DOCSLIB.ORG

IER5 Is Involved in DNA Double-Strand Breaks Repair In

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
IER5 Is Involved in DNA Double-Strand Breaks Repair In Int. J. Med. Sci. 2017, Vol. 14 1292 Ivyspring International Publisher International Journal of Medical Sciences 2017; 14(12): 1292-1300. doi: 10.7150/ijms.21510 Research Paper IER5 is involved in DNA Double-Strand Breaks Repair in Association with PAPR1 in Hela Cells Xin-Ping Yu1, Yu-Mei Wu1, Yang Liu1, Ming Tian1, Jian-Dong Wang1, Ku-Ke Ding2, Teng Ma3, Ping-Kun Zhou3 1. Department of Gynecologic Oncology, Beijing Obstetrics and Gynecology Hospital, Capital Medical University, Beijing, 100006, China; 2. National Institute for Radiological Protection, Chinese Center for Disease Control and Prevention, Beijing ,100088, China; 3. Department of Radiation Toxicology and Oncology, Beijing Key Laboratory for Radiobiology, Beijing Institute of Radiation Medicine, Beijing, 100850, China. Corresponding author: Yu-Mei Wu, Beijing Obstetrics and Gynecology Hospital, Capital Medical University, 17 Qi-he-lou St, Dongcheng District, Beijing 100006, China. E-mail: [email protected] © Ivyspring International Publisher. This is an open access article distributed under the terms of the Creative Commons Attribution (CC BY-NC) license (https://creativecommons.org/licenses/by-nc/4.0/). See http://ivyspring.com/terms for full terms and conditions. Received: 2017.06.17; Accepted: 2017.09.01; Published: 2017.09.30 Abstract The immediate early response gene 5 (IER5) is a radiation response gene induced in a dose-independent manner, and has been suggested to be a molecular biomarker for biodosimetry purposes upon radiation exposure. Here, we investigated the function of IER5 in DNA damage response and repair. We found that interference on IER5 expression significantly decreased the efficiency of repair of DNA double-strand breaks induced by ionizing radiations in Hela cells. We found that IER5 participates in the non-homologous end-joining pathway of DNA breaks repair. Additionally, we identified a number of potential IER5-interacting proteins through mass spectrometry-based protein assays. The interaction of IER5 protein with poly(ADP-Ribose) polymerase 1 (PARP1) and Ku70 was further confirmed by immunoprecipitation assays. We also found that Olaparib, a PARP1 inhibitor, affected the stability of IER5. These results indicate that targeting of IER5 may be a novel DNA damage response-related strategy to use during cervical cancer radiotherapy or chemotherapy. Key words: cervical cancer; IER5; DNA double strand break repair; ionizing radiation; PARP1; Olaparib. Introduction Cervical cancer is a leading threat to women’s early response gene 5 (IER5), was found to be induced health, especially in developing countries [1]. The by ionizing radiation (IR) in studies using cDNA treatment for cervical cancer includes surgery, microarray technology [9, 10]. radiation, and chemotherapy. Concurrent IER5 belongs to the immediate-early gene chemoradiotherapy has been regarded as the family, and encodes a protein of 327 amino acids, standard treatment of locally advanced cervical mostly located in the cytoplasm [11]. IER5 can be cancer [2-5]. Because of the widespread uptake of induced by growth-promoting and oncogenic signals, screening for the early detection of cervical cancer, its IR and heat shock. IER5 plays a role in cell death rate has declined [1, 6]. However, no significant proliferation, and it inhibits cell proliferation through improvements have been achieved in cervical cancer the reduction of Cdc25B expression, resulting in survival rate over the past three decades [7]. G2/M cell cycle arrest [11, 12]. Additionally, IER5 Therefore, it is necessary to discover new and interacts with protein phosphatase 2A (PP2A) and is effective strategies for a favorable therapeutic involved in the generation of a hypophosphorylated outcome. Specific molecules involved in active form of heat shock factor 1 (HSF1), contributing radiosensitivity have been the focus of many