P a g e | I

COMMUNITY ANALYSIS OF CORAL MUCUS-ASSOCIATED BACTERIA AND

IMPACT OF TEMPERATURE AND CO2 CHANGES ON THEM

By JULIANA HO SING FANG

A thesis submitted in partial fulfilment of the requirements for the degree of Masters of Science (by Research)

Faculty of Engineering, Computing and Science Swinburne University of Technology (Sarawak campus) 2015 P a g e | II

Abstract The coral holobiont is a complex assemblage of the coral animal and microbial organism. Coral mucus harbours distinct microbial communities and bacteria living in the coral mucus play a major role in the survival of corals. While several studies have assessed their importance in protecting their coral hosts from disease, very little is known about the response of these bacteria to climate change. One of the major consequences of climate changes are enhanced ocean temperatures which lead to coral bleaching. Another major cause of coral bleaching is the increased amount of anthropogenic carbon dioxide (CO2) which leads to a phenomenon called ocean acidification. In both cases, very little its known about how bacteria living in the coral mucus react to the changing conditions. In a laboratory-based experiment, we assessed the impact of temperature and carbon dioxide elevation on mucus-associated bacteria in Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp.. Fragments of the selected corals were placed into tanks and exposed to enhanced concentrations of CO2 and temperature in a series of experiments. Coral mucus samples were collected on a weekly basis and CO2 concentrations monitored using a Fourier-Transform Infrared (FTIR) trace gas analyzer. Potential changes in the coral mucus-associated bacteria communities were monitored by (a) culture based and (b) molecular approaches. Mucus samples were cultured weekly and bacterial isolates identified using Sanger sequencing. Furthermore, fingerprinting methods such as Denaturing Gel Gradient Electrophoresis (DGGE) and Ribosomal Intergenic Spacer analysis (RISA) were applied to monitor changes in the microbial communities. Enzymatic properties (amylase, caseinase, gelatinase and phospholipase) of the coral mucus- associated bacteria were also assessed to identify potential pathogenic bacteria. Significant shifts were detected in all three corals. For Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp., When the temperature and carbon dioxide were maintained around 25°C to 28°C and 500 ppm, Vibrio sp., Bacillus sp. and Pseudomonas sp. were found but as temperature increases up to 29°C, Bacillus sp. started to dominate. However, when both temperature and carbon dioxide were rised up to stressful conditions for the corals, Vibrio sp. dominated the corals mucus layers. Lastly, the isolation of bacteriophage that has the ability to cause a plaque in the Bacteriophage Plaque Assay when tested against selected potential pathogens was also identified. The species identified are phylogenetically 96% similar to Enterobacteriophage reference strain, which are potential bacteriophages for the inhibition of marine pathogens. There were shifts in Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp. mucus- associated bacteria community when temperature and carbon dioxide content of the corals surrounding changes.

P a g e | III

Acknowledgements

For since the creation of the world God’s invisible qualities – his eternal power and divine nature – have been clearly seen, being understood from what has been made, so that people are without excuse. (Romans 1:20)

Foremost, I would like to express my sincere gratitude to my principal coordinating supervisor, Dr. Moritz Müller for his continuous support of my MSc study and research, for his patience, motivation, enthusiasm, and immense knowledge. Thank you for giving me the chance to explore this field, allowing me freedom and space to make mistakes and for believing in me. I would also like to extend my appreciation to my co- supervisors: Dr. Aazani Mujahid, and Dr. Irine Henry Ninjom for their encouragements, insightful comments, hard questions, as well as access to laboratories and facilities in Universiti Malaysia Sarawak (UNIMAS).

Heartfelt thanks also to the Biotechnology laboratory officers and technicians: Chua Jia Ni, Nurul Arina, and Dyg. Rafika Atiqah for allowing me to use the labs past office hours and for giving me access to use the apparatus and experiment materials. Without your help, this project may not have been completed on time.

A big thank you to my fellow lab mates and student helpers: Edward Cheah, Miandy Lee and Angelica Chong, or the stimulating discussions, the company during long hours in the lab, the support during various existential crises and for all the fun we have had in the last two years.

Last but not least, I would like to thank my family, especially my mother, for encouraging me to take up this MSc opportunity and for having my back throughout every circumstance in the past two years. I am grateful to Swinburne University of Techonology for providing me with funding via the Swinburne Postgraduate Student Scholarship which enabled me to pursue this postgraduate study. Declaration P a g e | IV

I hereby declare that this research entitled “COMMUNITY ANALYSIS OF CORAL MUCUS-

ASSOCIATED BACTERIA AND IMPACT OF TEMPERATURE AND CO2 CHANGES ON THEM” is original and contains no material which has been accepted for the award to the candidate of any other degree or diploma, except where due reference is made in the text of the examinable outcome; to the best of my knowledge contains no material previously published or written by another person except where due reference is made in the text of the examinable outcome; and where work is based on joint research or publications, discloses the relative contributions of the respective workers or authors.

(JULIANA HO SING FANG) Date: 29.06.2015

P a g e | V

Table of Contents Page

List of Figures VIII List of Tables XIII 1 Introduction 1.1 Microbial life in the ocean 1 1.2 Coral reefs 2 1.3 Coral reefs and bacteria 3 1.3.1 Coral surface mucus layer (SML) and bacteria 4 1.4 Threats to coral reefs 7 1.4.1 Ocean Acidification 8 1.4.2 Temperature rise 10 1.4.3 Coral bleaching and coral diseases 11 1.4.4 Coral diseases and the role of microbes in coral surface mucus 16 layer 18 1.5 Phage Therapy 20 1.6 Significance and aims of the present study and dissertation outline

2 Methodology 21 2.1 Methodology Flowchart 23 2.2 Field sampling and Experimental Setup 25 2.2.1 Week 1 to week 4 32 2.3 Laboratory procedures 32 2.3.1 Isolation and DNA Extraction of bacteria of Coral Mucus Associated Bacteria 32 2.3.2 Molecular characterisation 34 2.3.3 Constructing phylogenetic trees for coral mucus-associated 36 bacteria 2.3.4 Indices for bacteria diversity 37

P a g e | VI

2.3.5 Fingerprinting Analysis 39 2.3.5 (i) Extraction of genomic DNA from coral mucus 40 samples 2.3.5 (ii) Automated Ribosomal Internal Spacer (ARISA) 42 Analysis 2.3.5 (iii) Denaturing gradient gel electrophoresis (DGGE) 43 Analysis 2.3.6 Enzyme Essays 47 2.3.6 (i) Amylase Activity 47 2.3.6 (ii) Caseinase Activity 48 2.3.6(iii) Phospholipase Activity 49 2.3.6. (iv) Gelatinase Activity 50

2.3.7 Screening and Isolation of Bacteriophages 52 2.3.8 Whole Genome Amplification via Multiple Displacement 54 Amplification (MDA) of Bacteriophages 2.3.9 Sequencing Analysis For Bacteriophages Identification 56 2.3.9(i) g20 genes 56 2.3.9(ii) phoH genes 57 2.3.9 (iii) Phylogenetic analyses 59

3 3 Diversity of the Bacterial Communities Associated to Coral Mucus Layer 60 3.1 Introduction 3.1.1 Bacteria associated with Trachyphyllia geoffroyi 61

3.1.2 Bacteria associated with Euphyllia ancora 67 74 3.1.3 Bacteria associated with Corallimorphs sp.

3.1.4 Diversity of Coral Mucus-Associated Bacteria 76

P a g e | VII

4 Bacterial Communities Shifts 84 4.1 Introduction on Bacteria Communities Shifts 4.2 Shifts in Bacterial Community Associated to Coral Mucus Layer of 93 Trachyphyllia sp. 4.2.1 Week 5 to Week 6 for Trachyphyllia geoffroyi 4.5.1(ii) Week 7 to 93 Week 8 For Trachyphyllia geoffroyi 4.2.2 Week 7 to Week 8 for Trachyphyllia geoffroyi 94 4.2.3 Week 9 for Trachyphyllia geoffroyi 95

4.3 Shifts in Bacterial Community Associated to Coral Mucus Layer of 97 Euphyllia ancora 4.3.1 Week 5 to Week 6 for Euphyllia ancora 97 4.3.2 Week 7 to Week 8 for Euphyllia ancora 98 4.3.3 Week 9 for Euphyllia ancora 99

4.4 Shifts in Bacterial Community Associated to Coral Mucus Layer of 100 Corallimorphs sp. 4.4.1 Week 5 to Week 6 for Corallimorphs sp. 100 4.4.2 Week 7 to Week 8 for Corallimorphs sp. 101 4.4.3 Week 9 for Corallimorphs sp. 103

4.5 Conclusion Bacterial Diversity Shifts in mucus layers of Trachyphyllia 103 geoffroyi, Euphyllia ancora and Corallimorphs sp. under temperature and

CO2 stress

5 Bacteriophages 107 5.1 Potential coral pathogens and phage therapy 107 5. 2 Identification of potential coral pathogens 108

5.3 Results and Discussions for Bacteriophages Screening 110

6.0 Summary and Future Work 115

P a g e | VIII

References 118-159

Appendix 159-172

P a g e | IX

Figure Page

I: Distribution of coral reefs in the East Asian Seas 3

II: The Ocean Acidification cycle process which summarizes the whole process 10 on how this phenomenon occurs (UK Ocean Acidification Programme 2012).

III: Overall methodology flowchart that summarizes the overall experimental 22 procedures. The identity and enzymatic properties of Trachyphyllia

geoffroyi, Euphyllia ancora and Corallimorphs sp. mucus-associated

bacteria were assessed and potential coral pathogens isolated were tested

against potential bacteriophages to detect whether their growth could be

inhibited by the potential bacteriophages chosen (phage therapy).

IV: Types of coral species investigated in this experimental study (top left: Euphyllia ancora; top right: Corallimorphs sp. and bottom left; Trachyphyllia 23 geoffroyi)

23 V: llustrations of experimental instruments used to monitor the parameters in

the aquaria

VI: Graph showing overall parameters during week 1 to 4 of the experiment. 26 Dissolved oxygen and carbon dioxide is shown on primary y-axis, pH and temperature on secondary y-axis.

27 VII: Graph showing overall parameters during week 5 to 6 of the experiment.

Dissolved oxygen and carbon dioxide are shown on primary y-axis, pH and temperature on secondary y-axis.

VIII: Graph showing overall parameters during week 7 to 8 of the experiment. 28 P a g e | X

Dissolved oxygen and carbon dioxide is shown on primary y-axis, pH and temperature on secondary y-axis.

IX: Graph showing overall parameters during Week 9 of the experimental 29 weeks. Dissolved oxygen and carbon dioxide is shown on primary y-axis, pH and temperature on secondary y-axis.

X: Graph showing Week 1 to week 9 overall experimental period for carbon dioxide (ppm) and temperature (°C) in the aquaria. Carbon dioxide is shown on 30 primary y-axis, temperature on secondary y-axis.

XI: The condition of Trachyphyllia geoffroyi., Euphyllia ancora and Corallimorphs 31 sp. after a period of 9 experimental weeks..

XII: Crude DNA Extraction of bacterial isolates-associated to Trachyphyllia 33 geoffroyi, Euphyllia ancora and Corallimorphs sp. on gel Band with 1kbp DNA ladder. L1 (Lane 1) represents the 1kbp DNA ladder. L2-L11 represents the DNA smears of bacterial isolates-associated to Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp.

XIII: PCR bands result obtained from amplification of bacterial 16S rRNA genes of bacteria-associated to Trachyphyllia geoffroyi., Euphyllia ancora and 36 Corallimorphs sp. on gel band with 1kbp DNA ladder. XIV: Genomic DNA of bacteria-associated to Trachyphyllia geoffroyi, Euphyllia 41 ancora and Corallimorphs sp. on gel band with 1kbp DNA ladder.

XV: PyElph Software Analysis System. Screenshot showcases band matching 46 step during gel analysis.

XVI: Example bacterial isolates showing positive amylase activity (zig-zag clear 48 halo zone). 49 XVII: Example bacterial isolates showing positive caseinase activity (clear zones).

XVIII: Example bacterial isolates showing positive phospholipase activity 50 P a g e | XI

(opalescence around the bacterial growth). 51 XIX: Example bacterial isolates showing positive gelatinase activity (clear zones).

XX: Comparison of TFF and FeCl3 flocculation methods and the results of the 53 concentration efficiency via viral fraction (< 0.22µm filtrate)s

XXI: Experimental controls of Potential Coral Pathogen Isolates to make sure 54 that there is no experimental errors during phage assay experiment.

XXII: The Genomic DNA bands of the bacteriophages isolated and amplified via 55 MDA on gel band with 1kbp DNA ladder.

XXIII: The DNA bands of the bacteriophages isolated and amplified via PCR using primers CPS1/8. Lane 1(L1) represents DNA ladder and L3 and L4 represents the 58 DNA of bacteriophages amplified.

XXIV: The DNA bands of the bacteriophages isolated and amplified via PCR using 59 primers vPhof.

XXVI: 16S rRNA Phylogenetic Tree representing bacterial sequences found in Trachyphyllia geoffroyi (Brain coral). 60

XXVII: 16S rRNA Phylogenetic Tree representing bacterial sequences found in Euphyllia ancora (Hammer coral). 69

XXVIII: 16S rRNA Phylogenetic Tree representing bacterial sequences found in

Corallimorphs sp. (Mushroom coral). 75

XXIX: ARISA analysis result to detect the bacteria community associated to Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp. shifting pattern. 87

XXX: DGGE Analysis Gel Result detect the bacteria community associated to 88 P a g e | XII

Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp. shifting pattern.

XXXI: Complete linkage agglomeration tree with genetic distances calculated using PyElph software analysis tool. 89

XXXII: UPGMA tree with genetic distances calculated using PyElph software 90 analysis tool.

XXXIII(a): Results of Bacteriophages Plaque Assay showing the activity of phage Cand E in forming plaques on the agar plates inoculated with the selected 111 potential coral pathogen isolates.

XXXIII (b): Results of Bacteriophages Plaque Assay showing the activity of phage C and E in forming plaques on the agar plates inoculated with the selected 112 potential coral pathogen isolates.

XXXIII (c): Results of Bacteriophages Plaque Assay showing the activity of phage B and C in forming plaques on the agar plates inoculated with the selected 113 potential coral pathogen isolates.

P a g e | XIII

List of Tables

Page Table A: Regional distribution of coral reefs (source: Veron & Stafford-Smith 2 2000) 13

B: Overview of coral diseases, their common hosts and pathogens.

C: Overview of parameters (pH, CO2, dissolved oxygen, temperature) observed 25 during weeks 1 to 9 35 D: Components of 16S rRna PCR reaction per PCR tube

E: List of Variables for Biodiversity Indices 38

F: Components of ARISA PCR reaction per PCR tube 42 44 G: Components of DGGE PCR reaction per PCR tube

H: Indices used to quantify the diversity of 3 selected corals’ mucus layer 77 associated bacterial communities 79 I: Results of Corallimorphs sp. after testing for their enzyme assays

J: Results of Euphyllia ancora after testing for their enzyme assays 80

K: Results Trachyphyllia geoffroyi after testing for their enzyme assays 81

L: Indices used to quantify the diversity of Trachyphyllia geoffroyi mucus layer associated bacterial communities 91 M: Indices used to quantify the diversity of Euphyllia ancora corals’ mucus layer 91 associated bacterial communities

N: Indices used to quantify the diversity of Corallimorphs sp. corals’ mucus layer 92 associated bacterial communities

P a g e | 1

CHAPTER 1

1 Introduction

1.1 Microbial Life in the Ocean

One of the major community members residing in the ocean are marine microbes with an estimated number of 3.6×1029 microbial cells (Singh 2010). Marine microorganisms have experienced billions of years worth of evolution, forming vast and complex communit ies of bacteria, archaea, protists and fungi, within what is said to be the domin ant biome of the E a rt h (DeLong 2009). According to Karl (2002) and Sogin et al. (2006),y man marine microbes are still in the process of being identified as an equally great percentage still remains undiscovered (Karl 2002; Sogin et al. 2006).

Marine microbes play important roles in the oceanic ecosystem by mediating geochemical cycles in the ocean (Arrigo 2005) and allowing for rapid nutrient recycling in an environment that is poor in essential nutri ents (Mayer & Wild 2010). They are said to be responsible for around 98% of overall primary production in the ocean, providin g sustainabilit y to the marine ecosystem (Karl 2002; Sogin et al. 2006). Since Oceans cover appr oximately 40% of the Earth’s surface, marine microbes and their ienvolvem nt in biogeochemical processes are signif icant on a global scale (Karl 2002).

One of the most biologically diverse and productive ecosystem in the world are coral reefs. They are a major source of protein and income to many people (Wilkinson & Buddemeier 1994) and also contribute in revenue earned from tourism, recreation, and education (Wilkinson & Buddemeier 1994). Coral reefs also act as a natural protection between the open seas and coastlines by acting as wave breaks, thus effectively preventing coastal erosion (McLeod et al. 2013). According to Wilkinson (1999), they perform a vital role in protecting coastal areas from the consequences of P a g e | 2

rising sea levels such as storm flooding (Wilkinson 1999). Corals are further known to act as host organisms to diverse bacterial populations (Wegley et al. 2007) and these are the focus of the present study and will be introduced in the following.

1.2 Coral reefs Southeast Asia is home to a large number of coral reefs with an approximate area of 87,000 km2 covered by reefs (see Table A).

Table A: Regional distribution of coral reefs (source: Veron & Stafford-Smith 2000)

Region Reef area (km2) South Pacific 116,200 Southeast Asia 87,760 Indian Ocean 31,930 Middle East 21,450 Caribbean 20,360 Western Atlantic 2.820

Figure 1 shows an overview of reef di stribution in the East Asian Seas and Southeast Asia’s coral reefs have the highest biodiversity of all the world’s reefs (Veron & Stafford-Smith 2000). This region contains more than 600 of the nearly 800 reef building coral species found worldwide (Veron & Stafford-Smith 2000). P a g e | 3

Figure I: Distribution of coral reefs in the East Asian Seas (State of Reefs 19 95 ).

In the following, we introduce the various roles of microbes in coral reefs (with a focus on the surface mucus layer), before we move to introduce threats to coral reefs and their impacts on the microbes. a

1.3 Coral reefs and bacteria

Bacterial communities residing in coral reefs are extremely diverse in their identities (Rohwer et al. 2002) and have been found to play major roles in nutrient recycling(Wild et al. 2004b). There are many different species of bacteria discovered in the coral reefs environment ranging from α-proteobacteria, β- proteobacteria, firmicutes, anaerobes and also actinobacteria (Ducklow & Mitchell 1979a; Tringe et al. 2005; Wegley et al. 2007).Generally, for coral associated bacteria to sustain their normal health and survivability, they have to ensure that they are P a g e | 4

supplemented with adequate amount of nutrition. Corals obtain their nutrition via capturing particulate organic material using their tentacles and also by sharing photosynthetic products that are initially produced by their symbiotic algae (zooxanthellae). The symbiotic algae provide the corals with carbon and energy sources while prokaryotes associated to the corals often seem to provide nitrogen to the corals (Lesser et al. 2004; Shashar et al. 1994). Nitrogen is vital to corals because they need it for synthesizing essential building blocks such as amino acids, purines, pyrimidines and amino-sugars. As for carbon and energy sources, the corals need these for their growth and survival as well. Other than that, reef corals are also host to a group of dinoflagellates symbionts which belong to the Symbiodinium genus. Symbiodiniums are important symbionts tp the coral reefs as their loss in the reefs during coral bleaching phenomenon will lead to mass mortality of coral reefs (Baker 2003).

1.3.1 Coral Surface Mucus Layer (SML) and Bacteria

The coral surface mucus layer (SML) plays a very important role in maintaining the coral reefs ecosystem. It acts as protective physicochemical barrier (Hayes & Goreau 1998; Peters 1997; Santavy & Peters 1997; Sutherland, Porter & Torres 2004), medium for growth of bacteria, barrier for potential marine pathog ens (Duck low & Mitchell 1979a, b), and is also involved in sediment cleansing (Brown & Bythell 2005) Coral mucus is comprised of mucins which are complex mixture of polymeric glycoprotein and also other exudates such as lipids that are secreted by mucocytes of the epithel ium (Brown & Bythell 2005). Mucins are highly heterogeneous glyc oproteins tha t consist of a filamentous protein core to whic h short polysaccharide side- chains are attac hed. The core amounts are made up of about 20 % of the polymer by weight, and the remaining 80 % are carbohydrate (Verdugo 1990). The composition of the coral mucus layer is also greatly affected by the coral algae symbionts as about 20 to 45% of photosynthate are being released as part of coral mucus and dissolved organic carbon (Bythell 1988; Crossland 1987; Davies 1984; Edmunds & Davies 1989). It follows then that during coral bleachin g, when densities of algal symbionts are significantly reduced, both the composition and secretion of mucus may be markedly affected. A P a g e | 5

decrease in mucus release has been shown to negatively affect the coral reef ecosystem (Brown & Bythell 2005).

Since corals are able to obtain additional nutrients via their mucus layer, the potential food resources for their growth is greatly increased (Lewis 1977). These food resources include not only the zooplankton but also some suspended particulate material that involves bacterioplankton, bacterial aggregates(Bak et al. 1998; Sorokin 1973) and other fine particulates, such as silts and fine sands (Mills & Sebens 1997). However, the coral host also known to use up energy for the production of coral mucus layer. For example, about 40% of all carbon fix ed by symbiotic algae in Acropora acuminata goes into mucus production (Crossland 1987). The SML helps corals in protecting them from desiccation, as well as binding or absorbing pollutants such as heavy metals (Brown & Howard 1985; Howard & Brown 1984; Howell 1982) and aromatic hydrocarbons (Neff & Anderson 1981). There are several studies showing an increase of mucus secretion when corals are exposed to mechanic al stresses and pollutants such as crude oil (Mitchell & Chet 1975; Neff & Anderson 1981) and copper sulphate (Mitchellh & C et 1975). In addition, the coral mucus layer also aids in excreting excess organic carbon produced by symbiont photosynthesis of the dinoflagellates on the coral hosts (Davies 1984). Besides acting as protecting layer to the coral host, coral mucus is also involved in reproduction and larval behavior of the coral host. For example, “surface broodin g” is a mode of reproduction that has been observed in the Red Sea soft coral Parerythropodium fulvum fulvum (Benayahu & Loya 1983). This mode of reproduction actually means presence of larvae development in a protective mucous coat surrounding the parent colony.

The coral mucus layer composes of 56 to 80% of a dissolved organic matter (DOM) fraction so it is expected to be readily available for microbial biomineralisation. However, there are also finding by Vacelet & Thomassin (1991) that argued that the released coral mucus layer does not contribute to seawater microbial growth as the dissolved organic matter (DOM) was not readily accessible and/or that the mucus contained bacterial inhibitors (Vacelet & Thomassin 1991). According to Rohwer & P a g e | 6

Kelley (2004), corals have the ability to control the bacterial colonies that inhabit the SML through changing the composition of the mucus (Rohwer & Kelley 2004). By altering the mucus’ composition, the growth of beneficial bacteria (such as nitrogen fixeb rs or acteria tha t inhibit potential pathogens), could be promoted. Recent studies have indeed shown that the bacterial community harboring the surface layer of corals is distinctly diff erent from the bacteria of the water column surrounding the corals (Cooney et al. 2002; Frias-Lopez et al. 2002). The SML was found to contain 100 times the number of culturable bacteria than in of the surrounding seawater (Ritchie & Smith 2004). The coral mucus-associate d bacteria are also several orders of magnitude more metabolically active (Ritchie & Smith 2004) than the ones in seawater column. According to Wegley et al. (2007), the coral-associated microorganisms are mostly heterotrophic as they aid in carbon and nitrogen fixation processes of the corals (Wegley et al. 2007). In return, the carbohydrate-rich mucus is exploit ed by these microorganisms as a medium for their growth. This shows a symbiotic relationship between the bacteria and the coral colony. However, the carbon source utilization pattern by the coral mucus bacteria is coral specific and thus, the utilization pattern differs among different species of corals (Brown & Bythell 2005).The bacterial community does however not contribute much to the amount of carbon content of mucous sheets which is only about < 0.1 % (Coffroth 1990). Oligotrophic tropic al seas lack of nutrients and organic matte r. Therefore, the release of mucus to the seawater can become an important substrate for microbial growth (Linley & Koop 1986; Moriarty, Pollard & Hunt 1985; Paul, DeFlaun & Jeffrey 1986; Wild et al. 2004a; Wild et al. 2004b). Bacterial communities living within the coral mucus layer are viable, functional, and their diversity depends significantly on the physiological state of the coral host (Ducklow & Mitchell 1979a). It has been shown that the organic content of mucus collected from stressed corals was much higher (76 to 82% ash- free dry weight, AFDW) than mucus collected in-situ from unstressed corals (9 to 60% AFDW) (Gottfried & Roman 1983).

The coral mucus layer plays an important role in protecting the coral tissues against bacterial attack. SML acts as a physicbal arrier to microbes inform the surrounding seawater (Cooney et al. 2002) and also helps in mucociliary transport of food particles P a g e | 7

to thep coral poly ’s opening (Ducklow 1990; Sorokin 1978), preventing colonization of potenti al pathogenic bacteria on coral tissues (Garrett & DUCKLOW 1975; Rublee et al. 1980). For example, anti-bacterial activity was not observed against coral- associated bacterial strains isolated from coral tissue and its mucoid surface while very high activity was found against Vibrio sp. isolate d from necrot ic coral tissue in the Red Sea soft Paerythropodium fulvum (Kelman et al. 1998). The specificity of SML antib acterial property is important to allow only specific bacteria to live in association with the coral host while the others are not allowed to. The SML also serves as a medium into which allelochemicals, which have an anti- bacterial role, are deposited (Kelman et al. 1998; Koh 1997; Slattery, McClintock & Heine 1995).

Novel bioactivities of coral mucus have been discovered in the scleractinian coral Galaxea fascicularis in which mucus compounds showed a DNAse-like activity and apoptotic activity against a multiple drug-resistant leukemia cell line (Ding et al. 1999) and also contained a novel anti-tumour compound (Fung & Ding 1998).

As introduced above, the symbiotic interaction between corals and their associated microbial community can influence on coral’s physiolo gy and health. Therefore, many studi es have investigated the pathogens related to coral diseases (Hoegh- Guldberg et al. 2007) and also the beneficial coral- associated bacteria which provides essential nutrients for the coral host (for example, nitrogen) (Wegley et al. 2007) and at the same time protectin g the coral from infection by producing antimicrobial agents that restrict the growth of potential pathogens ( Ritchie 2006 ) .

The occurrence of coral pathogens is closely linked to a weakened state of health and in the following, we highhlight ocean acidification and temperature increase as major threats to corals, and move on to discuss microbial coral diseases.

P a g e | 8

1.4 Threats to coral reefs

Due to the combined effects of global changes (increment in seawater temperature) and local anthropogenic stressors (for example water pollution, industrial pollution, overfishing), the coral reefs survival are threatened. Most reefs are affected by diseases and their health starts to deteriorate during the past few decades.i Accord ng to ( Downs et al. 2005 ) , the emerging pathogen-causing diseases and vast global climate changes have contributed to estimated loss of 30% of corals worldwid e. Coral biologists also predicted that if current stresses on coral reefs are not prevented, most of the world’s coral reefs may be destroyed by the year 2050 ( Downs et al. 2005 ) . Due to the combined effects of global changes (increment in seawater temperature) and local anthropogenic stressors (for example water pollution, industrial pollution, overfishing), the coral reefs survival are thre atened (Richmond 1993).

The increase in CO2 leads to a phenomenon known as ocean acidification (Rodriguez‐ Lanetty, Harii & Hoegh‐Guldberg 2009) which will be introduced in the following.

1.4.1 Ocean Acidification

The ocean plays a fun damental g role in aseous exchange such as absorbing and releasi ng carbon dioxide gas (CO2) with the atmosphere. The factors that affect the

CO2 uptake by the ocean are chemical processes involving the changes to the CO2 buffering capacity (Gruber 1998) and also the effects of temperature on CO2 solubility. Hence, once the normal ocean environmental condition undergo changes (change in pH value of the ocean), marine organism’s growth and survival will be affected too.

The exchange of carbon dioxide gasses between important reservoirs of the biosphere, the atmosphere and the ocean is part of the carbon cycle. The ocean plays an important role as a carbonate buffer. The pH of the seawater is determined - by the composition of three forms of dissolved ino rganic carbon (DIC), CO2, HCO3 and P a g e | 9

2- CO3 . DIC functions as the natural buffer duringa the ddition of hydrogen ions (carbonate buffer). When CO2 is absorbed by the ocean, hydrogen ions will react with readily available carbonate (CO32-) ions, which results in the formation of bicarbonate

(HCO3-) ions. In that case, the hydrogen ions (that increa se ocean’s acidity) added into the ocean via CO2 absorpti on are reduced. Therefore, the change in pH value of the ocean is not very visible (Gruber 1998).

When atmospheric CO2 dissolves in seawater, the acidity of the ocean should increase but because of the efficiency of the carbonate buffer reaction, the seawater remains alkaline. Scientifically, the seawater carbonate chemistry can be explained by a series of chemical reactions below:

+ - + 2- CO2(atmosphere) CO2(aq) + H2O H2CO3 H + HCO3 2H + CO3

The capacity of the carbonate buffer in restricting pH changes of the ocean is however limited (Raven et al. 2005) . Wh en the ocean loses its capability to act as a carbonate buffer, the absorption of CO2 by the ocean will result in the surface waters to become more acidic. This phenomena h a s b e e n t e r m e d called ocean acidification ( Doney et al. 2009 ) . Ocean acidification is predicted to become more severe over the century unless future emissions of CO2 are reduced dramatically (Doney et al. 2009). It is stated that the uptake of anthropogenic CO2 is the major reason why there is long-term increase in dissolved ino rganic carbon

(DIC) and decrease in CaCO3 saturation state in the ocean (Takahashi et al. 2006). Ocean acidification does not occur by itself as it is a phenomenon linked to climate change and other factors (Doney et al. 2009).

According to Millero et al. (2006), the seawater reactions are reversible and near equilibrium for surface seawater with pH of ∼8.1. The released of H+ ions results in reduction of the ocean’s pH. LiberatH ed + will react with the available carbonate 2− − (CO3 ) ion which further increases the bicarbonate (HCO3 ) in the ocean, causing a P a g e | 10

2− reduction in (CO3 ) ions. Changing the acidity of the oceans can cause adverse effects on calcifying marine organisms such as corals and shell animals because these organisms undergo calcification which is impeded progressively as the ocean becomes acidified (Raven et al. 2005). Figure II shows the process of how ocean acidification phenomenon occurs in a simplified chemical equation form. Most carbon dioxide released to the atmosphere due to human activity for example, burning of fossil fuels will be absorbed by the ocean and eventually bring adverse consequences to marine organism particularly calcifying organisms (Gruber 1998).

Figure ii: The Ocean Acidification cycle process which summarizes the whole process on how this phenomenon occurs (UK Ocean Acidification Programme 2012).

Many studies have been carried out to investigate the ocean acidification phenomenon as it has been a rising concern to everyone and researchers are trying to understand the overall phenomenon process in order to come out with solutions to overcome it (Ben-Yaakov & Goldhaber 1973; Gruber 1998; Takahashi, Broecker & Bainbridge 1981).

P a g e | 11

1.4.2 Temperature rise

Back in the twentieth century, there was an average of 1°C increase in temperature, which is the largest in more than 1000 years, and meteorologists are expecting a higher increment in temperature in this centu ry due to excessive pollutions and many other contributing factors (Bijlsma et al. 1996). The rise of temperature in the world will affects the weathe r, sea levels, dist ribution of flora and fauna as well as the environment surrounding microorganisms. Bleaching of corals has been correlated with high seawater temperatures and high levels of solar irradiance (Jokiel & Brown 2004). The phenomena of coral bleaching have been widespread and increased dramatically over the last few decades. The big destruction of coral reefs is highly correlated to increase in seawater temperature, which is indirectly caused by global warming (Rosenberg & Ben‐Haim 2002). According to (Carpenter et al. 2008), coral bleaching and disease outbreaks have been on the rise and several reefs around the world are in danger of extinction. Coral bleaching events have been reported to increase over wide geographical scales over the last two decades and in certain location, the entire coral reefs ecosystems have been badly impacted (Bourne et al. 2008 ). It is also stated that coral bleaching occurs in the world’s three major oceans and involves more than 50 countries worldwide (Wilkinson & Network 2008). Therefore, many studies have been carried out to study the impact of gradual environmental changes such as thermal changes (climate changes) and pH changes (ocean acidification) on the coral reefs ecosystems in order to discover ways to decrease bleaching events.

1.4.3 Coral Bleaching and Coral Diseases

Coral bleaching is defined as the disruption of symbiosis between coral hosts and photosynthetic microalgae endosymbionts (zooxanthellae) (Brown 1997). Coral bleaching is reversible within a few weeks or months, depending on the specific coral species and condition. However, it can cause mortality to the coral species if left to persist as the zooxanthellae, whic h produce the major portion of the coral’s nut rition, P a g e | 12

are gone (Glynn & De Weerdt 1991). It is expected that predicted ocean warming in the current century will result in more coral bleaching events in the future which will lead to mortality of the coral reefs ecosystem (Bourne et al. 2008).

