CBFA2T3–ZNF651, Like CBFA2T3–ZNF652, Functions As a Transcriptional Corepressor Complex

View metadata, citation and similar papers at core.ac.uk brought to you by CORE

provided by Elsevier - Publisher Connector

FEBS Letters 584 (2010) 859–864

journal homepage: www.FEBSLetters.org

CBFA2T3–ZNF651, like CBFA2T3–ZNF652, functions as a transcriptional corepressor complex

Raman Kumar a,*, Kelly M. Cheney b, Paul M. Neilsen a, Renèe B. Schulz a, David F. Callen a

a Breast Cancer Genetics Group, Discipline of Medicine, University of Adelaide and SA Pathology, Adelaide, SA, Australia b Wohl Virion Centre, Division of Infection and Immunity, University College London, London, United Kingdom

article info abstract

Article history: A significant proportion of the human genome codes for transcription factors. Balanced activity of Received 26 November 2009 transcriptional activators and repressors is essential for normal development and differentiation. Revised 13 January 2010 Previously we reported that a classical C2H2 zinc finger DNA binding protein ZNF652 functionally Accepted 21 January 2010 interacts with CBFA2T3 to repress transcription of genes containing ZNF652 consensus DNA binding Available online 30 January 2010 sequence within the promoters of these target genes. Here we show that ZNF651 is a ZNF652 para- Edited by Ivan Sadowski logue that shares a common DNA binding sequence with ZNF652 and represses target gene expression through the formation of a CBFA2T3–ZNF651 corepressor complex. It is suggested that CBFA2T3–ZNF651 and CBFA2T3–ZNF652 repressor complexes perform functionally similar roles in Keywords: Repressor a tissue-specific manner. ZNF651 ZNF652 Structured summary: CBFA2T3 MINT-7555667: CBFA2T3 (uniprotkb:O75081) physically interacts (MI:0915) with ZNF651 (uniprotkb:Q9UFB7) by anti tag co-immunoprecipitation (MI:0007)

1. Introduction proteins do not directly bind DNA, but exhibit their repressor activity by interacting with transcription factors (for example, Transcriptional activation and repression is critical in develop- BCL6, PLZF, Gﬁ-1, ZNF652) that bind directly to their cognate ment and differentiation. Although about 10% of proteins encoded DNA binding sequences located within the promoters of target by the human genome are transcription factors, only a small num- genes. ETOs are scaffold proteins that recruit a range of corepressor ber of these have been functionally characterised [1]. Transcription proteins such as N-CoR, SMRT, Sin3A and ATN1 and HDACs to gen- factors directly bind their cognate DNA binding sequences gener- erate complexes that function to repress gene transcription [3].

ally located within the promoter regions of their target genes. A We have previously shown that the classical C2H2 zinc finger number of these DNA binding transcription factors are evolution- DNA binding protein ZNF652 specifically and functionally interacts arily conserved, particularly within regions of the protein that di- with the ETO protein CBFA2T3 to repress transcription [4]. The rectly bind the DNA sequences. For example, Gfi-1 and Gfi-1b are CBFA2T3–ZNF652 complex was proposed to repress transcription highly conserved within their DNA binding zinc finger regions of genes that have roles in breast oncogenesis [4]. Subsequently, and both recognise the same DNA binding motif. However, their we identified the ZNF652 consensus DNA binding sequence, and differing functions are attributed to dissimilarity between the showed that CBFA2T3–ZNF652 represses HEB expression by bind- two proteins outside their zinc finger regions [2]. ing to a single ZNF652 DNA binding motif located within the HEB CBFA2T1, CBFA2T2 and CBFA2T3 (MTG8, R1 and 16, respec- promoter [5]. We have now identified ZNF651 (also called ZBTB47) tively) constitute a group of ubiquitously expressed transcriptional as a ZNF652 paralogue. The deduced ZNF652 and ZNF651 amino regulatory proteins sometimes referred to as the ‘‘ETO” family. ETO acid sequences are highly conserved within the zinc finger region, and we show that ZNF651 can also bind to the consensus ZNF652 DNA binding sequence. We present data showing that CBFA2T3– ZNF651 functions as a repressor complex in a manner similar to * Corresponding author. Address: Breast Cancer Genetics Group, SA Pathology, CBFA2T3–ZNF652. We also determined that both ZNF651 and Frome Road, Adelaide, SA 5000, Australia. Fax: +61 8 8222 3217. E-mail address: [email protected] (R. Kumar). ZNF652 share a region of homology through which they interact

