TRANSCRIPTION FACTORS of the NFAT FAMILY: Regulation and Function

P1: MBL/plb P2: MBL/rsk QC: MBL/uks T1: MBL February 12, 1997 16:24 Annual Reviews AR026-27 AR26-27

TRANSCRIPTION FACTORS OF THE NFAT FAMILY: Regulation and Function

Anjana Rao∗, Chun Luo∗, and Patrick G. Hogan Center for Blood Research and the ∗Department of Pathology, Harvard Medical School, 200 Longwood Avenue, Boston, Massachusetts 02115; email: [email protected]

KEY WORDS: nuclear factor of activated T cells, immunosuppression, cytokine gene regulation, inducible gene transcription, signal transduction, lymphocyte activation, calcineurin

ABSTRACT As targets for the immunosuppressive drugs cyclosporin A and FK506, transcription factors of the NFAT (nuclear factor of activated T cells) family have been the focus of much attention. NFAT proteins, which are expressed in most immune- system cells, play a pivotal role in the transcription of cytokine genes and other genes critical for the immune response. The activity of NFAT proteins is tightly regulated by the calcium/calmodulin-dependent phosphatase calcineurin, a primary target for inhibition by cyclosporin A and FK506. Calcineurin controls the translocation of NFAT proteins from the cytoplasm to the nucleus of activated cells by interacting with an N-terminal regulatory domain conserved in the NFAT family. The DNA-binding domains of NFAT proteins resemble those of Rel- family proteins, and Rel and NFAT proteins show some overlap in their ability to bind to certain regulatory elements in cytokine genes. NFAT is also notable for its ability to bind cooperatively with transcription factors of the AP-1 (Fos/Jun) family to composite NFAT:AP-1 sites, found in the regulatory regions of many genes that are inducibly transcribed by immune-system cells. This review dis-

Annu. Rev. Immunol. 1997.15:707-747. Downloaded from www.annualreviews.org cusses recent data on the diversity of the NFAT family of transcription factors, the regulation of NFAT proteins within cells, and the cooperation of NFAT proteins Access provided by University of Wisconsin - Milwaukee on 12/04/17. For personal use only. with other transcription factors to regulate the expression of inducible genes.

INTRODUCTION Proteins belonging to the NFAT (nuclear factor of activated T cells) family of transcription factors play a central role in inducible gene transcription during the immune response (1–4). Despite their name, NFAT proteins are expressed 707 0732-0582/97/0410-0707$08.00

P1: MBL/plb P2: MBL/rsk QC: MBL/uks T1: MBL February 12, 1997 16:24 Annual Reviews AR026-27 AR26-27

708 RAO, LUO & HOGAN

Table 1 Stimuli that elicit NFAT activation

Receptor/Function Stimulus/Drug Cell type tested References

A. Immunoreceptors T cell receptor (TCR) Ag/MHC, αCD3 T cells (1–4, 52) B cell receptor αIg B cells (177–179) CD40 CD40L plus IL-4 B cells (178) FcεRI Ag/IgE Mast cells, basophils (173, 180, 181) Fcγ RIIIA (CD16) Ag/IgG, αCD16 NK cells (44) G protein-coupled receptors m3 Muscarinic Carbachol Stably transfected Jurkat T (66, 86, 182) acetylcholine receptor cells and PC12 pheochromocytoma cells H1 histamine receptor Histamine Endothelial cells (human J. Carew & A. Rao, Thrombin receptor Thrombin umbilical vein) unpublished Pharmacological agents Calcium ionophore Ionomycin, T cells, B cells, mast cells, (1–4, 9, 22, 44, 50, A23187 macrophages, NK cells, 52, 173, 177–181) and endothelial cells, PC12 J. Kim & P. G. Hogan, cells unpublished Inhibitor of endoplasmic Thapsigargin T cells (71) 2 reticulum Ca +-ATPase

not only in T cells, but also in other classes of immune-system cells. NFAT proteins are activated by stimulation of receptors coupled to calcium mobilization, such as the antigen receptors on T and B cells, the Fc receptors on mast cells and basophils, the Fcγ receptors on macrophages and NK cells, and receptors coupled to certain heterotrimeric G proteins (see Table 1). Receptor stimulation and calcium mobilization result in activation of many intracellular enzymes including the calcium- and calmodulin-dependent phosphatase calcineurin, a major upstream regulator of NFAT proteins (5, 6). Stimulated cells inducibly transcribe a large array of activation-associated genes, many of which are potential targets for NFAT; the genes encode transcription factors, signaling

Annu. Rev. Immunol. 1997.15:707-747. Downloaded from www.annualreviews.org proteins, cytokines, cell surface receptors, and other effector proteins (7–10). As substrates for calcineurin, NFAT proteins are major targets of the im- Access provided by University of Wisconsin - Milwaukee on 12/04/17. For personal use only. munosuppressive drugs cyclosporin A (CsA) and FK506 that have revolution- ized transplant surgery since the introduction of CsA in 1983 (11, 12). The toxicity of these drugs, which arises from their ability to inhibit calcineurin in cells outside the immune system (13, 14), has precluded their use in other clinical situations for which immunosuppressive therapies might be warranted (such as allergy, inﬂammation, and autoimmune disease). Compounds that target NFAT directly, without affecting the phosphatase activity of calcineurin,

P1: MBL/plb P2: MBL/rsk QC: MBL/uks T1: MBL February 12, 1997 16:24 Annual Reviews AR026-27 AR26-27

NFAT FAMILY TRANSCRIPTION FACTORS 709

may lack the toxicity of CsA and FK506 while retaining their broad immunosuppressive effects. Conceivably, more selective immunomodulatory effects might be achieved by ablating the functions of individual NFAT proteins in speciﬁc cell types or on selected inducible genes. This review describes recent advances in our understanding of the structure, regulation, and function of NFAT proteins. Because of space limitations, we do not discuss the potential involvement of NFAT proteins in many biological phe- nomena, including apoptosis, thymocyte development, and immunodeﬁciency diseases. For an introduction to earlier work on NFAT and calcineurin, we refer the reader to several excellent reviews (1–7, 11, 15–19).

STRUCTURE AND DISTRIBUTION OF NFAT PROTEINS Isolation and Nomenclature NFAT was first identified in T cells as a rapidly inducible nuclear factor binding to the distal antigen receptor response element, ARRE-2, of the human IL-2 promoter (20). The induction of NFAT in T cells required calcium-activated signaling pathways and was blocked by CsA and FK506 (21). The NFAT complex that formed on this site contained a cytoplasmic component that was expressed in resting T cells but not in fibroblasts, and a nuclear component that was expressed in both T cells and fibroblasts upon stimulation with phorbol esters (22). The nuclear component was identified as the ubiquitous transcription factor AP-1, which consists of dimers of Fos- and Jun-family proteins (reviewed in 1). The cytoplasmic component (also termed preexisting, from its presence in resting cells) was purified based on its ability to bind independently, in the absence of AP-1 proteins, to the distal NFAT site of the murine IL-2 promoter (23–25) and as an NFAT:AP-1 complex to the CLE0 element of the human GM-CSF promoter (26). It appears in the nucleus as a result of calcium mobilization and calcineurin activation (22, 27) and migrates on SDS gels with an apparent molecular weight of 120–140 kDa (23, 26, 28, 29). Over the next few years, studies from several laboratories indicated that the preexisting/cytoplasmic component of NFAT was a mixture of proteins

Annu. Rev. Immunol. 1997.15:707-747. Downloaded from www.annualreviews.org belonging to a novel family of transcription factors [reviewed in (2–4); see Figure 1 and Table 2]. The first member of the family (NFATp, later renamed Access provided by University of Wisconsin - Milwaukee on 12/04/17. For personal use only. NFAT1) was purified from cytoplasmic extracts of a murine T cell clone by affinity chromatography using the distal NFAT site of the murine IL-2 promoter (23, 24) and cloned from murine (Ar-5) and human (Jurkat) T cell cDNA libraries (24, 30). A distinct protein belonging to the same family, NFATc, was purified similarly from bovine thymus, and cDNA encoding it was isolated from a Jurkat T cell cDNA library (25). cDNA clones encoding two other NFATproteins, NFAT3 and NFAT4, were isolated from Jurkat T cell and human

P1: MBL/plb P2: MBL/rsk QC: MBL/uks T1: MBL February 12, 1997 16:24 Annual Reviews AR026-27 AR26-27

710 RAO, LUO & HOGAN Annu. Rev. Immunol. 1997.15:707-747. Downloaded from www.annualreviews.org Access provided by University of Wisconsin - Milwaukee on 12/04/17. For personal use only.

P1: MBL/plb P2: MBL/rsk QC: MBL/uks T1: MBL February 12, 1997 16:24 Annual Reviews AR026-27 AR26-27

NFAT FAMILY TRANSCRIPTION FACTORS 711

Table 2 Proposed nomenclature for NFAT family proteins and chromosomal location of the genes

Nomenclature Chromosomal location Proposed Current Human Mouse

NFAT1 20q13.1-13.31 2a (183, 184) NFAT1a NFATp (24), NFATc2 (183), NFAT1A (30) (183, 184) NFAT1b NFAT1b (30) NFAT1c NFAT1c (30) NFAT2 18q23-qterb 18E4 (183) NFAT2a NFATc (25), NFATc1 (183), NFATc.α (34) (183) NFAT2b NFATc.β (34) NFAT3 NFAT3 NFAT3 (31) NFAT4 16q21-22 (32) 8D (33) NFAT4x NFATx (32), NFATc3 (33) NFAT4a, b, c NFAT4a, b, c (31)

aThe Nfat1 locus maps between Ada and Gnas (expressed as genetic distance in centiMorgans): centromere- Ada-3.1-(Nfat1, Cebpb)-4.8-Gnas (184). bThe human NFAT2 gene is closely linked to STS marker D18S497 (183).

peripheral blood lymphocyte (PBL) cDNA libraries by cross-hybridization to an NFAT1 probe (31). cDNA clones encoding the NFATx isoform of NFAT4 were isolated from Jurkat T cell and murine thymus cDNA libraries (32, 33). Most recently, cDNA encoding a variant of NFATc, NFATc.β, was isolated from a Raji B cell library (34). A unifying nomenclature for NFAT proteins is proposed in Figure 1 and Table 2, which also lists the chromosomal location of the NFAT genes. The present complicated nomenclature arises largely from the isolation, in different

←−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−− Figure 1 Schematic alignment of NFAT proteins predicted from their cDNAs. For nomenclature, see Table 2. The region of highest homology within NFAT proteins is the DNA-binding domain (DBD), which shows similarity to the Rel homology region of Rel-family transcription factors. A second region of homology is the NFAT homology region (NHR), which binds to Annu. Rev. Immunol. 1997.15:707-747. Downloaded from www.annualreviews.org calcineurin (Cn) and is found only in NFAT family proteins. The N- and C-terminal transacti-

Access provided by University of Wisconsin - Milwaukee on 12/04/17. For personal use only. vation domains (TADs) are indicated. The acidic/hydrophobic motifs in the N-terminal TADs are schematized as a dot. The C-terminal LDQTYLDDVNEIIRKEFS motif, where present, is indicated as a thick bar. For protein isoforms, identical shading patterns represent identical sequences. The boundary of each region is labeled above the sequences with numbering referring to position in the human protein. The lengths indicated are also for the human proteins, except for NFAT1a, which was cloned from mouse. The GenBank accession numbers for these sequences are U02079 (murine NFAT1a), U43341 (NFAT1b), U43342 (NFAT1c), U08015 (NFATc.α), U59736 (NFATc.β), L41066 (NFAT3), U14510 (NFATx), L41067 (NFAT4c), U28807 (NFATc3, the murine homolog of NFATx).

P1: MBL/plb P2: MBL/rsk QC: MBL/uks T1: MBL February 12, 1997 16:24 Annual Reviews AR026-27 AR26-27

712 RAO, LUO & HOGAN

laboratories, of multiple isoforms and species variants of the same protein; and from the fact that the names NFATp (preexisting) and NFATc (cytoplasmic), which were originally used to describe NFAT DNA binding activity, were car- ried over to the recombinant proteins. Because it is conceivable that some members of the NFAT family will be neither preexisting nor cytoplasmic in certain cell types, we suggest the simpliﬁed nomenclature used by Hoey et al (31) (NFAT1, NFAT2, NFAT3, NFAT4), which follows that employed for other transcription factors such as those belonging to the STAT and GATA families (35, 36). For simplicity, the proposed nomenclature in Figure 1 and Table 2 is used in the remainder of this review. As we discuss in a later section, DNA- protein complexes containing NFAT proteins come in many forms, and thus we use NFAT as a general abbreviation for NFAT-family proteins, as well as occasionally in its original sense to refer to transcriptionally competent, NFAT- containing complexes such as NFAT:AP-1. Sequence Homologies, Functional Domains The predicted primary structures of the four NFATproteins are shown schemati- cally in Figure 1. Multiple isoforms, most likely derived by alternative splicing, have been described for NFAT1, NFAT2, and NFAT4. Two major regions of sequence homology, comprising the DNA-binding domain (DBD) (37) and the NFAT homology region (NHR) (30), are represented in all the isoforms. The DNA-binding domain, which lies between amino acid residues 400 and 700 in the known isoforms, is highly conserved within the NFAT family≈ and shows≈ moderate sequence similarity to the DNA-binding domains of Rel-family proteins (37–39). The NFAT homology region of 300 amino acids, which is located just N-terminal to the DNA-binding domain,≈ shows a lesser degree of pairwise sequence identity but strong conservation of several sequence motifs characteristic of the NFAT family (30, 32, 33). The region of NFAT homology deﬁnes a calcineurin-activated regulatory domain that binds calcineurin, is dephosphorylated when calcineurin is activated, and controls the calcineurin- regulated nuclear translocation of NFAT1 (40). The properties of these two domains are described in more detail in later sections.

Annu. Rev. Immunol. 1997.15:707-747. Downloaded from www.annualreviews.org The regions of NFAT proteins located outside the DNA-binding and regulatory domains show relatively little sequence conservation. The 100 amino Access provided by University of Wisconsin - Milwaukee on 12/04/17. For personal use only. acid region at the very N-terminus of each protein, which behaves≈ as a strong transactivation domain (TAD) in NFAT1 (41), is not conserved in sequence. The most obvious instance of sequence conservation in the region C-terminal to the DBD is in a region spanning the C-terminal splice site, where NFAT3 and NFAT4x contain a sequence highly homologous to the NFAT1c sequence LDQTYLDDVNEIIRKEFS (Figure 1). A detailed discussion of the transactivation domains of NFAT proteins is deferred to a later section.

P1: MBL/plb P2: MBL/rsk QC: MBL/uks T1: MBL February 12, 1997 16:24 Annual Reviews AR026-27 AR26-27

NFAT FAMILY TRANSCRIPTION FACTORS 713

Tissue Distribution, Potential Target Genes The transcript sizes and reported sites of expression of NFAT mRNAs are listed in Table 3. Only in the case of NFAT2a and NFAT2b have distinct transcripts been correlated with protein isoforms (34). The mRNA expression data should be interpreted with some caution: There are signiﬁcant differences in the expression patterns of NFAT mRNAs reported by different laboratories (Table 3) that may reﬂect variable contamination with circulating lymphocytes or resi- dent mast cells. Moreover, analysis of NFAT1 indicates that protein and mRNA

Table 3 Tissue distributions of NFAT family members

Tissue distribution Member mRNA size mRNA protein

NFAT1 8 kb (h, m) Thymus, spleen, heart, testis, Thymus, spleen, T cells, B cells, NK ∼ brainr (25) cells, mast cells, monocytes, PBL, placenta, muscle, spleen, macrophages, olfactory epithelium, thymus, pancreasn (31) olfactory bulb, and endothelial cells spleen, leukocyte, placentan (32) w,e,i (9, 42–45, 180) B cells, mast cells, T cellsp not present in cardiac or (173, 177) skeletal muscle, small intestine, liver, kidney, fat tissue, ﬁbroblasts, neutrophilsw (42, 43) NFAT2a 2.7 kb (h) PBL, testis, thymus, spleen, small T cells, mast cellse (141, 180) (NFATc.α) intestine, prostate, colonn (34), protein not detected in NK cellse (44) NK cellsn (44) expression in other cells and tissues spleen, thymus, skin tumorr (25) not determined muscle, thymus, spleen, PBL, testisn (31) muscle, thymus, leukocyte; low in othersn (32) NFAT2b 4.5 kb (h) spleen, testis, ovary, small intestine, (NFATc.β) thymus, prostate, colon, PBLn (34) Muscle, leukocyte, thymus, spleen, testis, ovary, colonn (32)

Annu. Rev. Immunol. 1997.15:707-747. Downloaded from www.annualreviews.org muscle; low in thymus, spleen, testis, PBLn (31)

Access provided by University of Wisconsin - Milwaukee on 12/04/17. For personal use only. NFAT3 3 kb (h) Placenta, lung, kidney, testis, ovary, Not determined 4.5 kb (h) heart, colon; 4.7 kb (h) low in brain, spleen, thymus, PBLn (31) NFAT4 7.0 kb (h) Thymus, leukocyte, low in othersn (32) Not determined thymus, spleen, LNr (33) muscle, thymus, kidneyn (31) Abbreviations: h, human; m, mouse; w, protein detected by Western blotting with speciﬁc antibodies; e, protein detected by speciﬁc antibody supershift in EMSA; i, protein detected by immune staining; r, mRNA detected by ribonuclease protection assays; n, mRNA detected by Northern blotting; p, mRNA detected by RT-PCR.

