehydration and cover-slipping were then performed as previously described.
Routine acid fast staining (Sheehan and Hrapchak, 1980) was used to identify dermal mast cells.
115 4.3.5 Morphometry
Epidermal thickness was determined using an ocular micrometer. Six different fields were measured at a magnification of 600x, and then the values from each mouse were averaged.
The number of dermal neutrophils and mast cells in the non-tumor chronically exposed skin was counted from hematoxylin and eosin and acid-fast stained sections, respectively. Neutrophils and mast cells were counted in six different 400x fields and the values were then averaged for each mouse. The average number of cells per mouse was then averaged for each genotype and then compared.
CD3-positive cells with strong cytoplasmic staining were counted in the epidermis and dermis of six different 400x fields. These numbers were averaged for each genotype and compared to the CD3-positive cell counts from 5 wild type and 5 knockout mice not exposed to UVR. In each of these fields, the total number of epidermal cells was also counted, and the number of CD3-positive epidermal cells was expressed as a percent of total epidermal cells. These epidermal cell counts were included as an indicator of epidermal thickness.
For K8, K14, and E-cadherin staining, tumors were graded on a scale of 0 to 3.
Grade 0 tumors had no staining; grade 1 tumors had 1-5% immunopositive cells; grade 2 tumors had 5-10% immunopositive cells; and grade 3 tumors had 10-15% immunopositive cells. For Ki67 staining, spindle cell tumors were graded on a scale of 1 to 3. Grade 1 tumors had 0-25% immunopositive epidermal cell nuclei; grade 2 tumors had 25-50% immunopositive nuclei; and grade 3 tumors had 50-75% immunopositive epidermal nuclei.
116 4.3.6 Quantitative RT-PCR
Samples of non-tumor skin from all mice and half of each tumor larger than 3 mm were frozen in liquid nitrogen for subsequent RNA analysis. Frozen tumor samples were homogenized in Trizol (Invitrogen, Carlsbad, California, USA) for RNA isolation. Five ug pooled total RNA was treated with DNaseI (Ambion, Austin, Texas, USA), and cDNA was produced by reverse transcription of 500 ng of this RNA using Superscript II
(Invitrogen, Carlsbad, California, USA) and oligo(dT) primers, as directed by the manufacturer. Quantitative RT-PCR was performed using the primer sets shown in Table
1. The Brilliant SYBR Green QPCR mix (Stratagene, La Jolla, California, USA) was used as directed with 100 nM of each primer in an MX3000P Real-Time PCR System
(Stratagene, La Jolla, California, USA). Fifty cycles at 94° C (30 seconds), 60° C (30 seconds), and 72° C (30 seconds) were performed. RNA concentrations were calculated using the LinReg PCR program which uses 4 points in the best linear region of amplification to determine starting mRNA concentration and PCR efficiency for each sample (Ramakers et al, 2003). GAPDH was used as an internal standard to account for efficiency of reverse transcription and amplification. Expression values for each primer set were normalized to GAPDH values. For all quantitative RT-PCR analyses, 3 separate
PCR reactions were performed.
4.3.7 Statistics
Skin thickness, tumor number and tumor area were determined by weekly observation. For comparison of tumor grade, tumors that were too small for histopathologic analysis and those classified histologically as hyperplasia were not
117 included. A one-tailed T-test, assuming equal variance was applied to the skin thickness data, basic tumor data, tumor burden data, immunohistochemical quantitations, and quantitative RT-PCR data to determine significance. Significance was defined as a p value less than or equal to 0.05.
4.4 Results
4.4.1 Skin Thickness
Prior to UV exposure, skin from the knockout mice was significantly thinner than that of the wild type mice (0.82 mm ± 0.31 versus 1.03 mm ± 0.12, p = 0.021 by the t test), as measured by the skin calipers, therefore, all data is presented as a percent change in skin thickness. Total skin thickness in wild type mice peaked during the second week of UVR exposure at 163% ± 38.9 versus 110% ± 89.1 in the knockout mice; however, this difference was not significant (p = 0.065 by the t test). By 6 weeks of exposure, skin thickness in the wild type had reached a minimum (61.46% ± 22.78). At this time point, the skin thickness of the knockout mice had also declined to 62.76% ± 76.61; this difference was not significant (p = 0.4789 by the t test). The skin thickness of the knockout mice continued to decline, and reached a minimum by 9 weeks (20.78 ± 34.82), meanwhile skin thickness of the wild type mice remained around 60% (66.81% ± 17.69); this difference was significant (p = 0.0007) by the t test. Throughout the study, skin thickness in all mice progressively increased from its lowest point. The final skin thickness measurements were taken after 42 weeks of exposure, and at that time, the wild type skin was significantly thicker than the knockout skin (106.90% ± 32.26 versus
37.9% ± 21.67, p = 3.397 x 10-05 by the t test).
118 Similarly, in unexposed skin, there was significantly decreased epidermal thickness in knockout compared to wild type skin (7.38 um ± 0.99 versus 8.91 um ± 1.67, p = 0.016 by the t test). At the termination of the study, the epidermal thickness measured from histologic sections was significantly lower in knockout mice compared to the wild type mice (8.91 um ± 1.67 versus 7.38 um ± 0.99, p = 0.016 by the t test).
In unexposed knockout mice, there were 93.6 ± 11.04 epidermal cells per 400x field compared to 126.48 ± 31.90 epidermal cells in knockout mice exposed to UVR for
50 weeks (p = 0.011). In unexposed wild type mice, there were 93.60 ± 11.04 epidermal cells per 400x field compared to 157.37 ± 23.16 epidermal cells in the chronically exposed wild type mice (p = 2.5 x 10-6). Thus, there was no difference between normal wild type and normal Slug knockout skin in the numbers of epidermal cells per 400x field, however, following 50 weeks of UVR, there were significantly (p = 0.00059) fewer epidermal cells per 400x field in the knockout epidermis as compared to wild type epidermis.
4.4.2 Inflammation
No neutrophils were present in the normal dermis of the Slug knockout and wild type mice. Following chronic UVR exposure, there was no difference in the number of dermal neutrophils in the wild type and Slug null mice (2.23 ± 1.18 versus 2.27 ± 1.46, p
= 0.456 by the t test) (Figure 4.2A).
Significantly increased numbers of mast cells were present in the dermis of the
Slug knockout mice compared to the wild type following chronic UVR exposure (15.56
± 3.65 versus 12.18 ± 4.31, p = 0.006 by the t test) (Figure 4.2B).
119 There was no difference in the number of CD3 positive cells in the dermis of normal skin from the Slug knockout and wild type mice (Figure 4.2C). However, in response to chronic UVR exposure, there was a significant increase in CD3-positive cells in the dermis of the wild type mice (p = 0.00085); a similar increase in CD3 positive cells did not occur in the dermis of Slug knockout mice. Likewise, there were significantly more CD3 positive cells in the dermis of the wild type mice than the knockout mice in response to chronic UVR exposure (p = 0.019).
4.4.3 Tumor Development
The first tumor was noted at week 29 of UVR exposure in a Slug knockout mouse. As shown in Figure 4.3 and Table 4.2, there was no significant difference in time to tumor onset between the two genotypes. Eighty percent of the wild type mice developed skin tumors. Sixty-five percent of knockout mice developed tumors; however, seven knockout mice were removed early from the study due to problems unrelated to
UVR exposure (for example, inanition, priaprism, preputial gland abscess); 72% of the knockout mice that remained on the study past week 35 developed skin tumors.
When tumor burden, calculated as total tumor area per mouse per week (including hyperplastic lesions), was compared between genotypes (Figure 4.4), the knockout mice consistently had a lower tumor burden than the wild type mice. This difference between the wild type and knockout mice was significant at weeks 39 (1.14 ± 2.60 versus 0 ± 0, p
= 0.040), 41 (4.08 ± 6.60 versus 1.02 ± 2.78, p = 0.043), 42 (7.52 ± 12.72 versus 1.32 ±
3.08, p = 0.033), 44 (20.40 ± 29.86 versus 5.00 ± 11.65, p = 0.031), and 45 (32.32 ±
45.52 versus 7.32 ± 16.54, p=0.038). Although there was no statistically significant difference in the distribution of tumor types in the genotypes, there was a tendency
120 towards less aggressive tumor types in the knockout mice (Figure 4.5). More than half of the tumors in Slug knockout mice were benign papillomas, while papillomas constituted only 30% of the tumors in wild type mice. Thirty per cent of the tumors in wild type mice and less than 20% of the tumors in Slug knockout mice were spindle cell tumors. None of the mice developed metastases. Overall, these findings suggest that the conversion of benign papillomas to miSCC and malignant epithelial tumors to spindle cell tumors was slower in Slug knockout mice than in wild type mice.
4.4.4 Expression of Slug and Snail
Given the small number of epithelial tumors available for RNA analysis, relative expression values from all epithelial tumors (papillomas, miSCC, and SCC) were averaged and compared to the values from spindle cell tumors (spindle cell, anaplastic).
Hyperplastic lesions were not included. These analyses included 10 wild type spindle cell tumors, 4 knockout spindle cell tumors, 6 wild type epithelial tumors, and 5 knockout epithelial tumors. Slug and Snail expression levels in normal skin were provided by analysis of RNA samples from two wild type mice and two knockout mice.
Quantitative RT-PCR for Slug expression was performed only on RNA from wild type tumors. There was significantly higher expression of Slug in both epithelial tumors
(p=0.016) and spindle cell tumors (p=0.041) than in normal skin (Figure 4.6). The difference between Slug expression in the epithelial tumors versus the spindle tumors was also significant (p=0.052). In contrast to Slug expression, Snail expression in wild type tumors was higher in spindle cell tumors than in epithelial tumors (Figure 4.6). There was significantly increased Snail expression in both the wild type (p=0.0093) and knockout
(p=0.0295) spindle cell tumors compared to epithelial tumors in the same genotype.
121 There was also significantly higher Snail expression in knockout epithelial tumors than in wild type epithelial tumors (p=0.031), and there was significantly more Snail in the knockout spindle cell tumors than in normal skin from the knockout mice (p=0.045).
There was no difference in Snail expression between normal skin from the wild type and either the epithelial or the spindle cell tumors from these mice.
4.4.5 Expression of Slug and Snail Targets
Slug has been reported to repress keratin 8 expression in a mammary epithelial cell line (Tripathi et al, 2005) and keratin 8 is aberrantly expressed in the epidermis of
Slug knockout mice (manuscript in submission). In keeping with these reports, keratin 8 mRNA expression was minimal in the normal skin of wild type mice and significantly higher (p = 0.046) in the normal skin of knockout mice (Figure 4.7). Keratin 8 expression was also significantly higher in knockout epithelial tumors (p=0.0011) and spindle cell tumors (p=0.0215) compared to the same tumor types from the wild type mice. There was no significant difference in keratin 8 expression among normal skin, epithelial tumors, and spindle cell tumors of knockout mice. Although keratin 8 expression has been reported to be a marker of skin tumor progression in UVR-induced murine skin tumors (Larcher et al, 1992), we observed that keratin 8 expression levels in the wild type epithelial tumors and the spindle tumors were significantly lower (p=0.00846 and 0.0002, respectively) than expression in normal skin. Additionally, there was significantly less keratin 8 in the wild type spindle cell tumors than in the wild type epithelial tumors
(p=0.0196).
E-cadherin has been reported to be a target of transcriptional repression by both
Slug and Snail (Bolos et al, 2003; Cano et al, 2000). As expected in tumors expressing
122 high levels of Snail, there was significantly lower E-cadherin expression in the spindle cell tumors from the wild type mice as compared to normal skin (p=0.0056) or epithelial tumors (p=0.0003). However, the same difference was not seen in spindle cell tumors from knockout mice. E-cadherin expression did not change significantly from normal in either the epithelial or spindle cell knockout tumors. Moreover, there was significantly higher E-cadherin expression in spindle cell tumors from the knockout mice as compared to those from wild type mice (p=0.029) (Figure 4.7). Thus, in the absence of Slug expression, even elevated levels of Snail were unable to significantly suppress E-cadherin expression in spindle cell tumors. These findings suggested that spindle cell tumors in wild type mice had a more mesenchymal phenotype than morphologically similar tumors in Slug knockout mice.