0014-5793/$36.00 Crown Copyright Ó 2010 Published by Elsevier B.V. on behalf of Federation of European Biochemical society. All rights reserved. doi:10.1016/j.febslet.2010.01.047 860 R. Kumar et al. / FEBS Letters 584 (2010) 859–864 with CBFA2T3. We predict that ZNF651 and ZNF652 perform func- as previously reported [5]. Short double-stranded annealed DNA tionally similar roles in a tissue-specific manner. carrying wild type and mutant sequences were used in normal and supershift EMSA as reported [5]. Co-immunoprecipitations, 2. Materials and methods promoter precipitation and Western blots were performed as de- scribed previously [5]. 2.1. Plasmid constructs 2.4. Dual luciferase reporter assays Epitope-tagged CBFA2T3 and ZNF652 expression constructs have been reported recently [5]. To generate HA- and Myc- Dual luciferase assays were performed using HeLa cells as pre- ZNF651 expression constructs, ZNF651 coding sequence was viously reported [5]. Briefly, HeLa cells were co-transfected with amplified using forward 50-CACACACACACAGAATTCCCATGGGCTG- the firefly luciferase expressing pGL2-IRF2BP1-TK-Luc and Renilla CCTCCTGGATGGCTG and reverse 50-CACACACACACAGGATCCCT- luciferase expression plasmid pRL-TK and the indicated expression AGTTGTTGGCGTTCATCCTC primers from brain cDNA and cloned constructs (see Fig. 4). The firefly luciferase activity was expressed in-frame with the respective tags at EcoRI and BglII sites in the relative to the Renilla luciferase activity. All reporter assays were pCMV-HA and pCMV-Myc expression vectors (Clontech). To gener- performed in triplicate and repeated at least three times with the ate pGL2-IRF2BP1-TK-Luc construct for dual luciferase reporter data presented as mean ± S.E. assays, a 435 bp region of the IRF2BP1 promoter was PCR amplified using forward 50-CACACACAGGTACCTCCAGGTAGTGAGCGCTCAA- 3. Results GGTT and reverse 50-CACACACACAGGATCCCTCGAGAGAGCCTT- GTCTCAGTTGTTTCTC primers from human genomic DNA and 3.1. ZNF651 and ZNF652 are paralogues that are differentially cloned at KpnI–XhoI sites located upstream of a Herpes simplex expressed in human tissues virus thymidine kinase (TK) gene promoter in the pGL2-TK-Luc vector. ZNF651 is located on chromosome 3 and encodes a 371 amino acid protein that is shorter than the 606 amino acid ZNF652 pro- 2.2. Cell lines and antibodies tein encoded by the ZNF652 gene located on chromosome 17. Alignment of the deduced amino acid sequences of ZNF651 and HEK293T (human embryonic kidney) and HeLa (cervical carci- ZNF652 shows 77% overall similarity. The two proteins are highly noma) cells were purchased from the American Type Culture Col- conserved (95%) within their zinc finger regions. Besides this zinc lection (Manassas, VA) and grown in the recommended media at finger region, a short carboxy-terminal proline-rich sequence of

37 °Cin5%CO2. Antibodies used were; affinity-purified rabbit ZNF651 and ZNF652 is the only other region with significant sim- anti-ZNF652 [4]; rat anti-HA (12CA5, Roche Diagnostics); mouse ilarity (85%) (Fig. 1). Whereas both ZNF651 and ZNF652 are differ- anti-Myc (9E10: sc-40, Santa Cruz Biotechnology); rabbit anti- entially expressed in different tissues, only ZNF652 is expressed in rat-IgG-HRP (Dako Cytomation), sheep anti-mouse-IgG-HRP and blood and mammary tissue (Fig. 2). donkey anti-rabbit-IgG-HRP (Amersham Biosciences). 3.2. ZNF651 and ZNF652 bind to the identical consensus DNA binding 2.3. EMSA (electrophoretic mobility shift assay), co- sequence immunoprecipitations, promoter precipitation and Western blotting Using a CASTing protocol, we previously identified NBNAVGG- Nuclear extracts from the HEK293T and HEK293T cells tran- GTTAAN (where N = AGCT, B = GCT and V = AGC) as the ZNF652 siently expressing either HA-ZNF651 or HA-ZNF652 were prepared DNA binding sequence [5]. As ZNF651 and ZNF652 shared 95% sim-

