DOCSLIB.ORG

Loss of FAM46C Promotes Cell Survival in Myeloma Yuan Xiao Zhu1, Chang-Xin Shi1, Laura A

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Loss of FAM46C Promotes Cell Survival in Myeloma Yuan Xiao Zhu1, Chang-Xin Shi1, Laura A Published OnlineFirst June 15, 2017; DOI: 10.1158/0008-5472.CAN-16-3011 Cancer Tumor and Stem Cell Biology Research Loss of FAM46C Promotes Cell Survival in Myeloma Yuan Xiao Zhu1, Chang-Xin Shi1, Laura A. Bruins1, Patrick Jedlowski1, Xuewei Wang2, K. Martin Kortum€ 1, Moulun Luo3, Jonathan M. Ahmann1, Esteban Braggio1, and A. Keith Stewart1,4 Abstract FAM46C is one of the most recurrently mutated genes in ated depletion of endogenous FAM46C enhanced multiple mye- multiple myeloma; however its role in disease pathogenesis has loma cell growth, decreased Ig light chain and HSPA5/BIP expres- not been determined. Here we demonstrate that wild-type (WT) sion, activated ERK and antiapoptotic signaling, and conferred FAM46C overexpression induces substantial cytotoxicity in mul- relative resistance to dexamethasone and lenalidomide treat- tiple myeloma cells. In contrast, FAM46C mutations found in ments. Genes altered in FAM46C-depleted cells were enriched multiple myeloma patients abrogate this cytotoxicity, indicating a for signaling pathways regulating estrogen, glucocorticoid, B-cell survival advantage conferred by the FAM46C mutant phenotype. receptor signaling, and ATM signaling. Together these results WT FAM46C overexpression downregulated IRF4, CEBPB, and implicate FAM46C in myeloma cell growth and survival and MYC and upregulated immunoglobulin (Ig) light chain and identify FAM46C mutation as a contributor to myeloma patho- HSPA5/BIP. Furthermore, pathway analysis suggests that enforced genesis and disease progression via perturbation in plasma FAM46C expression activated the unfolded protein response cell differentiation and endoplasmic reticulum homeostasis. pathway and induced mitochondrial dysfunction. CRISPR-medi- Cancer Res; 77(16); 1–11. Ó2017 AACR. Introduction yses, proposed that FAM46 proteins are novel eukaryotic nonca- nonical poly (A) polymerases and may be involved in the regu- The molecular basis of multiple myeloma is still incompletely lation of gene expression, cell differentiation, and development of understood. Cytoband 1p12 is deleted in approximately 20% of several malignancies (11). In a cell-based assay, FAM46C was multiple myeloma patients and has been reported to associate identified to enhance replication of some viruses, including with shorter overall survival (OS; ref. 1). The target gene on 1p12, yellow fever virus, in response to type I interferon (12). FAM46C as suggested by the presence of recurrent homozygous deletions, expression is also reported to correlate with the expression of is FAM46C (2). Several studies have reported FAM46C mutations ribosomal proteins and the eukaryotic initiation and elongation in 5% to 13% of primary multiple myeloma tumors (3–7), factors involved in protein translation in myeloma cells (3). implying its pathogenic relevance. We have previously suggested In this study, we conducted a comprehensive analysis of that FAM46C mutations are less frequent in newly diagnosed FAM46C in multiple myeloma. We found that enforced multiple myeloma patients harboring deletion 17p (8), poten- FAM46C expression in human multiple myeloma cell lines tially inferring some overlap in function. Moreover, acquisition of (HMCL) induced multiple myeloma cytotoxicity and enhanced mutations was observed in longitudinal analysis in multiple drug sensitivity, whereas introduction of FAM46C mutants has myeloma patients (9), suggesting that FAM46C loss of function no such anti-multiple myeloma activity. Furthermore, FAM46C is a progression event in multiple myeloma. CRISPR depletion enhanced multiple myeloma cell growth, FAM46C belongs to the nucleotidyltransferase superfamily survival, and decreased immunoglobulin (Ig) expression in (10), together with three other FAM46 proteins (FAM46A, B, and multiple myeloma cells. D). A recent study, using a combination of bioinformatics anal- Materials and Methods 1Division of Hematology, Mayo Clinic Scottsdale, Arizona. 