The Microbiome Profile of Oral Squamous Cell Carcinoma Tissues in a Group of Sri Lankan Male Patients

The microbiome profile of oral squamous cell carcinoma tissues in a group of Sri Lankan male patients

Author Perera, Manosha

Published 2017-06

Thesis Type Thesis (PhD Doctorate)

School School of Dentistry&Oral Hlth

DOI https://doi.org/10.25904/1912/3833

Downloaded from http://hdl.handle.net/10072/370682

Griffith Research Online https://research-repository.griffith.edu.au

THE MICROBIOME PROFILE OF ORAL SQUAMOUS CELL CARCINOMA TISSUES IN A GROUP OF SRI LANKAN MALE PATIENTS

Manosha Lakmali Perera,

BSc (Open University of Sri Lanka), MSc in Applied Microbiology (University of Kelaniya, Sri Lanka)

School of Dentistry and Oral Health

Menzies Health Institute Queensland

Griffith University, Queensland, Australia

Submitted in fulfillment of the requirements of the Degree of

DOCTOR OF PHILOSOPHY

June 2017 Statement of Originality

This work has not previously been submitted for a degree or diploma in any university. To the best of my knowledge and belief, the thesis contains no material previously published or written by another person except where due reference is made in the thesis itself.

Manosha Lakmali Perera

[i] Abstract Background: Findings of previous metagenomic studies on the association between the nature of the oral microbiome and oral squamous cell carcinoma (OSCC) remain indecisive due to inherent methodological limitations and variations. Furthermore, except one recently published study, investigations on the complete oral microbiome (mycobiome, bacteriome, and some putative oncogenic viruses, in the present study HPV, EBV and HHV8) in oral cancer, assessed in a single study have not been reported.

Objective: To ascertain the microbiome profile of oral squamous cell carcinoma (OSCC) tissues in a group of Sri Lankan male patients.

Methods: An unmatched case-control study was performed, comprised of 134 cases of clinically diagnosed OSCC, subsequently subjected to histopathological confirmation and 134 clinically diagnosed controls with benign oral mucosal lesions namely; Fibro-epithelial polyps FEPs, lipomas, keratosis without dysplasia and mucoceles. From this main sample, a sub-sample consisting of 29 Oral Squamous Cell Carcinoma (OSCC) cases, similar in clinical presentation and in the associated risk factors to the overwhelming majority of OSCC cases in Sri Lanka, and 25 FEP controls were selected. All subjects were > 40 years old, and were not on antibiotics in the 2 months prior to of data collection. The affected sites were buccal mucosa or tongue.

Incisional biopsies of cases and excisional biopsies of controls were collected, transported, stored and dispatched as frozen tissues at -800C. DNA was extracted from frozen specimens using Gentra Puregene Tissue kit (Qiagen, Germany), solid tissue protocol according to the manufacturer’s instructions. Few modifications were made to this protocol to ensure complete lysis of Gram positive cell walls of bacteria to obtain maximum yield of microbial DNA. The DNA extracts were stored at -800C. Subsequently, extracted DNA samples were subjected to sequencing by Illumina’s 2x300 bp chemistry at ACE (Australian Centre for Ecogenomics). High quality non-chimeric merged reads were classified to the species level using a prioritized BLASTN-algorithm for bacteriome and BLASTN-algorithm with UNITE’s named species sequences as reference for mycobiome. Downstream compositional analysis was performed using QIIME. Differentially abundant taxa were identified by linear discriminant analysis

[ii] Effect Size (LEfSe) and G-test for bacteriome and mycobiome. PICRUSt (pylogenetic investigation of communities by reconstruction of unobserved states) was utilized for prediction of functional genes of bacteriome. Differences in compositional bacterial profile, functional bacteriome profile and compositional fungal profile in OSCC tissues and FEP tissues were compared by Mann-Whitney test of statistical significance. Statistical significance was set at p <0.05. The analysis was conducted based on KEGG orthologs (KO) and pathways. Variations in genes and pathways between the cases and controls were investigated using LEfSe. Nested PCR was performed to detect HPV and real time PCR was performed to detect EBV and HHV 8 in these OSCC cases and FEP controls. A pre-tested interviewer administered questionnaire was used for data collection which predominantly comprised of socio-demographic information, tooth cleaning habits, information on established risk factors: areca nut/betel chewing, tobacco smoking and chewing, and alcohol consumption, daily fruit and vegetable consumption. Clinical data were extracted from clinical records and biopsy reports. The clinical oral examinations of these cases and controls were conducted by a Specialist in Dental Public Health comprising recording decayed teeth, missing teeth, filled teeth and mobile teeth. Oral hygiene status was assessed with the simplified oral hygiene index (OHI-S) of Green & Vermillion 1964 and periodontal disease status was assessed by probing pocket depth (PD) and clinical attachment loss (CAL) at 4 sites per anterior teeth and 6 sites per posterior teeth.Periodontal disease status was classified according to Case Definitions for Periodontitis developed by Centre for Disease Control (CDC) Periodontal Disease Surveillance Work Group (Page & Eke, 2007). These data were entered and analysed using SPSS-21 Statistical Package. Percentage distributions were presented as descriptive statistics and Chi-Square Test of Statistical Significance was used as inferential statistics to compare groups with regard to differences in socio-demographic attributes, risk habit profiles, tooth cleaning practices, oral hygiene status and periodontal disease status. Furthermore, t-test and Fisher’s exact test to compare groups (cell counts <5) were used to compare means with regard to duration of risk habits, missing teeth, mobile teeth, decayed and filled teeth among cases and controls.

[iii]

Results: 1074 bacterial species representing 274 genera and 21 phyla were recognized with Streptococcus and Rothia comprising of the approximately 28% and 18% of average bacteriome respectively.The species richness and diversity were significantly decreased in OSCC. Capnocytophaga, Pseudomonas and Atopobium were the marker genera associated with OSCC cases with significantly different relative abundance compared to FEP controls. Conversely, Streptococcus and Rothia were significantly abundant keystone genera in controls.Citrobacter koseri, Fusobacterium nucleatum subsp.polymorphum, Streptococcus dysgalactiae and Pseudomonas aeruginosa were dominated in OSCC bacteriome profile. In contrast, Rothia mucilaginosa, Streptococcus mitis, Gemella haemolysans andStreptococcus sp. oral taxon 070 were the predominant members of the FEP bacteriome. It was possible to predict important metabolic pathways of bacterial communities by PICRUSt bioinformatics resource extant computer algorithms. These metabolic pathways included biosynthesis of lipopolysaccharides (LPS), energy metabolism, replication recombination, carbon fixation and nitrotoluene degradation which were significantly higher in OSCC tissues compared to FEP tissues (p <0.05). Moreover, membrane and intracellular structural molecules, chromosomes, peptides and repair proteins were predicted to be significantly higher in OSCC tissues compared to FEP tissues (p < 0.05) Thus, inflammatory and bacterial carcinogenic metabolite production such as nitrotoluene by nitroreductase enzyme activity was predicted to be significantly higher (p < 0.05) in the bacteriome of OSCC tissues compared with FEP tissues. In contrast, bacteria performing, glycolysis / glucogenesis, base excision repair, protein kinases, C5 branched dibasic acid metabolism and metabolism of xenobiotic molecules by cytochrome P450 were significantly higher in the bacteriome of FEP tissues compared with OSCC tissues (p <0.05) according to the same prediction algorithms.

364 fungal species representing 160 genera and 2 phyla (Ascomycota and Basidiomycota) were identified, with Candida and Malassezia making up 48% and 11% of the average mycobiome, respectively. However, only 5 species and 4 genera were detected in ≥50% of the samples. The species richness and diversity were significantly lower in OSCC. At the genus level, Candida, Hannaella and Gibberella were overrepresented in OSCC while Alternaria and Trametes were more abundant in FEP. Species-wise, C. albicans, C. etchellsii and Hannaella luteola-like

[iv]

species were enriched in OSCC while Malassezia restricta, Aspergillus tamarii, Alternaria alternate, Cladosporium halotolerans, and Hanseniaspora uvarum-like species were the most significantly abundant in FEP. HPV was detected in 4/54 (7.4 %) of overall samples and only 1/29 (3.5%) of OSCC cases. HPV was present in 3/25 (12.0%) of FEP controls. HPV 12, HPV 42, HPV 32, HPV 31 type and HPV α9 were detected in 4 subjects. One FEP control subject was infected with multiple HPV types. Of the types identified from this FEP tissue, HPV α9 and HPV 31, considered as high risk family and type respectively. EBV was detected in 21/27( 77.8%) of OSCC cases and in 13/26 (50%) of FEP controls. Thus, prevalence of EBV was significantly higher (p < 0.05) in OSCC cases when compared with FEP controls. HHV 8 was not detected in any sample. According to socio-demographic profile 51.7% OSCC cases were employed as farmers and another 41.4% as skilled/unskilled labourers in significantly higher proportions than FEP controls (p <0.05). Moreover, 20.7% and 69.0% OSCC cases had poor and fair oral hygiene status respectively compared to 12.0% and 36.0% FEP controls. Furthermore, the overwhelming majority (96.0%) of controls used tooth paste and tooth brush for tooth cleaning while the majority of OSCC cases reported less optimal methods of tooth cleaning such as use of finger and charcoal/tooth powder and use of charcoal with the tooth brush. Furthermore, 34.5% and 51.7% of OSCC cases had severe and moderate periodontal status while 8.0% and 24.0% FEP controls belonged to those two categories respectively. All aforementioned differences among OSCC cases and FEP controls were statistically significant (p <0.05). In addition, significantly higher frequency of practicing betel chewing, alcohol consumption and significantly lower daily consumption of fruits and vegetables (< 5 portions) were reported by OSCC cases compared to FEP controls (p <0.05).

Conclusions: A dysbiotic, inflammatory and carcinogenic metabolite-producing bacteriome dominated by Citrobacter koseri, Fusobacterium nucleatum subsp.polymorphumPseudomonas aeruginosa as well as a dysbiotic mycobiome dominated by Candida albicans, was found at the advancing front of OSCC compared with FEP tissues. A plethora of factors related to tumour microenvironment such as nutrient availability, pH of the environment, competition among species for binding sites, inter-species antagonism or cooperation and the differences in

[v]

receptors present on OSCC tissues could have resulted in this specific OSCC associated bacteriome.Moreover, life-style related risk habits such as betel chewing and periodontal disease status of the cases could have influenced oral bacterial colonization in OSCC tissues. Against this backdrop, it is reasonable to speculate that the tumour microenvironment influences the community structure and function of the microbiome associated with OSCC as evident from the present study. However, present findings do not exclude the possibility of bacteriome contributing to carcinogenesis. Overall, fungi of the genera Candida, Hannaella and Gibberella were significantly more abundant amongst OSCC samples compared with FEP controls (p<0.05). Among viruses, a higher prevalence of EBV was found in OSCC cases compared with controls and this difference was statistically significant (p<0.05). As poor oral hygiene status, sub optimal tooth cleaning habits, burden of periodontal disease, frequency of betel chewing and alcohol consumption were significantly higher (p<0.05) among OSCC cases compared with FEP controls is reasonable to argue such differences could have had influenced aforementioned findings in two distinct microbiome profiles of OSCC cases and FEP controls. Thus, functional metagenomic studies with cohort study design (including adequate sample size, controlling for confounding effects of established risk factors) is warranted to determine possible signature bacteria and fungi which correlate with OSCC as well as to explore their exact role in oral carcinogenesis.

[vi]

Dedication

This thesis is dedicated to my beloved late Mother, Jayaseeli Mallika for her great inspiration and for sharing my burden and difficulties with fervent prayers. She instilled the value of Higher Education in me for which I have developed a yearning to the extent of being a Higher Degree Research Student amidst a plethora of obstacles and turbulance.

[vii]

Acknowledgement

This thesis is the outcome of a blend of meta-genomic and bioinformatics data, PCR (Nested & Real Time) as well as socio-demographic and clinical data aimed at determining “The Microbiome Profile of Oral Squamous Cell Carcinoma tissues in a group of Sri Lankan Patients”. As one of the first extensive investigations into this expanding yet challenging arena of research the present study required blend of multi-disciplines, meticulous planning in study design, extensive data and sample collection involving, 9 collaborating Oral & Maxillo-Facial Units of Public Hospitals across 6 provinces in Sri Lanka as well as elaborated handling of different types of data. Against this backdrop, I am indebted to many for their invaluable contributions.

First and foremost, I wish to extend my deep gratitude to my Principal Supervisor, Emeritus Professor N.W.J. Johnson, Menzies Health Institute and School of Dentistry and Oral Health, Griffith University, Gold coast, QLD for his excellent overall supervision, guidance and advice. Moreover, I am indebted to my Associate Supervisor, Prof. Glen Ulett, School of Medicine and Health Sciences, Gold coast, QLD for the focused guidance not to miss the value of broad impact of this study and provision of laboratory facilities. I am also indebted to my External Supervisors, Prof. W.M. Tilakaratne, the Dean, Faculty of Dental Sciences, University of Peradeniya, Sri Lanka and Prof. L. Samaranayake, Former Dean of School of Dentistry and Oral Health, University of Queensland, QLD for their valuable contributions. I am grateful indeed to Dr. Irosha Perera, Dental Public Health Specialist, Preventive Oral Health Unit, the National Dental Hospital (Teaching) Sri Lanka for overall facilitation of data and sample collection as well as for conducting clinical examinations.

The unique contribution of Prof. Nezar, Noor-Al-Hebshi, now at the Maurice H. Kornberg School of Dentistry, Temple University, and Philadelphia, USA with his expertise in Metagenomics and Dental Research, is most gratefully appreciated. Furthermore, I am indebted to Dr David Speicher, Microbiology & Infectious Diseases, St Joseph’s Health Care Hamilton, Canada, Dr. Deepak Ipe, School of Medical Sciences, Gold Coast, QLD, Dr. Tsute Chen, Department of Microbiology, Forsyth Institute, Cambridge, USA, Dr Nicola Angel, Manager, Australian Centre for Ecogenomics, Dr. Annika Antonsson, Research Scientist, for assisting in laboratory experiments and analysis of metagenomic/ PCR data.

[viii]

My grateful appreciation is due to Mr. Shehan Silva, my cousin brother for helping me continuously with his information technology skills to accomplish this thesis.

I am indebted to all participants of this study. Moreover, the Dean Research Prof. David Shum the administrative consultation and support of Ms. Kyla Truloff need grateful appreciation. I would like to acknowledge the contributions of Oral & Maxillo-Facial Surgeons and Staff of collaborative OMF Units in Sri Lanka.

I acknowledge with gratitude the Australian Government for providing me with a Griffith University International Postgraduate Research Scholarship, 2012.

I would like appreciate Surani, Bhawna, Mushfiq, Jyothi and Santosh my friends and colleagues of Prof. Johnson’s group. Special word of thanks goes to Bhawna and Jungee for providing me classical examples from their lives to develop resilience without loosing peace in mind when conditions are unfavourable.

I would like to express my genuine appreciation to Dr. Gerard Ranasinghe, Consultant Microbiologist, Teaching Hospital, Kurunegala, Sri Lanka for assisting me to interpret metagenomic findings with clinical relevance.

Last but not least I would like to pay my heartfelt gratitude to my twin sister, cousin sister and little nieces, Sheneshi and Umendri for providing me emotional strength as well as to my Father, Bappa (Uncle) and Podiamma (Aunt) for their fervent prayers to withstand several turbulences and adverse consequences I faced during my PhD journey.