P1: MBL/plb P2: MBL/rsk QC: MBL/uks T1: MBL February 12, 1997 16:24 Annual Reviews AR026-27 AR26-27

714 RAO, LUO & HOGAN

Table 4 Involvement of calcineurin and NFAT proteins in expression of selected inducible genes

Effects of CsA or NFAT Cell type testeda FK506b implicatedc References

A. Cytokines IL-1β macrophages (bacteria) partial inhibition n.t. (185) mast cells (FcεRI) partial inhibition n.t. (186) IL-2 T cells inhibition yes (2–4, 112, 187) IL-3 T cells inhibition yesd (187, 188) eosinophils, neutrophils inhibition n.t. (189) IL-4 T cells inhibition yes (152, 180, 190) mast cells inhibition yes and references therein IL-5 T cells inhibition n.t. (191) T cells (Ag/APC) partial inhibition n.t. (188) T cells (ConA/αTCR) no inhibition n.t. (192) T cells (PMA/dbcAMP) inhibition yes (193, 194) mast cells (Ag/IgE) inhibition yes (173, 195) IL-6 mast cells (FcεRI) inhibition n.t. (186, 196) IL-8 T cells inhibition yese (155) IL-10 T cell (Ag/APC) partial inhibition n.t. (188) spleen cells partial inhibitionf n.t. (197) IL-13 T cells inhibition yes (198) T cells (αCD28/PMA αCD3) stimulation n.t. (199) ± GM-CSF T cells inhibition yesg (58, 59, 141, 187, 200–202) endothelial cells partial inhibition yes (9) NK cells (Ag/IgG) inhibition yes (44) eosinophils, neutrophils inhibition n.t. (189) IFN-γ T cells inhibition yes (203–206) TGF-β T cells stimulation n.t. (207, 208) TNF-α T cells inhibition yes (57, 136, 153, 187) B cells inhibition yes (57, 137) macrophages (bacteria) partial inhibition n.t. (185) mast cells (Ag/IgE) inhibition n.t. (186, 196) NK cells (Ag/IgG) inhibition yes (44) B. Surface Receptors Annu. Rev. Immunol. 1997.15:707-747. Downloaded from www.annualreviews.org CD40L T cells inhibition yes (150, 151, 209) h

Access provided by University of Wisconsin - Milwaukee on 12/04/17. For personal use only. IL-2Rα T cells inhibition n.t. (210) (CD25) CD69 T cells partial inhibition n.t. (211) CTLA-4 spleen cellsi n.t. altered in (73, 176) NFAT1 / mice − − FasL spleen cellsi n.t. decreased in (176) NFAT1 / mice − − T cell hybridoma inhibition n.t. (212) (Continued)

P1: MBL/plb P2: MBL/rsk QC: MBL/uks T1: MBL February 12, 1997 16:24 Annual Reviews AR026-27 AR26-27

NFAT FAMILY TRANSCRIPTION FACTORS 715

Table 4 Continued

Effects of CsA or NFAT Cell type testeda FK506b implicatedc References

C. Transcription Factors NF-κB1 T cells inhibition n.t. (8, 210) c-Rel T cells inhibitionj n.t. (213) Oct-2 T cells inhibition n.t. (214) NFATc T cells inhibition n.t. (25) Nur77 T cells inhibitionk n.t.l (215, 216) aUnless otherwise specified (in parentheses), T cells were stimulated with αCD3, ConA, or ionomycin, alone or in combination with phorbol ester PMA, and other cells were stimulated with PMA plus ionomycin. bThe effect of CsA or FK506 on the induction of protein, mRNA, or promoter/enhancer activity was assessed. cn.t., not tested. yes, at least one of the criteria is met experimentally: (i) identification of NFAT-binding sites in the promoter/enhancer, (ii) mutation of the sites diminishes reporter expression driven by the promoter/enhancer, (iii) multimers of the sites confer CsA/FK506-sensitive induction on a linked reporter gene, (iv) overexpression of NFAT proteins enhances reporter activity. dA T cell-specific enhancer has recently been identified 14 kb upstream of the IL-3 gene. Like the GM-CSF enhancer, the IL-3 enhancer contains three NFAT binding sites that function as enhancer elements (P Cockerill, personal communication). eS. Okamoto & K. Matsushima, personal communication. fCsA inhibited in vivo induction of mRNA in spleen cells and serum IL-10 levels by anti-CD3. gThe NFAT binding site (CLE0) in the GM-CSF promoter also binds the Ets protein, Elf-1 (217). hCsA inhibited the induction of NF-κB1 mRNA. imRNA induction was assessed in spleen cells from mice injected with anti-CD3 antibody. jCsA inhibits c-Rel mRNA induction as well as the nuclear translocation of c-Rel protein. kCsA inhibits the DNA binding activity of Nur77 as well as Nur77 promoter-driven reporter gene expression. lA distinct nuclear factor, belonging to the RSRF/MEF2 family, has been implicated.

expression do not always correlate: Although NFAT1 mRNA has been variably detected in brain, heart, and skeletal muscle, NFAT1 protein expression has not been detected in bulk extracts of these tissues (42, 43). Consistent ﬁndings are that NFAT1 and NFAT2 mRNAs are expressed in peripheral lymphoid tissue (spleen, PBL), and that NFAT4 mRNA is expressed at high levels in the thymus, suggesting a role in T cell development. NFAT3 mRNA is expressed at low levels in lymphoid tissues (31), and thus this protein may be preferentially expressed outside the immune system. NFAT2 mRNA is upregulated in activated T cells and NK cells via a CsA-sensitive mechanism that may involve an NFAT-regulated positive feedback loop (25, 32, 44).

Annu. Rev. Immunol. 1997.15:707-747. Downloaded from www.annualreviews.org At the protein level, NFAT2 and the major NFAT1 isoforms NFAT1b and NFAT1c are expressed in peripheral T cells and T cell lines (Table 3), but their Access provided by University of Wisconsin - Milwaukee on 12/04/17. For personal use only. relative expression may vary in different cell lines or T cell subsets. NFAT1 is also expressed in other classes of immune-system cells (B cells, mast cells, NK cells, some monocytes and macrophages), consistent with NFAT activation and CsA-sensitive gene expression in these cells (Table 1). Additionally, NFAT1 is expressed in olfactory epithelium (45) and in some endothelial cell lines (9, 42). Some potential target genes for NFAT proteins are listed in Table 4. NFAT involvement is reasonably well established for the IL-2, IL-4, GM-CSF, and

P1: MBL/plb P2: MBL/rsk QC: MBL/uks T1: MBL February 12, 1997 16:24 Annual Reviews AR026-27 AR26-27

716 RAO, LUO & HOGAN

TNF-α cytokine genes in T cells. There is good but less extensive evidence for NFAT regulation of the IL-3, IL-5, IL-8, interferon-γ (IFN-γ ) and CD40L genes in T cells, the TNF-α gene in B cells, and the IL-4 and IL-5 genes in mast cells. In many of the other examples listed in Table 4, inducible gene expression is inhibited by CsA and FK506, suggesting but by no means proving the participation of calcineurin and NFAT. High concentrations of these im- munosuppressants are known to affect cell metabolism by interfering with the chaperone (peptidyl prolyl isomerase) functions of their immunophilin receptor (46). Further, calcineurin is known to modulate the functions of transcription factors other than NFAT (reviewed in 3). A recent example relates to the CsA- sensitive induction of Nur77 mRNA in activated T cells, which is thought to be mediated by RSRF (MEF2), a nuclear factor distinct from NFAT (47).

REGULATION OF NFAT ACTIVATION Early Stages of NFAT Activation: Role of Calcineurin The early activation of NFAT proteins has been investigated for NFAT1 (43, 48–52), recombinant NFAT2 (25), and recombinant NFAT4 (33, 53). Three different steps of activation have been defined: dephosphorylation, nuclear translocation, and increase in affinity for DNA (Figure 2). The consensus from these studies is that, in resting cells, NFAT proteins are phosphorylated, reside in the cytoplasm, and show low affinity for DNA. Stimuli that elicit calcium mobilization (see Table 1) result in the rapid dephosphorylation of NFAT proteins and their translocation to the nucleus; the dephosphorylated proteins show increased affinity for DNA. Each step of activation is blocked

−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−→ Figure 2 A model for activation of NFAT proteins. (1) NFAT interacts with calcineurin (CnA and CnB) and is retained in the cytoplasm by a complex of other proteins (shaded) in resting T cells. Without calcium and calmodulin (CaM), the autoinhibitory domain of CnA blocks the catalytic active site of CnA and calcineurin is inactive. The identiﬁed functional regions of NFATare

Annu. Rev. Immunol. 1997.15:707-747. Downloaded from www.annualreviews.org denoted TADn for N-terminal transactivation domain, NLS for nuclear localization sequence, DBD for DNA-binding domain, and TADc for C-terminal transactivation domain. In the resting state,

Access provided by University of Wisconsin - Milwaukee on 12/04/17. For personal use only. phosphorylation of NFAT proteins masks the NLS and the residues in the DBD that will contact 2 DNA. (2) The binding of calmodulin triggered by increase of intracellular calcium ([Ca +]i) leads to a conformational change in calcineurin that moves the autoinhibitory domain of calcineurin away from the catalytic active site. Activated calcineurin dephosphorylates NFAT. (3) Dephosphorylation causes a conformational change in NFATproteins, which exposes the NLS and the residues that will contact DNA, resulting in nuclear import and increase in DNA binding activity. (4) Withdrawal of calcium or inhibition of calcineurin leads to rephosphorylation of NFAT proteins by unidentiﬁed kinase(s). The rephosphorylated NFAT proteins return to the original state in the cytoplasm. See text for details.

P1: MBL/plb P2: MBL/rsk QC: MBL/uks T1: MBL February 12, 1997 16:24 Annual Reviews AR026-27 AR26-27

NFAT FAMILY TRANSCRIPTION FACTORS 717 Annu. Rev. Immunol. 1997.15:707-747. Downloaded from www.annualreviews.org Access provided by University of Wisconsin - Milwaukee on 12/04/17. For personal use only.

P1: MBL/plb P2: MBL/rsk QC: MBL/uks T1: MBL February 12, 1997 16:24 Annual Reviews AR026-27 AR26-27

718 RAO, LUO & HOGAN

by CsA or FK506, implying that calcineurin is involved, and suggesting that dephosphorylation is the initial step of activation. It should be noted that 2 cytokine and LPS receptors, which are not linked to Ca + mobilization, are not expected to activate calcineurin or NFAT. The activation of NFAT proteins follows precisely the activation of cal- 2 cineurin. In T cells, if intracellular free calcium levels ([Ca +]i) remain el- evated, calcineurin activity remains high, and NFAT1 remains activated and nuclear for many hours (43, 51, 52). Conversely if calcineurin activity is inhibited by removal of the calcium-mobilizing stimulus, or by addition of the calcineurin inhibitors CsA and FK506 to stimulated T cells, NFAT1 re- verts to its original phosphorylated state within 5–15 min, returns to the cytoplasm, and again shows a low affinity for DNA (43, 51, 52). Similar results have been obtained for recombinant NFAT4 expressed in fibroblasts (53). The dephosphorylation/rephosphorylation and nuclear import/export cycle can be repeated many times by removal and readdition of ionomycin (51, 53), indicating that the activation of NFAT1 and NFAT4 is regulated by a dynamic interplay between calcineurin and constitutively active kinases. In an analo- gous physiological situation, nuclear NFAT1 returns slowly to the cytoplasm in antigen-stimulated cells as a result of feedback mechanisms that cause a de- cline in capacitative calcium entry and the eventual repletion of calcium stores (52). Overexpression of mutant calcineurins has pronounced effects on NFAT function. Constitutively active calcineurin substituted partially for the calcium requirement for NFAT-dependent gene expression (54–60). Conversely, an inactive calcineurin, mutated in an essential active site histidine, inhibited the movement of recombinant NFAT4 from the cytoplasm to the nucleus of stimulated fibroblasts (53). Further, a calcineurin A chain fragment containing only the B subunit-binding region suppressed NFAT-dependent reporter gene expression in Jurkat T cells, apparently by competing with the endogenous A chain for the regulatory B chain and thereby reducing the calcineurin activity in stimulated cells (61). However, mice deficient in the expression of the major calcineurin Aα isoform showed only a moderate impairment of the secondary

Annu. Rev. Immunol. 1997.15:707-747. Downloaded from www.annualreviews.org immune response, suggesting that NFAT activation could be mediated by other calcineurin isoforms (62). Access provided by University of Wisconsin - Milwaukee on 12/04/17. For personal use only. Requirement for Capacitative Calcium Entry 2 A prolonged elevation of [Ca +]i levels, beyond the initial transient resulting from the emptying of calcium stores, is required in T cells to maintain calcineurin and NFAT proteins in an activated state. This plateau phase of calcium mobilization is the outcome of capacitative calcium entry, a process that cou- ples the depletion of intracellular calcium stores to the inﬂux of extracellular

P1: MBL/plb P2: MBL/rsk QC: MBL/uks T1: MBL February 12, 1997 16:24 Annual Reviews AR026-27 AR26-27

NFAT FAMILY TRANSCRIPTION FACTORS 719

calcium through specialized calcium channels (reviewed in 63–65). Capacita- tive calcium entry can be elicited by stimulation of each of the receptors listed in Table 1, as a result of their ability to activate phospholipase C, increase the intracellular concentration of inositol trisphosphate, and deplete intracellular calcium stores (5, 6, 66). It can also be elicited pharmacologically by treating 2 cells with thapsigargin, an inhibitor of the endoplasmic reticulum Ca +-ATPase needed for repletion of calcium stores, or with calcium ionophores such as ionomycin, which deplete the stores directly (67, 68). Addition of SKF96365, an inhibitor of capacitative calcium entry, to stimulated T cells resulted in an immediate deactivation of NFAT1 (52) that resembled the deactivation caused by the calcineurin inhibitors CsA and FK506 (51). The importance of capacitative calcium entry for NFAT activation is further emphasized by the finding that among mutant T cells selected for their inabil- ity to promote NFAT-dependent expression of a toxin gene, a high proportion 2 were defective in their ability to increase [Ca +]i in response to ionomycin or 2 thapsigargin (69, 70). Moreover, parallel measurements of [Ca +]i and NFAT- dependent reporter gene expression in individual T cells indicated that effective activation of the transcriptional functions of NFAT proteins required capacitative calcium entry (71). In cells stimulated with thapsigargin or immobilized anti-CD3, NFAT-dependent reporter gene expression was observed only in the 2 cells that also showed a sustained increase in [Ca +]i. In T cells that were less effectively stimulated, as with soluble rather than immobilized anti-CD3, or under conditions that would decrease the driving force for calcium influx, only the transient peak of calcium mobilization was apparent, and NFAT-dependent transactivation was less effective or did not occur (71). Dephosphorylation of NFAT Proteins by Calcineurin It is likely that NFAT proteins are directly dephosphorylated by calcineurin in activated cells. When tested in vitro, calcineurin dephosphorylated purified NFAT1 (23), NFAT1 in immunoprecipitates (40, 43), recombinant NFAT1 in COS cell extracts (40), and endogenous NFAT1 in T cell nuclear or cytoplasmic extracts (49). The phosphatase inhibitor okadaic acid, at a concentration

Annu. Rev. Immunol. 1997.15:707-747. Downloaded from www.annualreviews.org (300 nM) known to inhibit protein phosphatase-1 (PP1) and PP2A completely, did not inhibit the dephosphorylation of recombinant NFAT1 by added cal- Access provided by University of Wisconsin - Milwaukee on 12/04/17. For personal use only. cineurin in COS cell extracts (40). This result argues against the involvement of a phosphatase cascade initiated by calcineurin and resulting in PP1 or PP2A activation, such as that previously described in hippocampus (72). The evidence relating dephosphorylation to changes in NFAT function is strong but still circumstantial. Dephosphorylation is a major biochemical change detected in NFAT1, NFAT2, and NFAT4 after cell stimulation (25, 33, 43, 50–53) and clearly precedes the nuclear import of endogenous NFAT1 (50),

P1: MBL/plb P2: MBL/rsk QC: MBL/uks T1: MBL February 12, 1997 16:24 Annual Reviews AR026-27 AR26-27

720 RAO, LUO & HOGAN

suggesting that dephosphorylation is required for nuclear import. Dephospho- rylation may also be required for optimal DNA binding. Stimulation of T cells with ionomycin or through the T cell receptor (TCR) results in a substantial increase in the intrinsic DNA-binding afﬁnity of NFAT1 (50–52) and NFAT2 (73) for the distal NFAT site of the murine IL-2 promoter. Treatment of cell extracts with calcineurin or alkaline phosphatase also results in increased DNA binding of NFAT1 (49), suggesting that phosphorylated residues directly or indirectly mask a region of DNA contact in NFAT1. A model incorporating these ﬁndings is discussed below (Figure 2). Targeting of Calcineurin to the NFAT Regulatory Domain There is evidence that NFAT proteins interact directly with calcineurin within the cell. NFAT1 in T cell extracts binds to calcineurin immobilized on calmodulin-sepharose beads (48, 51). Binding can be demonstrated using both the phosphorylated form of NFAT1 from resting cells and the physiologically dephosphorylated form from stimulated cells (48, 51). The ability of bacterially expressed recombinant NFAT1 to bind to calcineurin in vitro (40) shows that the interaction is not mediated by other proteins in cell lysates. Analysis of recombinant NFAT fragments shows that the NFAT-calcineurin interaction involves the N-terminal 400 residues of NFAT1, NFAT2, and NFAT4 (40, 53), and thus the interaction≈ maps to the conserved NHR (30). The conserved residues in this region are clustered in several short sequence motifs (30), which include the three SP motifs (consensus SPxxSPxxSPxxxxx[D/E] [D/E]) noted earlier (32, 33). In NFAT1 and NFAT4, the N-terminal region containing the conserved residues functions as a calcineurin-activated regulatory domain: It contains phosphorylated serine residues that are dephosphorylated by calcineurin, and it regulates the subcellular localization of covalently linked protein domains in a calcium- and calcineurin-dependent way (40, 53). The regulatory domain also contains a candidate nuclear localization sequence (NLS) whose mutation prevents the nuclear import of full-length NFAT1 (40). When overexpressed, a fragment of NFAT2 containing this regulatory domain has a “dominant negative” effect, in that it downregulates NFAT-dependent transac-

Annu. Rev. Immunol. 1997.15:707-747. Downloaded from www.annualreviews.org tivation mediated by endogenous or recombinant NFAT proteins (25, 74). The NFAT-calcineurin interaction appears to be another example of target- Access provided by University of Wisconsin - Milwaukee on 12/04/17. For personal use only. ing interactions involving protein phosphatases (40). For instance, the catalytic subunit of PP1, which shows little substrate speciﬁcity in vitro, is targeted to substrates in glycogen, in myoﬁbrils, and in sarcoplasmic reticulum by distinct targeting subunits (75). Calcineurin itself is directed to the inositol trisphosphate and ryanodine receptors by an interaction with FKBP12 (76), and to the RII subunit of protein kinase A and relevant subsynaptic substrates by its interaction with the A-kinase anchor protein AKAP-79 (77, 78).