In both the Slug knockout mice and wild type mice, there was significantly lower vimentin expression in epithelial tumors compared to normal skin (p=0.007 and p=0.033, respectively) (Figure 4.7). Additionally, in the knockout mice there was significantly less vimentin in the spindle tumors as compared to the normal skin (p=0.0298). In both the wild type and knockout mice, spindle cell tumors expressed significantly more vimentin than did the epithelial tumors in the same genotype (p=8.35 x 10-05 and p=0.0377, respectively), as expected if these spindle cell tumors have a more mesenchymal phenotype . However, vimentin expression did not differ significantly between the two genotypes in normal skin, epithelial tumors, or spindle cell tumors. Thus, levels of vimentin expression did not support a difference between wild type and Slug knockout tumors in the mesenchymal character of the spindle cell tumors.
123 MMP-2 has been shown by to be induced by Snail (Yokoyama et al, 2003;
Miyoshi et al, 2004) and that finding was corroborated by this study (Figure 4.7). In the both the wild type and knockout tumors, there was higher MMP-2 expression in the spindle cell tumors than in the epithelial tumors (p=0.019 and p=0.051, respectively). In addition, both epithelial and spindle cell tumors from wild type mice had higher MMP-2 expression than those from knockout mice; for epithelial tumors, this difference was significant (p = 0.021). These findings suggested that Slug also contributed to MMP-2 expression in wild type tumors.
4.4.6 Immunohistochemical Characterization of the Spindle Cell Tumors
Spindle cell tumors arising in Slug knockout mice demonstrated somewhat stronger immunoreactivity for the epithelial markers keratin 8, keratin 14, and E-cadherin than wild type spindle cell tumors (Figure 4.8). In normal skin, E-cadherin staining was localized to the cell membrane; however, in all of the spindle cell tumors, E-cadherin staining was cytoplasmic, indicating a redistribution of E-cadherin in these neoplastic cells. Surprisingly, given the elevated keratin 8 mRNA expression in the normal skin and tumors of Slug knockout mice, immunohistochemical staining for keratin 8 was comparable in the spindle cell tumors of the two genotypes. This suggests that levels of keratin 8 protein in the tumors may be regulated by mechanisms other than transcriptional control. Detection of the proliferation marker Ki67 demonstrated slightly fewer proliferating cells in the Slug knockout spindle cell tumors than in the wild type tumors.
124 4.5 Discussion
4.5.1 Slug and Epidermal Proliferation
Increases in skin thickness prior to approximately 6 weeks of UVR exposure reflected UVR-induced dermal edema and inflammation, while later changes reflected both epidermal and dermal changes. Our findings suggested a decreased proliferative response of Slug knockout epidermis to chronic UVR exposure compared to wild type epidermis. This decrease was unexpected, as Snail has been shown to block cell cycle progression by repressing cyclin D transcription (Turner et al, 2006) and overexpression of Slug in keratinocytes in vitro results in decreased proliferation without changes in cyclin D expression (Turner et al, 2006). Our recent work however, demonstrated decreased expression of cyclin D2, cyclin G2, and epithelial mitogen in untreated Slug knockout epidermis, as compared to untreated wild type epidermis (manuscript in preparation). Our findings in the previous study and this study, taken together, suggest that Slug expression is required for a robust proliferative epidermal response to UVR.
4.5.2 Slug and Cutaneous Inflammation
The present studies demonstrate decreased cutaneous inflammation in the skin of
Slug knockout mice chronically exposed to UVR, as evidenced by significantly fewer
CD3 positive cells in the dermis of the knockout mice. In humans, inflammation has been shown to drive the conversion of actinic keratosis to SCC (Halliday, 2005). Chronic
UVR exposure causes constitutive induction of cyclooxygenase 2 (COX-2) in the skin which results in increases in prostaglandin E2 (PGE2), inflammation, and reactive oxygen intermediates (Wilgus et al, 2003). PGE2 can act as a tumor promoter by contributing to the uncontrolled proliferation of damaged cells (Wilgus et al, 2003). High levels of
125 COX-2 expression have been associated with more aggressive tumors, and oral or topical
COX-2 inhibitors protect against skin tumor development in UVR-exposed mice (Wilgus et al, 2003). The cancer preventive effect of COX-2 inhibition may be due to decreased
UVR-induced inflammation or to enhanced apoptosis of UVR-damaged keratinocytes, since PGE2 is required for the growth of skin tumor cells (Halliday, 2005).
The finding of increased dermal mast cells following chronic UVR exposure has been previously reported in mice (Clydesdale et al, 2001). The functional significance of increased mast cells following chronic UVR-exposure is still unclear. Hart et al. (1998) showed a direct correlation between the number of dermal mast cells and the degree of
UVR-associated immunosuppression. It is hypothesized that these increased numbers of mast cells and subsequent immunosuppression would allow the development of skin tumors, however, no relationship has been identified between the number of mast cells and the incidence of skin tumors (Grimbaldeston et al, 2006).
4.5.3 Slug and Skin Carcinogenesis
The expression of detectable levels of various keratins and E-cadherin in the spindle cell tumors in this study suggested that they were of epithelial origin, as proposed by other investigators (Pons et al, 2005). The occurrence of a similar variety of tumor types in both Slug knockout and wild type mice indicated that Slug was not required for tumor development or progression. However, Slug knockout mice had a consistently lower tumor burden than wild type mice and there was a tendency for the knockout mice to develop less aggressive tumor types, as demonstrated by a higher proportion of benign tumors. Spindle cell tumors in wild type mice had a more mesenchymal phenotype than
126 spindle cell tumors in Slug knockout mice. This suggested that Slug expression in wild type tumors enhanced EMT in response to chronic UVR exposure.
In wild type mice, Slug expression was higher in epithelial tumors than in spindle cell tumors, while Snail expression was higher in the more aggressive spindle tumors.
This finding supports the findings of Kurrey et al. (2005) who reported that Slug was effective in triggering EMT but that maintenance of EMT required continuous Snail expression (Kurrey et al, 2005). In the epithelial ovarian cancer cell line, SKOV3, Slug suppressed expression of adherens junction components (E-cadherin and β-catenin), tight junction components (occludin and ZO-1), and desmosomal junction components
(desmoglein 2), while Snail only suppressed expression of adherens and tight junction components. Furthermore, Slug expression preceded Snail expression in response to hypoxic conditions. Savagner et al. (1997) found that Slug induced the first phase of growth factor-induced EMT, including desmosome dissociation, cell spreading, and initiation of cell separation in a rat bladder carcinoma cell line (NBT-II) (Savagner et al,
1997). However, Slug alone was not able to induce the second phase of EMT, which included enhanced cell motility, repression of cytokeratin expression and activation of vimentin expression. In the present study, significantly increased Snail expression in the epithelial tumors of Slug knockout mice compared to wild type mice suggested that Snail expression might have substituted for enhanced Slug expression in driving evolution of epithelial tumors to a more aggressive phenotype.
Decreased UVR-induced epidermal proliferation in Slug knockout skin may have contributed to the development of fewer tumors, smaller tumors and less aggressive
127 tumors in the knockout mice than in the wild type mice, as decreased epidermal proliferation would decrease the potential to accumulate mutations contributing to tumor progression. The decreased tumor number and median grade in Slug knockout mice chronically exposed to UVR may also have been due, at least in part, to decreased chronic inflammation.
4.5.4 Slug Targets During EMT in Skin Tumors
E-cadherin is a cell-cell adhesion molecule which complexes with the actin cytoskeleton via cytoplasmic catenins to form and maintain intercellular junctions and polarization of epithelial cells (Yokoyama et al, 2001; Poser et al, 2001). Disruption of
E-cadherin-mediated cell adhesion commonly occurs during the transition from non- invasive tumors to invasive malignant carcinomas (Birchmeier et al, 1994; Perl et al,
1998). Decreased E-cadherin expression is a hallmark of EMT (Conacci-Sorrell et al,
2003). Both Slug and Snail have been shown to repress E-cadherin expression and induce EMT (Bolos et al, 2003; Cano et al, 2000; Savagner et al, 1997). In the present studies, E-cadherin expression at both the RNA and protein levels were lower in the spindle cell tumors than in the epithelial tumors from wild type mice, but not in tumors from the Slug knockout mice. The finding of persistent E-cadherin expression in spindle cell tumors from the Slug knockout mice is consistent with the role of Slug in repressing
E-cadherin expression and fostering EMT. This finding suggests that although the spindle cell tumors in the two genotypes were morphologically similar, spindle cell tumors in the Slug knockout mice maintained a more epithelial expression profile than those in wild type mice. Thus EMT was impaired in UVR-induced skin tumors in Slug knockout mice.
128 MMP expression has also been strongly linked with EMT and carcinoma progression driven by Snail family transcription factors. Transfection of hepatocellular carcinoma cell lines with Snail increased expression of MMP-1, MMP-2, MMP-7 and
MT1-MMP, decreased E-cadherin expression, and enhanced tumor invasive activity
(Miyoshi et al, 2004). In another study, human oral SCC cells transfected with Snail developed a mesenchymal phenotype, increased invasive behavior, de novo expression of vimentin, and high levels of MMP-2 activity (Yokoyama et al, 2003). Moreover, overexpression of MMP-2 has been demonstrated in stromal and neoplastic cells near the invasive front of a neoplasm, a site of EMT (Sier et al, 1996; Kuniyasu et al, 2000). Our study found that MMP-2 expression was greatest in the spindle cell tumors of both wild type and Slug knockout mice; however, MMP-2 was significantly higher in wild type spindle cell tumors than in Slug knockout tumors. This finding was consistent with impaired EMT in Slug knockout mice as suggested by E-cadherin findings.
Loss of keratin expression accompanied by de novo expression of vimentin is a further characteristic of EMT in carcinomas. In the present studies, vimentin expression was higher in both the wild type and knockout spindle cell tumors than in the epithelial tumors. In the absence of Slug, there was significantly less vimentin in the spindle cell tumors, supporting the conclusion that EMT was impaired in Slug knockout tumors. We saw markedly elevated keratin 8 transcription in the skin and skin tumors of Slug knockout mice compared to wild type mice, however, this difference was not reflected in altered immunohistochemical staining for keratin 8 in spindle cell tumors. In general keratin 8 expression is regarded as a marker of tumor progression, since keratin 8 is not normally expressed in the adult epidermis, but is often aberrantly expressed in squamous
129 cell carcinomas (Hendrix et al, 1996; Larcher et al, 1992; Oshima et al, 1996).
Moreover, expression of exogenous keratin 8 in a variety of cell lines results in anchorage-independent growth, shortened doubling times, increased invasive and migratory capabilities (Chu et al, 1996), and apoptosis resistance in vitro (Gilbert et al,
2001), as well as enhanced metastasis in vivo (Raul et al, 2004). Based on these considerations, the implications of enhanced keratin 8 transcription in Slug knockout tumors are unclear.
130
Figure 4.1: Histologic Appearance of Tumors. (A, D) Hyperplasia. (B, E) Papilloma.
(C, F) Micro-invasive squamous cell carcinoma. (G, J) Squamous cell carcinoma. (H, K)
Spindle cell tumor. (I, L) Anaplastic tumor. Bar = 300 um (A, B, C, G, H, I); Bar =
75um (D, E, F, J, K, L).
131
Continued
Figure 4.2: Inflammatory Cells in Chronically UVR-Exposed Non-Tumor Skin.
132 Figure 4.2 continued. (A) Neutrophil infiltrates. There were markedly increased numbers of neutrophils in the chronically exposed epidermis, as compared to the unexposed epidermis. There was no difference in the number of neutrophils between the wild type (WT) and Slug knockout (KO) mice. (B) Dermal mast cell counts. Increased numbers of dermal mast cells were present following chronic UVR exposure. There were significantly more mast cells in the chronically-exposed KO skin, as compared to the WT skin. (C) Dermal CD3 positive cells. Increased numbers of CD3 positive cells were present in the dermis following chronic UVR exposure. There were significantly fewer CD3 positive cells in the chronically-exposed KO skin, as compared to the WT skin.
133
Figure 4.3: Tumor Onset. There was no difference in the time to tumor onset between the wild type (WT) and Slug knockout (KO) mice.
134
Figure 4.4: Tumor Burden. Total tumor area per mouse per week was calculated for each genotype. * p < 0.05.
135
Figure 4.5: Distribution of tumor types. Percentage of each tumor type that occurred in each genotype. There was a tendency for the knockout mice to develop less aggressive tumor types.
136
Figure 4.6: Expression of Slug and Snail. Quantitative RT-PCR analysis of normal skin (basal), epithelial tumors, and spindle cell tumors from wild type (WT) and Slug knockout (KO) mice. (A) Slug. Expression of Slug was not evaluated in the Slug KO mice. For comparison to basal expression * p < 0.05. For comparison between epithelial and spindle cell tumors ** p < 0.05. (B) Snail. For clarity of presentation, the asterisk represents significant associations between the WT and KO, for significant associations with the genotypes, refer to the text. * p < 0.05.