Fig. 1. ZNF651 and ZNF652 are paralogues. Alignment of the deduced amino acid sequences of ZNF651 and ZNF652. Conserved regions are shown in yellow. The zinc ﬁnger domains are marked with lines above the sequence and amino acids conserved within the carboxy-terminal proline-rich regions are underlined. R. Kumar et al. / FEBS Letters 584 (2010) 859–864 861

140 ZNF651 sequences and resolved on a non-denaturing acrylamide gel. Whereas both the ZNF652 and ZNF651 proteins bound to the wild 120 ZNF652 type probes (Fig. 3, lanes 4 and 10) no such binding was seen with 100 the mutant probes (lanes 5 and 11). To conﬁrm the speciﬁcity of protein–DNA complexes, rabbit anti-ZNF652 and rat anti-HA anti- 80 bodies were used in a supershift EMSA. Whereas the ZNF652– and

60 ZNF651–wild type DNA probe complexes supershifted in the presence of anti-ZNF652 (lane 6) and anti-HA (lane 12) antibodies, 40 respectively, no further mobility shift was detected in the presence

Transcripts per million Transcripts of appropriate non-specific antibodies (lanes 8 and 14). Taken to- 20 gether, these results suggest that both ZNF652 and ZNF651 can 0 specifically bind to the same DNA binding sequence that was previously identified as the consensus ZNF652 DNA binding sequence. Eye lung Blood Brain Testis Uterus Embryo Prostate Although both proteins bind to the same DNA binding sequence, subtle differences in their strength of binding may be present. Mammary Gland

Fig. 2. ZNF651 and ZNF652 are differentially expressed in different human tissues. 3.3. The CBFA2T3–ZNF651 complex mediates transcriptional The graph shows levels of ZNF651 and ZNF652 expression in selected human tissues. repression through a ZNF652 DNA binding sequence Data for the transcripts per million in the pool for each tissue was accessed from http://www.ncbi.nlm.nih.gov/UniGene/ESTProfileViewer.cgi?uglist=Hs.409561 IRF2BP1 was identified as one of several ZNF652 target genes (ZNF651) and http://www.ncbi.nlm.nih.gov/UniGene/ESTProfileViewer.cgi?uglist= Hs.463375 (ZNF652). from our recent ChIP-chip assay (manuscript in preparation). The pGL2-IRF2BP1-TK-Luc construct carrying an IRF2BP1 promoter region was used (Fig. 4) in a dual luciferase assay to determine if ilarity within their zinc finger regions, we premised whether CBFA2T3–ZNF651 complex is capable of mediating the transcrip- ZNF651 binds to the ZNF652 consensus DNA binding sequence. tional repression through the consensus ZNF652 DNA binding se- This was determined by an EMSA using nuclear extracts from quence located within the IRF2BP1 promoter. HEK293T cells ectopically expressing HA-tagged ZNF651 or The pGL2-IRF2BP1-TK-Luc reporter showed a moderate level of ZNF652 proteins. Ectopically expressed HA-ZNF651 and HA- basal transcriptional activity. A dose-dependent decrease in lucif- ZNF652 proteins were used due to unavailability of an EMSA com- erase activity in response to increasing levels of exogenous patible anti-ZNF651 antibody. Binding reactions were performed ZNF651 or ZNF652 was observed. This repression was further en- by mixing the nuclear extracts and radio-labelled short double hanced in the presence of increasing levels of CBFA2T3 (Fig. 4). stranded DNA probes carrying either wild type ZNF652 or mutant The results showed that both the CBFA2T3–ZNF651 and/or

0.7

0.6 Non-specific antibody Non-specific antibody Anti-ZNF652 Anti-HA No antibody No antibody 0.5 Probe (WT) + - ++ --+ + - ++- - + ------Probe (NS) + + + + + + - + 0.4 ZNF652-DNA Complex-SS ZNF651-DNA 0.3 Complex-SS ZNF652-DNA ZNF651-DNA 0.2 Complex Complex Normalised Activity 0.1 Renilla Luciferase) (Firefly/