P1: MBL/plb P2: MBL/rsk QC: MBL/uks T1: MBL February 12, 1997 16:24 Annual Reviews AR026-27 AR26-27

NFAT FAMILY TRANSCRIPTION FACTORS 721

Models and Speculations A model for NFAT activation is depicted in Figure 2. NFAT proteins are targeted via their conserved regulatory domains to inactive calcineurin in resting cells; depending on the affinity, these interactions may be either transient or 2 stable. Increases in [Ca +]i lead to the activation of calmodulin (79); binding of calmodulin to a region near the C-terminus of calcineurin displaces the autoinhibitory domain of calcineurin and exposes the calcineurin active site (80). Ac- tivated calcineurin dephosphorylates associated NFAT proteins at multiple sites in their regulatory domains. The NLS in the regulatory domain, and potentially a DNA recognition region in the DNA-binding domain, become accessible in the dephosphorylated proteins. One possibility (not shown) is that the residues immediately adjacent to the NLS or to the region of DNA contact are directly modified with phosphates and thus masked. Alternatively, dephosphorylation may expose these regions by producing an intrinsic conformational change in NFAT proteins (Figure 2). The model also depicts a calcineurin-dependent interaction of the regulatory domain with a larger protein complex (possibly calcineurin itself) in the cytoplasm. This is inferred from the fact that although they are small enough to diffuse through nuclear pores, N-terminal fragments of NFAT1 and NFAT4 are retained in the cytoplasm of resting cells and move to the nucleus only upon activation (40, 53). Dephosphorylated NFAT proteins are still capable of binding calcineurin and may continue to bind it in activated cells. The rapid reversal of NFAT activation by CsA and FK506 implies a con- tinuing interplay between NFAT kinases and calcineurin (51, 53). Both sets of enzymes can act on NFAT proteins in the nucleus: Activated calcineurin maintains nuclear NFAT proteins in their activated state, while the kinases rephosphorylate the proteins when calcineurin is inhibited with CsA or FK506. An interesting possibility is that the enzymes move to the nucleus upon activation, as demonstrated for calcineurin overexpressed with recombinant NFAT4 in fibroblasts (53).

Annu. Rev. Immunol. 1997.15:707-747. Downloaded from www.annualreviews.org OTHER SIGNALING PATHWAYS THAT INFLUENCE

Access provided by University of Wisconsin - Milwaukee on 12/04/17. For personal use only. NFAT ACTIVATION Many signaling pathways and proteins, other than calcineurin, modulate NFAT function in T cells (see Figure 3). Since most of the experiments involve measuring reporter gene expression driven by a composite NFAT:AP-1 site, their interpretation is necessarily complex, and it is not always apparent whether calcineurin, NFAT proteins, or AP-1 proteins are affected. For the sake of brevity, we have limited our discussion to the effects of pathways normally

P1: MBL/plb P2: MBL/rsk QC: MBL/uks T1: MBL February 12, 1997 16:24 Annual Reviews AR026-27 AR26-27

722 RAO, LUO & HOGAN Annu. Rev. Immunol. 1997.15:707-747. Downloaded from www.annualreviews.org Figure 3 A simplified view of some signaling pathways reported to influence NFAT-dependent transcription (see text). Molecules discussed in the text are boxed. Unidentified signaling molecules Access provided by University of Wisconsin - Milwaukee on 12/04/17. For personal use only. 2 and pathways are indicated by question marks. Key: CaMK, multifunctional Ca +/calmodulin- dependent protein kinases; CAML, calcium-signal modulating cyclophilin ligand; Cn, calcineurin; 1Cn, constitutively active calcineurin lacking the autoinhibitory domain; JNK, c-Jun N-terminal kinase; DN, dominant negative; SRF, serum response factor.

P1: MBL/plb P2: MBL/rsk QC: MBL/uks T1: MBL February 12, 1997 16:24 Annual Reviews AR026-27 AR26-27

NFAT FAMILY TRANSCRIPTION FACTORS 723

activated in antigen-stimulated cells, concentrating on cases in which NFAT function has been specifically addressed, and where there is an indication of the mechanisms involved. Experiments involving transgenic or “knockout” mice are not described except where a mechanistic interpretation is possible. TCR-Proximal Steps: Lck, ZAP-70, Vav The earliest consequence of TCR cross-linking is the activation of tyrosine kinases including Lck and ZAP-70, and the tyrosine phosphorylation of multiple intracellular substrates including Vav (81, 82). Stimulation of T cells with a combination of a calcium ionophore and PMA bypasses these early steps but mimics the effects of TCR cross-linking on gene transcription (6). Both Lck and ZAP-70 are required for calcium mobilization in T cells (82), and overexpression of wild-type or constitutively active Lck upregulated NFAT-dependent reporter gene expression in Lck JCam.1 cells (83). Likewise, overexpression of kinase-deficient ZAP-70 inhibited NFAT activity in Jurkat T cells stimulated with anti-TCR antibodies but did not affect NFAT activity in PMA/ionomycin- stimulated cells, suggesting that an early TCR-proximal step was involved (84). ZAP-70 interacts with Vav, an SH2 domain–containing protein that is rapidly phosphorylated on tyrosine residues upon T cell activation (85). In turn, Vav interacts through its SH2 domain with SLP-76, a tyrosine-phosphorylated protein that also binds the adapter protein Grb2 (85a). Overexpression of Vav and/or SLP-76 augmented basal and TCR-stimulated NFAT-dependent reporter gene expression in Jurkat cells (85a, 86). The effect of Vav was specific for T cell receptor stimulation, since NFAT activation through the muscarinic receptor was not augmented by Vav. Likewise, there was no augmentation in cells lacking Lck, CD45, or the TCR β chain, and Vav overexpression did not result in 2 increases in [Ca +]i or in the levels of tyrosine-phosphorylated proteins. Vav- induced augmentation was blocked by the calcineurin inhibitors CsA and FK506 and by overexpression of dominant negative forms of Ras and Raf, suggesting that Vav functioned upstream of these molecules or in a parallel pathway. PMA-Activated Signaling Pathways

Annu. Rev. Immunol. 1997.15:707-747. Downloaded from www.annualreviews.org Single-cell measurements indicate that PMA enhances the calcium sensitivity of NFAT-dependent reporter gene expression, as assessed by the number of cells Access provided by University of Wisconsin - Milwaukee on 12/04/17. For personal use only. 2 expressing the reporter gene at different [Ca +]i levels (71). The magnitude of this effect is striking: In the presence of PMA, an average threefold increase 2 in the sustained plateau level of [Ca +]i results in reporter gene expression in half of the responsive cells (71). The most likely effect of PMA is to induce the de novo synthesis and posttranslational modiﬁcation of AP-1 and other transcription factors (6), thereby increasing the transcriptional effectiveness of nuclear NFATproteins. PMA-activated kinases may also directly phosphorylate

P1: MBL/plb P2: MBL/rsk QC: MBL/uks T1: MBL February 12, 1997 16:24 Annual Reviews AR026-27 AR26-27

724 RAO, LUO & HOGAN

NFAT2 (25), although there are no data on whether this influences NFAT2 function. In contrast, PMA stimulation does not, under the conditions so far tested, alter the mobility of NFAT1 on SDS gels, its subcellular distribution, or the function of its major transactivation domain (41, 52). Mechanistically, the major known effect of PMA in T cells is to activate protein kinase C, Ras, and Raf; the effects of activated and dominant negative versions of these proteins on NFAT-dependent transactivation in T cells have been previously reviewed (6). A major conclusion is that Ras is indis- pensable for NFAT function: Activated Ras substitutes effectively for PMA, and together with constitutively active calcineurin it provides a full stimulus for NFAT-dependent reporter gene expression, whereas dominant negative Ras inhibits NFAT activation in response to TCR stimulation (6, 87, 88). Multiple Ras effectors including Raf and the Ras-related GTPases Rac and Rho have been described (88–94). The Raf pathway is clearly important for AP-1 induction, via activation of the Raf substrate MEK1, a dual specificity kinase, and its substrates the MAP kinases ERK-1 and ERK-2 (reviewed in 95). In T cells, however, constitutively active Raf or MEK1 was not as effective as activated Ras in substituting for PMA and synergizing with ionomycin to stimulate NFAT- driven transcription. Consistent with these findings, dominant negative versions of these proteins only partially inhibited Ras-mediated activation (88, 96). A constitutively active form of another Ras effector, Rac-1, activated AP-1-driven reporter gene expression maximally by a pathway not involving ERK but did not activate an NFAT-driven reporter gene efficiently, even in combination with ionomycin and constitutively active MEK1 (88). Based on these results, it has been proposed that yet another Ras effector pathway exists in T cells and is needed for maximal expression of a reporter gene driven by NFAT:AP-1 (88; see Figure 3). It will be interesting to determine whether this effector pathway targets NFAT proteins, AP-1 proteins, or both. Pathways Related to Calcium Mobilization 2 In addition to activating calcineurin, increases in [Ca +]i lead to the activation of other calmodulin-dependent enzymes (79). Among these, two multifunc-

Annu. Rev. Immunol. 1997.15:707-747. Downloaded from www.annualreviews.org 2 tional Ca +/calmodulin-dependent protein kinases (CaMK) may regulate NFAT activity. A constitutively active form of a T cell CaMKII, CaMKIIγ B, partially Access provided by University of Wisconsin - Milwaukee on 12/04/17. For personal use only. inhibited both NFAT- and AP-1-driven reporter gene expression in Jurkat T cells and blocked the ability of constitutively active calcineurin to augment IL-2 promoter function (97, 98). The opposite effect was observed for constitutively active CaMKIV/Gr, which enhanced NFAT activity in large part by activating AP-1 (99). The enhancement by CaMKIV/Gr, which was not blocked by dominant negative Ras, may be mediated through upregulation of the transcriptional function of serum response factor (SRF) and the consequent induction of c-Fos

P1: MBL/plb P2: MBL/rsk QC: MBL/uks T1: MBL February 12, 1997 16:24 Annual Reviews AR026-27 AR26-27

NFAT FAMILY TRANSCRIPTION FACTORS 725

2 (99, 100). Curiously, both CaMKs are activated by CaM and Ca + during T cell activation, exhibit broad substrate specificity, and phosphorylate the same minimal consensus substrate sequence (101), suggesting that the opposite effects of the two CaMKs may involve their targeting to different intracellular substrates. Overexpression of a cyclophilin-binding protein, CAML, significantly increased the basal level of intracellular calcium in transfected T cells and partially substituted for the calcium requirement for NFAT-dependent transcription (102). This effect required extracellular calcium and was inhibited by CsA or FK506, suggesting that CAML functioned by facilitating calcium entry into cells (102). Costimulatory Pathways The T cell surface molecule CD28 delivers a costimulatory signal necessary for maximal activation through the TCR (103). CD28 stimulation results in a striking augmentation of IL-2, TNF-α, GM-CSF, and IFN-γ production (104), which has its basis in a large increase in steady state mRNA levels (105). A significant component of the effect is posttranscriptional (106), possibly arising from mRNA stabilization (105). However, CD28 stimulation also results in three- to eightfold increases in reporter gene expression driven by the IL-2, IL-3, GM-CSF, and IFN-γ promoters (107, 108). The CD28 response elements (CD28REs) in these genes have been mapped (107, 108) and shown to bind inducible factors variously identified as Rel proteins (109–111), NFAT proteins (112, 113), and 35-kDa protein(s) visualized by UV cross-linking to a labelled oligonucleotide≈ probe but not yet characterized molecularly (108, 114). It is interesting that in both the IL-2 and GM-CSF promoters, the sequences that confer responsiveness to HTLV-1 Tax map to the CD28REs (113, 115). The nature of the signaling pathways involved in CD28 signaling has been studied in many laboratories (116). Stimulation of T cells with anti-CD28 antibodies elicits a spectrum of responses, in part resembling those elicited by activation of the TCR, but differing from those resulting from stimulation with the physiogical ligand of CD28, B7.1 (117). The consensus is that the CD28 pathway is not CsA sensitive (104, 118).

Annu. Rev. Immunol. 1997.15:707-747. Downloaded from www.annualreviews.org In considering whether NFAT proteins play a role in CD28-mediated costimulatory pathways, two observations are relevant. First, at least some NFAT pro- Access provided by University of Wisconsin - Milwaukee on 12/04/17. For personal use only. teins may be activated via CD28-dependent, calcineurin-independent pathways, as judged by the CsA-insensitive induction of low levels of NFAT-dependent reporter gene expression and nuclear NFAT DNA-binding activity in T cells stimulated with anti-CD28 and PMA (74). Second, NFAT proteins can bind to the CD28REs of both the IL-2 and GM-CSF promoters, which bind Rel-family proteins (108–111, 115). Thus a plausible mechanism linking CD28 stimulation to cytokine gene transcription would be activation of NFAT proteins through

P1: MBL/plb P2: MBL/rsk QC: MBL/uks T1: MBL February 12, 1997 16:24 Annual Reviews AR026-27 AR26-27

726 RAO, LUO & HOGAN

a distinct pathway that may synergize with the calcium/calcineurin pathway, followed by binding of the activated proteins to CD28REs and conventional NFAT sites in the promoter and enhancer regions of NFAT-inducible genes. The potential interplay between NFAT and Rel proteins at the CD28REs and other κB-like sites is discussed in a later section. Other Signaling Pathways A variety of biological and pharmacological agents including protein kinase A (PKA) activators (119–123), glucocorticoids (124–126), transforming growth factor-β (TGF-β) (127), retinoic acid (128), and vitamin D3 (129) are known to inhibit IL-2 production by activated T cells. Of these, PKA activators and vitamin D3 have been reported to affect NFAT function.

PKA In a mouse T cell hybridoma stimulated with thapsigargin, dibutyryl cAMP inhibited NFAT:AP-1-dependent reporter gene expression, and the inhibition was substantially reversed by PMA, suggesting either that AP-1 proteins were limiting in the treated cells or that a PKA-mediated inhibition of NFAT function could be compensated for by an increase in AP-1 (71). Whether PKA activators inhibit AP-1 function, NFAT function, or both remains unclear. In several studies in which EL-4 mouse thymoma cells were used, PKA activators had no effect on NFAT DNA-binding activity (119, 121, 122); this finding could reflect the fact that NFAT is constitutively nuclear in EL-4 cells (130), in which the calcineurin A chain bears a spontaneous activating mutation in its autoinhibitory domain (60). In primary human T cells, however, prostaglandin E2 (PGE2) significantly inhibited the induction of both NFAT:AP-1 and AP-1 DNA-binding activity (123); whereas in primary CD4+ murine T cells, cholera toxin, one of whose several effects is to elevate cAMP (131), inhibited the induction of NFAT but not AP-1 DNA-binding activity (120). The inhibitory effects of PKA may not involve AP-1, however. An established target for PKA is the transcription factor CREB, which becomes phosphorylated on serine-133; based on the findings that CREB is phosphorylated at the same site, presumably by other kinases, upon stimulation through the TCR (132, 133), and that thymo-

Annu. Rev. Immunol. 1997.15:707-747. Downloaded from www.annualreviews.org cytes from transgenic mice expressing a dominant negative version of CREB showed signiﬁcantly decreased induction of several Fos- and Jun-family m- Access provided by University of Wisconsin - Milwaukee on 12/04/17. For personal use only. RNAs (132), it has been suggested that CREB is involved in upregulating AP-1 activity in stimulated T cells. Clearly, further experiments are necessary to elu- cidate the molecular effects (if any) of PKA on the phosphorylation status and function of NFAT proteins in cells. If the evidence favors a consistent effect of PKA on NFAT activity, a further point that will need to be considered is that PKA activators upregulate IL-4 and IL-5 production while inhibiting IL-2 production (120, 121).