Increases in temperature have also been linked to increase diseased outbreaks and although coral reefs extend to water depths greater than 100 m (Goreau & Wells 1967), hermatypic (reef-building) scleractinian corals are most prevalent and ecologically prone to suffer from diseases as they reside, in warm shallow (less than 10 m), near-shore reef environments. These stony corals develop diseases due to elevated seawater temperatur es and increa se in concentrations of pollutants (Navas- Camacho et al. 2010). The high seawater temperature surrounding the coral reefs influence the outcome of bacterial infections by lowering resistance of the coral to diseases and/ or increasing pathogen growth, infectivity as well as virulence (Rodriguez‐Lanetty, Harii & Hoegh-Guldberg 2009; Ward, Kim & Harvell 2007).

Many disease outbreaks inv olve opportunistic infections by endemic microbes following periods of stress ( B ourne et al. 2009 ; Lesser et al. 2007 ) . Bleached corals are additionally vulnerable because the loss of algae reduces the concentrationo of xygen and the resulting radicals that protect the coral animal (Banin et al. 2000b). One good example of how closely linked coral bleaching and disease outbreaksare, was shown by studies on the scleractinian coral O.patagonica along the Mediterranean coast of Israel in the year of 1993 (Fine & Loya 1995). Similar to other bleaching phenomen a, it occurred due to relations with high sea-water temperature which lead to loss of endosymbiotic zooxanthellae and also impairment in the coral’s reproductive ability (Rosenberg & Ben-Haim 2002). When the corals are exposed to increase in sea-water temperature up to 29°C, the bleaching occurred. Firstly, the infection process started with adhesion of the V.shiloi to a beta-galactoside- containing receptor on the coral surface (Toren et al. 1998) and the adhesion process was specific between the coral host and bacteria. Adhesion of V.shiloi on coral host only occurs when the temperature surrounding the corals have been elevated to 25- 30°C (Rosenberg & Ben-Haim 2002). This showed that environmental stress condition P a g e | 13

such as higher sea-water temperature is needed to cause coral bleaching marine pathog en to initiate infection on the coral host itself and become virulent itself. Other than that, the synthesis and secretion of the bacterium’s receptor requires active photosynthesis process by the zooxanthellae in the coral mucus layer (Banin et al. 2000b). After adhesion of the receptor on the coral host, the bacterium V. shilo i will penetrate into the epidermal cells of the coral host. Then, these bacteria will start to differentiate and multipintly racellularly. Althou gh V.shiloi appears as viable –but-not- culturable state (VBNC) in the epidermal cell, theya re highly infectious (Israely, Banin & Rosenberg 2001). Once the V.shiloi penetrates the coral host and become virulent, it will produce extracellular toxins that block photosynthesis, bleach and lyse zooxanthellae (Rosenberg et al. 1999). This bacterium produces heat-sensitive, high molecular weight toxins which function in bleachingg and lysin isolated zooxanthellae especially when exposed to temperature at 28°C (Rosenberg et al. 1999).

There have been numerous reports being made on different types of coral diseases for the last 20 years (Rosenberg & Ben-Haim 2002). For example, black band, white band, red band, yellow band, dark spot, white pox and many other necrosis diseases. As mentioned above. Infectious diseases could often be correlated to the increment in seawater temperature. For example, coral diseases occur when there is increased in virulence of the marine pathogen, increased in the sensitivity of the host to the pathogen, higher frequency of transmission via a vector or the combination of all three factors (Rosenberg & Ben-Haim 2002). . Table B summarises well-studied coral diseases, their causative agents, the coral species involved and also the relevant scientific publication.

Table B: Overview of coral di seases, their common hosts and pathogens. Disease Hosts Pathogen Reference

Bleaching Oculina Vibrio shiloi (Kushmaro et al. 1996)

Bleaching and tissue Pocillopora Vibrio corallyliiticus (Rosenberg et al. 2008) lysis Black Band Many species Consortium (Antonius 1973)

P a g e | 14

White Band Acropora Vibrio charcharia (Gladfelter 1982) (Peters 1993) (Ritchie & Smith 1995)

Coral Plague Acropora, Sphingomonas sp. (Dustan 1977; Dichocenia Richardson et al. 1998) and other Aspergillosis speciGorgoens acea Aspergillus sydowii (Ritchie & Smith 1995; Smith et al. 1996)

The consortium contains Phormidium corallyticum, a marine fungus, Desulfovibrio and Beggiatoa.

spp. As for coral’s black band disease, it was first investigate d by (Antonius 1973) and it is known as a dark band that moves around across coral colonies destroying coral tissues. According to (Kuta & Richardson 1996), this disease is most active on warm summer days. Durin g the occurrence of black band disease on corals, heterotrophic and photosynthetic bacteria were discovered. For example, a few bacteria were ide ntified as the possible marine pathogens that caused the disease such as Phormidium corallyticum( Antonius 1981; Rützler & Santavy 1983), a marine fungus (Ramos- Flores 1983) , s Beggiatoa pp. (Ducklow & Mitchell 1979b) and sulphate-reducing bacteria (Garrett & Ducklow 1975). The microbial communities found during the occurrence of black band disease produces high level of sulphide whic h harms the coral’s tissue. In order for the spreading and presence of black band disease, the presence of Desulf ovibrio sp. and sulphate-reducing bacterium are needed to establish a complete set of conditions (sharp gradients of oxygen, sulphate-sulphide and nutrients) (Antonius 1981). In addition, Cooney and colleagues also discovered the presence of a Cytophaga sp., an α- Proteobacteriaium and a single cyanobacterial durin g the spreading of the disease (Cooney et al. 2002).

Another well-known coral disease is the white band disease. This disease is known as a white band appearing of bare coral skeleton of seen at the base of the coral Acropora P a g e | 15

sp. (Gladfelter 1982). The microbial communities present in the corals that are infected wit h white band disease are mostly gram-negative bacteria which, indirectly means these bacteria are mostly the causative agent of the disea( se Rosenberg & Ben‐Haim 2002). However, it is not proven yet that these gram-negative bacteria are the confirm ed causative agent of the disease as the pathogenicity is not tested. White band diseases are said to occur in two forms. Ritchie & Smith (1998) stated that type 1 white band disease shows coral tissue undergo major necrosis while type 2 shows bleached area on the coral that subsequently lysed (Ritchie & Smith 1998). According to (Ritchie & Smith 1998; Ritchie & Smith 1995), they found out that Vibrio charcharia is always present in the corals that infect ed by white band disease type 2. Moreover, corals can also suffer from plague which is described further as spreading disease of massive and plate-forming corals which in the end leads to mortality of coral’s individual colonies (Dustan 1977). It was found that Sphingom onas sp. is one of the causative agent of this plague disease (Richardson et al. 1998). Researchers have managed to identify a few causative agents that contribute to the occurrence of certain coral species’ bleaching and diseases. For example, the bleaching phenomenon of coral Oculina patalogica is caused by a marine pathogen named Vibrio Shiloi (Kushmaro et al. 1996) while the bleachin g of coral Pocillopora damicronis by Vibrio coraliilyticus (Rosenberg & Ben-Haim 2002), the black band disease is caused by a microbial consortium (Antonius 1973), sea-fan disease which is better known as “aspergillosis” is caused by Aspergillus sydowlii (Smith et al. 1996) and lastly, the coral white plague disease caused by Sphingom onas sp. (Dustan 1977; Richardson et al. 1998).

Althou gh the coral mucus layer serves as a protection against pathogenic bacterial infi ect on, there is also an exceptional case. For example, there is a study tha t showed that the Mediterranean coral Oculina patagonicaw as infect ed by V.shiloi, a pathogen that targets the symbiotic algae of the coral (Kushmaro et al. 1998;Kushmaro et al. 1997; Rosenberg & Ben-Haim 2002). Its infection is due to the fact the bacteria is able to adhere to the coral mucus layer (Banin et al. 2000a). The study also shows that adhesion of the pathogen to the coral was reduced when there was depletion of the mucus layer and also the reduction in the symbiotic algae presence. For this case, it can P a g e | 16

be seen that the pathogen utilizes the mucus layer’s component to enter the coral host.

1.4.4 Coral diseases and the role of microbes in coral surface mucus layer (SML)

Disease susceptibilit y is positively correlated with a change in coral SML pcom osition, loss of antibiotic activity and an increa se in pathogenic microbes (Reshef et al. 2006b). The bacterial communities of diseased corals are different from healthy ones, both qualitatively and quantitatively (Reshef et al. 2006). The bacterial population of apparent ly healthy corals undergo changes within a period of a few months, probably as a result of temperature changes (Koren & Rosenberg 2006). Previous studies have shown a sudden shift to pathogen dominance occurring in the coral SML prior to a bleaching event (Ritchie 2006; Rosenberg & Ben-Haim 2002) and it has been demonstrated that antibiotic activity and antibiotic- producing bacteria in the SML decline in times of increased water temperature when bleaching is most likely to occur (Ritchie 2006). One possible explanationf or an increased in cidence of coral diseases is stress-induced susceptibilityo to pportunistic microbes trapped in the coral SML (Ritchie 2006). Indigenous bacteria may help prevent infection by pathogens by producing antibacterial materials (Koh 1997).

Vibrio shiloi is a known bacterial pathogen to the coral Oculina patagonica found in the Medit erranean sea (Kushmaro et al. 2001; Kushmaro et al. 1996; Kushmaro et al. 1997). It induc es bleaching by reducing the amount of viable zooxanthellae available for symbiosis with the coral. This is achieved by the secretion of a toxin (a proline-rich, 12 amino acid peptide) (Banin et al. 2000a) that inhibits photosynthesis, and bleaches and lyses zooxanthellae (Rosenberg et al. 1999). Vibrio shilon ii only actively pathogenic at temperatures of 20-32°C and displays maximum efficacy around 29- 30°C (Kushmaro et al. 2001).

A more recently discovered temperature-dependent agent of bleaching is Vibrio coralliilyticus which infects the coral Pocillopora damicornis (Ben-Haim et al. 2003). A patchy pattern of bleaching of Pocillopora damicornis has been observed at 24 °C, P a g e | 17

suggesting that bacterial bleaching results from an attack on the zooxanthellae, followed by bacterium-induced coral lysis and death caused by bacterial extracellular proteases which were produced at temperatures of 24 to 28 °C ( Be n - H a im , Zicherman-Keren & Rosenberg 2003 ) .

There is evidence that a community shiftt in he coral SML from beneficial bacteria to Vibrio -dominance occurs prior to zooxanthellae loss (Ritchie 2006). Studies have shown that Vibrio may be normal constituents of the coral microbial assemblages and can opportunistically proliferate if holobiont health is compromised (Bourne & Munn 2005a). Previous studies have implicated Vibrio sp. as the principal causative agent in seasonal and species-specific episodes of coral bleaching (Ben-Haim et al. 2003; Kushmaro et al. 1996; Kushmaro et al. 1997). Three separate studies (Ben-Haim, Zicherman-Keren & Rosenberg 2003; Kushmaro et al. 1996) showed that the number of Vibrio in coral SML did increa se with increa sing temperatures. In elevated temperatures, Vibrio sp. will produce a photosynthesis inhibit( or Rosenberg et al. 1999), thereby allowing them to multiply, leading to overgrowth and in turn, causing the loss of anti biotic properties of the SML inhabiting microorganisms (Ritchie 2006). It was speculated that the endosymbiotic zooxanthellae (Symbiodinium sp.) play a significant role in restricting Vibriow gro th in the coral SML by producing free radicals (Sharon & Rosenberg 2008) but their limited temperature tolerance leads to the loss of the protective function for the coral.

Elevated sea water temperatures can also indu ce pathogens to produce adhesions that allow it to adhere to the coral surface and subsequently establish infections in the pathogenic systems of the coral (Banin et al. 2000a). The production of toxins and lytic enzymes which cause bleaching and lysisz of ooxanthellae were also found to be temperature-regulated (Banin et al. 2000a).

Sin ce mucus-associated bacteria play a major role as a first line of defence against pathogens (Shnit-Orland, Sivan & Kushmaro 2012), and are of significance to the survival of coral reefs in the area, the present study aimed to investigate: P a g e | 18

 the bacterial communities in three different coral species, namely Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp. and  the shift in the bacterial community associated to these three corals when their surrounding temperature and carbon dioxide concentrations were increased.

Trachyphyllia geoffroyi and Euphyllia ancora belong to the order of scleractianian and they are the most basal eumetazan taxon that provided the biological and physical framework for coral reefs (Mydlarz, Jones & Harvell 2006). Although Corallimorphs sp. is not classified under the order of scleractinian corals, they are closely related to scleractinian corals. Scleractinian corals play an important role as they form the tropical coral reef ecosystems adjacent to developing countries (Mydlarz, Jones & Harvell 2006). In addition to that, they also support major industries such as in terms of food production, tourism, and biotechnology development (Vidal-Dupiol et al. 2011). Coral mucus associated bacteria that took over at higher temperatures were likely pathogenic to the coral host (Banin et al. 2000a). In an extension to the above questions, we performed phage assays to identify potential bacteriophages that could potentially in the future be utilised as a treatment for diseased corals.

1.5 Phage Therapy

Bacteriophages are bacterial viruses that play an important role in the evolution of theira host nd whole genome sequenci ng of the bacteria showed that phage elements contribute to sequence diversity and are potential to influence bacterial pathogenicity (Hanlon 2007).One of the best approaches to combat the issue of deteriorating coral’s health condition due to diseases is through the application of phage therapy. Bacteriophage (phage) therapy is defined as using phages or their products as bioagents for the treatment or prophylaxis of bacterial infectious diseases (Matsuzaki et al. 2005 ). Phage therapy is said to be a better approach in curing coral’s disease rather than other methods such as immunization and antibiotic P a g e | 19

treatments. This is due to the fact that in troduction of antibiotics in an open system like the coral reefs is not practical and corals generally do not possess an adaptive immune system (Nair et al. 2005). Phage therapy of coral diseases has many advantages such as host specificity, self-replication ability and it is an environmentally safety procedure (Efrony et al. 2006). Besides, phages used for phage therapy only targets on specific pathogens and thus will not harm the remaining beneficial microorganisms. In addition, phage multiplies at a very fast rate at the expense of its host bacterium which in the end will increa se the phage titer leading to more effective control of the specific pathogen (Efrony et al. 2006). According to Weld et. al. (2004), the phage concentrati on will also decline once the pathogens concentration starts declinin g (Weld, Butts & Heinemann 2004). Therefore, this therapy is a good alternative to help in combating coral diseases worldwide.

To hypothesize, changes of temperature and carbon dioxide (CO2) will affect the diversity of coral-mucus associated bacteria. P a g e | 20

1.6 Aims of the present study and dissertation outline

In this present study, the main aim of the project is to investigate the diversity of microbial community associated with the coral of Corallimorphs sp. (Mushr oom coral), Euphyllia ancora (Hammer coral) and Trachyphyllia geoffroyi (Brain coral) to under stand the bacterial community that reside in the m. Besides investigatingl the cora mucus-associated bacterial communities of the three corals, the second aim of the project is to understand the dynamics of the bacterial community development changes when the corals are exposed to environmental changes (eg. surrounding temperature changes). The third aim of the study is to in vestigate potential bacteriophages isolates that can inhibit growths of potential marine pathogens.

The objectives of this study are:

 To isolate and identify microbial communities associat ed with the coral mucus layer for the selected scleractini an stony corals.  To assess the effects of elevated temperatures on the microbial communities.  To identify potential bacteriophage isolates that can inhibitw gro ths of potential marine pathogens.

The results obtained will contribute in our understanding of the coral’s health (Bourne et al. 2009) which will eventually aid in searching for potential ways to solve the current deteriorating coral reefs' health. P a g e | 21

CHAPTER 2

2 Methodology

2.1 Methodology Overview

In the beginning, culture-based studies were applied by microbiologist in order to study the marine microbi al diversity. Although this methodology enables microbiolog ist to gain understandin g about the marine microbial diversity, there are a number of limitations in this method such as the inabili ty to detect those ‘uncult urable’ bacteria (Jørgensen 2006). Today, the advances in molecular biology have brought ecolo gical studies in microbi ology to even greater heights. Physiological and biochemical studies, previously hindered by obstacles in culturing the ‘ unculturable’, can now be carried out to establish the identities, phylogenetic relationa ships nd metabolic processes of both cultured and uncultured microbial populations via DNA or RNA based methods (Jørgensen 2006).

The characterization of microbes by genera and species, which previously could not be achieved through biochemical methods alone, can now be carried out with the help of sequence-classifier algorithm s (Petrosino et al. 2009). Sequencin g studies are conventionally carri ed out via the Sanger method (Sanger, Nicklen & Coulson 1977) which is wid ely used in microbial population studies. Sequencing provides us with an in dication of whether specif ic genes of interest (for example a bacterial group) are present in a sample (Rajendhran & Gunasekaran 2011). In this study, coral mucus- associated bacteriawere investigated using both approaches; culture based, as well as molecular approach. A summary of the methods utilised is provided in the following in form of a flowchart. P a g e | 22

Assessing bacteria community of coral mucus-associated bacteria from Week 1 to Week 11 Cuturing for pure bacterial isolates and Genomic bacterial DNA Extraction DNA Extraction

Amplification of genes via PCR

16S rDNA ARISA and DGGE Fingerprinting Analysis

Phylogenetic Trees construction , Results and Discussions Identifying types of coral mucus Detecting the bacteria that present and associated bacteria and their enzymatic disappear during changes in properties environmental condition

Screening of potential bacteriophage

Detecting the presence of plaques caused by isolated phages on the selected potential coral pathogens and sequence the postiive resutls for phages identities

Figure III: Overall methodology flowchart that summarizes the overall experimental procedures. The identity and enzymatic properties of Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp. mucus-associated bacteria were assessed and potential coral pathogens isolated were tested against potential bacteriophages to detect whether their growth could be inhibited by the potential bacteriophages chosen (phage therapy). P a g e | 23

2.2 Field Sampling and Experimental Set Up

The selected coral samples; Euphyllia ancora, Corallimorphs sp., and Trachyphyllia geoffroyi (Figure IV) were obtained from Aquadot Aquarium Shop, Kuching, Malaysia in 1st July 2014 and placed into a 240 litre aquaria tank. The corals were allowed to settle in the tank for a period of 4 weeks before any changes of temperature and carbon dioxide content in their surrounding were applied.

Euphyllia ancora coral

Corallimorphs sp. coral P a g e | 24

Trachyphyllia geoffroyi coral

Figure IV: Types of coral species investigated in this experimental study (top left: Euphyllia ancora; top right: Corallimorphs sp. and bottom left; Trachyphyllia geoffroyi.) The main equipment used to monitor the aquarium conditions are the WTW 3420 Multiparameter and LI-COR 820 Carbon Dioxide Analyzer (Figure V). The WTW 3420 Multiparameter is a device used to measure and monitor the two parameters namely the DO (dissolved oxygen) and pH value of the set-up aquarium tank. The software used to output the data is called the SoftwareMultiLab® User (WTW Xylem Brand).

LI-COR 820 measures carbon dioxide content (ppm) via pumping air to the air inlet and passing the sample gas through the instrument's optical path. As for data collection, four convenient data output options are available such as Windows® Interface Software, Analog Outputs, Digital Outputs and lastly the XML Communications Protocol (LI-COR Environmental Home). The sampling intervals for throughout the experiment are 30 minutes interval time.

LI-COR 820 Carbon Dioxide Analyzer WTW Multi 3420 Multiparameter

P a g e | 25

Figure V: llustrations of experimental instuments used to monitor the parameters in the aquaria

The overall experimental period was a total of 9 weeks. The starting date of the experiment was from 26.07.2013 and ended on 29.10.2013. Table C summarises the detail on the exact dates of the experiment and also the changes in the parameters throughout the experimental weeks. The experiment is divided into 4 different sets of environmental conditions which are going to be discussed in the following paragraphs.

Table C: Overview of parameters (pH, CO2, dissolved oxygen, temperature) observed during weeks 1 to 9

Date of 26.07.2013- 23.08.2013- 06.09.2013- 09.10.2013- Experiment 22.08.2013 05.09.2013 19.09.2013 29.10.2013

Week of Week1 to Week 5 to Week 7 to Week 9 Experiment Week 4 Week 6 Week 8

Temperature (°C) 25 27 29 29

Carbon dioxide 380 450 450 ~2000 (ppm) pH value 8.1 8.1 8.1 7.5

Dissolved oxygen ~101 ~101 ~101 ~101 (%)

2.2.1 Week 1 to Week 4 The selected corals for testing were maintained in artificial seawater (Red Sea Salt) at a set of controlled parameters during Week 1 to Week 4 of the experimental period:

 Temperature (°C): 25 P a g e | 26

 Carbon dioxide (ppm): 380  Dissolved oxygen (%): 100  pH value: 8.1

Figure VI shows that the conditions did not vary significantly.

Figure VI: Graph showing overall parameters during week 1 to 4 of the experiment. Dissolved oxygen and carbon dioxide is shown on primary y-axis, pH and temperature on secondary y-axis.

2.2.2 Week 5 to Week 6, Temperature increase to 27°C

The selected corals for testing were maintained in artificial seawater (Red Sea Salt) at a set of controlled parameters during Week 1 to Week 4 of the experimental period:

 Temperature (°C): 27  Carbon dioxide (ppm): 380  Dissolved oxygen (%): 100  pH value: 8.1 P a g e | 27

Figure VII shows that the temperature was constant around 27°C and other parameters were stable.

Figure VII: Graph showing overall parameters during week 5 to 6 of the experiment. Dissolved oxygen and carbon dioxide are shown on primary y-axis, pH and temperature on secondary y-axis.

2.2.3 Week 7 to Week 8, Temperature increase to 29°C

The selected corals for testing were maintained in artificial seawater (Red Sea Salt) at a set of controlled parameters during Week 1 to Week 4 of the experimental period:

 Temperature (°C): 27  Carbon dioxide (ppm): 380  Dissolved oxygen (%): 100  pH value: 8.1 P a g e | 28

Figure VIII shows that the temperature was constant around 28°C and other parameters were stable.

Figure VIII: Graph showing overall parameters during week 7 to 8 of the experiment. Dissolved oxygen and carbon dioxide is shown on primary y-axis, pH and temperature on secondary y-axis.

2.2.4 Week 9, Temperature 25°C and CO2 increase

The selected corals for testing were maintained in artificial seawater (Red Sea Salt) at a set of controlled parameters during week 9 of the experimental period:

 Temperature (°C): 25  Carbon dioxide (ppm): 380  Dissolved oxygen (%): 100  pH value: 8.1

Figure IX shows that the temperature was constant around 25°C and other parameters were stable, except the CO2 increase upto close to 2500 ppm. P a g e | 29

Figure X provides an overview of the CO2 and temperature over the course of the whole experiment.

Figure IX: Graph showing overall parameters during Week 9 of the experimental weeks. Dissolved oxygen and carbon dioxide is shown on primary y-axis, pH and temperature on secondary y-axis.

P a g e | 30

Figure X: Graph showing Week 1 to week 9 overall experimental period for carbon dioxide (ppm) and temperature (°C) in the aquaria. Carbon dioxide is shown on primary y-axis, temperature on secondary y-axis.

After the conclusion of the experiment, Euphyllia ancora a nd Trachyphyllia geoffroyi were dead (see Figure XI), whereas Corralimorphs sp. was struggling but still alive (Figure XI).

P a g e | 31

Euphyllia ancora • The coral experiences bleaching and gradually loses its polyps till it undergo mortality when temperature rised up to 30°C and with elevated CO2 content. The mucus secretion reduces gradually throughtout the experiment.

Trachyphyllia geoffroyi • The coral experiences bleaching and increases in mucus secretion when undergo thermal stress (27°C). It undergo mortality when temperature rised to 30°C along with elevated temperature. The colour changes from neon green and red centre to faded color and dry skeletal condition.

Corralimorphs sp. • The zooxanthellae that resides on the corals survived and threfore the coral does not undergo mortality throughout the experiment. There is no change in the morphology condition except producing less mucus secretion when the coral is exposed to temperature up to 30°C.

Figure XI: The condition of Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp. after a period of 9 experimental weeks.

P a g e | 32

2.3 Laboratory procedures

The first step to obtain the bacterial community identity associated to Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp. is the need to extract their DNA. DNA extraction is a step of removing the deoxyribonucleic acid (DNA) from the bacterial cells. The target of any isolation and extraction procedure should be to maximise yield and purity of the resulting DNA. The yield of DNA is important for increasing the efficiency of lysis, as a yield 9 μg instead of 10 μg from the same sample can mean either 90% efficiency of the lysis of all the different cells present or lysis of only 90% of cells which are the most sensitive to the lytic protocol used (Rohwer et al. 2001). Purity will determine the extent to which the microbial DNA template can be analysed by PCR for community analysis. Also different PCR primers vary in sensitivity to impurities. Pure DNA is essential also for other molecular techniques.

2.3.1 Isolation and DNA Extraction of coral mucus associated bacteria

Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp. mucus layer were extracted on weekly basis starting from week 1 to week 9 respectively. The corals are taken out from the aquaria tanks left in a beaker to let their mucus layers drip into the beaker for collections. Then, in order to culture only the original residents of coral mucus layer, steps for inhibition of potentially invasive microorganisms were applied. For every tested coral samples, 50 µl of the fresh undiluted coral mucus samples were collected from the corals and using a pipette and spreader, the mucus was spread evenly onto the half-strength marine agar plate (HI-MEDIA) and allowed to dry for 10 minutes (Ritchie 2006). These mucus treated plate were sterilized via UV irradiation by placing the plates onto laminar flow for UV irradiation treatment (10 mins at 320 nm wavelength) as previously described by Ritchie KB (2006). UV irradiated mucus-treated plates that were un-inoculated by mucus sample were used to control for complete UV killing in the experiment. Then, the inoculated plates were spread with another 50 µL of mucus layer on top evenly. Each sample was made duplicates. Then, these plates P a g e | 33

were incubated for 48 hours at 30 °C, followed by continuous sub-culturing and isolation for purification(Ritchie 2006).

To extract the DNA of the pure isolates, the colony of each pure culture was inoculated in 10ml of marine broth (HI-MEDIA) and left overnight for growth. Then, the inoculated cultures were spun in 13,000g for 20minutes and the supernatant were removed. 100µL of autoclaved TE buffer was added to each bacterial pellets and the mixture was vortexed to homogenize. Then, 3 cycles of freeze-thawing (5 minutes in -80 °C followed by 3 minutes in 85 °C) were carried out(Ritchie 2006). Gel electrophoresis on an agarose gel containing ethidium bromide (1 %, 100 V, 35 min) and viewing under UV light and Geldoc was carried out to confirm the presence of the crude bacterial DNA. Figure XII shows an example of crude bacterial DNA extracted from the pure isolates.

L1 L2 L3 L4 L5 L6 L7 L8 L9 L10 L11

Figure XII: Crude DNA Extraction of bacterial isolates-associated to Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp. on gel Band with 1kbp DNA ladder. L1 (Lane 1) represents the 1kbp DNA ladder. L2-L11 represent the DNA smears of P a g e | 34

bacterial isolates-associated to Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp.

2.3.2 Molecular characterisation

Small subunit ribosomal RNA (16S rRNA) has been proven to be most useful for establishing evolutionary relationships because of their high information content, conservative nature, and universal distribution (Lane et al. 1985). The 16S sequence analysis is used in two major applications: (a) identification and classification of isolated pure cultures and, (b) estimation of bacterial diversity in environmental samples without culturing through metagenomic approaches. New bacterial isolates are identified based on the 16S sequence homology analysis with existing sequences in the databases (Rajendhran & Gunasekaran 2011).

Sequence analysis is chosen as one of the methods to assess the biodiversity of the coral mucus associated bacteria because is the ability to use it for generation of additive and retrievable data which can be used to generate phylogenetic probes and primers for use in further studies (McCaig, Glover & Prosser 1999).

The bacterial DNA were amplified by polymerase chain reaction (PCR) and PCR products were purified using PureLink® PCR Purification Kit following the manufacturer’s protocol (Invitrogen Life Technologies). Amplification of bacterial 16S rRNA genes was performed with primers 8F (Eden et al. 1991) and 519R (Lane et al. 1985). The availability of this set of universal 16s rRNA gene primers made the amplification of a mixed population of 16s rRNA possible and enable the characterization of phylogenetic diversity of coral-associated bacteria communities (Rohwer et al. 2001). Amplification was performed by using REDTaq® ReadyMix™ PCR Reaction Mix (Sigma Aldrich) using instructions provided by the Sigma Aldrich. An overview of the reaction mixture in each PCR tube is provided below in Table D. P a g e | 35

Table D: Components of 16S Rrna PCR reaction per PCR tube Components Volume (L)

2x Bioline Red Taq Mix 12.5

Forwardprimer 1.0 8F (AGAGTTTGATCCTGGCTCAG)

Reverse primer 1.0 519R (GWATTACCGCGGCKGCTG)

DNA template 3.0

ddH2O 7.5

Final volume 25.0

Amplification reactions were performed as follows: initial denaturation at 94°C for 5 min, followed by 30 cycles of 94°C for 30 sec, 55°C for 30 sec, 72°C for 45 sec, and final extension at 72 °C for 10 min (Eden et al. 1991). PCR reaction results were checked using 1% agarose gel containing 1 µg of ethidium bromide per ml for pure DNA bands (see Figure XIII) via electrophoresis (100V, 40 min), then sent for sequencing to BGI Tech, Hong Kong. P a g e | 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22

Figure XIII: PCR bands result obtained from amplification of bacterial 16S rRNA genes of bacteria-associated to Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp. on gel band with 1kbp DNA ladder. L1 (Lane 1) represents the 1kbp DNA ladder. L2- L22 represents the DNA smears of bacterial isolates-associated to Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp.

Nucleotide sequences were determined by the dideoxynucleotide method by cycle sequencing of the purified PCR products. An ABI Prism BigDye Terminator Cycle Sequencing Kit was used in combination with an ABI Prism 877 Integrated Thermal Cycler and ABI Prism 377 DNA Sequencer (Perkin Elmer Applied Biosystems).

2.3.3 Construction of phylogenetic trees for coral mucus-associated bacteria

A total of 265 isolates were isolated from the three selected corals mucus layer samples (Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp.) via culturing method. However, only 104 amounts of isolates are successfully sequenced for their identity via Sanger sequencing (see Figures Figures XXVI, XVII and XXVIII for P a g e | 37

phylogenetic trees). This is due to some experimental errors such as failure in optimization PCR condition for certain isolates, complications in yielding pure PCR samples and low concentration of bacterial DNA extracted.

Returned DNA sequences were analysed using Basic Local Alignment Search Tool software (NCBI) and Chromas 2.22 (Zhang et al. 2000). Phylogenetic analysis was performed with Mega6.0 software. Sequences were aligned with ClustalX. BLASTN from the source http://www.ncbi.nlm.nih.gov/BLAST/BLAST.cgi was then used to characterize each sequence cluster. The phylogenetic tree was generated with distance methods, and sequence distances were estimated with the neighbour-joining method. Bootstrap values ≥50 are shown and the scale bar represents a difference of 0.05 substitution per site. Accession numbers for the reference sequences are indicated. Resulting trees are presented in FiguresI XXV , XVII and XXVIII.

Phylogenetic analysis and culture-based approaches used in this study provide information regarding the identity of microbes present in the coral mucus layer and at the same time also some information regarding the elucidation of true coral residents which are microbes that benefits the coral host, zooxanthellae or other resident microbes.

2.3.4 Indices for Bacterial Diversity

In order to retrieve more information about the bacteria diversity associated to the coral mucus layer, a few ecological diversity indices are applied. These diversity indices are defined as mathematical measures of species diversity in a community (Beals, Gross & Harrell 2000). Diversity indices generally compare the diversity among microbial communities that enables us to quantify the diversity within the communities and describe their numerical structure (see Table E).

These mathematical formulae provide important information about rarity and commonness of species in a community. Therefore, the ability to quantify diversity in this way is a useful tool to understand community structure. P a g e | 38

Table E: List of Variables for Biodiversity Indices

H Shannon's diversity index

S total number of species in the community (richness)

N Total Number of Isolates

pi proportion of S made up of the ith species

EH equitability (evenness)

J’ Shannon Evenness

DMg Margalef Index

The first index method applied is the Margalef Index (DMg) which functions in measuring the species richness and is highly sensitive to sample sizes although it tries to compensate for sampling effects (Magurran 2004). It is calculated in this formula:

DA= (S-1)/logeN

Where S is the number of bacteria species, N is the total number of species present in the coral on respective weeks. According to (Gamito 2010), DMg is a more accurate index if data is related to species richness as it uses absolute numbers compared to a density data matrix. Berger and Parker (1970) also stated that Margalef Index is useful in conjuction with indices sensitive to evenness or changes in dominant species(Berger & Parker 1970). Besides this method, another commonly use index formula called Shannon index (H’) is also applied. The Shannon diversity index (H) is another index that is commonly used to characterize species diversity in a community(Gamito 2010). Shannon's index accounts for both abundance and evenness of the species present. This method considers proportions which will ensure no differences when using either data set (Gamito 2010). The proportion of species i relative to the total number of species (pi) is calculated, and then multiplied by the natural logarithm of this proportion (lnpi). The resulting product is summed across species, and multiplied by -1: P a g e | 39

As a result, if the particular sample has the highest H’, it appears to be the most diverse. The Shannon evenness index (J’) is derived from H’ which therefore makes it sensitive to changes in evenness of rare species, thereby possibly overestimating its true value (Hill et al. 2003). The Smith and Wilson evenness index (Evar), however, is known to show greater resolution in reflecting true values (Blackwood et al. 2007).