studies to proliferation and survival of cancer cells [13-15]. in recent years [8]. One of such molecules, immediate Previous studies have shown that the expression http://www.medsci.org Int. J. Med. Sci. 2017, Vol. 14 1293 of IER5 in response to radiation response is Mix with gDNA Remover kit (TOYOBO), following dose-independent [16]. IER5 is involved in DNA the manufacturer’s instructions. Quantitative PCR damage repair. Therefore, it has been suggested that (qPCR) was performed with a Bio-Rad iCycler&iQ IER5 can be used as molecular biomarker for Real-time PCR system (Bio-Rad) and a biodosimetry purposes [16, 17]. However, whether fluorescence-labeled SYBR Green real master Mix kit IER5 functions in cervical cancer cellular response to (TIANGEN Biotech [Beijing] Co. LTD). The mRNA radiation is still unclear. primers were as follows: IER5 (forward: In the present study, we report that IER5 is 5’CCGGGAACGTGGCTAACC3’; reverse: involved in the DNA repair process. Specifically, IER5 5’TTCCGTAGGAGTCCCGAGAA3’); β-actin participates in non-homologous end joining (forward: 5’GCGCGGCTACAGCTTCA3’; reverse: (NHEJ)-mediated DNA double strand breaks (DSBs) 5’CTTAATGTCACGCACGATTTCC3’). repair. Additionally, we used immunoprecipitation assays and mass spectrometry (MS) to identify the Plasmids, RNA interference and cell proteins that interact with IER5. Our study has transfection established the foundation to further study the role of The cDNA of IER5 was amplified by RT-PCR IER5 in cervical cancer, and hypothesized its use in from total RNA extracted from Hela cells and cloned cancer therapy. into the pCMV plasmid in frame with the sequence encoding 3×FLAG epitopes (p3×FLAG-IER5-CMV). Materials and methods To specifically knock down gene expression in Hela cells, the following small interfering RNAs (siRNAs) Patient samples and immunohistochemistry were used: native control siRNA (siNC) Human cervical tissue samples were obtained (UUCUCCGAACGUGUCACGUTT), siIER5 from Beijing Biobank of Clinical Resources. The (CCUCAUCAGCAUCUUCGGUUU), si53BP1 collection of human tissue samples was approved and (GAAGGACGGAGUACUAAUATT), siRAD51 supervised by the Ethics Committee of Beijing (GAAGCUAUGUUCGCCAUUATT). The pDR-GFP, Obstetrics and Gynecology Hospital. Thirty-one pEGFP-Pem1-Ad2 and pCherry plasmids and I-SceI cervical cancer tissues and 20 normal cervical tissues had been previously obtained by our laboratory. were obtained. Hela cells were seeded into 6-well plates or 100 Immunohistochemistry was carried out using mm culture plates and cultured in medium without the Ultra-Sensitive S-P kit (Boster Bioscience [Hubei antibiotics; siRNAs or plasmids were transfected into Province, China] Co. LTD), following the cells using Lipofectamine 2000 (Invitrogen), following manufacturer’s instructions. The staining of IER5 was the manufacturer’s recommendations. Cells were scored considering both the percentage of positive harvested 36/48 h after transfection and subjected to cells and intensity of the staining, as described the specified assays. previously [18]. The number of positive cells was counted in at least ten fields for each section and Western blot analysis analyzed with the Image Pro Plus software. Cells were lysed in lysis buffer (Thermo); equal amounts of protein were separated by Cell culture and treatment SDS-polyacrylamide gel electrophoresis (SDS-PAGE) Hela cells were cultured in Dulbecco’s modified and then transferred onto polyvinylidene fluoride Eagle’s medium (Hyclone), supplemented with 10 % membranes. The membranes were blocked with 5 % fetal calf serum (FBS, Sigma), and 100 U/ml penicillin milk in TBST (20 mM Tris-HCl, 500 mM NaCl [pH7.5], and 100 mg/ml streptomycin (Hyclone). Cells were 0.1 % [v/v] Tween 20) for 1 h at room temperature, incubated at 37 °C, in a 5 % CO2 incubator. and incubated with the primary antibodies overnight Cells were irradiated with 60Co γ-rays at a dose at 4 °C. Membranes were then incubated with the rate of 1.98 Gy/min at room temperature. Cells were appropriate secondary antibody for 1 h at