2Division of Biomed- Cells and reagents ical Statistics and Informatics, Department of Health Sciences Research, Mayo HMCLs were either obtained from ATCC or provided by Dr. Leif 3 Clinic Rochester, Minnesota. Center for Metabolic and Vascular Biology, Arizona Bergsagel's laboratory (Mayo Clinic, Scottsdale, AZ) from 2014 to 4 State University, Tempe, Arizona. Center for Individualized Medicine, Mayo 2016. An initial genetic analysis of these lines (copy number Clinic, Rochester, Minnesota. variation analysis) established a baseline, identifying fingerprint Note: Supplementary data for this article are available at Cancer Research (developed by Dr. Leif Bergsagel and Dr. Jonathan Keats, Trans- Online (http://cancerres.aacrjournals.org/). lational Genomics Research Institute, Phoenix, AZ). The identity Corresponding Author: A. Keith Stewart, Mayo Clinic Arizona, 13400 East Shea of cell lines was confirmed using copy number variation analysis Blvd., Scottsdale, AZ 85259. Phone: 507-284-5511; Fax: 507-293-2379; E-mail: each time samples are removed from liquid nitrogen storage for [email protected] propagation. All cell lines taken from liquid nitrogen were thawed doi: 10.1158/0008-5472.CAN-16-3011 and maintained in RPMI1640 media, supplemented with 5% of Ó2017 American Association for Cancer Research. sterile FCS and antibiotics. All cell lines were maintained for 3 to 4 www.aacrjournals.org OF1 Downloaded from cancerres.aacrjournals.org on September 28, 2021. © 2017 American Association for Cancer Research. Published OnlineFirst June 15, 2017; DOI: 10.1158/0008-5472.CAN-16-3011 Zhu et al. weeks (8–10 passages) before starting experiment and they were clones that have FAM46C knockout were selected using limited tested negative for mycoplasma at the beginning and during the dilution and immunoblotting assay. experiments (using Mycoplasma Detection Kit from Lonza). Anti- Flag was from Sigma-Aldrich. Anti-IRF4, anti-CDK6, anti-PARP, Array-based comparative genomic hybridization anti-BIP, anti-caspase-8, anti-CHOP, Anti-Lamin A/C, anti-p DNA was extracted from mononuclear cells using Puregene Kit ERK1/2, anti ERK1/2 and anti-BCL2 were from Cell Signaling (Qiagen) and the manufacturer's recommended protocol. All Technology. Anti-MYC antibody was from Epitomics. Anti- HMCLs were run using the Human 244K microarray (Agilent FAM46C antibodies were from Abcam and Proteintech and their Technologies). The digestion, labeling, and hybridization steps specificities were validated by Western blot analysis of the lysates were performed as previously described with minor modifications either from the cells without FAM46C expression or with exog- (15). Copy number abnormalities were calculated using two enous FAM46C expression (shown in figures). Anti-Ig lambda (l) probe and 0.2 log2 filters and aberration detection module and kappa (k) chain antibodies were from Abcam and Santa Cruz (ADM)-1 algorithm (16) with a threshold of 9.0. Biotechnology, respectively. Anti-human influenza hemaggluti- nin (HA) was from Covance. Dexamethasone was from Sigma- DNA sequencing Aldrich. Lenalidomide and bortezomib were from LC Laborato- DNA was extracted using the Qiagen AllPrep DNA/RNA Mini ries. All Taqman probes (BIP and MAGED1) used in real-time PCR Kit according to the manufacturer's recommendations. To screen were from Thermo Fisher Scientific. HMCLs for mutations and to confirm the introduction of CRISPR- mediated FAM46C mutations, we used the Ion Torrent semicon- Preparation of lentiviral virus expressing FAM46C or other ductor sequencing platform (PGM, Life Technologies; ref. 8), proteins and infection of myeloma cells using 20 ng of starting