[ix]

Publications Arising from Work Described in this thesis

Perera M, Al-hebshi NN, Speicher DJ, Perera I, Johnson NW. Emerging role of bacteria in oral carcinogenesis: a review with special reference to perio-pathogenic bacteria. Journal of Oral Microbiology. 2016;8.https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5039235/Sep 26, 2016 (Appendix 1)

Approval from publishers (Appendix 2)

[x]

Table of Contents

Statement of Originality 1

Abstract 11 – V1

Dedication Acknowledgement VI1- V111

Publications Arising from Work Described in this thesis IX

Table of Contents X-IV

List of Figures XV1-XVII1

List of Tables XIX-XX

List of Annexures XX1

List of Appendices XX11

Abbreviations XXII1-XXV

CHAPTER 1: GENERAL INTRODUCTION 1

1.1 Oral Cancer 1 1.2 General Background 1 1.2.1 Global Burden of Oral Cancer 1 1.2.2 Local Burden of Oral Cancer 3 1.2.3 Aetiology of Oral Cancer 4-5 1.3 The Importance of Determination of Oral Microbiome Profile in OSCC 5-7

1.4 Justification 7-9 1.5 Research Question and Hypotheses to be tested 9 1.5.1 Research Question 9 1.5.2 Hypotheses 10 1.6 Objectives 10 1.6.1 General Objective 10

[xi]

1.6.2 Specific Objectives 10

CHAPTE 2: LITERATURE REVIEW 11

2.1 The Human Microbiome 11 2.2 The Oral Microbiome 13

2.2.1 Exclusive attributes of the Oral Microbiome 13-14

2.2.2 Oral Biofilm 14-15

2.3 Emerging Importance of Microbial Ecology in Inflammatory

Diseases and Cancer 15-18

2.3.1. The Key Stone Pathogen Hypothesis 18

2.3.2 Well defined life-style related risk factors of

oral cancer influencing the colonization of oral microbiome 18-20

2.4 Can the Microbiome Profile be a Risk Factor for Oral Cancer? 20-21

2.4.1.1 The healthy oral bacteriome 21

2.4.1.2 Oral bacteriome, dysbiosis and disease 22-23

2.4.1.2.1 Key-Stone Pathogen Mediated Polymicrobial Synergy and 23-24

dysbiosis (PSD) model

2.4.1.3 Oral bacteriome dysbiosis in oral cancer 24-29

2.4.1.4 Possible mechanisms by which oral bacteria

contribute to oral carcinogenesis 30

2.4.1.4.1 Inhibition of apoptosis 30

2.4.1.4.2 Activation of cell proliferation 30-31

2.4.1.4.3 Promoting cellular migration and invasion 31

[xii]

2.4.1.4.4 Induction of inflammation 32

2.4.1.4.5 Production of carcinogens 32-33

2.4.2 Can the mycobiome be a risk factor for oral cancer? 33-35

2.4.2.1 The Healthy Oral Mycobiome 35-38

2.4.2.2 Oral Mycobiome dysbiosis and diseases 38-40 2.4.2.3.1 Candida species and OSCC 40-41 2.4.2.3 Possible mechanisms by which oral fungi contribute to oral carcinogenesis 41-42

2.4.4.2 Possible role of Candida species in oral carcinogenesis 42-44 2.4.3 Can the virome be a risk factor for oral cancer? 44 2.4.3.1 Human Papillomavirus (HPV) Infections 44-46 2.5 Characterization of the Oral Microbiome 46-47

2.5.1.1 Conventional/Culture Dependent Techniques 48-49

2.5.1.2 Culture independent molecular techniques

(other than NGS) 49-52

2.5.3 Characterization of oral microbiome by NGS 53-55

2.5.3.1 Types of NGS platforms 55-56

2.6 Taxonomic Diversity of the Oral Microbiome 56-57

2.6.1 Oral bacteriome 57-59

2.6.2 Oral mycobiome 59-60

CHAPTER 3:SAMPLES, DATA COLLECTION AND

EXTRACTION OF DNA 61

Overview 61

3.1 Study Design 62

[xiii]

3.2 Study Setting 62-65

3.3 Study Period 66

3.4 Study Population 66

3.4.1 Inclusion Criteria 66

3.4.1.1 For Cases 66

3.4.1.2 For Controls 66

3.4.2 Exclusion Criteria 67

3.4.2.1 For Cases 67

3.4.2.2 For Controls 68

3.5 Sample Size Calculation 68

3.6 Sampling Technique 68

3.7 Study Instruments & Data Analysis 68-70

3.8 Sample Collection, Transport, Storage and Dispatch 71

3.8.1 Sample Collection by Performing Biopsies 71

3.8.1 For Cases 71-72

3.8.2 For Controls 72-73

3.8.2 Transport, Storage and Dispatch of Samples 74-76

3.9 Extraction of DNA from Tissue Specimens 76-78

CHAPTER 4: DETERMINATION OF THE STRUCTURAL AND FUNCTIONAL PROFILES OF BACTERIOME IN A GROUP OF SRI LANKAN ORAL SQUAMOUS CELL CARCINOMA (OSCC) CASES COMPARED WITH FIBROEPITHELIAL POLYP (FEP) CONTROLS

4.1 Introduction 79-81

[xiv]

4.2 Materials and Methods 81-84

4.3 Results 84-94

4.4 Discussion 94-100

CHAPTER 5: EXPLORATION OF THE MYCOBIOME PROFILE IN A GROUP OF SRI LANKAN ORAL SQUAMOUS CELL CARCINOMA (OSCC) CASES COMPARED WITH FIBRO EPITHELIAL POLYP (FEP) CONTROLS

5.1 Introduction 101-102

5. 2 Materials and Methods 102-105

5.3 Results 105-110

5.4 Discussion 110-114

CHAPTER 6: DETECTION OF HPV, EBV AND HHV 8 IN ORAL SQUAMOUS CELL CARCINOMA (OSCC) TISSUES IN A GROUP OF SRI LANKAN PATIENTS BY POLYMERASE CHAIN REACTION (PCR)

6.1 Introduction 115-119

6.2 Materials and Methods 120-123

6.3 Results 123-133

6.2.4 Discussion 133-142

CHAPTER7: GENERAL CONCLUSIONS, RECOMMENDATIONS AND

FUTURE DIRECTION 142-148

REFERENCES 149-176

ANNEXURE 177-187

APPENDICES 188

[xv]

List of Figures

Figure 2.1 Various microhabitats in human body Pg 12 (news.bbcimg.co.uk)

Figure 2.2 Human Microbiome Pg 16

Figure 2.3 The possible mechanisms by which oral bacteria Pg 33 contribute to oral Carcinogenesis

Figure 2.4 Past Strategies for Microbial Analysis Pg 47 http://hmp.jcvi.org/

Figure 2.5 The 16S rRNA Marker Gene - Pg 58 [email protected]

Figure 2.6 Schematic representation of the nuclear ribosomal Pg 60 repeat unit in fungi which includes the 18S, 5.8S and 28S rRNA genes and the internal transcribed spacers (ITS) 1 and 2.

Figure 3.1 Distribution of Cases and Controls by location of OMF Pg 63 Units by Provinces in Sri Lanka.

Figures 3.2 Unit D, The National Dental Hospital (Teaching) Sri Pg 64 Lanka, Colombo (Western Province)

Figure 3.3 District General Hospital, Kegalle (Sabaragamuwa Pg 64 Province)

Figure 3.4 OMF unit, Provincial General Hospital, Ratnapura Pg 65

Figure 3.5 OMF unit, Provincial General Hospital, Badulla Pg 65

Figure 3.6 OMF unit, Provincial General Hospital, Kurunegala Pg 65

Figure 3.7 OMF unit, Teaching Hospital, Karapitiya Pg 66

Figure 3.8 North Carolina Probe Pg 70

Figure 3.9 Records Pg 70

Figure 3.10 Buccal Mucosa:Macroscopic appearance of sampled Pg 71 area of OSCC lesion

[xvi]

Figure 3.11 Tongue: Macroscopic appearance of sampled area of Pg 71 OSCC lesion

Figure 3.12 Longitudinal section of site of deep advanced margin of Pg 72 OSCC tissue subjected to Microbiome profiling (Line diagram)

Figure 3.13 Clearly labeled, tightly closed cryostat vials containing Pg 72 OSCC tissue

Figure 3.14 FEP in Buccal Mucosa Pg 73

Figure 3.15 FEP in Tongue Pg 73

Figure 3.16 Longitudinal section of site of tissue subjected to Pg 73 microbiome profiling (Line diagram)

Figure 3.17 FEP tissue placed in a cryostat vial Pg 74

Figure 3.18 Clearly labeled box containing cryostat vials with fresh Pg 74 frozen tissues

Figure 3.19 Medical Research Institute, Colombo, Sri Lanka Pg 75

Figure 3.20 Dispatch of samples from Sri Lanka to Gold Coast Pg 76

Figure 3.21 White DNA pellet at the bottom of tube Pg 77

Figure 3.22 Nano drop instrument Pg 78

Figure 4.1 The Bacteriome Profile (the % of average abundances of Pg 86 taxa in phylum, genera and species level [Overall- All samples (47), OSCC -Cases (25), Control -FEP (22)]

Figure 4.2 Mean number of bacterial species present in cases and Pg 89 controls

Figure 4.3 β diversity (Summary score between population) and Pg 90 Rarefaction Curve

Figure 4.4 Differentially abundant taxa. Linear Discriminant Pg 91 Analysis Effect Size (LEfSe) analysis showing genera (A) and species (B) that was significantly differentially abundant between the cases and controls (LDA score≥ 3).

[xvii]

Figure 4.5 Differentially enriched functions. Linear Discriminant Pg 93 Analysis Effect Size (LEfSe) Showing genes (A) and pathways (B) that were significantly differentially enriched between the cases and controls (LDA score≥ 2.25)

Figure 5.1 The Mycobiome profile (The % of average abundances Pg 106 of taxa in phylum, genera and species level)

Figure 5.2 Rarefaction and β=diversity Pg 108

Figure 5.3 Differentially abundant taxa. Linear Discriminant Pg 109 Analysis Effect Size (LEfSe) analysis showing genera (A) and species (B) that was significantly differentially abundant between the cases and controls (LDA score≥ 3).

Figure 6.3.1 HPV status in Overall samples Pg 130

Figure 6.3.2 EBV status in Overall samples Pg 133

[xviii]

List of Tables

Table 2.1 Summary of epidemiological studies that assessed the Pg 25 association between bacteria and oral cancer

Table 2.2 Summary of five major NGS platforms Pg 56

Table 4.1 MiSeq v3 Kit Pg 82

Table 4.2 Standard PCR conditions Pg 82

Table 4.3 Average abundances of main phyla in the overall Pg 86 bacteriome profile Table 4.4 Average abundances of main genera in the overall Pg 87 bacteriome profile Table 4.5 Average abundance of main genera in the OSCC Pg 87 bacteriome profile Table 4.6 Average abundance of main genera in the OSCC Pg 88 bacteriome profile Table 4.7 Average abundance of main genera in the FEP Pg 88 bacteriome profile Table 4.8 Average abundance of main species in the OSCC Pg 88 bacteriome profile Table 4.9 Average abundance of main species in the FEP Pg 89 bacteriome profile Table 4.10 Species richness, α-diversity and coverage (mean ± SE) Pg 90 calculated from the rarefied biom. Table 4.11 Differentially abundant species as identified by G-test Pg 92

Table 5.1 Standard PCR conditions Pg 103

Table 5.2 Species richness, α-diversity and coverage (mean ±SE) Pg 107 calculated from the rarefied biom. Table 6.2.1 Primers used for Nested MY/GP+PCR Pg 120

[xix]

Table 6.2.2 Quantitative PCR reaction mixture for 384 wells plate Pg 122

Table 6.2.3 Primers used for rt PCR EBV EBNA-1 assay Pg 122

Table 6.2.4 Primers used for rt PCR EBV HHV-8 assay Pg 123

Table 6.3.1.1 Distribution of Cases and Controls by Oral &Maxillo- Pg 124 Facial Unit Location

Table 6.3.1.2 Distribution of Cases and Controls by Socio- Pg 125 demographic profile Table 6.3.1.3 Age categories of cases and controls of present study Pg 126

Table 6.3.1.4 Distribution of the Cases and Controls by Risk Habit Pg 127 Profile & Daily Vegetable & Fruit Consumption Table 6.3.2.1 Distribution of β-globin positive and negative amplicon Pg 129 production status of the samples Table 6.3.2.2 The distribution of Cases and Controls by HPV Status Pg 130

Table 6.3.4 Distribution of Cases and Controls by EBV Status Pg 132

Table 6.4.1 Prevalence of HPV in South Asia Pg 136

[xx]

List of Annexures

Annexure 01: Classification of Risk Factors for Oral Cancer

[xxi]

List of Appendices

Appendix 1 : Perera M, Al-hebshi NN, Speicher DJ, Perera I, Johnson NW. Emerging role of bacteria in oral carcinogenesis: a review with special reference to perio- pathogenic bacteria. Journal of Oral Microbiology. 2016;8.

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5039235/Sep 26, 2016

Appendix 2 : Approval from publishers of JOM

Appendix 3 : Photomicrographs of H& E Stains of OSCC tissues

Appendix 3.1 : Sample size calculation for unmatched case control study

Appendix 3.2 : Table 1: Adjusted Odds Ratio and Corresponding 95% Confidence Intervals for OSCC Cases compared to FEP controls by Well Established and Emerging Risk Factors

Appendix 3.3 : Data Collection Form

Appendix 4.1 : Relative Abundances of Bacteria by Phyla

Appendix 4.2 : Relative Abundances of Bacteria by Genus

Appendix 4.3 : Relative Abundances of Bacteria by Species

Appendix 4.4 : List of Taxa exclusively identified in either group at prevalence

≥ 15%

Appendix 5.1 : Relative Abundances of Fungi by Phyla

Appendix 5.2 : Relative Abundances of Fungi by Genus

Appendix 5.3 : Relative Abundances of Fungi by Species

[xxii]

Appendix 5.4 : List of Taxa exclusively identified in either group at prevalence

≥ 10%

Appendix 6 : Ethics approval from Sri Lanka : FRC/FDS/UOP/E/2014/32

Appendix 7 : Ethics approval from QLD : DOH/18/14/HREC

[xxiii]

Abbreviations

HNSCCs Head and Neck Squamous Cell Carcinoma

OSCC Oral Squamous Cell Carcinoma

FEP Fibro Epithelial Polyp

WHOWorld Health Organization

AUDT Upper Aero Digestive Tract

USA United States of America

OPMD Oral Potentially Malignant Disorders

HPV Human Papilloma Virus

SEC Socio Economic Conditions

UV Ultra Violet

MALT Mucosa Associated Lymphoid Tissue

KSHV Kaposi sarcoma associated Herpes Virus

EBV Epstein Bar Virus

HSV Herpes Simplex Virus

PCR Polymerase Chain Reaction

NGS Next Generation Sequencing

[xxiv]

NO Nitric Oxide

IARC International Agency for Research on Cancer

ADH Alcohol Dehydrogenase

ALDH 2 Aldehyde Dehydrogenase 2

TSG Tumour Suppressor Gene

DNA Deoxyribose Nucleic Acid

DNMT DNA methyltransferase

SNP Single Nucleotide Polymorphism

OR Odds Ratio

NBMA Nitrobenzyl Methyl Amine

MT Missing Teeth

ROS Reactive Oxygen Species

IL Interleukin

COX-2 cyclooxygenase-2

ICD International Classification of Diseases

HR Hazard Ratio

CPITN Community Periodontal Index of Treatment Needs

[xxv]

IBD Inflammatory Bowel Disease

HMP Human Microbiome Project

MALT Mucosa-associated lymphoid tissue

HOMD Human Oral Microbiome Database

CRC Colorectal Cancers

OTU Operational Taxonomic Unit

OPSCC Oropharyngeal Squamous Cell Carcinoma

OCSCC Oral Cavity Squamous Cell Carcinoma

QIIME Quantitative Insights into Microbial Ecology

PIRUSt Phylogenetic Investigation of communities by Reconstruction of Unobserved States

PD Probing pocket Depth

CAL Clinical Attachment Loss

IHC Immuno Histo Chemistry

ELISA Enzyme Linked Immuno Sorbent Assay

GAPDH Glyceraldehyde3-phosphatedehydrogenase

[xxvi]

CHAPTER 1: INTRODUCTION

Oral Cancer

Oral squamous cell carcinoma is a sub group of head and neck squamous cell carcinomas (HNSCCs) which includes malignant neoplasms, beginning from the lining mucosae of the lips and the mouth (oral cavity) including the anterior two thirds of the tongue as defined by the WHO International Classification of Disease (1, 2). At present, oral squamous cell carcinoma (OSCC) accounts for 90-95% of oral malignancies in most countries (3, 4). Cell division is a physiological process and the balance between cell proliferation and programmed cell death (apoptosis) is kept under tight regulation in normal conditions. In carcinogenesis, this regulation is dysfunctional and cells undergo excessive and uncontrolled proliferation. Accordingly, there are number of critical mutations or other abnormalities in genes which control cell proliferation, cell death, DNA repair and numerous other genetic and epigenetic modifications that follow (5). The progression of normal epithelium to invasive cancer is often described as a series of steps seen as hyperplasia, dysplasia, carcinoma in situ and invasive carcinoma with genetic changes which promote proliferation, angiogenesis, local invasion and eventually distant metastasis (5, 6).

However, not all invasive tumours evolve from an overlying dysplasia, or at least not from a pre-existing stage recognized by patient or clinician. Pathological changes of tissues include loss of maturation, architectural disorganization and increased pleomorphism and cell size with dyskeratosis to a variable degree amounting to different grades of dysplasia (7). Overtly invasive carcinomas are separated into keratinizing and non-keratinizing. Furthermore, degree of differentiation is expressed as poorly, moderately and well differentiated. The length of time from hyperplasia to invasive carcinoma is usually measured in years, though it is variable. During this time disease progression might be slowed or eliminated by quitting usage of tobacco, areca nut and alcohol, surgical removal or other methods of ablation (7).

1.1 General Background

1.2.1 Global burden of oral cancer

Head and neck squamous cell carcinomas constitute broad group of carcinomas arising from the mucous membranes of the upper aero-digestive tract (AUDT): this includes malignant neoplasms arising in the lips, mouth, pharynx, larynx, nose and sinuses. Of them around 85% are lip and oral cavity cancers (8). Cancers of the lip, oral cavity, nasopharynx and oro/hypopharynx could be considered as a global public health th th challenge, being the 7 most frequent type of cancer by incidence and the 9 most common cause of cancer related deaths with an estimated 529 000 new cases worldwide and 292 000 deaths in 2012 (7,8). The overwhelming majority of the disease burden is carried by males, socially disadvantaged population groups in developing countries as well as minority ethnic groups in developed countries (9, 10). Hence, oral cancer demonstrates marked social and ethnic disparities in its incidence and outcomes (3) as well as temporal and geographic patterns (3, 10). Papua New Guinea, Bangladesh, Hungary and Sri Lanka currently have the highest incidence rates. Moreover, because of the magnitude of its population, India accounts for almost one quarter (120 000) of new cases per annum and one third (88 000) of total oral cancer deaths. Some populations where the incidence rates that were previously high (India, China, Blacks in the USA and Australia) have demonstrated a drop in incidence since the1990s. On the other hand, populations in Denmark and Japan with historically low incidence rates display rising trends of oral cancer (7, 11).