room treated with 10 μM Olaparib (Selleck), MG132 temperature, and washed with TBST. Bands were (Merck), or cycloheximide (CHX, Sigma), as indicated; visualized using the Image quant LAS500 system stock solution were prepared in dimethyl sulfoxide (GE). (DMSO ). Antibodies used in this study: anti-IER5 goat polyclonal antibody (Abcam), anti-IER5 rabbit Reverse transcription and quantitative polyclonal antibody (Santa Cruz), anti-GAPDH polymerase chain reaction mouse monoclonal antibody (Zhong Shan Jin Qiao), Total RNA was extracted from cells using TRIzol anti-PARP1 rabbit monoclonal antibody (Santa Cruz), (Invitrogen). Reverse transcription (RT-PCR) was anti-Ku70 mouse monoclonal antibody (Abcam), carried out using the ReverTra Ace qPCR RT Master http://www.medsci.org Int. J. Med. Sci. 2017, Vol. 14 1294 anti-Ku80 rabbit monoclonal antibody (Santa Cruz), Visualization and Integrated Discovery (DAVID) anti-FLAG M2 mouse monoclonal antibody (Sigma), online database was used to analyze the MS report. anti-53BP1 rabbit polyclonal antibody (Santa Cruz), Statistical significance was defined as p < 0.05. anti-RAD51 rabbit polyclonal antibody (Proteintech), anti-γH2AX mouse monoclonal antibody (Millipore), Results anti-Ubiquitinylated proteins mouse monoclonal The expression of IER5 was higher in tumor antibody (Millipore), and anti-PADPR mouse tissues than in normal cervical tissues monoclonal antibody (Abcam). We analyzed the expression of IER5 in 31 Neutral comet assay cervical cancer tissues samples and 20 normal cervical Hela cells were collected at 0 h (mock treated), 10 tissue samples.
Load more

Recommended publications
  • Technical Note: Colorimetric Protein Assays Assays for Determining Protein Concentration
    Technical Note: Colorimetric Protein Assays Assays for Determining Protein Concentration Contents speed. No colorimetric assay is as simple and quick as direct UV measurements at 280 nm for Introduction ....................................................... 1 the determination of protein concentration. Assay Choice ..................................................... 1 However measurements at 280 nm rely on the Buffer Composition ........................................ 1 protein containing aromatic amino acids such as Sample Composition ...................................... 2 tyrosine (Y), phenylalanine (F), and, or tryptophan Standard Selection ......................................... 2 (W). Not all proteins contain these amino acids, Assays ................................................................ 2 and the relative proportions of theses amino acids Biuret, BCA, and Lowry Assays ..................... 3 differ between proteins. Furthermore, if nucleic Bradford Assay............................................... 3 acids are present in the sample, they would also Troubleshooting ............................................. 4 absorb light at 280 nm, further compromising FAQ’s .................................................................. 5 accuracy. Therefore, the sensitivity achieved Bibliography ...................................................... 5 without prior knowledge of the protein of interest’s Contact Us ......................................................... 6 absorbance maxima (λmax) and attenuation coefficient
    [Show full text]
  • Thermostable and Long-Circulating Albumin-Conjugated Arthrobacter Globiformis Urate Oxidase
    pharmaceutics Article Thermostable and Long-Circulating Albumin-Conjugated Arthrobacter globiformis Urate Oxidase Byungseop Yang and Inchan Kwon * School of Materials Science and Engineering, Gwangju Institute of Science and Technology (GIST), Gwangju 61005, Korea; [email protected] * Correspondence: [email protected]; Tel.: +82-62-715-2312 Abstract: Urate oxidase derived from Aspergillus flavus has been investigated as a treatment for tumor lysis syndrome, hyperuricemia, and gout. However, its long-term use is limited owing to potential immunogenicity, low thermostability, and short circulation time in vivo. Recently, urate oxidase isolated