DNA per sample. The coding regions of Human wild-type (WT) FAM46C cDNA was purchased from FAM46C were amplified in 200-bp libraries using four pairs of Thermo Scientific and were subcloned into a lentiviral expression customized oligos from Ion AmpliSeq Designer, Life Technolo- vector, pCDH-CMV-MCS-EF1-copGFP (System Bioscience). gies (#1 Fwd primer CGAGCTGCTTTGCCATGTAGAA and #1 Rev FAM46C tagged with Flag or HA at its C-terminal was generated primer CATGGAAGATTAGGTCCAGGTCTTTG; #2 Fwd primer by PCR method and inserted into the modified pCDH-CMV- GCCACGTTTTGGTCAAAGACAAT and #2 Rev primer GAAGAAA- MCS-EF1-copGFP or pCDH-CMV-MCS-EF1-puro. All FAM46C AGCAAAGAATCCAGGATGATTT; #3 Fwd primer GGCGTCAG- mutants were amplified with specific primers (Supplementary TTTGAGTTCAGTGT and #3 Rev primer TCAGCGAAGTGGTTTT- Table S1) from WT cDNA by PCR methods and were cut with GAAGGT; #4 Fwd primer GACATCCTTGAACAGCAGAGGAA and appropriate restriction enzymes and then subcloned into pCDH- #4 Rev primer GTGGAAACCCTCAGGTCTCAAG). Libraries were CMV-MCS-EF1-copGFP. Human PSMC6 cDNA was from Thermo templated and enriched using IonOneTouch2 and IonOneTouch Scientific and PSMC6 tagged with HA at its C-terminal was ES automated systems, respectively. Samples were sequenced generated by PCR and inserted into the modified pCDH-CMV- using the 318T chip (ThermoFisher). Overall, we obtained an MCS-EF1-puro. All constructs were verified by sequencing. average coverage depth of 500Â. Raw data were aligned and pCDH-EF1-CYMR-T2A-puro was from System Bioscience. Lenti- indexed in BAM and BAI files using the IonTorrent suite. virus harboring control vector and all expression constructs were Variants were called using IonTorrent Somatic VariantCaller generated and used to infect HMCLs. The infection efficiency was version 4.6.0.7 and low stringency settings (Thermo Fisher). measured by flow cytometry analysis of GFP expression at day 3 VCF files were annotated using a standalone
Load more

Recommended publications
  • PARSANA-DISSERTATION-2020.Pdf
    DECIPHERING TRANSCRIPTIONAL PATTERNS OF GENE REGULATION: A COMPUTATIONAL APPROACH by Princy Parsana A dissertation submitted to The Johns Hopkins University in conformity with the requirements for the degree of Doctor of Philosophy Baltimore, Maryland July, 2020 © 2020 Princy Parsana All rights reserved Abstract With rapid advancements in sequencing technology, we now have the ability to sequence the entire human genome, and to quantify expression of tens of thousands of genes from hundreds of individuals. This provides an extraordinary opportunity to learn phenotype relevant genomic patterns that can improve our understanding of molecular and cellular processes underlying a trait. The high dimensional nature of genomic data presents a range of computational and statistical challenges. This dissertation presents a compilation of projects that were driven by the motivation to efficiently capture gene regulatory patterns in the human transcriptome, while addressing statistical and computational challenges that accompany this data. We attempt to address two major difficulties in this domain: a) artifacts and noise in transcriptomic data, andb) limited statistical power. First, we present our work on investigating the effect of artifactual variation in gene expression data and its impact on trans-eQTL discovery. Here we performed an in-depth analysis of diverse pre-recorded covariates and latent confounders to understand their contribution to heterogeneity in gene expression measurements. Next, we discovered 673 trans-eQTLs across 16 human tissues using v6 data from the Genotype Tissue Expression (GTEx) project. Finally, we characterized two trait-associated trans-eQTLs; one in Skeletal Muscle and another in Thyroid. Second, we present a principal component based residualization method to correct gene expression measurements prior to reconstruction of co-expression networks.