137
Continued
Figure 4.7 Expression of Slug and Snail Targets.
138 Continued Figure 4.7
Figure 4.7: Expression of Slug and Snail Targets. Quantitative RT-PCR analysis of normal skin (basal), epithelial tumors, and spindle cell tumors from wild type (WT) and
Slug knockout (KO) mice. (A) Keratin 8 (B) E-cadherin (C) Vimentin (D) MMP-2. For clarity of presentation, the asterisk represents significant associations between the WT and KO, for significant associations with the genotypes, refer to the text. * p < 0.05; ** p
< 0.005.
139
Figure 4.8: Immunohistochemical Characterization of Spindle Cell Tumors. Data represents the average grade of immunohistochemical staining in both with wild type
(WT) and Slug knockout (KO) spindle cell tumors. KO spindle cell tumors had decreased Ki67 staining, and increased staining for keratins 8 and 14 (K8 and K14) and
E-cadherin (E-cad).
140
Gene Forward sequence Reverse sequence
GAPDH TGATGACATCAAGAAGGTGAAC ATGGCCTTACATGGCCTCCAAGG
Slug GATGTGCCCTCAGGTTTGAT ACACATTGCCTTGTGTCTGC
Snail CTCACTGCCAGGACTCCTTC TGTCCAGAGGCTACACCTCA
E-Cadherin GGTCTCTTGTCCCTTCCACA CCTGACCCACACCAAAGTCT
Vimentin AATGCTTCTCTGGCACGTCT GCTCCTGGATCTCTTCATCG
MMP-2 CACCTACACCAAGAACTTCC GAACACAGCCTTCTCCTCCT
Table 4.1: Primer Sequences for Quantitative RT-PCR
141
Genotype Percent of Mice Week of Onset Number of Tumors Tumor area with Tumors1 of First Tumor2 per Mouse3 (mm2) WT 80 42.4 ± 3.8 1.9 ± 1.5 66.9 ± 212.6
KO 72.2 43.5 ± 5.6 1.4 ± 1.5 32.7 ± 64.0
Table 4.2: Basic Tumor Data. Data is represented as average ± standard deviation.
1 Reflects percentage of mice remaining on the study past 35 weeks of exposure that developed skin tumors.
2 Does not include mice that did not develop tumors.
3Includes mice that did not develop tumors.
142 CHAPTER 5
ULTRAVIOLET RADIATION-INDUCED
CORNEAL DEGENERATION IN 129 MICE
5.1 Abstract
Ultraviolet radiation (UVR) is a risk factor for the development of ocular disease in humans, including acute photokeratitis, chronic corneal spheroidal degeneration, and cataract formation. This report describes the ocular lesions seen in twenty-one mice chronically exposed to UVR as part of a skin carcinogenicity study. All globes were affected to varying degrees. The primary lesion, not previously reported in UVR- exposed mice, was marked loss of keratocytes relative to age-matched controls.
Secondary lesions included corneal stromal thinning, keratoconus, corneal vascularization and fibrosis, keratitis, globe rupture, and phthisis bulbi. In addition, more than 90% of UVR-exposed and unexposed lenses had evidence of cataract formation; this is the first report of the occurrence of spontaneous cataracts in 129 mice. In a subsequent study, apoptotic cells were identified histologically and by cleaved caspase 3
143 immunoreactivity in the corneal epithelium and, less commonly, in the corneal stroma after acute UVR exposure. Our data indicate that the loss of keratocytes observed in the chronic study was due to UVR-induced apoptosis.
5.2 Introduction
Exposure to ultraviolet radiation (UVR) is a significant risk factor for ocular disease. Acute UVR exposure in man can cause photokeratitis characterized by apoptosis and exfoliation of the corneal epithelium, formation of punctate ulcers, inflammation, edema, and pain (Cullen, 2002; Young, 2006). Chronic UVR exposure, on the other hand, is associated with spheroidal degeneration of the cornea, which has also been called
Bietti corneal degeneration, Labrador keratopathy, Eskimo corneal degeneration, and elastotic degeneration Clinically, spheroidal corneal degeneration is characterized by homogeneous, translucent, yellowish, spherical lesions (0.1-0.6 mm) in the superficial corneal stroma. Histologically, the superficial cornea contains extracellular spherules thought to represent accumulations of plasma proteins that have diffused into the cornea from the limbal circulation and have been modified by UVR (Magovern et al., 2004).
Lifetime exposure to chronic UVR has been directly associated with the development of cortical cataracts in man, and the World Health Organization has reported that as much as
20% of cataract-associated blindness may be due to UVR exposure. Genetic factors, diabetes, steroid use, and smoking are also strongly associated with cataract formation in humans (Robman and Taylor, 2005).
There are few reports of adverse UVR effects on the mouse eye. In one study, all male albino mice chronically exposed to high doses of UVR for 20 weeks had anterior
144 cortical lens opacities and most developed corneal scarring and vascularization (Jose and
Pitts, 1985; Jose, 1986). With chronic exposure to much lower doses of UVR, mice developed clinically evident posterior lens opacities in the absence of anterior lens opacities or corneal disease after 6-9 mos (Jose, 1986).
In this study we report previously undescribed clinical and histologic lesions in the corneas of 129 mice chronically exposed to UVR, as well as a high incidence of posterior cortical opacities in both unexposed and UVR-exposed mice.
5.3 Materials and Methods
5.3.1 Study Design
Studies were conducted in compliance with all applicable state and national guidelines and were approved by The Ohio State University (OSU) Institutional
Laboratory Animal Care and Use Committee. Twenty-one 129 mice (14 females, 7 males) constituted the control group in a long-term skin carcinogenesis study. Mice were obtained from a breeding colony of 129 mice maintained at OSU from mice originally acquired from Jackson Laboratory (Bar Harbor, ME, USA). Mice were exposed to 3200
J/m2 (2 minimal erythemal doses, MED) of UVR 3 times a week for up to 50 wks. One
MED is the dose required to cause detectable skin thickening. UVR was provided by
Kodacel-filtered Westinghouse FS-40 sunlamps that emitted wavelengths between 280 and 400 nm, with a peak at 313 nm. The emitted light contained approximately 60%
UVB and 40% UVA; UVC wavelengths were removed by Kodacel filters. A single mouse was sacrificed after 9 wks of UVR exposure. Five mice were removed early from the study (38-48 wks of exposure) due to large skin tumor size. One mouse was found
145 dead; the eyes were not examined histologically. A total of 14 mice were alive at the end of the study (50 wks). For comparison, eyes from 13 untreated 129 mice maintained in our breeding colony were examined. Six of these control mice were 10-12 wks old, and 7 of the mice were 13-17 mos of age. In the acute UVR exposure study, adult male and female 129 mice were exposed to a single dose of 4800 J/m2 (3 MED) and sacrificed at
12, 24, 48, 72, and 96 hrs and 1 wk after UVR exposure. Mice were killed by carbon dioxide asphyxiation. Following euthanasia, the globes were removed and fixed in 10% neutral buffered formalin for histologic examination.
5.3.2 Ophthalmic Examination
Eyes were examined using a Zeiss HSO-10 slit lamp (Dublin, CA, USA) and a
Keeler All Pupil indirect ophthalmoscope with a 40 diopter lens (Broomall, PA, USA).
In the chronic UVR exposure study, the first ophthalmic examination was performed when mice had been on study for 36-49 wks. For some mice, repeated examinations were performed to document lesion progression. Six mice that were removed early or died during the study did not receive ophthalmic examinations. In the acute UVR study, selected mice were examined before UVR exposure and immediately prior to euthanasia.
5.3.3 Histology and Immunohistochemistry
Eyes were embedded in paraffin, sectioned at 4-5 µm, and stained with hematoxylin and eosin. For stromal cell counts, all stromal cells within a 200x field of axial cornea were counted. Axial cornea was defined as that portion of the cornea overlying the pupil. Apoptosis was evaluated by immunohistochemical detection of cleaved caspase-3. Slides were deparaffinized and re-hydrated. Antigen retrieval was performed with DakoCytomation Target Retrieval Solution (Carpinteria, CA, USA) and
146 the Biocare Digital Decloaking Chamber (Concord, CA, USA) by heating under pressure to 125o C for 30 sec followed by cooling in the chamber to 90o C and on the bench top for
10 min. Immunohistochemical staining was performed using the Dako Autostainer.
Slides were rinsed with water, then treated for 5 min with 3% hydrogen peroxide and with protein block (DakoCytomation Serum-free Protein Block) for 10 min. Slides were incubated for 30 min with primary antibody (Cell Signaling, Danvers, MA, USA) diluted
1:200 in DakoCytomation Antibody Diluent with Background Reducing Components.
Slides were incubated for 30 min with secondary antibody (Vector biotinylated goat-anti- rabbit antibody; Burlingame, CA, USA) diluted 1:200 in antibody diluent and for 30 min with ABC reagent (Vector R.T.U. Vectastain Elite ABC). Slides were then incubated for
5 min in DakoCytomation Liquid DAB Substrate, counter-stained with hematoxylin, dehydrated, and coverslipped. Rinses were performed using DakoCytomation Wash
Buffer (Tris-Buffered Saline/Tween 20).
5.3.4 Statistical Analysis
Statistical analysis was performed with Prism version 4 software (GraphPad
Software, San Diego, CA, USA). Data were analyzed using one-way analysis of variance
(ANOVA) with Tukey’s post test. A p value of less than 0.05 was deemed statistically significant. All graphs were generated in Prism version 4.
5.4 Results
5.4.1 Chronic UVR Exposure
All mice developed unilateral or bilateral lesions. Corneal abnormalities were noted clinically as early as 31 wks. Repeated slit lamp examination demonstrated
147 progression from corneal stromal cleft formation and stromal thinning to keratoconus with variable degrees of corneal vascularization to corneal perforation, iris prolapse, and phthisis bulbi (Figure 5.1, Figure 5.2A-E). Eleven of the 38 globes examined (29%) ruptured; eye rupture occurred in 9 of 21 mice (43%).
Posterior and, less commonly, anterior cortical cataracts were noted both in older unexposed mice and in chronically UVR-exposed mice. In some mice, repeated slit lamp examination demonstrated progression from no detectable cataract to a detectable posterior cataract (Figure 5.2F).
Microscopically, corneal lesions were characterized primarily by mild to marked hypocellularity of the corneal stroma, accompanied by coagulation necrosis and liquefaction of stromal collagen. Stromal thinning and, rarely, stromal cleft formation were also observed (Figure 5.3B,C). Hyperplasia or dysplasia of the corneal epithelium was occasionally seen. As observed by slit lamp examination, corneal lesions often progressed to rupture of the globe with iris prolapse and phthisis bulbi. Five of 21 mice
(24%) had corneal fibrosis, vascularization, and inflammation (Figure 5.3D). Mice whose corneal lesions were characterized only by loss of keratocytes often had normal slit lamp examinations.
Examination of the eyes of unexposed mice revealed a significant age-dependent loss of keratocytes. Mice 10-12 wks old averaged 95 stromal cells per 200x field of axial cornea, while mice 13-17 mos old averaged 59 stromal cells per 200x field of axial cornea (Figure 5.4). The difference in the number of stromal cells between the 10-12 wk- old and 13-17 mos old unexposed mice was significant (p < 0.001). Chronically UVR- exposed mice averaged 18 stromal cells per 200x field of axial cornea; this was
148 significantly fewer than in age-matched unexposed mice (p<0.001) or young unexposed mice (p < 0.001) (Figure 5.4). The mouse that was exposed to 9 wks of UVR had 44.5 stromal cells per 200x field of axial cornea. This suggested that as few as 9 wks of UVR was sufficient to markedly decrease the number of stromal cells.
Cataracts identified by slit lamp examination in both UVR-exposed and unexposed mice were confirmed histologically in all cases. In some cases, cataracts were seen histologically that were not identified clinically. This discrepancy was due, in part, to the difficulties involved in evaluating the eyes of non-anesthetized mice and the severity of corneal disease. Of the lenses examined microscopically, 92% of UVR- exposed lenses and 93% of unexposed lenses had evidence of cataract formation.