P1: MBL/plb P2: MBL/rsk QC: MBL/uks T1: MBL February 12, 1997 16:24 Annual Reviews AR026-27 AR26-27

NFAT FAMILY TRANSCRIPTION FACTORS 727

VITAMIN D3 The natural immunosuppressant vitamin D3 downregulates IL-2 production by activated T cells. The inhibitory effects of vitamin D3 are mediated through the vitamin D3 receptor, which binds as a heterodimer with its partner the retinoid X receptor to sequences overlapping the distal NFAT site of the human IL-2 promoter, thereby preventing the binding of the NFAT:AP-1 complex to the same site (129).

GLUCOCORTICOIDS NFAT and NFAT:AP-1 complexes do not appear to be direct targets for inhibition by glucocorticoids, because neither the induction of NFAT DNA-binding activity nor the level of NFAT:AP-1-dependent reporter gene expression was affected by dexamethasone treatment of Jurkat T cells (124–126).

RETINOIC ACID, TGF-β The inhibitory effects of retinoic acid and TGF-β have been mapped to the octamer element of the IL-2 promoter (127, 128), which is now known to be a composite NFAT:AP-1:Oct site (112). However, neither compound inﬂuenced NFAT:AP-1-dependent reporter gene expression, suggesting that neither directly affected the function of NFAT.

DNA BINDING AND TRANSACTIVATION DNA Binding The DNA-binding domains of NFAT proteins are likely to be similar in three- dimensional structure to the DNA-binding domains of Rel-family proteins, and to utilize corresponding loops to make some of their contacts with DNA (37–39). The domains ( 300 amino acids) are highly conserved within each family (60– 70% pairwise identity≈ for NFATproteins; 41–61% for mammalian Rel proteins) and show a low but significant level of sequence identity ( 17%) in pairwise comparisons between individual members of the NFAT family≈ and the Rel family (31). The minimal DNA-binding domain ( 190 amino acids) of NFAT1 (37) corresponds almost exactly to the N-terminal≈ specificity domain of NF-κB p50, which makes the majority of base-specific contacts with DNA (134, 135).

Annu. Rev. Immunol. 1997.15:707-747. Downloaded from www.annualreviews.org This domain contains the highly conserved recognition loop (RFRYxCEG) of Rel-family proteins, represented in the NFAT family as the equally highly Access provided by University of Wisconsin - Milwaukee on 12/04/17. For personal use only. conserved RAHYETEG sequence in which each of the underlined residues is likely to contact DNA (37, 39). A striking difference between NFATand Rel proteins is that whereas Rel proteins are dimeric in solution and bind DNA as obligate dimers, NFAT proteins are monomeric in solution and when bound to DNA (31). NFAT proteins can also bind to certain κB-like sites (see below): in this case, an NFAT monomer binds to the 50 half-site, and a second NFAT monomer binds to the symmetrical

P1: MBL/plb P2: MBL/rsk QC: MBL/uks T1: MBL February 12, 1997 16:24 Annual Reviews AR026-27 AR26-27

728 RAO, LUO & HOGAN

Table 5 Site selectivities of NFAT proteins

IL-2 (distal NFAT) NFAT AP-1 AP-1 IL-4 (P1)a TNF-α (κ3) References − + NFAT1 (31, 33, 34) +++ ++++ +++ ++ NFAT2 (31–34) ++ ++++ +++ − NFAT3 n.t. (31) + ++++ +++ NFAT4 (31–33) ± ++++ ± − aResults from Hoey et al (31) using bacterially-expressed recombinant DNA-binding domains. Using full-length recombinant proteins expressed in COS cells, Ho et al (33) found that NFAT2 bound least well to the IL-4 P1 site (binding decreases in the order NFAT1 > NFAT4 > NFAT2).

30 half-site, without stabilization of the binding by protein-protein interactions between the monomers (136). This property has led to the classification of NFAT proteins as “monomeric Rel proteins” (39). The monomeric nature of NFAT proteins explains why the minimal DNA-binding fragment of NFAT1, which lacks the region corresponding to the C-terminal dimerization domain of Rel proteins, can bind independently to DNA (37). Moreover, it provides a rationale for why the N-terminal two thirds of the Rel similarity region of NFAT proteins is more highly conserved in sequence than the C-terminal one third (31). Although all four NFAT proteins are capable of binding cooperatively with AP-1 proteins to the distal IL-2 promoter NFAT site (31, 32, 34), they show characteristic site preferences when tested for DNA binding in the absence of AP-1 (Table 5). Of the four NFAT proteins, NFAT1 displays the highest affinity for each of the three sites shown in Table 5, binding in the order IL-4 P1 > distal IL-2 > TNF-ακ3. In contrast, NFAT4 binds poorly or not at all to the distal IL-2 site (31–33), and neither NFAT2 nor NFAT4 bind under standard conditions to the TNF-α promoter κ3 site (33, 34). As a consequence, NFAT2b fails to activate the TNF-α promoter when transiently expressed in T or B cell lines, while NFAT1 is highly active in this respect (34). Curiously, overall TNF- α production is not impaired in NFAT1-deficient mice (73), possibly because

Annu. Rev. Immunol. 1997.15:707-747. Downloaded from www.annualreviews.org the TNF-α promoter contains additional NFAT sites capable of binding the other NFAT proteins (137), or because the other NFAT proteins do function at Access provided by University of Wisconsin - Milwaukee on 12/04/17. For personal use only. the κ3 site in the genomic context. Transactivation Domains Analysis of NFAT1 suggests that both the N- and C-terminal regions of NFAT proteins contain transcriptional activation domains (30). The N-terminal TAD of NFAT1 has been localized to the N-terminal 100 residues of NFAT1, which like the corresponding regions of NFAT2b, NFAT3,≈ and NFAT4 is rich in acidic

P1: MBL/plb P2: MBL/rsk QC: MBL/uks T1: MBL February 12, 1997 16:24 Annual Reviews AR026-27 AR26-27

NFAT FAMILY TRANSCRIPTION FACTORS 729

residues and proline (30–32, 34). In this region, NFAT1 contains at least one acidic/hydrophobic patch, 25QDELDFSILFDYEYL39, that resembles those implicated in transactivation by acidic activation domains (138, 139). Similar acidic/hydrophobic patches are present in NFAT2b (4LEDQEFDFEFLFEF17), NFAT3 (8DEELEFKLVFGEE20), and NFAT4 (9HDELDFKLVFGED21) (31, 32, 34). Despite the very limited sequence conservation, therefore, the N-terminal regions of all these proteins could conceivably function as acidic transactivation domains. The corresponding region of NFAT2a, which lacks the acidic/hydrophobic patches, is also capable of transactivation (C Luo, unpublished), perhaps through interaction with a distinct set of nuclear proteins. When expressed as a GAL4 fusion protein, the region of NFAT1c located C-terminal to the DNA-binding domain is also capable of transactivation (41). Again, this region shows only limited sequence similarity to the corresponding regions of NFAT2b, NFAT3, or NFAT4, except for the LDQTYLDDVNEI- IRKEFS sequence mentioned previously, which spans a C-terminal splice site and is represented in NFAT3 and NFAT4x (see Figure 1). Although more experiments are needed to establish the signiﬁcance of this conserved segment, it is interesting that the NFAT1c isoform, which possesses this sequence, is reproducibly more active in transactivation assays than the NFAT1b isoform, which differs in this portion of the C-terminal sequence (41). Cooperation with AP-1 NFAT proteins show a characteristic ability to cooperate with AP-1 in DNA binding and transactivation (reviewed in 1). The minimal DNA-binding domain of NFAT1 sufﬁces for cooperative binding with AP-1 dimers to the distal NFAT site of the murine IL-2 promoter (37). The interaction between NFAT proteins and AP-1 involves binding of these unrelated transcription factors to adjacent sites on DNA and results in an approximately 20-fold increase in the stability of the NFAT1:AP-1:DNA complex compared with the DNA-protein complex containing NFAT1 alone (23, 27, 140). In DNA-protein complexes containing NFAT1, Fos, and Jun, the Fos-Jun dimer shows a remarkable orientational preference that is not apparent in the absence of NFAT1,in that the AP-1 half-site

Annu. Rev. Immunol. 1997.15:707-747. Downloaded from www.annualreviews.org proximal to the bound NFAT1 monomer is occupied exclusively by Jun (140). The paradigm of NFAT-AP-1 cooperation has been recognized in a number of Access provided by University of Wisconsin - Milwaukee on 12/04/17. For personal use only. different cytokine promoter/enhancer regions (reviewed in 1) (Table 6). Note that cooperative binding implies not merely that two transcription factors can occupy adjacent sites on DNA, but that the DNA-protein complex containing both transcription factors is signiﬁcantly more stable or of higher afﬁnity than those containing the individual proteins (27, 140, 141). When expressed without its transactivation and regulatory domains in T cells, the DNA-binding domain of NFAT1 is found in the nucleus and can mediate

P1: MBL/plb P2: MBL/rsk QC: MBL/uks T1: MBL February 12, 1997 16:24 Annual Reviews AR026-27 AR26-27

730 RAO, LUO & HOGAN

Table 6 Selected NFAT binding sites in gene regulatory regions

Promoter Species Site Sequences References

Group I NFAT AP-1

IL-2 m 280 AGGAAAATT TGTTTCA (20, 27, − h 280 AGGAAAAAC TGTTTCA 162, 163) − m 135 AGGAAAAAC AAAGGTA (21, 162, − h 135 AGGAAAAAT GAAGGTA 163) − m, h 90 TTGAAAATA TGTGTAA (112, 218) − m 45 TGGAAAAAT AATATGGr (112) − h 45 TGGAAAAAT ATTATGGr − IL-4 m P1 TGGAAAATT TTATTACAr (219) hP TGGAAATTT TCGTTACAr (161) IL-5 m P TGGAAACCC TGAGTTTr (173, 195) hP TGGAAACAT TTAGTTTr GM-CSF h GM330 CGGAGCCCC TGAGTCA (141) enhancer h GM420 TGGAAAGA TGACATCAr − h GM550 AGGAAAGCA AGAGTCAr CD40L m, h NM-1 TGGAAAATG TGCTTCGr (150, 151) IFN-γ h TGGAAATTT TTTTGTAr (205, 206) IL-13 h TGGAAAATC CAGTGTCGCAr (198) CTLA-4 m 207 TGGAAAAT GTACTCAAr (220) − − h 195 TGGAAAAT GTATTCAAr − − T A Consensus GGAAAATN TGAGTCA TGACGTCA A NC (AP-1) (CREB/ATF)

Group II κB like sites adjacent sites

hTNF-ακ3/CRE GGAGAAACCC ATGAGCTCAr (ATF-2/Jun) (136, 154) hIL-8 81/ 65 TGGAATTTCC TCTGACATAA (155) − − ...... E-selectin PDI GGGGATTTCC TCTTTACTGGATGT (9, 157)

Annu. Rev. Immunol. 1997.15:707-747. Downloaded from www.annualreviews.org ...... HIV-1 LTR κB/SP-1 GGGACTTTCC AGGGAGGCGTGGCC (Sp1) (201)

Access provided by University of Wisconsin - Milwaukee on 12/04/17. For personal use only. hGM-CSF CK-1 (CD28RE) AGGAGATTCC ACAGTTCA (115, 201) mIL-2 CD28RE/AP-1 AAGAAATTCC AGAGAGTCA (AP-1) (112, 113) For each element, a continuous sequence is divided by inspection into adjacent NFAT and AP-1 sites in Group I, and a κB-like site and the adjacent sequence in Group II. Introduced gaps are indicated by dashes. Nucleotides known or presumed to interact with NFAT proteins are shown in boldface type. Known and probable binding sites for AP-1/CREB/ATF proteins are underlined, with nucleotides ﬁtting the consensus shown in boldface type. The Group I NFAT consensus is based on the sequences shown. The human IL-4 P element and the IL-13 element could equally well be classiﬁed in Group II. m, mouse; h, human; r, sequence shown is for the noncoding strand.

P1: MBL/plb P2: MBL/rsk QC: MBL/uks T1: MBL February 12, 1997 16:24 Annual Reviews AR026-27 AR26-27

NFAT FAMILY TRANSCRIPTION FACTORS 731

strong NFAT-dependent transactivation in cells stimulated with ionomycin and PMA (41). Under these circumstances, mutation of either the NFAT site or the adjacent AP-1 site abrogated reporter gene expression, indicating that transcription required recruitment of AP-1 proteins by the NFAT1 DNA-binding domain. Recruitment of unrelated transcription factors by strong cooperative interactions involving DNA-binding domains could be a general theme in transcriptional regulation: The isolated DNA-binding domains of GATA proteins and MyoD1 induce cell differentiation (142, 143), and protein-protein interactions have been detected between the DNA-binding domains of AP-1 and Ets proteins (144), AP-1 and NF-κB (145), C/EBP and NF-κB (146), and c-Jun and the glucocorticoid receptor (147).

NFAT BINDING SITES IN GENE REGULATORY REGIONS Table 6 presents a compilation of known and potential NFAT binding sites in the regulatory regions of selected inducible genes. The largest and best- documented class consists of sites on which NFAT proteins form a cooperative complex with AP-1 or other bZIP proteins (Group I). NFAT proteins also bind to sites that are, or resemble, binding sites for conventional Rel-family proteins (Group II). Sites that bind NFAT proteins with relatively high afﬁnity in the apparent absence of an adjacent AP-1 site have also been described (112). NFAT:AP-1 Sites This subject has been extensively reviewed (1, 141), and only salient points are emphasized here. Composite elements that support the cooperative binding of NFAT and AP-1 proteins have been noted in the promoter regions of the IL-2, IL-4, IL-5, and CD40L genes, and in the GM-CSF enhancer (Table 6, Group I). Based on a comparison of these sequences, the NFAT binding site is presented as a 9-bp element positioned next to a 7–8-bp element capable of binding dimers of AP-1, CREB/ATF, or other bZIP-family proteins. The spacing of the NFAT and AP-1 elements appears to be narrowly speciﬁed, with no more than a single base pair insertion or deletion permitted between the two sites. Sites in which

Annu. Rev. Immunol. 1997.15:707-747. Downloaded from www.annualreviews.org the GGAAA core sequence is preceded by a T rather than an A appear to bind NFAT proteins more strongly. The identiﬁed AP-1/CRE sites range from strong Access provided by University of Wisconsin - Milwaukee on 12/04/17. For personal use only. elements, as in the GM330 AP-1 and GM420 CRE sites, to barely recognizable variants of the consensus sequence, as in the IL-4 and CD40L sites. The relative strengths of the NFAT and AP-1 elements can vary reciprocally over a wide range: The 90 IL-2 site does not bind NFAT proteins independently and binds AP-1 proteins− only moderately well, but supports a strong cooperative interaction between these two proteins. Conversely the CD40L element pairs a strong NFAT site with a relatively weak AP-1 site. Note that the CTLA-4

P1: MBL/plb P2: MBL/rsk QC: MBL/uks T1: MBL February 12, 1997 16:24 Annual Reviews AR026-27 AR26-27

732 RAO, LUO & HOGAN

sites in Table 6 were identified by inspection, within the region shown to be functional by promoter deletions. Also note that NFAT:AP-1 cooperation at the IFN-γ , IL-13, and CTLA-4 sites has not yet been established. The possibility that NFAT binding to Group I-like sites in vivo always involves AP-1 or bZIP proteins deserves serious consideration. In the absence of NFAT, AP-1 proteins do not bind detectably to the distal NFAT site of the murine IL-2 promoter (23, 140), a moderately high-affinity NFAT-binding site that is the prototype for a cooperative NFAT:AP-1 site (23). It is possible, therefore, that even strong NFAT sites with no obvious adjacent AP-1 sites, such as the 45 site of the IL-2 promoter (Table 6), do in fact support the formation of cooperative− NFAT:AP-1 complexes in the context of larger transcriptional complexes assembled on genomic promoters and enhancers. Conversely, reporter gene expression driven by multiple AP-1 sites has been reported to be selectively sensitive to CsA and FK506 in T cells (148, 149); this may reflect, in part, the ability of AP-1 proteins to recruit NFAT proteins to adjacent sites. An important technical point when assessing protein binding to these sites by electrophoretic mobility shift assay is that the use of insufficiently long oligonu- cleotides may lead to the classification of an NFAT site as independent of AP-1 (see 150 and 151 for the CD40L site), or an AP-1 site as independent of NFAT. Carrying this reasoning further, if either half of a composite NFAT:AP-1 site is of low affinity, the weak binding of the relevant protein to that site may be entirely missed if the adjacent site or the partner protein that binds to it is not represented in the assay. The relative order of the NFAT and AP-1 sites is fixed as shown in Table 6: reversal of the order, such that the NFAT site lies 30 to the AP-1 site on the DNA strand represented, permits independent but not cooperative binding (J Jain, A Rao, unpublished). By this analysis, the interaction of the bZIP protein c-Maf with NFAT1 on the IL-4 promoter (152) is unlikely to involve the same type of protein-protein interactions as in prototype NFAT:AP-1 complexes (140), since it occurs on the sequence AGTTGCTGAAACCAAGGGAAAATGAGTT (noncoding strand), with the order of NFAT (bold and underlined) and c-Maf (underlined) sites reversed with respect to the canonical NFAT:AP-1 site. Annu. Rev. Immunol. 1997.15:707-747. Downloaded from www.annualreviews.org κB-Like Sites Access provided by University of Wisconsin - Milwaukee on 12/04/17. For personal use only. NFAT proteins also bind several sequences that resemble binding sites for Rel family proteins (Group II). The κ3 element in the TNF-α promoter, which behaves as a strong CsA-sensitive element in stimulated T cells (153), is the best-documented example of a functional site in this group (136). As mentioned above, NFAT1 appears to bind with much higher affinity than NFAT2 and NFAT4 to this site (33, 34). Detailed analysis indicates that the GGA sequence (bold in Table 6) is a nucleating site that is preferentially occupied at low NFAT1