    [Show full text]
  • Transcriptome-Wide Identification of Transient RNA G-Quadruplexes In
    ARTICLE DOI: 10.1038/s41467-018-07224-8 OPEN Transcriptome-wide identification of transient RNA G-quadruplexes in human cells Sunny Y. Yang1, Pauline Lejault2, Sandy Chevrier3, Romain Boidot 3, A. Gordon Robertson4, Judy M.Y. Wong 1 & David Monchaud 2 Guanine-rich RNA sequences can fold into four-stranded structures, termed G-quadruplexes (G4-RNAs), whose biological roles are poorly understood, and in vivo existence is debated. 1234567890():,; To profile biologically relevant G4-RNA in the human transcriptome, we report here on G4RP-seq, which combines G4-RNA-specific precipitation (G4RP) with sequencing. This protocol comprises a chemical crosslinking step, followed by affinity capture with the G4- specific small-molecule ligand/probe BioTASQ, and target identification by sequencing, allowing for capturing global snapshots of transiently folded G4-RNAs. We detect wide- spread G4-RNA targets within the transcriptome, indicative of transient G4 formation in living human cells. Using G4RP-seq, we also demonstrate that G4-stabilizing ligands (BRACO-19 and RHPS4) can change the G4 transcriptomic landscape, most notably in long non-coding RNAs. G4RP-seq thus provides a method for studying the G4-RNA landscape, as well as ways of considering the mechanisms underlying G4-RNA formation, and the activity of G4-stabilizing ligands. 1 Faculty of Pharmaceutical Sciences, University of British Columbia, Pharmaceutical Sciences Building, 2405 Wesbrook Mall, Vancouver, BC V6T 1Z3, Canada. 2 Institut de Chimie Moléculaire (ICMUB), UBFC Dijon, CNRS UMR6302, 9, Rue Alain Savary, 21078 Dijon, France. 3 Platform of Transfer in Cancer Biology, Centre Georges-François Leclerc, BP 77980, 1, Rue Professeur Marion, 21079 Dijon, France.
    [Show full text]
  • The Role of Type I Interferon in the Immunobiology of Chikungunya Virus
    The role of type I interferon in the immunobiology of chikungunya virus Jane Amelia Clare Wilson B. App. Sc. (Human Biology), B. App. Sc. (Hons) A thesis submitted for the degree of Doctor of Philosophy at The University of Queensland in 2015 School of Medicine & QIMR Berghofer Medical Research Institute I Abstract Chikungunya virus (CHIKV) is a mosquito-transmitted alphavirus that can cause explosive outbreaks of a febrile, arthritic/arthralgic disease usually lasting weeks to months, and in rare cases, more than a year. In 2004, the largest ever CHIKV outbreak began in Kenya, spreading to islands of the Indian Ocean, India, South East Asia and major outbreaks have recently occurred in the South Pacific Islands and the Caribbean. The host type I interferon (IFN) response is crucial for effective control of CHIKV infection. Herein, the dynamics, source and responses generated by the type I IFNs following CHIKV infection were investigated. Interferon regulatory factors 3 (IRF3) and IRF7 are key transcription factors for the type I IFN response. While CHIKV infection of wild-type mice is non-lethal, infection of mice deficient in both IRF3 and IRF7 (IRF3/7-/-) resulted in mortality, illustrating that these factors are essential for protection. Using knockout mice for the adaptor molecules upstream of IRF3 and 7, IPS1 was found to be the most important for type I IFN production, with TRIF and MyD88 also contributing to the response. Mortality in IRF3/7-/- mice was also associated with type I IFN suppression of pathological levels of IFNγ and haemorrhagic shock. Heterozygous reporter mice, in which eGFP was expressed under the control of either the IFNβ or the IFNα6 promoter on one chromosome, were employed to try and identify the cellular source of type I IFN production following CHIVK infection.
    [Show full text]
  • Meta-Analysis of Nasopharyngeal Carcinoma
    BMC Genomics BioMed Central Research article Open Access Meta-analysis of nasopharyngeal carcinoma microarray data explores mechanism of EBV-regulated neoplastic transformation Xia Chen†1,2, Shuang Liang†1, WenLing Zheng1,3, ZhiJun Liao1, Tao Shang1 and WenLi Ma*1 Address: 1Institute of Genetic Engineering, Southern Medical University, Guangzhou, PR China, 2Xiangya Pingkuang associated hospital, Pingxiang, Jiangxi, PR China and 3Southern Genomics Research Center, Guangzhou, Guangdong, PR China Email: Xia Chen - [email protected]; Shuang Liang - [email protected]; WenLing Zheng - [email protected]; ZhiJun Liao - [email protected]; Tao Shang - [email protected]; WenLi Ma* - [email protected] * Corresponding author †Equal contributors Published: 7 July 2008 Received: 16 February 2008 Accepted: 7 July 2008 BMC Genomics 2008, 9:322 doi:10.1186/1471-2164-9-322 This article is available from: http://www.biomedcentral.com/1471-2164/9/322 © 2008 Chen et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background: Epstein-Barr virus (EBV) presumably plays an important role in the pathogenesis of nasopharyngeal carcinoma (NPC), but the molecular mechanism of EBV-dependent neoplastic transformation is not well understood. The combination of bioinformatics with evidences from biological experiments paved a new way to gain more insights into the molecular mechanism of cancer. Results: We profiled gene expression using a meta-analysis approach. Two sets of meta-genes were obtained. Meta-A genes were identified by finding those commonly activated/deactivated upon EBV infection/reactivation.