Shannon's equitability (EH) can be calculated by dividing H by Hmax (here Hmax = lnS). Equitability assumes a value between 0 and 1 with 1 being complete evenness.

2.3.5 Fingerprinting Analyses

In order to assess the changes in the bacterial communities associated to the coral mucus layer, advanced molecular fingerprinting techniques such as denaturing gel gradient electrophoresis (DGGE) (Ferris, Muyzer & Ward 1996) were applied in this study. The use of molecular biological techniques is getting more popular and is frequently used to explore microbial diversity (Muyzer & Smalla 1998) . This advanced technique has also aid in overcome the limitations of traditional cultivation techniques to retrieve the bacterial diversity (Muyzer & Smalla 1998). Examples include Denaturing Gradient Gel Electrophoresis (DGGE), Temperature Gradient Gel Electrophoresis (TGGE), Terminal Restriction Fragment Length Polymorphism (T-RFLP) and (Automated) Ribosomal Intergenic Spacer Analysis (ARISA). These molecular techniques have in common that they determine the variants of a certain gene (often the small subunit ribosomal RNA; ssu rRNA or 16S rRNA in case of bacteria) and use this measurement as a proxy for the actual microbial cell abundances in the sample. It is thereby assumed that each gene variant (apparent as a band or peak in the fingerprint) corresponds to a certain microbial taxon, often referred to as a phylotype or Operational Taxonomic Unit (OTU) (Muyzer & Smalla 1998).

For this study, ARISA and DGGE analysis methods were chosen because both are genetic fingerprinting techniques which provide a pattern or profile of the genetic P a g e | 40

diversity in a microbial community. The details of these methods are provided in the following procedures below.

2.3.5.1 Extraction of genomic DNA from coral mucus samples

In order to perform DGGE and ARISA analysis, the genomic DNA of corals’ bacteria needs to be extracted. Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp. mucus layers were extracted weekly throughout the experiment. The mucus for molecular analysis was collected by holding the corals out of the water for 3 minutes, rinsing them with seawater from the tank and dripping the freshly produced mucus into autoclaved 1.5 ml Eppendorf centrifuge tubes. Mucus samples were maintained at -20°C and processed within 2 hours of collections to prevent DNA degradations.

Initially, genomic DNA of coral mucus layer was extracted via the Nucleospin protein purification kit (Macherey-Nagel, Duren, Germany). However, the product yielded very low DNA concentrations. Another conventional method was also applied which is by using the beat beater to break apart or "lyse" the bacterial cells in the early steps of extraction in order to make the DNA accessible. Glass beads are added to an Eppendorf tube containing a sample of interest and the bead beater vibrates the solution causing the glass beads to physically break apart the bacterial cells in 8000 g for 1 minute. The results were negative as there was very little genomic DNA detected via gel electrophoresis. It could be due to excessive break down of the cells causing damages to the bacterial DNA. Hence, another method for genomic DNA extraction was applied which is by using SDS/Proteinase K. First, lysozyme was added (75 µL of 100 mg /ml) to the mucus samples and incubated at 37°C for an hour followed by 3 cycles of freeze and thaw (-80°C and +65°C). Lysozyme was added to break down the lipid membranes so that the DNA in the bacterial cells can be freed (Bourne et al. 2008). Then, sodium dodecyl sulphate (SDS) was added (100µL of 25%) then mixed and incubated at 70°C for 10 minutes. SDS is a detergent that used to further break down the lipid membrane of the bacterial cell wall. The samples were cooled to room temperature before adding 10 µl of 20 mg ml of Proteinase K solution and followed by incubation in 37°C for an hour. The proteinase K solution is used to digest the P a g e | 41

contaminating proteins of the bacteria cells. Then, another 3 cycles of DNA freeze and thaw method is applied to further rupture and lyse the bacterial cell wall so that the bacteria DNA can be obtained (Bourne et al. 2008). Samples were then spun in centrifuge machine for 1 min in 13,000rpm and supernatant was removed. The genomic DNA pellets were eluted using 30 μL of TE buffer and stored at −20 °C. Gel electrophoresis on an agarose gel containing ethidium bromide (1%, 100 V, 35 min) and viewing under UV light and Geldoc was carried out to confirm the presence of the genomic DNA.This method has yielded high genomic DNA (see Figure XIV) and was therefore chosen as the method of choice.

L1 L2 L3 L4 L5 L6 L7

Figure XIV: Genomic DNA of bacteria-associated to Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp. on gel band with 1kbp DNA ladder. L1 (Lane 1) represents the 1kbp DNA ladder. L2-L7 represent the genomic DNA of bacterial isolates-associated to Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp.

P a g e | 42

2.3.5.2 (Automated) Ribosomal Internal Spacer Analysis (ARISA)

After obtaining the genomic DNA of the bacteria from the selected corals’ mucus layers, Ribosomal Intergenic Apacer Analysis (ARISA) was carried out. ARISA is a commonly used method for microbial community analysis that provides estimates of microbial richness and diversity (Cardinale et al. 2004; Danovaro et al. 2006). This method is based on the length heterogeneity of the bacterial rRNA operon 16S and 23S intergenic spacer (better known as the internal transcribed spacer or ITS). In this study, this analysis method is chosen because it is a suitable tool for comparing bacterial community structure across multiple coral mucus samples on profile patterns and estimate the bacterial richness and diversity (Cardinale et al. 2004).

RISA was performed as previously described by Cardinale et al. (2004) using primer set ITS F/ITSReub. The 5’ and 3’ ends of primers ITSF (5’-GTC GTA ACA AGG TAG CCG TA-3’) and ITSReub (5’-GCC AAG GCA TCC ACC-3’) are complementary to positions 1423 and 1443 of the 16S rDNA and 38 and 23 of the 23S rDNA of Escherichia coli, respectively (Cardinale et al. 2004). An overview of the reaction mixture in each PCR tube is provided in Table F:

Table F: Components of ARISA PCR reaction per PCR tube Components Volume (L)

2x Bioline Red Taq Mix 12.5

Forward primer

ITSF 1.0

(5’-GTCGTAACAAGGTAGCCGTA-3’)

Reverse primer

ITSReub 1.0

(5’-GCCAAGGCATCCACC-3’) P a g e | 43

DNA template 3.0

ddH2O 7.5

Final volume 25.0

The mixture was amplified at 94 °C for 3 min, followed by 30 cycles of 94 °C for 45 seconds, 55 °C for 1 minute, 72 °C for 2 minutes, and a final extension at 72 °C for 7 minutes (Cardinale et al. 2004). PCR products were then analysed on a 3% agarose gel (100 V for 40 minutes) and viewed under UV transluminator and Geldoc.

2.3.5.3 Denaturing gradient gel electrophoresis (DGGE) Analysis

Same as RISA, by using DGGE, many coral mucus samples taken at different time intervals during the study can be simultaneously analysed. This makes the techniques a suitable tool for monitoring community behaviour after environmental changes (eg. temperature changed in the tank). With the attachment of a GC-rich sequence (GC clamp) on the selected primer for DGGE, nearly 100% of the sequence variants can be detected in DNA fragments up to 500 bp (Muyzer, De Waal & Uitterlinden 1993).

For this analysis, the bacterial genomic DNA was extracted from coral mucus samples and segments of the 16S rRNA genes were amplified in the polymerase chain reaction(Saiki et al. 1988). As a result, a mixture of PCR products obtained from the different bacteria present in the sample. Then, the individual PCR products were subsequently separated by DGGE. The result was a pattern of bands, for which the number of bands corresponded to the number of predominant members in the microbial communities.

PCR for DGGE was performed using the primers of GC341f (5'- CCTACGGGAGGCAGCAG-3) (Muyzer et al. 1996) and 907R(5'-CCGTCAATTCMTTTRAGTTT-3') (Ishii & Fukui 2001)for P a g e | 44

amplification of V3 region of the 16S rRNA genes of bacteria. The GC clamp ( 5'- CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGG-3') was attached to the 5’ end of the GC341f primer. It is recommended that 10-20 ng of template DNA. These primers produce a 600 bp product (including the gc clamp sequence) (Muyzer, De Waal & Uitterlinden 1993). An overview of the reaction mixture in each PCR tube is provided in Table G.

Table G: Components of DGGE PCR reaction per PCR tube Components Volume (L)

2x Bioline Red Taq Mix 22.5

Forwardprimer 1.0 341GCF

Reverse primer 1.0 907R

DNA template 5.0

ddH2O 20.5

Final volume 50.0

The thermocycling program for the touchdown PCR was as follows: initial denaturation was performed at 95°C for 3 min and then at 95°C for 30 sec, followed by touchdown primer annealing from 65°C to 55°C (the annealing temperature was decreased 1°C every second cycle for the first 10 cycles, to touchdown at 55°C), followed by extension at 72°C for 1min (for each of the 10 cycles), 20 more cycles were then performed at 95°oC for 30 sec, 55°C for 30 sec, and 72°C for 1 min, with a final extension step at 72°C for 10 min (Muyzer & Smalla 1998).

P a g e | 45

PCR products availability was then checked on a 1% agarose gel (100 V for 40 minutes) and view under UV transluminator and Geldoc. The preparation for the conduct of DGGE analysis is done according to the manufacturer’s procedures (BioRad Manual). A summary is provided in the following:

Gel Casting for DGGE Analysis

As for gel casting for parallel DGGE which the gradient and electrophoresis run in the same direction, the gel is run overnight, at 70V for 16 hours. Before starting the electrophoresis, 8 liters of 0.5X TAE are made and filled into the buffer tank. Then, the lid is put on to ensure the stirring bar fits into support hole in tank. The buffer in the gel tank is heated up by turning on the power and set the temperature to 65°C.

Running the DGGE Gel

The next step after gel casting is loading the DGGE PCR product into the wells of the gel. 5 µl of gel-loading buffer is added to each PCR product before loading. Then, the lid was placed and the power and heater are turned on. The gel is run for 16 hours at 70V and 60°C.

Staining

The last part is staining of the gel after electrophoresis. The gel is carefully transferred to a plastic wrap. Then SYBR Green is poured onto the gel for staining purpose. The gel is covered with aluminum foil (SYBR Green is light sensitive) and left for staining for 15- 30 minutes. Lastly.the gel image is viewed under Geldoc.

Analysing the DGGE Gel

Since the resulting DNA fragments in the DGGE analysis gel were not excised for further sequencing process, the DGGE gel image were analysed via a software tool called PyElph. Although sequencing analysis of the specific DNA bands obtained from DGGE analysis enables the determination of more specific community structure traits, the complex nature of the resulted DGGE fingerprinting makes interpretation of data difficult. Many bands present in the gel have almost similar mobility and thus making P a g e | 46

the excision of the DNA bands difficult to be done. In order to gain a better understanding and interpretation from the DGGE gel, the software PyElph was used because it is software that automatically extracts data from gel images (Pavel & Vasile 2012). It then computes the molecular weights of the analysed molecules or fragments and compares the DNA patterns which result from the experiments with molecular markers and finally generating phylogenetic trees computed by 5 clustering methods based on the information extracted from the analysed gel image (Pavel & Vasile 2012). There are many different software that function almost similarly with PyElph such as QuantityOne from Bio-Rad and GelAnalyzer but both these software have their disadvantages. QuantityOne is expensive and has a complex design while GelAnalyzer is not an open source and does not have phylogenetic analysis (Pavel & Vasile 2012). To first start using the software, DGGE gel image is loaded into it and some editing operation is done in order for the software to be able to detect all the bands present (see Figure XV for an example in form of a screenshot). Then, the three selected coral samples data are combined to infer a phylogenetic tree.

P a g e | 47

Figure XV: PyElph Software Analysis System. Screenshot showcases band matching step during gel analysis.

The PyElph software automatically detects the migration lanes and bands, computes the molecular weight of each separated fragment, matches the bands from all samples, based on their migration distance and finally computes similarity and distance matrices which are then used to generate the phylogenetic trees(Pavel & Vasile 2012). The results of the phylogenetic trees constructed for DGGE Analysis are presented in the following chapter.

2.3.6 Enzyme Assays

Besides identifying the bacterial community associated to Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp. it is important to know about their enzymatic properties too to further understand the roles they might play while harbouring the coral hosts’ mucus layer. Therefore, enzymatic assays were carried out to test for the presence of amylase, caseinase, phospholipase and gelatinase enzymes in bacterial isolates of Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp.

2.3.6.1 Amylase Activity

Overnight bacterial isolates were inoculated in corn starch–agarose: 1% (w/v) agarose, 50 mM Tris-HCl pH 6.8, 1 mM CaCl2, and 0.5% (w/v) corn starch (Alves et al. 2014). After incubation at room temperature for 5 days, the culture plates were flooded with 2% iodine solution to colorize the remaining starch, and the amylase-producing isolates showed a clear halo (Alves et al. 2014). Example of a positive amylase activity is shown below in Figure XVI:

P a g e | 48

Figure XVI: Example bacterial isolates showing positive amylase activity (zig-zag clear halo zone).

2.3.6.2 Caseinase Activity

Skimmed milk agar plates were prepare with double strength TNA mixed with an equal volume of 4% (w/v) sterile (115°C for 10 min) skimmed milk (Oxoid) (Austin et al. 2005). Pure bacterial isolates were inoculated onto the skimmed milk agar plates and incubated at room temperature (27°C) for up to 5 days. Example of a positive response was recorded as the presence of clear zones around the bacterial colonies (Figure XVII). P a g e | 49

Figure XVII: Example bacterial isolates showing positive caseinase activity (clear zones).

2.3.6.3 Phospholipase Activity

Overnight bacterial cultures were inoculated onto TNA supplemented with either 1% (v/v) egg yolk emulsion (Oxoid) or 1% (w/v) Tween 80 (GibcoBRL; Life Sciences) for the determination of phospholipase and lipase activity (Liuxy, Lee & Chen 1996). The cultures were incubated in the agar at room temperature (27°C) for 7 days. A positive P a g e | 50

response was recorded as the development of opalescence around the bacterial growth (Figure XVIII).

Figure XVIII: Example bacterial isolates showing positive phospholipase activity (opalescence around the bacterial growth).

2.3.6.4 Gelatinase Acitivity

For gelatinase activity, pure bacteria cultures were inoculated on TNA agar which are supplemented with 0.5% (w/v) gelatin (Oxoid)(Loghothetis & Austin 1996). Saturated ammonium sulfate solution was poured over the plates after incubation at room P a g e | 51

temperature (27°C) for 7 day. A a positive response is recorded where there is the presence of zones of clearing around the colonies (Figure XIX).

Figure XIX: Example bacterial isolates showing positive gelatinase activity (clear zones).

Testing the ability of coral-associated bacteria abilities to produce enzyme is vital as some enzymes produce by marine bacteria such as amylase and proteases are useful to produce industrial enzymes (Alves et al. 2014). Enzymes such as amylase and proteases are widely used for the manufacturing of pharmaceuticals, foods, beverages, confectioneries and even for waste water treatment (Alves et al. 2014). Results P a g e | 52

presented in Tables I, J and K are the bacteria isolates that produced positive results to the enzyme assays. However, some of the bacteria were not identified due to failure in sequencing of the 16S rRNA genes.

Bacteriophage assay was also conducted on selected potential coral pathogens derived from the three corals. This assay is to find a suitable environmental friendly way to inhibit the growth of coral pathogen to save the corals’ health from declining. Six (6) bacterial strains which are potential pathogens (see chapter 5) derived from Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp. were tested for phage sensitivity via plaque assay.

2.3.7 Screening and Isolation of Bacteriophages

The extraction of marine bacteriophages began with concentrating the marine phages in the seawater via the Fe-Virus Concentration Method. This method benefits in terms of cost, reliability add recovery efficiency if compared to other method such as Centramate Tangential Flow FilterTFF (John et al. 2011). Therefore, it has been chosen to be implied in this research work. According to John et. al. (2011), TFF-set up will cost up to 10 thousand dollars while FeCl2 method only cost above a few hundred dollars. Figure XX shows the experiment done to prove the efficiency of virus recovery is higher when using FeCl3 flocculation method compared to TFF.

P a g e | 53

Figure XX: Comparison of TFF and FeCl3 flocculation methods and the results of the concentration efficiency via viral fraction (< 022µM filtrate) seawater .

The recovery of the virus is based on virus counts by epifluorescence microscopy (retrieved from . John, 2011). However, this method did not yield any positive result as there was no phage DNA detected after the filtration process.

Bacteriophages utilised for this experiment were kindly provided by Associate Professor Dr. Peter Morin Nissom of Swinburne University of Technology, Sarawak. The phages were isolated as described in Tang and Ong (2013). In summary, the bacteriophages were isolated from soil samples collected from a chicken farm in Kuching, Sarawak, Malaysia. 5 g of soil sample were inoculated into 20 mL of Muller Hinton Broth (HI-Media) and inoculated with a variety of test (host) bacteria. The cultures were shaken at 150 rpm and incubated at 37⁰C for 18 hours. Five (5) ml of the cultures were then transferred to sterile 15 ml falcon tube and centrifuged at 13,400 rpm, 4⁰C, for 30 minutes. The supernatant was filtered to remove sediments through 0.22 μm filters and used as phage lysate. The function of the 0.22 μm filter membrane is to filter the liquid by removing microorganisms in the samples.

In order to detect the phages isolated, spot test method was applied to screen for the presence of lytic phage activity. After bacterial lysis was observed, the solution was centrifuged and the supernatant containing phage particles was filtered through 0.22- μm filter membranes and used as the phage suspension. The phages were further purified by soft agar method so as to ensure the homogeneity of the phage stock. Soft agar method or known as the Double Layer Agar technique is a technique used to enumerate and purify the isolated phages (Santos et al. 2009). High-titer phage stocks were prepared from the lysates by liquid infection (Sambrook, Fritsch & Maniatis 1989).

Five (5) phages were chosen at random (termed A, B, C D and E for the remainder) and used for phage assay to investigate their potential capability to inhibit the growth of the six (6) selected potential coral pathogens derived from Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorph sp.. Before conducting the assay, chosen potential P a g e | 54

marine pathogens isolates cultured on marine agar and inoculated with one drop of distilled water in replaced of bacteriophages for confirmation of plaque assay’s accuracy (control set; see Figure XXI). All test organisms grew well without appearance of any plaques or other growth inhibition.

Marine broth as Control Vibrio azureus Bacilllus cereus

Vibrio harveyi

Bacillus cereus Vibrio Bacillus thuringiensis neoccalledonicus

Figure XXI: Experimental controls of Potential Coral Pathogen Isolates to make sure that there is no experimental errors during phage assay experiment.

2.3.8 Whole Genome Amplification via Multiple Displacement Amplification (MDA) of Bacteriophages

After the plaque assay, bacteriophages that successfully formed plaques on the selected bacterial cultures were identified. Crude DNA extraction of the selected bacteriophage samples was carried out via DNA freeze and thaw method. The selected bacteriophages underwent whole-metagenome amplification to amplify their genomic DNA before Sanger sequencing (Yokouchi et al. 2006). Multiple Disaplacement Ampification is used to enrich the small and circular ssDNA genomes (Haible, Kober & Jeske 2006), and has successfully assisted to identify many ssDNA phages and eukaryotic viruses in the ocean. MDA can generate large amount of high quality P a g e | 55

bacteriophages DNA from a small amount of phage DNA using the ϕ29 DNA polymerase and random exonuclease-resistant primers to amplify the entire genome (Dean et al. 2001).

Extracted DNA of selected bacteriophages were used as template for the MDA. MDA was performed by denaturing the DNA template at 95°C for 3 minutes after mixing with 5– 110 µM random primers, 2.5 mM dNTP and 1x reaction buffer. The bacteriophages samples were cooled on ice and added to 900 units of ϕ29 DNA polymerase (EPICENTRE, Madison,WI). Multiple displacement amplification reactions were performed up to 20 hours at 30°C followed by incubation at 65°C for 10 min to inactivate the enzyme. DNA concentrations of the MDA products were subjected to gel electrophoresis under the following conditions: 1% agarose, 100 V, 35 minutes to confirm the presence of the genomic DNA samples. Figure XXII shows the presence of genomic DNA after the MDA process.

L1 L2 L3 L4 L5

Figure XXII: The Genomic DNA bands of the bacteriophages isolated and amplified via MDA on gel band with 1kbp DNA ladder. L1 (Lane 1) represents the 1kbp DNA ladder. P a g e | 56

L2-L5 represent the genomic DNA bands of samples bacteriophages extracted from chicken dunk samples.

2.3.9 Sequencing Analysis For Bacteriophages Identification

Several signature genes of phages are used to study phage diversities such as primers available for amplifying the DNA polymerase gene of T7-like podophages which are only restricted to a subset of that particular phage group and g20 primers that target specifically on cyanomyophages (Goldsmith et al. 2011). The presence of phoH genes in phages that infect both herotrophic and autotrophic hosts allows the primers that targets on that specific phoH genes have the potential to capture a wider range of phage diversity (Goldsmith et al. 2011). For example, phoH genes are detected in a group of phages infecting the heterotrophic bacteria such as roseophage SI01 and a broad range of vibrio phage (Rohwer et al. 2000). Besides, another benefit of having phoH gene as a signature gene for identifying phages diversity is this gene is not restricted to only one morphological type of phage. These genes are discovered in the genomes of podophages, siphophages and enterobacterial phage as well as myophages (Goldsmith et al. 2011).The MDA products were subjected to amplification of the g20 and the phoH genes.

2.3.9.1 g20 gene

Primers CPS 1 and CPS 8 were used to amplify g20 gene fragments from our samples. The primers sequences were CPS1 (59-GTAG[T/A]ATTTTCTACATTGA[C/T]GTTGG-39) designed by (Fuller et al. 1998) and CPS 8 5’- AAATA(C/T)TT(G/A/T)CCAACA(A/T)ATGGA-3, respectively (Zhong et al. 2002). 3 µL of extracted phageDNA were used as DNA template for PCR amplification. The reaction mixture (total volume, 25 µL) contained 3 µL of template DNA, 1 µL each of 25 µmol of CPS1or CPS8, 12.5 µL of MyRedtaq (Bioline) and 8.5 µL of MilliQ deionised water. P a g e | 57

PCR amplification was carried out with thermal cycling consisted of an initial denaturation step of 94°Cfor 3 min, followed by 35 cycles of denaturation at 94°C for 15s, annealing at 35°Cfor 15s, ramping at 0.3°C/s, and elongation at 73°C for 1 min, with a final elongation step of 73°C for 4 min (Zhong et al. 2002). A 6µl aliquot of PCR product was analysed by electrophoresis in a 1.5% agarose gel and stained with ethidium bromide for 15 min. The results of the amplication are displayed in Figure XXXVI can be seen that the amplification of expected products of 592 bp was successful.

2.3.9.2 phoH gene

The phoH primers are based on a CLUSTALX alignment of the full-length phoH gene from Synechococcus phage S-PM2, Prochlorococcus phages P-SSM2 and P-SSM4, and Vibrio phage KVP40.PCR primers of vPhoHf (5_-TGCRGGWACAGGTAARACAT-3_) and vPhoHr (5_-TCRCCRCAGAAAAYMATTTT-3_) were used to amplify a product of approximately 420 bp (Goldsmith et al. 2011). The 25 µL reaction mixture for PCR amplification of the phoH gene contained 12.5 µL MyRedTaq reaction buffer, 1 µL of each 25 µM of the primers, 3 µL of the DNA templates and 8.5 µL of milliQ deionized water.

P a g e | 58

L1 L2 L3 L4 L5 L6 L7 L8 L9

Figure XXIII: The DNA bands of the bacteriophages isolated and amplified via PCR using primers CPS1/8. Lane 1(L1) represents DNA ladder and L3 and L4 represents the DNA of bacteriophages amplified.

The PCR reaction conditions were (i) 5 min of initial denaturation at 95°C; (ii) 35 cycles of 1 min of denaturation (95°C), 1 min of annealing (53°C), and 1 min of extension (72°C); and (iii) 10 min of final extension at 72°C (Goldsmith et al. 2011).

P a g e | 59

L1 L2 L3 L4 L5

Figure XXIV: The sDNA bands of the bacteriophages isolated and amplified via PCR using primers vPhof . Lane 1(L1) represents 1kbp DNA ladder and L5 and L6 represents the DNA of bacteriophages amplified.

2.3.9.3 Phylogenetic analyses The DNA sequences were analyzed with MEGA 5 software (Kumar et al. 2008). From All sequences were aligned at the amino acid level using CLUSTALW (using default parameters). This is because protein-coding sequences such as phoH and g20 are more conserved at the amino acid level than they are at the nucleotide level and thus alignments are more accurate when conducted at the amino acid level. Genbank analysis via MEGA 5 software, reference sequences from cultured phages were obtained. The back-translated nucleotide sequences obtained from the amino acid alignments were used to build the tree.

P a g e | 60

CHAPTER 3

3 Diversity of the Bacterial Communities Associated to Coral Mucus Layer

3.1 Introduction

Studies show that many coral microbes reside within or upon the coral mucus layer which is a layer secreted onto the surface of the exposed coral tissues area (Bythell 1988; Ducklow & Mitchell 1979a). These mucus layers are suitable for microbial growth as it has high concentration of proteins, polysaccharides and lipids (Bythell 1988; Ducklow & Mitchell 1979a) (Ducklow & Mitchell 1979b; Wild et al. 2004a). Therefore, many researchers assumed that the mucus composition must play an important role in shaping microbial communities (Ritchie and Smith, 2004). Investigations on corals via molecular analysis have shown that the microbial community associated to corals is extremely diverse in terms of species richness and abundance (Bourne & Munn 2005b; Cooney et al. 2002; Frias-Lopez et al. 2002; Rohwer et al. 2002). One good example is a study by Rohwer and colleagues in 2002 who managed to identify a total of 430 ribotypes from 14 coral sample in the Carribean (Rohwer et al. 2002). The coral associated bacteria that they managed to identify and considered the most common ranged from ɣ-Proteobacteria to α- Proteobacteria. In addition to that, Bacillus/ Clostridium, Cytophaga- Flavobacter/Flexibacter-Bacteroides and cyanobacteria were also found to be common except that these groups were less dominant in the 16S DNA banks (Rohwer et al. 2002).

Generally, coral-associated bacteria are also discovered to be involved in additional nitrogen cycling processes which includes nitrification, ammonium assimilation, ammonification and denitrification. The members of the coral-associated microbiota were also found to be involved in carbon and sulfur cycling (Wegley et al. 2007).

P a g e | 61

In the following we introduce the bacteria associated with the three coral mucus layers under normal conditions, before we move to discuss changes in bacterial communities over the course of the experiment in chapter 4.

3.1.1 Bacteria associated with Trachyphyllia geoffroyi

Based on Genbank analysis, the genus of bacteria obtained from Trachyphyllia geoffroyi mucus layers ranged from the Vibrio sp, Bacillus sp., Pseudoalteromonas sp. and Chromohalobacter sp. and Halophilic sp. group (see Figure XXVI for phylogenetic tree and Table 1 in Appendix for overview of closest matches).

The dominant bacteria group in Trachyphyllia geoffroyi mucus layer comprised of the ɤ-Proteobacteria and Firmicutes. ɤ-Proteobacteriaare commonly found as coral associated bacteria (Kvennefors et al. 2010). Isolates linked to the ɤ -Proteobacteria were related mostly to Vibrio species such as V. parahaemolyticus, V. communis, V.harveyi, V. owensii, V. alginolyticus (Figure XXVI). Isolates linked to Firmicutes were mostly related to Bacilli such as B. cereus, B. subtilis, B. anthracis, B. thuriengiensis.

In week 1 of the experiment where all the parameters were set to normal seawater condition, there were isolates collected that showed similarities to the references Pseudoalteromonas sp. up to >91% as well as P. piscicida and P. flaviputra (Figure XXXIX and Table 1, Appendix). Pseudoalteromonas sp. has been reported to display activity against the coral pathogen Vibrio shilonii (Nissimov, Rosenberg & Munn 2009). The study by Nissimov, Rosenberg & Munn (2009) also reported that during the test on the antimicrobial property of Pseudoalteromonas sp. on V. shilonii, there was complete inhibition of the V. shilonii observed with stationary-phase cultures at low cell densities. From the finding by Nissimov, Rosenberg & Munn (2009), it is likely to state that Pseudoaltermonas sp. plays a role in protecting the coral host by producing antibiotics and therefore, it is reasonable to have abundance of this genus found during the beginning of the experiment (Week 1) as they act as potential beneficial bacteria to Trachyphyllia geoffroyi that protects Trachyphyllia geoffroyi from opportunistic pathogens. Pseudoalteromonas piscicida or originally known as P a g e | 62

Flavobacterium piscicida (sp. nov), was also discovered as a reference strain that has 91% similarity with one of the isolates derived from Trachyphyllia geoffroyi during week 1. This species was indicated as bacteria that is capable of killing certain fishes when exist as pure culture in laboratory condition (Bein 1954). P a g e | 63

Figure XXVI: 16S rRNA Phylogenetic Tree representing bacterial sequences found in Trachyphyllia geoffroyi (Brain coral). The phylogenetic tree was generated with P a g e | 64

distance methods, and sequence distances were estimated with the neighbour- joining method. Bootstrap values ≥50 are shown and the scale bar represents a difference of 0.05 substitution per site. Accession numbers for the reference sequences are indicated.

Pseudoalteromonas piscicida is also investigated to have anti-yeast properties aside from its virulent factor in killing certain fishes (Buck & Meyers 1966). A bacteria strain identified as Pseudoalteromonas piscicida designated as X153, was known for its production of a vibriostatic protein with a broad spectrum inhibition against marine bacteria (Longeon et al. 2004). Other than that, NJ6-3-1, also related to Pseudoalteromonas piscicida, showed antimicrobial activity against Staphylococcus aureus (Zheng et al. 2005) by a β-carboline alkaloid. The discovery of bacteria strain that are related to Pseudomonas piscicida in Trachyphyllia geoffroyi can be considered normal because this species is commonly found in the marine environment (Rohwer et al. 2001). It might be not harmful to Trachyphyllia geoffroyi’s health and play a role in the corals defense against potential pathogens. Pseudoalteromonas flavipulchra is classified under the pigmented species clades as it is P.flavipulchra JG1 has been shown to produce a protein PfaP and small-molecule compounds which inhibit the growth of Vibrio anguillarum, a pathogen which causes vibrosis (a type of fish diseases) (Austin & Austin 2007). This JG1 strain has excellent antibacterial activated against pathogens in marine aquaculture and is harmless to aquatic animals (Bowman 2007). This isolate could potentially also play an important role in the corals initial defense.

In week 3 of the experiment (control experiment period), a strain with 97% similarities to Lysinibacillus fusiformis was identified in Trachyphyllia geoffroyi mucus layer. In a study on antibacterial activity of marine bacteria, an isolate which was phylogenetically identical to L. sphaericus and L. fusiformis, has shown positive results in inhibiting a selection of bacteria such as Bacillus lentus, Pseudomonas aeruginosa, Yersinia enercolitica and Bacillus cereus. This shows that Lysinibacillus sp. has antimicrobial P a g e | 65

properties and therefore, making it theoretically reasonable to conclude that it is common to discover this species when Trachyphyllia geoffroyi is in healthy state as Lysinibacillus sp. act as one of the coral’s symbionts that aids in maintaining coral’s health. Based on the phylogenetic tree of Trachyphyllia geoffroyi in Figure XXVI, one of the isolates collected in Week 4 has 100% similarity with the reference strain of Chromohalobacter salexigens. This is the first study that has found bacteria related to Chromohalobacter salexigens to be associated with scleractinian corals. It was reported in Rodriguez-Moya et al. (2013) that C. salexigens is a natural producer of hydroxyectoine, which is an extremolyte produced by halophiles to cope with extreme saline environments (Rodríguez-Moya et al. 2013). This capability might aid the the coral itself to become more resilient towards environmental changes in terms of salinity. In another study, it has been shown that Chromohalobacter sp. possesses antimicrobial activity against Aerobacter aerogenes (Velho-Pereira & Furtado 2012) and might also serve as protection to the coral host.