P1: MBL/plb P2: MBL/rsk QC: MBL/uks T1: MBL February 12, 1997 16:24 Annual Reviews AR026-27 AR26-27

NFAT FAMILY TRANSCRIPTION FACTORS 733

concentration; mutation of this sequence eliminates binding to the site (136). At higher concentrations, a second molecule of NFAT1 binds to the other half-site, contacting the GGG sequence on the opposite strand, but the monomers bound to the two half-sites make few if any cooperative interactions with each other. An adjacent site that binds ATF-2/Jun dimers is required for maximal function of the κ3 element in reporter assays, although there are no stabilizing protein- protein interactions between NFAT1 and ATF-2/Jun bound to the adjacent sites (154). The IL-8 site, which was originally identified by inspection as a κB-like site (155), may also fit the criteria for classification in Group II. The distance between the presumed CRE and the GGAA sequence identified by mutation as functional (155) matches the spacing in the TNF-ακ3 element more closely than the spacing in any of the Group I sites. The IL-8 site does not bind any of the known Rel proteins in electrophoretic mobility shift assays using nuclear extracts from stimulated Jurkat T cells, but the complex formed reacts with anti-NFAT1 antibodies (S Okamoto, K Matsushima, personal communication). Moreover, production of IL-8 and induction of the IL-8 promoter are both strongly inhibited by FK506 in Jurkat T cells (155), in which NF-κB induction is not sensitive to CsA or FK506 (21), implying that this site behaves in vivo as a functional NFAT site. The κB sites in the E-selectin promoter and the HIV-1 LTR are other examples of κB-like sites that bind NFAT1 in vitro (Table 6). Where known, the nucleotides (TTCC) that are complementary to those contacted by bound NFAT1 are shown in bold, and comprise the nucleating site. Both sites are well established as Rel binding sites (156, 157), but it is not known whether NFAT binding at these sites has a functional effect. CD28 Response Elements The CD28REs of the IL-2 and GM-CSF promoters bind Rel-family proteins as well as NFAT proteins (109–113, 115), and we have therefore classified them as κB-like elements in Group II. The CD28RE of the GM-CSF promoter is the same as its CK-1 site (115). Like the IL-8 site, however, these elements

Annu. Rev. Immunol. 1997.15:707-747. Downloaded from www.annualreviews.org have characteristics of both Group I and Group II sites, although the Rel-like characteristics may predominate. Access provided by University of Wisconsin - Milwaukee on 12/04/17. For personal use only. The binding of NFAT proteins to the IL-2 promoter CD28RE has been suggested to involve their cooperation with AP-1 proteins bound to a strong adjacent AP-1 site (112). Based on our earlier discussion of composite NFAT:AP-1 sites, this would only be possible if the NFAT protein bound to the weak NFAT site, AAGAAA, at the 50 end of the element; however, the spacing between the NFAT and AP-1 sites is not optimal for cooperation (Table 6). The functional sequence in the CD28RE is thought to be the GGAA sequence on the noncoding

P1: MBL/plb P2: MBL/rsk QC: MBL/uks T1: MBL February 12, 1997 16:24 Annual Reviews AR026-27 AR26-27

734 RAO, LUO & HOGAN

strand (TTCC in Table 6), which could serve as the nucleating sequence for binding of NFAT proteins to a κB-like site (see discussion above): Mutation of this site diminishes or eliminates IL-2 promoter function in response to anti- CD3 (112, 158). Indeed, NFAT proteins appear to be capable of binding to the CD28RE independently of AP-1, as observed in nuclear extracts from Jurkat T cells stably expressing HTLV-1 Tax (113). Given the available evidence, it is plausible that NFAT proteins could bind in either mode, to one or both ends of the CD28REs. It remains to be determined, however, whether either mode of NFAT binding is functional in terms of CD28 costimulation. Interactions Among NFAT and Rel Proteins on κB-Like Sites An interesting question is the degree to which NFATand Rel proteins contribute to transactivation at κB-like sites or CD28REs. Mixed dimers of NFATand NF- κB proteins have not been observed, and so any given κB-like site is expected to bind either NFAT or NF-κB, and not a combination of both proteins. The relative contributions of NFAT and Rel proteins to transactivation from the site will depend in part on the concentrations of NFAT, AP-1, and Rel proteins in the nucleus at any given time of stimulation, and in part on relative affinities of these proteins for the site in question. Since NFAT proteins are activated primarily by calcium-mobilizing stimuli, whereas Rel proteins are activated by many types of stimuli (159, 160), the cell type and mode of stimulation employed will be crucial. Bound NFAT and Rel proteins may have similar or antagonistic effects on promoter function. An interesting example of an interaction between NFAT and NF-κB is provided by their competition on the P sequence of the human IL-4 promoter (TGGAAATTTTC, Table 6), which binds both NFAT and NF-κB (161). The corresponding P1 sequence in the mouse IL-4 promoter (TGGAAAATTTT, Table 6) differs by two nucleotides from the human sequence, and hence binds NFAT with fourfold higher affinity and NF-κB with fourfold lower affinity than does the human sequence. In consequence, the activity of the human IL-4 promoter was repressed by PMA stimulation and by coexpression of RelA, while that of the mouse IL-4 promoter was not. Moreover, substitution of the mouse

Annu. Rev. Immunol. 1997.15:707-747. Downloaded from www.annualreviews.org sequence for the human P element eliminated the sensitivity of the human IL-4 promoter to PMA stimulation and to Rel A (161), consistent with the proposed Access provided by University of Wisconsin - Milwaukee on 12/04/17. For personal use only. competition between NFAT and NF-κB for binding to the P site.

ROLE OF NFAT PROTEINS IN GENE TRANSCRIPTION Multiple NFAT Binding Sites in Gene Regulatory Regions A notable feature of NFAT-dependent promoters and enhancers is the presence of multiple NFAT binding sites. This theme, ﬁrst recognized in the IL-2 (162,

P1: MBL/plb P2: MBL/rsk QC: MBL/uks T1: MBL February 12, 1997 16:24 Annual Reviews AR026-27 AR26-27

NFAT FAMILY TRANSCRIPTION FACTORS 735

163) and IL-4 (164, 165) promoters, has since been extended to the GM-CSF enhancer (141), two more sites in the IL-2 promoter (112), the TNF-α promoter (137), and a newly identified enhancer located 14-kb upstream of the IL-3 gene (P Cockerill, personal communication). Each of these regulatory regions contains three to five sites for NFAT binding, within a total length of 200 to 300 base pairs. The implication is that higher-order, synergistic interactions among NFAT-containing complexes are required for effective transcription. A similar hypothesis was proposed based on studies of reporter expression, using constructs driven by multiple NFAT:AP-1 sites (71, 166). T cells stably expressing such constructs showed reporter expression in only a proportion of stimulated cells, and changes in the strength or effectiveness of the stimulus changed the number of expressing cells rather than the level of reporter expression, suggesting that NFAT-dependent transcription was initiated in the stimulated cells only when they attained a threshold level of nuclear NFAT proteins that permitted tandem occupancy of multiple sites. In vivo footprinting of the IL-2 promoter suggested that these long-range interactions were not limited to NFAT, but involved the synergistic assembly of all the relevant transcription factors into a coordinate promoter complex (167). Indeed, transcriptional activation in many systems requires the ordered assembly of a cooperative transcription complex, containing transcription factors, coactivators, and the core transcriptional ma- chinery (168). Cell Specificity of Cytokine Gene Expression Each cell type in the immune system produces a characteristic pattern of cytokines during an immune response (169). For instance, IL-2 is produced by T cells, IL-4 by T cells and mast cells, IFN-γ by T cells and NK cells, and TNF-α by virtually every cell type. Other inducible genes such as CD40L, CTLA-4, and FasL are also selectively expressed. The cytokine profiles of T cells dif- ferentiating down the Th1 and Th2 pathways have been well documented; Th1 cells preferentially produce IL-2 and IFN-γ , whereas Th2 cells produce IL-4, IL-5, IL-10, and IL-13 (169–171). In many pathological situations, the balance between Th1 and Th2 patterns of cytokine production determines the clinical

Annu. Rev. Immunol. 1997.15:707-747. Downloaded from www.annualreviews.org outcome of the immune response (103, 170). The proto-oncogene c-Maf, a member of the bZIP family, is held to be Access provided by University of Wisconsin - Milwaukee on 12/04/17. For personal use only. responsible for the selective expression of IL-4 in Th2 cells (152). Within the T cell lineage, c-Maf is expressed in Th2 but not in Th1 cells. Coexpression of c-Maf and NFAT1 in Th1 cells and B cells results in strong synergistic activation of the IL-4 promoter, reﬂecting their interaction with the P0 NFAT site and an adjacent c-Maf binding site. As discussed above, the orientation and spacing of the NFAT and Maf-binding sites within this region suggest that the NFAT:Maf interaction differs substantially from the conventional NFAT:AP-1

P1: MBL/plb P2: MBL/rsk QC: MBL/uks T1: MBL February 12, 1997 16:24 Annual Reviews AR026-27 AR26-27

736 RAO, LUO & HOGAN

interaction, and protein-protein interactions between NFAT and c-Maf remain to be demonstrated. If the interactions are in fact cooperative, it is likely that the protein-protein contacts involved will differ from those observed on composite NFAT:AP-1 sites. What determines the cell-specific expression of inducible genes? As noted above, the sequences of the NFAT sites and their arrangement relative to sites for other transcription factors show considerable variability. For instance, the interaction of NFAT and Oct proteins differs on the IL-2 and IL-4 promoters, being cooperative in the former case and competitive in the latter (172); both NF-κB and NFAT:AP-1 are required for the function of the human GM-CSF promoter (59); and GATA as well as NFAT proteins have been implicated in IL-5 gene induction (173–175). Selective gene expression is likely to be determined by the particular NFAT proteins and cooperating transcription factors expressed in individual cell types, or by cell-specific nuclear coactivators (or corepressors) that mediate interactions between these transcription factors and the basal transcription complex. Target Genes for NFAT Proteins: Lessons from NFAT1-Deficient Mice The specialized functions of NFAT1 in the immune response have been explored by targeted disruption of the NFAT1 gene (73, 176). In both cases the targeted exon was in the DNA-binding domain, and its disruption resulted either in the expression of a deleted version of the protein without DNA-binding activity (176), or in no protein expression (null phenotype) (73). Except for a moderate degree of splenomegaly, the NFAT1-deficient mice developed normally and were immunocompetent, as they showed no impairment in IL-2, IL-4, TNF-α, and IFN-γ production by stimulated spleen cells. Surprisingly, however, certain primary and secondary immune responses were markedly enhanced, with a tendency toward the development of a late Th2-type response in at least three experimental situations: increased intrapleural accumulation of eosinophils and increased serum IgE levels in an in vivo model of allergic inflammation (73); increased serum IgE levels in response to immunization with TNP-ovalbumin

Annu. Rev. Immunol. 1997.15:707-747. Downloaded from www.annualreviews.org (176); and more efﬁcient differentiation toward a Th2 phenotype in spleen cells stimulated in vitro with IL-4 and anti-CD3 (176). Access provided by University of Wisconsin - Milwaukee on 12/04/17. For personal use only. Given the evidence that NFAT proteins are essential transcription factors for the expression of cytokine genes, the overall immunocompetence of NFAT1- deﬁcient mice suggests that many genes that are targets for NFAT1 may be redundantly controlled by another NFAT protein. However, the unusual phenotype of enhanced immune responsiveness is consistent with the possibility that some genes are unique or preferred targets for NFAT1. In normal mice, activation of NFAT1 may elevate the expression of inhibitory cytokines or cell-surface

P1: MBL/plb P2: MBL/rsk QC: MBL/uks T1: MBL February 12, 1997 16:24 Annual Reviews AR026-27 AR26-27

NFAT FAMILY TRANSCRIPTION FACTORS 737

receptors in certain cells, or decrease the expression of activating effector proteins, thus dampening the overall magnitude of the immune response and perhaps limiting the late expression of Th2-type cytokines. By analogy, protein kinase C (PKC), which is activated early in stimulated T cells, has both positive effects and feedback inhibitory effects on the subsequent response: It modiﬁes 2 and activates the positive regulators Ras and Raf but also decreases [Ca +]i by inhibiting phospholipase C-γ and activating plasma membrane calcium pumps (131). Alternative explanations for the phenotype of NFAT1-deﬁcient mice are that changes in early cytokine production (176) alter the balance of cytokines produced at later times, thus skewing the overall pattern of the response; or that unless counterbalanced by the presence of NFAT1, the other NFAT proteins will favor transcription of the cytokine genes characteristic of Th2 cells. Given the fact that NFATproteins or their mRNAs have been detected outside the immune system, some target genes for NFAT1 and other NFAT proteins are likely to be expressed in nonlymphoid cells. For instance, mRNAs encoding all four NFAT proteins are expressed in testis and/or ovary and in skeletal or cardiac muscle, suggesting a possible involvement in reproduction and in muscle development or function. New members of the NFAT family may also be discovered, with presently unsuspected roles.

FUTURE DIRECTIONS The molecular characterization of NFAT proteins has greatly advanced our understanding of inducible gene transcription in the immune system. How- ever, the basis for the cell-specific expression of genes induced via the receptor/calcium/calcineurin pathway remains to be understood. This will involve defining the functions of individual NFAT proteins, both biochemically and by targeted gene disruption; exploring the mechanisms by which calcineurin, kinases, and other signaling molecules regulate the phosphorylation status, subcellular localization and transactivation functions of NFAT proteins; and determining whether NFAT-mediated transcription involves cooperation with cell-specific transcription factors or coactivator proteins. Other questions are

Annu. Rev. Immunol. 1997.15:707-747. Downloaded from www.annualreviews.org whether NFAT proteins play a role in other biological and immune processes, such as lymphocyte development and programmed cell death; or in disease Access provided by University of Wisconsin - Milwaukee on 12/04/17. For personal use only. processes such as immunodeﬁciency or autoimmune diseases or oncogenesis.

ACKNOWLEDGMENTS We thank the many colleagues who generously provided us with unpublished information and discussed their research with us, and we apologize sincerely to those whose work we have overlooked or omitted to cite because of space limitations. We are grateful to all the members of our laboratories for their

P1: MBL/plb P2: MBL/rsk QC: MBL/uks T1: MBL February 12, 1997 16:24 Annual Reviews AR026-27 AR26-27

738 RAO, LUO & HOGAN

contributions to this review, particularly Dr. J Aramburu for help with Figure 2. Work in the A.R. and P.G.H. laboratories was supported by grants from the National Institutes of Health and Hoffmann-La Roche, Inc.

Visit the Annual Reviews home page at http://www.annurev.org.

Literature Cited

1. Rao A. 1994. NF-ATp:a transcription fac- JJ, Peterson L, Rich DH, Dunlap BE, tor required for the co-ordinate induction Staruch MJ, Melino MR, Koprak SL, of several cytokine genes. Immunol. To- Williams D, Witzel B, Pisano JM. 1991. day 15:274–81 Is cyclophilin involved in the immuno- 2. Crabtree GR, Clipstone NA. 1994. Signal suppressive and nephrotoxic mechanism transmission between the plasma mem- of action of cyclosporin A? J. Exp. Med. brane and nucleus of T-lymphocytes. 173:619–28 Annu. Rev. Biochem. 63:1045–83 14. Dumont FJ, Staruch MJ, Koprak SL, 3. Jain J, Loh C, Rao A. 1995. Transcrip- Siekierka JJ, Lin CS, Harrison R, Sewell tional regulation of the interleukin 2 gene. T, Kindt VM, Beattie TR, Wyvratt M, Curr. Opin. Immunol. 7:333–42 Sigal NH. 1992. The immunosuppressive 4. Serfling E, Avots A, Neumann M. 1995. and toxic effects of FK-506 are mechanis- The architecture of the interleukin-2 tically related: pharmacology of a novel promoter: a reflection of T lympho- antagonist of FK-506 and rapamycin. J. cyte activation. Biochem. Biophys. Acta Exp. Med. 176:751–60 1263:181–200 15. Liu J. 1993. FK506 and cyclosporin, 5. Weiss A, Littman DR. 1994. Signal trans- molecular probes for studying intracellu- duction by lymphocyte antigen receptors. lar signal transduction. Immunol. Today Cell 76:263–74 14:290–9 6. Cantrell D. 1996. T cell antigen receptor 16. Kincaid RL, O’Keefe SJ. 1993. Cal- signal transduction pathways. Annu. Rev. cineurin and immunosuppression: a Immunol. 14:259–74 calmodulin-dependent protein phos- 7. Crabtree GR. 1989. Contingent genetic phatase acts as the “gatekeeper” to regulatory events in T lymphocyte acti- interleukin-2 gene transcription. Adv. vation. Science 243:355–61 Protein Phosphatases 7:543–83 8. Kelly K, Siebenlist U. 1995. Immediate- 17. Bierer BE, Holländer G, Fruman D, early genes induced by antigen receptor Burakoff SJ. 1993. Cyclosporin A and stimulation. Curr. Opin. Immunol. 7:327– FK506: molecular mechanisms of im- 32 munosuppression and probes for trans- 9. Cockerill GW, Bert AG, Ryan GR, Gam- plantation biology. Curr. Opin. Immunol. ble JR, Vadas MA, Cockerill PN. 1995. 5:763–73 Regulation of granulocyte-macrophage 18. Wiederrecht G, Etzkorn F. 1994. The im- colony-stimulating factor and E-selectin munophilins. Perspec. Drug Discovery expression in endothelial cells by cy- Design 2:57–84 closporin A and the T-cell transcription 19. Masuda ES, Naito Y, Arai K-I, Arai N.