0 ZNF651 (ng) - 410 101010 ------ZNF652 (ng) ------410 101010 CBFA2T3 (ng) - - - 2 5 10 - - - 2 5 10 1 23 456 7819 011 12 Non-specific binding Non-specific

CTTAACCCCTTACT Luciferase Free Probe -1026 -941 -928 -592 TK Promoter 1342 576891011121314 15 IRF2BP1 Promoter

293T 293T/HA-ZNF652 293T/HA-ZNF651 pGL2-IRF2BP1-TK-Luc Reporter Construct

Fig. 3. ZNF651 and ZNF652 proteins bind to the same DNA binding sequence. The Fig. 4. CBFA2T3 enhances ZNF651- and ZNF652-mediated transcriptional repres- nuclear extracts from HEK293T cells ectopically expressing either HA-tagged sion. Increasing levels of ZNF651 and ZNF652 result in a dose dependent decrease in ZNF652 (lanes 4–9) or ZNF651 (lanes 10–15) were incubated with 32P-labelled wild pGL2-IRF2BP1-TK-Luc reporter gene activity and this is further reduced in the type (WT) probe consisting of consensus ZNF652 binding sequence, or a non- presence of CBFA2T3. Dual-luciferase reporter assays were performed to determine specific (NS) probe containing a randomised sequence of the same length, and the effect of ZNF651 and ZNF652 on transcriptional activity of the pGL2-IRF2BP1- analysed by EMSA. 18- and 35-mer oligonucleotide probes were used for ZNF651 TK-Luc reporter construct (schematic shown below the graph). ZNF651/ZNF652 and ZNF652 binding reactions, respectively. Binding reactions containing WT (lane DNA binding site located at 928 to 941 within the IRF2BP1 promoter is shown. 1, 18-mer), NS (lane 2, 18-mer) or WT (lane 3, 35-mer) oligonucleotide probes and The core ZNF652 DNA binding sequence is underlined. HeLa cells were transfected HEK293T nuclear extracts were used as controls. The anti-ZNF652 (lanes 6–7), anti- with pGL2-IRF2BP1-TK-Luc together with or without different expression con- HA (lanes 12–13) or appropriate non-specific (lanes 8–9 and 14–15) antibody was structs as shown. pRL-TK-Renilla luciferase vector was used as a transfection added to the reactions for supershift analysis (lanes 6–9 and 12–15, respectively). control. Promoter activity was calculated from the ratio of firefly to Renilla Protein–DNA complexes and protein–DNA-supershift (SS) complexes that super- luciferase activities. Repressive activity was enhanced in the presence of ZNF651 or shifted only in the presence of anti-ZNF652 or anti-HA antibody are shown with ZNF652 alone or in combination with CBFA2T3. Data shown is representative of arrows. three independent experiments and is presented as mean ± S.E. (n = 3). 862 R. Kumar et al. / FEBS Letters 584 (2010) 859–864

Input WT MT _ anti-myc (ZNF651)

anti-myc (CBFA2T3)

1 2 3 4

Interaction with ZNF651 ZNF652 1aa 85 181 308 334 399 447 470 506 567aa (this study) [5] CBFA2T3 + + PST NHR1 NHR2 NHR3 NHR4

341aa 567aa CBFA2T3-3 448aa + +

Input IP: anti-myc 1 2 3 4 5 6 myc-CBFA2T3 --+ --+ myc-CBFA2T3-3 - - + - - + HA-ZNF651 ++++++