Cataracts were characterized by minimal to moderate swelling and degeneration of lens fibers at the posterior pole and, in some cases, by vacuolation of nucleated lens fibers at the equator (Figure 5.5C, D). There was evidence of posterior migration of lens epithelial cells in only 3 globes, from 3 different UVR-exposed mice. In these eyes, there was global lens fiber degeneration, as well as hyperplasia, metaplasia, and posterior migration of the lens epithelial cells (Figure 5.5E, F). This type of cataract was associated with either a ruptured cornea or severe corneal fibrosis and inflammation. Such cataracts likely developed in response to inflammatory mediators in the aqueous humor, rather than in response to UVR exposure alone. Eyes from the mouse that was exposed to UVR for only 9 wks were not examined with the slit lamp, but microscopically there was minimal posterior cataract formation in one eye. The presence of minimal lens fiber
149 degeneration after 9 wks of UVR exposure suggested that mice that did not have clinical evidence of cataract prior to 47 wks may have had histologically apparent cataractous changes too mild to be visualized by slit lamp.
5.4.2 Acute UVR Exposure
All eyes were grossly normal, without evidence of corneal edema, ulceration, or keratitis at any time point following a single UVR dose of 3 MED. There were no significant differences from unexposed eyes in the number of stromal cells at any time point following acute UVR exposure (data not shown).
Occasional apoptotic corneal epithelial cells and rare apoptotic corneal stromal cells were apparent histologically, but there was no histologic evidence of corneal ulceration or keratitis at any time point. Cleaved caspase 3 immunostaining was positive in the corneal epithelium at 12, 24, and 48 hrs post-UVR exposure (Figure 5.6A). Rarely, cleaved caspase 3 staining was noted in stromal cells (Figure 5.6B). The number of cleaved caspase 3-positive apoptotic epithelial cells in UVR-exposed eyes peaked at 24 hrs and was significantly higher than the number in unirradiated eyes (p < 0.01) or in
UVR-exposed eyes at 72 hrs after exposure (p < 0.05) (Figure 5.7). Vacuolation of equatorial lens fibers was apparent in a few lenses, but no cataracts were apparent at 1 wk after a single dose of 3 MED UVR.
5.5 Discussion
Keratocytes function in maintaining corneal transparency, as well as structural stromal stability, by regulating collagen fibril size and spacing within the proteoglycan matrix (Kallinikos and Efron, 2004). In this study, we report both age-related and UVR- 150 induced loss of corneal stromal cells. Age-related loss of keratocytes has been reported in humans (Moller-Pedersen, 1997), but has not previously been reported in other species. Loss of keratocytes in the anterior stroma is commonly seen following corneal de-epithelialization (Campos et al., 1994; Szerenyo et al., 1994; Ivarsen et al., 2004), and exposing the de-epithelialized rabbit cornea to UVR results in full thickness loss of keratocytes (Podskochy, 2004). The mechanism of this phenomenon is controversial.
Some authors suggest that exposure of the de-epithelialized cornea to tears is sufficient to induce keratocytes apoptosis in mice (Zhao et al., 2001). Others suggest that cytokines and other mediators, such as FasL, from the injured epithelium mediate the apoptosis
(Podskochy and Fagerholm, 2002). Additional suggested etiologies include altered glucose metabolism and osmotic factors (Zhao et al., 2001). In the present study, however, there was no evidence of corneal ulceration at any time following UVR that could explain the observed loss of keratocytes.
Podskochy et al. (2000) have shown that UVB focused on the center of the un- wounded cornea of an anesthetized rabbit resulted in full thickness corneal damage with apoptosis of corneal epithelium, keratocytes, and corneal endothelial cells. Apoptosis of corneal epithelial cells, visualized by TUNEL staining, peaked at 24 hrs post-UVR, as was seen in the current study; by 72 hrs post-exposure, keratocytes were completely absent from the exposed region of the cornea (Podskochy et al., 2000). By 7 days there was almost complete repopulation of the injured stroma by new keratocytes (Podskochy and Fagerholm, 1998). Also consistent with the present study, Podskochy et al. (2000) reported that there was no inflammation in the cornea at any time during following UVR exposure. The corneal epithelial apoptosis detected by TUNEL was confirmed by
151 electron microscopy, and it was found to correlate with de novo FasL expression by keratocytes. IL-1 from injured corneal epithelium may induce FasL expression by keratocytes (Podskochy and Fagerholm, 2002). Alternatively, FasL expression in keratocytes may be induced by UVR (Podskochy and Fagerholm, 2002).
Loss of keratocytes has also been reported in humans following contact lens usage and is hypothesized to be due to apoptosis mediated by cytokines, growth factors, and other inflammatory mediators released by contact lens–induced trauma to the corneal epithelium (Kallinikos and Ephron, 2004). In support of this theory, rubbing of the eye exacerbates the loss of keratocytes. UVR-induced apoptosis of corneal epithelial cells demonstrated in our study and by others could have resulted in the prolonged release of mediators that were responsible for the continued apoptosis and loss of keratocytes seen in this study. Continued UVR exposure may have prevented replacement of stromal keratocytes. Because one of the key functions of keratocytes is to synthesize and maintain stromal collagen, loss of keratocytes would result in decreased collagen production of collagen in the face of normal collagen turnover, resulting in a net loss of stromal collagen and subsequent corneal thinning. UVR has also been shown to induce the production of matrix metalloproteinases (MMP) by the corneal epithelium in dogs and humans (Kozak et al., 2003). UVR- induced MMPs are thought to contribute to the pathogenesis of photokeratitis in both species. UVR induction of MMPs in the current study may have contributed to the degradation and loss of the corneal stroma, and further investigation of the role of MMPs in the development of these lesions is warranted.
Although there was no histologic evidence of inflammatory cell infiltrates in the eyes of
152 mice described in the present study, other researchers have reported that phagocytes are occasionally apparent by transmission electron microscopy. These inapparent phagocytes may remove degenerate collagen and contribute to the stromal thinning.
Since cataracts occurred in both the unexposed and UVR-exposed mice, they were likely age-related and not UVR-induced; however, it is likely that UVR exacerbated and accelerated cataract formation. Since the corneal stroma is known to absorb UVB
(Podskochy, 2004), the loss of corneal stroma might allow greater amounts of UVB to reach the lens. Cataracts in the present study were characterized by variable degrees of posterior cortical lens fiber degeneration and swelling without changes in the lens epithelial cells. In globes with severe inflammation, cataracts were characterized by global lens fiber degeneration and swelling with proliferation, metaplasia and posterior migration of the lens epithelial cells. Interestingly, in a report by Jose and Pitts, cataracts in male albino mice exposed to very high doses of UVR were characterized primarily by proliferation, metaplasia, and posterior migration of the lens epithelial cells with disruption of adjacent cortical fibers (Jose and Pitts, 1985). Thus, the UVR dose and degree of direct ocular damage may determine the character of the cataracts that develop.
This is the first report of age-related loss of keratocytes in a non-human species, and the first report of cataracts in 129 mice. Recognition of these changes is essential to interpretation of ocular lesions in aged mice. This is also the first report describing corneal degeneration induced by chronic UVR exposure in mice. This unique lesion was characterized primarily by loss of keratocytes and subsequent degeneration and loss of
153 the corneal stroma and was often complicated by secondary inflammation or globe rupture. Although the exact pathogenesis of corneal degeneration remains unclear, the lesion is clearly UVR-induced.
154
Figure 5.1: Gross Images of 129 Mouse Eyes. (A) Normal eye from a 10-12 wk old non-UV-exposed mouse. Images B-D represent mice following chronic UVR exposure
(B) Keratoconus. (C) Corneal perforation and iris. (D) Phthisis.
155
Continued
Figure 5.2: Slit Lamp Images of 129 Mouse Eyes. (A) Normal eye from a 10-12 wk old non-UV-exposed mouse. 156 Figure 5.2 continued. Images B-F represent mice following chronic UVR exposure. (B) Axial corneal stromal thinning. (C, D) Corneal stromal cleft. (E) Corneal stromal thinning, cleft formation and vascularization. (F) Retroillumination demonstrating posterior cortical vacuoles and cataract formation.
157
Figure 5.3: Histopathology of the Corneas of 129 Mice (hematoxylin & eosin stain).
(A) Normal cornea from a 10-12 wk old mouse not exposed to UVR (scale bar: 30 µm).
Images B-D represent mice following chronic UVR exposure. (B) Diffuse loss of corneal stromal cells (scale bar: 30 µm). (C) Loss of corneal stromal cells and cleft formation
(scale bar: 30 µm). (D) Keratoconus with cornea markedly thickened by fibrosis, neovascularization, and a mixed inflammatory infiltrate (scale bar: 100 µm).
158
Figure 5.4: Keratocyte Numbers in the Corneas of 129 Mice. Asterisks indicate significant differences (p < 0.001) from young (10-12 wk-old) unexposed mice. Old (1 yr-old) UVR-exposed mice also had significantly fewer keratocytes than old (1 yr-old/
13-17mos) unexposed mice (p < 0.001).
159
Continued
Figure 5.5: Histopathology of the Lens of 129 Mice (hematoxylin & eosin stain). (A)
Normal lens equator from a 10-12 wk old non-UVR-exposed mouse (scale bar: 30 µm).
160 Figure 5.5 continued. (B) Normal posterior cortex of the lens from a 10-12 wk old non-UVR-exposed mouse (scale bar: 30 µm). (C) Vacuolization of the equator of the lens, as seen in some old and UVR-exposed mice (scale bar: 30 µm). (D) Lens fiber swelling and degeneration in the posterior cortex of the lens of old and UVR-exposed mice (scale bar: 30 µm). (E) Proliferation and metaplasia of lens epithelial cells at the equator, as seen in some chronically-UVR-exposed mice with keratoconus or globe rupture (scale bar: 30 µm). (F) Posterior migration of lens epithelial cells to the posterior cortex of the lens, with associated lens fiber degeneration and swelling, as seen in some chronically-UVR-exposed mice with keratoconus or globe rupture (scale bar: 30 µm).
161
Figure 5.6 . Immunohistochemistry for Cleaved Caspase 3 to Demonstrate Apoptotic
Cells in 129 Mice 24 hrs After Exposure to UVR. (A) Positive cells in the corneal epithelium (scale bar: 10 µm). (B) Rare positive cell in the corneal stroma (arrow) (scale bar: 10 µm).
162
Figure 5.7: Cleaved Caspase 3-positive Epithelial Cells in the Corneas of Mice
Exposed to 3 MED UVR. The asterisk indicates a significant difference in mean compared to unirradiated eyes (p < 0.01) and UVR-exposed eyes at 72 hrs after exposure
(p < 0.05).
163 CHAPTER 6
CONCLUSIONS
Slug is a member of the Snail family of zinc-finger transcription factors and has been implicated in a wide range of processes, including development, tissue morphogenesis, tumor progression and epithelial-mesenchymal transformation (EMT).
During development, the process of EMT involves the loss of cell: cell adhesion mediated by desmosomes and adherens junctions, increased secretion of extracellular matrix-degrading proteases, enhanced motility, loss of cytokeratin expression, and de novo expression of vimentin. Slug expression during development facilitates the release of cells from epithelial structures allowing them to migrate (Makinen and Stenback,
1998). Little is known about Slug expression and its function in normal adult tissue; however a role for Slug in the skin was suggested by our previous observations of Slug expression in normal murine keratinocytes and Slug induction at wound margins.
To study the impact of Slug in normal skin, we compared patterns of gene expression in epidermis from Slug null and wild type mice. In the Slug null mice, the zinc finger region of the Slug gene has been replaced by a β-galactosidase gene, resulting in the formation of a Slug-β-galactosidase fusion protein (Jiang et al, 1998). The Slug portion of this protein is non-functional since it lacks the zinc finger region; however the
164 β-galactosidase portion is fully functional. We employed a novel technique to specifically isolate epidermal cells; RNA harvested from these cells was used for comparative microarray analyses. A total of 139 genes had significantly increased and
109 genes had significantly decreased expression in Slug knockout epidermis. Previously known downstream targets of the Snail family included E-cadherin, Aromatase,
Aggrecan, Collagen II, Claudin, Occludin, Na,K-ATPase β1 subunit, Keratin 8 and
Keratin 19 (Come et al, 2004; Tripathi et al, BBRC 2005). Our study helped identify more putative targets of Snail, including Keratin 18, Gli-1, Gli2, periostin, and TIMP-3.
Functional classification of genes with altered expression was consistent with a role for
Slug in keratinocyte development and differentiation, proliferation, apoptosis, adhesion, motility, as well as angiogenesis and response to environmental stimuli. These functional categories all have important implications for skin homeostasis, wound healing, and carcinogenesis.