Annu. Rev. Immunol. 1997.15:707-747. Downloaded from www.annualreviews.org factor NFAT. Blood 86:2689–98 1993. Expression of lymphokine genes in 10. Leonard DG, Ziff EB, Greene LA. 1987. T cells. The Immunologist 1:198–203

Access provided by University of Wisconsin - Milwaukee on 12/04/17. For personal use only. Identification and characterization of m- 20. Shaw J-P, Utz PJ, Durand DB, Toole JJ, RNAs regulated by nerve growth factor in Emmel EA, Crabtree GR. 1988. Identifi- PC12 cells. Mol. Cell. Biol. 7:3156–67 cation of a putative regulator of early T 11. Schreiber SL, Crabtree GR. 1992. The cell activation genes. Science 241:202–5 mechanism of action of cyclosporin A and 21. Mattila PS, Ullman KS, Fiering S, FK506. Immunol. Today 13:136–42 Emmel EA, McCutcheon M, Crabtree 12. Sigal NH, Dumont FJ. 1992. Cyclosporin GR, Herzenberg LA. 1990. The action of A, FK-506, and rapamycin: pharmaco- cyclosporin A and FK506 suggest a novel logic probes of lymphocyte signal trans- step in the activation of T lymphocytes. duction. Annu. Rev. Immunol. 10:519–60 EMBO J. 9:4425–33 13. Sigal NH, Dumont F, Durette P, Siekierka 22. Flanagan MW, Corthésy B, Bram RJ,

P1: MBL/plb P2: MBL/rsk QC: MBL/uks T1: MBL February 12, 1997 16:24 Annual Reviews AR026-27 AR26-27

NFAT FAMILY TRANSCRIPTION FACTORS 739

Crabtree GR. 1991. Nuclear association Li X, Francke U, Crabtree GR. 1995. of a T-cell transcription factor blocked NFATc3, a lymphoid-specific NFATc by FK-506 and cyclosporin A. Nature family member that is calcium-regulated 352:803–7 and exhibits distinct DNA binding speci- 23. Jain J, McCaffrey PG, Miner Z, Kerppola ficity. J. Biol. Chem. 270:19898–907 TK, Lambert JN, Verdine GL, Curran T, 34. Park J, Takeuchi A, Sharma S. 1996. Rao A. 1993. The T-cell transcription fac- Characterization of a new isoform of the tor NFATp is a substrate for calcineurin NFAT (nuclear factor of activated T cells) and interacts with Fos and Jun. Nature gene family member NFATc. J. Biol. 365:352–55 Chem. 34:29014–21 24. McCaffrey PG, Luo C, Kerppola TK, Jain 35. Weiss MJ, Orkin SH. 1995. GATA tran- J, Badalian TM, Ho AM, Burgeon E, Lane scription factors: key regulators of hema- WS, Lambert J, N., Curran T, VerdineGL, topoiesis. Exp. Hematol. 23:99–107 Rao A, Hogan PG. 1993. Isolation of the 36. Schindler C, Darnell JE, Jr. 1995. cyclosporin-sensitive T cell transcription Transcriptional responses to polypeptide factor NFATp. Science 262:750–54 ligands: the JAK-STAT pathway. Annu. 25. Northrop JP, Ho SN, Chen L, Thomas Rev. Biochem. 64:621–51 DJ, Timmerman LA, Nolan GP, Admon 37. Jain J, Burgeon E, Badalian TM, Hogan A, Crabtree GR. 1994. NF-AT compo- PG, Rao A. 1995. A similar DNA-binding nents define a family of transcription fac- motif in NFAT family proteins and the tors targeted in T-cell activation. Nature Rel homology region. J. Biol. Chem. 369:497–502 270:4138–45 26. Tokumitsu H, Masuda ES, Tsuboi A, Arai 38. Nolan GP. 1994. NF-AT-AP-1 and Rel- K-I, Arai N. 1993. Purification of the 120 bZIP: hybrid vigor and binding under the kDa component of the human nuclear fac- influence. Cell 77:795–98 tor of activated T cells (NF-AT). Biochem. 39. Chytil M, Verdine GL. 1996. The Rel Biophys. Res. Comm. 196:737–44 family of eukaryotic transcription factors. 27. Jain J, Miner Z, Rao A. 1993. Analysis Curr. Opin. Struct. Biol. 6:91–100 of the preexisting and nuclear forms of 40. Luo C, Shaw KTY, Raghavan A, Aram- nuclear factor of activated T cells. J. Im- buru J, Garcia-Cozar F, Perrino BA, munol. 151:837–48 Hogan PG, Rao A. 1996. Interaction of 28. McCaffrey PG, Perrino BA, Soderling calcineurin with a domain of the tran- TR, Rao A. 1993. NF-ATp, a T lympho- scription factor NFAT1 that controls nu- cyte DNA-binding protein that is a tar- clear import. Proc. Natl. Acad. Sci. USA get for calcineurin and immunosuppres- 93:8907–12 sive drugs. J. Biol. Chem. 268:3747–52 41. Luo C, Burgeon E, Rao A. 1996. Mech- 29. Northrop JP, Ullman KS, Crabtree GR. anisms of transactivation by nuclear fac- 1993. Characterization of the nuclear tor of activated T cells-1. J. Exp. Med. and cytoplasmic components of the 184:141–47 lymphoid-specific nuclear factor of acti- 42. Wang DZ, McCaffrey PG, Rao A. 1995. vated T cells (NF-AT) complex. J. Biol. The cyclosporin-sensitive transcription Chem. 268:2917–23 factor NFATp is expressed in several 30. Luo C, Burgeon E, Carew JA, Badalian classes of cells in the immune system. TM, McCaffrey PG, Lane WS, Hogan Ann. N. Y. Acad. Sci. 766:182–94 PG, Rao A. 1996. Recombinant NFAT1 43. Ruff VA, Leach KL. 1995. Direct demon- (NFATp) is regulated by calcineurin in stration of NFATp dephosphorylation and T cells and mediates the transcription of nuclear localization in activated HT-2 several cytokine genes. Mol. Cell. Biol. cells using a specific NFATp polyclonal Annu. Rev. Immunol. 1997.15:707-747. Downloaded from www.annualreviews.org 16:3955–66 antibody. J. Biol. Chem. 270:22602–7 31. Hoey T, Sun Y-L, Williamson K, Xu 44. Aramburu J, Azzoni L, Rao A, Perussia

Access provided by University of Wisconsin - Milwaukee on 12/04/17. For personal use only. X. 1995. Isolation of two new members B. 1995. Activation and expression of the of the NFAT gene family and functional nuclear factor of activated T cells, NFATp characterization of the NFAT proteins. and NFATc, in human natural killer cells: Immunity 2:461–72 regulation upon CD16 ligand binding. J. 32. Masuda E, Naito Y, Tokumitsu H, Camp- Exp. Med. 182:801–10 bell D, Saito F, Hannum C, Arai K-I, Arai 45. Ho AM, Jain J, Rao A, Hogan PG. N. 1995. NFATx, a novel member of the 1994. Expression of the transcription fac- NFAT family that is expressed predom- tor NFATp in a neuronal cell line and in inantly in the thymus. Mol. Cell. Biol. the murine nervous system. J. Biol. Chem. 15:2697–706 269:28,181–86 33. Ho SN, Thomas DJ, Timmerman LA, 46. Rutherford SL, Zuker CS. 1994. Protein

P1: MBL/plb P2: MBL/rsk QC: MBL/uks T1: MBL February 12, 1997 16:24 Annual Reviews AR026-27 AR26-27

740 RAO, LUO & HOGAN

folding and the regulation of signaling necrosis factor α gene induction in stimu- pathways. Cell 79:1129–32 lated T and B cells. J. Exp. Med. 180:763– 47. Woronicz JD, Lina A, Calnan BJ, Szy- 68 chowski S, Cheng L, Winoto A. 1995. 58. Tsuboi A, Masuda ES, Naito Y, Tokumi- Regulation of thr Nur77 orphan steroid tsu H, Arai K-I, Arai N. 1994. Calcineurin receptor in activation-induced apoptosis. potentiates activation of the granulocyte- Mol. Cell. Biol. 15:6364–76 macrophage colony-stimulating factor 48. Wesselborg S, Fruman DA, Sagoo JK, gene in T cells: involvement of the con- Bierer BE, Burakoff SJ. 1996. Identifica- served lymphokine element 0. Mol. Biol. tion of a physical interaction between cal- Cell 5: 119–28 cineurin and nuclear factor of activated T 59. Jenkins F, Cockerill PN, Bohmann D, cells (NFATp). J. Biol. Chem. 271:1274– Shannon MF. 1995. Multiple signals 77 are required for function of the hu- 49. Park J, Yaseen NR, Hogan PG, Rao man granulocyte-macrophage colony- A, Sharma S. 1995. Phosphorylation of stimulating factor gene promoter in T the transcription factor NFATp inhibits cells. J. Immunol. 155:1240–51 its DNA binding activity in cyclosporin 60. Fruman DA, Pai S-Y, Burakoff SJ, Bierer A-treated human B and T cells. J. Biol. BE. 1995. Characterization of a mu- Chem. 270:20653–59 tant calcineurin Aα gene expressed by 50. Shaw KT-Y, Ho AM, Raghavan A, Kim EL4 lymphoma cells. Mol. Cell. Biol. J, Jain J, Park J, Sharma S, Rao A, Hogan 15:3857–63 PG. 1995. Immunosuppressive drugs pre- 61. Muramatsu T, Kincaid RL. 1996. In- vent a rapid dephosphorylation of the hibition of NF-AT signal transduction transcription factor NFAT1 in stimulated events by a dominant-negative form of immune cells. Proc. Natl. Acad. Sci. USA calcineurin. Biochem. Biophys. Res. Com- 92:11205–9 mun. 218:466–72 51. Loh C, Shaw KT-Y, Carew J, Viola JPB, 62. Zhang W, Zimmer G, Chen J, Ladd D, Luo C, Perrino BA, Rao A. 1996. Cal- Li E, Alt FW, Wiederrecht G, Cryan J, cineurin binds the transcription factor O’Neill EA, Seidman CE, Abbas AK, Sei- NFAT1 and reversibly regulates its activ- dman JG. 1996. T cell responses in cal- ity. J. Biol. Chem. 271:10884–91 cineurin Aα-deficient mice. J. Exp. Med. 52. Loh C, Carew JA, Kim J, Hogan PG, Rao 183:413–20 A. 1996. T-cell receptor stimulation elic- 63. Putney JWJ. 1990. Capacitative calcium its an early phase of activation and a later entry revisited. Cell Calcium 11:611–24 phase of deactivation of the transcription 64. Clapham DE. 1995. Calcium signaling. factor NFAT1. Mol. Cell. Biol. 16:3945– Cell 80:259–68 54 65. Lewis RS, Cahalan MD. 1995. Potas- 53. Shibasaki F, Price ER, Milan D, McKeon sium and calcium channels in lympho- F. 1996. Role of kinases and the phos- cytes. Annu. Rev. Immunol. 13:623–53 phatase calcineurin in the nuclear shut- 66. Boss V, Talpade DJ, Murphy TJ. 1996. tling of transcription factor NF-AT4. Na- Induction of NFAT-mediated transcrip- ture 382:370–73 tion by Gq-coupled receptors in lymphoid 54. O’Keefe SJ, Tamura J, Kincaid RL, and non-lymphoid cells. J. Biol. Chem. Tocci MJ, O’Neill EA. 1992. FK- 271:10429–32 506- and CsA-sensitive activation of the 67. Mason MJ, Grinstein G. 1993. Ionomycin 2 interleukin-2 promoter by calcineurin. activates electrogenic Ca + influx in rat Nature 357:692–94 thymic lymphocytes. Biochem. J. 296:33–

Annu. Rev. Immunol. 1997.15:707-747. Downloaded from www.annualreviews.org 55. Clipstone NA, Crabtree GR. 1992. Iden- 39 tification of calcineurin as a key signaling 68. Morgan AJ, Jacob R. 1994. Ionomcyin en- 2 Access provided by University of Wisconsin - Milwaukee on 12/04/17. For personal use only. enzyme in T-lymphocyte activation. Na- hances Ca + influx by stimulating store- ture 357:695–97 regulated cation entry and not by a direct 56. Kubo M, Kincaid RL, Webb DR, Ran- action at the plasma membrane. Biochem. 2 som JT. 1994. The Ca +/calmodulin- J. 300:665–72 activated, phosphoprotein phosphatase 69. Serafini AT, Lewis RS, Clipstone NA, calcineurin is sufficient for positive tran- Bram RJ, Fanger C, Fiering S, Herzen- scriptional regulation of the mouse IL-4 berg LA, Crabtree GR. 1995. Isolation of gene. Int. Immunol. 6:179–88 mutant T lymphocytes with defects in ca- 57. Goldfeld AE, Tsai E, Kincaid R, Belshaw pacitative calcium entry. Immunity 3:239– PJ, Schreiber SL, Strominger JL, Rao A. 50 1994. Calcineurin mediates human tumor 70. Fanger CM, Hoth M, Crabtree GR, Lewis

P1: MBL/plb P2: MBL/rsk QC: MBL/uks T1: MBL February 12, 1997 16:24 Annual Reviews AR026-27 AR26-27

NFAT FAMILY TRANSCRIPTION FACTORS 741

RS. 1995. Characterization of T cell mu- signaling. Curr. Opin. Immunol. 7:306– tants with defects in capacitative calcium 11 entry: genetic evidence for the physiolog- 82. Howe LR, Weiss A. 1995. Multiple ki- ical roles of CRAC channels. J. Cell Biol. nases mediate T-cell-receptor signaling. 131:655–67 Trends Biochem. Sci. 20:59–64 71. Negulescu PA, Shastri N, Cahalan MD. 83. Carrera AC, Paradis H, Borlado LR, 1994. Intracellular calcium dependence Roberts TM, Martinez-A C. 1995. Lck of gene expression in single T lympho- unique domain influences Lck specificity cytes. Proc. Natl. Acad. Sci. USA 91: and biological function. J. Biol. Chem. 2873–77 270:3385–91 72. Mulkey RM, Endo S, Shenolikar S, 84. Qian D, Mollenauer MN, Weiss A. 1996. Malenka RC. 1994. Involvement of a Dominant-negative Zeta-associated pro- calcineurin/inhibitor-1 phosphatase cas- tein 70 inhibits T cell antigen receptor sig- cade in hippocampal long-term depres- naling. J. Exp. Med. 183:611–20 sion. Nature 369:486–88 85. Katzav S, Sutherland M, Packham G, Yi 73. Xanthoudakis S, Viola JPB, Shaw KTY, T, Weiss A. 1994. The protein tyrosine Luo C, Wallace JD, Bozza PT, Luk DC, kinase ZAP-70 can associate with the Curran T, Rao A. 1996. An enhanced im- SH2 domain of proto-Vav. J. Biol. Chem. mune response in mice lacking the trans- 269:32579–85 cription factor NFAT1. Science 272:892– 85a. Wu J, Motto DG, Koretzky GA, Weiss A. 95 1996. Vav and SLP-76 interact and func- 74. Ghosh P, Sica A, Cippitelli M, Subleski J, tionally cooperate in IL-2 gene activation. Lahesmaa R, Young HA, Rice NR. 1996. Immunity 4:593–602 Activation of nuclear factor of activated T 86. Wu J, Katzav S, Weiss A. 1995. A func- cells in a cyclosporin A-resistant pathway. tional T-cell receptor signaling pathway J. Biol. Chem. 271:7700–4 is required for p95vav activity. Mol. Cell. 75. Hubbard MJ, Cohen P. 1993. On target Biol. 15:4337–46 87. Woodrow M, Clipstone NA, Cantrell D. with a new mechanism for the regula- ras tion of protein phosphorylation. Trends 1993. p21 and calcineurin synergize to Biochem. Sci. 18:172–77 regulate the nuclear factor of activated T 76. Cameron AM, Steiner JP, Roskams AJ, cells. J. Exp. Med. 178:1517–22 88. Genot E, Cleverley S, Henning S, Cantrell Ali SM, Ronnett GV, Snyder SH. 1995. ras Calcineurin associated with the inosi- D. 1996. Multiple p21 effector path- tol 1,4,5-trisphophate receptor-FKBP12 ways regulate nuclear factor of activated 2 T cells. EMBO J. 15:3912–22 complex modulates Ca + flux. Cell 83: 89. Coso OA, Chiariello M, YuJ-C, Teramoto 463–72 H, Crespo P, Xu N, Miki T, Gutkind JS. 77. Coghlan VM, Perrino BA, Howard M, 1995. The small GTP-binding proteins Langeberg LK, Hicks JB, Gallatin WM, Rac1 and Cdc42 regulate the activity of Scott JD. 1995. Association of protein the JNK/SAPK signaling pathway. Cell kinase A and protein phosphatase 2B 81:1137–46 with a common anchoring protein. Sci- 90. Coso OA, Teramoto H, Simonds WF, ence 267:108–11 Gutkind JS. 1996. Signaling from G 78. Faux MC, Scott JD. 1996. Molecular protein-coupled receptors to c-Jun ki- glue: kinase anchoring and scaffold pro- nase involves βγ subunits of het- teins. Cell 85:9–12 erotrimeric G proteins acting on a Ras and 79. James P, Vorherr T, Carafoli E. 1995. Rac1-dependent pathway. J. Biol. Chem. Calmodulin-binding domains: just two 271:3963–66 Annu. Rev. Immunol. 1997.15:707-747. Downloaded from www.annualreviews.org faced or multi-faceted? Trends Biochem. 91. Hill CS, Wynne J, Treisman R. 1995. The Sci. 20:38–42 Rho family GTPases RhoA, Rac1, and