Approximately 70% of the isolates derived from Trachyphyllia geoffroyi mucus layer have >97% similarities with various Vibrio species. In week 1, isolates having similarities up to >97% with reference strains V. rotiferianus and V. algonolyticus were identified in Trachyphyllia geoffroyi mucus layer. In week 2, isolates with 99% of similarities with V. parahaemolyticus and V. alginolyticus were discovered followed by week 3 with also isolates that have 99% similarities with reference V. communis, V. owensii, V. harveyi and V. parahaemolyticus were identified. It is interesting that Vibrio sp. is dominant during this stage of the experiment as Trachyphyllia geoffroyi is still in a healthy state because Vibrio sp. are associated with disease in corals (Rosenberg et al. 2007) in many studies. The presence of Vibrio sp. when the coral species are exposed to normal seawater temperature (25°C) indicate that the members of this group form natural part of the microbial community associated to the healthy corals too besides being classified as potential marine pathogens. This is supported by finding from Bourne and Munn (2005) who also discovered Vibrionaceae when the selected corals are in normal and healthy state (Bourne & Munn 2005a). According to Bourne and Munn (2005), Vibrionaceae can exist as normal microbial residents on coral mucus layer when the surrounding seawater condition is normal. Only when the P a g e | 66

environmental condition changes such as increment in temperature will switch on their virulent factors (Rosenberg & Falkovitz 2004). These will cause the occurrence of infections and subsequently lead to bleaching or necrosis of corals (Rosenberg & Falkovitz 2004). Vibrio sp. are said to be involved in nitrogen fixation (Kvennefors et al. 2010) (Chimetto et al. 2008a; Rincón‐Rosales et al. 2009) and also breakdown of amino acids.

During Week 4 of the experiment where the parameters were still in constant normal condition with temperature of 25°C, one of the strains were discovered to have 99% similarities with Vibrio coraliilytiicus, which is a well-known marine coral pathogen (Reshef et al. 2006b). Vibrio coraliilytiicus’ cells are Gram-negative, in non-sporing forming rods that are motile (Ben-Haim et al. 2003). Vibrio coraliilytiicus is identified as temperature-dependent coral pathogen in Pocillopora damicornis in the Red Sea and Indian Ocean (Ben-Haim et al. 2003). It is very interesting that the isolate found in this Trachyphyllia geoffroyi is similar to Vibrio coraliilytiicus as Trachyphyllia geoffroyi is still exposed to normal seawater temperature (25°C) during its presence while Ben-Haim et. al. (2003) stated that infection by this species will only occur when the seawater rised up to 27°C and above as it is a temperature-dependent bacteria species. The pathogenicity of Vibrio corallytiicus is related to their function in producing putative toxins, also known as zinc-metalloprotease (Ben-Haim et al. 2003). This zinc- metalloprotease compound was proven to be able to cause coral tissue damage within 18 hours at 27°C (Ben-Haim et al. 2003).The result finding in this experiment could indicate that Vibrio corallytiicus possibly survive in non-virulent state in Trachyphyllia geoffroyi as this isolate brought no damage to the Trachyphyllia geoffroyi’s health as observed.

P a g e | 67

3.1.2 Bacteria associated with Euphyllia ancora.

According to the phylogenetic tree in Figure XXVII of Euphyllia ancora, it has variety of bacterial community harbouring at the mucus layer.

There is presence of isolates related to Vibrio sp., Bacillus sp., Pseudoalteromonas sp., Shewanella and Photobacterium sp. (see Figure XXVII for phylogenetic tree and Table 2 in Appendix for overview of closest matches) which is relatively similar to other related journals findings such as (Geffen & Rosenberg 2004). All these groups of bacteria are very common in the marine environment and can be found either as residents of the coral hosts or in the seawater column (Geffen & Rosenberg 2004).

In week 1 to week 4 of the control experiment week, approximately more than 50% of the isolates derived in the mucus layer of Euphyllia ancora were from the family of ɤ- Proteobacteria. Vibrio sp. was the dominant group during this duration of the experiment This data further support the report finding that stated Vibrio core group (V. harveyi, V. rotiferianus, V. campbellii, V.alginolyticus, V. mediterranei(= V. shilonii) as common marine coral inhabitants as they are found abundant associated to Brazilian coral Mussismilia hispida (V. meditteranei). These Vibrio core groups are said to contribute beneficial effects to the coral host which include nitrogen fixation (Chimetto et al. 2009), food resource(Shashar et al. 1994), chitin decomposition and production of antibiotics (Chimetto et al. 2009). Several isolates were related to V. parahaemolyticus which is a gram-negative, halophilic bacteria that occurs naturally in the marine environment (DePaola et al. 2003). Higher densities of V. parahaemolyticus are often associated with an increment of seawater temperatures (DePaola et al. 2003) as they are known for their pathogenicity role on coral hosts. V. parahaemolyticus produces a thermostable direct hemolysin (TDH), which is the product of tdh gene (Nishibuchi & Kaper 1995). Based on Nishibuchi & Kaper (1995), V. parahaemolyticus are normally classified as coral pathogen due to their virulence factor which did not correlate with our data finding which has discovered this pathogen when Euphyllia ancora was still in healthy state. However, there is also a report that can explain our data finding in terms of occurrence of V. parahaemolyticus which is that Vibrio sp. can generally appear as a considerable fraction of the microbiota of coral species (with P a g e | 68

counts of up to 107 cells ml-1 of coral mucus), in both healthy (Koren & Rosenberg 2006) and diseased specimens (Chimetto et al. 2009) (Kooperman et al. 2007). P a g e | 69

P a g e | 70

Figure XXVII: 16S rRNA Phylogenetic Tree representing bacterial sequences found in Euphyllia ancora (Hammer coral).The phylogenetic tree was generated with distance methods, and sequence distances were estimated with the neighbour-joining method. Bootstrap values ≥50 are shown and the scale bar represents a difference of 0.05 substitution per site. Accession numbers for the reference sequences are indicated.

There is also isolated that is 99% similar of 1432 bp to the reference strain of V. proteolyticus during week 1 of the experiment which are associated to Euphyllia ancora. Based on a report that detected two of their coral-bacteria isolates are 99% similar to V. proteolyticus, this report has identified that V. proteolyticus which in the report is associated to Oculina patagonica, showed high protease activity which suggest that they could utilize the high protein available in the coral mucus (Sharon & Rosenberg 2008). Other than that, V. proteolyticus were also tested to be able to carry out nitrogen fixing process (Sharon & Rosenberg 2008) which could explain the presence of this bacteria species in Euphyllia ancora during the early experimental week as they could serve as the coral symbionts that contribute in nitrogen fixation for Euphyllia ancora health maintenance (Sharon & Rosenberg 2008).

In week 3 and 4of the experiment, one of the isolates were sequenced and found to have 99% similarities with the reference species of Vibrio shilonii or better known as V. shilonii. And another was found to be 97% similar to V. mediterranei which is also regarded as phylogenetically related to V. shilonii (Chimetto et al. 2009). Kushmaro and colleagues were the first to discover about V. shilonii as the causative agent that caused the infection and bleaching of O. patagonica sp. (Kushmaro et al. 1996; Kushmaro et al. 1997). The infection by V. shilonii is temperature dependent as it does not occur at 16-20°C and only stimulated when the temperature is above 25°C (Kushmaro et al. 1998). V. shilonii only infects the coral species at high temperature condition which it will adhere to the β-galactoside receptor of the coral surface and also only on corals that possesses photosynthetically active zooxanthellae (Ben‐Haim et al. 1999). When V. shilonii successfully enters the coral host’s tissue, this coral pathogen itself will multiply and produce extracellular protein toxin that blocks P a g e | 71

photosynthesis and results in the bleaching and lysing of the zooxanthellae (Banin et al. 2001a; Banin et al. 2000a; Banin et al. 2001b). Since Kushmaro et. al. (1996) has acknowleged and identified V. shilonii as a coral pathogen, it is interesting that the isolate collected when Euphyllia ancora is still in healthy state is closely related to V. shilonii. Another interesting finding about V.shilonii presence in the coral of O. patagonica is that its presence was no longer detected during the annual bleaching event in year 2005 (Ainsworth et al. 2007). V. shilonii is reported to still adhere to the O. patagonica tissue but its population in the coral slowly decline and eventually no longer present in the coral host. One possible explanation to this incident is based on the Coral Probiotic Hypotheses proposed by (Reshef et al. 2006a) and developed by (Rosenberg & Falkovitz 2004). This hypothesis proposed that the abundance and types of microorganisms associated to the coral species will change in response to environmental changes such as temperature in order to adapt to the new condition for survival purpose. In a study, Pseudoalteromonas sp. is known for being the strongest inhibitor to a coral pathogen, Vibrio shilonii (Nissimov, Rosenberg & Munn 2009; Rosenberg et al. 1999). Vibrio shilonii were first discovered during week 3 of the experiment but its presence was not detected on the following week (week 4). Based on the experimental result from NIssimov et. al. (2009) which Pseudoaltermonas sp. was found to inhibit the growth of Vibrio shilonii, it is theoretically reasonable to speculate that one of the isolates found in Week 4 which has 97% similarity with reference strain of Pseudoalteromonas rubra has inhibited the growth of V. shilonii found previously resulting to the absence of Vibrio shilonii in Euphyllia ancora This statement supports the concept of probiotic effect on microbial communities that are related with the coral holobiont.

Isolates that are 97% similar to the reference strain of Photobacterium rosenbergii and 97% similar to Photobacterium rubra were also discovered associated to Euphyllia ancora. Although there is study that discovered P. rosenbergii isolated from mucus and surrounding bleached corals, researchers stated that there was no evidence that that particular species exhibits any pathogenic characteristic (Austin et al. 2005; Munn, Marchant & Moody 2008b). Moreover, in a study which investigates superoxide P a g e | 72

dismutase activity of Photobacterium rosenbergii, the result shows that P. rosenbergii has the highest activity observed among other tested species such as Vibrio corallyliiticus which means it contains high amount of SOD enzyme that responsible to - break down oxygen obtained to superoxide (O2 ) radical and hydrogen peroxide (H2O2). In addition, the study also revealed that the tested P. rosenbergii shows very low levels of catalase which is an enzyme responsible in breaking down hydrogen peroxide (H202) (Munn, Marchant & Moody 2008a). Therefore, the tested P. rosenbergii strain is very sensitive to even an extremely low level of H2O2. Judging from this study, P.rosenbergii could be classify under the non-pathogenic bacteria that are associated to Euphyllia ancora and that would be the reason why this strain existed when the coral host is still in healthy state during normal control experimental weeks. Also, Photobacterium mandapamensis which is a type of Photobacterium sp. was classified as commensal bacteria for the coral Acopora palmata (Krediet et al. 2009; Ritchie 2006). Hence, it could be possible that Photobacterium sp. is coral-associated commensal bacteria that bring no threat to coral species.

During week 2 to week 4, a few isolates collected from Euphyllia ancora also have similarity with the genus of Bacillus sp. such as B.cereus with 100% similarity and Lysinibacillus fusiformis with 99% similarity as well as Bacillus firmus with (100%). The Bacillus sp. genus is well-known to produce lipoproteins, phenolic derivatives, aromatic acids, acetyl- amino acids (amino acid analogues), peptides (Gebhardt et al. 2002), isocoumarin antibiotics (Pinchuk et al. 2002) and bacteriocin like substances (Bizani & Brandelli 2002) which classified this genus as having a broad antibiotic spectrum. In a study conducted to investigate potential marine bacteria that can act as a source of anti-biofilm agents against Pseudomonas aeruginosa, strains with >99% similarities to B.cereus and B. arseniscus were identified as showing antibiofilm activity (Itoh et al. 1981). Therefore, it is reasonable for us to find Bacillus sp during the beginning of the experiment where Euphyllia ancora is exposed to normal parameter condition with temperature of 25°C as this species will serve as symbiotic bacteria that contribute in defending Euphyllia ancora from any harmful pathogens via their ability in producing antimicrobial properties. The presence of strains similar to the reference strains of P a g e | 73

Bacillus sp. could possibly inhibit the growth of harmful bacteria such as P. aeruginosa from invading Euphyllia ancora.

P a g e | 74

3.1.3 Bacteria associated with Corallimorphs sp.

As for Mushroom coral, there is also variety of bacterial community in reference to the Vibrio sp., Photobacterium sp., Pseudoalteromonas sp., Chlomahalobacter sp. and Bacillus sp. and this findings can be correlated with the data in other journal that is related to coral bacteria biodiversity (Geffen & Rosenberg 2004). For Corallimorphs sp., based on the references bacteria from Genbank analysis, when the corals were exposed to 25°C (normal temperature), α-Proteobacteria such as V. parahaemolyticus, V. alginolyticus, V. owensii and V. harveyi dominated the coral mucus layer (see Figure XXVIII for phylogenetic tree and Table 3 in Appendix for overview of closest matches).

Approximately 85% of the isolates associated to Corallimorphs sp. were discovered during the first four weeks of the experiment were phylogenetically related to Vibrio sp.. There was little diversity discovered associated to Corallimophs sp. One isolate is found 99% similar to Lysinibacillus fusiformis and another one is 95% similar to Photobacterium leiognathi. Presence of Lysinibacillus fusiformis is considered not unusual as this species has been associated to antibiotic production (Pinchuk et al. 2002) for maintenance of coral host’s health as discussed in Trachyphyllia geoffroyi phylogenetic studies. As for Photobacterium leiognathi, this species is also known as coral-associated commensal bacteria (Krediet et al. 2009; Ritchie 2006).

Among the Vibrio sp. discovered associated to Corallimophs sp. during the control experiment weeks were isolates related to V. rotiferianus, V harveyi, V. alginolyticus, V. parahaemolyticus, V. azureus and V, owensii. Since these Vibrio sp. are categorised under the Vibrio core group, it has the same observation as the investigation of bacteria community associated to the Brazilian coral Mussismilia hispida which also stated the dominance of Vibrio sp. even when the coral host was in healthy state (Chimetto et al. 2009). Since during the presence of these Vibrio sp. the health condition of Corallimorphs sp. is favourable, we can conclude that these Vibrio sp. are in a non-virulent state for the beginning of the experiment despite their abundance.

P a g e | 75

P a g e | 76

Figure XXVIII: 16S rRNA Phylogenetic Tree representing bacterial sequences found in Corallimorphs sp. (Mushroom coral).The phylogenetic tree was generated with distance methods, and sequence distances were estimated with the neighbour-joining method. Bootstrap values ≥50 are shown and the scale bar represents a difference of 0.05 substitution per site. Accession numbers for the reference sequences are indicated.

3.1.4 Diversity of Coral Mucus-Associated Bacteria

This study is the first report of coral mucus-associated bacteria isolated from corals Euphyllia ancora and Trachyphyllia geoffroyi. Limited scientific papers have been published on bacteria interactions with genus Euphyllia. Only two evaluations of bacterial association with coral genuses Trachyphyllia and Euphyllia (Vob, Larrieu & Wells 2013) respectively have been made but with emphasis on green fluorescent protein and its isolation. No studies could be found on the characterisation of mucus- associated bacteria with the host coral Trachyphyllia geofroyyi.

In addition, based on phylogenetic trees in Figure Figures XXVI, XVII and XXVIII, our results show the first and successful isolation of an isolate related to Vibrio azureus from the mucus of Euphyllia ancora and Corralimorphs sp.. Chimetto et al. (2011) are the only previous study that found V. azureus to be associated with Mussismilia hispida, which is a coral native to Brazil (Chimetto et al. 2011).

V. azureus differ from related Vibrio species in the utilization of starch and other complex carbohydrates. Hence current research focuses on unique enzymes which can only be isolated from this Vibrio strain. Another successful and first isolation from the mucus of coral Trachyphyllia geofroyyi, Euphyllia ancora and Corallimorph sp. is Vibrio communis, a novel Vibrio species isolated in 2011. In the previous study, Vibrio communis sp. was also linked with marine corals (Chimetto et al. 2011). Many microbes identified in the mucus layer are not only comprised of the actual ‘residents’ or mutualist of the coral hosts but they can be also the ‘visitors’ which consist of commensal organisms that do not bring any benefit or harm to the hosts. P a g e | 77

These microbes could also be potential opportunistic pathogens when they are exposed to the right condition for their proliferation.

Due to the fact that diversity indices provide more information than simply the number of species present (i.e., they account for some species being rare and others being common), they serve as valuable tools that enable biologists to quantify diversity in a community and describe its numerical structure.

Diversity indices were calculated by using sequence data of isolates obtained from the coral mucus of all three corals. Isolates which showed >97% sequence similarity were clustered into OTUs after normalization of sample sizes in order to directly compare individual corals. Table H shows the diversity indices obtained.

Figures that are underlined and in blue font indicate the highest values of biodiversity for Shannon Index and Smith and Wilson evenness indices methods. Both the highest biodiversity values appear to be under Euphyllia ancora.

Table H: Indices used to quantify the diversity of 3 selected corals’ mucus layer associated bacterial communities. Genus Trachyphyllia Euphyllia Corallimorph geoffroyi. ancora s sp.

Total isolates (N) 17 19 15

Total genus (S) 4 4 3

Margalef index (DMg) 10.57 11.73 10.20

Shannon index (H’) 0.66 0.95 0.62

Shannon evenness (J’) 0.82 0.34 0.46

Smith and Wilson evenness (Evar) 1.87 3.57 2.20

*Formulae of diversity indices are from(Margalef 1958; Shannon-Weaver 1963; Smith & Wilson 1996) P a g e | 78

Based on the indices values, it can be concluded that all three corals has approximately similar diverse community associated to their mucus layer (DMg of Trachyphyllia geoffroyi = 10.57, Euphyllia ancora = 11.33 and Corallimorphs sp. = 10.20). The limited findings of species diversity for this research study could possibly be due to the choice of coral samples as different coral samples would yield different result findings. These three selected corals’ mucus layer associated bacteria community were never studied by other researchers before in terms of its coral mucus layer associated bacteria community and thus, no comparison can be made.

Differences between the diversities of the three coral samples bacterial diversity were still evident though as the values of the Shannon Index, Shannon evenness and Smith and Wilson evenness values are quite varied (see Table I). The calculated bacterial indices show that diversity and evenness of the bacterial community associated to Euphyllia ancora coral mucus layer are much higher than the Trachyphyllia geoffroyi and Euphyllia ancora. corals (shown by the highest value for Evar and DMg in Table H.

In order to understand the mechanism of the coral-associated bacteria community in more detail, enzyme assay have also been carried out. Corals are generally harboured by bacteria that produce enzymes which have ability to overcome toxic effects of reactive oxygen species (ROS) which includes superoxide dismutase (SOD) and catalase as well as amylase and many more other enzymes that aid In coral’s and their own survival (Munn, Marchant & Moody 2008b). These assays are important to investigate whether the coral-associated bacteria community contains enzymes that contribute or harm the health and survival of Trachyphyllia geoffroyi, Euphyllia ancora. and Corallimorphs sp. The amylase assay for example was carried out to identify if coral- associated bacteria are involved in degrading carbon sources into glucose to provide the coral hosts with food source. Although many coral-associated bacteria function are still not widely known, there are studies that show certain bacteria provide food source to the coral hosts either directly or indirectly ( Environmental Protection Agency P a g e | 79

United States 2007). Based on our results, among the total 104 isolates tested, only 12 isolates produced amylase (Table I, J and K).

Table I : Results of Corallimorphs sp. after testing for their enzyme assays

STRAIN ID Amylase Gelatinase Caseinase Phospholipa se

MH Unidentified YES YES NO YES WK4 (1) (STRONG)

MH Vibrio harveyi YES NO NO NO WK4 (4)

MH Pseudoalteromonas YES YES NO YES WK8 (2) prydensis

MH Vibrio harveyi YES NO YES NO WK8 (5)

Bacillus subtilis is widely used to produce enzymes such as amylase, protease , inosine, ribosides and amino acids ( Environmental Protection Agency United States, 2007). In addition, B. subtilis also known to produce a variety of proteases and other enzymes that enables it to degrade a variety of natural substrates and contribute to nutrient cycling ( Environmental Protection Agency United States, 2007). From the data finding regarding Bacillus subtilis, we know that Bacillus sp. contains amylase that will function in degrading carbon sources such as starch into glucose. A bacterium identified associated with Trachyphyllia geoffroyi as Bacillus cereus via phylogenetic analysis was found to have positive result when tested for amylase assay. Hence, the result data correlates with the journal that also stated Bacillus sp. possesses amylase. This Bacillus sp. strain discovered during Week 8 of the experiment in Trachyphyllia geoffroyi could be contributing in supplying Trachyphyllia geoffroyi with food sources (glucose) for the P a g e | 80

coral host survival. However, this isolate does not show any positive results for other enzyme assays tested in this study.

Table J: Results of Euphyllia ancora after testing for their enzyme assays

STRAIN ID Amylase Gelatinase Caseinase Phospholipa se

HM Unidentified YES NO NO NO WK4 (3)

HM Pseudoalteromas YES NO NO NO WK4 (5) rubra (WEAK)

HM Unidentified YES NO NO YES WK4 (6) (WEAK)

HM Unidentified YES NO NO NO WK8 (1) (WEAK)

HM Unidentified YES NO NO NO WK8 (5) (STRONG)

HM Unidentified NO NO YES NO WK8 (8)

Other than Bacillus cereus, isolates with phylogenetic similarity with Chromahalobacter salaxigens were also discovered to yield positive result when tested with amylase assay. This result showed that C. salaxigens play a role in contributing food sources by breaking down carbon sources to glucose for Trachyphyllia geoffroyi survival. However, the data finding did not correlate with an article (Arahal et al. 2001) which discovered that C. salaxigen is catalase- positive, oxidase-negative, caseinase-positive P a g e | 81

and amylase negative (does not hydrolysed starch into glucose) (Arahal et al. 2001). Based on our result finding, C. salaxigens found in Trachyphyllia geoffroyi was found to be casein-negative. It was only found to be amylase-positive while the other enzyme assays tested results were negative.

Table K: Results Trachyphyllia geoffroyi after testing for their enzyme assays

STRAIN ID Amylase Gelatinase Caseinase Phospholipa se

BR WK4 Chromahalobacter YES NO NO NO (1) salaxigens (WEAK)

BR WK4 Unidentified NO NO NO NO (2)

BR WK4 Unidentified YES YES NO YES (3)

BR WK8 Unidentified NO NO YES NO (3)

BR WK8 Bacillus cereus YES NO NO NO (4)

BR WK8 Unidentified NO NO YES NO (6)

For isolates discovered in Euphyllia ancora mucus layer, identified isolate strain which is the Pseudoalteromonas rubra found in Euphyllia ancora during Week 4 (control experimental week) only shows positive result for amylase assay. The rest of the enzyme assay tested was negative. Based on a study that stated Pseudoalteromonas P a g e | 82

sp. utilized glucose oxidatively and hydrolysed starch (Lee et al. 2010), it is reasonable to conclude that Pseudoalteromonas sp. plays a role in degrading carbon sources to glucose for coral host’s growth and maintenance. Besides being amylase-positive, Pseudoalteromonas sp. strain discovered to be associated with Corallimorphs sp. is also found to be gelatinase and phospholipase positive. However, it is not caseinase positive in this study. This result correlated well with Lee et. al. (2010) as they also stated that the Pseudoalteromonas sp. strain tested appeared to be gelatinase and lipase positive while catalase was negative. Gelatinase enzyme found in Pseudoalteromonas sp. plays an important role as proteolytic enzyme that hydrolysed gelatin into its sub-compound such as polypeptides, peptides and amino acids so that the compounds can cross the cell membrane and be utilized by itself and also Trachyphyllia geoffroyi for growth and maintenance (Lee et al. 2010). As for phospholipase enzyme, Pseudoalteromonas sp. would utilize them to hydrolysed phospholipids intro fatty acids and other lipophilic substances. A novel extracellular phospholipase C was discovered from a marine bacterium, Pseudoalteromonas sp. J937 (Mo, Kim & Cho 2009), which showed the potential of Pseudoalteromonas sp. in secreting phospholipase enzyme. Generally, coral mucus layer consists of polymers of mixed origin (Krediet et al. 2009) and glycoprotein is the major component for soft and hard corals (Meikle, Richards & Yellowlees 1987, 1988; Molchanova et al. 1985). One of the components in glycoproteins are lipids (Krediet et al. 2009). Therefore, Pseudoalteromonas sp. could secrete phospholipase enzymes which will contribute in breaking phospholipids down into smaller units which is used by Trachyphyllia geoffroyi to construct its mucus layer.

Another isolate discovered to be amylase-positive and caseinase-positive was an isolate related to Vibrio harveyi. However, this isolate yielded negative result for enzyme assays for gelatinase and phospholipase. This isolate was discovered in week 8 of the experiment where temperature surrounding Corallimorphs sp. was high. Based on a study on virulence of Vibrio to Artemia nauplii, the Vibrio harveyi strains tested were able to hydrolyse glucose, produce phospholipase and gelatinase (Lee 1995). This data finding does not correlate with our data as we did not discover positive results for phospholipase and gelatinase assay. The differences could be due to the fact that the P a g e | 83

Vibrio strains were obtained from different areas and therefore, exhibit different properties.

As for isolates discovered in Corallimorphs sp., one of the isolates identified as Vibrio harveyi (discovered during week 4 of the experiment), showed positive results for amylase test only. Vibrio are known to be able to function as corals symbionts (providing nutrients for coral’s survival) or opportunistic pathogens when they turn virulent due to environmental factors (Chimetto et al. 2009). In this scenario, Vibrio harveyi could be concluded as playing a role as coral symbiont in terms of contributing to nutrient cycling by breaking down carbon sources into glucose for Corallimorphs sp.

There are not many studies on enzymatic properties of Vibrio sp. Some other studies include the discovery that V. communis and is catalase and oxidase positive (Chimetto et al. 2011) which has similar result with another paper investigating Vibrio azureus which is also classified as oxidase-positive and catalase-positive (Yoshizawa et al. 2009). These findings could indicate that many Vibrio sp. yield similar enzymatic assay results.

To sum up, every bacterial strain associated to the coral species are seen to have different enzymatic properties. The enzymes produced such as amylase are important for the coral host and the bacterial isolate itself sustainability of their growth and health.

P a g e | 84

CHAPTER 4

4 Shift in Bacterial Communities of Coral Mucus-Associated Bacteria

4.1 Introduction on Bacterial Communities Shifting

Reef-building corals have a narrow range of thermal tolerance, making them extremely susceptible to temperature stress and outbreaks of coral diseases, whereby the immunity of corals decrease (Baker, Glynn & Riegl 2008). This makes the corals more vulnerable towards pathogens that are more virulent, especially at higher temperatures (Goreau & Hayes 2008). The coral surface mucus layer (SML) contains a complex microbial community that respond to such changes in the environment (Ritchie & Smith 2004). The normal microbial flora within the SML can protect the coral against pathogen invasion and disturbances which may have led to coral diseases (Sutherland, Porter & Torres 2004). On average, 20-30 % of bacterial isolates originating from coral SML possess antibacterial properties (Ritchie 2006) that may assist the coral’s survival. Elevated seawater temperature of 1-3°C above with increase solar irradiance can result in large scale of coral bleaching (Brown 1997; Klaus et al. 2007). Bleaching normally caused the corals to be susceptible to diseases and previous studies have demonstrated shift in the microbial populations of diseased corals (Cooney et al. 2002).

Generally, the chemical nature and quantity of mucus can change when corals are exposed to environmental stresses (Ritchie & Smith 1995), which in the end changes the coral mucus layer’s environment. Changes in the coral mucus layer will therefore affect the survival of the coral-mucus associated bacteria. Also, the differences among the bacterial community found among the three selected corals can be explained by the fact that the biochemical composition of the coral mucus layer differ among different species. Hence, it results in different populations of coral associated microorganisms among different coral types (Ritchie & Smith 1995). Changes in environmental conditions will alter the coral host physiology which leads to variable microbiota. For instance, since coral mucus is an important carbon source to coral- P a g e | 85

associated bacteria (Ferrier-Pages et al. 1998), the changes in the mucus secretion rate and amount due to abiotic factors changes (eg. temperature and carbon dioxide content changes) could also lead to shift in the bacteria community of the coral mucus layer (La Barre 2011). Thurber et. al. (2009)demonstrated that elevation in seawater temperature shifted the microbial community of Porites compressa to a more disease- associated state which means the number of genes encoding the virulence pathways and abundance of ribosomal sequences associated with diseased organism is greater (Thurber et al. 2008). For most coral diseases, the growth rates and/or virulence pathogens are temperature dependent (Alker, Smith & Kim 2001). To sum up, the increase in seawater temperature could potentially shift the coral-associated microbial assemblages by selecting for more pathogenic taxanomy (La Barre 2011). Infectious diseases may be a major cause of biodiversity loss and change in bacterial species distribution in the context of predicted climate warming (Bally & Garrabou 2007; Harvell et al. 2002).

As discussed earlier, molecular fingerprinting methods such as DGGE and RISA are helpful to monitor changes over time and have hence been used for this study. The ARISA analysis showed shifting of banding patterns indicating changes in the bacterial community when the selected corals are exposed to different environmental conditions (Figure XXIV). According to ARISA gel results, it demonstrated that thermal stresses and carbon dioxide content changes can result in shift in coral-associated bacterial community which led to deteriorating coral health and mortality. Based on Figure XXIX that shows the gel images of ARISA analysis, there are significant changes in the bacteria community species as indicated by the positioning of the gel bands which each of them represent the bacteria isolates’ identity. There is a clear decrease in band numbers from week 2 to week 7 to week 9. Unfortunately, the DNA bands were not sequenced so no species identity could be derived.

Figure XXX shows the gel results obtained from DGGE analysis. The coral mucus layers of Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp. show shifting in the P a g e | 86

bacterial community based on the changes of the bands positioning. These DGGE band results confirmed ARISA results and were further analyzed PyElph software.

P a g e | 87

Week 2 Week 7 Week 9

DNA TR EU CO TR EU CO TR EU CO

LEGEND

TR TRACHIPHYLLIA GEOFFROYI.

EU EUPHYLLIA ANCORA

CO CORALLIMORPHS SP.

Figure XXIX: ARISA analysis result to detect the bacteria community associated to Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp. shifting pattern.

P a g e | 88

Week 2 Week 7 Week 9

TR EU CO TR EU CO TR EU

Figure XXX: DGGE Analysis Gel Result detect the bacteria community associated to Trachyphyllia geoffroyi, Euphyllia ancor. and Corallimorphs sp. shifting pattern. LEGEND

TR TRACHYPHYLLIA GEOFFROYI

EU EUPHYLLIA ANCORA

CO CORALLIMORPHS SP. P a g e | 89

Based on the gel image of the DGGE analysis, a complete linkage agglomeration tree or also known as furthest neighbour sorting was calculated (Figure XXX). In this method, proposed by Sorensen (1948), the fusion of two clusters depends on the most distant pair of objects instead of the closest (Sørensen 1948). Thus, an isolate joins a cluster only when it is linked to the all the other isolates that are already members of the same cluster. Two clusters can only fuse when all isolates of the first are linked to isolates of the second and vice-versa.

Figure XXXI: Complete linkage agglomeration tree with genetic distances calculated using PyElph software analysis tool.

According to Figure XXXI, the bacterial communities from week 2 of all three corals (Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp.) were all grouped in the same cluster. Some was true for communities from week 7 and week 9 (CO2), thus supporting the observed shifts in community structures (DDGE, RISA) and highlighting P a g e | 90

the significant differences of the bacterial communties isoalted under different conditions. The same analysis was repeated using the Unweighted Pair-Group Method (UPGMA; Figure XLVII). It is also called the “average linkage” (Sneath & Sokal 1973) and in this method, the lowerst distance (or highest similarity) identifies the next cluster to be formed. This method computes the arithmetic average of the distance between a candidate isolate and each of the cluster members between all members of two clusters. All isolates of bacteria receive equal weights in the computation.

Figure XXXIII: UPGMA tree with genetic distances calculated using PyElph software analysis tool.

Both methods produced the same distinction between the microbial communities.

Based on Tables L, M and N, the values of Margalef index (DMG) for all three coral species (Trachyphyllia geoffroyi, Corallimorphs sp. and Euphyllia ancora) shows that the values are highest on the first four weeks (Week 1-4), indicating a high biodiversity of bacteria when the corals are exposed to normal seawater temperature of 25°C.

P a g e | 91

Table L: Indices used to quantify the diversity of Trachyphyllia geoffroyi mucus layer associated bacterial communities Genus Week 1-4 Week 5-6 Week 7-8 Week 9

Total isolates (N) 17 9 9 1

Total genus (S) 4 3 3 1

Margalef index (DMg) 10.57 7.33 6.29 0

Shannon index (H’) 0.66 1.06 0.85 0

Shannon evenness (J’) 0.82 1.06 0.63 0

Smith and Wilson evenness (Evar) 1.87 2.47 2.71 1

*Formulae of diversity indices are from Margalef (1958), Shannon & Weaver (1963) and Smith & Wilson (1996)

Table M: Indices used to quantify the diversity of Euphyllia ancora corals’ mucus layer associated bacterial communities

Genus Week 1-4 Week 5-6 Week 7-8 Week 9

Total isolates (N) 19 9 4 4

Total genus (S) 4 5 2 2

Margalef index (DMg) 11.73 5.4 8.3 6.65

Shannon index (H’) 0.95 1.00 0.56 0.56

Shannon evenness (J’) 0.34 0.56 0.20 0.20

Smith and Wilson evenness (Evar) 3.57 3.99 2.99 1.99

*Formulae of diversity indices

P a g e | 92

Table N: Indices used to quantify the diversity of Corallimorphs sp. corals’ mucus layer associated bacterial communities Genus Week 1-4 Week 5-6 Week 7-8 Week 9

Total isolates (N) 15 10 12 1

Total genus (S) 3 3 2 1

Margalef index (DMg) 10.20 7.00 9.27 0

Shannon index (H’) 0.62 1.03 0.68 0

Shannon evenness (J’) 0.46 1.01 0.39 0

Smith and Wilson evenness (Evar) 2.20 2.38 1.89 1

*Formulae of diversity indices

However, it is also observed that Corallimorphs sp. and Euphyllia ancora mucus samples’ H’, J’ and EVAR values show the same pattern as they have gradual decrease in the EVAR values starting from Week 5-6 to Week 9. These indicate the decrease in biodiversity of bacteria in both Corallimorphs sp. and Euphyllia ancora when their environmental temperature starts increasing from 27°C to 30°C. All three corals species mucus samples show increment int the EVAR values from Week 1-4 to Week 5-6 indicating the increment in the biodiversity of the bacteria group when the corals are exposed to temperature increment from 25°C to 27°C. The H’ and J’ values for all three corals are at the highest when the corals are exposed to 27°C (Week5-6) indicating wide range of diversity. All three corals have the lowest amount of values for all the indices calculated in week 9 as the diversity of bacteria decreases when the corals are exposed to both elevated temperature and carbon dioxide content.