45kDa WB:anti-HA

78kDa

WB:anti-myc

36kDa

Fig. 5. CBFA2T3 interacts to the ZNF651 bound to the ZNF652 DNA binding sequence and ZNF651 interacts with CBFA2T3 through its conserved proline-rich carboxy- terminal sequence. (A) The 50-end biotinylated DNA carrying wild type (WT) or mutant (MT) DNA binding sequences were immobilised to streptavidin-coated magnetic beads. Magnetic beads charged with DNA sequences (lanes 2 and 3) or uncharged beads (lane 4) were incubated with protein lysates from HEK293T cells ectopically expressing Myc-tagged ZNF651 and CBFA2T3 proteins and then washed and eluted. Input and eluted proteins were analysed by Western blotting with anti-Myc antibody. Low level of non-speciﬁc binding of the CBFA2T3 to the magnetic beads was detected. (B) HEK293T cells were transfected with constructs expressing HA-tagged ZNF651 proteins alone (lanes 1 and 4) or with Myc-CBFA2T3 (lanes 2 and 5) or Myc-CBFA2T3-3 (lanes 3 and 6) as shown. Cell lysates were co-immunoprecipitated with anti-Myc antibody. Inputs (lanes 1–3) and immunoprecipitates (lanes 4–6) were Western blotted with anti-HA or anti-Myc antibodies.

CBFA2T3–ZNF652 complexes can functionally corepress transcrip- zinc finger region [4]. We also showed that both NHR3 and NHR4 tion of the IRF2BP1 gene. (CBFA2T3-3) motifs of CBFA2T3 are required for its interaction with ZNF652 [5]. As the proline-rich region is the only conserved 3.4. The CBFA2T3–ZNF651 complex specifically binds to the ZNF652 domain between ZNF651 and ZNF652 outside the highly conserved DNA binding sequence zinc finger region, we predicted that, like ZNF652, ZNF651 also interacted with CBFA2T3 through this proline-rich region. Indeed, An in vitro DNA binding assay was performed to determine both the full length CBFA2T3 and CBFA2T3-3 interacted with HA- whether CBFA2T3 associates with ZNF651 when bound to the ZNF651 in co-immunoprecipitation assays performed on cells ZNF652 DNA binding sequence. Nuclear extracts from HEK293T ectopically expressing these proteins (Fig. 5B, lanes 5 and 6). How- cells ectopically expressing Myc-ZNF651 and Myc-CBFA2T3 pro- ever, ZNF651 did not interact with CBFA2T3-1 (containing NHR2), teins were incubated with DNA fragments carrying either wild CBFA2T3-2 (containing NHR3) or CBFA2T3-4 (containing NHR4) type or mutant ZNF652 DNA binding sequences. Both ZNF651 (data not shown). The results suggested that CBFA2T3 also interacts and CBFA2T3 proteins bound to the wild type ZNF652 DNA binding with ZNF651 through its carboxy-terminal proline-rich region. sequence but no such binding to the mutant sequences was observed (Fig. 5). A low level of CBFA2T3 binding to the magnetic beads charged with mutant DNA sequence appeared to be non- 4. Discussion specific as a comparable level of CBFA2T3 binding was also observed in the uncharged beads (Fig. 5A; lanes 3 and 4). Transcriptional regulation is an extremely complex and tightly controlled process and is the result of finely balanced activities of 3.5. ZNF651 interacts with CBFA2T3 via its carboxy-terminal proline- activator and repressor proteins. These controls are critical to a rich region multitude of developmental and differentiation processes while deregulation of transcriptional regulation can lead to disease or We have previously shown that CBFA2T3 interacts with ZNF652 cancer. The observation that a significant proportion of the human via its carboxy-terminal region and not through the DNA binding genome encodes for transcription factors, whose key functional R. Kumar et al. / FEBS Letters 584 (2010) 859–864 863

N-terminal Zinc Fingers C-terminal 1 742 364 565 475 606aa ZNF652 PPVPHLPPPP 1 26 872 345 453 371aa ZNF651 PPPPHLPPPP