from Arthrobacter globiformis (AgUox) has been reported to be thermostable and less immunogenic than the Aspergillus-derived urate oxidase. Conjugation of human serum albumin (HSA) to therapeutic proteins has become a promising strategy to prolong circulation time in vivo. To develop a thermostable and long-circulating urate oxidase, we investigated the site-specific conjugation of HSA to AgUox based on site-specific incorporation of a clickable non-natural amino acid (frTet) and an inverse electron demand Diels–Alder reaction. We selected 14 sites for frTet incorporation using the ROSETTA design, a computational stability prediction program, among which AgUox containing frTet at position 196 (Ag12) exhibited enzymatic activity and thermostability comparable to those of wild-type AgUox. Furthermore, Ag12 exhibited a high HSA conjugation yield without compromising the enzymatic activity, generating well-defined HSA-conjugated AgUox (Ag12-HSA). In mice, the serum half-life of Ag12-HSA was approximately 29 h, which was roughly Citation: Yang, B.; Kwon, I. 17-fold longer than that of wild-type AgUox. Altogether, this novel formulated AgUox may hold Thermostable and Long-Circulating enhanced therapeutic efficacy for several diseases.
    [Show full text]
  • UDP-N-Acetylglucosamine Transporter and UDP-Galactose Transporter
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector FEBS Letters 586 (2012) 4082–4087 journal homepage: www.FEBSLetters.org UDP-N-acetylglucosamine transporter and UDP-galactose transporter form heterologous complexes in the Golgi membrane ⇑ Dorota Maszczak-Seneczko a, Paulina Sosicka a, Michał Majkowski b, Teresa Olczak a, Mariusz Olczak a, a Laboratory of Biochemistry, Faculty of Biotechnology, University of Wroclaw, Wroclaw, Poland b Laboratory of Cytobiochemistry, Faculty of Biotechnology, University of Wroclaw, Wroclaw, Poland article info abstract Article history: UDP-galactose transporter (UGT; SLC35A2) and UDP-N-acetylglucosamine transporter (NGT; Received 6 August 2012 SLC35A3) are evolutionarily related. We hypothesize that their role in glycosylation may be coupled Revised 2 October 2012 through heterologous complex formation. Coimmunoprecipitation analysis and FLIM–FRET mea- Accepted 8 October 2012 surements performed on living cells showed that NGT and UGT form complexes when overexpressed Available online 23 October 2012 in MDCK-RCAr cells. We also postulate that the interaction of NGT and UGT may explain the dual Edited by Judit Ovádi localization of UGT2. For the first time we demonstrated in vivo homodimerization of the NGT nucle- otide sugar transporter. In conclusion, we suggest that NGT and UGT function in glycosylation is combined via their mutual interaction. Keywords: UDP-N-acetylglucosamine transporter UDP-galactose transporter Structured summary
    [Show full text]
  • Step-By-Step Guide to Better Laboratory Management Practices
    Step-by-Step Guide to Better Laboratory Management Practices Prepared by The Washington State Department of Ecology Hazardous Waste and Toxics Reduction Program Publication No. 97- 431 Revised January 2003 Printed on recycled paper For additional copies of this document, contact: Department of Ecology Publications Distribution Center PO Box 47600 Olympia, WA 98504-7600 (360) 407-7472 or 1 (800) 633-7585 or contact your regional office: Department of Ecology’s Regional Offices (425) 649-7000 (509) 575-2490 (509) 329-3400 (360) 407-6300 The Department of Ecology is an equal opportunity agency and does not discriminate on the basis of race, creed, color, disability, age, religion, national origin, sex, marital status, disabled veteran’s status, Vietnam Era veteran’s status or sexual orientation. If you have special accommodation needs, or require this document in an alternate format, contact the Hazardous Waste and Toxics Reduction Program at (360)407-6700 (voice) or 711 or (800) 833-6388 (TTY). Table of Contents Introduction ....................................................................................................................................iii Section 1 Laboratory Hazardous Waste Management ...........................................................1 Designating Dangerous Waste................................................................................................1 Counting Wastes .......................................................................................................................8 Treatment by Generator...........................................................................................................12