Access provided by University of Wisconsin - Milwaukee on 12/04/17. For personal use only. 80. Kissinger CR, Parge HE, Knighton DR, CDC42Hs regulate trnscriptional activity Lewis CT, Pelletier LA, Tempczyk A, by SRF. Cell 81:1159–70 Kalish VJ, Tucker KD, Showalter RE, 92. Minden A, Lin A, Claret F-X, Abo A, Moomaw EW, Gastinel LN, Habuka Karin M. 1995. Selective activation of the N, Chen X, Maldonado F, Barker JE, JNK signaling cascade and c-Jun tran- Bacquet R, Villafranca JE. 1995. Crys- scriptional activity by the small GTPases tal structures of human calcineurin and Rac and Cdc42Hs. Cell 81:1147–57 the human FKPB12-FK506-calcineurin 93. Olson MF, Ashworth A, Hall A. 1995. An complex. Nature 378:641–44 essential role for Rho, Rac, and Cdc42 81. Bolen JB. 1995. Protein tyrosine ki- GTPases in cell cycle progression through nases in the initiation of antigen receptor G1. Science 269:1270–72

P1: MBL/plb P2: MBL/rsk QC: MBL/uks T1: MBL February 12, 1997 16:24 Annual Reviews AR026-27 AR26-27

742 RAO, LUO & HOGAN

94. Qiu R-G, Chen J, Kirn D, McCormick Schwartz RH. 1995. Regulation of inter- F, Symons M. 1995. An essential role leukin 2 gene expression by CD28 cos- for Rac in Ras transformation. Nature timulation in mouse T-cell clones: both 374:457–59 nuclear and cytoplasmic RNAs are reg- 95. Su B, Karin M. 1996. Mitogen-activated ulated with complex kinetics. Mol. Cell. protein kinase cascades and regulation of Biol. 15:3197–205 gene expression. Curr. Opin. Immunol. 107. Fraser JD, Irving BA, Crabtree GR, Weiss 8:402–11 A. 1991. Regulation of interleukin-2 gene 96. Whitehurst CE, Geppert TD. 1996. enhancer activity by the T cell accessory MEK1 and the extracellular signal- molecule CD28. Science 251:313–16 regulated kinases are required for the 108. Fraser JD, Weiss A. 1992. Regulation of stimulation of IL-2 gene transcription in T-cell lymphokine gene transcription by T cells. J. Immunol. 156:1020–29 the accessory molecule CD28. Mol. Cell. 97. Nghiem P, Ollick T, Gardner P, Schul- Biol. 12:4357–63 man H. 1994. Interleukin-2 trans- 109. Ghosh P, Tan T-H, Rice NR, Sica A, criptional block by multifunctional Young HA. 1993. The interleukin 2 2 CD28-responsive complex contains at Ca +/calmodulin kinase. Nature 371: 347–50 least three members of the NF κB family: 98. Hama N, Paliogianni F, Fessler BJ, c-Rel, p50, and p65. Proc. Natl. Acad. Sci. Boumpas DT. 1995. Calcium/calmo- USA 90:1696–700 dulin-dependent protein kinase II down- 110. Bryan RG, Li Y, Lai J-H, Van M, Rice regulates both calcineurin and protein ki- NR, Rich RR, Tan T-H. 1994. Effect of nase C-mediated pathways for cytokine CD28 signal transduction on c-Rel in hu- gene transcription in human T cells. J. man peripheral blood T cells. Mol. Cell. Exp. Med. 181:1217–22 Biol. 14:7933–42 99. Ho N, Gullberg M, Chatila T. 1996. Ac- 111. Lai J-H, Horvath G, Subleski J, Bruder J, tivation protein 1-dependent transcrip- Ghosh P, Tan T-H. 1995. RelA is a po- tional activation of interleukin 2 gene by tent transcriptional activator of the CD28 2 response element within the interleukin 2 Ca +/calmodulin kinase type IV/Gr. J. promoter. Mol. Cell. Biol. 15:4260–71 Exp. Med. 184:101–12 112. Rooney JW, Sun Y-L,Glimcher LH, Hoey 100. Miranti CK, Ginty DD, Huang G, Chatila T. 1995. Novel NFAT sites that mediate T, Greenberg ME. 1995. Calcium ac- activation of the interleukin-2 promoter tivates serum response factor-dependent in response to T-cell receptor stimulation. transcription by a Ras- and Elk-1- Mol. Cell. Biol. 15:6299–310 independent mechanism that involves a 113. Good L, Maggirwar SB, Sun S-C. 1996. 2 Ca +/calmodulin-dependent kinase. Mol. Activation of the IL-2 gene promoter by Cell. Biol. 15:3672–84 HTLV-1 Tax involves induction of NF-AT 101. Schulman H. 1993. The multifunctional complexes bound to the CD28-responsive 2 Ca +/calmodulin-dependent protein ki- element. EMBO J. 15:3744–50 nases. Curr. Opin. Cell Biol. 5:247–53 114. Civil A, Bakker A, Rensink I, Doerre S, 102. Bram RJ, Crabtree GR. 1994. Calcium Aarden LA, Verweij CL. 1996. Nuclear signalling in T cells stimulated by a appearance of a factor that binds the CD28 cyclophilin B-binding protein. Nature response element within the interleukin- 371:355–58 2 enhancer correlates with interleukin-2 103. Lenschow DJ, Walunas TL, Bluestone JA. production. J. Biol. Chem. 271:8321–27 1996. CD28/B7 system of T cell costim- 115. Himes SR, Katsikeros R, Shannon MF. ulation. Annu. Rev. Immunol. 14:233–58 1996. Constimulation of cytokine gene Annu. Rev. Immunol. 1997.15:707-747. Downloaded from www.annualreviews.org 104. Thompson CB, Lindsten T, Ledbetter expression in T cells by the human T JA, Kunkel SL, Young HA, Emerson leukemia/lymphotropic virus type 1 trans

Access provided by University of Wisconsin - Milwaukee on 12/04/17. For personal use only. SG, Leiden JM, June CH. 1989. CD28 activator Tax. J. Virol. 70:4001–8 activation pathway regulates the pro- 116. June CH, Bluestone JA, Nadler LM, duction of multiple T-cell-derived lym- Thompson CB. 1994. The B7 and phokines/cytokines. Proc. Natl. Acad. CD28 receptor families. Immunol. Today Sci. USA 86:1333–37 15:321–31 105. Lindsten T, June CH, Ledbetter JA, Stella 117. Nun`es JA, Collette Y, Truneh A, Olive G, Thompson CB. 1989. Regulation of D, Cantrell DA. 1994. The role of p21ras lymphokine messenger RNA stability by in CD28 signal transduction: triggering a surface-mediated T cell activation path- of CD28 with antibodies, but not the lig- way. Science 244:339–43 and B7–1, activates p21ras. J. Exp. Med. 106. Umlauf SW, Beverly B, Lantz O, 180:1067–76

P1: MBL/plb P2: MBL/rsk QC: MBL/uks T1: MBL February 12, 1997 16:24 Annual Reviews AR026-27 AR26-27

NFAT FAMILY TRANSCRIPTION FACTORS 743

118. June CH, Ledbetter JA, Gillespie MM, the inducible activity of the interleukin- Lindsten T, Thompson CB. 1987. T-cell 2 gene in T cells through a noncanoni- proliferation involving the CD28 pathway cal octamer-binding site. Mol. Cell. Biol. is associated with cyclosporine-resistant 13:1155–62 interleukin 2 gene expression. Mol. Cell. 128. Felli MP, Vacca A, Meco D, Screpanti Biol. 7:4472–81 I, Farina AR, Maroder M, Martinotti S, 119. Chen D, Rothenberg EV. 1994. Inter- Petrangeli E, Frati L, Gulino A. 1991. leukin-2 transcription factors as molec- Retinoic acid-induced down-regulation ular targets of cAMP inhibition: de- of the interleukin-2 promoter via cis- layed inhibition kinetics and combina- regulatory sequences containing an oc- torial transcription roles. J. Exp. Med. tamer motif. Mol. Cell. Biol. 11:4771– 179:931–42 78 120. Lacour M, Arrighi J-F, Müller KM, Carl- 129. Alroy I, Towers TL, Freedman LP. berg C, Saurat J-H, Hauser C. 1994. 1995. Transcriptional repression of the cAMP up-regulates IL-4 and IL-5 produc- interleukin-2 gene by vitamin D3: direct tion from activated CD4 T cells while inhibition of NFATp/AP-1 complex for- decreasing IL-2 release and+ NF-ATinduc- mation by a nuclear hormone receptor. tion. Int. Immunol. 6:1333–43 Mol. Cell. Biol. 15:5789–99 121. Neumann M, Grieshammer T, Chuvpilo 130. Novak TJ, Chen D, Rothenberg EV.1990. S, Kneitz B, Lohoff M, Schimpl A, Franza Interleukin-1 synergy with phosphoinosi- BR, Jr., Serfling E. 1995. RelA/p65 is a tide pathway agonists for induction of molecular target for the immunosuppres- interlekin-2 gene expression: molecular sive action of protein kinase A. EMBO J. basis of costimulation. Mol. Cell. Biol. 14:1991–2004 10:6325–34 122. Tsuruta L, Lee H-J, Masuda ES, Koyano- 131. Rao A. 1991. Signaling mechanisms in T Nakagawa N, Arai N, Arai K-I, Yokota T. cells. Critical Rev. Immunol. 10:495–519 1995. Cyclic AMP inhibits expression of 132. Barton K, Muthusamy N, Chanyangam the IL-2 gene through the nuclear factor of M, Fischer C, Clendenin C, Leiden JM. activated T cells (NF-AT) site, and trans- 1996. Defective thymocyte proliferation fection of NF-AT cDNAs abrogates the and IL-2 production in transgenic mice sensitivity of EL-4 cells to cyclic AMP. J. expressing a dominant-negative form of Immunol. 154:5255–64 CREB. Nature 379:81–85 123. Paliogianni F, Boumpas DT. 1996. 133. Brindle F, Nakajima T, Montminy M. Prostaglandin E2 inhibits the nuclear tran- 1995. Multiple protein kinase A-regulated scription of the human interleukin 2, but events are required for transcriptional in- not the IL-4, gene in human T cells by duction by cAMP. Proc. Natl. Acad. Sci. targeting transcription factors AP-1 and USA 92:10,521–25 NF-AT. Cell. Immunol. 171:95–101 134. Müller CW, Rey FA, Sodeoka M, Verdine 124. Vacca A, Felli MP, Farina AR, Martinotti GL, Harrison SC. 1995. Structure of the S, Maroder M, Screpanti I, Meco D, NF-κB p50 homodimer bound to DNA. Petrangeli E, Frati L, Gulino A. 1992. Nature 373:311–17 Glucocorticoid receptor-mediated sup- 135. Ghosh G, Van Duyne G, Ghosh S, Sigler pression of the interleukin 2 gene expres- PB. 1995. Structure of NF-κB p50 ho- sion through impairment of the coopera- modimer bound to a κB site. Nature tivity between nuclear factor of activated 373:303–10 T cells and AP-1 enhancer elements. J. 136. McCaffrey PG, Goldfeld AE, Rao A. Exp. Med. 175:637–46 1994. The role of NFATp in cyclosporin 125. Northrop JP, Crabtree GR, Mattila PS. A-sensitive tumor necrosis factor-α gene Annu. Rev. Immunol. 1997.15:707-747. Downloaded from www.annualreviews.org 1992. Negative regulation of interleukin transcription. J. Biol. Chem. 269:30445– 2 transcription by the glucocorticoid re- 50

Access provided by University of Wisconsin - Milwaukee on 12/04/17. For personal use only. ceptor. J. Exp. Med. 175:1235–45 137. Tsai EY, Yie J, Thanos D, Goldfeld AE. 126. Paliogianni F, Raptis A, Ahuja SS, Najjar 1996. Cell-type speciﬁc regulation of the SM, Boumpas DT. 1993. Negative tran- human TNF-α gene in B cells and T scriptional regulation of human inter- cells by NFATp and ATF-2/Jun. Mol. Cell. leukin 2 (IL-2) gene by glucocorticoids Biol. 16:459–67 through interference with nuclear tran- 138. Cress WD, Triezenberg SJ. 1991. Critical scription factors AP-1 and NF-AT. J. Clin. structural elements of the VP16 transcrip- Invest. 91:1481–89 tional activation domain. Science 251:87– 127. Brabletz T, Pfeuffer I, Schorr E, Siebelt F, 90 Wirth T, Serﬂing E. 1993. Transforming 139. Schmitz ML, dos Santos Silva MA, Alt- growth factor β and cyclosporin A inhibit mann H, Czisch M, Holak TA, Baeuerle

P1: MBL/plb P2: MBL/rsk QC: MBL/uks T1: MBL February 12, 1997 16:24 Annual Reviews AR026-27 AR26-27

744 RAO, LUO & HOGAN

PA. 1994. Structural and functional anal- clear factor of activated T cells-binding ysis of the NF-κB p65 C terminus. J. Biol. motifs which require AP-1 binding for Chem. 269:25613–20 activation of transcription. J. Biol. Chem. 140. Chen L, Oakley MG, Glover JNM, Jain 271:3763–70 J, Dervan PB, Hogan PG, Rao A, Ver- 151. Schubert LA, King G, Cron RQ, Lewis dine GL. 1995. Only one of the two DNA- DB, Aruffo A, Hollenbaugh D. 1995. The bound orientations of AP-1 found in solu- human gp39 promoter. J. Biol. Chem. tion cooperates with NFATp. Current Bi- 270:29624–27 ology 5:882–89 152. Ho I-C, Hodge MR, Rooney JW, 141. Cockerill PN, Bert AG, Jenkins F, Ryan Glimcher LH. 1996. The proto-oncogene GR, Shannon MF, Vadas MA. 1995. c-maf is responsible for tissue-specific ex- Human granulocyte-macrophage colony- pression of interleukin-4. Cell 85:973– stimulating factor enhancer function is as- 83 sociated with cooperative interactions be- 153. Goldfeld AE, McCaffrey PG, Strominger tween AP-1 and NFATp/c. Mol. Cell. Biol. JL, Rao A. 1993. Identification of a novel 15:2071–79 cyclosporin-sensitive element in the hu- 142. Visvader JE, Crossley M, Hill J, Orkin man tumor necrosis factor α gene pro- SH, Adams JM. 1995. The C-terminal moter. J. Exp. Med. 178:1365–79 zinc finger of GATA-1 or GATA-2 is suf- 154. Tsai EY, Jain J, Pesavento PA, Rao A, ficient to induce megakaryocyte differen- Goldfeld AE. 1996. Tumor necrosis factor tiation of an early myeloid cell line. Mol. α gene regulation in activated T cells in- Cell. Biol. 15:634–41 volves ATF-2/Jun and NFATp. Mol. Cell. 143. Tapscott SJ, Davis RL, Thayer MJ, Cheng Biol. 16:459–67 P-F, Weintraub H, Lassar AB. 1988. 155. Okamoto S-I, Mukaida N, Yasumoto MyoD1: a nuclear phosphoprotein re- K, Rice N, Ishikawa Y, Horiguchi H, quiring a Myc homology region to con- Murakami S, Matsushima K. 1994. The vert fibroblasts to myoblasts. Science interleukin-8 AP-1 and κB-like sites are 242:405–11 genetic end targets of FK506-sensitive 144. Bassuk AG, Leiden JM. 1995. A direct pathway accompanied by calcium mobi- physical association between ETS and lization. J. Biol. Chem. 269:8582–89 AP-1 transcription factors in normal hu- 156. Nabel G, Baltimore D. 1987. An inducible man T cells. Immunity 3:223–37 transcription factor activates expression 145. Stein B, Baldwin AS Jr, Ballard DW, of human immunodeficiency virus in T Greene WC, Angel P, Herrlich P. 1993. cells. Science 326:711–13 Cross-coupling of the NF-κB p65 and 157. Whitley MZ, Thanos D, Read MA, Fos/Jun transcription factors produces po- Maniatis T, Collins T. 1994. A striking tentiated biological function. EMBO J. similarity in the organization of the E- 12:3879–91 selectin and beta interferon gene promot- 146. Stein B, Cogswell PC, Baldwin AS, Jr. ers. Mol. Cell. Biol. 14:6464–75 1993. Functional and physical associa- 158. Civil A, Geerts M, Aarden LA, Verweij tions between NF-κB and C/EBP family CL. 1992. Evidence for a role of CD28RE members: a Rel domain-bZIP interaction. as a response element for distinct mito- Mol. Cell. Biol. 13:3964–74 genic T cell activation signals. Eur. J. Im- 147. Yang-Yen H-F, Chambard J-C, Sun Y-L, munol. 22:3041–43 Smeal T, Schmidt TJ, Drouin J, Karin 159. Siebenlist U, Franzoso G, Brown K. 1994. M. 1990. Transcriptional interference be- Structure, regulation and function of NF- tween c-Jun and the glucocorticoid recep- κB. Annu. Rev. Cell. Biol. 10:405–55 tor: mutual inhibition of DNA binding 160. Baldwin AS, Jr. 1996. The NF-κB and Annu. Rev. Immunol. 1997.15:707-747. Downloaded from www.annualreviews.org due to direct protein-protein interaction. IκB proteins: new discoveries and in- Cell 62:1205–15 sights. Annu. Rev. Immunol. 14:649–81