We then investigated the role of Slug in the response to ultraviolet radiation
(UVR). Although Slug expression is induced in murine epidermal cells following exposure to UVR both in vitro and in vivo (Hudson et al, 2007), the role of Slug in either the acute or chronic response to UVR had not previously been evaluated. We found a marked difference in the acute cutaneous responses of Slug knockout and wild type mice to UVR. Although the extent of direct UVR-induced DNA damage was similar in both genotypes, Slug knockout mice did not develop the hallmarks of sunburn - erythema, skin peeling, and increase in skin thickness - seen in wild type mice. Slug knockout mice had markedly reduced dermal neutrophil infiltrates at all time points post-UVR compared to wild type mice. The attenuated neutrophilic responses seen in the knockout mice could
165 be explained, at least in part, by differences in the pattern of cytokine induction following a single dose of UVR. Most cytokines had delayed and sometimes exaggerated expression in the knockout mice, compared to the wild type mice. Decreased expression of IL-1β, CXCL2, and CXCL4 could account for the impaired neutrophil response in the
Slug knockout mice. Additionally, knockout mice demonstrated reduced epidermal hyperplasia in response to UVR. There were no consistent differences in markers of apoptosis, p53 protein stabilization or cleaved caspase 3 expression, between the genotypes. These findings indicated an important role for Slug in the acute inflammatory and proliferative responses of the skin to UVR exposure. However, Slug did not appear to influence UVR-induced apoptosis, despite the fact that Slug is anti-apoptotic in other cell types.
Having identified a role for Slug in the acute inflammatory response to UVR, we evaluated the role of Slug in the carcinogenic response to chronic UVR exposure. Slug null mice consistently had less cutaneous inflammation, less epidermal proliferation, and a lower tumor burden than wild type mice. Furthermore, the knockout mice had a tendency to develop fewer aggressive spindle cell tumors, believed to arise from squamous cell carcinomas that have undergone EMT, than wild type mice. Using quantitative RT-PCR and immunohistochemistry, we showed that the spindle cell tumors in the Slug knockout mice demonstrated impaired EMT, as shown by decreased vimentin and increased E-cadherin expression. Impaired EMT in these tumors suggested reduced invasive or metastatic capabilities; however, in this study, no metastases were observed in either the wild type of Slug knockout mice. This study confirmed a role for Slug in skin
166 carcinogenesis and EMT, but demonstrated that Slug is not required for the development or progression of UVR-induced skin tumors Moreover, this was the first study to test directly the contribution of Slug to de novo tumor development in vivo.
Inflammation can contribute to tumor development and progression by eliciting the production of growth and survival factors, increased angiogenesis, increased DNA damage, remodeling of the extracellular matrix, and evasion of the host immune response
(Coussens and Werb, 2002). The combination of UVR-induced inflammation, DNA mutation, and immunosuppression result in the formation of cutaneous neoplasms
(Halliday, 2005). Decreased or impaired expression of various inflammatory mediators following cutaneous UVR exposure in Slug null mice, the reduced proliferative response of epidermis of these mice, and impaired EMT in these mice likely contributed to their decreased tumor burden and the occurrence of fewer aggressive tumors.
In humans, UVR is a well-known risk factor for the development of ocular disease in humans, including acute photokeratitis, chronic corneal spheroidal degeneration, and cataract formation. During the UVR carcinogenesis study described above, we identified a previously unreported condition of UVR-induced corneal degeneration in wild type mice. There was a 100% incidence of this lesion in UVR- exposed wild type mice. The primary lesion was marked loss of keratocytes relative to age-matched controls. Our studies suggested that this loss of keratocytes was due to
UVR-induced keratocyte apoptosis. Secondary lesions included corneal stromal thinning, keratoconus, corneal vascularization and fibrosis, keratitis, globe rupture, and
167 phthisis bulbi. In addition, more than 90% of the lenses of aged UVR-exposed and unexposed wild type mice had evidence of cataract formation; this is the first report of the occurrence of spontaneous cataracts in 129 mice.
Overall, our studies have demonstrated unexpected roles for Slug in epidermal homeostasis and the cutaneous inflammatory response and provided evidence for the role of Slug in skin carcinogenesis. Thus Slug makes important contributions to normal skin differentiation and to the cutaneous response to the environment. Future studies will be required to determine the precise mechanisms by which Slug exerts its effects in the skin.
168 LIST OF REFERENCES
Adolphe C, Hetherington R, Ellis T, Wainwright B (2006). Patched1 functions as a gatekeeper by promoting cell cycle progression. Cancer Res 66: 2081-2088.
Alibardi L, Tschachler E, Eckhart L (2005). Distribution of caspase-14 in epidermis and hair follicles is evolutionarily conserved among mammals. Anat Rec A Discov Mol Cell Evol Biol 286: 962-973.
Alnouti Y, Klaassen CD (2006). Tissue distribution and ontogeny of sulfotransferase enzymes in mice. Toxicol Sci 93: 242-255.
Arredondo J, Chernyavsky AI, Webber RJ, Grando SA (2005). Biological effects of SLURP-1 on human keratinocytes. J Invest Dermatol 125: 1236-1241.
Bachelder RE, Yoon SO, Franci C, de Herreros AG, Mercurio AM (2005). Glycogen synthase kinase-3 is an endogenous inhibitor of Snail transcription: implications for the epithelial-mesenchymal transition. J Cell Biol 168: 29-33.
Baldwin ME, Catimel B, Nice EC, Roufail S, Hall NE, Stenvers KL, Karkkainen MJ, Alitalo K, Stacker SA, Achen MG (2001). The specificity of receptor binding by vascular endothelial growth factor-D is different in mouse and man. J Biol Chem 276: 19166-19171.
Barrallo-Gimeno A, Nieto MA (2005). The Snail genes as inducers of cell movement and survival: implications in development and cancer. Development 132: 3151-3161.
Batlle E, Sancho E, Franci C, Dominguez D, Monfar M, Baulida J, Garcia De Herreros A. (2000). The transcription factor Snail is a repressor of E-cadherin gene expression in epithelilal tumour cells. Nat Cell Biol 2: 84-89.
Bellovin DI, Simpson KJ, Danilov T, Maynard E, Rimm DL, Oettgen P, Mercurio AM (2006). Reciprocal regulation of RhoA and RhoC characterizes the EMT and identifieds RhoC as a prognostic marker of colon carcinomas. Oncogene 25: 6959- 6967.
Birchmeier W (2005). Cell adhesion and signal transduction in cancer. EMBO reports 6: 413-417.
169 Birchmeier W, Behrens J (1994). Cadherin expression in carcinomas: role in the formation of cell junctions and the prevention of invasiveness. Biochim Biophys Acta 1198: 11-26.
Blanco MJ, Moreno-Bueno G, Sarrio D, Locascio A, Cano A, Palacios J, Nieto MA (2002). Correlation of snail expression with histological grade and lymph node status in breast carcinomas. Oncogene 21: 3241-3246.
Bolos V, Peinado H, Perez-Moreno MA, Fraga MF, Esteller M, Cano A (2003). The transcription factor Slug represses E-cadherin expression and induces epithelial to mesenchymal transitions: a comparison with Snail and E47 repressors. J Cell Sci 116: 499-511.
Boniface K, Bernard FX, Garcia M, Gurney AL, Lecron JC, Morel F (2005). IL-22 inhibits epidermal differentiation and induces proinflammatory gene expression and migration of human keratinocytes. J Immunol 174: 3695-3702.
Borish LC, Steinke JW. Cytokines and chemokines. (2003) J Allergy Clin Immunol 111: S460-S475.
Bourguignon LY, Ramez M, Gilad E, Singleton PA, Man MQ, Crumrine DA, Elias PM, Feingold KR (2006). Hyaluronan-CD44 interaction stimulates keratinocyte differentiation, lamellar body formation/secretion, and permeability barrier homeostasis. J Invest Dermatol 126: 1356-1365.
Campos M, Szerenyi K., Lee M, McDonnell J.M, Lopez P F, McDonnell PJ (1994). Keratocyte loss after corneal deepithelialization in primates and rabbits. Arch Ophthalmol 112, 254-260.
Cano A, Perez-Moreno MA, Rodrigo I, Locascio A, Blanco MJ, del Barrio MG, Portillo F, Nieto MA (2000). The transcription factor Snail controls epithelial-mesenchymal transitions by repressing E-cadherin expression. Nature Cell Biology 2: 76-83.
Carver EA, Jiang R, Lan Y, Oram KF, Gridley T (2001). The mouse snail gene encodes a key regulator of the epithelial-mesenchymal transition. Mol Cell Biol 21: 8184-8188.
Catalano A, Rodilossi S, Rippo MR, Caprari P, Procopio A (2004). Induction of stem cell factor/c-kit/slug signal transduction in multidrug-resistant malignant mesothelioma cells. J Biol Chem 279: 46706-46714.
Chandler HL, Colitz CM, Lu P, Saville WJ, Kusewitt DF (2006). The role of the slug transcription factor in cell migration during corneal re-epithelialization in the dog. Exp Eye Res Epub ahead of print 2006 Dec 28.
170 Chisholm JC, Houliston E (1987). Cytokeratin filament assembly in the preimplantation embryo. Development 101: 565-582.
Cho CH, Sung HK, Kim KT, Cheon HG, Oh GT, Hong HJ, Yoo OJ, Koh GY (2006). COMP-angiopoietin-1 promotes wound healing through enhanced angiogenesis, lymphangiogenesis, and blood flow in a diabetic mouse model. Proc Natl Acad Sci U S A 103: 4946-4951.
Christofori G (2006). New signals from the invasive front. Nature 441: 444-449
Chu YW, Seftor EA, Romer LH, Hendrix MJC (1996). Experimental coexpression of vimentin and keratin intermediate filaments in human melanoma cells augments motility. Am J Pathol 148: 63-69.
Clydesdale GJ, Dandie GW, Muller HK (2001). Ultraviolet light induced injury: Immunological and inflammatory effects. Immunology and Cell Biology 79: 547-68.
Come C, Arnoux V, Bibeau F, Savagner P (2004). Roles of the transcription factors Snail and Slug during mammary morphogenesis and breast carcinoma progression. Journal of Mammary Gland Biology and Neoplasia 9: 183-193.
Come C, Magnino F, Bibeau F, De Santa Barbara P, Friedrich Becker K, Theillet C, Savagner P (2006). Snail and Slug play distinct roles during breast carcinoma progression. Clin Cancer Res 12: 5395-5402.
Comijn J, Berx G, Vermassen P, Verschueren K, van Grunsven L, Bruyneel E, Mareel M, Huylebroeck D, van Roy F (2001). The two-handed E box binding zinc finger protein SIP1 down-regulates E-cadherin and induces invasion. Mol Cell 7: 1267- 1278.
Conacci-Sorrell M, Simcha I, Ben-Yedidia T, Blechman J, Savagner P, Ben-Ze’ev A (2003). Autoregulation of E-cadherin expression by cadherin-cadherin interactions: the roles of β-catenin signaling, slug and MAPK. J Cell Biol 163: 847-857.
Coussens LM, Werb Z (2002). Inflammation and cancer. Nature 420: 860-867.
Cullen AP (2002). Photokeratitis and other phototoxic effects on the cornea and conjunctiva. Int J Toxicol 21, 455-464.
Danielsen AJ, Maihle NJ (2002). The EGF/ErbB receptor family and apoptosis. Growth Factors 20: 1-15.
DeCraene B, vanRoy F, Berx G (2005). Unraveling signaling cascades for the Snail family of transcription factors. Cell Signaling 17: 535-547.
171 Dennis G Jr, Sherman BT, Hosack DA, Yang J, Gao W, Lane HC, Lempicki RA (2003). DAVID: Database for Annotation, Visualization, and Integrated Discovery. Genome Biol 4: P3. Epub 2003 Apr 3.
DiGiovanna JJ (1998). Posttransplantation skin cancer: Scope of the problem and role for systemic reinoid chemoprevention. Transplant Proc 30: 2771-2778.
Dohadwala M, Yang SC, Luo J, Sharma S, Batra RK, Huang M, Lin Y, Goodglick L, Krysan K, Fishbein MC, Hong L, Lai C, Cameron RB, Gemmill RM, Drabkin HA, Dubinett SM (2006). Cyclooxygenase-2-dependent regulation of E-cadherin: prostaglandin E(2) induces transcriptional repressors ZEB1 and snail in non-small cell lung cancer. Cancer Res 66: 5338-53345.
Dominguez D, Montserrat-Sentis B, Virgos-Soler A, Guaita S, Grueso J, Porta M, Puig I, Baulida J, Franci C, Garcia de Herreros A (2003). Phosphorylation regulates the subcellular location and activity of the snail transcriptional repressor. Mol Cell Biol 23: 5078-89.