N-CoR 606-615 EPPPPLPPPP N-CoR 1031-1040 RPPPPLIPSS SMRT 1103-1112 SNPPPLISSA SMRT 1664-1673 LYPPYLIRGY

Fig. 6. Conserved proline-rich motifs facilitate functional protein–protein interactions. The diagram shows the structure of ZNF651 and ZNF652 proteins. An alignment of the proline-rich regions of ZNF652, ZNF651, N-CoR, and SMRT proteins is also shown. Amino acids (aa) identical among the aligned sequences are shaded. motifs are generally highly conserved among diverse organisms, line-rich PPLXP motif within N-CoR [8]. A number of other pro- signifies the critical role they play in essential developmental teins have been reported to interact with MYND domains processes. (NHR4) through proline-rich domains and a PXLXP peptide motif ETOs are modular proteins that do not directly bind DNA but has been proposed (Fig. 6). ZNF651 and ZNF652 carboxy-terminal interact with transcription factors bound to their cognate DNA proline-rich region conforms to this motif. MYND domains are de- binding sequences located within the promoter regions of target fined by a C4–C2HC consensus and are frequently implicated in genes and recruit a range of corepressors to facilitate transcrip- transcriptional repression [10,11]. Interaction of ZNF651 and tional repression. The ETO proteins interact with the zinc finger ZNF652 with CBFA2T3 through their carboxy-terminal proline- proteins, Gfi-1, BCL6, PLZF, GATA-1 and transcription factors HEB rich conserved sequence further emphasises the functional signif- and TAL-1/SCL to repress gene expression [5]. We showed that icance of proline-rich regions in protein–protein interaction and ETOs can also exhibit their transcriptional repressor activity by cell signaling [12]. interacting with a novel zinc finger protein ZNF652 [4]. In this re- Similarly to other examples of paralogous transcription factors, port we have now shown that CBFA2T3 can also exhibit its repres- we find that ZNF651 and ZNF652 share a number of similarities sive activity through a ZNF652 paralogue ZNF651 adding to the with the Gfi-1 and Gfi-1b transcriptional repressor proteins. Both existing range of ETOs-transcriptional complex-mediated gene ZNF651 and ZNF652 are highly conserved paralogous transcrip- repression. We have presented in vitro and in vivo data showing tional factors that are located on different chromosomes (3 and that ZNF651 and ZNF652 can bind to the same DNA binding con- 17, respectively) and may have resulted from gene duplication. sensus sequence and that CBFA2T3 interacts with both of these Both proteins bind to the same DNA binding sequences located proteins. We have shown that both CBFA2T3–ZNF651 and within promoter regions of their target genes and interact with CBFA2T3–ZNF652 function as corepressors on the ZNF652 DNA the corepressor CBFA2T3 through a proline-rich region located binding site located within the IRF2BP1 promoter. As CBFA2T3– within their respective carboxyl-terminal regions. ZNF651 and ZNF651 did not show transcriptional repression on the HEB pro- ZNF652 are conserved within their zinc finger and proline-rich re- moter ([5] and data not shown) and as ZNF651 and ZNF652 pro- gions that are critical for DNA binding and CBFA2T3 corepressor teins are differentially expressed among different tissues, we interaction, respectively. Likewise, Gfi-1 and Gfi-1b are highly con- premise that the two complexes may exhibit both tissue and gene served pair of paralogous transcriptional repressors located on dif- specific roles. ferent chromosomes (chromosome 1 and 9, respectively) that may Although dysregulation of most ETO-based complexes is associ- also have resulted from gene duplication, and bind to the same ated with leukaemia [3], down regulation of CBFA2T3 in breast tu- DNA binding sequence and interact with CBFA2T3. However, un- mours and functional studies are consistent with a role of CBFA2T3 like ZNF651 and ZNF652, Gfi proteins interact with CBFA2T3 as a breast tumor suppressor [6]. We have reported that CBFA2T3 through their evolutionarily conserved six carboxy-terminal zinc- suppresses breast oncogenesis through its interaction with ZNF652 finger motifs. [4]. A recent report showed that CBFA2T3 interacts with the solu- Typically, ETO proteins form complexes with the DNA binding ble intracellular domain, termed s80, of ERBB4 and has a role in proteins and recruit corepressors such as N-CoR, Sin3A, SMRT and ERBB4-dependent differentiation [7]. Whereas CBFA2T3 is ubiqui- HDACs. It is not known whether CBFA2T3–ZNF652 recruits unique tously expressed, ZNF651 and ZNF652 show differential expression co-factors although ZNF651- and ZNF652-specific protein motifs among a range of human tissues. Therefore, we suggest that may provide interfaces for interaction with as yet unidentified CBFA2T3–ZNF651 and CBFA2T3–ZNF652 complexes exhibit their co-factors thereby providing functional specificity to the two tran- transcriptional repressor function in a tissue-specific manner. scriptional repressors. These findings further define the complex- We showed that CBFA2T3 interacts with ZNF652 through a ity and diverse nature of the ETO-based repressor complexes. proline-rich region located within the carboxy-terminal region ZNF651 and ZNF652 are differentially expressed in different tis- of ZNF652. We also showed that both NHR3 and NHR4 motifs sues (Fig. 2). Expression of ZNF651 is absent while ZNF652 is ex- of CBFA2T3 are required for its interaction with ZNF652 [5]. Here pressed in blood and mammary tissue. The presence of relatively we have shown that CBFA2T3-3 carrying the NHR3–NHR4 motifs high ZNF652 expression in mammary tissue is consistent with the interacts with ZNF651 and that this interaction most likely also original identification of ZNF652 as a CBFA2T3 interacting protein occurs through ZNF651 carboxy-terminal proline-rich region. This in a yeast two-hybrid screen of a breast cDNA library [4]. It is sug- is because, besides zinc finger regions, carboxy-terminal proline- gested that although ZNF651 and ZNF652 transcription factors rich sequence is the only other region with significant similarity interact with the same consensus DNA binding sequence, func- between ZNF651 and ZNF652. Previous studies on the ETO mem- tional specificity is provided by their tissue distribution. Future ber CBFA2T1 showed that both the NHR3 and NHR4 domains work will determine tissue-specific functional differences be- were also required for its interaction with the corepressor N- tween the CBFA2T3–ZNF651 and CBFA2T3–ZNF652 transcrip- CoR [8,9] and this interaction occurs through a conserved pro- tional repressor complexes. 864 R. Kumar et al. / FEBS Letters 584 (2010) 859–864