    [Show full text]
  • Disclosing the Essentiality of Ribose-5-Phosphate Isomerase B In
    www.nature.com/scientificreports OPEN Disclosing the essentiality of ribose-5-phosphate isomerase B in Trypanosomatids Received: 04 January 2016 Joana Faria1,2, Inês Loureiro1,2, Nuno Santarém1,2, Pedro Cecílio1,2, Sandra Macedo-Ribeiro2,3, Accepted: 10 May 2016 Joana Tavares1,2,* & Anabela Cordeiro-da-Silva1,2,4,* Published: 27 May 2016 Ribose-5-phosphate isomerase (RPI) belongs to the non-oxidative branch of the pentose phosphate pathway, catalysing the inter-conversion of D-ribose-5-phosphate and D-ribulose-5-phosphate. Trypanosomatids encode a type B RPI, whereas humans have a structurally unrelated type A, making RPIB worthy of exploration as a potential drug target. Null mutant generation in Leishmania infantum was only possible when an episomal copy of RPIB gene was provided, and the latter was retained both in vitro and in vivo in the absence of drug pressure. This suggests the gene is essential for parasite survival. Importantly, the inability to remove the second allele of RPIB gene in sKO mutants complemented with an episomal copy of RPIB carrying a mutation that abolishes isomerase activity suggests the essentiality is due to its metabolic function. In vitro, sKO promastigotes exhibited no defect in growth, metacyclogenesis or macrophage infection, however, an impairment in intracellular amastigotes’ replication was observed. Additionally, mice infected with sKO mutants rescued by RPIB complementation had a reduced parasite burden in the liver. Likewise, Trypanosoma brucei is resistant to complete RPIB gene removal and mice infected with sKO mutants showed prolonged survival upon infection. Taken together our results genetically validate RPIB as a potential drug target in trypanosomatids.
    [Show full text]
  • Evaluation of Signaling Pathways Profiling in Human Dermal
    toxins Article Evaluation of Signaling Pathways Profiling in Human Dermal Endothelial Cells Treated by Snake Venom Cysteine-Rich Secretory Proteins (svCRiSPs) from North American Snakes Using Reverse Phase Protein Array (RPPA) Montamas Suntravat 1,2,* , Oscar Sanchez 1, Armando Reyes 1, Abcde Cirilo 1, Jack S. Ocheltree 1, Jacob A. Galan 1,2, Emelyn Salazar 1 , Peter Davies 3 and Elda E. Sanchez 1,2 1 National Natural Toxins Research Center (NNTRC), Texas A&M University-Kingsville, MSC 224, 975 West Avenue B, Kingsville, TX 78363, USA; [email protected] (O.S.); [email protected] (A.R.); [email protected] (A.C.); [email protected] (J.S.O.); [email protected] (J.A.G.); [email protected] (E.S.); [email protected] (E.E.S.) 2 Department of Chemistry, Texas A&M University-Kingsville, MSC 161, Kingsville, TX 78363, USA 3 Institute of Biosciences and Technology, Texas A&M University, Houston, TX 77843, USA; [email protected] * Correspondence: [email protected] Abstract: Cysteine-Rich Secretory Proteins (CRiSPs) are typically found in many snake venoms; however, the role that these toxins play in the pathophysiology of snakebites is still unclear. Herein, we compared the effects of snake venom CRiSPs (svCRiSPs) from the most medically important Citation: Suntravat, M.; Sanchez, O.; species of North American snakes on endothelial cell permeability and vascular permeability. We Reyes, A.; Cirilo, A.; Ocheltree, J.S.; used reverse phase protein array (RPPA) to identify key signaling molecules on human dermal Galan, J.A.; Salazar, E.; Davies, P.; lymphatic (HDLECs) and blood (HDBECs) endothelial cells treated with svCRiSPs.