Edmondson SR, Thumiger SP, Kaur P, Loh B, Koelmeyer R, Li A, Silha JV, Murphy LJ, Wraight CJ, Werther GA (2005). Insulin-like growth factor binding protein-3 (IGFBP-3) localizes to and modulates proliferative epidermal keratinocytes in vivo. Br J Dermatol 152: 225-230.
Enk CD, Mahanty S, Blauvelt A, Katz SI. (1996) UVB induces IL-12 transcription in human keratinocytes in vivo and in vitro. Photochem Photobiol 63:854-859.
Fischer J, Bouadjar B, Heilig R, Huber M, Lefevre C, Jobard F, Macari F, Bakija-Konsuo A, Ait-Belkacem F, Weissenbach J, Lathrop M, Hohl D, Prud'homme JF (2001). Mutations in the gene encoding SLURP-1 in Mal de Meleda. Human Mol Genet 10: 875-880.
Foltz G, Ryu GY, Yoon JG, Nelson T, Fahey J, Frakes A, Lee H, Field L, Zander K, Sibenaller Z, Ryken TC, Vibhakar R, Hood L, Madan A (2006). Genome-wide analysis of epigenetic silencing identifies BEX1 and BEX2 as candidate tumor suppressor genes in malignant glioma. Cancer Res 66: 6665-6674.
Fraga MF, Herranz M, Espada J, Ballestar E, Paz MF, Ropero S, Erkek E, Bozdogan O, Peinado H, Niveleau A, Mao JH, Balmain A, Cano A, Esteller M (2004). A mouse skin multistage carcinogenesis model reflects the aberrant DNA methylation patterns of human tumors. Cancer Res 64: 5527-5534.
Gilbert S, Loranger A, Daigle N, Marceau N (2001). Simple epithelium keratins 8 and 18 provide resistance to Fas-mediated apoptosis. The protection occurs through a receptor-targeting modulation. J Cell Biol 154: 763-773.
172 Girardi M (2006). Immunosurveillance and immunoregulation by gammadelta T cells. J Invest Dermatol 126: 25-31.
Girardi M, Oppenheim DE, Steele CR, Lewis JM, Glusac E, Filler R, Hobby P, Sutton B, Tigelaar RE, Hayday AC (2001). Regulation of cutaneous malignancy by gammadelta T cells. Science 294: 605-609.
Goren I, Linke A, Muller E, Pfeilschifter J, Frank S (2006). The suppressor of cytokine signaling-3 is upregulated in impaired skin repair: implications for keratinocyte proliferation. J Invest Dermatol 126: 477-485.
Gotzmann J, Fischer AN, Zojer M, Mikula M, Proell V, Huber H, Jechlinger M, Waerner T, Weith A, Beug H, Mikulits W (2006). A crucial function of PDGF in TGF-beta- mediated cancer progression of hepatocytes. Oncogene 25: 3170-3185.
Grimbaldeston MA, Finlay-Jones JJ, Hart PH (2006). Mast cells in photodamaged skin : what is their role in skin cancer? Photochem Photobiol Sci 5: 177-183.
Grimes HL, Chan TO, Zweidler-McKay PA, Tong B, Tsichlis PN (1996). The Gfi-1 proto-oncoprotein contrains a novel transcriptional repressor domain, SNAG, and inhibits G1 arrest induced by interleukin-2 withdrawal. MolCell Biol 16: 6263-6272.
Griswold DE, Connor JR, Dalton BJ, Lee JC, Simon P, Hillegass L, Sieg DJ, Hanna N (1991). Activation of the IL-1 gene in UV-irradiated mouse skin: association with inflammatory sequelae and pharmacologic intervention. J Invest Dermatol 97: 1019- 1023.
Grotegut S, von Schweinitz D, Christofori G, Lehembre F (2006). Hepatocyte growth factor induces cell scattering through MAPK/Egr-1 –mediated upregulation of Snail. EMBO J 25: 3534-3545.
Guaita S, Puig I, Franci C, Garrido M, Dominguez D, Batlle E, Sancho E, Dedhar S, De Herreros AG, Baulida J (2002). Snail induction of epithelial to mesenchymal transition in tumor cells is accompanied by MUC1 repression and ZEB1 expression. J Biol Chem 277: 39209-39216.
Hachiya A, Kobayashi A, Ohuchi A, Takema Y, Imokawa G (2001). The paracrine role of stem cell factor/c-kit signaling in the activation of human melanocytes in ultraviolet-B-induced pigmentation. J Invest Dermatol 116: 578-586.
Halliday GM (2005). Inflammation, gene mutation and photoimmunosuppression in response to UVR-induced oxidative damage contributes to photocarcinogenesis. Mutat Res 571: 107-120.
173 Han C, Wu T (2005). Cyclooxygenase-2 derived prostaglandin E2 promotes human Cholangiocarcinoma cell growth and invasion through EP1 receptor-mediated activation of epidermal growth factor receptor and Akt. J Biol Chem 280: 24053- 24063.
Hara-Chikuma M, Verkman AS (2005). Aquaporin-3 functions as a glycerol transporter in mammalian skin. Biol Cell 97: 479-486.
Hart PH, Grimbaldeston MA, Swift GJ, Jaksic A, Noon FP, Finlay-Jones JJ (1998). Dermal mast cells determine susceptibility to UVB-induced systemic suppression of contact hypersensitivity responses in mice. J Exp Med 187: 2045-2053.
Hemavathy K, Ashraf SI, Ip YT (2000). Snail/Slug family of repressors: Slowly going into the fast lane of development and cancer. Gene 257: 1-12.
Hemavathy K, Guru SC, Harris J, Chen JD, Ip YT (2000). Human Slug is a repressor that localizes to sites of active transcription. Mol Cell Biol 20: 5087-5095.
Hendrix MJC, Seftor EA, Chu YW. Trevor KT, Seftor REB (1996). Role of intermediate filaments in migration, invasion and metastasis. Cancer Metastasis Rev 15: 507-525.
Hines SJ, Organ C, Kornstein MJ, Krystal GW (1995). Coexpression of the c-kit and stem cell factor genes in breast carcinomas. Cell Growth Differ 6: 7679-7679.
Hofer MD, Menke A, Genze F, Gierschik P, Giehl K (2004). Expression of MTA-1 promotes motility and invasiveness of PANC-1 pancreatic carcinoma cells. Br J Cancer 90: 455-462.
Honkakoski P, Negishi M (1997). Characterization of a phenobarbital-responsive enhancer module in mouse P450 Cyp2b10 gene. J Biol Chem 272: 14943-14949.
Hudson LG, Choi C, Newkirk KM, Parkhani J, Cooper KL, Lu P, Kusewitt DF (2007). Ultraviolet radiation stimulates expression of snail family transcription factors in keratinocytes. Mol Carcinog In Press.
Inoue A, Seidel MG, Wu W, Kamizono S, Ferrando AA, Bronson RT, Iwasaki H, Akashi K, Morimoto A, Hitzler JK, Pestina TI, Jackson CW, Tanaka R, Chong MJ, McKinnon PJ, Inukai T, Grosveld GC, Look AT. (2002) Slug, a highly conserved zinc finger transcriptional repressor, protects hematopoietic progenitor cells from radiation-induced apoptosis in vivo. Cancer Cell 2: 279-288.
Inukai T, Inoue A, Kurosawa H, Goi K, Shinjyo T, Ozawa K, Mao M, Inaba T, Look AT (1999). Slug, a ces-1-related zinc finger transcription factor gene with antiapoptotic activity, is a downstream target of the E2A-HLF oncoprotein. Molecular Cell 4: 343- 352.
174 Ivarsen A, Laurberg T, Moller-Pedersen T (2004). Role of keratocyte loss on corneal wound repair after LASIK. Invest Ophthalmol Vis Sci 45: 3499-3506.
Iyer PV, Leong AS (1992). Poorly differentiated squamous cell carcinomas of the skin can express vimentin. J Cutan Pathol 19: 34-39.
Jechlinger M, Sommer M, Moriggl R, Seither P, Kraut N, Capodiecci P, Donovan M, Cordon-Cardo C, Beug H, Grunert S (2006). Autocrine PDGF signaling promotes mammary cancer metastasis. J Clin Invest 116: 1561-1570.
Jiang R, Lan Y, Norton CR, Sundberg JP, Gridley T (1998). The Slug gene is not essential for mesoderm or neural crest development in mice. Dev Biol 198: 277-285.
Jose JG (1986). Posterior cataract induction by UV-B radiation in albino mice. Exp Eye Res 42, 11-20.
Jose JG, Pitts DG (1985). Wavelength dependency of cataracts in albino mice following chronic exposure. Exp Eye Res 41, 545-563.
Jullig M, Zhang WV, Ferreira A, Stott NS (2006). MG132 induced apoptosis is associated with p53 independent induction of pro-apoptotic Noxa and transcriptional activity of beta catenin. Apoptosis 11: 627-641.
Kajita M, McClinic KN, Wade PA (2004) Aberrant expression of the transcription factors snail and slug alters the response to genotoxic stress. Mol Cell Biol 24: 7559-66.
Kallinikos P, Efron N (2004). On the etiology of keratocyte loss during contact lens wear. Invest Ophthalmol Vis Sci 45, 3011-3020.
Kang Y, Massague J (2004). Epithelial-Mesenchymal Transitions: Twist in Development and Metastasis. Cell 118: 277-279.
Katoh M, Katoh M (2004). Identification and characterization of ARHGAP24 and ARHGAP25 genes in silico. Int J Mol Med 14: 333-338.
Kaya G, Rodriguez I, Jorcano JL, Vassalli P, Stamenkovic I (1997). Selective suppression of CD44 in keratinocytes of mice bearing an antisense CD44 transgene driven by a tissue-specific promoter disrupts hyaluronate metabolism in the skin and impairs keratinocyte proliferation. Genes Dev 11: 996-1007.
Kochupurakkal BS, Harari D, Di-Segni A, Maik-Rachline G, Lyass L, Gur G, Kerber G, Citri A, Lavi S, Eilam R, Chalifa-Caspi V, Eshhar Z, Pikarsky E, Pinkas-Kramarski R, Bacus SS, Yarden Y (2005). Epigen, the last ligand of ErbB receptors, reveals intricate relationships between affinity and mitogenicity. J Biol Chem 280: 8503- 8512.
175 Kozak I, Klisenbauer D, Juhas T (2003). UV-B induced production of MMP-2 and MMP-9 in human corneal cells. Physiol Res 52, 229-234.
Krunic AL, Garrod DR, Madani S, Buchanan MD, Clark RE (1998). Immunohistochemical staining for desmogleins 1 and 2 in keratinocytic neoplasms with squamous phenotype: actinic keratosis, keratoacanthoma and squamous cell carcinoma of the skin. Br J Cancer 77: 1275-1279.
Kulms D, Pöppelmann B, Yarosh D, Luger TA, Krutmann J, Schwarz T (1999). Nuclear and cell membrane effects contribute independently to the induction of apoptosis in human cells exposed to UVB radiation. Proc Natl Acad Sci U S A 96: 7974-79.
Kuniyasu H, Troncoso P, Johnston D, Bucana CD, Tahara E, Fildler IJ, Pettaway CA (2000). Relative expression of type IV collagenase, E-cadherin and vascular endothelial growth factor/vascular permeability factor in prostatectomy specimens distinguishes organ-confirmed from pathologically advanced prostate cancer. Clinical Cancer Research 6: 2295-2308.
Kurrey NK, Amit K, Bapat SA (2005). Snail and Slug are major determinants of ovarian cancer invasiveness a the transcriptional level. Gynecol Oncol 97: 155-165.
Kyo S, Sakaguchi J, Ohno s, Mizumoto Y, Maida Y, Hashimoto M, Nakamura M, takakura M, Nakajima M, Masutomi K, Inoue M (2006). High Twist expression is involved in infiltrative endometrial cancer and affects patient survival. Human Pathology 37: 431-438.
Larcher F, Bauluz C, Diaz-Guerra M, Quintanila M, Conti CJ, Ballestin C, Jorcano JL (1992). Aberrant expression of the simple epithelial type II keratin 8 by mouse skin carcinomas but not papillomas. Mol Carcinog 6: 112-121.
Lee JL, Mukhtar H, Bickers DR, Kopelovich L, Athara M (2003). Cyclooxygenases in the skin: pharmacological and toxicological implications. Toxicology and Applied Pharmacology 192: 294–306.