    [Show full text]
  • Building Bonds Between NHGRI and NICHD • NICHD Has Four ABMGG Boarded Clinical Geneticists • Drs
    Building Bonds Between NHGRI NICHD Diana W. Bianchi, M.D. Director, NICHD November 8, 2017 A Vision for NICHD’s Future What’s In a Name? NICHD 18% Other Institutes 82% Eunice Kennedy Shriver National Institute of Child Health and Human Development History of Our Mission ". We will look to the National Institute of Child Health and Human Development for a concentrated attack on the unsolved health problems of children and of mother-infant relationships. This legislation will encourage imaginative research into the complex processes of human development from conception to old age. For the first time, we will have an institute to promote studies directed at the entire life process rather than toward specific diseases or illnesses." —John F. Kennedy, October 17, 1962 My Vision for NICHD-I • Define “our brand” (what is our focus?) • Communicate the message • Listen to the Voice of the Patient • Integrate obstetrics and pediatrics research at NICHD; take the long view (DoHaD) • Advocate for personalized medicine in pediatrics, obstetrics and rehabilitative medicine My Vision for NICHD-II • Stress the importance of data science and sharing to leverage our investments • Analyze best way to identify trainees most likely to succeed • Catalyze innovation • Emphasize the “A” (for “Advice”) in the Advisory Council • Build bridges between other NIH Institutes – especially with NHGRI Ensure Representation of NICHD Populations in Trans-NIH Initiatives • Pregnant women can be enrolled in Phase I • Adults with intellectual disabilities can be enrolled once consent issues have been clarified • Children to be enrolled in Phase II Building Bonds Melissa Parisi MD PhD Medical Genetics Branch: Prenatal Genomics and Therapy Section • New Lab at NHGRI • Focus on Prenatal Treatment of Down syndrome • Incidental Findings Following Prenatal DNA Screening Building Bonds Between NHGRI and NICHD • NICHD has four ABMGG boarded clinical geneticists • Drs.
    [Show full text]
  • FAM46C Inhibits Cell Proliferation and Cell Cycle Progression And
    www.aging-us.com AGING 2020, Vol. 12, No. 7 Research Paper FAM46C inhibits cell proliferation and cell cycle progression and promotes apoptosis through PTEN/AKT signaling pathway and is associated with chemosensitivity in prostate cancer Libin Ma1,*, Huadong He2,*, Kang Jiang2, Peiwu Jiang3, Han He2, Shengjia Feng4, Kean Chen5, Jia Shao2, Gang Deng2 1Department of Nephrology, Sir Run Run Shaw Hospital, Zhejiang University School of Medicine, Hangzhou 310016, Zhejiang, China 2Department of Urology, Affiliated Hangzhou First People's Hospital, Zhejiang University School of Medicine, Hangzhou 310006, Zhejiang, China 3Surgical Department I, Hangzhou Hospital of Traditional Chinese Medicine, Hangzhou 310007, Zhejiang, China 4Clinical Medical College of Zhejiang Chinese Medical University, Hangzhou 310006, Zhejiang, China 5Department of Urology, The Second Hospital of Jiaxing, Jiaxing 314001, Zhejiang, China *Equal contribution Correspondence to: Gang Deng; email: [email protected] Keywords: prostate cancer, tumorigenesis, ubiquitination, FAM46C, PTEN Received: September 27, 2019 Accepted: February 23, 2020 Published: April 13, 2020 Copyright: Ma et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Family with sequence similarity 46 member C (FAM46C) is a non-canonical poly(A) polymerase that is associated with tumorigenesis. However, its role in prostate cancer development is not fully understood. Herein, we determined expression pattern of FAM46C in prostate cancer and further identified its effect on the tumorigenesis and chemosensitivity. FAM46C expression was decreased in prostate cancer tissues and cell lines compared with corresponding controls.