It has been argued that, with life style modifications, early detection and wider availability of modern treatments, more than two thirds of deaths from cancer across the globe might be prevented (12). Unfortunately, despite the easy accessibility of the oral cavity to direct examination, these malignancies are all too frequently detected at late stages (13). Furthermore, patients who survive a first cancer of the oral cavity have up to a 20-fold-increased risk of developing a second primary oral cancer and the risk could last for 5-10 years (14). For those who survive, there is a substantially elevated risk of developing a new primary HNSCC at another site (13). Furthermore, aftertreatment for

oral cancer, recurrence rates vary between 25-40% during a follow up period of 2-4years (15-17).

Despite advances in surgery, radiation and chemotherapy, the 5-year survival rates in many countries are of the order of only 54%, one of the lowest of the major cancer sites, and in much of the world (excluding few high quality treatment centers) this rate has not improved significantly over recent decades (13, 14). It is distressing and disfiguring to the affected person and difficult for the family members to cope with as well as challenging and costly to the health care system. Against this backdrop, oral cancer constitutes a significant cause of mortality, extensive morbidity and loss of quality of life enhancing social inequalities in its outcomes between and within countries. This underpins the importance of exploring new strategies for early detection and improving access to care and the design and implementation of multi-pronged prevention and control strategies targeted to high risk population groups as well as to the general population.

1.2.2 Local burden of oral cancer

According to Sri Lankan cancer incidence data 2010, approximately 2500 newly diagnosed oral cancer cases are being identified in each year. Therefore, in Sri Lanka lip, oral cavity and oro-pharynx cancer, taken together, is the commonest cancer among men with 23.6% of all cancer types of men and ranks 5th among women with 5.9% of all cancer types of women. Thus, oral cancer accounts for 14.3 % (sexes combined) and has an age standardised rate 12.0 per 100,000 population per annum of all reported malignancies (18). In Sri Lanka 83% of oral cancers are oral squamous cell carcinomas (18). About 40% increase in oral cancer patients is evident when considering cancer incidence data for past seven years. Hence, this most preventable cancer yet with very low survival rate of all cancer types has become a horrifying health burden in Sri Lanka (18, 19). Moreover, oral cancer in countries like Sri Lanka and India (20), is considered as a disease of the poorest of the poor. Therefore, the death of an only ‘bread winner’ in a family due to this most easily diagnosed cancer will turn out to be not only a public health problem but also a family problem. Surgeries for oral cancer are very costly, debilitating and time consuming which need a large multi-disciplinary care team. However, the outcome is not often

3 satisfactory as treatment is associated with high morbidity, loss of quality of life and often mortality. Therefore, it is very unfortunate to accept the fact that one of most preventable cancers has become the number 1 cancer among males in Sri Lanka.

1.2.3 Aetiology of oral cancer Squamous cell carcinoma of the oral cavity, in South Asian countries, is usually preceded by oral potentially malignant disorders (OPMD (21). The global prevalence of these is reported to be 1-5%, but with higher prevalence in Asia and South East Asia as an example: 11.3% prevalence rate has been reported in Sri Lanka (12, 22). This is a multifactorial disease with an array of socio-behavioural (life style related), environmental and genetic risk factors. These risk factors are population and geographic specific and they act individually and synergistically. The well known risk factors which are modifiable are use of smoked/smokeless tobacco, consumption of areca nut, alcohol abuse, diet deficient in anti-oxidants, essential vitamins and trace elements, poor oral hygiene and high risk human papilloma virus infections (HPV), especially type 16 and 18 (23-28). In addition, there is a small genetic predisposition (7, 12, 29). Interestingly, low socioeconomic conditions are independently associated with oral cancer (30). For example, a meta-analysis of 41 case controlled global studies conducted by Conway et al. 2008, together with other studies have revealed that low SEC is an independently associated with for oral cancer (3, 30, 31). Oral cancer in Sri Lanka is reported to be a common disease of those aged between 50 and 70 years (19, 32). Other risk indicators, which are also likely to be risk factors, (ie. they are in the causal chain of the disease) include exposure to excessive solar radiation/UV light (for carcinoma of the lip), sulphur dioxide, pesticides, mists from strong inorganic acids and burning of fossil fuels and inflammation associated with chronic infections (33, 34). Conversely, aetiology of approximately 15% of oral cancer cases remains unexplained (35). Overall 16% of cancers in the World in 2008 were argued as attributable to infections: viruses, bacteria, fungi and microparasites (7). There is growing evidence of involvement of bacteria as risk factors of certain cancers and a classic example is the etiological role of Helicobacter pylori in gastric cancer and mucosa-associated lymphoid tissue (MALT) lymphomas(36). Further examples include associations between Chlamydia trachomatis in cervical cancer (37), Salmonella typhi in gallbladder cancer

(37), as well as Bacterioides fragilis and Fusobacterium nucleatum in colon cancer (38, 39). Among viruses, hepatitis B, hepatitis C and HPV are accountable for 1.9 million cancer cases globally comprising gastric, liver and cervical cancer respectively (7). In light of such evidence, several epidemiological studies have been conducted in the last decade employing methodologies ranging from traditional culture techniques to 16S rRNA metagenomics to assess the possible role of bacteria in oral carcinogenesis (36, 37, 39). At present, there is sound evidence to substantiate that chronic microbial inflammations could initiate or trigger carcinogenesis and may contribute to so-called “tumour promotion” (40). Nevertheless, information is lacking on chronological order of events with regard to inflammation evoked by respective bacteria which could progress to cancer. Moreover, there is dearth of information to substantiate evidence for interpretation of presence of these bacteria as a cause, a consequence or co-incidence in the given OSCC tissue micro-environment (36, 41-43).

Candida species especially, C.albicans potentially contributes to the development of oral “premalignant lesions” – now referred to as “oral potentially malignant disorders” (OPMD) (44-47). Nonetheless, the exact mechanism by which C.albicans contributes as a causative agent of oral carcinogenesis warrants further research (47).

Human Papilloma Virus (HPV), Epstein Bar Virus (EBV) and Human Herpes Simplex Virus (HSV) have shown their oncogenic capabilities by molecular as well as epidemiological studies and are frequently associated with OSCC (48-54)

1.3 The Importance of Determination of Microbiome Profile in OSCC

It has been found that for millions of years the resident microbiota of man has co-evolved and co-existed with human beings with symbiotic beneficial relationship under healthy conditions, thus making a ‘holobiont’ or ‘supra organism’(41, 55). Furthermore, the collective genome of bacteria (metagenome) surpasses the human genome by orders of magnitude (> 150 fold) in terms of gene content (56, 57). Accordingly, the gut harbors the most diverse microbial community in the body, while the oral cavity habours the second most diverse microbial community in the body (nurturing at least 1000 species/phylotypes (58, 59). Under certain circumstances, such as changes in dietary

5 habits or presence of systemic disease, the homeostatic state of oral bacterial flora might be lost (60). As a result, changes in relative abundance of bacterial species and flourishment of certain pathogenic species at the expense of commensals occur and this process is termed as “ecological shift” or ‘dysbiosis” (61, 62). In disease, the oral microbial relationship with the host reverts from a symbiosis to a parasitic one (61, 63). A consortium of microbes rather than one species is believed to be involved in breaking down the harmonious relationship with host and causing disease (64).

Interestingly, it has been revealed that dysbiosis of the gut microbiota is capable of initiating an inflammatory response which can promote progression of cancer (65, 66). Strong evidence on role of periodontal pathogens, for instance, P.gingivalis in pancreatic cancer aetiology via systemic changes in inflammatory response in genetically susceptible individuals has been revealed (67, 68). Inspired by these findings, investigation of the possible role of oral microbiome in oral carcinogenesis is emerging as a new arena of research. Consequently, association of inflammatory bacteriome dominated by F.nucleatum and P.aeruginosa with OSCC has been discovered for the first time (69). In previous studies, it has been demonstrated that a distinct microbiome profile occurs in OSCC cases compared with healthy controls (70-75). Nevertheless, there was no consensus on specific bacteria or patterns of oral microbial dysbiosis that are associated with oral cancer (75). Clearly, there is considerable methodological variation among studies particularly with respect to sampling (e.g., deep tissue biopsy vs. surface swab), selection of control tissues and microbial profiling technology. Interestingly, 16S rRNA metagenomics with NGS has a great potential in exploring the oral microbiome shifts associated with oral cancer. However, the approach currently lacks adequate standardization (41).

There is emerging clinical and experimental evidence which propose a role for fungi in immune regulation, chronic inflammatory diseases and metabolic disorders including cancer (76, 77). Hence, fungal dysbiosis associated with inflammatory bowel disease has been revealed very recently (78) and there is research evidence to suggest that Candida dysbiosis was associated with OSCC (46).

There are geographic and population specific variations in prevalence of HPV in OSCC tissues. This marked heterogeneity among studies may be due to inherent limitations in collection of specimens, DNA extraction, detection methods, analysis and interpretation of results (53, 79-81). Exploration of the microbiome profile is crucial in metagenomic research. When there is adequate knowledge on stable microbial signatures of specific cancer tissues they could be used as suitable indicators of presence of cancers (82). Hence, constant microbial signatures might serve as diagnostic markers to explore microbial exposure, cancer risk, and incidence as well as prognostic markers to assess the treatment response of a specific cancer. Moreover, microbiome studies involving diverse cohorts of potentially malignant disorders consisted of large sample sizes (83), adequately controlled for confounders and methodological standardization may be helpful to recognize the role of microbes as an emerging independent risk factor for oral carcinogenesis, which may possibly contribute to breakthroughs in discovering novel preventive measures and facilitating early diagnosis (41, 83). In future, a great deal of metagenomic, meta transcriptomics and mechanistic studies using cell lines and animal models will pave the way to isolate cause and molecular damage in order to plan personalized therapy for OSCC which has multi factorial aetiology with geographic/population specificity (41).

1.4 Justification for Conducting the Study

Sri Lanka is a developing lower middle-income country with a highly efficient and effective public health care system extended up from grass root level. Combined with a high literacy rate, the country paints the picture of commendable health gains comparable to some developed countries at relatively low public health expenditure. Nevertheless, oral cancer has become the number 1 cancer among males and number 5 among females in Sri Lanka with increasing incidence as revealed by statistics from National Cancer Control Programme in Sri Lanka. Oral cancer demonstrates stark socio-economic disparities as the overwhelming disproportionate burden of oral cancer is carried by the poor and socially disadvantaged groups who indulged in well-established risk habits. Of them, betel quid chewing and areca nut chewing are deeply intrinsically interlinked to the socio-cultural fabric of Sri Lanka, though they are modifiable. Being one of the most

7 preventable and controllable type of cancer among all types of cancers, by timely habit intervention and early detection, such a context not only underpins an unexplainable paradox or a dilemma in already achieved health gains for Sri Lankans while showcasing a vital public health problem with high mortality, morbidity and marked impairment of quality of life. As 70% of oral cancer patients present at late stages; stage 3 and 4, the five year survival rate has been significantly low with unsatisfactory treatment outcomes yet at a colossal sum of Rs. 1 million per surgery. This surgery is cumbersome and time consuming (at least 8hrs per surgery) and demands multi-disciplinary teams to perform the surgery and rehabilitate the patients. Unfortunately, approximately 50% of OSCC patients in Sri Lanka developed their reoccurrence within one year of the excision of the primary tumour (19). Investigations into microbiome and chronic inflammatory disease conditions through metagenomic research have gained acceptance as ground breaking area of work. Oral microbiome represents one of the two most complex microbial communities and consists of the mycobiome, bacteriome, and virome. The complexity is caused in part because of site specificity as well as other influential factors such as gender, ethnicity, habits and periodontal status (55). Epidemiological studies have been carried on to assess the possible role of bacteria in oral carcinogenisis in the last decade or so (41, 84). However, to this date there are discernibly limited investigations into oral microbiome profile in oral cancer tissues with adequate sample size. This results in knowledge gaps in the existence of a specific oral microbiome profile in oral cancer tissues among population groups who carry highest global burden of oral cancer such as South East-Asians. It is not known how the oral microbiome profile (mycobiome,bacteriome, and certain viruses) varies in oral cancer tissues compared with non-cancerous growths such as fibro- epithelial polyps. The study of the mycobiome is considered to be a newly emerging discipline that lags far behind our understanding of the bacteriome and this field is still in its infancy (77). Even with this very limited research it has been revealed that diverse mycobiome profiles are associated with various systemic diseases (85-89). Nevertheless, none of the studies to this date investigated the mycobiome profile in OSCC.

Moreover, existing yet very limited investigations into oral microbiome (bacteriome and mycobiome) in oral cancer tissues do not have methodological rigor in terms of power,

8 precision and homogeneity of the participants by gender, ethnicity, life-style related habits, diet, and periodontal status and viral infections such as HPV, EBV and HHV 8. The outcome has been highly variable findings that emerged from different studies thus hindering consistency of findings to strengthen the associations among oral microbiome and oral cancer tissues.

Against this back drop, this study was designed to address the aforementioned existing knowledge gaps by establishing the microbiome profile in oral cancer tissues in a homogenous sub sample, representing the overwhelming majority of OSCC cases in Sri Lanka. The findings of this study are expected to be useful to find out breakthroughs in developing novel strategies in reducing the burden of oral cancer among Sri Lankans by early detection and facilitating better prognosis. Moreover, these findings will provide baseline metagenomic evidence for possible associations of oral microbiome and OSCC with some insights into functional aspects of the respective microbes. These findings will pave the way for further refined research and exploration of oral microbiome for treatment and monitoring of oral cancer initiation, progression and recurrence.

1.5 Research Question and Hypothesis to be tested

1.5.1 Research Question

What is the microbiome profile of oral squamous cell carcinoma tissues in a group of Sri Lankan male patients?

 What are the structural and estimated functional bacteriome profiles in a group of Sri Lankan male OSCC cases compared to Fibro Epithelial Polyp controls?  What is the mycobiome profile in a group of Sri Lankan male OSCC cases compared to FEP controls?  What is the status of HPV, EBV and HHV 8 carriage in a group of Sri Lankan male OSCC cases compared to FEP controls?

1.5.2 Research Hypothesis

The hypothesis of present study is, that there is a disease associated distinct microbiome profile: a ‘cancerbiome’ present in oral cancer tissues (buccal mucosa and tongue) of group of Sri Lankan Sinhala male patients, compared to fibro-epithelial polyp tissues (buccal mucosa and tongue) of a control group, having risk habits of betel chewing and/or smoking and alcohol consumption.

It was hypothesized that the advancing margin of the neoplasm would be the most important area to obtain OSCC associated microbiota as microorganisms at these sites may have particularly significant interactions with the motile and infiltrating malignant cells. Furthermore, it was assumed that the microbiota present in the depths of FEP would present a health associated flora in the tissues. Microorganisms in saliva lying on tissue surfaces may not be specific to neoplasia or to benign hyperplasias.

1.6 Objectives

1.6.1 General Objective To ascertain the microbiome profile of oral squamous cell carcinoma (OSCC) tissues in a group of Sri Lankan male patients.

1.6.2 Specific Objectives

1. To determine the structural and estimate the functional bacteriome profiles in a group of Sri Lankan male OSCC cases and FEP controls. 2. To explore the mycobiome profile in a group of Sri Lankan male OSCC cases and FEP controls. 3. To detect HPV, EBV and HHV 8 in a group of Sri Lankan male OSCC cases and FEP controls.

CHAPTER 2: MICROBIOME PROFILES OF ORAL SQUAMOUS CELL CARCINOMA TISSUES: A LITERATURE REVIEW

The association between chronic inflammation and a range of epithelial malignancies has been known since the observation of Virchow who, in 1863, hypothesized that cancer occurred at sites of inflammation (90). In general, infection-driven inflammation has been estimated to contribute to the pathogenesis of about 15-20% of human neoplasms (91, 92). Such inflammation could be an important preventable cause of cancer (93, 94). At present there is sound evidence that “chronic microbial inflammation” initiates or triggers carcinogenesis and may contribute to so-called “tumour promotion” by evading the immune system.(7, 40, 93, 95, 96).Therefore, it has been suggested that “chronic microbial inflammation” may influence oral carcinogenesis (36) along with existing “well defined” and “other risk factors”.