Lewis MT, Ross S, Strickland PA, Sugnet CW, Jimenez E, Hui C, Daniel CW (2001). The Gli2 transcription factor is required for normal mouse mammary gland development. Dev Biol 238: 133-144.
Lightner VA (1994). Tenascin: does it play a role in epidermal morphogenesis and homeostasis? J Invest Dermatol 102: 273-277.
176 Lippens S, Kockx M, Knaapen M, Mortier L, Polakowska R, Verheyen A, Garmyn M, Zwijsen A, Formstecher P, Huylebroeck D, Vandenabeele P, Declercq W (2000). Epidermal differentiation does not involve the pro-apoptotic executioner caspases, but is associated with caspase-14 induction and processing. Cell Death Differ 7: 1218-1224.
Lu Z, Ghosh S, Wang Z, Hunter T (2003). Downregulation of caveolin-1 function by EGF leads to the loss of E-cadherin, increased transcriptional activity of beta-catenin, and enhanced tumor cell invasion. Cancer Cell 4: 499-515.
Luo Y, He DL, Ning L, Shen SL, Li L, Li X (2006). Hypoxia-inducible factor-1alpha induces the epithelial-mesenchymal transition of human prostate cancer cells. Chin Med J 119: 713-718.
Madson JG, Lynch DT, Tinkum KL, Putta SK, Hansen LA (2006). Erbb2 regulates inflammation and proliferation in the skin after ultraviolet irradiation. Am J Pathol 169: 1402-1414.
Magovern M, Wright JD, Mohammed A (2004). Spheroidal degeneration of the cornea: a clinicopathologic case report. Cornea 23, 84-88.
Makinen M, Stenback F (1998). Skin tumor development and keratin expression in different experimental models. Relation to inducing agent and target tissue structure. Exp Toxicol Pathol 50: 199-208.
Mancuso M, Pazzaglia S, Tanori M, Hahn H, Merola P, Rebessi S, Atkinson MJ, Di Majo V, Covelli V, Saran A (2004). Basal cell carcinoma and its development: insights from radiation-induced tumors in Ptch1-deficient mice. Cancer Res 64: 934- 941.
Mann JR, Backlund MG, Buchanan FG, Daikoku T, Holla VR, Rosenberg DW, Dey SK, DuBois RN (2006). Repression of prostaglandin dehydrogenase by epidermal growth factor and snail increases prostaglandin E2 and promotes cancer progression. Cancer Res 66: 6649-6656.
Manzanares M, Locascio A, Nieto MA (2001). The increasing complexity of the Snail gene superfamily in metazoan evolution. Trend Genet 17: 178-181.
Marconcini L, Marchiò S, Morbidelli L, Cartocci E, Albini A, Ziche M, Bussolino F, Oliviero S (1999). c-fos-induced growth factor/vascular endothelial growth factor D induces angiogenesis in vivo and in vitro. Proc Natl Acad Sci U S A 96: 9671-9676.
Maschler S, Grunert S, Danielopol A, Beug H, Wirl G (2004). Enhanced tenascin-C expression and matrix deposition during Ras/TGF-beta-induced progression of mammary tumor cells. Oncogene 23: 3622-3633.
177 Mastrangeli R, Donini S, Kelton CA, He C, Bressan A, Milazzo F, Ciolli V, Borrelli F, Martelli F, Biffoni M, Serlupi-Crescenzi O, Serani S, Micangeli E, El Tayar N, Vaccaro R, Renda T, Lisciani R, Rossi M, Papoian R (2003). ARS Component B: structural characterization, tissue expression and regulation of the gene and protein (SLURP-1) associated with Mal de Meleda. European Journal of Dermatology 13: 560-570.
Matsumura Y, Ananthaswamy HN (2004). Toxic effects of ultraviolet radiation on the skin. Toxicology and Applied Pharmacology 195: 298-308.
Mazzalupo S, Wawersik MJ, Coulombe PA (2002). An ex vivo assay to assess the potential of skin keratinocytes for wound epithelialization. J Invest Dermatol 118: 866-870.
Miyoshi A, Kitajima Y, Shimonishi T, Matsuyama S, Kitahara K, Miyazaki K (2005). Snail accelerates cancer invasion by upregulating MMP expression and is associated with poor prognosis of hepatocellular carcinoma. Br J Cancer 92: 252-258.
Miyoshi A, Kitajima Y, Sumi K, Sato K, Hagiwara A, Koga Y, Miyazaki K (2004). Snail and SIP1 increase cancer invasion by upregulating MMP family in hepatocellular carcinoma cells. Br J Cancer 90: 1265-1273.
Moll I, Kurzen H, Langbein L, Franke WW (1997). The distribution of the desmosomal protein, plakophilin 1, in human skin and skin tumors. J Invest Dermatol 108: 139- 146.
Moller-Pedersen T (1997). A comparative study of human corneal keratocyte and endothelial cell density during aging. Cornea 16, 333-338.
Moreno-Bueno G, Cubillo E, Sarrio D, Peinado H, Rodriguez-Pinilla SM, Villa S, Bolos V, Jorda M, Fabra A, Portillo F, Palacios J, Cano A (2006). Genetic profiling of epithelial cells expressing E-cadherin repressors reveals a distinct role for snail, slug, and E47 factors in epithelial-mesenchymal transition. Cancer Res 66: 9543-9556.
Motulsky H (1995). Comparing three or more means: Analysis of variance. In: Intuitive Biostatistics Oxford University Press: Oxford, 255-262.
Mukhtar H, Elmets CA (1996). Photocarcinogenesis: Mechanisms, models, and human health implications. Photochem Photobiol 63: 356-357.
Murakami T, Hosomi N, Oiso N, Giovannucci-Uzielli ML, Aquaron R, Mizoguchi M, Kato A, Ishii M, Bitner-Glindzicz M, Barnicoat A, Wilson L, Tsukamoto K, Ueda H, Mancini AJ, Suzuki T, Riley J, miertus J, Camargo M, Santoro-Zea A, Atkin J, Fukai K (2005). Analysis of KIT, SCF and initial screening of SLUG in patients with piebaldism. J Invest Dermatol 124: 670-672.
178 Myers C, Charboneau A, Cheung I, Hanks D, Boudreau N (2002). Sustained expression of homeobox D10 inhibits angiogenesis. Am J Pathol 161: 2099-2109.
Nass SJ, Herman JG, Gabrielson E, Iversen PW, Parl FF, Davidson NE, Graff JR (2000). Aberrant methylation of the estrogen receptor and E-cadherin 5’CpG islands increases with malignant progression in human breast cancer. Cancer Res 60: 4346- 8.
Nelson WJ, Nusse R (2004). Convergence of Wnt, β-catenin, and cadherin pathways. Science 303: 1483-1487.
Nieto AM (2002). The Snail superfamily of zinc-finger transcription factors. Nature Rev 31: 155-166.
Nieto MA, Sargent MG, Wilkinson DG, Cooke J (1994). Control of cell behavior during vertebrate development by Slug, a zinc finger gene. Science 264: 835-839.
Nilsson M, Unden AB, Krause D, Malmqwist U, Raza K, Zaphiropoulos PG, Toftgard R (2000). Induction of basal cell carcinomas and trichoepitheliomas in mice overexpressing GLI-1. Proc Natl Acad Sci U S A 97: 3438-3443.
Ogawa K, Ito M, Takeuchi K, Nakada A, Heishi M, Suto H, Mitsuishi K, Sugita Y, Ogawa H, Ra C (2005). Tenascin-C is upregulated in the skin lesions of patients with atopic dermatitis. J Dermatol Sci 40: 35-41.
Oshima RG, Baribault H, Caulin C (1996). Oncogenic regulation and function of keratins 8 and 18. Cancer Metastasis Rev 15: 445-471.
Owens DW, Lane EB (2003). The quest for the function of simple epithelial keratins. Bioessays 25: 748-758.
Pappas DJ, Rimm DL (2006). Direct Interaction of the C-Terminal Domain of alpha- Catenin and F-Actin is Necessary for Stabilized Cell-Cell Adhesion. Cell Communication and Adhesion 13: 151-170.
Parent AE, Choi C, Caudy K, Gridley T, Kusewitt DF (2004). The developmental transcription factor Slug is widely expressed in tissues of adult mice. J of Histochem Cytochem 52: 959-965.
Park JH, Sung IJ, Lee SW, Kim KW, Kim YS, Yoo MA (2005). The zinc-finger transcription factor Snail downregulates proliferating cell nuclear antigen expression in colorectal carcinoma cells. Int J Oncology 26: 1541-1547.
179 Peinado H, Marin F, Cubillo E, Stark HJ, Fusenig N, Nieto MA, Cano A (2004). Snail and E47 represssors of E-cadherin induce distinct invasive and angiogenic properties in vivo. J Cell Sci 117: 2827-2839.
Perez-Losada J, Sanchez-Martin M, Perez-Caro M, Perez-Mancera PA, Sanchez-Garcia I (2003). The radioresistance biological function of the SCF/kit signaling pathway is mediated by the zinc-finger transcription factor Slug. Oncogene 22: 4205-4211.
Perez-Losado J, Sanchez-Martin M, Rodriguez-Garcia A, Sanchez ML, Orfao A, Flores T, Sanchez-Garcia I (2002). Zinc-finger transcription factor Slug contributes to the function of the stem cell factor c-kit signaling pathway. Blood 100: 1274-1286.
Perl AK, Wilgenbus P, Dahl U, Semb H, Christofori G (1998). A causal role for E- cadherin in the transition from adenoma to carcinoma. Nature 392: 190-193.
Podskochy A (2004). Protective role of corneal epithelium against ultraviolet radiation damage. Acta Ophthalmol Scand 82: 714-717.
Podskochy A, Fagerholm P (1998). Cellular response and reactive hyaluronan production in UV-exposed rabbit corneas. Cornea 17: 640-645.
Podskochy A, Fagerholm P (2002). The expression of Fas ligand protein in ultraviolet- exposed rabbit corneas. Cornea 21, 91-94.
Podskochy A, Gan L, Fagerholm P (2000). Apoptosis in UV-exposed rabbit corneas. Cornea 19, 99-103.
Pons M, Cigudosa JC, Rodriguez-Perales S, Bella JL, Gonzalez C, Gamallo C, Quintanilla M (2005). Chromosomal instability and phenotypic plasticity during the squamous-spindle carcinoma transition: association of a specific T(14;15) with malignant progression. Oncogene 24: 7608-7618.
Poser I, Dominguez D, Garcia de Herreros A, Varnai A, Buettner R, Bosserhoff AK (2001). Loss of E-cadherin expression in melanoma cells involves up-regulation of the transcriptional repressor snail. J Biol Chem 276: 24661-24666.
Robman L, Taylor H (2005). External factors in the development of cataract. Eye 19, 1074-1082.
Ramakers C, Ruijter JM, Deprez RH, Moorman AF (2003). Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data. Neurosci Lett 339: 62- 66.
180 Ramirez A, Vidal M, Bravo A, Jorcano JL (1998). Analysis of sequences controlling tissue-specific and hyperproliferation-related keratin 6 gene expression in transgenic mice. DNA Cell Biol 17: 177-185.
Raul U, Sawant S, Dange P, Kalraiya R, Ingle A, Vaidya M (2004). Implications of Cytokeratin 8/18 filament formation in stratified epithelial cells: Induction of transformed phenotype. Int J Cancer 111: 662-668. Repertinger SK, Campagnaro E, Fuhrman J, El-Abaseri T, Yuspa SH, Hansen LA (2004). EGFR enhances early healing after cutaneous incisional wounding. J Invest Dermatol 123: 982-989.
Rich B, Kupper T (2001). Cytokines: IL-20 — a new effector in skin inflammation. Curr Biol 11: R531–R534.
Rocnik EF, Liu P, Sato K, Walsh K, Vaziri C (2006). The novel SPARC family member SMOC-2 potentiates angiogenic growth factor activity. J Biol Chem 281: 22855- 22864.
Rosano L, Spinella F, DiCastro V, Decandia S, Nicotra MR, Natali PG, Bagnato A (2006). Endothelin-1 is required during epithelial to mesenchymal transition in ovarian cancer progression. Exp Biol Med 231: 1128-1131.
Rosel M, Seiter S, Zoller M (1997). CD44v10 expression in the mouse and functional activity in delayed type hypersensitivity. J Cell Physiol 171: 305-317.
Rosivatz E, Becker I, Specht K, Fricke E, Luber B, Busch R, Hofler H, Becker K (2002). Differential expression of the epithelial-mesenchymal transition regulators Snail, SIP1, and Twist in gastric cancer. Am J Pathol 161: 1881-1891.