    [Show full text]
  • Triplet Repeat Length Bias and Variation in the Human Transcriptome
    Triplet repeat length bias and variation in the human transcriptome Michael Mollaa,1,2, Arthur Delcherb,1, Shamil Sunyaevc, Charles Cantora,d,2, and Simon Kasifa,e aDepartment of Biomedical Engineering and dCenter for Advanced Biotechnology, Boston University, Boston, MA 02215; bCenter for Bioinformatics and Computational Biology, University of Maryland, College Park, MD 20742; cDepartment of Medicine, Division of Genetics, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA 02115; and eCenter for Advanced Genomic Technology, Boston University, Boston, MA 02215 Contributed by Charles Cantor, July 6, 2009 (sent for review May 4, 2009) Length variation in short tandem repeats (STRs) is an important family including Huntington’s disease (10) and hereditary ataxias (11, 12). of DNA polymorphisms with numerous applications in genetics, All Huntington’s patients exhibit an expanded number of copies in medicine, forensics, and evolutionary analysis. Several major diseases the CAG tandem repeat subsequence in the N terminus of the have been associated with length variation of trinucleotide (triplet) huntingtin gene. Moreover, an increase in the repeat length is repeats including Huntington’s disease, hereditary ataxias and spi- anti-correlated to the onset age of the disease (13). Multiple other nobulbar muscular atrophy. Using the reference human genome, we diseases have also been associated with copy number variation of have catalogued all triplet repeats in genic regions. This data revealed tandem repeats (8, 14). Researchers have hypothesized that inap- a bias in noncoding DNA repeat lengths. It also enabled a survey of propriate repeat variation in coding regions could result in toxicity, repeat-length polymorphisms (RLPs) in human genomes and a com- incorrect folding, or aggregation of a protein.
    [Show full text]
  • NCTD Elicits Proapoptotic and Antiglycolytic Effects on Colorectal Cancer Cells Via Modulation of Fam46c Expression and Inhibition of ERK1/2 Signaling
    774 MOLECULAR MEDICINE REPORTS 22: 774-782, 2020 NCTD elicits proapoptotic and antiglycolytic effects on colorectal cancer cells via modulation of Fam46c expression and inhibition of ERK1/2 signaling SHIQIANG ZHANG1,2*, YUN YANG1,2*, YUNWEI HUA3, CHEN HU4 and YI ZHONG2 1Shanghai University of Traditional Chinese Medicine; Departments of 2Oncology and 3Gastroenterology, Shanghai Traditional Chinese Medicine-Integrated Hospital; 4School of Life Sciences and Technology, Tongji University, Shanghai 200082, P.R. China Received April 18, 2019; Accepted November 1, 2019 DOI: 10.3892/mmr.2020.11151 Abstract. Colorectal cancer is a digestive tract malignancy identified a novel therapeutic target of NCTD in the clinical and the third leading cause of cancer-related mortality treatment of colorectal cancer. worldwide. Norcantharidin (NCTD), the demethylated form of cantharidin, has been reported to possess anticancer Introduction properties. Family-with-sequence-similarity-46c (Fam46c), a non-canonical poly(A) polymerase, has been reported to Colorectal cancer was the third leading cause of cancer-related be critical in NCTD‑mediated effects in numerous types of deaths worldwide in 2016 (1,2). Its pathogenesis is closely cancer, including hepatoma. In the current study, it was found related to various factors, including lifestyle, heredity and that Fam46c expression was reduced in colorectal cancer colorectal adenoma (3,4). Colorectal cancer often arises at tissues and cells. Treatment with NCTD was observed to the age of 40-50 years, with the ratio of men to women being significantly enhance apoptosis and inhibit glycolysis in 1.65:1 (1). According to previous studies, the incidence of colorectal cancer cells. In addition, Fam46c and cleaved colorectal cancer has been steadily increasing in China over caspase 3 expression levels were found to be increased in the years, especially in underdeveloped areas (5-7).