2.1 The Human Microbiome “Human microbiome” is a term being used to define all microorganisms, their genomes (metagenome) and ecosystems they inhabit on and within the human (Homo sapiens) body (63,97,98) “Supra-organism” or “Holobiont” (55) are terms currently used to define human and symbiotic microbial cells. In this “supra-organism”, trillions of bacteria perhaps >1014) live in various habitats (Figure 2.1) on and within the body, outnumbering eukaryotic cells and beginning in the neonatal period (56, 57, 99). It is known that bacteria in the human gut help to digest and extract energy from food, break down toxins, perform xenobiotic metabolism, produce vitamins and essential amino acids (100) as well as modifying neurological development and behaviour (76). Microbes are also capable of forming a barrier, promoting disease resistance and shaping the immunity of the host (101). It has been well established that multifaceted relationships between the microbiota (especially intestinal) and host’s innate and adaptive immune systems, work hand in hand to resolve the status of microbial threats and direct the type and degree of immune response to potential pathogens (101). Interestingly, the immune system and

11 microbes evolve and mature together, at birth or even earlier, probably in the foetal stage (101). It has been revealed that resident microbes have been performing metabolic functions in animals for more than 500 million years (102). Consequently, many similarities in the composition and organization of the human microbiome with other mammals have been found due to co-evolution (103). Nevertheless, co-evolution of the microbiome in humans has resulted in minor, yet crucial differences between ethnic groups (104, 105). Furthermore, throughout evolution the environment has continuously molded the composition of microbiome from Neolithic time to present day. Thus, the use of fire, invention of agriculture, increased access to processed food after the industrial revolution and the advent of medicinal therapy have been found to influence the composition of the human microbiome (55, 106). Various microhabitats (especially nasal, mouth, skin, gut and urogenital) throughout the body contribute to the overall microbiome (Figure 2.1). Each microhabitat maintains a unique ecosystem with distinct atmospheric and nutritional compositions that provide a setting for symbiotic interactions among the various microbes within that ecosystem and the host. Interestingly, microbiomes from the same location on the body are more similar among different individuals than micrbiomes from different locations on the same individual (100).

Figure 2.1: Various microhabitats in human body (news.bbcimg.co.uk)

2.2 The Oral Microbiome

The many microenvironments of the human oral cavity create a series of distinct microbial communities. Accordingly, the oral cavity harbours the second most diverse microbial community in human body, being second only to the gut (59).The oral microbiome is composed of different communities, predominated by bacteria, followed by fungi and viruses inhabiting the human oral cavity both in suspended (or planktonic) phase in saliva as ‘salivary microbiome’ and attached to biotic and abiotic surfaces as the ‘biofilm microbiome’. In addition, there are protozoa and archaea (59, 101). More details of oral bacteriome will be explained in section 2.4.1. Initial exploration of oral bacteria dated back to the well-known microscopic examination conducted by Antony van Leeuwenhoek, who observed a varied assortment of bacterial morpho-types in dental plaque (107). Subsequently, with the advent of bacterial culture media by Koch, Pasteur and others, the charcterization of cultivable oral microbiota was originated (59). The human mouth harbours almost 1000 bacterial species. These species are reported to be members of 185 genera and 12 phyla namely, Firmicutes, Fusobacteria, Proteobacteria, Actinobacteria, Bacteroidetes, Chlamydiae, Chloroflexi, Spirochaetes, SR1, Synergistetes, Saccharibacteria (TM7) and Gracilibacteria (GN02) (108). Candida

13 albicans has been well established as a commensal in oral cavity of 30% -70% of individuals of an increasing prevalence with age. However, these fungi are capable of causing acute and chronic infections, especially in immuno compromised patients (59, 109). Filamentous fungi were predominated by fungal genera Cladosporium, Aureobasidium, Saccharomycetales, Fusarium and Cryptococcus (110). Further information of oral mycobiome will be explored in 2.4.2 section of this literature review. A range of viruses including majority of bacteriophages and a few viruses of Eukariya (herpes viruses and circoviruses) have been found in a metagenomic study conducted to explore human oral viral ecology (111) and further details of oral viruses will be explained in 2.4.3.

2.2.1Exclusive attributes of the Oral Microbiome

Transmission of microbes from mother to child occurs during birth. Hence, delivery mode (vaginal vs caesarian) is responsible for the type of microbes that a child is initially exposed to (112). Furthermore, the delivery mode influences the diversity of the oral microbiome. Thus, vaginally born babies harbour higher number of taxa, 3 months after birth compared with babies born by caesarean section (113). Furthermore, the method of feeding is reported to influence the colonization of bacteria as 3 months old breast fed infants showed higher colonization with oral lactobacilli than formula fed infants (114). The major ecological event in the mouth of a child occurs during the eruption of teeth, which provides new surfaces for microbial colonization (115). Interestingly, by the age of three the oral microbiome is established but complexity increases with age (116). As a result, replacement of the deciduous teeth with adult dentition significantly alters the habitat and affects the composition of oral microbiome in a child (117).

2.2.2 Oral Biofilm

There is an essential need for microorganisms to attach to oral surfaces to remain in the mouth. Hence, the oral microbiota develop as interactive microbial communities on mucosal and dental surfaces in the form of structurally as well as functionally organized biofilms (55, 118). The progression of biofilm development has been appraised recently (119-121). The entire surfaces of the mouth are covered by a layer of adsorbed molecules

14 of bacterial and salivary origin and this is defined as acquired pellicle. The pioneer microbial colonizers attach reversibly to this layer through weak, prolonged physiochemical interactions between charged molecules on the bacterial cell and oral surfaces, with the possibility of detachment (121). Nevertheless, these interactions will become permanent by strong short- range stereo chemical interactions between adhesions on the bacterium and complementary receptors in the acquired pellicle (121). Streptococci act as primary colonizers by modifying the local environment and make conditions favourable for colonization by more fastidious successors. Thus, secondary colonizers will be able to attach to receptors on these bacteria by co-adhesion. Subsequently, the diversity of the biofilm will enhance to form a multi-species community over the time. A biofilm matrix is formed by a series of extra-cellular polymers synthesized by attached bacteria. This matrix not only acts as a structural scaffold but is also a biologically active entity by retaining numerous molecules consisted of enzymes (122).The resident bacteria in the biofilm interact both synergistically and antagonistically. Metabolic forces of bacteria inhabiting the biofilm operate synergistically to break down complex host macro molecules such as mucin to obtain nutrients. Subsequently, cascades of food chains manifest in the biofilm where the metabolic product of one organism becomes a primary nutrient for another. Furthermore, bacterial cells communicate by signaling with each other, using a range of diffusible molecules which facilitate the coordination of gene expression among members of the microbial community. Peptides are used for communication between Gram positive bacteria. In contrast, autoinducer 2 is employed by many Gram negative species to communicate among them. As a result, the biofilm is structurally as well as functionally organized (121) with better biological properties for survival as a consortium than a single species (120) and more tolerant of antimicrobial agents and host defenses. The microbial diversity varies between different surfaces of the mouth depending on the prevailing physical and biological conditions. The microbial load at mucosal sites is relatively low due to desquamation. Nevertheless, biofilms with higher microbial diversity are found on the highly papillated surfaces of the tongue. Teeth are non- shedding surfaces and the highest amount of biomass in the mouth can be seen on them. The maximum numbers and greatest diversity of oral microbiota are found at stagnant

15 sites which provide protection from oral removal forces (118). Fissures on occlusal surfaces equipped with high numbers of aerobic and facultatively anaerobic, saccharolytic Gram positive bacteria predominantly streptococci. Moreover, there are few anaerobes or Gram negative bacteria. However, the highest proportion of proteolytic and many Gram negative obligate anaerobes are present in the gingival crevice. Some of these bacteria are reported to be uncultivable (118).

2.3 Emerging Importance of Microbial Ecology in Inflammatory Diseases and Cancer

The human microbiome can be classified into a ‘core ’microbiome and a ‘variable’ microbiome according to early metagenomic research (Figure 2.2). The former is shared among all individuals and consists of the predominant species that exist under healthy conditions (97, 100, 123).The variable microbiome has evolved in response to geography, unique life style, diet, early-life exposure and genotypic determinants (124, 125). Conversely, later studies of ecological diversity among healthy individuals disregarded the hypothesis of ‘core’ microbiome due to sufficient variation in the taxonomic composition of the microbiome, even shared taxa from individual species to entire phyla were observed to differ in abundance by more than an order of magnitude among healthy individuals (126, 127). An alternative for the definition of ‘core’ microbiome is ‘functional core’ a complement of metabolic and other molecular functions that are carried out by the microbiome within a particular habitat but are not essentially provided by the identical microbes in different people (127). Furthermore, the abundance of metabolic pathways is significantly more consistent across people for a given site when compared with huge interpersonal variations that are observed in the taxonomic composition of the microbiome at all sites (57, 128-130). Nevertheless, there are commonalities in the microbiome profile with particular diseases and this is revealed by recent research findings. Moreover, there is research evidence to support that the microbiome profile in diseased samples is different from samples obtained from healthy individuals (131).

Figure 2.2: Human microbiome is composed of a core microbiome - common to all individuals and variable microbiome - unique to individuals depending on genotype, life style and physiological differences (97, 132).

As the correlation between the human microbiome and health becomes more evident, microbiome research is becoming central to the advancement of disease diagnostics and therapeutics as well as the development of personalized medicine(100). The emerging field of research that targets the microbiome for therapeutic purposes is known as “microbiomics”. Microbiomics aims to understand how microorganisms interplay with the host’s physiology and health by analysing their distinct functions and inter-relationships (133). Interestingly, metagenomic studies have revealed that the richness and diversity of bacterial species in the human gut may be an indicator of health (134). Consequently, therapeutic use of faecal microbiota transplant (FMT) has gained acceptance as a natural treatment modality for Clostridium difficile infection (CDI) (135) and inflammatory bowel disease (IBD) (136).

In recent years, the Human Microbiome Project (HMP) took a leading role in metagenomic research. It explored the role of the human microbiome in physiology, health and disease through metagenomic and meta transcriptomic research and analyses of the genomes of specific microorganisms (63). In addition, researchers mapping the human microbiome discovered previously unknown species and genes and their relationship with human diseases such as inflammatory bowel disease, colon cancer,

17 pancreatic cancer, breast cancer, irritable bowel syndrome and non- alcoholic fatty liver disease (137-143). Microbial dysbiosis has been found to be associated with multiple sclerosis, diabetes (types 1 and 2), allergies, asthma, autism, obesity and cancer in general (101, 126, 144-147), especially colon, gastric, pancreatic, laryngeal, breast and gall bladder carcinomas (148).

Despite significant strides made on understanding the complex bacterial communities inhabiting the human oral cavity, their links to ecological contributions of oral fungi, viruses, phages and the candidate phyla radiation (CPR) group of ultrasmall have remained relatively uninvestigated (149).To this date there are information gaps on the complex host-microbial and inter-microbial interactions that either promote health or lead to disease. Thus, the importance of an in-depth understanding into ecological perspectives of oral microbiome has become increasingly gaining acceptance more than ever before (150). ‘Hypothetical Models’ have been proposed based on research evidence in this regard such as the ‘Key-Stone Pathogen Hypothesis’(151) as well as ‘Key-Stone Pathogen mediated polymicrobial synergy and dysbiosis model’(150).

2.3.1 The Key Stone Pathogen Hypothesis

The ‘Keystone Pathogen Hypothesis’ holds that certain low abundance microbial pathogens could orchestrate inflammatory diseases by remodeling a normally benign microbiota into a dysbiotic one. Dysbiosis is defined as a state of microbial composition that is characterized by an unbalanced proportion of bacteria compared with the proportion of healthy state by dominance of key stone pathogens in the disease status (151, 152). Most importantly, the capacity of keystone pathogens to instigate inflammation in contrast to inflammation induced by dominant pathogens significantly outweighs the quantitative minor position possessed by them. Evidence that supports ‘keystone pathogen hypothesis’ provides novel arena to develop targeted diagnostic modalities and therapies for complex dysbiotic diseases. There is accumulating research evidence to substantiate that keystone pathogens that provoke inflammation by remodeling the microbiota, evoke two mechanisms proposed as direct effects on the microbiota (eg. altered transcriptional profile) or indirect effects resulting from host

18 modulation (eg. manipulation of host signaling leading to impaired host immune surveillance) or, in principle by both mechanisms (151).

2.3.2 Well defined lifestyle related risk factors of oral cancer influencing the colonization of oral microbiome

Oral Cancers demonstrate a multi-factorial aetiology and risk factors vary according to geographical regions and socio-cultural groups (34, 43). Of them, betel chewing with or without tobacco, smoking and alcohol consumption considered to be the major well- defined risk factors (19, 20, 22, 153). Moreover, areca nut (betel nut) chewing is among the leading causes for oral cancer in regions of Asia-Pacific (153). Other than the carcinogens in tobacco and areca nut, continuous and frequent chewing may induce chronic irritation and inflammation that could damage epithelia cells of the oral mucosa (154). Moreover, betel chewing, smoking and alcohol consumption are associated with poor oral hygiene and periodontal disease both of which are linked to alterations in oral bacterial composition as well as for an increased oral cancer risk (155, 156).

Table of Classification of Risk Factors of Oral Cancer is presented in Annexure 01.

It has been revealed that betel nut chewing influences the composition of oral bacteriome. Betel quid associated microbiome profiles with elevation or reduction in relative abundances of common oral bacteria including Streptococcus were observed in prolonged betel chewers compared with non-chewers (157, 158). A recent study was conducted by Hernandez et al. 2017 (154) among 122 adults comprised of 64 current areca nut chewers, 37 former areca nut chewers and 21 never chewers as well as 10 with leukoplakia and Oral Submucous Fibrosis (OSMF) to assess oral bacterial profiles. Oral swabbing and saliva samples were evaluated using 454 pyro-sequencing of v3-v5 region of 16S r RNA bacterial and genotyping for HPV was performed. Bacterial diversity between samples based on unifrac-distances differed significantly by chewing status and oral lesion status. Thus, beta- diversity demonstrated clustering between current, past and never chewers (154). Accordingly, bacterial diversity was significantly lower among long-term ≥ 10 years chewers vs never chewers as well as current chewers with OPMD (leukoplakia and OSMF) and without OPMD. Current chewers had significantly increased levels of Streptococcus infantis and Actinomyces but lower levels other species

in Streptococcus genera. Moreover, long-term areca nut chewers had reduced levels of Parascardovia and Streptococcus. Chewers with OPMD had significantly elevated levels of Oribacterium, Actinomyces and Streptoccus including S.anginosus. However, S.anginosus and S. infantis levels emerged as independent predictors for OPMD status of current chewers by multivariate analysis controlled for smoking and HPV status. Hence, the findings suggested bacterial dysbiosis and altered bacterial composition associated with areca-nut chewing and OPMD status, yet as concluded by the authors further studies are warranted with regard to the clinical significance of an altered microbiome and mechanisms of oral carginogenesis among areca-nut chewers (154).

Moreover, Kumar et al. (2011) (159) conducted a study based on marginal and subgingival plaque and gingival crevicular fluid samples of 15 smokers and 15 non-smokers using 16S r RNA cloning and sequencing. As emerged from the findings, periodontal pathogens such as Fusobacterium, Cardiobacterium, Synergistetes as well as respiratory pathogenic genera such as Haemophilus and Psedomonas dominated early acquisition; colonization and pro-inflammatory response for this colonization were evident in the biofilms of smokers compared to non-smokers (159). In addition, there was a positive correlation in pro-inflammatory cytokine levels and commensal bacteria in the biofilm of smokers but not in non-smokers. In summary, the findings suggested that smoking influenced early colonization of bacterial pathogens in oral biofilm as well as host response to it (159).

A recent study conducted to assess the relationship between cigarette smoking and oral microbiome using 16S rRNA gene sequencing among 1204 oral wash samples. Sequences were clustered into OTUs using QIIME and functional aspect of metagenome content was predicted using PICRUSt. Overall oral microbiome composition was significantly varied between current and non- current (former and never) smokers (p<0.001). The relative abundance of Proteobacteria was low (4.6%) in current smokers compared with never smokers (11.7%), with no difference between former and never smokers. In addition, Capnocytophaga, Peptostreptococcus and Leptotrichia were reduced, while Atopobium and Streptococcus were enriched, in current smokers compared with never smokers (160). Functional analysis from inferred metagenomes demonstrated that bacterial genera

20 diminished by smoking were related to carbohydrate and energy metabolism, and to xenobiotic metabolism. These findings suggest that smoking changes the community structure of oral microbiome, potentially leading to shifts in functional pathways with implications for smoking-related diseases (160).

Therefore, despite the need for further studies with robust methodologies there is research evidence to suggest that well-defined, life-style factors influence microbial colonization.

2.4 Can the Microbiome Profile be a Risk Factor for Oral Cancer?

Overall, about 2 million (16% ) of the total of 12.7 million new cancer cases worldwide in 2008 were attributable to infectious agents such as viruses, bacteria and microparasites (7).Periodontitis has been reported to associate with increased risk of OSCC(161), with a possible underlying mechanism being persistant chronic inflammation (162). Hence, thequestion as to weather a microbiome at a given site could promote cancer is the ‘million dollar question’ that this current research seeks to answer. In the first sub section (2.4.1),invovement of “oral bacteriome” in oral carcinogenesis is discussed.Ensuing sub sections will focuss on facts of “oral mycobiome” (2.4.2) and “oral virome”(2.4.3) in relation to initiation and progression of oral carcinogenesis.