Roy HK, Iversen P, Hart J, Liu Y, Koetsier JL, Kim Y, Kunte DP, Madugula M, Backman V, Wali RK (2004). Down-regulation of Snail suppresses MIN mouse tumorigenesis: modulation of apoptosis, proliferation and fractal dimension. Mol Cancer Ther 3: 1159-1165.
Ruiz JC, Conlon FL, Robertson EJ (1994). Identification of novel protein kinases expressed in the myocardium of the developing mouse heart. Mech Dev 48: 153-164.
Sanchez-Martin M, Rodriguez-Garcia A, Perez-Losada J, Sagrera A, Read AP, Sanchez- Garcia I (2002). Slug (Snai2) deletions in patients with Waardenburg disease. Human Molecular Genetics 11: 3231-3236.
Sander CS, Chang H, Hamm F, Elsner P, Thiele JJ (2004). Role of oxidative stress and the antioxidant network in cutaneous carcinogenesis. Int J Dermatol 43: 326-335.
181 Savagner P (2001). Leaving the neighborhood: molecular mechanisms involved during epithelial mesenchymal transition. Bioessays 23: 912-923.
Savagner P, Kusewitt DF, Carver EA, Magnino F, Choi C, Gridley T, Hudson LG (2005). Development transcription factor Slug is required for effective re- epithelialization by adult keratinocytes. J Cell Physiol 202: 858-866.
Savagner P, Yamada KM, Thiery JP (1997). The zinc finger protein slug causes desmosome dissociation, an initial and necessary step for growth factor-induced epithelial-mesenchymal transition. J Cell Biol 137: 1403-1419.
Sefton M, Sanchez S, Nieto MA (1998). Conserved and divergent roles for members of the Snail family of transcription factors in the chick and mouse embryo. Development 125: 3111-3121.
Sheehan D, Hrapchak B (1980). Theory and practice of histotechnology, 2nd Ed, pp 235- 237, Battelle Press, Ohio.
Sheng H, Goich S, Wang A, Grachtchouk M, Lowe L, Mo R, Lin K, de Sauvage FJ, Sasaki H, Hui CC, Dlugosz AA (2002). Dissecting the oncogenic potential of Gli2: deletion of an NH(2)-terminal fragment alters skin tumor phenotype. Cancer Res 62: 5308-5316.
Shibue T, Taniguchi T (2006). BH3-only proteins: Integrated control point of apoptosis. Int J Cancer 119: 2036–2043.
Shih JY, Tsai MF, Chang TH, Chang YL, Yuan A, Yu CJ, Lin SB, Liou GY, Lee ML, Chen JJ, Hong TM, Yang SC, Su JL, Lee YC, Yang PC (2005). Transcription repressor slug promotes carcinoma invasion and predicts outcome of patients with lung adenocarcinoma. Clin Cancer Res 11: 8070-8078.
Shiori M, Shida T, Koda K, Oda K, Sike K, Nishimura M, Takano S, Miyazaki M (2006). Slug expression is an independent prognostic parameter for poor survival in colorectal carcinoma patients. Br J Cancer 94: 1816-1822.
Shook D, Keller R (2003). Mechanisms, mechanics and function of epithelial- mesenchymal transitions in early development. Mech Dev 120: 1351-1383.
Sier CF, Kubben FJ, Ganesh S, Heerding MM, Griffioen G, Hanemaaijer R, vanKrieken JH, Lamers CB, Verspaget HW (1996). Tissue levels of matrix metalloproteinases MMP2 and MMP-9 are related to overall survival of patients with gastric carcinoma. Br J Cancer 74: 413-417.
182 Sterner-Kock A, Thorey IS, Koli K, Wempe F, Otte J, Bangsow T, Kuhlmeier K, Kirchner T, Jin S, Keski-Oja J, von Melchner H (2002). Disruption of the gene encoding the latent transforming growth factor-beta binding protein 4 (LTBP-4) causes abnormal lung development, cardiomyopathy, and colorectal cancer. Genes Dev 16: 2264-73.
Stephenson A, Huang GY, Nguyen NT, Reuter S, McBride JL, Ruiz JC (2004). snf1lk encodes a protein kinase that may function in cell cycle regulation. Genomics 83: 1105-1115.
Strachan L, Murison JG, Prestidge RL, Sleeman MA, Watson JD, Kumble KD (2001). Cloning and biological activity of epigen, a novel member of the epidermal growth factor superfamily. J Biol Chem 276:18265-18271.
Suzuki S, Honma K, Matsuyama T, Suzuki K, Toriyama K, Akitoyo I, Yamamoto K, Suematsu T, Nakamura M, Yui K, Kumatori A (2004). Critical roles of interferon regulatory factor 4 in CD11bhighCD8alpha- dendritic cell development. Proc Natl Acad Sci U S A 101: 8981-8986.
Szerenyi KD, Wang X, Gabrielian K, McDonnell PJ (1994). Keratocyte loss and repopulation of anterior corneal stroma after de-epithelialization. Arch Ophthalmol 112, 973-976.
Takeda H, Katagata Y, Hozumi Y, Kondo S (2004). Effects of angiotensin II receptor signaling during skin wound healing. Am J Pathol 165: 1653-1662.
Taki M, Verschueren K, Yokoyama K, Nagayama M, Kamata N (2006). Involvement of Ets-1 transcription factor in inducing matrix metalloproteinase-2 expression by EMT in human squamous carcinoma cells. Int J Oncol 28: 487-496.
Tammela T, Saaristo A, Lohela M, Morisada T, Tornberg J, , Oike Y, Pajusola K, Thurston G, Suda T, Yla-Herttuala S, Alitalo K (2005). Angiopoietin-1 promotes lymphatic sprouting and hyperplasia. Blood 105: 4642-4648.
Tanaka H, Shirkoohi R, Nakagawa K, Qiao H, Fujita H, Okada F, Hamada J, Kuzumaki S, Takimoto M, Kuzumaki N (2006). siRNA gelsolin knockdown induces epithelial- mesenchymal transition with a cadherin switch in human mammary epithelial cells. Int J Cancer 118: 1680-1691.
Terui T, Funayama M, Terunuma A, Takahashi K, Tagami H (2000). Ultraviolet B radiation exerts enhancing effects on the production of complement component, C3, by interferon-gamma-stimulated cultured human epidermal keratinocytes, in contrast to photochemotherapy and ultraviolet A radiation that show suppressive effects. Br J Dermatol 142: 660-668.
183 Tribulo C, Aybar MJ, Sanchez SS, Mayor R (2004). A balance between the anti- apoptotic activity of Slug and apoptotic activity of msx1 is required for the proper development of the neural crest. Dev Biol 275: 325-342.
Tripathi MK, Misra S, Chaudhuri G (2005). Negative regulation of the expressions of cytokeratins 8 and 19 by SLUG repressor protein in human breast cells. Biochem Biophys Res Commun 329: 508-515.
Tripathi MK, Misra S, Khedkar SV, Hamilton N, Irvin-Wilson C, Sharan C, Sealy L, Chaudhuri G (2005). Regulation of BRCA2 gene expression by the Slug repressor protein in human breast cells. J Biol Chem 280: 17163-17171.
Turner FE, Broad S, Khanim FL, Jeanes A, Talma S, Hughes S, Tselepis C, Hotchin NA (2006). Slug regulates integrin expression and cell proliferation in human epidermal keratinocytes. J Biol Chem 281: 21321-21331.
Valdes F, Alvarez AM, Locascio A, Vega S, Herrera B, Fernandez M, Benito M, Nieto MA, Fabregat I (2002). The epithelial mesenchymal transition of transforming growth factor β in fetal rat hepatocytes. Molecular Cancer Research 1: 68-78. van Kleffens M, Groffen CA, Dits NF, Lindenbergh-Kortleve DJ, Schuller AG, Bradshaw SL, Pintar JE, Zwarthoff EC, Drop SL, van Neck JW (1999). Generation of antisera to mouse insulin-like growth factor binding proteins (IGFBP)-1 to -6: comparison of IGFBP protein and messenger ribonucleic acid localization in the mouse embryos. Endocrinology 140: 5944-5952. van Oosten M, Rebel H, Friedberg EC, van Steeg H, van der Horst GTJ, van Kranen HJ, Westerman A, van Zeeland AA, Mullenders LHF, de Gruijl FR (2000). Differential role of transcription-coupled repair in UVB-induced G2 arrest and apoptosis in mouse epidermis. Proc Natl Acad Sci U S A 97: 11268-11273.
Vega S, Morales AV, Ocana OH, Valdes F, Fabregat I, Nieto MA (2004). Snail blocks the cell cycle and confers resistance to cell death. Genes Dev 18: 1131-1143.
Wang Y, Sakuma M, Chen Z, Ustinov V, Shi C, Croce K, Zago AC, Lopez J, Andre P, Plow E, Simon DI (2005). Leukocyte engagement of platelet glycoprotein Ibalpha via the integrin Mac-1 is critical for the biological response to vascular injury. Circulation 112: 2993-3000.
Wilgus TA, Koki AT, Zweifel BS, Kusewitt DF, Rubal PA, Oberyszyn TM (2003). Inhibition of cutaneous ultraviolet light B-mediated inflammation and tumor formation with topical celecoxib treatment. Mol Carcinog 38: 49-58.
Wong AS, Gumbiner BM (2003). Adhesion-independent mechanism for suppression of tumor cellinvasion by E-cadherin. J Cell Biol 161: 1191-1203.
184 Wu WS, Heinrichs S, Xu D, Garrison SP, Zambetti GP, Adams JM, Look AT (2005). Slug antagonizes p53-mediated apoptosis of hematopoietic progenitors by repressing puma. Cell 123: 641-653.
Yang AD, Camp ER, Fan F, Shen L, Gray MJ, Liu W, somcia R, Bauer TW, Wu Y, Hicklin DJ, Ellis LM (2006). Vascular endothelial growth factor receptor-1 mediates epithelial to mesenchymal transition in human pancreatic carcinoma cells. Cancer Res 66: 46-51.
Yarmola EG, Bubb MR (2006). Profilin: emerging concepts and lingering misconceptions. Trends Biochem Sci 31: 197-205.
Yokoyama K, Kamata N, Fujimoto R, Tsutsumi S, Tomonari M, Taki M, Hosokawa H, Nagayama M (2003). Increased invasion and matrix metalloproteinase-2 expression by Snail-induced mesenchymal transition in squamous cell carcinomas. Int J Oncol 22: 891-898.
Yokoyama K, Kamata N, Hayashi E, Hoteiya T, Ueda N, Fujimoto R, Nagayama M (2001). Reverse correlation of E-cadherin and snail expression in oral squamous cell carcinoma cells in vitro. Oral Oncology 37: 65-71.
Yook JI, Li XY, Ota I, Fearon ER, Weiss SJ (2005). Wnt-dependent regulation of the E- cadherin repressor snail. J. Biol Chem 280: 11740-11748.
Young AR (2006). Acute effects of UVR on human eyes and skin. Prog Biophys Mol Biol 92, 80-85.
Zeuner A, Pedini F, Signore M, Testa U, Pelosi E, Peschle C, DeMaria R (2003). Stem cell factor protects erythroid precursor cells from chemotherapeutic agents via upregulation of BCL-2 family proteins. Blood 102: 87-93.
Zhang JS, Nelson M, Wang L, Liu W, Qian CP, Shridhar V, Urrutia R, Smith DI (1998). Identification and chromosomal localization of CTNNAL1, a novel protein homologous to alpha-catenin. Genomics 54: 149-154.
Zhao J, Nagasaki T, Maurice DM (2001) Role of tears in keratocyte loss after epithelial removal in mouse cornea. Invest Ophthalmol Vis Sci 42: 1743-1749.
Zheng X, Bollinger Bollag W (2003). Aquaporin 3 colocates with phospholipase d2 in caveolin-rich membrane microdomains and is downregulated upon keratinocyte differentiation. J Invest Dermatol 121: 1487-1495.
185 Zhuge X, Kataoka H, Tanaka M, Murayama T, Kawamoto T, Sano H, Togi K, Yamauchi R, Ueda Y, Xu Y, Nishikawa S, Kita T, Yokode M et al. (2005). Expression of the novel Snai-related zinc finger transcription factor gene Smuc during mouse development. Int J Mol Med 15: 945-949.
Zippo A, DeRobertis A, Bardelli M, Galvagni F, Oliviero S (2004). Identification of Flk- 1 target genes in vasculogenesis: Pim-1 is required for endothelial and mural cell differentiation in vitro. Blood 103: 4536-4544.
186