    [Show full text]
  • Frequent Loss of Heterozygosity Targeting the Inactive X Chromosome in Melanoma
    6476 Vol. 9, 6476–6482, December 15, 2003 Clinical Cancer Research Frequent Loss of Heterozygosity Targeting the Inactive X Chromosome in Melanoma James O. Indsto,1 Najah T. Nassif,2 INTRODUCTION Richard F. Kefford,1 and Graham J. Mann1 Chromosomal deletions and amplification events are fre- 1Westmead Institute for Cancer Research, University of Sydney at quent in advanced neoplasms and provide evidence for the Westmead Millennium Institute, Westmead, New South Wales, existence and location of putative tumor suppressor genes Australia, and 2Department of Cell and Molecular Biology, University (TSGs) and oncogenes. In melanoma, 9p and 10q deletions are of Technology, Sydney, New South Wales, Australia most frequent, and losses on 6q, 11q, 1p, 15p, 17q, and 18q are also frequently found (1, 2). However, no studies have focused on the X chromosome. In the human female, random inactiva- ABSTRACT tion of one copy of an X chromosome by hypermethylation is an After previous preliminary observations of paradoxical early event in embryogenesis, resulting in most tissues being a deletion events affecting the inactive X chromosome in mel- mosaic in terms of X inactivation status. Neoplasms, being anoma, we have surveyed the X chromosome for deletions clonal expansions of single precursor cells, usually share a using 23 polymorphic microsatellite markers in 28 inform- common X inactivation status. This can be conveniently assayed ative (female XX) metastatic melanomas. Ten tumors (36%) using the methylation-sensitive restriction enzyme HpaII, which showed at least one loss of heterozygosity (LOH) event, and has a recognition site within the highly polymorphic exon 1 in two cases an entire chromosome showed LOH at all CAG repeat (ARTR) in the androgen receptor (AR) gene.
    [Show full text]
  • Analysis of the Indacaterol-Regulated Transcriptome in Human Airway
    Supplemental material to this article can be found at: http://jpet.aspetjournals.org/content/suppl/2018/04/13/jpet.118.249292.DC1 1521-0103/366/1/220–236$35.00 https://doi.org/10.1124/jpet.118.249292 THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS J Pharmacol Exp Ther 366:220–236, July 2018 Copyright ª 2018 by The American Society for Pharmacology and Experimental Therapeutics Analysis of the Indacaterol-Regulated Transcriptome in Human Airway Epithelial Cells Implicates Gene Expression Changes in the s Adverse and Therapeutic Effects of b2-Adrenoceptor Agonists Dong Yan, Omar Hamed, Taruna Joshi,1 Mahmoud M. Mostafa, Kyla C. Jamieson, Radhika Joshi, Robert Newton, and Mark A. Giembycz Departments of Physiology and Pharmacology (D.Y., O.H., T.J., K.C.J., R.J., M.A.G.) and Cell Biology and Anatomy (M.M.M., R.N.), Snyder Institute for Chronic Diseases, Cumming School of Medicine, University of Calgary, Calgary, Alberta, Canada Received March 22, 2018; accepted April 11, 2018 Downloaded from ABSTRACT The contribution of gene expression changes to the adverse and activity, and positive regulation of neutrophil chemotaxis. The therapeutic effects of b2-adrenoceptor agonists in asthma was general enriched GO term extracellular space was also associ- investigated using human airway epithelial cells as a therapeu- ated with indacaterol-induced genes, and many of those, in- tically relevant target. Operational model-fitting established that cluding CRISPLD2, DMBT1, GAS1, and SOCS3, have putative jpet.aspetjournals.org the long-acting b2-adrenoceptor agonists (LABA) indacaterol, anti-inflammatory, antibacterial, and/or antiviral activity. Numer- salmeterol, formoterol, and picumeterol were full agonists on ous indacaterol-regulated genes were also induced or repressed BEAS-2B cells transfected with a cAMP-response element in BEAS-2B cells and human primary bronchial epithelial cells by reporter but differed in efficacy (indacaterol $ formoterol .