    [Show full text]
  • Bio Safe Coomassie Stain Protocol
    Bio Safe Coomassie Stain Protocol Hexaplaric and gory Gil slaver so semplice that Bucky untuned his togues. Usufructuary Shannon sometimes satirized his stills malapropos and tithe so freakishly! Is Rufe irradiative when Glynn slenderizes point-device? Rinsing the three types of proprietary formulas of coomassie stain to get expert images and kit Electrolyte challenge in four formats and restricted use in aging epidermal cells in an additional buffers for any necessary are strict scenarios for signing up more. Bio Safe Coomassie Stain Bio-Rad Bioz Ratings For Life. Here I introduce a haven safe in less expensive method to tray and destain PAGE gels. These data and one of coomassie staining intensity gives you are usually provides three values. PRIDE Proteomics Identification Database EMBL-EBI. Cbb and immediately according to provide the twelve containing tryptophan providing a broad range unstained standards into wells with coomassie staining methods. Coomassie brilliant blue and northern blotting protocols that you in the reproductive capacity of damaged proteins and culture saccharomyces cerevisiae culture. The stain is about tenfold more sensitive than the regular Coomassie stain. Can i am getting confused with a modular template without affecting product is in the safe side of trap air bubbles in the choice of analysis. Repeat the PBS rinse, but may contain dark red or brown flecks. Incubate for those least 5- hours the gel can be in overnight in staining solution if. Ethidium bromide is a sensitive fluorescent stain for visualizing DNA or RNA in agarose and polyacrylamide gels. Flame the resolution than most coomassie based on agarose gel should be transparent sheets are checking for maximum sensitivity may not found.
    [Show full text]
  • Standard Dyes for Total Protein Staining in Gel-Based Proteomic Analysis
    Materials 2010, 3, 4784-4792; doi:10.3390/ma3104784 OPEN ACCESS materials ISSN 1996-1944 www.mdpi.com/journal/materials Review Standard Dyes for Total Protein Staining in Gel-Based Proteomic Analysis François Chevalier Proteomic Laboratory, iRCM, CEA, Fontenay aux Roses, France; E-Mail: [email protected]; Tel.: +33-146-548-326; Fax: +33-146-549-138. Received: 8 October 2010; in revised form: 13 October 2010 / Accepted: 15 October 2010 / Published: 20 October 2010 Abstract: Staining of two-dimensional gels is a primary concern in proteomic studies using two-dimensional gel electrophoresis with respect to the number of proteins analyzed, the accuracy of spot quantification and reproducibility. In this review article, the efficiency of the most widely used dyes was investigated. Visible dyes (Coomassie blue and silver nitrate), fluorescent dyes (Sypro Ruby, Deep Purple) and cyanine labeled methods were compared. Keywords: protein staining; fluorescent dyes; two-dimensional electrophoresis; proteomics 1. Introduction Protein separation by two-dimensional electrophoresis (2DE) is largely used in proteomic approaches because of both high resolution and the availability of powerful image analysis software for gel comparison and compatibility with subsequent protein characterization by mass spectrometry [1]. For these various aspects, the selection of the protein staining procedure is of major importance [2]. Based on two independent biochemical characteristics of proteins, 2DE combines isoelectric focusing, which separates proteins according to their isoelectric point, and SDS-PAGE, which separates them further according to their molecular mass (Figure 1, step 2). The next typical steps of the flow of gel-based proteomics are spots visualization and evaluation (Figure 1, step 3), expression analysis, and finally protein identification by mass spectrometry (Figure 1, step 4).