2.4.1 Can bacteria be a risk factor for oral cancer?

Importantly, in the last two decades, significant evidence has emerged implicating bacteria in the aetiology of some cancer types suchasHelicobacter pylori in gastric cancer and mucosa-associated lymphoid tissue (MALT) lymphomas (36),Chlamydiatrachomatis in cervical cancer (37), Salmonella typhiin gallbladder cancer (163), and both Bacteroides fragilis and Fusobacterium nucleatum in colon cancer (38, 39). This has recently inspired and triggered considerable amount of research into the possible role for bacteria in oral oncogenesis. Relevant work has been already reviewed in a number of publications (91, 95, 164). Therefore, this section (2.4.1) aspires to dessect existing literature on the association between bacteria and oral cancer to provide in depth update about the importance of exploring

21 possibilities of bacteria as a risk factor for oral cancer under four sub sections as follows.

2.4.1.1 The healthy oral bacteriome

The oral cavity has several distinct niches which provide unique conditions and nutrients for populating microbes, predominately bacteria (108). Each niche (e.g. hard palate, soft palate, lateral and dorsal surfaces of the tongue, and tooth surfaces above and below the gingival margin) displays site specificity and distinct bacterial profiles (157). Once established, the oral microbial communities maintain a stable composition, a ‘microbial homeostasis’, and exhibit commensal and mutualistic relations with the host (118). The host provides its microbial communities with an environment where they can flourish; in return microbes protect the host as they colonize specific surfaces and prevent adherence and/or hinder growth of pathogens (132).

2.4.1.2 Oral bacteriome dysbiosis and disease Under certain circumstances the homeostatic state of the oral bacterial flora can be lost, resulting in an “ecological shift” or “dysbiosis” characterized by increased abundance of pathogenic bacteria and expression of virulence properties (118, 132). Subsequently, these pathogens become capable of causing diseases within and beyond the oral cavity, reverting the oral microbiota relationship with the host from mutualistic to parasitic (63). A consortium of microbes rather than one species is usually involved in causing disease (64). Modifiable factors leading to oral dysbiosis include poor oral hygiene, gingival inflammation, dietary habits, smoking and salivary gland dysfunction (166). Classic examples of oral microbial dysbiosis include dental caries and periodontal infections. In caries, the ecological shift favours growth ofacidogenic and aciduric species namely mutans streptococci, Lactobacilli and Bifidobacteria (167). In periodontal diseases, proteolytic bacteria that challenge the host inflammatory response are in play (119). The leading bacteria at periodontal destruction sites include members of the so called red complex, namely Porphyromonas gingivalis, Tannerella forsythia andTreponema denticola (168), as well as a number of new taxa such as oral

Synergistetes and Saccharibacteria (TM7) (169). Currently, there is increasing interest in the possible role of microbial dysbiosis in cancers (147, 170). Hence, the ‘Key-Stone Pathogen hypothesis’ has offered a hypothetical model to explain the microbial ecosystems with inflammatory diseases such as periodontal disease and oral cancer (150). 2.4.1.2.1 Key-Stone Pathogen Mediated Polymicrobial Synergy and dysbiosis (PSD) model

Recent metagenomic study was conducted to discover potential patterns and interactions among microbial communities under three statuses namely: healthy control, stable periodontitis and progressive periodontitis. Overall, the results supported the key-stone pathogen mediated polymicrobial synergy and dysbiosis model of periodontitis using alpha-diversity and species composition as metrics(150). Apart from Porphyromonas gingivalis, three additional key-stone species were identified namely Haemophilus haemolyticus, Prevotella melaninogenica and Capnocytophaga ochracea.

Research evidence on metabolic and community synergy of oral bacteria in colorectal cancer has highlighted the importance of considering the community-wide virulence properties in it (171). The polymicrobial nature of oral biofilms and a saccharolytic metabolism of many of these species make them well suited to live in the microenvironment of colorectal lesions. The presence of Fusobacterium nucleatum in colorectal cancer is well established and molecular analyses have identified specific virulence factors that promote tumourogenesis in the colon. However, other oral community members such as Porphyromonas species also found with Fusobacterium nucleatum in colonic tumours (171).

Jung-Jung, Jun and Choi, 2017 reported that P. gingivalis may suppress the invasion of co-infecting F. nucleatum into gingival epithelial cells, to which inactivation of P13K/AKT pathway by its gingipains might contribute partly. However, as P.gingivalis degrades intercellular junctions in the epithelium it guides F.nucleatum towards para- cellular pathway in order to avoid intracellular degradation. These findings support synergy of pathogens P.gingivalisand F.nucleatum implicated for aetiopathogenesis of periodontitis as well as colorectal cancer.

2.4.1.3 Oral bacteriome dysbiosis in oral cancer

The relationship between bacterial profiles and OSCC has been thoroughly studied and Table 2.1 summarizes epidemiological studies that assessed the association between bacteria and oral cancer.

Table 2.1: Summary of epidemiological studies that assessed the association between bacteria and oral cancer

Study Sam Technology used Case sample Control sample Taxa associated with oral cancer ple size Tumor Nagy et al, Cultivation; biochemical Contralateral mucosa Fusobacterium, Porphyromonas, Actinomyces, 21 surface 1998(172) identification surface swabs Propioni-bacterium spp. and Candida albicans swabs FFPE Katz et Immunohistochemical gingival FFPE normal tissue al.,2011 15 Porphyromonas gingivalis staining carcinoma from controls (173) tissue Tumor tissue; Tateda et Cultivation, PCR and gingival al.,2000 270 None Streptococcus anginosus Southern-blot smears; oro- (174) pharyngeal swabs Fresh tumor Sasaki et Fresh tissue: Polymerase Chain tissue; dental al., 2005 49 leukoplakia; lymphoma; Streptococcus anginosus Reaction plaque; (175) rhabdomyosarcoma saliva Morita et Fresh tumor Fresh non-cancerous al., 2003 63 Real Time PCR Streptococcus anginosus tissue tissue (176) Mager et Checkboard DNA-DNA Unstimulated Capnocytophaga gingivalis,Prevotella al.,2005 274 Unstimulated saliva hybridization saliva melaninogenica and Streptococcus mitis (177) Micrococcus luteus , Prevotella Hooper et melaninogenica, Cultivation; 16S rRNA Fresh tumor Fresh Contralateral al., 2006 51 Exiguobacteriumoxidotolerans, Fusobacterium gene sequencing tissue tissue (71) naviforme, Staphylococcus aureus and Veillonella parvula Ralstoniainsidiosa, Fusobacterium naviforme, Hooper et 16S rRNA Peptostreptococcus Fresh tumor Fresh Contralateral al., 2007 20 metagenomics: Sanger micros,Clavibactermichiganensis subsp. tissue tissue (70) sequencing Tessellarius,Capnocytophaga sp. oral strain S3 and Prevotella sp. oral clone BE073 Parvimonas sp. oral taxon 110, Eubacteriuminfirmum, Eubacteriumbrachy, Pushalkar 16S rRNA Gemella haemolysans, Gemella morbillorum, Fresh tumor Fresh Contralateral et al., 2012 20 metagenomics: Sanger Gemella sanguinis, Johnsonellaignava, tissue tissue (73) sequencing; DGGE Peptostreptococcus stomatis, Streptococcus gordonii, Streptococcus parasanguinis I and Streptococcus salivarius Pushalkar 16S rDNA Genera Streptococcus, Rothia, Gemella, Stimulated et al.,2011 05 metagenomics: NGS Stimulated saliva Peptostreptococcus, Lactobacillus, Micromonas saliva (72) (454); DGGE and Porphyromonas Surface swabs: Schmidt et 16S rDNA Tumor Genus Fusobacterium; phylum Bacterioidetes; contralateral normal; al.,2014 94 metagenomics: NGS surface (Streptococcus and Rothia showed inverse healthy and (74) (Illumina) swabs association) precancerous subjects Al- Hebshi 16S rDNA Fresh tumor et al., 2015 03 metagenomics: NGS; None Bacteroides fragilis tissue (178) Roche’s 454 Guerrero et al., 2016 59 Roche 454 GS/junior Saliva Saliva Streptococcus, Dialister andVeillonella (75) Al-Hebshi Illumina’s Miseq 2x300 F.nucleatum subsp.polymorphum, et al., 2017 40 Fresh tissues Deep epithelium swabs bp P.aeruginosa, Campylobacter sp.Oral taxon 44 (69)

In the first association study, Nagy et al. 1998 performed culture-based analysis of surface swabs, and discovered that levels of Porphyromonas species, Fusobacterium species and other bacterial species were significantly higher on OSCC tissue compared to adjacent healthy mucosa (172). In a subsequent study using Immunohistochemistry for detection of P. gingivalis, Katz et al. 2011 found that sections of gingival squamous cell carcinoma displayed higher staining intensity than those of healthy gingival tissue samples, indicating a higher colonization of cancerous tissues by this bacterium (173). It has been revealed that P.gingivalis is associated with orodigestive cancer mortality, thus has been suggested as a biomarker for microbiome-associated risk of death of orodigestive cancer in a study conducted using 7852 serum samples of orodigestive cancer patients to detect P.gingivalis IgG antibodies (179). Furthermore, in a study conducted by Woo et al. 2017 (180), oral cancer cells sustainably infected with P.gingivalis demonstrated resistance to Taxol (a chemotherapy drug) and had higher metastatic potential in an animal model. Thus, P.gingivalis and F. nucleatum have been linked recently to pancreatic and colorectal cancers (CRC) respectively (38,67,179, 181). Streptococcus anginosus has also been implicated in OSCC (Table 2.1). In one study, S.anginosus was detected by PCR in all head and neck squamous cell carcinomas, including OSCC, samples (174). Consistently, Sasaki et al.2005, detected S.anginosus in 19/42 (45%) OSCC samples, but in none of the leukoplakia, lymphoma or rhabdomyosarcoma samples tested (175). Morita et al. 2003, identified S.anginosus in only 5/38 (13%) of their OSCC samples (176). In addition, more recent studies have identified S.anginosusin non-tumorous oral tissue at equal and even higher frequency compared to tissue from the tumours (not involving same patients as cases and controls), suggesting that S.anginosus is only a normal colonizer of the oral mucosa (70, 73).

Mager et al. 2005 studied the differences in salivary counts of 40 common oral bacteria between 45 OSCC cases and 229 cancer-free controls using checkerboard DNA-DNA hybridization (Table 2.1). They found Capnocytophaga gingivalis, Prevotella melaninogenica and Streptococcus mitis to be significantly elevated in the saliva of cases (177). When used as diagnostic markers, these three bacterial species were found to

26 differentiate between cases and controls with 80% sensitivity and 83% specificity. Nevertheless, these results have not been replicated in any subsequent study.

In 2006, Hooper et al. using culture methods, isolated 80 bacterial species from within the tissue of 20 OSCC biopsies (71). Further analysis of 10 specimens using 16S rRNA Sanger sequencing identified an additional 28 bacterial species (70). These studies provided some evidence for tumour specificity of bacteria, as some species were exclusively found in either the cancerous or non-cancerous tissues. The majority of bacteria identified in the tumours were saccharolytic and aciduric (Table 2.1), suggesting a selection process by the tumour micro-environment rather than a potential association with carcinogenesis. In 2012 Pushalkar et al. also using 16S rRNA Sanger sequencing, detected 80 bacterial species in 10 specimens of OSCC (73), 35 species of which had been reported for the first time in OSCC, thus expanding the bacterial diversity within OSCC tissues to 140 species. In this study, however, a totally different panel of species from previous studies was found to be associated with the tumours (Table 2.1).

A caveat of conventional culture methods and Sanger sequencing is low analysis depth: i.e., the limited number of strains/clones that can be affordably analyzed, which hampers reproducible of detection of possibly relevant species, particularly those with relatively low abundance. This limitation has been surpassed by the advent of NGS which allows the study of microbial communities at unprecedented depth and breadth (165). To date, three studies have employed NGS to characterize the oral bacteriome associated with OSCC. In one study, Pushalkar et al. 2011 identified 860 operational taxonomic units (OTUs) in salivary samples from 3 OSCC cases and 2 healthy controls. These OTUs matched known species; 244 and 398 of these were exclusively present in the OSCC and control samples, respectively (72). However, the comparison between the two groups was limited to the genus level; the genera Streptococcus, Rothia, Gemella, Peptostreptococcus, Porphyromonas, Micromonas and Lactobacillus were found to be more abundant in the OSCC cases, whereas Prevotella, Neisseria, Leptotrichia, Capnocytophaga, Actinobacillus and Oribacterium were higher in the controls. In a larger-scale study, Schmidt et al. 2014 analyzed swabs of lesion surfaces and contra-lateral normal mucosa from 18 OSCC patients, 8 pre-cancer cases and 9 healthy controls (74). In contrast, to

27 the study by Pushalkar et al.2011 the genera Streptococcus and Rothia were significantly lower in the tumor samples compared to contra-lateral normal samples as well as to the pre-cancer samples (72). Of note was that, the tumors were associated with significantly higher proportions of the genus Fusobacterium. In addition, the phylum Bacteroidetes was notably more abundant in both cancerous and normal tissues of OSCC patients compared to pre-cancer and healthy control subjects, suggesting that higher colonization with this phylum may be associated with increased risk of OSCC, and thus serve as a biomarker (72).

A limitation to the studies by Pushalkar et al.2011 and Schmidt et al.2014(72, 74), as is the case with most oral microbiome studies employing NGS, was the low taxonomic resolution; i.e. failure to reliably classify NGS sequences beyond the genus level, which hinders accurate assessment of the possible association between bacteria and oral cancer. This limitation was overcome in a third study by Al-hebshi et al. 2015 (178), utilizing the Human Oral Microbiome Database (HOMD) for the classification of individual NGS reads to the species level. By applying the algorithm to 3 samples of OSCC DNA, the study revealed the presence of 228 bacterial species, of which 35 species were present in all samples. Two of the samples contained Bacteroides fragilis, a bacterium seldom detected in the oral cavity. Interestingly, six proteins from this species had been identified in saliva of OSCC in an earlier study (182). Furthermore, B.fragilis has been recently implicated in colon cancer (39).Together, these findings are suggestive of a role of B. fragilis in oral carcinogenesis, which is an area worth further investigation.

Guerrero et al. (75) conducted a study in 2016, using pyrosequencing to find out the microbial diversity and taxonomic composition of human saliva microbiota associated with HPV positive and HPV negative head and neck squamous cell carcinoma (HNSCC). Study subjects consisted of OSCC cases with tumours in the oral cavity and the oropharynx compared with normal epithelium of healthy controls. In addition, the abundance of bacteria before and after the surgical resection of OSCC tumours was analysed by Gurero et al.2016 (75) revealed a dominance of classes such as Fermicutes, Proteobacteria and Bacterioidetes with less frequent presence of Actinobacteria and Fusobacteria before surgery. Streptococcus, Prevotella, Haemophilus, Lactobacillus and Veillonella were the abundant genera with lower numbers of Citrobacter and Kingella.

Interestingly, HNSCC patients demonstrated a remarkable loss in species richness and diversity of bacterial species (p < 0.05) compared to the healthy tissue controls. In general, relative abundance of OTUs within the genus Streptococcus, Dialister and Veillonella seemed to discriminate tumour from control samples (p< 0.05). Furthermore, tumour samples lost Neisseria, Aggregatibacter (Proteobacteria), Haemophillus (Firmicutes) and Leptotrichia (Fusobacteria). Oral Cavity Squamous Cell Carcinoma (OCSCC) differed from Oropharyngeal Squamous Cell Carcinoma (OPSCC) and normal tissues by paired taxa within family, Enterobacteriaceae, together with genus Oribacterium (p< 0.05).Citrobacter was abundant in 6.2% OPSCC, HPV negative samples while, Veillonella was more abundant in OPSCC HPV positive samples (75). Moreover, abundance of Gemellaceae and Leuconostoc was higher in HPV positive samples. Longitudinal analysis of samples taken before and after surgery demonstrated a reduction in alpha diversity measures after surgery. Based on these findings, the authors concluded that the application of microbiota profiling was a diagnostic and prognostic tool (75).

A very recent study conducted by Al- Hebshi et al. 2017 sought to find out the association of bacteriome with tissues of OSCC cases in Yamen. In these studies, an inflammatory bacteriome featuring F. nucleatum subsp.polymorphum, P.aeruginosa and Campylobacter species Oral taxon 44 was evident flourishing in OSCC tissues. In contrast, S. mitis, R. mucilaginosa and H. parainfluenzae were abundant in deep epithelium swabs of matched controls (69). In this study, Illumina’s 2x300 bp chemistry was employed for sequencing. Subsequently, high quality non-chimeric merged reads were classified to species level using a validated prioritized BLASTIN- algorithm and downstream analysis was performed employing QIME, PICRUSt and LEFSe bioinformatic software packages. Remarkably, this was the first epidemiological evidence for association of an inflammatory bacteriome dominated by Fusobacterium nucleatum and Pseudomonas aeruginosa enriched in OSCC tissues. Nonetheless, there is an important need for future studies to explore the role of differentially abundant taxa and pathways in initiation and progression of OSCC (69).