Access provided by University of Wisconsin - Milwaukee on 12/04/17. For personal use only. 148. Su B, Jacinto E, Hibi M, Kallunki T, Karin 161. Casolaro V, Georas SN, Song Z, Zubkoff M, Ben-Neriah Y. 1994. JNK is involved ID, Abdulkadir SA, Thanos D, Ono in signal integration during costimulation SJ. 1995. Inhibition of NF-AT-dependent of T lymphocytes. Cell 77:727–36 transcription by NF-κB: implications for 149. Rincón M, Flavell RA. 1994. AP-1 tran- differential gene expression in T helper scriptional activity requires both T-cell cell subsets. Proc. Natl. Acad. Sci. USA receptor-mediated and co-stimulatory 92:11623–27 signals in primary T lymphocytes. EMBO 162. Randak C, Brabletz T, Hergenröther M, J. 13:4370–81 Sobotta I, Serfling E. 1990. Cyclosporin 150. Tsytsykova AV, Tsitsikov EN, Geha RS. A suppresses the expression of the inter- 1996. The CD40L promoter contains nu- leukin 2 gene by inhibiting the binding

P1: MBL/plb P2: MBL/rsk QC: MBL/uks T1: MBL February 12, 1997 16:24 Annual Reviews AR026-27 AR26-27

NFAT FAMILY TRANSCRIPTION FACTORS 745

of lymphocyte-specific factors to the IL-2 174. Yamagata T, Nishida J, Sakai R, Tanaka enhancer. EMBO J. 9:2529–36 T, Honda H, Hirano N, Mano H, Yazaki Y, 163. Brabletz T, Pietrowski I, Serfling E. 1991. Hirai H. 1995. Of the GATA-binding pro- The immunosuppressives FK506 and cy- teins, only GATA-4 selectively regulates closporin A inhibit the generation of pro- the human interleukin-5 gene promoter in tein factors binding to the two purine interleukin-5 producing cells which ex- boxes of the interleukin 2 enhancer. Nu- press multiple GATA-binding proteins. cleic Acids Res. 19:61–67 Mol. Cell. Biol. 15:3830–39 164. Szabo SJ, Gold JS, Murphy TL, Mur- 175. Siegel MD, Zhang D-H, Ray P, Ray A. phy KM. 1993. Identification of cis- 1995. Activation of the interleukin-5 pro- acting regulatory elements controlling moter by cAMP in murine EL-4 cells re- interleukin-4 gene expression in T cells: quires the GATA-3 and CLE0 elements. roles for NF-Y and NF-ATc. Mol. Cell. J. Biol. Chem. 270:24548–55 Biol. 13:4793–805 176. Hodge MR, Ranger AM, de la Brousse 165. Chuvpilo S, Schomberg C, Gerwig R, FC, Hoey T, Grusby M, Glimcher LH. Heinfling A, Reeves R, Grummt F, Ser- 1996. Hyperproliferation and dysregu- fling E. 1993. Multiple closely-linked lation of IL-4 expression in NF-ATp- NFAT/octamer and HMG I(Y) binding deficient mice. Immunity 4:397–405 sites are part of the interleukin-4 pro- 177. Venkataraman L, Francis DA, Wang Z, moter. Nucleic Acids Res. 21:5694–704 Liu J, Rothstein TL, Sen R. 1994. Cy- 166. Fiering S, Northrop JP, Nolan GP, Mattila closporin A-sensitive induction of NF-AT PS, Crabtree GR, Herzenberg LA. 1990. in murine B cells. Immunity 1:189–96 Single cell assay of a transcription factor 178. Choi MSK, Brines RD, Holman MJ, reveals a threshold in transcription acti- Klaus GGB. 1994. Induction of NF- vated by signals emanating from the T-cell AT in normal B lymphocytes by anti- antigen receptor. Genes Dev. 4:1823–34 immunoglobulin or CD40 ligand in con- 167. Garrity PA, Chen D, Rothenberg EV, junction with IL-4. Immunity 1:179–87 Wold BJ. 1994. Interleukin-2 transcrip- 179. Yaseen NR, Maizel AL, Wang F, Sharma tion is regulated in vivo at the level of S. 1993. Comparative analysis of NFAT coordinated binding of both constitutive (nuclear factor of activated T cells) com- and regulated factors. Mol. Cell. Biol. plex in human T and B lymphocytes. J. 14:2159–69 Biol. Chem. 268:14285–93 168. Tjian R, Maniatis T. 1994. Transcriptional 180. Weiss DL, Hural J, Tara D, Timmerman activation: a complex puzzle with few LA, Henkel G, Brown MA. 1996. Nuclear easy pieces. Cell 77:5–8 factor of activated T cells is associated with a mast cell interleukin 4 transcrip- 169. Paul WE, Seder RA. 1994. Lymphocyte tion complex. Mol. Cell. Biol. 16:228–35 responses and cytokines. Cell 76:241–51 181. Hutchinson LE, McCloskey MA. 1995. 170. Carter LL, Dutton RW. 1996. Type 1 and FcεRI-mediated induction of nuclear fac- type 2: a fundamental dichotomy for all T- tor of activated T-cells. J. Biol. Chem. cell subsets. Curr. Opin. Immunol. 8:336– 270:16333–38 42 182. Desai DM, Newton ME, Kadlecek T, 171. Bucy RP, Karr L, Huang G-Q, Li J, Weiss A. 1990. Stimulation of the phos- Carter D, Honjo K, Lemons JA, Murphy phatidylinositol pathway can induce T- KM, Weaver CT. 1995. Single cell anal- cell activation. Nature 348:66–69 ysis of cytokine gene coexpression dur- 183. Li X, Ho SN, Luna J, Giacalone J, ing CD4+ T-cell phenotype development. Thomas DJ, Timmerman LA, Crabtree Proc. Natl. Acad. Sci. USA 92:7565–69 GR, Francke U. 1995. Cloning and chro- Annu. Rev. Immunol. 1997.15:707-747. Downloaded from www.annualreviews.org 172. Pfeuffer I, Klein-Hebling S, Heinfling mosomal localization of the human and A, Chuvpilo S, Escher C, Brabletz T, murine genes for the T-cell transcrip-

Access provided by University of Wisconsin - Milwaukee on 12/04/17. For personal use only. Hentsch B, Schwarzenbach H, Matthias tion factor NFATc and NFATp. Cytogenet. P, Serﬂing E. 1994. Octamer factors exert Cell Genet. 68:185–91 a dual effect on the IL-2 and Il-4 promot- 184. Luo C, Edelhoff S, Disteche C, Copeland ers. J. Immunol. 153:5572–85 NG, Jenkins NA, Hogan PG, Rao A. 1996. 173. Prieschl EE, Gouilleux-Gruart V, Walker Normal function of the transcription fac- C, Harrer NE, Baumruker T. 1995. A nu- tor NFAT1 in wasted mice: chromosome clear factor of activated T cell-like tran- localization of NFAT1 gene. Gene.In scription factor in mast cells is involved in press IL-5 gene regulation after IgE plus anti- 185. Svensson U, Holst E, Sundler R. 1995. gen stimulation. J. Immunol. 154:6112– Cyclosporin-sensitive expression of cy- 19 tokine mRNA in mouse macrophages

P1: MBL/plb P2: MBL/rsk QC: MBL/uks T1: MBL February 12, 1997 16:24 Annual Reviews AR026-27 AR26-27

746 RAO, LUO & HOGAN

responding to bacteria. Mol. Immunol. 196. Fruman DA, Bierer BE, Benes JE, Bura- 32:157–65 koff SJ, Austen KF, Katz HR. 1995. 186. Kaye RE, Fruman DA, Bierer BE, Albers The complex of FK506-binding pro- MW, Zydowsky LD, Ho SI, Jin Y-J, tein 12 and FK506 inhibits calcineurin Castells MC, Schreiber SL, Walsh CT, phosphatase activity and IgE activation- Burakoff SJ, Austen KF, Katz HR. 1992. induced cytokine transcripts, but not exo- Effects of cyclosporin A and FK506 on cytosis, in mouse mast cells. J. Immunol. Fc receptor type I-initiated increases in 154:1846–51 cytokine mRNA in mouse bone marrow- 197. Durez P, Abramowicz D, Gérard C, van derived progenitor mast cells: resistance Mechelen M, Amraoui Z, Dubois D, to FK506 is associated with a deficiency Leo O, Velu T, Goldman M. 1993. In in FK506-binding protein FKBP12. Proc. vivo induction of interleukin 10 by anti- Natl. Acad. Sci. USA 89:8542–46 CD3 monoclonal antibody or bacterial 187. Tocci MJ, Matkovich DA, Collier KA, lipopolysaccharide: differential modu- Kwok P, Dumont F, Lin S, Degudicibus lation by cyclosporin A. J. Exp. Med. S, Siekierka JJ, Chin J, Hutchinson N. 177:551–55 1989. The immunosuppressant FK506 se- 198. Dolganov G, Bort S, Lovett M, Burr J, lectively inhibits expression of early T cell Schubert L, Short D, McGurn M, Gib- activation genes. J. Immunol. 143:718–26 son C, Lewis DB. 1996. Coexpression of 188. Stranick KS, Payvandi F, Zambas DN, the interleukin-13 and interleukin-4 genes Umland SP, Egan RW, Billah MM. 1995. correlates with their physical linkage in Transcription of the murine interleukin 5 the cytokine gene cluster on human chro- gene is regulated by multiple promoter el- mosome 5q23–31. Blood 87:3316–26 ements. J. Biol. Chem. 270:20575–82 199. van der Pouw Kraan TCTM, Boeije LCM, 189. Kita H, Ohnishi T, Okubo Y, Weiler D, Troon JTM, Rutschmann SK, Wijdenes Abrams JS, Gleich GJ. 1991. Granulo- J, Aarden LA. 1996. Human IL-13 pro- cyte/macrophage colony-stimulating fac- duction is negatively influenced by CD3 tor and interleukin 3 release from human engagement: enhancement of IL-13 pro- peripheral blood eosinophils and neu- duction by cyclosporin A. J. Immunol. trophils. J. Exp. Med. 174:745–48 156:1818–23 190. Casolaro V, Georas SN, Marone G, Ono 200. Masuda ES, Tokumitsu H, Tsuboi A, SJ. 1996. Molecular mechanisms control- Shlomai J, Hung P, Arai K-I, Arai ling interleukin-4 synthesis. Curr. Opin. N. 1993. The granulocyte-macrophage Immunol. 8:6–11 colony-stimulating factor promoter cis- 191. Andersson J, Nagy S, Groth C-G, Ander- acting element CLE0 mediates induction sson U. 1992. Effects of FK506 and cy- signals in T cells and is recognized by fac- closporin A on cytokine production stud- tors related to AP1 and NFAT. Mol. Cell. ied in vitro at a single-cell level. Immunol- Biol. 13:7399–407 ogy 75:136–42 201. McCaffrey PG, Jain J, Jamieson C, Sen 192. Bourke PF, van Leeuwen BH, Camp- R, Rao A. 1992. A T cell nuclear fac- bell HD, Young IG. 1995. Localization tor resembling NF-AT binds to an NF- of the inducible enhancer in the mouse κB site and to the conserved lymphokine interleukin-5 gene that is responsive to T- promoter sequence “Cytokine-1”. J. Biol. cell receptor stimulation. Blood 85:2069– Chem. 267:1864–71 77 202. Cockerill PN, Shannon MF, Bert 193. Karlen S, D’Ercole M, Sanderson CJ. AG, Ryan GR, Vadas MA. 1993. 1996. Two pathways can activate the The granulocyte-macrophage colony- interleukin-5 gene and induce binding stimulating factor/interleukin 3 locus is Annu. Rev. Immunol. 1997.15:707-747. Downloaded from www.annualreviews.org to the conserved lymphokine element 0. regulated by an inducible cyclosporin Blood 88:211–21 A-sensitive enhancer. Proc. Natl. Acad.

Access provided by University of Wisconsin - Milwaukee on 12/04/17. For personal use only. 194. Lee HJ, Masuda ES, Arai N, Arai K- Sci. USA 90:2466–70 I, Yokota T. 1995. Deﬁnition of cis- 203. Granelli-Piperno A. 1990. Lymphokine regulatory elements of the mouse inter- gene expression in vivo is inhibited by cy- leukin-5 gene promoter. J. Biol. Chem. closporin A. J. Exp. Med. 171:533–44 270:17541–50 204. Penix L, Weaver WM, Pang Y, Young 195. Prieschl EE, Pendl GG, Harrer NE, HA, Wilson CB. 1993. Two essential Baumruker T. 1995. p21ras links FcRI to regulatory elements in the human iner- NF-AT family member in mast cells: the feron γ promoter confer activation spe- AP3-like factor in this cell type is an ciﬁc expression in T cells. J. Exp. Med. NF-AT family member. J. Immunol. 155: 178:1483–96 4963–70 205. Campbell PM, Pimm J, Ramassar V,

P1: MBL/plb P2: MBL/rsk QC: MBL/uks T1: MBL February 12, 1997 16:24 Annual Reviews AR026-27 AR26-27

NFAT FAMILY TRANSCRIPTION FACTORS 747

Halloran PF. 1996. Identiﬁcation of and FK506. Int. Immunol. 8:1017–26 a calcium-inducible, cyclosporine-sensi- 213. Venkataraman L, Wang W, Sen R. 1996. tive element in the IFN-γ promoter that Differential regulation of c-Rel transloca- is a potential NFAT binding site. Trans- tion in activated B and T cells. J. Immunol. plantation 61:933–39 159:1149–55 206. Brown DA, Nelson FB, Reinherz EL, 214. Kang S-M, Tsang W,Doll S, Scherle P,Ko Diamond DJ. 1991. The human inter- H-S, Tran A-C, Lenardo MJ, Staudt LM. feron-γ gene contains an inducible pro- 1992. Induction of the POU domain tran- moter that can be transactivated by tax I scription factor Oct-2 during T-cell acti- and II. Eur. J. Immunol. 21:1879–85 vation by cognate antigen. Mol. Cell. Biol. 207. Ahuja SS, Shrivastav S, Danielpour D, 12:3149–54 Balow JE, Boumpas DT. 1995. Regula- 215. Yazbanbakhsh K, Choi J-W, Li Y,Lau LF, tion of transforming growth factor-β1 and Choi Y.1995. Cyclosporin A blocks apop- its receptor by cyclosporine in human T tosis by inhibiting the DNA binding activ- lymphocytes. Transplantation 60:718–23 ity of the transcription factor Nur77. Proc. 208. Li B, Sehajpal PK, Khanna A, Vlassara Natl. Acad. Sci. USA 92:437–41 H, Cerami A, Stenzel KH, Suthanthiran 216. Woronicz JD, Calnan B, Ngo V, Winoto M. 1991. Differential regulation of trans- A. 1994. Requirement for the orphan forming growth factor β and interleukin steroid receptor Nur77 in apoptosis of T- 2 genes in human T cells: demonstra- cell hybridomas. Nature 367:277–81 tion by usage of novel competitor DNA 217. Wang C-Y, Bassuk AG, Boise LH, constructs in the quantitative polymerase Thompson CB, Bravo R, Leiden JM. chain reaction. J. Exp. Med. 174:1259–62 1994. Activation of the granulocyte- 209. Splawski JB, Nishioka J, Nishioka Y,Lip- macrophage colony-stimulating factor sky PE. 1996. CD40 ligand is expressed promoter in T cells requires cooperative and functional on activated neonatal T binding of Elf-1 and AP-1 transcription cells. J. Immunol. 156:119–27 factors. Mol. Cell. Biol. 14:1153–59 210. McCaffrey PG, Kim PK, Valge-Archer 218. Ullman KS, Flanagan WM, Edwards CA, VE, Sen R, Rao A. 1994. Cyclosporin Crabtree GR. 1991. Activation of early A sensitivity of the NF-κB site of the gene expression in T lymphocytes by Oct- IL2Rα promoter in untransformed murine 1 and an inducible protein, OAP40. Sci- T cells. Nucleic Acid. Res. 22:2134–42 ence 254:558–62 211. Taylor-Fishwick DA, Siegel JN. 1995. 219. Rooney JW, Hoey T, Glimcher LH. 1995. Raf-1 provides a dominant but not ex- Coordinate and cooperative roles for clusive signal for the induction of CD69 NFAT and AP-1 in the regulation of the expression on T cells. Eur. J. Immunol murine IL-4 gene. Immunity 2:473–83 25:3215–21 220. Perkins D, Wang Z, Donovan C, He H, 212. Brunner T, Yoo NJ, LaFace D, Ware CF, Mark D, Guan G, Wang Y, Walunas T, Green DR. 1996. Activation-induced cell Bluestone J, Listman J, Finn PW. 1996. death in murine T cell hybridomas. Dif- Regulation of CTLA-4 expression during ferential regulation of Fas (CD95) versus T cell activation. J. Immunol. 156:4154– Fas ligand expression by cyclosporin A 59 Annu. Rev. Immunol. 1997.15:707-747. Downloaded from www.annualreviews.org Access provided by University of Wisconsin - Milwaukee on 12/04/17. For personal use only.