    [Show full text]
  • 2-Methoxycinnamaldehyde Inhibits the TNF-Α-Induced Proliferation and Migration of Human Aortic Smooth Muscle Cells
    INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE 39: 191-198, 2017 2-Methoxycinnamaldehyde inhibits the TNF-α-induced proliferation and migration of human aortic smooth muscle cells YOUNG-HEE JIN and SOO-A KIM Department of Biochemistry, Dongguk University College of Oriental Medicine, Gyeongju 780-714, Republic of Korea Received March 23, 2016; Accepted November 24, 2016 DOI: 10.3892/ijmm.2016.2818 Abstract. The abnormal proliferation and migration of vascular Introduction smooth muscle cells (VSMCs) is a crucial event in the develop- ment of atherosclerosis, and tumor necrosis factor-α (TNF-α) is The abnormal proliferation and migration of vascular smooth actively involved in this process by enhancing the proliferation muscle cells (VSMCs) are major events in the development and and migration of VSMCs. 2-Methoxycinnamaldehyde (MCA) progression of atherosclerosis. During the early stages of athero- is a natural compound of Cinnamomum cassia. Although sclerosis, VSMCs migrate from the tunica media into the tunica 2-hydroxycinnamaldehyde (HCA), another compound from intima of the arterial wall, and this, along with proliferation, Cinnamomum cassia, has been widely studied with regard to its cause intimal thickening and narrowing of the arterial space (1). antitumor activity, MCA has not attracted researchers' interest Atherogenic lesions are characterized by the accumula- due to its mild toxic effects on cancer cells and its mecha- tion of inflammatory cells and released cytokines (2). Tumor nisms of action remain unknown. In this study, we examined necrosis factor-α (TNF-α) is a major inflammatory cytokine the effects of MCA on the TNF-α-induced proliferation and that plays an important role in the initiation and development of migration of human aortic smooth muscle cells (HASMCs).
    [Show full text]
  • Fingerprint Enhancement Revisited and the Effects Of
    Chantal J. Frégeau,1 Ph.D.; Olivier Germain,2 B.S.; and Ron M. Fourney,1 Ph.D. Fingerprint Enhancement Revisited and the Effects of Blood Enhancement Chemicals on Subsequent Profiler Plus™ Fluorescent Short Tandem Repeat DNA Analysis of Fresh and Aged Bloody Fingerprints REFERENCE: Frégeau CJ, Germain O, Fourney RM. Fingerprint lected (i.e., Crowle’s Double Stain and Hungarian Red) slightly re- enhancement revisited and the effects of blood enhancement chem- duced the amplification efficiency of the longer STR loci in profiles icals on subsequent Profiler Plus™ fluorescent short tandem repeat of fresh and 7 to 14-day-old bloodprints. This suggests that long- DNA analysis of fresh and aged bloody fingerprints. J Forensic Sci term exposure to these chemicals possibly affects the integrity of the 2000;45(2):354–380. DNA molecules. This study indicates that significant evidence can be obtained from fresh or aged bloody fingerprints applied to a va- ABSTRACT: This study was aimed at determining the effect of riety of absorbent and nonabsorbent surfaces which are exposed to seven blood enhancement reagents on the subsequent Profiler different enhancement chemicals for short or long periods of time. Plus™ fluorescent STR DNA analysis of fresh or aged bloody fin- It also reaffirms that PCR STR DNA typing procedures are robust gerprints deposited on various porous and nonporous surfaces. and provide excellent results when used in concert with fluores- Amido Black, Crowle’s Double Stain, 1,8-diazafluoren-9-one cence-based detection assays after fingerprint identification has (DFO), Hungarian Red, leucomalachite green, luminol and ninhy- taken place.