At present there is no agreement among studies on bacterial species, which are linked to oral cancer. In addition, because of the cross-sectional nature of these studies, is it is not

29 possible to tell whether any microbial dysbiosis identified is involved in the aetiology of oral cancer or just a consequence of it. Nevertheless, and despite the lack of strong epidemiological evidence to support a role for P. gingivalis and F. nucleatum in oral cancer, the carcinogenic properties of these two species, particularly P. gingivalis, have been extensively demonstrated in vitro and in experimental animals as detailed in the section below. 2.4.1.4 Possible mechanisms by which oral bacteria contribute to oral carcinogenesis

Oral bacteria possibly contribute to oral carcinogenesis via a number of mechanisms including inhibition of apoptosis, activation of cell proliferation, promotion of cellular invasion,induction of chronic inflammationand production of carcinogens (Figure 2.3).

2.4.1.4.1 Inhibition of apoptosis

P. gingivalis represses chemically-induced apoptosis in primary cultures of gingival epithelial cells (GECs)(183), which seems to be mediated by various mechanisms. Thus, P. gingivalis stimulates JAK1/STAT3 and PI3K/Aktsignalling which controls intrinsic mitochondrial apoptosis pathways (184, 185). At the mitochondrial membrane, the activity of proapoptotic BAD (BCL-2-associated death promoter)is suppressed, resulting in elevated BCL2 (antiapoptotic): BAX (proapoptotic) ratio, which in turn deceases the release of the apoptosis effector cytochrome c(186). As a result, downstream, activity of both caspase-9 and the executioner caspase-3 is blocked (185, 186). In a different mechanism, P. gingivalis has been shown to up-regulate microRNA-203 in GECs, whichthrough downregulation of SOCS3 (suppressor of cytokine signalling 3) increases the activity of STAT3 (signal transducer and activator of transcription 3) and, in turn, inhibits apoptosis (187). Furthermore, P. gingivalis secretes anucleoside diphosphate kinase (NDK),which prevents ATP-dependent apoptosis mediated through purinergic receptor P2X7on GECs (188); NDK might also interfere with an anticancer immune response mediated(187)by ATP activation of P2X7receptors on dendritic cells (95, 189). In 2015, Binder Gallimidi et al. reported that chronic coinfection with P. gingivalis and F. nucleatum promoted progression of chemically-induced oral cancer in a murine model via activation of the IL6/STAT3 axis (190).

2.4.1.4.2 Activation of cell proliferation

In addition to its anti-apoptotic properties, P.gingivalis accelerates progression of GECs through the S and G2 phases of the cell cycle viaupregulation of cyclins (A, D and E), activation (phosphorylation) of cyclin-dependent kinases (CDKs) and diminishing the level of p53 tumor suppressor gene (188, 191). These effects are dependent on the possession of fimbriae (FimAadhesin). Since bacterial lipopolysaccharide (LPS) has been reported to dysregulate p53, a similar role by P. gingivalis LPS is possible (95). Moreover, P. gingivalismay contribute to a proliferative phenotype in GECs through activation of β-cateninvia a gingipain-dependent proteolytic process(192). F.nucleatumalso promotes cell proliferation. In human epithelial cells, infection by F. nucleatumresults in up-regulation of 12 kinases, the majority of which are involved in cell proliferation and cell survival signalling as well as DNA repair(193). A strong relationship between F. nucleatum and colorectal cancer is particularly evident. In vitro, fusobacterial adhesion FadA has been found to bind to E-cadherin on CRC cells, and in turn activate the β-catenin signalling pathway(194). Downstream, this results in elevated transcriptional activity of oncogenes and proinflammatory cytokines, and subsequently enhanced CRC cell proliferation. Consistently, expression levels of the FadA gene in colon tissue from patients with CRChave been shown to be>10 fold higher than those in normal individuals(194).

2.4.1.4.3Promoting cellular migration and invasion

Both P. gingivalis and F. nucleatum promote cellular invasion in OSCC. Using an OSCC cell line, P. gingivalis infection was demonstrated to upregulate expression of pro-matrix metalloproteinase-9 (pro-MMP-9) by activation of the ERK1/2-ETS1, p38/HSP27 and PAR/NF-kB pathways; gingipains then cleaved the proenzyme into active MMP-9, enhancing cellular invasion (195, 196). Repeated exposure to P. gingivalis can also increase invasiveness of OSCC cells by triggering epithelial cells to mesenchymal transition (EMT), acquisition of stemness and enhanced production of MMP-1 and 10 (197). In a similar fashion, infection of human epithelial cells by F. nucleatum increases production of MMP-13 (collagenase 3) through activation of mitogen-activated protein

31 kinase p38, and promotes cellular migration, possibly via stimulation of Etk/BMX, S6 kinase p70, and RhoA kinase (193).

2.4.1.4.4 Induction of inflammation

Chronic inflammation, triggered by infections or environmental exposures, plays a pivotal role in all stages of carcinogenesis including induction, progression, invasion and metastasis(198). Reactive oxygen species (ROS), reactive nitrogen intermediates (RNI) and cytokines produced by inflammatory cells are believed to contribute to initiation of cancer by inducing mutations, genomic instability and epigenetic alterations. Inflammatory cytokines then activate key transcription factors such as STAT3 and NF- kB within the premalignant cells; this is turn supports pro-malignant processes including proliferation, angiogenesis and invasion and metastasis, and most importantly, results in a sustained tumor-promoting inflammation within the tumor microenvironment (198, 199). Chronic inflammation has, therefore, been anticipated as one of the potential pathways by which bacteria contribute to oral carcinogenesis (164). Indeed, this provides a plausible explanation for the strong association between periodontitis and higher risk of OSCC (161). A pro-inflammatory potential is documented for some oral bacterial species. F. nucleatum has been found to be associated with high cytokine levels in CRC and creates an inflammatory microenvironment supportive of tumor progression(200). In GECs as well as OSCC cell lines, P. gingivalis, upregulates B7-H1 and B7-DC receptors, both of which are known to contribute to chronic inflammation(189). Increased production of IL- 1, IL-6, IL-8 and TNF-α in response to P. gingivalis infection has been documented in engineered human oral mucosa (201). Similar pro-inflammatory properties have been reported for other oral bacteria including Eikenellacorrodens, S. anginosus and S. mitis (202, 203).

2.4.1.4.5 Production of carcinogens

Ethanol itself is not a carcinogen but its metabolites: acetaldehyde, hydroxyl ethyl radicals and hydroxyl radicals are carcinogenic (204, 205).The International Agency for Research on Cancer classified acetaldehyde associated with alcohol consumption as a

32 group 1 carcinogen in humans, with the capability to cause sister chromatid exchanges, point mutations, DNA adducts and hyper proliferation of epithelium (206, 207). It is well established that certain bacteria and Candida species in the oral cavity possess the enzyme alcohol dehydrogenase (ADH), which catalyses the production of mutagenic amounts of acetaldehyde under aerobic or microaerophilic conditions (164, 208-210). Examples of such oral bacteria include Streptococcus salivarius, Streptococcus intermedius, Streptococcus mitis(211) and non-pathogenic Neisseria species (212).

Figure 2.3: The possible mechanisms by which oral bacteria contribute to oral Carcinogenesis (41).

2.4.2 Can the mycobiome be a risk factor for oral cancer?

The fungal biota in an environtment, including human body is termed as the ‘mycobiome’. This term was first used in 2010, and is an amalgamation of words ‘mycology’ and ‘microbiome’(77, 110). It is believed that fungi in the mouth constitute less than 0.1% of the totalhuman microbiome (76). This vital component of the human microbiome remains understudied (76, 77, 110, 213-215) due to the comparatively lower

33 biomass, except for clinical based evidence of association of fungi with infectious diseases and allergies in man (216). Nevertheless, fungi may play a vital role in metabolic function,interaction with the body’s immune system and maintaining the healthy microbial community composition in human (76). It has been shown that the microbiota including fungi that is present in different niches of humans can be divided into two categories:Indigenous (autochthonous) and transient (allochthonous) microbes(217, 218). Autochthonous microorganisms are found to be omnipresent in the Gastro Intestinal tract, promptly colonize available niches, and are stable over time, while allochthonous microorganisms (217, 219) are simply transient members that are unable to establish themselves in a foreign community due to population resistance created by established indigenous flora (217).These species predominantly arise from consumption of food or water and intake of air. The distinction between autochthonous and allochthonous microorganisms in the gut is critical in understanding the colonizers of the core mycobiome (217, 220). As the oral cavity is the entry point to the GI tract as well as its intersection with nasal passage ways of respiratory tract, fungi in mouth are common to numerous biocompartments (214). Intrestingly, fungi are ubiquitous with the majority of species being are environmental opportunists which are capable of occupying temporarily as transient (allochthonous) fungi in the human oral cavity as mentioned above (110). In contrast, certain fungi are capable of colonizing diverse biocompartments within the oral cavity and remain as indigenous colonizers of the core mycobiome (217, 220). Fungal isolation using conventional culture techniques dates back to the 1920s (77) and these methods have developed greatly in recent decades. Certain fungi are difficult to culture due to low abundance and requirement of microbe-microbe interactions for optimal growth (221). Exploration of the mycobiome, using NGS has recently gained the attention in the scientific community and disease associated mycobiome profiles were identified in hepatitis B (85), cystic fibrosis (86, 87), Crohn’s disease (222), atopic dermatitis (223)and inflammatory bowel disease (IBD) (88, 89). Furthermore, the incidence of opportunistic fungal infections in the immunocompromised, such as those affected by AIDS, organ transplant recipients and cancer patients on chemotherapy, have been on the rise in the past two decades (224).

Evidence is accumulating that fungal members of the microbiome may play a significant role than previously attributed in regulation of mucosal health, especially when bacterial dysbiosistakes place(76, 215,225). Hence, metagenomic research is much warranted to determine mycobiome profiles associated with OSCC. Moreover, functional profiles of mycobiome need to explore by functional metagenomics/meta transcriptomics, in order to understand their role of fungi as a consortium in oral carcinogenesis, in addition to better known Candida. These findings have potential of translational value for development of risk markers for prevention and control of oral cancer.

2.4.2.1 The Healthy Oral Mycobiome

The ‘human mycobiome’ is a term being used to define all fungi in the human body and their collective genome, which represent a vibrant and ecologically varied microbial community of the human flora (226, 227). Characterization of healthy oral mycobiome was initiated recently and it has been revealed that a much more diverse collection of fungi inhabit the oral cavity of healthy individuals, than previously thought. For the first time, the mycobiome of oral rinse samples of healthy individuals have been characterized by Ghannoum et al. (110), by a novel multitag pyrosequencing approach, using universal internaltranscribed spacer (ITS) primers, which have broad fungal specificity (228-230). It has been revealed that, fungal constituents of the oral microbiome is diverse with 74 culturable and 11 non-culturable fungal genera (110). Furthermore, overall 101 fungal species were identified with 9-23 species present in a single individual. Most of the healthy individuals haborured approximately 15 fungal genera and only one participant had more than 20 fungal genera. Ghannoum et al.2010 (110), propsed that the basal mycobiome of healthy individuals in USA, consisted of 15 genera, dominated by Candida which was found in 75% of samples, followed by Cladosporium, Aureobasidium, family-Saccharomycetales, Aspergillus, Fusarium and Cryptococcus present in (65%), (50%), (50%), (35%), (30%) and (20%) of samples respectively. The remaining fungi identified in the oral wash samples represented ‘transient fungi’. In this study, Aspergillus, Fusarium and Cryptococcus were encountered as healthy oral colonizers (110).This finding may reflect the influence of optimally functioning host’s immune system that keep pathogenic fungi under continous surveillance and control.

Abundance (<1%) fungal sequences were disregarded considering them as alloconthrus fungi, regardless of possibilities for them to be colonizers and over grow in disese conditions (110). The taxonomic data bases used by Ghannoum et al. 2010 (110)resulted in categorizing a siginificant percentage of sequences (36.1%) in >20% of the tested samples as ‘non culturable fungi’ (110). These were fungi which have not been previously taxonomically classified. This indicatethe imporrtance of expolring the oral mycobiome using metagenomics (76, 110, 213) and upgrading fungal data bases to identify fungal species in a greater depth and breadth. Moreover, a possible association of gender and ethnicity with the the oral mycobiome profile was suggested, while the small sample size was a limiting factor (76). Consequently, principle component analysis (PCoA) of this study indicated distinct fungal communities in Caucasian and Asian males, as they clustered separately (110). Nevertheless, Asian and Caucasian females showed an affinity to co- cluster together, regardless of ethinicity (110). Thus, cohort studes, considering other confunding factors including diet, risk habits and environment of the host will be needed to verify the independant associations of ethnicity/genotypeas well as gender for the community structure of microbiome in healthy individuals (76). Subsequently, the core oral mycobiome of healthy individuals had been re-investigated by Dupuy et al. 2014 (214),with the well-curated Fungal Metagenomic Project, in a pyrosequencing analysis of internal transcribed spacer 1 amplicons in saliva samples of 6 healthy individuals in USA, with NCBI BLAST, ITS sequence data base.In comparison with the Ghannoum et al, 2010 (110) study this was designed to avoid inherant limitations, despite the sampling techniques being the same. Therefore, Dupuy et al. 2014 were able to captured low abundance genera which may be present in relatively higher even in one individual, disregarding 1% abundance threshhold for further taxonomic analysis as they employed more comprehensive data base to over come the limitation of uncultured sequences found in the Ghannoum et al. 2010 study (110). Although, the aforementioned differences in the methodology of the two studies; by Ghannoum et al. 2010 (110) and Dupuy et al.2014 (214), there was uniqueness of findings but with considerable overlap (213, 214). In Dupuy et al. 2014 study, Malasseziaand Epicoccum were found to be most abundant genera with 38% and 33%

36 abundance respectively in healthy individuals. For the first time, Malassezia - a previously identified pathogen in skin was reported as the predominent fungal genus in the mouth of healthy individuals (214). Candida, Cladosporium, Alternaria, Aspergillus, Emericella, Eurotium, Fusarium, Gibberella, Cryptococcus, Fillobasidiella and Aurobasedium were common in both studies suggesting indigenous(autochthonous) memebers of the core mycobiome of healthy individuls in USA (214). Malassezia, Irpex, Cytospora/Valsa, Phoma, Lenzites, Sporobolomyces were unique in the core mycobiome ofthe study conducted by Dupuy et al.2014 (214). In contrast, Saccharomycetales, Dothioraceae, Teratosphaeriaand Glomus were reported as exclusive core taxa present in healthy mycobiome in the study performed by Gnannoum et al.2010 (110). There arecrucial obstacles to overcome in interpretation of sequencing data and integration of fungi in core mycobiome of healthy individuals, using metagenomic approaches (76, 213). Firstly, the deficiency of uniformity in application of curated data bases among studies. Fungal taxonomic nomenclature seems to be different in each data base. Due to continous progression of availability of higher number of sequence in data bases, interpretation is more complicated fom different groups (213, 231, 232). However, recently updated describedBLASTN-based algorithm, modified to analyze fungal ITS instead of bacterial 16S RNA reads and a set of 23,423 fungal ITS sequences representing all named species (16,595 species) in UNITE's database version 7.1(233) provides a better tool for more standardized and efficient metagenomic analysis of human samples of different groups. Secondly, agreement on abundance threshhold for further taxonomic analysis is not available (213). This limitation may hamper the possibility to descriminate between allochthonous(transient environmental passers) fungi from low abundance yet stable autochthonous(colonizers) fungi in the core mycobiome of healthy individuals (213). Thirdly,because of substantial inter personal variation in sequencing data (110, 213, 214), the sample size may possibly influence the composition of fungal genera in core mycobiome profile. In addition, the identification of large number of sequences as unculturable fungi (110, 213) may be not true. Challenges in application of culture techniques to confirm sequencing data evenfor cuturable species (213, 234), as well as verifying new species using culture dependant methods, before including them as

37 members of core mycobiome (213) is a real challenge. Last but not least, the discrepancies among abundance of genera and considerable interpersonal variations in different studies may be due to variations in diet, risk habits, environment, host genetics, age, gender, ethnicity, life style, occupation, health/immune status of healthy individual (55, 76, 217). Changes in host immunity have been hypothesized to influence the composition of core oral mycobiota which may lead to a disease-promoting dysbiotic state (213). Nevertheless, there are limited studies to date that have explored oral fungal community shifts in disease status (76, 213). The following section will critically analyse the available published data on ‘oral mycobiome dysbiosis and diseases, special reference with inflammation and immune compromise status due to diabetes, AIDS, organ transplant, cancer and corticosteroid treatment (77). Therefore, a favourable host environment which promotes colonization or overgrowth of fungi is responsible in the instigation of oral infection (213). Interactions between the host and the mycobiome seem to be balanced delicately for the clearance of asymptomatic infections, latency or disease. Variation in host’s immunityhas been associated with changes in community structure of core oral mycobiome. Consequently, homeostaticstate of oral bacterial flora would be lost.This may lead to disease promoting fungal dysbiotic state/ fungal community shift, especially in immunosuppressed humans. Nevertheless, there is handful of studies which have explored the global oral fungal community shifts/ oral fungal dysbiosis in immunosuppressive patients. Mukherjee et al. 2014 (235) conducted a studyto characterize the oral bacteriome and mycobiome of 12, HIV- infected patients and matched 12 uninfected controls. The number of bacterial and fungal genera in HIV infected patients ranged between 1-9; while 8-14 in uninfected controls. The core oral bacteriome (COB) consisted of 14 genera, of these 13 genera were common to both groups. The core oral mycobiome (COM) demonstrated distinct variations between HIV- infected and uninfected individuals, yet Candidadominated in both groups. Amongst, Candida species, C.albicans was the commonest with 83% and 58% in HIV infected and HIV-uninfected respectively.Furthermore, Epicoccum, Alternaria and Trichosporonwere abundant in the core oral mycobiome of HIV-infected subjects. In comparision, Pichia,

Cladosporium and Fusarium were found in the core oral mycobiome of HIV-uninfected (235), Candida and Penicillium were common to core oral mycobiomes of both groups.