In the following, we discuss shifts in microbial communities associated with the mucus layer in more detail for each coral tested.

P a g e | 93

4.2 Shifts in Bacterial Community Associated to Coral Mucus Layer of Trachyphyllia geoffroyi

4.2.1 Week 5 to Week 6 for Trachyphyllia geoffroyi

On week 5 of the experiment when Trachyphyllia geoffroyi surrounding temperature were increased to 27°C, there were diverse groups of bacteria identified. There were isolates that are phylogenetically identical to Bacillus sp. such as to reference strains of Bacillus thuringiensis (99%), Lysinibacillus boronitolerans (99%) and Lysinibacillus fusiformis (97%; Figure XXXIX and Table 1, Appendix) . Lysinibacillus sp. isolates are discovered in this stage of the experiment where it was observed that Trachyphyllia geoffroyi started to secrete more mucus secretions. It could be possible that during this stage which Trachyphyllia geoffroyi started to undergo thermal stress that Bacillus sp. present are also secreting antibiotic protection to protect the coral host from pathogenic infections. There were no papers found that stated about the virulence of this bacteria species when they are exposed to different environmental condition except that they turned dormant when they are exposed to extreme environment such as heat, UV and chemicals (Abideen & Babuselvam 2014).

Besides Bacillus sp., Pseudoalteromonas sp. strains were also discovered during week 5 of the experiment in Trachyphyllia geoffroyi mucus layer. The isolates were 95% identical with the reference strain of P. plecoglossicida in Genbank analysis. It is common to find P.plecoglossicida from Trachyphyllia geoffroyi because there was also study that found P. plecoglossicida is one of the bacteria-associated with the Caribbean coral Montastraea franksi (also a scleractianian coral) (Rohwer et al. 2001).

Moreover, there were also isolates phylogenetically related to Vibrio sp. discovered during Week 5 of the experiment that are associated to Trachyphyllia geoffroyi. The isolates are phylogenetically similar to the reference strains of V. persian (99%) and V. owensii (100%). Vibrio persian and V. owensii are classified under the Vibrio core group and these strains are also abundantly found associated to the mucus layer of Brazillian P a g e | 94

coral Musssismilia hispida and were also categorised as the dominant species (Chimetto et al. 2009). This finding shows that it is reasonable to discover the continuous presence of Vibrio sp. especially the core groups throughout the experimental weeks as they are also found to be abundant in other coral species as mentioned (Chimetto et al. 2009).

4.2.2 Week 7 to Week 8 for Trachyphyllia geoffroyi

In week 8 where the coral’s surrounding temperature were elevated, one of the isolates derived from Trachyphyllia geoffroyi has 99%similarity with the reference strain of Bacillus subtilis. B. subtilis is generally known for possessing antagonistic activities against numerous bacterial and also fungal pathogens (Logan 1988; Mazza 1994; Walker, Powell & Seddon 1998). Besides, this species is also known for its use as biocontrol and probiotic agents for the treatment of different plants and animal infections (Krebs et al. 1998). Isocoumarins compound is a type of antibiotic which was discovered in B. subtilis and this compound exhibits specific UV absorption properties (Kinder, Kopf & Margaretha 2000; Krohn et al. 1997; Schwebel & Margaretha 2000). To be more specific, the antibiotic compounds found in B. subtilis are known as amicoumacins A, B and C which belong to the Isocoumarins antibiotic family. Amicoumacins A. B and C possess antibacterial, anti-inflammatory and anti-ulcer activity (Itoh et al. 1981; Itoh et al. 1982). Since B. subtilis is a potential strain well- known for producing antibiotic compounds, it is interesting that the strain similar to this species was derived when Trachyphyllia geoffroyi is undergoing bleaching and health deterioration as the seawater temperature was 29°C high. For theoretical explanation, one possible reason for the occurence of B. subtilis strain during high seawater temperature could be due to the fact that this bacteria species is trying to secrete antibiotic compounds to kill the potential coral pathogens that will further harm Trachyphyllia geoffroyi. Another valid explanation to explain the existing of B. subtilis during week 8 where Trachyphyllia geoffroyi is exposed to extreme environment (thermal stress) is that this bacterium might have produced an endospore that allows it to endure extreme conditions of heat in the environment ( Environmental Protection Agency United States, 2007). Although this species synthesises a P a g e | 95

variety of proteases and enzymes that contribute to nutrient cycling of the coral host, it normally exist in a non-biologically active state which is in the spore form (Alexander 1977).Therefore, its presence in week 8 might be in an endospore form which did not contribute in secreting any antibacterial compounds to protect the invasion of opporturnistic pathogens which hence, making Trachyphyllia geoffroyi susceptible to bleaching and eventually leading to mortality.

Other than B. subtilis, another strain identical to reference strain of B. cereus was also found to be associated to Trachyphyllia geoffroyi mucus layer in week 7 and 8. Recent studies discovered that strains of B. subtilis and B cereus are one of the common inhabitants of the Pacific Ocean habitat (Pinchuk et al. 2002) and in fact they were also reported to be have been detected in marine environments among other numerous Bacillus species (Pinchuk et al. 2002).

Another strain isolated in week 8 was related to Oceanobacillus sp. with 88% of similarity. Oceanobacillus sp. is known to be an extreme halotolerant and alkaliphilic bacterium and it is gram positive (Lu, Nogi & Takami 2001). Its presence and potential impact on the coral is uncertain and warrants further investigations. Its low match percentage also indicates that it might be a novel species.

A bacteria strain related to Chromahalobacter salaxigens (99% similarity) was also discovered in week 8. Since it is a halophilic bacteria, this bacteria is able to survive in extreme environmental conditions which is environment with high salinity. However, it is interesting to discover that C. salaxigens is also able to survive in high temperature. A potential role for this isolate might be in the breakdown of amylase (see chapter 5.1).

4.2.3 Week 9 for Trachyphyllia geoffroyi

For week 11 when Trachyphyllia geoffroyi is exposed to extreme environmental condition with increment of maximum temperature up to 29°C and approximately P a g e | 96

2500 ppm of carbon dioxide content, an isolate was found with 99% similarity to reference strain Vibrio communis. Vibrio communis is commonly widespread in the marine environment and they are gram-negative bacteria and is catalase and oxidase positive (Soto-Rodriguez et al. 2003). Since strain related to V. communis is discovered during the elevation of both temperature and carbon dioxide concentration of Trachyphyllia geoffroyi surrounding, this data can correlate with a report that stated that Vibrio sp. produced a photosynthetic inhibitor when there is elevation of temperature which allow Vibrio sp to have a conducive environment to survive and multiply (Rosenberg & Ben-Haim 2002; Sharon & Rosenberg 2008). This data can also explain the existence of Vibrio harveyi in week 8 of the experiment during high temperature elevation (29°C) when there is no elevation in carbon dioxide content of Trachyphyllia geoffroyi surrounding yet. Besides, according to V. proteolyticus, the inhibition of Vibrio’s growth inhibition in the mucus by zooxanthellae via producing free radicals is no longer there when the mucus layer of Trachyphylia geoffroyi is extracted from the coral host itself and therefore, allowing the growth of Vibrio sp. throughout the experimental weeks ( not just week 8 and above). As mentioned earlier regarding the finding that scleractinian corals produces damicornin compound which has antibacterial property against several marine Vibrio sp. such as the core group inclusive of V. communis (Mydlarz, Jones & Harvell 2006), scleractinian coral’s immune defense is also said to be supressed in terms of their production when they are exposed to pathogenic virulent Vibrios sp.. (Choquet et al. 2003; Labreuche et al. 2006a; Labreuche et al. 2006b). This statement could be used as a logical explanation regarding the mortality of Trachyphyllia geoffroyi once the coral is exposed to extreme high temperature combined with high carbon dioxide content on its surrounding as Trachyphyllia geoffroyi could have lost its ability to synthesize its immune defense due to the presence of V. communis.

P a g e | 97

4.3 Shifts in Bacterial Community Associated to Coral Mucus Layer of Euphyllia ancora.

It was observed that there is more diversity of bacteria species when Euphyllia ancora is exposed to 25°C (Week1 to 4). The diversity slowly decreases as temperature rised up to 29°C which only Bacillus sp. is found. However, the diversity of bacteria increases again in week 8 when there are presence of both Vibrio sp. and Bacillus sp. When the coral is exposed to both increment of temperature and CO2 content, more Vibrio sp. is found to be dominating the Euphyllia ancora mucus layer than the Bacillus sp.

4.3.1 Week 5 to Week 6 for Euphyllia ancora

When Euphyllia ancora was exposed to increment in temperature up to 27°C, data obtained shows one of the isolates closely related to Shewanella sp. (99%). According to (Godwin et al. 2012), Shewanella sp. was only detected in healthy coral tissues. Thus, it is reasonable to discover Shewanella sp. related isolates at this period of the experiment when the coral host is still in semi-healthy state as the bleaching process just started to occur after this phase. Supporting this, Shewanella species were only detected during this period of the experiment and no longer presents when the surrounding temperature was increased up to 29°C (Figure XL) . Interestingly, Shewanella-related isolates were not discovered in the other two tested corals, Trachyphyllia geoffroyi and Corallimorphs sp., potentially pointing towards a close relationship with Euphyllia ancora.

During week 6 of the experiment, an isolate with 99% similarity to Bacillus cereus was isolated in Euphyllia ancora this finding is similar to Trachyphyllia geoffroyi as B.cereus was also identified associated to Trachyphyllia geoffroyi. during Week 6 of the experiment. Therefore, the interpretation regarding the existence of this species could be similar as both coral hosts are of same order (scleractinians). One of the bacterial isolates associated with an endermic marine sponge, Arenosclera brasiliensis, is phylogenetically identical to B. cereus and based on a study investigating its P a g e | 98

antimicrobial potential, B. cereus is said to have potential in producing antibiotic as the strain showed inhibition against the growth of B. subtilis (Rua et al. 2014).

Many Vibrio sp. related isolates were also discovered in Euphyllia ancora mucus layer in week 5. The isolates are mostly dominated by the Vibrio core group (V. harveyi, V. owensii, V.alginolyticus, V. communis and V. campbelli). This data again correlates well with the report by V. mediterranei which indicated that the Vibrio core group is dominant in the mucus layer of Brazillian cnidarians. However, based on high Vibrio colony counts and high proportion of different coral species in both healthy (Koren & Rosenberg 2006) and diseased corals (Chimetto et al. 2008b; Weil, Smith & Gil-Agudelo 2006), some authors stated that high dominance of Vibrio sp. in coral mucus layer could be an indication of an unhealthy environment (Chimetto et al. 2008a). As only limited Bacillus sp. related strains and high abundance of Vibrio sp. were discovered when Euphyllia ancora was exposed to higher temperatures (25 to 27°C), it could be an indication that the environment is starting to get undesirable. Another supportive observation would be that during this stage of the experiment, it was observed that Euphyllia ancora started to produce less mucus secretions as it started to get more difficult to extract Euphyllia ancora mucus for investigation purpose. One of the isolates discovered during Week 5 is 97% similar to V. alginolyticus which is one of the most well-known coral pathogens (Cervino et al. 2008; Chimetto et al. 2008a) and therefore, making the interpretation more valid.

4.3.2 Week 7 to Week 8 for Euphyllia ancora

As the surrounding temperature of Euphyllia ancora rised up to 29°C, it is interesting to discover the re-occurrence of Bacillus sp. such as isolates similar to reference strains B. thuringiensis (99%) and B. cereus (95%). The occurrence of Bacillus sp. could be due to their ability to produce endospores, as previously discussed under Trachyphyllia geoffroyi. Bacillus sp. discovered could be present in order to defend Euphyllia ancora by producing antibiotic from pathogens. P a g e | 99

The abundance of Vibrio sp. detected declined and only one of the isolates discovered was 95% similar to V. owensii. The decrease in the abundance of Vibrio sp. could be due to PCR error as in less isolates were successfully been sequenced for their identities due to laboratory errors when retrieving data. This study cannot conclusively rule out that PCR bias may contribute to these findings of species replacements.

4.3.3 Week 9 for Euphyllia ancora

In week 9 of the experiment, Euphyllia ancora died after exposure to extreme temperature and carbon dioxide content (29°C and approximately 2500 ppm). All the isolates discovered during this period were phylogenetically related to Vibrio species such as V. azureus (99%) and V. neocalledonicus (99%). There was a dramatic shift from isolates with more Bacillus sp. related strains in week 7-8 to only Vibrio sp. related strains in week 9. This observation is similar to a report which also showed the same pattern of bacteria community distributions where S. pistillata and A. hyacinthus associated bacteria switched to a community dominated by Vibrio sp. when the corals are exposed to high temperature surroundings (Kvennefors et al. 2010). It is also evident that various Vibrio sp. are well-known to be coral pathogens (Cervino et al. 2008; Sussman et al. 2008). A similar pattern of bacterial community shift was observerd in Acropora millepora; from α-Proteobacteria to Vibrio sp. when the coral host started to experience bleaching (Kvennefors et al. 2010).

P a g e | 100

4.4 Shifts in Bacterial Community Associated to Coral Mucus Layer of Corallimorphs sp.

4.4.1 Week 5 to Week 6 for Corallimorphs sp.

In week 5 and 6, isolates with 99% similarity to Lysinibacillus fusiformis were identified. This species is well-known for their antimicrobial properties as mentioned under Trachyphyllia geoffroyi’s coral’s sections. In the study by Abideen et. al. (2014), isolates with phylogenetic identity similar to reference strain of Lysinibacillus fusiformis presented a high inhibition zone against Streptococcus pneumonia which is another evidence that this species exhibit antimicrobial properties (Abideen & Babuselvam 2014).

Pseudoalteromonas sp. genus is generally known for their antibacterial properties as they produce a wide range of bioactive compounds (Bowman 2007). Generally, Pseudoalteromonas sp. is found in both healthy (Kellogg 2004; Koren & Rosenberg 2006; Kushmaro et al. 1997; Nissimov, Rosenberg & Munn 2009; Wegley et al. 2004; Wilson et al. 2005) and diseased corals(Kushmaro et al. 1996). Therefore, the presence of isolates related to P. prydensis (99%) and 86% to P. plecoglossicida are common in Corallimorphs. sp. There are many studies related to testing the antibacterial activity of Pseudoalteromonas sp. against coral-related gram positive and gram negative bacteria (Shnit-Orland, Sivan & Kushmaro 2012). However, the results on the types of bacteria that Pseudoalteromonas sp. can inhibit differs between different studies. For example, coral mucus layer collected from stony corals originating from Gulf of Eilat contained isolates related to Pseudoalteromonas sp. which only inhibited gram- positive bacteria strains (Shnit-Orland, Sivan & Kushmaro 2012). As for another study, Pseudoalteromonas sp. was reported to only have antibacterial activity against gram- negative bacterial strains (Nissimov, Rosenberg & Munn 2009; Shnit-Orland, Sivan & Kushmaro 2012). For this study, we could speculate that the isolates related to Pseudoalteromonas sp. inhibited the gram negative bacteria such as the Vibrio sp. as according to the phylogenetic tree of Corallimorphs sp., most Vibrio sp. were no longer present after week 5 of the experiment. In week 6, 7 and 8, there was only one isolate P a g e | 101

found to be related to the Vibrio sp. genus. Therefore, it could be that Pseudoalteromonas sp. had inhibited their growth during week 5 of the experiment.

4.4.2 Week 7 to Week 8 for Corallimorphs sp.

There is one isolate in week 7 that is 100% identical to Lysinibacillus fusiformis. During week 7 where the elevation of coral surrounding temperature (27°C) is already above the normal seawater temperature (25°C), this species could form dormant endospores as it is resistant to heat and forming dormant endospores is its natural way of surviving in harsh conditions (Abideen & Babuselvam 2014). These spores are said to be able to remain viable for a longer time which explains its survival around Corallimorphs’ mucus layer despite the unfavourable high surrounding temperature. As stated before, this bacterial species possesses antimicrobial activity and no study mentioned it turning virulent towards corals, so it can be regarded as not the causative agent for the deteriorating health condition of Corallimorphs at this stage (week 7 and week 8).

An isolate closely related to Desulfovubrio vullgaris (100%) was also detected in the Corallimorphs sp. mucus layer when the coral is exposed to temperature up to 29°C and according to Schnell et.al (1996), sulphate-reducing bacteria were discovered to be part of the microbial community that contributes to induction of black band disease in corals (Meron et al. 2011; Schnell, Assmus & Richardson 1996). However, Arboleda and Reichardt (2009) found that these sulfate-reducing bacteria are also present in healthy corals. In general, all living organism require sulphur for the synthesis of proteins and essential cofactors and therefore, sulphur compounds are usually assimilated by microbes for the biosynthesis of amino acids such as cysteine and methionine (Arboleda & Reichardt 2009; Wegley et al. 2007). No black band disease was observed and we hence assume that this isolate was not harmful to the coral.

In week 8 of the experiment where Corallimorphs sp. was exposed to temperature up to 29°C, an isolate related to Pseudoalteromonas prydensis (99% similarity) was discovered. This is interesting as another study found that Pseudomoalteromonas sp. P a g e | 102

wer able to survive in dead corals (Frias-Lopez et al. 2002). Therefore, it is reasonable to discover this species during week 8 of the experiment.

One isolate that was discovered in Corallimorphs sp. mucus layer was similar to Vibrio owensii (99%). According to an investigation in the Hawaii Reef Coral, Vibrio owensii was found to be the main causative agent that induced the tissue loss disease which is better known as Montipora white syndrome (MWS) in Montipora capitata (Vibrio owensii). This finding is one good evident that Vibrio owensii is a potential coral pathogen. Therefore, Vibrio owensii’s presence during high temperature exposure (29°C) to Corallimorphs sp. that made the coral’s health decreased is not surprising as they might be opportunistic pathogen that caused Corallimorphs sp.’ health to worsen as they act as the opportunistic pathogen. Although in week 8 Corallimorphs sp. has not undergone mortality yet, the health condition has already deteriorated (lack of mucus secretion and some white discolouration spots on the coral tissues).

Besides the presence of isolates identical to V. owensii, isolates with similarities up to 95% with reference strains V. harveyi, were also found in week 8. It is found that Vibrio harveyi and Vibrio alginolyticus function as nitrogen-fixing bacteria in the coral mucus layer and they are discovered to even dominate the culturable nitrogen-fixing bacteria of the Brazilian coral Mussismilia hispida (Klaus et al. 2007). In contrast, Vibrio harveyi is also found to have caused vibrionic coral bleaching in the Mediterranean (Kushmaro et. al. 2007). Vibrio harveyi sp. is only discovered in unhealthy coral host and not discovered in healthy coral colonies (Klaus et al. 2007). This finding is contradict to our finding as our study showed presence of isolates phylogenetically identical to V. harveyi throughout the experiment even when Corallimorphs sp. is still in good health condition. However, this statement regarding V. harveyi is closely related to the unhealthy state of the coral at this point of time.

P a g e | 103

4.4.3 Week 9 for Corallimorphs sp.

When Corallimorphs sp. was exposed to high surrounding temperature and carbon dioxide content, the only isolate discovered during this period is related to Vibrio communis (99%). This finding is similar to Trachyphyllia geoffroyi as V. communis was also discovered in Trachyphyllia geoffroyi during week 8 of the experiment. Trachyphyllia geoffroyi experienced extreme health deterioration and eventually mortality, we could speculate that Vibrio communis strains discovered within the corals are among the potential causative agents that contribute to the deteriorating health of Corallimorphs sp. and Trachyphyllia geoffroyi.

4.5 Conclusion Bacterial Diversity Shifts in mucus layers of Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp.

under temperature and CO2 stress

The shifting banding patterns observed using DGGE and RIASA can be correlated with the finding by Cooney et. al. (2002) which stated that the community of coral- associated bacteria will undergo changes in response to stress or disease (Cooney et al. 2002). Phylogenetic trees analysis also clearly indicated that there are obvious shifts in the bacterial community when the corals are exposed to different impact of sudden environmental changes such as the increment of temperature and carbon dioxide content.

In general, Trachyphyllia geoffroyi and Euphyllia ancora experienced severe deterioration of health and eventually mortalrty during the last week of the experiment when they are exposed to extreme temperature and carbon dioxide content. As for Corallimorphs sp., this coral also underwent health deterioration but managed to survive after the whole experiment. Based on an investigation regarding coral’s survival when they are exposed to extreme environmental condition, it is stated that bleached coral reefs cannot survive very long unless conditions are changed back to normal condition and the symbiosis between coral host and their associated bacteria and zooxanthellae are re-established (Szmant & Gassman 1990). Therefore, it is reasonable to conclude that in our experiment, the corals are exposed to P a g e | 104

unfavourable environmental condition for too long and too extreme for them to recover back to their normal health conditions. It was also observed that the mortality rate among the corals differed. Euphyllia ancora was observed to have undergone mortality first then followed by Trachyphyllia geoffroyi This observation could be explained by a report that stated different species of corals showed different sensitivity to bleaching with variation between individual colonies of the same species. Some coral species were said to have higher resistance to bleaching and health deterioration such as Montipora capitata and Montipora patula (Szmant & Gassman 1990). Besides, the rate of recovery of the coral hosts is also stated to be related to bleaching sensitivity (Szmant & Gassman 1990). From here, we could conclude that Euphyllia ancora is the most sensitive to bleaching copared to Trachyphyllia geoffroyi and Corallimorphs sp. in terms of its rate of bleaching and mortality.

In terms of bacterial community shifts, Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp. experienced decrease in the diversity of bacteria community after Week 4 where the surrounding temperature rose from 25 to 27°C. This data correlates well with other findings which also show reduction in microbial group numbers compared to when the coral hosts were in healthy states (Kooperman et al. 2007; Pantos et al. 2003).

In this study, Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp. have the same class of bacteria that generally dominates the corals species throughout the experimental weeks which are ɤ-Proteobacteria and Firmicutes. However, when it comes to the classification of the bacteria species via their genus, there are differences of isolates’ identities when compared among the three corals. This shows that coral- associated bacteria are species specific and there was an evident study that also observed that coral-associated bacteria are species specific regardless of their geographical location (Rohwer et 2001, UV).

According to 16s rRNA gene sequences, for Trachyphyllia geoffroyi, 23 of the isolates are related to ɤ-Proteobacteria while as for Euphyllia ancora coral 27 of them are also related to the ɤ-Proteobacteria family. Corallimorphs sp. coral has 21 also in relation P a g e | 105

with the family ɤ-Proteobacteria based on the bacteria references too. The results show that ɤ-Proteobacteria is the dominant species for all three corals. The majority of the isolates for all three corals are related to the Vibrio core group (Trachyphyllia geoffroyi n= 18, Euphyllia ancora n=22 and Corallimorphs sp. n=21). This group also appears to be dominant in other corals such as Montasstrea cavernosa from the Caribbean (Frias-Lopez et al. 2002). According to Godwin and colleagues, based on their culture based survey, they discovered that both healthy and Australian Subtropical White Syndrome (ASWS) - affected Turbinaria mesenterina were dominated by ɤ-Proteobacteria, in particular Vibrio species (Godwin et al. 2012). This finding is also similar to our research data which shows the domination of ɤ- Proteobacteria throughout the experiment. Shnit-Orland & Kusheuphyllmaro (2009) also stated that Vibrio sp. associated with the coral mucus produce anti-bacterial compounds against several pathogens, thereby protecting the coral host against pathogens. This proves the potential of Vibrio as beneficial residential bacteria on the coral mucus layer. This correlates with our data that shows Vibrio sp. dominance in the Trachyphyllia geoffroyi, Euphylliaancora. and Corallimorphs sp.’ corals mucus layers under control conditions.

The different roles played by Vibrio sp. such as coral mutualists and also coral pathogens are due to the fact that they respond swiftly to changes in environmental conditions. For example, when there is increase in temperature of seawater higher than 25°C and in carbon-rich environments such as the coral mucus, the doubling time of the Vibrio sp. growth rate may increase higher. When the corals are exposed to stressful conditions such as high seawater temperature and high nutrient loads (high concentration of dissolved ammonia, phosphate and organic matters), Vibrio sp. will switch their roles to become opportunistic pathogens that will outcompete other species present in the coral mucus (Chimetto et al. 2008a). These species will turn virulence to the corals species to adapt with the surrounding environmental changes in order to continue dominating and surviving in the corals. This statement explains why there is domination of Vibrio sp. when the 3 selected corals in this study are exposed to increment in both temperature and carbon dioxide content.

P a g e | 106

Ritchie and Smith (1995;2004) had demonstrated that Vibrio sp. population increase during the bleaching of coral species and when the coral experience recovery, the amount of Vibrio sp. returned to previous normal level (Ritchie & Smith 1995, 2004). As observed on our results. Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp. did not revived back to their normal healthy state as both Trachyphyllia geoffroyi and Euphyllia ancora experienced immediate mortality while Corallimorphs sp. no longer secretes mucus. Therefore, the corals tested did not manage to recover after our experiment due to too sudden and extreme environmental impact conditions.

As observed in the phylogenetic trees in Figure XXVI, XXVII and XXVIII no Photobacterium sp. were isolated when the selected corals are exposed to higher seawater temperatures for all three tested coral species. Photobacterium sp. was not found in the Trachyphyllia geoffroyi but they were discovered in both Euphyllia ancora and Corallimorphs sp.. Photobacterium sp. is only discovered in both Hammer and Mushroom corals when they are in the first four weeks of the control experiment when the corals are exposed to normal condition which means they are in healthy states at that period of time. This results correlate with other journal finding which also stated that no Photobacterium sp. strains were isolated from any part of T. mesenterina colonies affected by disease as these isolates only present when the coral host is still in healthy condition(Godwin et al. 2012).

Another dominant family related to Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp. are the Firmicutes (Trachyphyllia geoffroyi n= 18, Euphyllia ancora n=22 and Corallimorphs sp. n=21). Based on the phylogenetic results, Bacillus sp. was found in the Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp. during Week1 to Week 4 which was during the control weeks of the experiment. It is common to discover the presence of Bacillus sp. when the corals are still in normal state of health condition. This is due to the fact that Bacillus sp. (Weisenborn, Brown & Meyers 1984) play important roles in producing antibiotics and also functions as UV-absorbing bacteria that contribute to the coral’s health. According to Ravindran et. al. (2013), majority UV-absorbing bacteria belonged to the Firmicutes family (Ravindran et al. P a g e | 107

2013). However, it is also observed that Bacillus sp. dominates bacterial communities in the mucus layers of Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp. during week 6 and 7.

All the three corals exhibit the same bacterial community shifting phase pattern in this study. This domination of Bacillus sp. over Vibrio sp. in the coral mucus layer indicates an obvious bacterial community shift. This finding did not correlate with previous studies as normally Bacillus sp. appears as beneficial bacteria instead of potential pathogenic species that would dominate the corals mucus layer during increase in seawater temperature (Shnit‐Orland & Kushmaro 2009). Ritchie (2006) also stated the opposite statement with the current finding which is that thermal stresses would cause the increase of Vibrio sp. as these species would replace the community of beneficial bacteria instead of other species (Ritchie 2006). When the temperature rose further to 29°C in week 8, the diversity of the bacterial community increased back as the coral is not only dominated by Bacillus sp. but also the Vibrio sp. Then, the shift is followed by domination of only the Vibrio sp. when all the three corals are exposed to both elevation in temperature (30°C) and carbon dioxide content. This pattern is again in agreement with Ritchie et al. (2006). It seems that Bacilli living in the coral mucus try to fight off the infection but cannot sustain their defense under more extreme conditions.

CHAPTER 5

5.1 Potential coral pathogens and phage therapy

This study investigates the feasibility of applying bacteriophage therapy to treat the assumed potential coral pathogens such as the Vibrios sp. and Bacillus sp. isolated in the tested corals during an increase in temperature and carbon dioxide content of their surroundings. The study of bacteriophage is applied here in this study in order to seek for potential bacteriophages that can inhibit the growth of potential coral marine pathogen as this will help to reduce the deterioration of coral’s health. The worldwide decline of coral reefs ecosystems due to their health deterioration has brought up the P a g e | 108

need to seek for tools and strategies to treat and control coral diseases. Antibiotics were used as a way to treat the coral diseases but unfortunately, this method is not applicable for long term. This is because of the general effects of antibiotic on bacteria and the potential dangers of selection for antibiotic-resistant strains (Parisien et al. 2008). Besides, corals also do not possess an adaptive immune system (Nair et al. 2005). Therefore, another alternative should be applied instead and one of the most suitable treatment is via phage therapy as it does not bring negative effects to the coral hosts (Cohen et al. 2013). Bacteriophage plaque assay were carried out to identify whether any of the selected bacteriophages samples collected from the chicken dunk have the ability to cause plaques on the growth of the potential coral pathogens.

5.2 Identification of potential coral pathogens

Since there is shift of bacteria community from more diverse population to only dominating ones when temperature and carbon dioxide content increases, the isolates that dominated the coral mucus layer in the later stages of the experiment are expected to be potential coral pathogens. In this experiment, six (6) bacterial isolates that are potential coral pathogens (based on analysis of experiment results and also related journal regarding coral pathogens), were selected for the phage therapy assay. The potential phages were isolated from chicken dunk samples and phage assay was applied to investigate whether the potential phages can inhibit the growth of the selected potential pathogens.

Potential coral pathogens derived from Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp. mucus layer were selected from isolates collected during Week 8 and also week 11 of the experimental period. The main reason is due to the fact that Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp. health condition only started to show obvious deterioration and eventually mortality during week 8 of the experiment. For Trachyphyllia geoffroyi, isolate identified as Vibrio harveyi (derived in week 8) was selected because Vibrio sp. are well-known to be coral pathogens that caused coral diseases (Cervino et al. 2008; Kvennefors et al. 2010; Sussman et al. P a g e | 109

2008). It could be concluded that since V. harveyi was discovered during the period where Trachyphyllia geoffroyi. underwent severe bleaching; V. harveyi could be the virulent causative agent that contribute to this. Therefore, V. harveyi strain was selected for the phage assay to see whether their growth could be inhibited by potential bacteriophages.

Besides, Bacillus cereus strain derived from Trachyphyllia geoffroyi during week 8 was also selected for the phage assay. This isolate was selected due to that fact that there was more Bacillus sp. found during week 8 of the experiment in Trachyphyllia geoffroyi compared to Vibrio sp. It is very unlikely to discover more Bacillus sp. isolates than Vibrio sp. during elevation of temperature surrounding coral species as most studies found that Vibrio sp. are the dominating species when there is an increase in temperature that caused adverse health condition to coral host (Kushmaro et al. 1996; Ritchie et al. 1994; Sharon & Rosenberg 2008). The trend of the bacterial community shifting in this study could be considered as the first to discover higher abundance of Bacillus sp. genus than Vibrio sp. during temperature elevation around the coral host. Although there was no scientific journal evidence that stated that Bacillus sp. could be virulent to coral host, it could be possible that this study is the first to discover that Bacillus strain found in Trachyphyllia geoffroyi during week 8 is virulent to the coral host as during its presence and dominance, Trachyphyllia geoffroyi health were deteriorating badly.

As for Euphyllia ancora, three (3) isolates were selected for bacteriophages assay which are derived from week 8 (temperature up to 29°C) and week 11 (temperature

29°C coupled by increment in CO2) of the experiment. Similar to Trachyphyllia geoffroyi, there were more Bacillus sp. found in Euphyllia ancora during week 8 of the experiment compared to Vibrio sp. therefore, Bacillus sp. could be a potential virulent organism that contribute to the deteriorating health of Euphyllia ancora during week 8 when there is elevation in temperature up to 29°C. Vibrio azureus strain from week 11 isolated from Euphyllia ancora mucus layer were selected as Vibrio azureus is known to be one of the V. harveyi-related species that are associated with diseased aquatic oprganisms (Gomez-Gil et al. 2004). During its presence, Euphyllia ancora experienced death (removal of all polyps). Therefore, based on the journal finding and also P a g e | 110

experimental observation, V. azureus could be the potential causative agent that acted as opportunistic pathogen which caused mortality to Euphyllia ancora. Another isolate identified as V. neocalledonicus found in week 11 was also selected for phage assay for similar reasons as V. azureus.