    [Show full text]
  • Very Low Density Lipoprotein in Patients with Gout
    Ann Rheum Dis: first published as 10.1136/ard.44.6.390 on 1 June 1985. Downloaded from Annals of the Rheumatic Diseases, 1985, 44, 390-394 Demonstration of an abnormality of C apoprotein of very low density lipoprotein in patients with gout D G MACFARLANE, C A MIDWINTER, P A DIEPPE, C H BOLTON, AND M HARTOG From the University Department of Medicine, Bristol Royal Infirmary, Marlborough Street, Bristol BS2 8HU, Avon SUMMARY The very low density (VLDL) apolipoproteins of 12 male patients with gout have been studied by analytical isoelectric focusing. The relative percentage distribution of the C apolipoproteins was calculated and compared with that from 12 normolipidaemic and 12 'lipid-matched' controls. In the gout patients apolipoprotein CII (apo CII) represented 19-6% of the VLDL C proteins and the CII/CIII2 ratio was 0-57. In the normolipidaemic controls apo CII represented 28*8% and in the lipid-matched controls 33*1% of VLDL apo C, and the CII/C0112 ratio approached one in each control group. These differences were significant. This suggests that a reduction in VLDL apo CII may predispose to the hypertriglyceridaemia that is commonly found in patients with gout. copyright. Key words: gout, hyperlipidaemia, apolipoprotein CII. Many studies have shown a high incidence of had been approved by the local ethical committee. hyperlipidaemia in patients with gout, commonly All their drug treatment was stopped for a period of hypertnxglyceridaemia due to raised endogenous six weeks, and they were also requested to reduce http://ard.bmj.com/ VLDL. -3 As well as lipid, VLDL particles contain their alcohol intake as much as possible and avoid B, C, and E apoproteins, and recent discoveries self medication.
    [Show full text]
  • Dietary Apigenin and Naringenin Protect Against Colon
    DIETARY APIGENIN AND NARINGENIN PROTECT AGAINST COLON CARCINOGENESIS BY LOWERING HIGH MULTIPLICITY ABERRANT CRYPT FOCI AND ENHANCING APOPTOSIS IN AZOXYMETHANE-TREATED RATS A Thesis by TETY LEONARDI Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE May 2005 Major Subject: Nutrition DIETARY APIGENIN AND NARINGENIN PROTECT AGAINST COLON CARCINOGENESIS BY LOWERING HIGH MULTIPLICITY ABERRANT CRYPT FOCI AND ENHANCING APOPTOSIS IN AZOXYMETHANE-TREATED RATS A Thesis by TETY LEONARDI Submitted to Texas A&M University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE Approved as to style and content by: Nancy D. Turner Joanne R. Lupton (Co-Chair of Committee) (Co-Chair of Committee) Robert S. Chapkin Naisyin Wang (Member) (Member) Nancy D. Turner Gary R. Acuff (Chair of Faculty of Nutrition) (Head of Department) May 2005 Major Subject: Nutrition iii ABSTRACT Dietary Apigenin and Naringenin Protect Against Colon Carcinogenesis by Lowering High Multiplicity Aberrant Crypt Foci and Enhancing Apoptosis in Azoxymethane-Treated Rats. (May 2005) Tety Leonardi, B.S., Texas A&M University Co-Chairs of Advisory Committee: Dr. Nancy D. Turner Dr. Joanne R. Lupton Colon cancer is the third most common cancer in the United States. However, evidence indicates that a proper diet abundant in fruits and vegetables may be protective against colon cancer development. Bioactive compounds in fruits and vegetables, such as flavonoids and limonoids, have been shown to possess anti-proliferative and anti- tumorigenic effects in various in vitro and in vivo models of cancer.
    [Show full text]