2.4.2.2 Oral Mycobiome dysbiosis and diseases

Alteration of systemic health due to factors affecting the immune system of the host is commonly observed in most oral fungal diseases resulting from overgrowth of indigenous fungal species; for instance in candidiasis as well as in oral histoplasmosis (77, 213). These factors include inflammation and immune compromised status due to diabetes, AIDS, organ transplant, cancer and corticosteroid treatment (77).Therefore, a favourable host environment, which promotes colonization or overgrowth of fungi is essential in the oral cavity to initiate oral fungal infections (213). Variation in the host’s immunity has been associated with changes in community structure of the core oral mycobiome. This may leading to a disease promoting fungal dysbiotic state/ fungal community shift, especially in immunosuppressed humans. Nevertheless, there are limited studies to date which explored the global oral fungal community shifts/ oral fungal dysbiosis in immunosuppressive patients(213). A recent study conducted by Mukherjee et al. 2014 (235) characterized the oral bacteriome and mycobiome of 12, HIV- infected patients and matched 12 uninfected controls. The core oral bacteriome (COB) consisted of 14 genera, of them 13 genera were common to both groups. However, the core oral mycobiome (COM) demonstrated distinct variations between HIV-infected and uninfected individuals, yet Candida dominated in both groups. Amongst, Candida species, C.albicans was the commonest with83% and 58% in HIV infected and HIV-uninfected respectively. Furthermore, Epicoccum, Alternariaand Trichosporon were abundant in core oral mycobiome of HIV- infected subjects. In comparison, Pichia, Cladosporium and Fusarium were found in core oral mycobiome of HIV-uninfected (235),Candida and Penicillium were common to core oral mycobiome of both groups. Increased Candida colonization was associated with a simultaneous decrease in the abundance of Pichia, suggesting antagonism. Subsequently, this has been proved by functional studies. Pichia spent medium (PSM) from Pichia cultures was shown to be demonstrated inhibitory to Candida hyphae formation and invasive disease in a murine model of candidiasis(235). The presence of oral Candida

39 was shown to have a positive association with oral bacteria namely; Atopobium, Capnocytophaga and Fusobacterium. Despite of this, these bacteria did not demonstrate negative correlation with Pichia. Therefore, it is unlikely to reverse the reduction of Candida by Pichia abundance in the oral mycobiome, by the presence of these bacteria in the oral bacteriome of HIV- uninfected individuals (76, 213,235). Alterations in mycobiome is primary or secondary to an imbalanced bacteriome (89). Moreover, a pathogenic synergy between oral commensal bacteria and C.albicans using a novel murine oral mucosal co-infection model (213, 236) has been demonstrated. On the other hand, whole or individual members of the mycobiome may play a beneficial or commensal role in host. Hence, beneficial fungi could manipulate as therapeutic or preventive agents, for instance , Saccharomyces boulardii being use for the treatment for diarrhoeal diseases (237).

2.4.2.3 Oral mycobiome dysbiosis in oral cancer Evidence is accumulating that fungal members of the microbiome may play a significant role than previously attributed in regulation of mucosal health, especially, when bacterial dysbiosis is occurred (76, 215, 225).No attempts have been made to explore the fungal dysbiosis associated with oral cancer, though there is sound evidence implicating Candida albicans in oral carcinogenesis. 2.4.2.3.1 Candida species and OSCC

Candida species are considered the commonest commensal fungi that colonize the oral mucosa, with the carriage rates in healthy individuals ranging from 3- 70% (110). Usually candidal infections occur within the oral and/or vaginal mucosae. Nevertheless, C. albicans is accountable for a wide range of mucosal and systemic infections in immunocompetent as well as immunocompromised individuals (238, 239). Possible association between candidosis and pre-cancerous oral neoplasia dated back to 1969 (44, 240). Cawson,1969 stated that the presence of Candida was an independent risk factor for oral carcinogenesis (240). His findings were validated twice by important studies conducted in 1998 by Nagy et al.1998 (172) and in 2002 by McCullough et al. (241). Firstly, Nagyet al.1998 observed an increase in frequency of C.albicans in biofilms of OSCC tissues (172). Secondly, McCullough et al. 2002 proposed that oral

40 yeast carriage correlated with existence of severity of oral epithelial dysplastic and neoplastic development (241). In addition to these two, another five studies found a strong relationship between malignant transformation of pre-cancerous lesions (241-245). It has been shown that leukoplakia with candidal infection (formerly known as candidal leukoplakia) has an elevated rate of malignant transformation than non- infected with the estimated rate up to 10%(46, 246-248).These findings are in harmony with the finding that, Candida may play a causal role in oral carcinogenesis (249, 250).

Current studies of the prevalence Candida on malignancy have sought to identify the specific strains of C. albicans eliciting hyperplasia. A study conducted by Kroug in 1987 (251), revealed a difference in C.albicans biotypes isolated from candidal leukoplakia compared to normal mucosa and he suggested that malignant progression of pre cancer may be associated a certain strain of C. albicans(251). Additionally, other species such as Candida dubliniensis, Candida tropicalis, Candida pintolopesii, Candida glabrata, and Saccharomyces cerevisiae have been identified in oral cancer patients (248, 252). Thus, it is worthwhile to explore exact molecular mechanisms of Candida species/strains that induce carcinogenesis using tissue cultures and animal model experiments.

The exact mechanisms of a causative role of C.albicans in oral carcinogenesis has yet to be revealed (47). As a result, the independent role of C.albicans in oral carcinogenesis was disputed by Sitheeque & Samaranayake, 2003 in a critical review arguing that the evidence did not prove a causal relationship between two (253). Conversely, other researchers proposed that C. albicans had an indirect causal role in oral cancer along with other confounding factors such as tobacco and alcohol usage (242). Therefore, the presence of Candida as an independent risk factor for oral carcinogenesis is controversial and inconclusive as it encompasses dual aspects (47, 241, 243-245). Besides, precise contributions of other confounding factors facilitating the initiation of carcinogenesis with Candida also remains ambiguous (242) and additional research needs to establish the validity of both school of thoughts.

2.4.2.3 Possible mechanisms by which oral fungi contribute to oral carcinogenesis

Opportunistic fungal infections affect the oral mucosa of immunocompromised host

(213, 215). As a result, it is useful to explore the host- pathogen responses in immune regulation (76, 213).Under normal circumstances, host’s immune system is likely to initiate a cascade of responses to decline the proportion of opportunistic fungal pathogens, while increasing the proportion of non-pathogens to maintain a homeostatic balance in the fungal community structure. Quite a few pattern recognition receptors (PRRs) on phagocytes, TLR-2, TLR-4, dectin-1, dectin-2 and galectin-3 are able to recognize specifically, pathogen-associated molecular patterns (PAMPs) of fungi. These PAMPs include α mannans and β- glucans (254-257).Then, macrophages and dendritic cells attain maturation, which leads to activation of T cells by antigen presenting process. In mucosal candidosis, T cells promote recruitment of neutrophils and subsequent phagocytosis of the fungus (77). Differentiation of Th-17, following C.albicans infection, suggests a potential role for Th-17 in host defense against fungal infections (256, 257). This confirms the primary role of Th-17 cells in mucosal protection (213). Conversely, the innate oral epithelial fungal recognition system and subsequent responses which compel a protective, Th -17immunity against fungal infections in the oral mucosa is poorly understood (213). It has been suggested that oral mycobiome may play a role in inflammatory and metabolic disorders via chronic inflammation (213, 215, 236) as the mycobiome has been gained attention as a potential cofactor in inflammatory responses (215).

2.4.2.3.1 Possible role of Candida species in oral carcinogenesis

It has been indicated that certain attributes of C. albicans may directly or indirectly influence oral and oropharyngeal carcinogenesis (46). Induction of chronic inflammation after modifying the microenvironment (258-260), and production of carcinogens (e.g. nitrosoamines) (164), as well as carcinogenic metabolites(e.g. acetaldehyde) are the potential carcinogenic attributes (261). These carcinogenic attributes are briefly explained as follows.

Modification of microenvironment and induction of chronic inflammation is facilitated by numerous factors of Candida such as phenotypic switching, dimorphism, adhesive properties, extracellular hydrolytic enzyme production and biofilm formation (262).

Furthermore, C. albicans plays a momentous role in the development of OSCC by damaging host tissues via its interaction with epithelial cells, resulting in production of epithelial cytokines and matrix metalloproteinases (MMPs) and pro-invasive phenotype. Therefore, C. albicans possesses the ability to enhance the invasion of genetically altered epithelial cells by reducing keratinocyte cohesion followed by assisting their passage the basement membrane, in a similar manner of mucosal bacterial infections (46).

It has been revealed that C. albicans induces IL-8 secretion by endothelial cells by stimulating the cells to produce TNF- α(46, 263). The transcript factor NF-κB is a key coordinator of inflammation and an important tumor promoter (264, 265). NF-kB activates genes encoding inflammatory cytokines and enzymes such as COX-2. Members of the Toll-Like Receptors (TLR) family have been made known to be vital in the recognition of C. albicans and induction of cytokines (266). Thus, candidal infection may stimulate particular TLRs that can communicate with the tumor promoter NF-kB. Furthermore, NF-kB is frequently engaged in carcinogenesis where cancer-related inflammation is a feature (265). Production of cytokines and enzymes in the prostaglandin synthesis pathway such as COX-2 could be considered as another potential mechanism of C. albicans which might influence the early stages of the progression of oral cancer (46). Moreover, cancer related inflammation is involved in the metastasis of malignant cells (265). Interestingly, this carcinogenic effect is likely connected with both the form of candidal growth (whether yeast or hyphal) and the interaction with other microbial species in a mixed biofilm. Hence, further research is warranted to assess the invasive behaviour of oral keratinocytes when grown in contact with a range of biofilms which consists of C.albicans (47). According to Hooper et al. 2009 (164), Candida species might encourage OSCC by directly producing carcinogenic compounds, such as nitrosamines. It has been revealed that nitrosamines are capable of binding with DNA to form adducts with bases, phosphate residues, and/or hydrogen bonding sites that could cause miscoding or irregularities with DNA replication and produce point mutations (267). These point mutations may activate specific oncogenes and instigate the development of oral cancer. Kroget al. 1987 (250), indicated that some Candida species isolated from leukoplakia

43 lesions were able to produce the potent carcinogen N-nitrosobenzyl methylamine (NBMA). Interestingly, strains with the highest potential to produce NBMA were isolated from potentially malignant advanced oral mucosal lesions rather than early lesions or normal oral mucosa (250). Another mechanism by which Candida species may influence oral and oropharyngeal carcinogens indirectly is production of carcinogenic metabolites. Interestingly, Candida species such as C. albicans, C. tropicalis, C. parapsilosis and C. glabrata have been demonstrated to have exceptional capacity to produce acetaldehyde from ethanol by oxidation as well as by glucose fermentation (268, 269). Furthermore, Nieminenet al. 2009 (268) found C. tropicalis cultures accumulated highest concentrations of acetaldehyde compared to other 30 Candida species in vitro. A study conducted by Gainza- Cirauquiet al. 2012 (270) to assess the production of carcinogenic acetaldehyde by C. albicans from patients with potentially malignant oral mucosal disorders confirmed of production of mutagenic levels of acetaldehyde. Thus, they concluded that cigarette smoking and alcohol consumption may favour adoptional changes resulting in the up regulation of acetaldehyde metabolism by Candida species (270). Significant positive association (p<0.05) between the ability of Candida isolates of oral cancer patients to form biofilms, with higher production of hydrolytic enzymes and acetaldehyde (which may promote oral carcinogenesis),when compared with Candida isolates from patients with non-oral cancer was revealed in a study conducted by Alnuaimi et al.2016 (262). Thus, proper understanding of causative role of Candida species in oral carcinogenesis will widen the horizon of knowledge on prevention and treatment modalities (47), of oral cancer in the era of ‘personalized medicine.

2.4.3 Can the virome be a risk factor for oral cancer?

The first evidence of association of OSCC with infectious viral agents was suggested nearly in early 2000s (271-273). Since then, several oncogenic viruses have been implicated with the development of OSCC (274, 275). Of these, human papilloma viruses (HPV) especially HPV 16 and HPV 18 as well as particular members of Herpesviridae family such as Epstein Bar Virus (EBV) and human herpes simplex

44 virus (HSV) have shown their oncogenic capabilities by molecular and epidemiological studies (48-52). HHV 8 is the causative agent of Kaposi’s sarcoma (KS), multicentric Castleman’s disease (MCD) and primary effusion lymphoma (PEL) which are common malignancies in HIV infected patients (276, 277).

2.4.3.1 Human Papillomavirus (HPV) Infections

Human papillomavirus (HPV) is well established as an etiological agent in the development of cancers of the oropharynx, especially in the palatine tonsils and the base of the tongue (ICD 10 [International Classification of Diseases,10th Revision] Codes C01 and G09 - C10 (278). As a result, it is now considered that HPV infections accounts for 20% of oral cancers and 60 - 80% of OPC cancers and International Agency of Research of Cancer (IARC), accepted that there is sufficient evidence that HPV 16 is causally associated with oral cancer (279). Hence, this association varies by anatomical site/subsite (280).

Exclusively, HPV associated OSCC prevalence is high among men aged 40-65yrs, with higher socio economic status, exposed to more sexual partners and practicing oral sex, compared to HPV- negative HNSCCs (7, 281-288). Moreover, HPV related HNSCCs have a unique biology and differentiation compared to non-HPV related HNSCCs and this is important as the former have improved clinical outcomes (281-283). Presence of HPV in these malignant tumours also represents a public health issue and the need for comprehensive HPV vaccination programs and patients counseling about disease and prognosis. Therefore, the detection of HPV has not only prognostic value for treatment regimens, but also an epidemiologic association (53, 282, 283).

HPV is a member of the papovaviridae family and is a non-enveloped small DNA viruses with a symmetrical icosahedral shape (289). Currently, approximately 150 types have been identified and 120 types are fully sequenced (280); with 33% of HPV types which are capable of infecting the human genital tract (290). Of these high risk sub types, HPV16 and HPV 18 are mostly associated with oropharyngeal and oral cancers (7). In addition, types 31, 33, 35, 52, 58 and 67 are considered to be moderate to high risk (291- 293). HPV replicates in the nucleus of squamous epithelial cells (289). Two viral

45 oncoproteins associated with high risk HPVs (E6 and E7) promote tumour progression. E6 inactivates p53 and E7 inhibits retinoblastoma (pRb) tumour suppresser gene products (282, 289), leading to abnormal cell growth by elevating inhibition of apoptosis and dysregulation of cell cycle respectively (294). Accordingly, p16 which is a cyclin dependent kinase needed for cell cycle regulation is elevated through a negative feedback loop after functional inactivation of retinoblastoma protein by E7 (282, 295). Though, HPV infections clear spontaneously in healthy individuals (around 80%), in some cases HPV infections persist in chronically and lead to cancer (296). Moreover, sexual behaviour has been associated with HPV infection. Univariate analysis revealed that incidence of oral HPV infections significantly increased with life time number of oral/vaginal sexual partners. Multivariate analysis demonstrated that oral- HPV infection was considerably increased among individuals who reported having more than 10 oral or 25 vaginal partners during their life time (297, 298).

It has been reported that the a prevalence of HPV infection in OSCC varies from 17%- 85% (23, 299). In 2003 Jayasooriya et al, conducted a study to investigate the prevalence of HPV in OSCC of Sri Lanka with clinic- pathological parameters, using PCR and direct cycle sequencing and HPV was detected in 37.2% of samples. Interestingly, 64% of habitual betel chewing OSCC patients consisted of equal proportion of more than 60 yrs and less than 60 yrs were infected with HPV. Regarding site specificity, 37% of buccal mucosa and 50% of tongue were infected with HPV. With these remarkable findings this study suggested the possibility of HPV contribution in a multifactor model, as a causative agent of OSCC in Sri Lanka (23). Using, single PCR assay and sequencing to detect HPV, HSV and EBV in OSCC patients in Sri Lanka and other seven different countries, 30% of Sri Lankan OSCC patients of mean age of 59.10 yrs found to be infected with HPV. However, no firm conclusion has been made regarding the relationship between alcohol, tobacco and viral infections (24). A recent case control study examined the serological evidence for the role of oncogenic types of HPV types 16 and 18 in oral and pharyngeal cancer in Sri Lanka, Interestingly, 32% of both oral and pharyngeal cancer (OPC) and 24.53% of oral cancer showed HR- HPV16 and/ or HR- HPV18 seropositivity (25). Moreover, this prototype study in Sri Lanka indicated a

46 significant risk of 15 fold in developing OPC due to HPV16/18 seropositivity after eliminating variability of other factors such as risk habits (25).