Acknowledgement [6] Kochetkova, M. et al. (2002) CBFA2T3 (MTG16) is a putative breast tumor suppressor gene from the breast cancer loss of heterozygosity region at 16q24.3. Cancer Res. 62, 4599–4604. We thank the National Breast Cancer Foundation, Australia for [7] Linggi, B. and Carpenter, G. (2006) ErbB-4 s80 intracellular domain abrogates supporting research in our laboratory. ETO2-dependent transcriptional repression. J. Biol. Chem. 281, 25373–25380. [8] Lausen, J., Cho, S., Liu, S. and Werner, M.H. (2004) The nuclear receptor corepressor (N-CoR) utilizes repression domains I and III for interaction and co- References repression with ETO. J. Biol. Chem. 279, 49281–49288. [9] Hildebrand, D., Tiefenbach, J., Heinzel, T., Grez, M. and Maurer, A.B. (2001) [1] Kummerfeld, S.K. and Teichmann, S.A. (2006) DBD: a transcription factor Multiple regions of ETO cooperate in transcriptional repression. J. Biol. Chem. prediction database. Nucleic Acids Res. 34, D74–D81. 276, 9889–9895. [2] Fiolka, K., Hertzano, R., Vassen, L., Zeng, H., Hermesh, O., Avraham, K.B., [10] Spadaccini, R., Perrin, H., Bottomley, M.J., Ansieau, S. and Sattler, M. (2006) Duhrsen, U. and Moroy, T. (2006) Gfi1 and Gfi1b act equivalently in Structure and functional analysis of the MYND domain. J. Mol. Biol. 358, 498– haematopoiesis, but have distinct, non-overlapping functions in inner ear 508. development. EMBO Rep. 7, 326–333. [11] Liu, Y. et al. (2007) Structural basis for recognition of SMRT/N-CoR by the [3] Hug, B.A. and Lazar, M.A. (2004) ETO interacting proteins. Oncogene 23, 4270– MYND domain and its contribution to AML1/ETO’s activity. Cancer Cell 11, 4274. 483–497. [4] Kumar, R. et al. (2006) ZNF652, a novel zinc finger protein, interacts with the [12] Kay, B.K., Williamson, M.P. and Sudol, M. (2000) The importance of being putative breast tumor suppressor CBFA2T3 to repress transcription. Mol. proline: the interaction of proline-rich motifs in signaling proteins with their Cancer Res. 4, 655–665. cognate domains. FASEB J. 14, 231–241. [5] Kumar, R. et al. (2008) CBFA2T3-ZNF652 corepressor complex regulates transcription of the E-box gene HEB. J. Biol. Chem. 283, 19026–19038.