    [Show full text]
  • SUPPLEMENTARY APPENDIX Inflammation Regulates Long Non-Coding RNA-PTTG1-1:1 in Myeloid Leukemia
    SUPPLEMENTARY APPENDIX Inflammation regulates long non-coding RNA-PTTG1-1:1 in myeloid leukemia Sébastien Chateauvieux, 1,2 Anthoula Gaigneaux, 1° Déborah Gérard, 1 Marion Orsini, 1 Franck Morceau, 1 Barbora Orlikova-Boyer, 1,2 Thomas Farge, 3,4 Christian Récher, 3,4,5 Jean-Emmanuel Sarry, 3,4 Mario Dicato 1 and Marc Diederich 2 °Current address: University of Luxembourg, Faculty of Science, Technology and Communication, Life Science Research Unit, Belvaux, Luxemburg. 1Laboratoire de Biologie Moléculaire et Cellulaire du Cancer, Hôpital Kirchberg, Luxembourg, Luxembourg; 2College of Pharmacy, Seoul National University, Gwanak-gu, Seoul, Korea; 3Cancer Research Center of Toulouse, UMR 1037 INSERM/ Université Toulouse III-Paul Sabatier, Toulouse, France; 4Université Toulouse III Paul Sabatier, Toulouse, France and 5Service d’Hématologie, Centre Hospitalier Universitaire de Toulouse, Institut Universitaire du Cancer de Toulouse Oncopôle, Toulouse, France Correspondence: MARC DIEDERICH - [email protected] doi:10.3324/haematol.2019.217281 Supplementary data Inflammation regulates long non-coding RNA-PTTG1-1:1 in myeloid leukemia Sébastien Chateauvieux1,2, Anthoula Gaigneaux1*, Déborah Gérard1, Marion Orsini1, Franck Morceau1, Barbora Orlikova-Boyer1,2, Thomas Farge3,4, Christian Récher3,4,5, Jean-Emmanuel Sarry3,4, Mario Dicato1 and Marc Diederich2 1 Laboratoire de Biologie Moléculaire et Cellulaire du Cancer, Hôpital Kirchberg, 9, rue Edward Steichen, 2540 Luxembourg, Luxemburg; 2 College of Pharmacy, Seoul National University, 1 Gwanak-ro,
    [Show full text]
  • The Multifunctional Role of EMP3 in the Regulation of Membrane Receptors Associated with IDH-Wild-Type Glioblastoma
    International Journal of Molecular Sciences Review The Multifunctional Role of EMP3 in the Regulation of Membrane Receptors Associated with IDH-Wild-Type Glioblastoma Antoni Andreu Martija 1,2,3 and Stefan Pusch 1,2,* 1 Clinical Cooperation Unit (CCU) Neuropathology, German Cancer Consortium (DKTK), German Cancer Research Center (DKFZ), 69120 Heidelberg, Germany; [email protected] 2 Department of Neuropathology, Heidelberg University Medical Center, 69120 Heidelberg, Germany 3 Faculty of Biosciences, Heidelberg University, 69120 Heidelberg, Germany * Correspondence: [email protected]; Tel.: +49-6221-42-1473 Abstract: Epithelial membrane protein 3 (EMP3) is a tetraspan membrane protein overexpressed in isocitrate dehydrogenase-wild-type (IDH-wt) glioblastoma (GBM). Several studies reported high EMP3 levels as a poor prognostic factor in GBM patients. Experimental findings based on glioma and non-glioma models have demonstrated the role of EMP3 in the regulation of several membrane proteins known to drive IDH-wt GBM. In this review, we summarize what is currently known about EMP3 biology. We discuss the regulatory effects that EMP3 exerts on a variety of oncogenic receptors and discuss how these mechanisms may relate to IDH-wt GBM. Lastly, we enumerate the open questions towards EMP3 function in IDH-wt GBM. Keywords: EMP3; glioblastoma; membrane receptors Citation: Martija, A.A.; Pusch, S. The Multifunctional Role of EMP3 in the Regulation of Membrane Receptors 1. Introduction Associated with IDH-Wild-Type The diagnosis of glioblastoma (GBM) is applied to highly aggressive primary central Glioblastoma. Int. J. Mol. Sci. 2021, 22, nervous system (CNS) tumors. Histologically, GBM is characterized by diffusely infiltrating 5261.
    [Show full text]