Only one isolate from Corallimorphs sp. mucus layer was selected for the phage assay which was phylogenetically identified as Bacillus thuringiensis. This species is isolated from Corallimorphs sp. during week 8 of the experiment where the coral host started to experience less mucus secretion due to unfavourable environmental condition. B. thuringiensis was selected as there were more Bacillus present compared to Vibrio sp. during week 8 (similar to Trachyphyllia geoffroyi. and Euphyllia ancora bacterial shift trend). Therefore, it could also be one of the potential coral pathogens that are virulent to Corallimorphs sp.

The pathogenicity of these six (6) chosen isolates is not proven as no scientific experimental procedures has been carried out to determine their pathogenicity factors such as Koch postulates. Hence, there is a chance that these 6 isolates might not be coral pathogens.

5.3 Results and Discussions for Bacteriophages Screening

Marine agar plates with selected bacterial isolates were used for phage assay. Each isolate was analysed in duplicates for more accurate results. Each plate is divided into 5 sections with the 5 different isolated bacteriophages (labelled as A B C D E) inoculated on top of the isolates on the plate. The isolates chosen were labelled as:

 Isolate 1: Bacillus thuringiensis (derived from Corallimorphs.sp. during week 8)  Isolate 2: Vibrio harveyi (derived from Trachyphyllia geoffroyi during week 8)  Isolate 3: Vibrio azureus (derived from Euphyllia ancora during week 11)  Isolate 4: Vibrio neocalledonicus (derived from Euphyllia ancora during week 11)  Isolate 5: Bacillus cereus (derived from Trachyphyllia geoffroyi during week 8)  Isolate 6: Bacillus cereus (derived from Euphyllia ancora during week 8) P a g e | 111

Bacteriophages that were able to form plaques on the marine agar plates inoculated with the potential coral pathogens isolates were regarded as being able to inhibit the growth of the isolates. The results were observed and recorded as follows:

Figure XXXIII(a): Results of Bacteriophages Plaque Assay showing the activity of phage C and E in forming plaques on the agar plates inoculated with the selected potential coral pathogen isolates.

P a g e | 112

Figure XXXIII (b): Results of Bacteriophages Plaque Assay showing the activity of phage C and E in forming plaques on the agar plates inoculated with the selected potential coral pathogen isolates.

P a g e | 113

Figure XXXIII(c): Results of Bacteriophages Plaque Assay showing the activity of phage B and C in forming plaques on the agar plates inoculated with the selected potential coral pathogen isolates.

The formation of plaques show the inhibition of the growth of the selected potential coral pathogens isolates tested in this experiment. Based on Figures XXXIII(a), XXXIII (b) and XXXIII( c), it is observed that bacteriophages labelled C and E yield positive results by causing plaques against all isolates. Despite the positive results, there are major limitations to this experiment. Plaque assay alone cannot conclude that the potential bacteriophages that inhibited the growth of the potential coral pathogens and the selected coral pathogens are also not certified experimentally as real coral pathogens unless Koch’s postulates studies is applied and been satisfied (Efrony et al. 2006). Despite the limitations, intitial were highly promising and phages type C and E were analysed further for their identifications. P a g e | 114

Based on Figures XXIII and XXIV (methodology section), the gel results show the success in amplifying the specific targeted genes of Phage C and E as they show clear bands approximately of 500 to 600 bp. The results obtained show the potential of the isolated bacteriophage to be a virus belonging to the family of cyanophages. However, based on the BLAST result in NCBI, the reference sequence did not show any relation to cyanophages. Instead, the reference sequence is related to the family of Inoviridae, in particular the Enterobacterio phage M13 with phylogenetic similarity up to 96% (accession number CP002824). Due to the complications in concentrating the viruses in the marine water samples collected, bacteriophages isolated from other sources (chicken dunk) were used instead. E.coli is the common host for the replication of Enterobacterio phage M13 hand despite the high degree of host specificity; it seems to be able to inhibit our potential coral pathogens.

It is definitely an interesting finding that both phages type C and E are closely related to Enterobacterio phage M13 and they actually yield positive results in inhibiting the selected potential coral pathogens growth in the phage plaque assay. There were no studies found that shows the potential of phage M13 as potential phage that can combat the growth of coral pathogens in the marine environment. These were only studies related to utilizing phage M13 for technological purposes such as using it as a viral gene delivery vehicle (Molenaar et al. 2002). Therefore, this finding could be the first study to have identified Enterobacterio phage M13 ability in inhibiting the growth of potential coral pathogens which are Bacillus thuringiensis, Vibrio harveyi, Vibrio azureus, Bacillus cereus and Vibrio neocalledonicus.

P a g e | 115

CHAPTER 6

Summary and Future Work

This study has presented (i) an overview of culturable bacterial communities of corals mucus layers obtained from 3 coral samples (ii) the shift in the bacteria community patterns when exposed to different environmental changes such as temperature and carbon dioxide content (iii) the role of potential bacteriophage inhibiting the growth of the potential extracted marine pathgens.

The present study showed the complexity of the coral holobiont and its response to changes in extreme environmental conditions. It is also found that the microbial community associated to the coral mucus layer and the surrounding environmental conditions determined the coral’s general health and function. Therefore, it is important to find out possible solutions to solve the deteriorating health of the coral reefs that are due to environmental factors. Phage therapy is one of the most desirable methods to counter the deteriorating health of corals caused by marine pathogens as it is not harmful. The threats to coral reefs worldwide give new urgency to understanding the nature of the relationships between healthy corals and their associated microbes. Characterizing these organisms and documenting their patterns of distribution, as what had been applied here, is an essential first step.

In order to gain more insights understanding of the bacterial community shifts for this research the DGGE gel obtained should be excised, re-amplified and re-run on the DGGE gel to ensure correct migration and purity of the product and identified via sequencing (Bourne & Munn 2005a). Then, the bands should be submitted for sequencing to identify the bacterial community species in order to see the changes of the species community throughout the experiment clearly (Bourne et al. 2008). Other than that, bacterial communities of the corals could also be analysed via pyrosequencing (Wegley et al. 2007). Metagenomics analysis via pyrosequencing, provides an opportunity to describe the taxonomic components (Tyson et al. 2004), P a g e | 116

relative abundances (Breitbart et al. 2002; Rodriguez-Brito, Rohwer & Edwards 2006) and metabolic potential (Tringe et al. 2005) of all microbes within the coral holobiont.

Screening for secondary metabolite-producing bacteria associated with corals via 16S rDNA approach should also be carried out. For example, polyketides and non- ribosomal peptides are compounds widely used in pharmaceuticals, industrial agents or agrochemicals (Silakowski et al, 2000). These compounds are biosynthesized by large polyfunctional enzyme systems within the protein. The biosynthetic proteins are known as polyketide synthases (PKS) and nonribosomal polypeptide sythetases (NRPS) (Cane, 1997). Hence, to detect these two genes in the isolated bacteria cultures, PCR screening needs to be conducted which a specific oligonucleotides primer was used to amplify DNA non-ribosomal peptide synthetase (NRPS) and polyketide synthases (PKS) (Radjasa OK. & Sabdono A., 2003). This is because PCR-based screening allows a rapid evaluation of many isolates among coral-associated bacteria produced secondary metabolites.

Bacteria isolates identified as phylogenetically similar to Vibrio sp. should be tested to see whether they are scientifically proven as culturable nitrogen-fixing bacteria to Trachyphyllia geoffroyi, Euphyllia ancora. and Corallimorph sp. The cultures identical to Vibrio sp. should be cultured in nitrogen-free medium to see whether do they show nitrogenase acitivity by means of the acetylene reduction assay (ARA) (Chimetto et. Al., 2008).

Besides, an investigation should be carried out to determine whether or not any of the isolated bacteria species are potentially pathogenic to coral. This can be done via pathogenesis test. The test can be done by hatching Artemia cysts in seawater (salinity = 32‰) at room temperature for 48 hours. The groups of nauplii were transferred to filtered (0.22 µm) seawater into which was pipetted 1.0 ml volumes of the overnight bacterial cultures isolated from the three selected corals, which were incubated at room temperature in TNB or T2NB, as appropriate to achieve 106 cells ml−1 (as deduced using an Improved Neubauer type haemocytometer slide at a P a g e | 117

magnification of ×400 on a Carl Zeiss Axiophot light microscope) or ECP preparation (Austin B. et. a.,2005). Then, these were incubated at room temperature, and examined daily for the presence of dead nauplii over a 4-day period.

In addition, only surface mucus layer of Trachyphyllia geoffroyi, Euphyllia ancoraand Corallimorph sp. samples were extracted for bacterial community analysis and in order to understand better of the entire bacterial community of the corals, future study should include the investigation of the corals’ tissue layer too. A study which compared the bacteria diversity of Oculina patagonica’s mucus layer and tissue layer demonstrated that there are differences in the diversity of the bacterial community (Koren & Rosenberg 2006). The tissue layer of the coral host has larger bacterial diversity compared to the mucus layer of the coral host (Koren & Rosenberg 2006). By providing both microbial analysis investigation of the corals tissues and mucus extract, it will help in providing a comprehensive database for future examinations of changes in the bacterial community during bleaching events.

In a controlled experiment conducted to test the impact of increased partial pressure of carbon dioxide (pCO2) on calcifying coral reefs organisms (Jokiel et al. 2008), mesocosm approach was applied and it was very effective at detecting the relative importance of various calcifying organisms in accounting for declines in reef community calcification under acidified conditions. Jokiel and colleagues had successfully identified groups of organisms that show a profound response to conditions of ocean acidification. Therefore, another recommended future research work would be conducting a mesocosm investigation where the corals are studied in their actual habitat. This would contribute in providing a more accurate and realistic data as the experiment will be conducted in replicate continuous flow coral reef mesocosms flushed with unfiltered sea water and original seawater parameter such as surrounding temperature and pH condtions.

In order to scientifically prove the pathogenicity of the bacterial isolates and their identities as causative agents of coral bleaching, Koch’s postulates can be applied (Bourne & Munn 2005a). P a g e | 118

References

Abideen, S & Babuselvam, M 2014, 'Antagonistic activity of Lysinibacillus fusiformis n 139 strain isolated from marine fish Triacanthus strigilifer and genome sequence', Int. J. Curr. Microbiol. App. Sci, vol. 3, no. 4, pp. 1066-1072.

Ainsworth, T, Fine, M, Roff, G & Hoegh-Guldberg, O 2007, 'Bacteria are not the primary cause of bleaching in the Mediterranean coral Oculina patagonica', The ISME journal, vol. 2, no. 1, pp. 67-73.

Ainsworth, T, Kramasky-Winter, E, Loya, Y, Hoegh-Guldberg, O & Fine, M 2007b, 'Coral disease diagnostics: what's between a plague and a band?', Applied and environmental microbiology, vol. 73, no. 3, pp. 981-992.

Alker, AP, Smith, GW & Kim, K 2001, 'Characterization of Aspergillus sydowii (Thom et Church), a fungal pathogen of Caribbean sea fan corals', Hydrobiologia, vol. 460, no. 1- 3, pp. 105-111.

Alves, PDD, de Faria Siqueira, F, Facchin, S, Horta, CCR, Victória, JMN & Kalapothakis, E 2014, 'Survey of Microbial Enzymes in Soil, Water, and Plant Microenvironments', The open microbiology journal, vol. 8, p. 25.

Antonius, A 1973, 'New observations on coral destruction in reefs,' Tenth Meeting of the Association of Island Marine Laboratories of the Caribbean, University of Puerto Rico (Mayaguez),

Antonius, A 1981, 'The ‘band’diseases in coral reefs,' Proc 4th Int Coral Reef Symp, 7- 14. Arahal, DR, García, MT, Vargas, C, Cánovas, D, Nieto, JJ & Ventosa, A 2001, 'Chromohalobacter salexigens sp. nov., a moderately halophilic species that includes P a g e | 118

Halomonas elongata DSM 3043 and ATCC 33174', International journal of systematic and evolutionary microbiology, vol. 51, no. 4, pp. 1457-1462.

Arboleda, M & Reichardt, W 2009, 'Epizoic communities of prokaryotes on healthy and diseased scleractinian corals in Lingayen Gulf, Philippines', Microbial ecology, vol. 57, no. 1, pp. 117-128.

Austin, B, Austin, D, Sutherland, R, Thompson, F & Swings, J 2005, 'Pathogenicity of vibrios to rainbow trout (Oncorhynchus mykiss, Walbaum) and Artemia nauplii', Environ Microbiol, vol. 7, no. 9, Sep, pp. 1488-95.

Austin, B & Austin, DA 2007, Bacterial fish pathogens: disease of farmed and wild fish, Springer. Banin, E, Israely, T, Fine, M, Loya, Y & Rosenberg, E 2001a, 'Role of endosymbiotic zooxanthellae and coral mucus in the adhesion of the coral‐bleaching pathogen Vibrio shiloi to its host', FEMS Microbiology Letters, vol. 199, no. 1, pp. 33-37.

Banin, E, Israely, T, Kushmaro, A, Loya, Y, Orr, E & Rosenberg, E 2000, 'Penetration of the Coral-Bleaching Bacterium Vibrio shiloi into Oculina patagonica', Applied and Environmental Microbiology, vol. 66, no. 7, pp. 3031-3036.

Banin, E, Khare, SK, Naider, F & Rosenberg, E 2001b, 'Proline-Rich Peptide from the Coral PathogenVibrio shiloi That Inhibits Photosynthesis of Zooxanthellae', Applied and environmental microbiology, vol. 67, no. 4, pp. 1536-1541.

Bein, SJ 1954, 'A study of certain chromogenic bacteria isolated from “red tide” water with a description of a new species', Bulletin of Marine Science, vol. 4, no. 2, pp. 110- 119.

P a g e | 118

Ben-Haim, Y, Thompson, F, Thompson, C, Cnockaert, M, Hoste, B, Swings, J & Rosenberg, E 2003, 'Vibrio coralliilyticus sp. nov., a temperature-dependent pathogen of the coral Pocillopora damicornis', International Journal of Systematic and Evolutionary Microbiology, vol. 53, no. 1, pp. 309-315.

Bizani, D & Brandelli, A 2002, 'Characterization of a bacteriocin produced by a newly isolated Bacillus sp. Strain 8 A', Journal of Applied Microbiology, vol. 93, no. 3, pp. 512- 519.

Buck, JD & Meyers, SP 1966a, 'Growth and Phosphate Requirement of Pseudomonas Piscicida and Related Antiyeast Pseudomonads', Bulletin of Marine Science, vol. 16, no. 1, pp. 93-101.

Bak, R, Joenje, M, De Jong, I, Lambrechts, D & Nieuwland, G 1998, 'Bacterial suspension feeding by coral reef benthic organisms', Marine Ecology Progress Series, vol. 175, pp. 285-288.

Bally, M & Garrabou, J 2007, 'Thermodependent bacterial pathogens and mass mortalities in temperate benthic communities: a new case of emerging disease linked to climate change', Global Change Biology, vol. 13, no. 10, pp. 2078-2088.

Beals, M, Gross, L & Harrell, S 2000, 'Diversity indices: Shannon's H and E', The Institute for Environmental Modelling (TIEM), University of Tennessee, USA.

Becking, LB, Kaplan, IR & Moore, D 1960, 'Limits of the natural environment in terms of pH and oxidation-reduction potentials', The Journal of Geology, pp. 243-284.

Ben-Haim, Y, Zicherman-Keren, M & Rosenberg, E 2003, 'Temperature-regulated bleaching and lysis of the coral Pocillopora damicornis by the novel pathogen Vibrio coralliilyticus', Applied and Environmental Microbiology, vol. 69, no. 7, pp. 4236-4242. P a g e | 118

Ben‐Haim, Y, Banim, E, Kushmaro, A, Loya, Y & Rosenberg, E 1999, 'Inhibition of photosynthesis and bleaching of zooxanthellae by the coral pathogen Vibrio shiloi', Environmental Microbiology, vol. 1, no. 3, pp. 223-229.

Benayahu, Y & Loya, Y 1983, 'Surface brooding in the Red Sea soft coral Parerythropodium fulvum fulvum (Forskål, 1775)', The Biological Bulletin, vol. 165, no. 2, pp. 353-369. Berger, WH & Parker, FL 1970, 'Diversity of planktonic foraminifera in deep-sea sediments', Science, vol. 168, no. 3937, pp. 1345-1347. Bochow, H & Hevesi, M 1998, 'Use of Bacillus subtilis as biocontrol agent. I. Activities and characterization of Bacillus subtilis strains', Zeitschrift für Pflanzenkrankheiten und Pflanzenschutz, vol. 105, no. 2, pp. 181-197.

Bijlsma, L, Ehler, C, Klein, R, Kulshrestha, S, McLean, R, Mimura, N, Nicholls, R, Nurse, L, Nieto, HP & Stakhiv, E 1996, Cambridge University Press, Cambridge, United Kingdom and New York, NY, USA, pp. 289-324.

Blackwood, CB, Hudleston, D, Zak, DR & Buyer, JS 2007, 'Interpreting ecological diversity indices applied to terminal restriction fragment length polymorphism data: insights from simulated microbial communities', Appl Environ Microbiol, vol. 73, no. 16, Aug, pp. 5276-83.

Bonilla-Findji, O, Malits, A, Lefèvre, D, Rochelle-Newall, E, Lemée, R, Weinbauer, MG & Gattuso, J-P 2008, 'Viral effects on bacterial respiration, production and growth efficiency: consistent trends in the Southern Ocean and the Mediterranean Sea', Deep Sea Research Part II: Topical Studies in Oceanography, vol. 55, no. 5, pp. 790-800.

Bourne, D 2005, 'Microbiological assessment of a disease outbreak on corals from Magnetic Island (Great Barrier Reef, Australia)', Coral Reefs, vol. 24, no. 2, pp. 304-312. P a g e | 118

Bourne, D, Iida, Y, Uthicke, S & Smith-Keune, C 2008, 'Changes in coral-associated microbial communities during a bleaching event', ISME J, vol. 2, no. 4, Apr, pp. 350-63.

Bourne, DG, Garren, M, Work, TM, Rosenberg, E, Smith, GW & Harvell, CD 2009, 'Microbial disease and the coral holobiont', Trends in Microbiology, vol. 17, no. 12, 12//, pp. 554-562.

Bourne, DG & Munn, CB 2005a, 'Diversity of bacteria associated with the coral Pocillopora damicornis from the Great Barrier Reef', Environ Microbiol, vol. 7, no. 8, Aug, pp. 1162-74. Bourne, DG & Munn, CB 2005b, 'Diversity of bacteria associated with the coral Pocillopora damicornis from the Great Barrier Reef', Environmental Microbiology, vol. 7, no. 8, pp. 1162-1174.

Bowman, JP 2007, 'Bioactive compound synthetic capacity and ecological significance of marine bacterial genus Pseudoalteromonas', Marine drugs, vol. 5, no. 4, pp. 220- 241.

Bratbak, G, Thingstad, F & Heldal, M 1994, 'Viruses and the microbial loop', Microbial Ecology, vol. 28, no. 2, pp. 209-221.

Breitbart, M, Miyake, JH & Rohwer, F 2004, 'Global distribution of nearly identical phage-encoded DNA sequences', FEMS Microbiol Lett, vol. 236, no. 2, Jul 15, pp. 249- 56.

Breitbart, M, Thompson, LR, Suttle, CA & Sullivan, MB 2007, 'Exploring the vast diversity of marine viruses', OCEANOGRAPHY-WASHINGTON DC-OCEANOGRAPHY SOCIETY-, vol. 20, no. 2, p. 135.

P a g e | 118

Brown, B 1997, 'Coral bleaching: causes and consequences', Coral reefs, vol. 16, no. 1, pp. S129-S138.

Brown, B & Bythell, J 2005, 'Perspectives on mucus secretion in reef corals', Marine Ecology Progress Series, vol. 296, pp. 291-309.

Brown, B & Howard, L 1985, 'Assessing the effects of “stress” on reef corals', Advances in marine biology, vol. 22, pp. 1-63.

Buck, JD & Meyers, SP 1966, 'In vitro inhibition ofRhodotorula minuta by a variant of the marine bacterium, Pseudomonas piscicida', Helgoländer Wissenschaftliche Meeresuntersuchungen, vol. 13, no. 1-2, pp. 171-180.

Bythell, J 1988, 'A total nitrogen and carbon budget for the elkhorn coral Acropora palmata (Lamarck),' Proceedings of the 6th International Coral Reef Symposium, 535- 540. Cardinale, M, Brusetti, L, Quatrini, P, Borin, S, Puglia, AM, Rizzi, A, Zanardini, E, Sorlini, C, Corselli, C & Daffonchio, D 2004, 'Comparison of different primer sets for use in automated ribosomal intergenic spacer analysis of complex bacterial communities', Applied and Environmental Microbiology, vol. 70, no. 10, pp. 6147-6156.

Carpenter, KE, Abrar, M, Aeby, G, Aronson, RB, Banks, S, Bruckner, A, Chiriboga, A, Cortés, J, Delbeek, JC & DeVantier, L 2008, 'One-third of reef-building corals face elevated extinction risk from climate change and local impacts', Science, vol. 321, no. 5888, pp. 560-563.

Cervino, J, Thompson, F, Gomez‐Gil, B, Lorence, E, Goreau, T, Hayes, R, Winiarski‐ Cervino, K, Smith, G, Hughen, K & Bartels, E 2008, 'The Vibrio core group induces yellow band disease in Caribbean and Indo‐Pacific reef‐building corals', Journal of Applied Microbiology, vol. 105, no. 5, pp. 1658-1671. P a g e | 118

Chenard, C & Suttle, C 2008, 'Phylogenetic diversity of sequences of cyanophage photosynthetic gene psbA in marine and freshwaters', Applied and environmental microbiology, vol. 74, no. 17, pp. 5317-5324.

Chimetto, LA, Brocchi, M, Gondo, M, Thompson, CC, Gomez-Gil, B & Thompson, FL 2009, 'Genomic diversity of vibrios associated with the Brazilian coral Mussismilia hispida and its sympatric zoanthids (Palythoa caribaeorum, Palythoa variabilis and Zoanthus solanderi)', J Appl Microbiol, vol. 106, no. 6, Jun, pp. 1818-26.

Chimetto, LA, Brocchi, M, Thompson, CC, Martins, RC, Ramos, HR & Thompson, FL 2008a, 'Vibrios dominate as culturable nitrogen-fixing bacteria of the Brazilian coral Mussismilia hispida', Syst Appl Microbiol, vol. 31, no. 4, Sep, pp. 312-319.

Chimetto, LA, Brocchi, M, Thompson, CC, Martins, RCR, Ramos, HR & Thompson, FL 2008b, 'Vibrios dominate as culturable nitrogen-fixing bacteria of the Brazilian coral Mussismilia hispida', Systematic and Applied Microbiology, vol. 31, no. 4, 9//, pp. 312- 319.

Chimetto, LA, Cleenwerck, I, Alves, N, Jr., Silva, BS, Brocchi, M, Willems, A, De Vos, P & Thompson, FL 2011, 'Vibrio communis sp. nov., isolated from the marine animals Mussismilia hispida, Phyllogorgia dilatata, Palythoa caribaeorum, Palythoa variabilis and Litopenaeus vannamei', Int J Syst Evol Microbiol, vol. 61, no. Pt 2, Feb, pp. 362-8.

Cho, H-B, Lee, J-K & Choi, Y-K 2003, 'The genetic diversity analysis of the bacterial community in groundwater by denaturing gradient gel electrophoresis (DGGE)', JOURNAL OF MICROBIOLOGY-SEOUL-, vol. 41, no. 4, pp. 327-334.

P a g e | 118

Choquet, G, Soudant, P, Lambert, C, Nicolas, J-L & Paillard, C 2003, 'Reduction of adhesion properties of Ruditapes philippinarum hemocytes exposed to Vibrio tapetis', Diseases of aquatic organisms, vol. 57, no. 1-2, pp. 109-116.

Coffroth, M 1990, 'Mucous sheet formation on poritid corals: an evaluation of coral mucus as a nutrient source on reefs', Marine biology, vol. 105, no. 1, pp. 39-49.

Cohen, Y, Joseph Pollock, F, Rosenberg, E & Bourne, DG 2013, 'Phage therapy treatment of the coral pathogen Vibrio coralliilyticus', Microbiologyopen, vol. 2, no. 1, Feb, pp. 64-74.

Cooney, RP, Pantos, O, Le Tissier, MD, Barer, MR & Bythell, JC 2002, 'Characterization of the bacterial consortium associated with black band disease in coral using molecular microbiological techniques', Environmental Microbiology, vol. 4, no. 7, pp. 401-413.

Correa, AM, Welsh, RM & Thurber, RLV 2012, 'Unique nucleocytoplasmic dsDNA and + ssRNA viruses are associated with the dinoflagellate endosymbionts of corals', The ISME journal, vol. 7, no. 1, pp. 13-27.

Crossland, C 1987, 'In situ release of mucus and DOC-lipid from the corals Acropora variabilis and Stylophora pistillata in different light regimes', Coral Reefs, vol. 6, no. 1, pp. 35-42.

Danovaro, R, Luna, GM, Dell'anno, A & Pietrangeli, B 2006, 'Comparison of two fingerprinting techniques, terminal restriction fragment length polymorphism and automated ribosomal intergenic spacer analysis, for determination of bacterial diversity in aquatic environments', Appl Environ Microbiol, vol. 72, no. 9, Sep, pp. 5982- 9.

P a g e | 118

Davies, PS 1984, 'The role of zooxanthellae in the nutritional energy requirements of Pocillopora eydouxi', Coral Reefs, vol. 2, no. 4, pp. 181-186.

Deacon, E 1979, 'The role of coral mucus in reducing the wind drag over coral reefs', Boundary-Layer Meteorology, vol. 17, no. 4, pp. 517-521.

Dean, FB, Nelson, JR, Giesler, TL & Lasken, RS 2001, 'Rapid amplification of plasmid and phage DNA using Phi 29 DNA polymerase and multiply-primed rolling circle amplification', Genome Res, vol. 11, no. 6, Jun, pp. 1095-9.

Denkin, SM & Nelson, DR 2004, 'Regulation of Vibrio anguillarum empA metalloprotease expression and its role in virulence', Applied and environmental microbiology, vol. 70, no. 7, pp. 4193-4204.

Denner, EB, Smith, GW, Busse, H-J, Schumann, P, Narzt, T, Polson, SW, Lubitz, W & Richardson, LL 2003, 'Aurantimonas coralicida gen. nov., sp. nov., the causative agent of white plague type II on Caribbean scleractinian corals', International Journal of Systematic and Evolutionary Microbiology, vol. 53, no. 4, pp. 1115-1122.

DePaola, A, Nordstrom, JL, Bowers, JC, Wells, JG & Cook, DW 2003, 'Seasonal abundance of total and pathogenic Vibrio parahaemolyticus in Alabama oysters', Appl Environ Microbiol, vol. 69, no. 3, Mar, pp. 1521-6.

Ding, J, Fung, F, Ng, G & Chou, L 1999, 'Novel bioactivities from a coral, Galaxea fascicularis: DNase-like activity and apoptotic activity against a multiple-drug-resistant leukemia cell line', Marine Biotechnology, vol. 1, no. 4, pp. 328-336.

Doney, SC, Fabry, VJ, Feely, RA & Kleypas, JA 2009, 'Ocean acidification: the other CO2 problem', Ann Rev Mar Sci, vol. 1, pp. 169-92. P a g e | 118

Downs, CA, Woodley, CM, Richmond, RH, Lanning, LL & Owen, R 2005, 'Shifting the paradigm of coral-reef ‘health’assessment', Marine Pollution Bulletin, vol. 51, no. 5, pp. 486-494.

Drollet, J, Glaziou, P & Martin, P 1993, 'A study of mucus from the solitary coral Fungia fungites (Scleractinia: Fungiidae) in relation to photobiological UV adaptation', Marine Biology, vol. 115, no. 2, pp. 263-266.

Ducklow, H 1990, 'The biomass, production and fate of bacteria in coral reefs', Ecosystems of the world, vol. 25, pp. 265-289.

Ducklow, HW & Mitchell, R 1979a, 'Bacterial populations and adaptations in the mucus layers on living corals', Limnol. Oceanogr.;(United States), vol. 24, no. 4

Ducklow, HW & Mitchell, R 1979b, 'Observations on naturally and artificially diseased tropical corals: a scanning electron microscope study', Microbial ecology, vol. 5, no. 3, pp. 215-223.

Dustan, P 1977, 'Vitality of reef coral populations off Key Largo, Florida: recruitment and mortality', Environmental Geology, vol. 2, no. 1, pp. 51-58.

Edmunds, P & Davies, PS 1986, 'An energy budget for Porites porites (Scleractinia)', Marine biology, vol. 92, no. 3, pp. 339-347.

Edmunds, P & Davies, PS 1989, 'An energy budget for Porites porites (Scleractinia), growing in a stressed environment', Coral Reefs, vol. 8, no. 1, pp. 37-43.

Efrony, R, Loya, Y, Bacharach, E & Rosenberg, E 2006, 'Phage therapy of coral disease', Coral Reefs, vol. 26, no. 1, pp. 7-13.

P a g e | 118

Ferrier-Pages, C, Gattuso, J, Cauwet, G, Jaubert, J & Allemand, D 1998, 'Release of dissolved organic carbon and nitrogen by the zooxanthellate coral Galaxea fascicularis', Marine Ecology Progress Series, vol. 172, pp. 265-274.

Ferris, M, Muyzer, G & Ward, D 1996, 'Denaturing gradient gel electrophoresis profiles of 16S rRNA-defined populations inhabiting a hot spring microbial mat community', Applied and Environmental Microbiology, vol. 62, no. 2, pp. 340-346.

Fine, M & Loya, Y 1995, 'The coral Oculina patagonica: a new immigrant to the Mediterranean coast of Israel', Isr J Zool, vol. 41, p. 81.

Finkelstein, RA & Hanne, LF 1982, 'Purification and characterization of the soluble hemagglutinin (cholera lectin)(produced by Vibrio cholerae', Infection and immunity, vol. 36, no. 3, pp. 1199-1208.

Frias-Lopez, J, Zerkle, AL, Bonheyo, GT & Fouke, BW 2002, 'Partitioning of Bacterial Communities between Seawater and Healthy, Black Band Diseased, and Dead Coral Surfaces', Applied and Environmental Microbiology, vol. 68, no. 5, pp. 2214-2228.

Fuller, NJ, Wilson, WH, Joint, IR & Mann, NH 1998, 'Occurrence of a sequence in marine cyanophages similar to that of T4 g20 and its application to PCR-based detection and quantification techniques', Applied and Environmental Microbiology, vol. 64, no. 6, pp. 2051-2060.

Fung, FMY & Ding, JL 1998, 'A novel antitumour compound from the mucus of a coral,< i> Galaxea fascicularis, inhibits topoisomerase I and II', Toxicon, vol. 36, no. 7, pp. 1053-1058.

Gamito, S 2010, 'Caution is needed when applying Margalef diversity index', Ecological Indicators, vol. 10, no. 2, pp. 550-551. P a g e | 118

Gauthier, G, Gauthier, M & Christen, R 1995, 'Phylogenetic analysis of the genera Alteromonas, Shewanella, and Moritella using genes coding for small-subunit rRNA sequences and division of the genus Alteromonas into two genera, Alteromonas (emended) and Pseudoalteromonas gen. nov., and proposal of twelve new species combinations', International journal of systematic bacteriology, vol. 45, no. 4, pp. 755- 761.

Gebhardt, K, Schimana, J, Müller, J, Fiedler, HP, Kallenborn, HG, Holzenkämpfer, M, Krastel, P, Zeeck, A, Vater, J & Höltzel, A 2002, 'Screening for biologically active metabolites with endosymbiotic bacilli isolated from arthropods', FEMS microbiology letters, vol. 217, no. 2, pp. 199-205.

Geffen, Y & Rosenberg, E 2004, 'Stress-induced rapid release of antibacterials by scleractinian corals', Marine Biology, vol. 146, no. 5, pp. 931-935.

Geffen, Y & Rosenberg, E 2005, 'Stress-induced rapid release of antibacterials by scleractinian corals', Marine Biology, vol. 146, no. 5, 2005/04/01, pp. 931-935.

Gill, DM 1982, 'Bacterial toxins: a table of lethal amounts', Microbiological Reviews, vol. 46, no. 1, p. 86.

Gladfelter, WB 1982, 'White-band disease in Acropora palmata: implications for the structure and growth of shallow reefs', Bulletin of Marine Science, vol. 32, no. 2, pp. 639-643.

Glynn, P & De Weerdt, W 1991, 'Elimination of two reef-building hydrocorals following the 1982-83 el nino warming event', Science(Washington), vol. 253, no. 5015, pp. 69- 71.

P a g e | 118

Godwin, S, Bent, E, Borneman, J & Pereg, L 2012, 'The role of coral-associated bacterial communities in Australian Subtropical White Syndrome of Turbinaria mesenterina', PLoS One, vol. 7, no. 9, p. e44243. Goldberg, WM 2002, 'Feeding behavior, epidermal structure and mucus cytochemistry of the scleractinian< i> Mycetophyllia reesi, a coral without tentacles', Tissue and Cell, vol. 34, no. 4, pp. 232-245.

Goldsmith, DB, Crosti, G, Dwivedi, B, McDaniel, LD, Varsani, A, Suttle, CA, Weinbauer, MG, Sandaa, RA & Breitbart, M 2011, 'Development of phoH as a novel signature gene for assessing marine phage diversity', Appl Environ Microbiol, vol. 77, no. 21, Nov, pp. 7730-9.

Gomez-Gil, B, Soto-Rodriguez, S, García-Gasca, A, Roque, A, Vazquez-Juarez, R, Thompson, FL & Swings, J 2004, 'Molecular identification of Vibrio harveyi-related isolates associated with diseased aquatic organisms', Microbiology, vol. 150, no. 6, pp. 1769-1777.

Goreau, TF & Wells, JW 1967, 'The Shallow-Water Scleractinia of Jamaica: Revised List of Species and their Vertical Distribution Range', Bulletin of Marine Science, vol. 17, no. 2, //, pp. 442-453.

Gottfried, M & Roman, M 1983, 'Ingestion and incorporation of coral-mucus detritus by reef zooplankton', Marine Biology, vol. 72, no. 3, pp. 211-218.

Green, EP & Bruckner, AW 2000, 'The significance of coral disease epizootiology for coral reef conservation', Biological Conservation, vol. 96, no. 3, pp. 347-361.

Haible, D, Kober, S & Jeske, H 2006, 'Rolling circle amplification revolutionizes diagnosis and genomics of geminiviruses', Journal of virological methods, vol. 135, no. 1, pp. 9-16. P a g e | 118

Hall-Stoodley, L, Costerton, JW & Stoodley, P 2004, 'Bacterial biofilms: from the natural environment to infectious diseases', Nature Reviews Microbiology, vol. 2, no. 2, pp. 95- 108.

Hanlon, GW 2007, 'Bacteriophages: an appraisal of their role in the treatment of bacterial infections', Int J Antimicrob Agents, vol. 30, no. 2, Aug, pp. 118-28.

Harvell, CD, Mitchell, CE, Ward, JR, Altizer, S, Dobson, AP, Ostfeld, RS & Samuel, MD 2002, 'Climate warming and disease risks for terrestrial and marine biota', Science, vol. 296, no. 5576, pp. 2158-2162.

Hayes, RL & Goreau, NI 1998, 'The significance of emerging diseases in the tropical coral reef ecosystem', Rev. Biol. Trop, vol. 46, no. Supl 5, pp. 173-185.

Hill, TC, Walsh, KA, Harris, JA & Moffett, BF 2003, 'Using ecological diversity measures with bacterial communities', FEMS Microbiology Ecology, vol. 43, no. 1, pp. 1-11.

Hoegh-Guldberg, O, Mumby, P, Hooten, A, Steneck, R, Greenfield, P, Gomez, E, Harvell, C, Sale, P, Edwards, A & Caldeira, K 2007, 'Coral reefs under rapid climate change and ocean acidification', science, vol. 318, no. 5857, pp. 1737-1742.

Holmström, C, James, S, Egan, S & Kjelleberg, S 1996, 'Inhibition of common fouling organisms by marine bacterial isolates ith special reference to the role of pigmented bacteria', Biofouling, vol. 10, no. 1-3, pp. 251-259.

Howard, L & Brown, B 1984, 'Heavy metals and reef corals', Oceanogr. Mar. Biol. Ann. Rev, vol. 22, pp. 195-210.

P a g e | 118

Howell, R 1982, 'The secretion of mucus by marine nematodes (Enoplus spp.): A possible mechanism influencing the uptake and loss of heavy metal pollutants', Nematologica, vol. 28, no. 1, pp. 110-114.

Hsieh, Y-J & Wanner, BL 2010, 'Global regulation by the seven-component P< sub> i signaling system', Current opinion in microbiology, vol. 13, no. 2, pp. 198-203.

Isa, Y & Yamazato, K 1981, 'The ultrastructure of calicoblast and related tissues in Acropora hebes (Dana),' Proc. 4th Int. Coral Reef Symp, 99-105. Ishii, K & Fukui, M 2001, 'Optimization of annealing temperature to reduce bias caused by a primer mismatch in multitemplate PCR', Applied and environmental microbiology, vol. 67, no. 8, pp. 3753-3755.

Israely, T, Banin, E & Rosenberg, E 2001, 'Growth, differentiation and death of Vibrio shiloi in coral tissue as a function of seawater temperature', Aquatic Microbial Ecology, vol. 24, no. 1, pp. 1-8.

Itoh, J, Omoto, S, Shomura, T, Nishizawa, N, Miyado, S, Yuda, Y, Shibata, U & Inouye, S 1981, 'Amicoumacin-A, a new antibiotic with strong antiinflammatory and antiulcer activity', The Journal of antibiotics, vol. 34, no. 5, p. 611.

Itoh, J, Shomura, T, Omoto, S, Miyado, S, Yuda, Y, Shibata, U & Inouye, S 1982, 'Isolation, physicochemical properties and biological activities of amicoumacins produced by Bacillus pumilus', Agricultural and Biological Chemistry, vol. 46, no. 5, pp. 1255-1259.

Jensen, P, Harvell, C, Wirtz, K & Fenical, W 1996, 'Antimicrobial activity of extracts of Caribbean gorgonian corals', Marine Biology, vol. 125, no. 2, pp. 411-419.

P a g e | 118

Jiang, SC & Paul, JH 1998, 'Gene transfer by transduction in the marine environment', Applied and Environmental Microbiology, vol. 64, no. 8, pp. 2780-2787.

John, SG, Mendez, CB, Deng, L, Poulos, B, Kauffman, AK, Kern, S, Brum, J, Polz, MF, Boyle, EA & Sullivan, MB 2011, 'A simple and efficient method for concentration of ocean viruses by chemical flocculation', Environ Microbiol Rep, vol. 3, no. 2, Apr, pp. 195-202.

Jokiel, PL & Brown, EK 2004, 'Global warming, regional trends and inshore environmental conditions influence coral bleaching in Hawaii', Global Change Biology, vol. 10, no. 10, pp. 1627-1641.

Jones, RJ, Hoegh-Guldberg, O, Larkum, AWD & Schreiber, U 1998, 'Temperature- induced bleaching of corals begins with impairment of the CO2 fixation mechanism in zooxanthellae', Plant, Cell & Environment, vol. 21, no. 12, pp. 1219-1230. Kushmaro, A, Loya, Y, Fine, M & Rosenberg, E 1996, 'Bacterial infection and coral bleaching', Nature, vol. 380, no. 6573, pp. 396-396.

Kushmaro, A, Rosenberg, E, Fine, M & Loya, Y 1997, 'Bleaching of the coral Oculina patagonica by Vibrio AK-1', Marine ecology progress series. Oldendorf, vol. 147, no. 1, pp. 159-165.

Kellogg, CA 2004, 'Tropical Archaea: diversity associated with the surface microlayer of corals', Marine ecology. Progress series, vol. 273, pp. 81-88.

Kelman, D, Kushmaro, A, Loya, Y, Kashman, Y & Benayahu, Y 1998, 'Antimicrobial activity of a Red Sea soft coral, Parerythropodium fulvum fulvum: reproductive and developmental considerations', Marine Ecology Progress Series, vol. 169, pp. 87-95.

P a g e | 118

Kinder, MA, Kopf, J & Margaretha, P 2000, 'Solid state photochemistry of isocoumarins and isothiocoumarins', Tetrahedron, vol. 56, no. 36, pp. 6763-6767.

Klaus, JS, Janse, I, Heikoop, JM, Sanford, RA & Fouke, BW 2007, 'Coral microbial communities, zooxanthellae and mucus along gradients of seawater depth and coastal pollution', Environ Microbiol, vol. 9, no. 5, May, pp. 1291-305.

Koh, EG 1997, 'Do scleractinian corals engage in chemical warfare against microbes?', Journal of Chemical Ecology, vol. 23, no. 2, pp. 379-398.

Kooperman, N, Ben-Dov, E, Kramarsky-Winter, E, Barak, Z & Kushmaro, A 2007, 'Coral mucus-associated bacterial communities from natural and aquarium environments', FEMS Microbiol Lett, vol. 276, no. 1, Nov, pp. 106-13.

Koren, O & Rosenberg, E 2006, 'Bacteria associated with mucus and tissues of the coral Oculina patagonica in summer and winter', Appl Environ Microbiol, vol. 72, no. 8, Aug, pp. 5254-9.

Krebs, B, Höding, B, Kübart, S, Workie, MA, Junge, H, Schmiedeknecht, G, Grosch, R, Bochow, H & Hevesi, M 1998, 'Use of Bacillus subtilis as biocontrol agent. I. Activities and characterization of Bacillus subtilis strains', Zeitschrift für Pflanzenkrankheiten und Pflanzenschutz, vol. 105, no. 2, pp. 181-197.

Krediet, CJ, Ritchie, KB, Cohen, M, Lipp, EK, Sutherland, KP & Teplitski, M 2009, 'Utilization of mucus from the coral Acropora palmata by the pathogen Serratia marcescens and by environmental and coral commensal bacteria', Applied and environmental microbiology, vol. 75, no. 12, pp. 3851-3858.

Krohn, K, Bahramsari, R, Flörke, U, Ludewig, K, Kliche-Spory, C, Michel, A, Aust, H-J, Draeger, S, Schulz, B & Antus, S 1997, 'Dihydroisocoumarins from fungi: isolation, P a g e | 118

structure elucidation, circular dichroism and biological activity', Phytochemistry, vol. 45, no. 2, pp. 313-320.

Kudva, IT, Jelacic, S, Tarr, PI, Youderian, P & Hovde, CJ 1999, 'Biocontrol of Escherichia coli O157 with O157-specific bacteriophages', Applied and environmental microbiology, vol. 65, no. 9, pp. 3767-3773.

Kumar, S, Nei, M, Dudley, J & Tamura, K 2008, 'MEGA: a biologist-centric software for evolutionary analysis of DNA and protein sequences', Briefings in bioinformatics, vol. 9, no. 4, pp. 299-306.

Kushmaro, A, Banin, E, Loya, Y, Stackebrandt, E & Rosenberg, E 2001, 'Vibrio shiloi sp. nov., the causative agent of bleaching of the coral Oculina patagonica', International journal of systematic and evolutionary microbiology, vol. 51, no. 4, pp. 1383-1388.

Kushmaro, A, Loya, Y, Fine, M & Rosenberg, E 1996, 'Bacterial infection and coral bleaching', Nature, vol. 380, no. 6573, pp. 396-396.

Kushmaro, A, Rosenberg, E, Fine, M, Ben Haim, Y & Loya, Y 1998, 'Effect of temperature on bleaching of the coral Oculina patagonica by Vibrio AK-1', Marine Ecology Progress Series, vol. 171, pp. 131-137. Kushmaro, A, Rosenberg, E, Fine, M & Loya, Y 1997, 'Bleaching of the coral Oculina patagonica by Vibrio AK-1', Marine ecology progress series. Oldendorf, vol. 147, no. 1, pp. 159-165.

Kuta, K & Richardson, L 1996, 'Abundance and distribution of black band disease on coral reefs in the northern Florida Keys', Coral reefs, vol. 15, no. 4, pp. 219-223.

Kvennefors, ECE, Sampayo, E, Ridgway, T, Barnes, AC & Hoegh-Guldberg, O 2010, 'Bacterial communities of two ubiquitous Great Barrier Reef corals reveals both site- P a g e | 118

and species-specificity of common bacterial associates', PloS one, vol. 5, no. 4, p. e10401.

Labonté, JM, Reid, KE & Suttle, CA 2009, 'Phylogenetic analysis indicates evolutionary diversity and environmental segregation of marine podovirus DNA polymerase gene sequences', Applied and environmental microbiology, vol. 75, no. 11, pp. 3634-3640.

Labreuche, Y, Lambert, C, Soudant, P, Boulo, V, Huvet, A & Nicolas, J-L 2006a, 'Cellular and molecular hemocyte responses of the Pacific oyster, Crassostrea gigas, following bacterial infection with Vibrio aestuarianus strain 01/32', Microbes and Infection, vol. 8, no. 12, pp. 2715-2724.

Labreuche, Y, Soudant, P, Gonçalves, M, Lambert, C & Nicolas, J-L 2006b, 'Effects of extracellular products from the pathogenic Vibrio aestuarianus strain 01/32 on lethality and cellular immune responses of the oyster Crassostrea gigas, Developmental & Comparative Immunology, vol. 30, no. 4, pp. 367-379.

Lee, K-K 1995, 'Pathogenesis studies on Vibrio alginolyticus in the grouper, Epinephelus malabaricus, Microbial pathogenesis, vol. 19, no. 1, pp. 39-48.

Lee, SY, Oh, TK, Kim, W & Yoon, JH 2010, 'Oceanobacillus locisalsi sp. nov., isolated from a marine solar saltern', Int J Syst Evol Microbiol, vol. 60, no. Pt 12, Dec, pp. 2758- 62.

Lenski, RE 1988, 'Dynamics of interactions between bacteria and virulent bacteriophage', in Advances in microbial ecology, Springer, pp. 1-44.

Lesser, MP, Falcón, LI, Rodríguez-Román, A, Enríquez, S, Hoegh-Guldberg, O & Iglesias- Prieto, R 2007, 'Nitrogen fixation by symbiotic cyanobacteria provides a source of P a g e | 118

nitrogen for the scleractinian coral Montastraea cavernosa', Marine Ecology Progress Series, vol. 346, pp. 143-152.

Lesser, MP, Mazel, CH, Gorbunov, MY & Falkowski, PG 2004, 'Discovery of symbiotic nitrogen-fixing cyanobacteria in corals', Science, vol. 305, no. 5686, pp. 997-1000.

Lewis, JB 1977, 'Suspension feeding in Atlantic reef corals and the importance of suspended particulate matter as a food source,' Proceedings of the 3rd International Coral Reef Symposium, 405-408.

Lin, B, Wang, Z, Malanoski, AP, O'Grady, EA, Wimpee, CF, Vuddhakul, V, Alves Jr, N, Thompson, FL, Gomez-Gil, B & Vora, GJ 2010, 'Comparative genomic analyses identify the Vibrio harveyi genome sequenced strains BAA-1116 and HY01 as Vibrio campbellii', Environ Microbiol Rep, vol. 2, no. 1, Feb, pp. 81-89.

Lindell, D, Jaffe, JD, Johnson, ZI, Church, GM & Chisholm, SW 2005, 'Photosynthesis genes in marine viruses yield proteins during host infection', Nature, vol. 438, no. 7064, pp. 86-89.

Lindell, D, Sullivan, MB, Johnson, ZI, Tolonen, AC, Rohwer, F & Chisholm, SW 2004, 'Transfer of photosynthesis genes to and from Prochlorococcus viruses', Proceedings of the National Academy of Sciences of the United States of America, vol. 101, no. 30, pp. 11013-11018.

Linley, E & Koop, K 1986, 'Significance of pelagic bacteria as a trophic resource in a coral reef lagoon, One Tree Island, Great Barrier Reef', Marine Biology, vol. 92, no. 4, pp. 457-464.

P a g e | 118

Liuxy, PC, Lee, KK & Chen, SN 1996, 'Pathogenicity of different isolates of Vibrio harveyi in tiger prawn, Penaeus monodon', Letters in Applied Microbiology, vol. 22, no. 6, pp. 413-416. Logan, N 1988, 'Bacillus species of medical and veterinary importance', Journal of medical microbiology, vol. 25, no. 3, pp. 157-165.

Loghothetis, P & Austin, B 1996, 'Variations in antigenicity of Aeromonas hydrophila strains in rainbow trout Oncorhynchus mykiss, Walbaum): an association with surface characteristics', Fish & Shellfish Immunology, vol. 6, no. 1, pp. 47-55.

Longeon, A, Peduzzi, J, Barthelemy, M, Corre, S, Nicolas, J-L & Guyot, M 2004, 'Purification and partial identification of novel antimicrobial protein from marine bacterium Pseudoalteromonas species strain X153', Marine biotechnology, vol. 6, no. 6, pp. 633-641.

Lu, J, Chen, F & Hodson, RE 2001, 'Distribution, isolation, host specificity, and diversity of cyanophages infecting marine Synechococcus spp. in river estuaries', Applied and environmental microbiology, vol. 67, no. 7, pp. 3285-3290.

Lu, J, Nogi, Y & Takami, H 2001, 'Oceanobacillus iheyensis gen. nov., sp. nov., a deep‐ sea extremely halotolerant and alkaliphilic species isolated from a depth of 1050 m on the Iheya Ridge', FEMS microbiology letters, vol. 205, no. 2, pp. 291-297.

Mann, NH, Cook, A, Millard, A, Bailey, S & Clokie, M 2003, 'Marine ecosystems: bacterial photosynthesis genes in a virus', Nature, vol. 424, no. 6950, pp. 741-741.

Margalef, R 1958, Temporal succession and spatial heterogeneity in phytoplankton, University of California press.

P a g e | 118

Marshall, A & Wright, O 1993, 'Confocal laser scanning light microscopy of the extra- thecal epithelia of undecalcified scleractinian corals', Cell and tissue research, vol. 272, no. 3, pp. 533-543.

Matsuzaki, S, Rashel, M, Uchiyama, J, Sakurai, S, Ujihara, T, Kuroda, M, Ikeuchi, M, Tani, T, Fujieda, M, Wakiguchi, H & Imai, S 2005, 'Bacteriophage therapy: a revitalized therapy against bacterial infectious diseases', J Infect Chemother, vol. 11, no. 5, Oct, pp. 211-9. Mazza, P 1994, 'The use of Bacillus subtilis as an antidiarrhoeal microorganism', Bollettino chimico farmaceutico, vol. 133, no. 1, pp. 3-18.

Mazza, P 1994, 'The use of Bacillus subtilis as an antidiarrhoeal microorganism', Bollettino chimico farmaceutico, vol. 133, no. 1, pp. 3-18.

McCaig, AE, Glover, LA & Prosser, JI 1999, 'Molecular analysis of bacterial community structure and diversity in unimproved and improved upland grass pastures', Applied and Environmental Microbiology, vol. 65, no. 4, pp. 1721-1730.

McLeod, E, Anthony, KRN, Andersson, A, Beeden, R, Golbuu, Y, Kleypas, J, Kroeker, K, Manzello, D, Salm, RV, Schuttenberg, H & Smith, JE 2013, 'Preparing to manage coral reefs for ocean acidification: lessons from coral bleaching', Frontiers in Ecology and the Environment, vol. 11, no. 1, pp. 20-27.

Meikle, P, Richards, G & Yellowlees, D 1987, 'Structural determination of the oligosaccharide side chains from a glycoprotein isolated from the mucus of the coral Acropora formosa', Journal of Biological Chemistry, vol. 262, no. 35, pp. 16941-16947.

Meikle, P, Richards, G & Yellowlees, D 1988, 'Structural investigations on the mucus from six species of coral', Marine biology, vol. 99, no. 2, pp. 187-193.

P a g e | 118

Meron, D, Atias, E, Iasur Kruh, L, Elifantz, H, Minz, D, Fine, M & Banin, E 2011, 'The impact of reduced pH on the microbial community of the coral Acropora eurystoma', ISME J, vol. 5, no. 1, Jan, pp. 51-60.

Millard, A, Clokie, MR, Shub, DA & Mann, NH 2004, 'Genetic organization of the psbAD region in phages infecting marine Synechococcus strains', Proceedings of the National Academy of Sciences of the United States of America, vol. 101, no. 30, pp. 11007- 11012.

Millard, AD, Zwirglmaier, K, Downey, MJ, Mann, NH & Scanlan, DJ 2009, 'Comparative genomics of marine cyanomyoviruses reveals the widespread occurrence of Synechococcus host genes localized to a hyperplastic region: implications for mechanisms of cyanophage evolution', Environmental microbiology, vol. 11, no. 9, pp. 2370-2387. Mills, M & Sebens, K 1997, 'Particle ingestion efficiency of the corals Siderastrea siderea and Agaricia agaricites: Effects of flow speed and sediment loads,' Proc 8th Int Coral Reef Symp, 1059-1064.

Mitchell, R & Chet, I 1975, 'Bacterial attack of corals in polluted seawater', Microbial Ecology, vol. 2, no. 3, pp. 227-233.

Miyoshi, Si & Shinoda, S 1988, 'Role of the protease in the permeability enhancement by Vibrio vulnificus', Microbiology and immunology, vol. 32, no. 10, pp. 1025-1032.

Mo, S, Kim, J-h & Cho, K 2009, 'A novel extracellular phospholipase C purified from a marine bacterium, Pseudoalteromonas sp. J937', Biotechnology Letters, vol. 31, no. 1, 2009/01/01, pp. 89-94.

P a g e | 118

Molchanova, VI, Ovodova, RG, Ovodov, YS, Elkin, YN & Fernandez Santana, V 1985, 'Studies of the polysaccharide moiety of corallan, a glycoprotein from Pseudopterogorgia americana, Carbohydrate research, vol. 141, no. 2, pp. 289-293.

Molenaar, TJ, Michon, I, de Haas, SA, van Berkel, TJ, Kuiper, J & Biessen, EA 2002, 'Uptake and processing of modified bacteriophage M13 in mice: implications for phage display', Virology, vol. 293, no. 1, Feb 1, pp. 182-191.

Moriarty, D, Pollard, P & Hunt, W 1985, 'Temporal and spatial variation in bacterial production in the water column over a coral reef', Marine biology, vol. 85, no. 3, pp. 285-292.

Mouchka, ME, Hewson, I & Harvell, CD 2010, 'Coral-associated bacterial assemblages: current knowledge and the potential for climate-driven impacts', Integr Comp Biol, vol. 50, no. 4, Oct, pp. 662-74.

Mumby, PJ & Steneck, RS 2008, 'Coral reef management and conservation in light of rapidly evolving ecological paradigms', Trends in ecology & evolution, vol. 23, no. 10, pp. 555-563. Munn, CB, Marchant, HK & Moody, AJ 2008a, 'Defences against oxidative stress in vibrios associated with corals', FEMS microbiology letters, vol. 281, no. 1, pp. 58-63.

Munn, CB, Marchant, HK & Moody, AJ 2008b, 'Defences against oxidative stress in vibrios associated with corals', FEMS Microbiol Lett, vol. 281, no. 1, Apr, pp. 58-63.

Muscatine, L, Falkowski, P, Porter, J & Dubinsky, Z 1984, 'Fate of photosynthetic fixed carbon in light-and shade-adapted colonies of the symbiotic coral Stylophora pistillata', Proceedings of the Royal Society of London. Series B. Biological Sciences, vol. 222, no. 1227, pp. 181-202.

P a g e | 118

Muyzer, G, De Waal, EC & Uitterlinden, AG 1993, 'Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA', Applied and environmental microbiology, vol. 59, no. 3, pp. 695-700.

Muyzer, G, Hottenträger, S, Teske, A & Wawer, C 1996, 'Denaturing gradient gel electrophoresis of PCR-amplified 16S rDNA—a new molecular approach to analyse the genetic diversity of mixed microbial communities', Molecular microbial ecology manual, vol. 3, no. 4, pp. 1-23.

Muyzer, G & Smalla, K 1998, 'Application of denaturing gradient gel electrophoresis (DGGE) and temperature gradient gel electrophoresis (TGGE) in microbial ecology', Antonie van Leeuwenhoek, vol. 73, no. 1, pp. 127-141.

Mydlarz, LD, Jones, LE & Harvell, CD 2006, 'Innate immunity, environmental drivers, and disease ecology of marine and freshwater invertebrates', Annual Review of Ecology, Evolution, and Systematics, pp. 251-288.

Nair, SV, Del Valle, H, Gross, PS, Terwilliger, DP & Smith, LC 2005, 'Macroarray analysis of coelomocyte gene expression in response to LPS in the sea urchin. Identification of unexpected immune diversity in an invertebrate', Physiological Genomics, vol. 22, no. 1, pp. 33-47.

Navas-Camacho, R, Gil-Agudelo, DL, Rodríguez-Ramírez, A, Reyes-Nivia, MC & Garzón- Ferreira, J 2010, 'Coral diseases and bleaching on Colombian Caribbean coral reefs', Revista de Biología Tropical, vol. 58, pp. 95-106.

Nishibuchi, M & Kaper, JB 1995, 'Thermostable direct hemolysin gene of Vibrio parahaemolyticus: a virulence gene acquired by a marine bacterium', Infection and Immunity, vol. 63, no. 6, p. 2093. P a g e | 118

Nissimov, J, Rosenberg, E & Munn, CB 2009, 'Antimicrobial properties of resident coral mucus bacteria of Oculina patagonica', FEMS Microbiol Lett, vol. 292, no. 2, Mar, pp. 210-5. Okazaki, H, Kishi, T, Beppu, T & Arima, K 1975, 'Letter: A new antibiotic, baciphelacin', The Journal of antibiotics, vol. 28, no. 9, pp. 717-719.

Pantos, O, Cooney, RP, Le Tissier, MD, Barer, MR, O'Donnell, AG & Bythell, JC 2003, 'The bacterial ecology of a plague‐like disease affecting the Caribbean coral Montastrea annularis', Environmental Microbiology, vol. 5, no. 5, pp. 370-382.

Parisien, A, Allain, B, Zhang, J, Mandeville, R & Lan, C 2008, 'Novel alternatives to antibiotics: bacteriophages, bacterial cell wall hydrolases, and antimicrobial peptides', Journal of Applied Microbiology, vol. 104, no. 1, pp. 1-13.

Paul, JH, DeFlaun, MF & Jeffrey, WH 1986, 'Elevated levels of microbial activity in the coral surface microlayer', Marine Ecology-Progress Series, vol. 33, no. 1, p. 29.

Pavel, AB & Vasile, CI 2012, 'PyElph - a software tool for gel images analysis and phylogenetics', BMC Bioinformatics, vol. 13, p. 9.

Peters, E 1997, 'Diseases of coral-reef organisms', Life and death of coral reefs. Chapman & Hall, New York, pp. 114-139. Peters, EC 1993, 'Diseases of other invertebrate phyla: Porifera, cnidaria, ctenophora, annelida, echinodermata', Pathobiology of Marine and Estuarine Organisms, pp. 393- 449.

Pinchuk, IV, Bressollier, P, Sorokulova, IB, Verneuil, B & Urdaci, MC 2002, 'Amicoumacin antibiotic production and genetic diversity of< i> Bacillus subtilis P a g e | 118

strains isolated from different habitats', Research in Microbiology, vol. 153, no. 5, pp. 269-276.

Raven, J, Caldeira, K, Elderfield, H, Hoegh-Guldberg, O, Liss, P, Riebesell, U, Shepherd, J, Turley, C & Watson, A 2005, Ocean acidification due to increasing atmospheric carbon dioxide, The Royal Society.

Ravindran, J, Kannapiran, E, Manikandan, B, Francis, K, Arora, S, Karunya, E, Kumar, A, Singh, SK & Jose, J 2013, 'UV-absorbing bacteria in coral mucus and their response to simulated temperature elevations', Coral Reefs, vol. 32, no. 4, pp. 1043-1050.

Reshef, L, Koren, O, Loya, Y, Zilber-Rosenberg, I & Rosenberg, E 2006a, 'The Coral Probiotic Hypothesis', Environmental Microbiology, vol. 8, no. 12, pp. 2068-2073.

Reshef, L, Koren, O, Loya, Y, Zilber‐Rosenberg, I & Rosenberg, E 2006b, 'The coral probiotic hypothesis', Environmental Microbiology, vol. 8, no. 12, pp. 2068-2073.'

Richardson, L & Aronson, R 2002, 'Infectious diseases of reef corals,' Proceedings of the Ninth International Coral Reef Symposium, Bali, 23-27 October 2000, 1225-1230.

Richardson, LL, Goldberg, WM, Kuta, KG, Aronson, RB, Smith, GW, Ritchie, KB, Halas, JC, Feingold, JS & Miller, SL 1998, 'Florida's mystery coral-killer identified', Nature, vol. 392, no. 6676, pp. 557-558.

Richardson, LL 2003, 'Aurantimonas coralicida gen. nov., sp. nov., the causative agent of white plague type II on Caribbean scleractinian corals', International Journal of Systematic and Evolutionary Microbiology, vol. 53, no. 4, pp. 1115-1122.

Richmond, RH 1993, 'Coral reefs: present problems and future concerns resulting from anthropogenic disturbance', American Zoologist, vol. 33, no. 6, pp. 524-536. P a g e | 118

Rincón‐Rosales, R, Lloret, L, Ponce, E & Martínez‐Romero, E 2009, 'Rhizobia with different symbiotic efficiencies nodulate Acaciella angustissima in Mexico, including Sinorhizobium chiapanecum sp. nov. which has common symbiotic genes with Sinorhizobium mexicanum', FEMS microbiology ecology, vol. 67, no. 1, pp. 103-117.

Ritchie, K & Smith, G 1998, 'Type II white-band disease', Rev Biol Trop, vol. 46, no. suppl 5, pp. 199-203.

Ritchie, KB 2006, 'Regulation of microbial populations by coral surface mucus and mucus-associated bacteria', Marine Ecology Progress Series, vol. 322, September 20, 2006, pp. 1-14.

Ritchie, KB, Dennis, J, McGrath, T & Smith, GW 1994, 'Bacteria associated with bleached and nonbleached areas of Montastrea annularis,' Proc Symp Nat Hist Bahamas, 75-80.

Ritchie, KB & Smith, GW 1995, 'Preferential carbon utilization by surface bacterial communities from water mass, normal, and white-band diseased Acropora cervicornis', Molecular Marine Biology and Biotechnology, vol. 4, no. 4, pp. 345-352.

Ritchie, KB & Smith, GW 2004, 'Microbial communities of coral surface mucopolysaccharide layers', in Coral health and disease, Springer, pp. 259-264.

Richardson, L & Aronson, R 2002, 'Infectious diseases of reef corals,' Proceedings of the Ninth International Coral Reef Symposium, Bali, 23-27 October 2000, 1225-1230.

Rohwer, F, Breitbart, M, Jara, J, Azam, F & Knowlton, N 2001, 'Diversity of bacteria associated with the Caribbean coral Montastraea franksi', Coral Reefs, vol. 20, no. 1, pp. 85-91. P a g e | 118

Radjasa OK. &Sabdono A. 2003, ‘Screening of Secondary Metabolite-Producing Bacteria associated with Corals using 16S rDNA Based Approach’, Journal of Coastal Development, vol.7, no.1, pp. 11-19.

Rodríguez-Moya, J, Argandoña, M, Iglesias-Guerra, F, Nieto, JJ & Vargas, C 2013, 'Temperature-and salinity-decoupled overproduction of hydroxyectoine by Chromohalobacter salexigens', Applied and environmental microbiology, vol. 79, no. 3, pp. 1018-1023.

Rodriguez-Lanetty, M, Harii, S & Hoegh-Guldberg, O 2009, 'Early molecular responses of coral larvae to hyperthermal stress', Molecular Ecology, vol. 18, no. 24, pp. 5101- 5114.

Rohwer, F, Breitbart, M, Jara, J, Azam, F & Knowlton, N 2001, 'Diversity of bacteria associated with the Caribbean coral Montastraea franksi', Coral Reefs, vol. 20, no. 1, pp. 85-91. Rohwer, F & Kelley, S 2004, 'Culture-independent analyses of coral-associated microbes', in Coral health and disease, Springer, pp. 265-277.

Rohwer, F, Segall, A, Steward, G, Seguritan, V, Breitbart, M, Wolven, F & Azam, F 2000, 'The complete genomic sequence of the marine phage Roseophage SIOI shares homology with nonmarine phages', Limnology and Oceanography, vol. 45, no. 2, pp. 408-418.

Rohwer, F, Seguritan, V, Azam, F & Knowlton, N 2002, 'Diversity and distribution of coral-associated bacteria', Marine Ecology Progr.ess Series , vol. 243, no. 1.

Rohwer, F & Thurber, RV 2009, 'Viruses manipulate the marine environment', Nature, vol. 459, no. 7244, pp. 207-212.

P a g e | 118

Rosenberg, E & Ben-Haim, Y 2002, 'Microbial diseases of corals and global warming', Environmental Microbiology, vol. 4, no. 6, pp. 318-326.

Rosenberg, E, Ben-Haim, Y, Toren, A, Banin, E, Kushmaro, A, Fine, M & Loya, Y 1999, 'Effect of temperature on bacterial bleaching of corals', Microbial ecology and infectious disease. ASM Press, Washington, DC, pp. 242-254.

Rosenberg, E & Ben‐Haim, Y 2002, 'Microbial diseases of corals and global warming', Environmental microbiology, vol. 4, no. 6, pp. 318-326.

Rosenberg, E & Falkovitz, L 2004, 'The Vibrio shiloi/Oculina patagonica model system of coral bleaching', Annu. Rev. Microbiol., vol. 58, pp. 143-159.

Rosenberg, E, Koren, O, Reshef, L, Efrony, R & Zilber-Rosenberg, I 2007, 'The role of microorganisms in coral health, disease and evolution', Nature Reviews Microbiology, vol. 5, no. 5, pp. 355-362.

Rosenberg, E, Kushmaro, A, Kramarsky-Winter, E, Banin, E & Yossi, L 2008, 'The role of microorganisms in coral bleaching', The ISME journal, vol. 3, no. 2, pp. 139-146. Rua, CP, Trindade-Silva, AE, Appolinario, LR, Venas, TM, Garcia, GD, Carvalho, LS, Lima, A, Kruger, R, Pereira, RC, Berlinck, RG, Valle, RA, Thompson, CC & Thompson, F 2014, 'Diversity and antimicrobial potential of culturable heterotrophic bacteria associated with the endemic marine sponge Arenosclera brasiliensis', PeerJ, vol. 2, p. e419.

Rublee, PA, Lasker, HR, Gottfried, M & Roman, MR 1980, 'Production and bacterial colonization of mucus from the soft coral Briarium asbestinum', Bulletin of Marine Science, vol. 30, no. 4, pp. 888-893.

Rützler, K & Santavy, DL 1983, 'The black band disease of Atlantic reef corals', Marine Ecology, vol. 4, no. 4, pp. 301-319. P a g e | 118

Saiki, RK, Gelfand, DH, Stoffel, S, Scharf, SJ, Higuchi, R, Horn, GT, Mullis, KB & Erlich, HA 1988, 'Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase', Science, vol. 239, no. 4839, pp. 487-491.

Sambrook, J, Fritsch, EF & Maniatis, T 1989, Molecular cloning, Cold spring harbor laboratory press New York.

Sandaa, RA, Clokie, M & Mann, NH 2008, 'Photosynthetic genes in viral populations with a large genomic size range from Norwegian coastal waters', FEMS microbiology ecology, vol. 63, no. 1, pp. 2-11.

Santavy, D & Peters, E 1997, 'Microbial pests: coral disease in the Western Atlantic,' Proc 8th Int Coral Reef Symp, 607-612.

Schnell, S, Assmus, S & Richardson, L 1996, 'Role of sulfate reducing bacteria in the black band disease of corals', Abstr. Annu. Meet. VAAM (Ver. Allg. Angew. Mikrobiol.) GBCH (Ges. Biol. Chem.). Elsevier, Cologne, Germany, p. 116.

Schwebel, D & Margaretha, P 2000, 'Photocycloaddition of 2H‐1‐Benzopyran‐3‐ carbonitriles and 2H‐1‐Benzothiopyran‐3‐carbonitriles to Alkenes and Alkenynes', Helvetica Chimica Acta, vol. 83, no. 6, pp. 1168-1174.

Shannon-Weaver 1963, Mathematical theory of communication, University Illinois Press. Sharon, G & Rosenberg, E 2008, 'Bacterial growth on coral mucus', Current microbiology, vol. 56, no. 5, pp. 481-488.

Sharon, I, Tzahor, S, Williamson, S, Shmoish, M, Man-Aharonovich, D, Rusch, DB, Yooseph, S, Zeidner, G, Golden, SS & Mackey, SR 2007, 'Viral photosynthetic reaction P a g e | 118

center genes and transcripts in the marine environment', The ISME journal, vol. 1, no. 6, pp. 492-501.

Shashar, N, Cohen, Y, Loya, Y & Sar, N 1994, 'Nitrogen fixation(acetylene reduction) in stony corals: Evidence for coral-bacteria interactions', Marine ecology progress series. Oldendorf, vol. 111, no. 3, pp. 259-264.

Shick, J, Lesser, M, Dunlap, W, Stochaj, W, Chalker, B & Won, JW 1995, 'Depth- dependent responses to solar ultraviolet radiation and oxidative stress in the zooxanthellate coral Acropora microphthalma', Marine Biology, vol. 122, no. 1, pp. 41- 51.

Shick, J, LESSER, MP & JOKIEL, PL 1996, 'Effects of ultraviolet radiation on corals and other coral reef organisms', Global Change Biology, vol. 2, no. 6, pp. 527-545.

Shnit-Orland, M, Sivan, A & Kushmaro, A 2012, 'Antibacterial activity of Pseudoalteromonas in the coral holobiont', Microb Ecol, vol. 64, no. 4, Nov, pp. 851-9.

Shnit‐Orland, M & Kushmaro, A 2009, 'Coral mucus‐associated bacteria: a possible first line of defense', FEMS microbiology ecology, vol. 67, no. 3, pp. 371-380.

Short, CM & Suttle, CA 2005, 'Nearly identical bacteriophage structural gene sequences are widely distributed in both marine and freshwater environments', Applied and environmental microbiology, vol. 71, no. 1, pp. 480-486. Slattery, M, McClintock, JB & Heine, JN 1995, 'Chemical defenses in Antarctic soft corals: evidence for antifouling compounds', Journal of Experimental Marine Biology and Ecology, vol. 190, no. 1, pp. 61-77.

Smith, B & Wilson, JB 1996, 'A consumer's guide to evenness indices', Oikos, pp. 70-82.

P a g e | 118

Smith, GW, Ives, LD, Nagelkerken, IA & Ritchie, KB 1996, 'Caribbean sea-fan mortalities', Sneath, PH & Sokal, RR 1973, Numerical taxonomy. The principles and practice of numerical classification.

Soffer, N, Zaneveld, J & Vega Thurber, R 2014, 'Phage-bacteria network analysis and its implication for the understanding of coral disease', Environ Microbiol, Jul 8

Sørensen, T 1948, '{A method of establishing groups of equal amplitude in plant sociology based on similarity of species and its application to analyses of the vegetation on Danish commons}', Biol. skr., vol. 5, pp. 1-34.

Sorokin, YI 1973, 'On the feeding of some scleractinian corals with bacteria and dissolved organic matter', Limnol Oceanogr, vol. 18, no. 3, pp. 380-385.

Sorokin, YI 1978, 'Microbial-production in coral-reef community', Archiv fur Hydrobiologie, vol. 83, no. 3, pp. 281-323.

Soto-Rodriguez, S, Roque, A, Lizarraga-Partida, M, Guerra-Flores, A & Gomez-Gil, B 2003, 'Virulence of luminous vibrios to Artemia franciscana nauplii', Diseases of aquatic organisms, vol. 53, no. 3, pp. 231-240.

Sullivan, MB, Coleman, ML, Quinlivan, V, Rosenkrantz, JE, DeFrancesco, AS, Tan, G, Fu, R, Lee, JA, Waterbury, JB & Bielawski, JP 2008, 'Portal protein diversity and phage ecology', Environmental microbiology, vol. 10, no. 10, pp. 2810-2823. Sullivan, MB, Coleman, ML, Weigele, P, Rohwer, F & Chisholm, SW 2005, 'Three Prochlorococcus cyanophage genomes: signature features and ecological interpretations', PLoS biology, vol. 3, no. 5, p. e144.

P a g e | 118

Sullivan, MB, Krastins, B, Hughes, JL, Kelly, L, Chase, M, Sarracino, D & Chisholm, SW 2009, 'The genome and structural proteome of an ocean siphovirus: a new window into the cyanobacterial ‘mobilome’', Environmental microbiology, vol. 11, no. 11, pp. 2935-2951.

Sullivan, MB, Lindell, D, Lee, JA, Thompson, LR, Bielawski, JP & Chisholm, SW 2006, 'Prevalence and evolution of core photosystem II genes in marine cyanobacterial viruses and their hosts', PLoS biology, vol. 4, no. 8, p. e234.

Sunagawa, S, DeSantis, TZ, Piceno, YM, Brodie, EL, DeSalvo, MK, Voolstra, CR, Weil, E, Andersen, GL & Medina, M 2009, 'Bacterial diversity and White Plague Disease- associated community changes in the Caribbean coral Montastraea faveolata', ISME J, vol. 3, no. 5, May, pp. 512-21.

Sussman, M, Loya, Y, Fine, M & Rosenberg, E 2003, 'The marine fireworm Hermodice carunculata is a winter reservoir and spring‐summer vector for the coral‐bleaching pathogen Vibrio shiloi', Environmental Microbiology, vol. 5, no. 4, pp. 250-255.

Sussman, M, Willis, BL, Victor, S & Bourne, DG 2008, 'Coral pathogens identified for white syndrome (WS) epizootics in the Indo-Pacific', PLoS One, vol. 3, no. 6, p. e2393.

Sutherland, KP, Porter, JW & Torres, C 2004, 'Disease and immunity in Caribbean and Indo-Pacific zooxanthellate corals', Marine ecology progress series, vol. 266, pp. 265- 272.

Suttle, CA & Chen, F 1992, 'Mechanisms and rates of decay of marine viruses in seawater', Applied and Environmental Microbiology, vol. 58, no. 11, pp. 3721-3729.

P a g e | 118

Szmant, A & Gassman, N 1990, 'The effects of prolonged “bleaching” on the tissue biomass and reproduction of the reef coral Montastrea annularis', Coral reefs, vol. 8, no. 4, pp. 217-224.

Takami, H, Kobata, K, Nagahama, T, Kobayashi, H, Inoue, A & Horikoshi, K 1999, 'Biodiversity in deep-sea sites located near the south part of Japan', Extremophiles, vol. 3, no. 2, pp. 97-102.

Teo, JW, Zhang, L-H & Poh, CL 2003, 'Cloning and characterization of a metalloprotease from< i> Vibrio< i> harveyi strain AP6', Gene, vol. 303, pp. 147-156.

Thurber, RLV, Barott, KL, Hall, D, Liu, H, Rodriguez-Mueller, B, Desnues, C, Edwards, RA, Haynes, M, Angly, FE & Wegley, L 2008, 'Metagenomic analysis indicates that stressors induce production of herpes-like viruses in the coral Porites compressa', Proceedings of the National Academy of Sciences, vol. 105, no. 47, pp. 18413-18418.

Toren, A, Landau, L, Kushmaro, A, Loya, Y & Rosenberg, E 1998, 'Effect of Temperature on Adhesion ofVibrio Strain AK-1 to Oculina patagonica and on Coral Bleaching', Applied and environmental microbiology, vol. 64, no. 4, pp. 1379-1384.

Tucker, KP, Parsons, R, Symonds, EM & Breitbart, M 2011, 'Diversity and distribution of single-stranded DNA phages in the North Atlantic Ocean', ISME J, vol. 5, no. 5, May, pp. 822-30.

Vacelet, E & Thomassin, BA 1991, 'Microbial utilization of coral mucus in long term in situ incubation over a coral reef', Hydrobiologia, vol. 211, no. 1, pp. 19-32.

Velho-Pereira, S & Furtado, I 2012, 'Antibacterial activity of halophilic bacterial bionts from marine invertebrates of Mandapam-India', Indian journal of pharmaceutical sciences, vol. 74, no. 4, p. 331. P a g e | 118

Verdugo, P 1990, 'Goblet cells secretion and mucogenesis', Annual review of physiology, vol. 52, no. 1, pp. 157-176.

Vidal-Dupiol, J, Ladrière, O, Destoumieux-Garzón, D, Sautière, P-E, Meistertzheim, A-L, Tambutté, E, Tambutté, S, Duval, D, Fouré, L & Adjeroud, M 2011, 'Innate immune responses of a scleractinian coral to vibriosis', Journal of Biological Chemistry, vol. 286, no. 25, pp. 22688-22698.

Vob, U, Larrieu, A & Wells, DM 2013, 'From jellyfish to biosensors: the use of fluorescent proteins in plants', International journal of developmental biology, vol. 57, no. 6, pp. 525-533.

Walker, R, Powell, A & Seddon, B 1998, 'Bacillus isolates from the spermosphere of peas and dwarf French beans with antifungal activity against Botrytis cinerea and Pythium species', Journal of Applied Microbiology, vol. 84, no. 5, pp. 791-801.

Ward, JR, Kim, K & Harvell, C 2007, 'Temperature affects coral disease resistance and pathogen growth', Marine Ecology Progress Series, vol. 329, pp. 115-121.

Wegley, L, Edwards, R, Rodriguez-Brito, B, Liu, H & Rohwer, F 2007, 'Metagenomic analysis of the microbial community associated with the coral Porites astreoides', Environ Microbiol, vol. 9, no. 11, Nov, pp. 2707-19.

Wegley, L, Yu, Y, Breitbart, M, Casas, V, Kline, DI & Rohwer, F 2004, 'Coral-associated archaea', Marine Ecology Progress Series, vol. 273, pp. 89-96.

Weigele, PR, Pope, WH, Pedulla, ML, Houtz, JM, Smith, AL, Conway, JF, King, J, Hatfull, GF, Lawrence, JG & Hendrix, RW 2007, 'Genomic and structural analysis of Syn9, a P a g e | 118

cyanophage infecting marine Prochlorococcus and Synechococcus', Environmental microbiology, vol. 9, no. 7, pp. 1675-1695.

Weil, E, Smith, G & Gil-Agudelo, DL 2006, 'Status and progress in coral reef disease research', Diseases of Aquatic Organisms, vol. 69, no. 1, pp. 1-7.

Weinbauer, MG & Rassoulzadegan, F 2004, 'Are viruses driving microbial diversification and diversity?', Environmental microbiology, vol. 6, no. 1, pp. 1-11.

Weisenborn, F, Brown, W & Meyers, E 1984, 'Antibiotic kristenin from Bacillus subtilis ATCC 31340 useful as against Gram-positive bacteria', Unlisted-Drug, vol. 36, p. 9Q.

Weld, RJ, Butts, C & Heinemann, JA 2004, 'Models of phage growth and their applicability to phage therapy', Journal of theoretical biology, vol. 227, no. 1, pp. 1-11.

Wiese, J, Thiel, V, Nagel, K, Staufenberger, T & Imhoff, JF 2009, 'Diversity of antibiotic- active bacteria associated with the brown alga Laminaria saccharina from the Baltic Sea', Marine Biotechnology, vol. 11, no. 2, pp. 287-300.

Wild, C, Huettel, M, Klueter, A, Kremb, SG, Rasheed, MY & Jørgensen, BB 2004a, 'Coral mucus functions as an energy carrier and particle trap in the reef ecosystem', Nature, vol. 428, no. 6978, pp. 66-70.

Wild, C, Rasheed, M, Werner, U, Franke, U, Johnstone, R & Huettel, M 2004b, 'Degradation and mineralization of coral mucus in reef environments', Marine ecology. Progress series, vol. 267, pp. 159-171.

Wilhelm, SW & Suttle, CA 1999, 'Viruses and Nutrient Cycles in the Sea Viruses play critical roles in the structure and function of aquatic food webs', Bioscience, vol. 49, no. 10, pp. 781-788. P a g e | 118

Wilkinson, C & Network, GCRM 2008, Status of coral reefs of the world: 2008, Global Coral Reef Monitoring Network Townsville.

Wilkinson, CR 1999, 'Global and local threats to coral reef functioning and existence: review and predictions', Marine and Freshwater Research, vol. 50, no. 8, pp. 867-878.

Wilkinson, CR & Buddemeier, RW 1994, Global Climate Change and Coral Reefs: Implications for People and Reefs: Report of the UNEP-IOC-ASPEI-IUCN Global Task Team on the Implications of Climate Change on Coral Reefs, IUCN.

Williamson, SJ, Rusch, DB, Yooseph, S, Halpern, AL, Heidelberg, KB, Glass, JI, Andrews- Pfannkoch, C, Fadrosh, D, Miller, CS & Sutton, G 2008, 'The Sorcerer II Global Ocean Sampling Expedition: metagenomic characterization of viruses within aquatic microbial samples', PloS one, vol. 3, no. 1, p. e1456.

Wilson W., Dale A., Davy, J & Davy, S 2005, 'An enemy within? Observations of virus- like particles in reef corals', Coral Reefs, vol. 24, no. 1, pp. 145-148.

Wommack, KE & Colwell, RR 2000, 'Virioplankton: viruses in aquatic ecosystems', Microbiology and molecular biology reviews, vol. 64, no. 1, pp. 69-114.

Wu, Z, Milton, D, Nybom, P, Sjö, A & Magnusson, K-E 1996, Vibrio cholerae hemagglutinin/protease (HA/protease) causes morphological changes in cultured epithelial cells and perturbs their paracellular barrier function', Microbial pathogenesis, vol. 21, no. 2, pp. 111-123.

Yokouchi, H, Fukuoka, Y, Mukoyama, D, Calugay, R, Takeyama, H & Matsunaga, T 2006, 'Whole-metagenome amplification of a microbial community associated with P a g e | 118

scleractinian coral by multiple displacement amplification using phi29 polymerase', Environ Microbiol, vol. 8, no. 7, Jul, pp. 1155-63.

Yonge, CM 1940, The biology of reef-building corals, British Museum (Natural History).

Yoshizawa, S, Wada, M, Kita-Tsukamoto, K, Ikemoto, E, Yokota, A & Kogure, K 2009, 'Vibrio azureus sp. nov., a luminous marine bacterium isolated from seawater', Int J Syst Evol Microbiol, vol. 59, no. Pt 7, Jul, pp. 1645-9.

Zeng, Z, Qian, L, Cao, L, Tan, H, Huang, Y, Xue, X, Shen, Y & Zhou, S 2008, 'Virtual screening for novel quorum sensing inhibitors to eradicate biofilm formation of Pseudomonas aeruginosa', Applied microbiology and biotechnology, vol. 79, no. 1, pp. 119-126.

Zheng, L, Chen, H, Han, X, Lin, W & Yan, X 2005, 'Antimicrobial screening and active compound isolation from marine bacterium NJ6-3-1 associated with the sponge Hymeniacidon perleve', World Journal of Microbiology and Biotechnology, vol. 21, no. 2, pp. 201-206.

Zhong, Y, Chen, F, Wilhelm, SW, Poorvin, L & Hodson, RE 2002, 'Phylogenetic Diversity of Marine Cyanophage Isolates and Natural Virus Communities as Revealed by Sequences of Viral Capsid Assembly Protein Gene g20', Applied and Environmental Microbiology, vol. 68, no. 4, pp. 1576-1584.

State of Reefs , May 1995. Available from: < http://www.ncdc.noaa.gov/paleo/outreach/coral/sor/sor_contents.html#toc >. [9 July 2014].

WTW Xylem Brand. Available from: . [10 August 2014]. P a g e | 118

LI-COR Environmental Home. Available from: . [9 July 2014].

UK Ocean Acidification Research Programme. Available from: < http://www.oceanacidification.org.uk>. [5 July 2014].

P a g e | 118

APPENDIX

Table 1: 16S rRNA gene sequence analysis of bacterial cultures from Trachyphyllia geoffroyi based on BLAST analysis.

Species Closest match Identities %/bp Phylogenetic division

Trachyphyllia Vibrio rotiferianus 97%/1420bp GammaProteobacteriaia geoffroyi. [KC534191] WEEK 1(1)

Trachyphyllia Vibrio alginolyticus 99%/899bp GammaProteobacteriaia geoffroyi [KC734518] WEEK 1(12)

Trachyphyllia Pseudoalteromonas 99%/1371bp GammaProteobacteriaia geoffroyi piscicida [FJ457196] WEEK 1(13)

Trachyphyllia Pseudoalteromonas 91%./1338bp GammaProteobacteriaia geoffroyi flavipulchra WEEK 1(9) [JQ409375]

Trachyphyllia Vibrio 99%/1453bp GammaProteobacteriaia geoffroyi parahaemolyticus WEEK 2(3) [JF432066]

Trachyphyllia Vibrio alginolyticus 99%/1459bp GammaProteobacteriaia geoffroyi [JN188406] WEEK 2(4)

Trachyphyllia Vibrio 99%/1450bp GammaProteobacteriaia geoffroyi parahaemolyticus P a g e | 118

WEEK 2(9) [DQ991216]

Trachyphyllia Vibrio communis 99%/1431bp GammaProteobacteriaia geoffroyi [JQ663883] WEEK 3(1)

Trachyphyllia Lysinibacillus 97%/1437bp GammaProteobacteriaia geoffroyi fusiformis WEEK 3(10) [JF343177]

Trachyphyllia Vibrio owensii 99%/1464bp GammaProteobacteriaia geoffroyi [GQ281105] WEEK 3(2)

Trachyphyllia Vibrio harveyi 99%/775bp GammaProteobacteriaia geoffroyi [DQ995246] WEEK 3(3)

Trachyphyllia Vibrio communis 99%/1423bp GammaProteobacteriaia geoffroyi [HQ161734] WEEK 3(5)A

Trachyphyllia Vibrio 99%/1456bp GammaProteobacteriaia geoffroyi parahaemolyticus WEEK 3(6) [JN188419]

Trachyphyllia Chromahaobacter 100%/934bp GammaProteobacteriaia geoffroyi salaxigen

WEEK 4(1) [GU397381]

Trachyphyllia Vibrio coralliitycus 99%/1471bp GammaProteobacteriaia geoffroyi [NR117892] WEEK 4(6) P a g e | 118

Trachyphyllia Lysinibacillus 99%/1045bp Bacilli geoffroyi boronitolerans WEEK 5(1) [FJI74646]

99%/1443bp

Trachyphyllia Vibrio sp. Persian GammaProteobacteriaia geoffroyi [KC765089] WEEK 5(11)

Trachyphyllia Vibrio owensii 100%/1418bp GammaProteobacteriaia geoffroyi [JX280419] WEEK 5(15)

Trachyphyllia Pseudomonas 97%/1445bp GammaProteobacteriaia geoffroyi plecoglossicida WEEK 5(17) [EU594553]

Trachyphyllia Pseudomonas 97%/1441bp GammaProteobacteriaia geoffroyi plecoglossicida WEEK 5(18) [KF358256]

Trachyphyllia Lysinibacillus 99%/1457bp Bacilli geoffroyi fusiformis WEEK 5(20) [KC775773]

Trachyphyllia Lysinibacillus 98%/1445bp Bacilli geoffroyi fusiformis WEEK 5(21) [KF916674]

Trachyphyllia Bacillus thuringiensis 99%/908bp Bacilli geoffroyi [FJ61355] WEEK 5(9) P a g e | 118

Trachyphyllia Bacillus subtilis 99%/1464bp Bacilli geoffroyi [HQ684005] WEEK 7(2)

Trachyphyllia Bacillus cereus 99%/1420bp Bacilli geoffroyi [KF841622], WEEK 1(7)

Trachyphyllia Bacillus cereus 100%/1042bp Bacilli geoffroyi [K376341] WEEK 7(5)

Trachyphyllia Chromahaobacter 99%/1424bp GammaProteobacteriaia geoffroyi salaxigen [KJ676975] WEEK 8(11)

Trachyphyllia Vibrio communis 99%/1431bp GammaProteobacteriaia geoffroyi [JQ663883] WEEK C3(16)

Trachyphyllia Bacillus cereus 97%/1402bp Bacilli geoffroyi [JN944764] WEEK 8(1)

Trachyphyllia Oceanobacillus sp. 88%/883bp Bacilli geoffroyi [KC433666] WEEK 8(2)

Trachyphyllia Bacillus cereus 95%/759bp Bacilli geoffroyi [JQ311944] WEEK 8(4)

Trachyphyllia Vibrio harveyi 99%/1414bp GammaProteobacteriaia geoffroyi [HM008704] P a g e | 118

WEEK 8(5)

Trachyphyllia Vibrio owensii 99%/1464bp GammaProteobacteriaia geoffroyi [HQ908697] WEEK 5(14)

Trachyphyllia Vibrio owensii 99%/1464bp GammaProteobacteriaia geoffroyi [HQ908697] WEEK 4(8)

P a g e | 118

Table 2: 16S rRNA gene sequence analysis of bacterial cultures from Euphyllia ancora., based on BLAST analysis

Species Closest match %/bp Phylogenetic division

Euphyllia ancora Vibrio 97%/1448bp GammaProteobacteria parahaemolyticus WEEK 1(3) [JN188419]

Euphyllia Lysinibacillus 99%/1186bp Bacilli ancoraWEEK 1(6) sphaericus [JX286700]

Euphyllia Vibrio proteolyticus 99%/1432bp GammaProteobacteria ancoraWEEK 1(7) [AF513463]

Euphyllia ancora. Lysinibacillus 99%/1273bp Bacilli WEEK 1(8) fusiformis [JX286689]

Euphyllia Lysinibacillus 99%/1471bp Bacilli ancoraWEEK fusiformis [HM101171] 2(10)

Euphyllia ancora. Bacillus cereus 100%/1273bp Bacilli WEEK 2(2) [EU621383]

Euphyllia Lysinibacillus 99%/1460bp Bacilli ancoraWEEK fusiformis [FJ973545] 2(5)A

Euphyllia Vibrio owensii 99%/1464bp GammaProteobacteria ancoraWEEK [HQ908697] 3(1)A

Euphyllia Vibrio azureus 99%/1431bp GammaProteobacteria ancoraWEEK P a g e | 118

3(15) [JN188419]

Euphyllia Vibrio shilonii 99%/815bp GammaProteobacteria ancoraWEEK [NR118242] 3(3)A

Euphyllia Vibrio harveyi 99%/1060bp GammaProteobacteria ancoraWEEK [FJ161275] 3(6)A

Euphyllia Vibrio coralliilyticus 99%/1444bp GammaProteobacteria ancoraWEEK [NR028014] 4(10)

Euphyllia Photobacterium 97%/1193bp GammaProteobacteria ancoraWEEK 4(4) rosenbergii [HQ449973]

Euphyllia Bacillus firmus 100%/1410bp Bacilli ancoraWEEK 4(7) [JN700106]

Euphyllia Vibrio harveyi 99%/1060bp GammaProteobacteria ancoraWEEK [FJ161275] 5(17)

Euphyllia Vibrio coralliilyticus 99%/1465bp GammaProteobacteria ancoraWEEK 4(9) [JQ307093]

Euphyllia Vibrio owensii 99%/1418bp GammaProteobacteria ancoraWEEK 5(1) [JX2804419]

Euphyllia Shewanella haliotis 99%/1436bp GammaProteobacteria ancoraWEEK [KF500918] 5(12) P a g e | 118

Euphyllia Vibrio alginolyticus 97%/899bp GammaProteobacteria ancoraWEEK [KC734518] 5(15)

Euphyllia Vibrio communis 99%/1423bp GammaProteobacteria ancoraWEEK [HQ161734] 5(16)

Euphyllia Vibrio 99%/1431bp GammaProteobacteria ancoraWEEK communis[JQ663883] 5(20)

Euphyllia Vibrio owensii 99%/1464bp GammaProteobacteria ancoraWEEK [HQ908673] 5(23)

Euphyllia Shewanella haliotis 86%/1436bp GammaProteobacteria ancoraWEEK [KF500918] 5(24)

Euphyllia Vibrio campbellii 99%/1413bp GammaProteobacteria ancoraWEEK 5(6) [KC534273]

Euphyllia Shewanella sp. 99%/1436bp GammaProteobacteria ancoraWEEK 5(8) [KC335140]

Euphyllia Bacillus cereus 99%/1448bp Bacilli ancoraWEEK 6(3) [JX317637]

Euphyllia Vibrio harveyi 99%/1457bp GammaProteobacteria ancoraWEEK [FJ161275] C2(4)

Euphyllia Vibrio azureus 99%/1455bp GammaProteobacteria ancoraWEEK P a g e | 118

C3(3) [JQ663884]

Euphyllia Vibrio neocalledonicus 99%/1517bp GammaProteobacteria ancoraWEEK [KJ841877] C3(6)

Euphyllia Bacillus thuringiensis 96%/1425bp Bacilli ancoraWEEK 8(2) [FJ897722]

Euphyllia Vibrio owensii [FJ5062] 99%/1464bp GammaProteobacteria ancoraWEEK 4(2)

Euphyllia Photobacterium 97%/1193bp GammaProteobacteria ancoraWEEK 4(8) leiognathi[FJ240417]

Euphyllia Photobacterium 95%/1469bp GammaProteobacteria ancoraWEEK 4(3) leiognathi [AB680576]

Euphyllia Pseudomoalteromonas 97%/1411bp GammaProteobacteria ancoraWEEK 4(5) rubra [JQ409378]

Euphyllia Vibrio mediterranei 96%/1484bp GammaProteobacteria ancoraWEEK [HF541959] 4(16)A

Euphyllia Bacillus cereus 95%/1438bp Bacilli ancoraWEEK 8(6) [KF591117]

Euphyllia Vibrio owensii 89%/809bp GammaProteobacteria ancoraWEEK [AB719181] 8(13)

P a g e | 118

Table 3: 16S rRNA gene sequence analysis of bacterial cultures from Corallimorphs sp., based on BLAST analysis.

Species Closest match Identities %/bp Phylogenetic division

Corralimorphs Vibrio harveyi 99%/1461bp GammaProteobacteria sp. WEEK 1(1) [GQ249053]

Corralimorphs Vibrio rotiferianus 99%/1433bp GammaProteobacteria sp. WEEK 1(2) [KC534191]

Corralimorphs Vibrio harveyi 99%/775bp GammaProteobacteria sp. WEEK 1(6) [DQ995240

Corralimorphs Vibrio brasiliensis 98%/1044bp GammaProteobacteria sp. WEEK 1(8) [JF721971]

Corralimorphs Vibrio alginolyticus 99%/1461bp GammaProteobacteria sp. WEEK 2(2) [JN188403]

Corralimorphs Vibrio 99%/1453bp GammaProteobacteria sp. WEEK 2(4) parahaemolyticus [JF432066],

Corralimorphs Vibrio 99%/1387bp GammaProteobacteria sp. WEEK 2(5) azureus[JQ663884]

Corralimorphs Lysinibacillus 99%/1455bp Bacilli sp. WEEK 2(7) fusiformis [JN416567]

Corralimorphs Vibrio alginolyticus 99%/1459bp GammaProteobacteria sp. WEEK [JN188406] 3(10) P a g e | 118

Corralimorphs Vibrio alginolyticus 99%/899bp GammaProteobacteriaia sp. WEEK [KC734518] 3(11)

Corralimorphs Vibrio 99%/1434bp GammaProteobacteriaia sp. WEEK parahaemolyticus 4(10) [KC210812]

Corralimorphs Photobacterium 95%/1460bp GammaProteobacteriaia sp. WEEK 4(2) leiognathi [FJ240415]

Corralimorphs Vibrio owensii 99%/1418bp GammaProteobacteriaia sp. WEEK 4(3) [JX280419]

Corralimorphs Vibrio harveyi 99%/1436bp GammaProteobacteriaia sp. WEEK 4(4) [GQ203111]

Corralimorphs Vibrio harveyi 99%/775bp GammaProteobacteriaia sp. WEEK [DQ995246] 5(10)

Corralimorphs Bacillus sphaericus 99%/1427bp Bacilli sp. WEEK [DQ923492] 5(12)

Corralimorphs Lysinibacillus 99%/1048bp Bacilli sp. WEEK fusiformis 5(13) [HQ829830]

Corralimorphs Pseudoalteromonas 99%/942bp GammaProteobacteriaia sp. WEEK prydensis 5(15) [HM583997]

Corralimorphs Vibrio owensii 99%/1463bp GammaProteobacteriaia P a g e | 118

sp. WEEK 5(2) [HQ908694]

Corralimorphs Vibrio harveyi 99%/884bp GammaProteobacteriaia sp. WEEK 5(6) [K700304]

Corralimorphs Lysinibacillus 99%/1458bp Bacilli sp. WEEK 6(2) fusiformis [AB732972]

Corralimorphs Pseudomonas 86%/1311bp GammaProteobacteriaia sp. WEEK 6(8) plecoglossicida [KF358256]

Corralimorphs Vibrio communis 99%/1420bp GammaProteobacteriaia sp. WEEK [HQ161744] C2(2)

Corralimorphs Vibrio alginolyticus 99%/1433bp GammaProteobacteriaia sp. WEEK 2(1) [EU249987]

Corralimorphs Bacillus cereus 99%738/bp Bacilli sp. WEEK 7(4) [HQ670590]

Corralimorphs Desulfovibrio vulgaris 100%/1449bp GammaProteobacteriaia sp. WEEK 7(9) [KC462187]

Corralimorphs Bacillus thuriengiensis 94%/1425bp GammaProteobacteriaia sp. WEEK [FJ897722] 8(14)

Corralimorphs Pseudoalteromonas 99%/945bp GammaProteobacteriaia sp. WEEK 8(2) prydensis [HM584031]

Corralimorphs Vibrio harveyi 99%/1078bp GammaProteobacteriaia sp. WEEK 8(5) [KJ00304] P a g e | 118

Corralimorphs Lysinibacillus 99%/1458bp Bacilli sp. WEEK 8(1) fusiformis [JN012077]

Corralimorphs Vibrio harveyi 99%/1464bp GammaProteobacteriaia sp. WEEK 8(3) [KJ00304]

Corralimorphs Lysinibacillus 100%/1506bp Bacilli sp. WEEK 8(6) fusiformis [KM817206]

Corralimorphs Vibrio owensii 99%/1464bp GammaProteobacteriaia sp. WEEK 8(9) [HQ908687]

Corralimorphs Lysinibacillus 100%/1286bp Bacilli sp. WEEK sphaericus [FJ844477] 8(10)