2.5 Characterization of the Oral Microbiome

A substantial number of oral infections are diagnosed clinically, rather substantiated with laboratory diagnosis in routine clinical dentistry. In a situation of atypical presentations or in confusing clinical circumstances, evidence is then sought from laboratory diagnosis. Culture based characterization of microbes had been considered as the ‘gold standard’ for the detection of causative agents of most bacterial and fungal infections in the oral cavity (300). Culture of bacteria/fungi is essential for performing antibiotic/antifungal sensitivity. Conversely, a large proportion of oral bacteria and certain fungi are fastidious, slow growing or uncultivable (59) and many oral infections are poly-microbial. Hence, it is impossible to identify all causative agents by culture based approaches (63). Subsequently, DNA based culture independent techniques exclusively polymerase chain reaction (PCR) technology began to develop in 1980s (55). These enable analysis of the extracted DNA directly from an environmental or clinical sample, allowing exploration of microbial communities(301). The most frequent technique to analyse the microbiome is based on 16 S rRNA community profiling for bacteriome (301) and primarily 18S rRNA profiling (77) for mycobiome by next generation sequencing technology.

2.5.1 Characterization of oral bacteriome

The approaches to identify and analyse the behavior of oral bacteria have evolved over almost two centuries. In this section, literature pertaining to culture dependent/ conventional techniques as well as culture independent molecular based techniques will be reviewed. Specific advantages and disadvantages of culture based, microscopic, immunological and metagenomic approaches will be appraised. Past strategies for microbial analysis indicated in Figure 2.4.

Figure 2.4: Past Strategies for Microbial Analysis http://hmp.jcvi.org/

2.5.1.1 Conventional/Culture Dependent Techniques

Initial characterization of oral bacteria dated back to mid-1600s with the well-known microscopic examination of Leeuwenhoek, who observed a varied assortment of bacterial morphotypes in dental plaque (107). Initial characterization of oral bacteria dated back to mid-1600s with the well-known microscopic examination of Leeuwenhoek, who observed a varied assortment of bacterial morphotypes in dental plaque (107). Subsequently, introduction of bacterial culture media by Koch, Pasteur and others in the 1800s,let to the characterization of cultivable oral microbiota using conventional techniques and these have progressed to-date with more user friendly approaches (55, 59, 63). Subsequently, introduction of bacterial culture media by Koch, Pasteur and others in the 1800s, let to the characterization of cultivable oral microbiota using conventional techniques and these have progressed to-date with more user friendly approaches (55, 59, 63). These conventional techniques involve, plating the specimen and growing bacteria contained in the specimen, on various solid, semi-solid or liquid media under aerobic, microaerophilic or anaerobic conditions. Then, based on colony morphology and staining properties, bacteria are presumptively identified. Further tests such as motility, demonstration of capsule or fimbriae and biochemical tests may be required for confirmation of presumptive identification (63, 132, 302,303).

Microscopical examination of a direct microbial or cytological smear often provides a useful rapid technique to reveal the presence or absence of microbes with distinct morphologies. For example, in the diagnosis of oral lesions of syphilis, the spiral shaped Treponemes can be demonstrated by dark ground microscope, but it is not possible to differentiate Treponema pallidum from T. denticola, T. vincentiiand T. pectinovarum using this method (63). Nonetheless, when microscopy is combined with fluorescent chemical tagged anti. T. pallidum specific antibodies it is possible to identify T. pallidum with higher sensitivity (304). Furthermore, the Gram stain is widely used for presumptive identification of oral bacteria by morphology (Gram positive and Gram negative) in routine culture based approach (305, 306). However, there are inherent limitations of microscopic examination as the information provides by it inconclusive and less precise in genus or species level identification (63, 132, 301).

Definitive identification of oral bacteria is mainly done by biochemical tests. These tests are designed to evaluate phenotypic characteristics (ability to ferment carbohydrates or to break down of other substrates/macromolecules) of bacteria (63, 132, 302, 303). Fortunately, most of these biochemical tests are being miniaturized as commercially available test panels/kits for rapid identification, for instance API and rapid ID (63). Furthermore, a variety of enzyme analysis and immunological assays are available as conventional methods for the identification of oral microbes (132, 302, 303). These assays are based on antigen–antibody reactions. Interestingly, reliable enzyme-linked immunosorbent assays (ELISA) are available to assess the stage (mild, moderate and severe) of periodontal disease by measuring the antibody response to the different sero types of P.gingivalis and Aggregatibacter actenomycetemcomitans (307). It has been suggested that sensitivity and specificity of these ELISA tests are similar to that of PCR and raise the possibility of large scale use (63, 307). However, more evidence is needed as sensitivities of immuno assays for oral bacteria are not adequately explored (132).

As mentioned earlier, nearly one third (32%)of oral bacteria are considered to be uncultivated (41, 55). Thus, culture independent techniques have evolved to characterize

49 uncultivable bacteria and next section will deal on basic aspects of culture-independent molecular techniques (other than NGS) for the characterization of oral bacteria.

2.5.1.2 Culture independent molecular techniques (other than NGS)

The advent of culture-independent molecular techniques in the 1980s widened the horizons of detection of many oral microbes (132). Close ended molecular techniques, namely checker-board DNA-DNA hybridization and PCR (41, 301) were considered as the earliest culture independent techniques, which had been used to detect uncultivable bacterial species in oral samples (62). One of the pioneer DNA-DNA hybridization assays for investigating uncultured microbial communities without prior DNA extraction was fluorescent in situ hybridization (FISH). In this techniques, fluorescent labeled specific oligonucleotide probes for marker genes are subjected to hybridize to microbial community (308). FISH probes can be targeted against nearly all taxonomic levels ranging from species to phylum. Initially, FISH was limited to detect taxonomic diversity. Later on, it has been expanded as functional gene probes to detect specific enzymes in the microbial community (309), though it remains a primarily low-throughput imaging-based technology (301). Consequently, these close ended molecular techniques have been recognized to be capable of capturing microbial/bacterial diversity at a broader level as well as to detect presence or absence of individual biochemical functions. However, with a narrow scope in diversity or functions of microbes (301) and providing limited view of community when compared with open- ended studies using NGS technology (72, 310, 311).

Application of DNA sequencing to investigate diversity of microbial communities in large scale dated back to 1970s (312). This was the advent of a new era of DNA sequencing technology in the 1980s. Analysis of the sequences of conserved housekeeping genes, directly isolated from samples of saliva or oral biofilms have been used to explore complex bacterial communities (59). The gene encoding 16S ribosomal RNA(16S rRNA) has been used most commonly for this purpose (313), while 16S rRNA itself can be isolated directly and sequenced (314). Detailed description of the structure of 16S rRNA gene will be provided in 2.6.1section of this literature review.

2.5.2 Characterization of oral mycobiome

The methods and approaches used to detect, identify and analyse fungal communities within biological samples have been progressed over decades (76, 77). In this section, literature relevant to culture dependent/ conventional technique as well as culture independent molecular based techniques will be reviewed. Moreover, specific advantages and disadvantages of each method will be appraised.

2.5.2.1 Conventional/ culture dependent techniques

Direct Microscopy, culture, identification based on morphology (lacto phenol cotton blue smear, slide culture, germ tube test, rice plate/cornmeal agar) and histopathological staining techniques are considered as basic conventional techniques for isolation and identification of filamentous fungi and Candida species (315). Direct microscopy routinely employs using 10-20% potassium hydroxide with fluorophorecalcofluor white. Interestingly, calcofluor white is reported to bind the chitin in the fungal cell wall and fluoresces blue-white or green providing rapid and sensitive means of detecting fungi in clinical specimens (316, 317). Furthermore, staining of smears or touch preparations with Gram or Giemsa stain can be undertaken. Thus, direct microscopic examination of clinical specimen is an imperative first line process to capture morphological features of fungi and this is the fastest (less than I hour), cost effective and valuable means of diagnosing a fungal infection (316), for some instances providing an etiological diagnosis of infections caused by Histoplasma capsulatum, Blastomyces dermatitidis, Coccidioides immitis, Pneumocystis carniior Penicillium marnefeii (315). Furthermore, detection of fungal elements microscopically may impart a presumptive diagnosis, in other infections (for example zygomycosis and candidiasis), whether a yeast or mould is present but not the actual species of the etiological agent. Thus, direct microscopy provides guidance in selecting the most suitable media by which to culture the clinical material, insight in interpreting culture results as well (315). Nevertheless, direct examination techniques have inherent limitations as they are less sensitive than culture and negative results of direct examination of a clinical specimen never exclude a fungal infection (316).

Keystone technique for the diagnosis of invasive mycoses is visualization of fungal elements in tissues using histopathological techniques. Special stains namely

Gomorimethanamine silver stain and periodic acid-Schiff are used to detect small numbers of fungi, clearly defining their morphological features (315). Furthermore, melanin in the cell wall of fungi could be stained with the Fontana-Masson stain. Hence, lightly pigmented demataceous fungi are highlighted enabling differentiation of capsule- negative strains of C. neoformans (melanin positive) in tissue. Mucicarmine stain is used to identify, capsular strains of C. neoformans in tissues as it stains the polysaccharide capsule of the fungus (315). Nevertheless, isolation and identification of fungi by culture methods are utmost importance in precise diagnosis of the causative agent of fungal infections (315).

The charcterization of fungi using most basic culture techniques dates back to the 1920s, when fungal mats were grown in flasks of sterile liquid media (318). Hence, the capability of growing fungi in different culture media was crucial in isolation and identification of fungi by means of microscopy, biochemical tests and variety of commercially available (selective/chromogenic) media (319), during the time culture based methods only available (215). Fungal culture methodology has developed over the years (77). Nevertheless, there are imperative limitations in culture based conventional techniques as it is not possible to isolate fungi which are present in low abundance and those that require microbe-microbe interactions to grow cannot be grown optimally (77). Moreover, filamentous fungi have longer generation time when compared with bacteria; which takes around two weeks for the optimum growth and fungal culture is a time consuming tedious process (315).

Immunohistologic staining for the identification of fungi in clinical specimens has been used. Moreover, monoclonal and polyclonal fluorescent- antibody reagents have been produced for differentiating the genera of Aspergillus, Fusarium and Scedesporium in situ. Regrettably, the cross reactivity due to high degree of antigenic relatedness among these fungi and other fungal pathogens such as Paecilomyces species resulted in low specificity of these techniques (320).

These limitations in culture dependent and Immunohistologic staining techniques for the detection of mycobiome have led to the advent of culture- independent techniques over the past two decades (77).

2.5.2.2 Culture- independent molecular techniques (other than NGS)

Due to limitations described previously on characterization of mycobiome in clinical specimens, relatively rapid molecular techniques have been developed. The application of PCR as a rapid and reliable approach (315), has been widely used to detect Candida species and Aspergillus species specially in blood (serum or whole blood) and respiratory samples (sputum or BAL fluid) (321-323). Moreover, target sequences most often included 18s rRNA or internal transcribed spacer regions (321, 324-327). Interestingly, sensitivities of aforementioned PCR techniques have been reported, from 78% to 100% and 33% to 100% for Candida and Aspergillus detection respectively (321). Nevertheless, specificity of PCR techniques are reported to be inconsistent but better detection of Aspergillus has been achieved using real time PCR in the diagnosis of pulmonary aspergillosis (322). C. albicans peptide nucleic acid (PNA), fluorescence in situ hybridization (FISH) test has been introduced for the identification of C.albicans in blood culture. The C.albicans PNA FISH test (AdvanDx) is developed as such a fluorescein-labeled PNA probe that targets C.albicans 26S rRNA with the excellent sensitivity (99% to 100%) and absolute specificity (100%) for direct identification of C.albicans from blood cultures. This test also includes probes for several other Candida species (328, 329).

There is limited information, over potential of PCR to compensate for the limitations of culture in the rapid detection of fungi in clinical specimens, though there are promising trends (315). Amplification of 18S rRNA which is common to almost all fungi (for example ‘panfungal PCR’ has been considered as a potential approach (321, 330) for characterization of the mycobiome, followed by restriction endonuulease analysis, sequencing or hybridization to a series of genus or species specific probes (324, 331, 332). Further details on taxonomic diversity/housekeeping genes of oral mycobiome will be described in 2.6.2 section of present literature review.

In conclusion, historically, characterization of the oral microbiome was almost entirely culture dependent (301). The oral cavity provides several distinct habitats (41, 108) for extremely diverse microbial communities and it has been revealed that, substantial number of oral microbiota are uncultivable (55, 77). Thus, the advent of molecular based culture

53 independent techniques have allowed us to explore the diversity of oral microbiome in better extent techniques (116, 333). Furthermore, metagenomic studies have broadened the horizons of studying microbial communities in their habitats (84) and understanding the community composition and function as a consortium (41, 132, 301). Interestingly, the advent of NGS has facilitated analysis of microbial communities at exceptional depth and breadth, providing a marvelous opportunity for profiling oral microbiome in health and identify microbial shifts/dysbiosis associated with disease (41, 165).

2.5.3 Characterization of oral microbiome by NGS

High–throughput molecular technologies such as ribosomal RNA, gene sequencing in combination with computational algorithms in population biology and bioinformatics (63), have made it possible to profile microbial communities (334), at much higher resolution of exceptional depth and breadth (41, 165) compared with culture based methods (300), in complex habitats such as gastro intestinal tract and oral cavity (301). Thus, profiling the oral microbiome in health and identifying microbial dysbiosis associated with diseases including oral cancer has emerged as a novel arena of metagenomic research (77, 165).

The Sanger sequencing method, considered as ‘first generation’ technology, has been used to explore oral microbial communities. However, technical difficulties and high cost make this approach not “user friendly” with a large number of samples. In addition, sequencing depth was not adequate as it reveals only the dominant members of the bacterial community. As a result, high throughput generating large number of sequence data very rapidly at comparatively low cost (165, 335). It is possible not only to reveal community composition of microbiome but also community profiling of functional genes, ground breaking to revolutionize the land scape of dynamics of microbial community in a specific environment (334).

NGS technology does not require a cloning step. The DNA to be sequenced is used to construct a library of fragments that contained synthetic DNAs (adapters), added covalently to each fragment end by the activity of DNA ligase (336). These adapters are universal sequences, thus specific to each type of platform. They are used to amplify the library fragments during specific steps of amplification process by polymerase activity

(336). In this approach, library fragments are amplified in situ on a solid surface, either a bead or flat glass micro fluidic channel. These covalent derivatives of adapter sequences are complementary to those on the library fragments. This amplification is digital in nature, a bead or surface born amplified cluster of DNA derive from a particular fragment. Amplification is needed to produce sufficient signal from each of the DNA sequencing reaction step that determine the sequencing data for that library fragment (335). The scale and throughput of next-generation sequencing are termed as massively parallel as fragment amplification is involved to obtain sequencing data. In this sequencing the process is a step wise reaction series that comprises of a nucleotide addition step, a detection step that determines the identity of the incorporated nucleotides on each fragment focus being sequenced, followed by a wash step that may capable of removing fluorescent labels or blocking groups(335) Hence, NGS platforms conduct sequencing and detection at the same time and these steps are performed in a manner that allows hundreds of thousands to billions of reaction foci to be sequenced during each instrument run, generating enormous data sets (165, 335, 337). Sequencing technology of these platforms based on the physical separation in a flow cell surface. The first three platforms sequence clonally amplified PCR products and the last two are capable of sequencing even a single DNA molecule.

2.5.3.1 Types of NGS platforms

The five most commonly used NGS platforms at present are454 pyrosequencing (Roche Applied Science, Basel, Switzerland), Illumina/Solexa Genome Analyzer(Illumina, San Diego, CA, USA),SOLiD (Applied Biosystems, Foster City, CA, USA), the HeliScope Single Molecule Sequencer (HelicosBioSciences, Cambridge,MA, USA), and the Single Molecule Real Time technology(SMRT, Pacific Biosciences, Menlo Park, CA, USA(165). Sequencing technology of these platforms based on the physical separation in a flow cell surface. Thefirstthree platforms sequence clonally amplified PCR products and the last two are capable of sequencing even a single DNA molecule (165).

These approaches allow for even finer resolution. Consequently, an array of bacterial species inhabiting different oral niches have been investigated and used to detect many unknown aspects of microbiome (63, 338). In NGS, there are several ways to sequence a

55 whole metagenome (shot gun sequencing)or a segment of a metagenome (amplicon sequencing), each technique serves a particular purpose(165). Most of the currently used NGS platforms generate relatively short read lengths in amplicon sequencing which based on sequencing of hyper variable region of 16S rRNA gene when compared with shotgun sequencing. Nevertheless, it provides highly informative sequencing data (165). At present Illumina produce the most widely used family of platforms. The technology was introduced in mid-2000 and from then its popularity increased due to the possibility of generation of large amount of data in a cost effective manner. Furthermore, over the years reads lengths have been increased. Hence, Illumina platforms were able to replace 454 pyrosequencing due to the cost effectiveness of the technology which govern the sustainability (339, 340). The chemistry behind Illumina technology is sequencing by synthesis and is the same as pyrosequencing (335). However, it differs from the 454 approach in two major ways: 1) it uses a flow cell with a field of oligos attached rather a chip containing individual micro wells with beads and 2) it employs reversible dye terminators instead of pyrosequencing. The dye termination approach resembles to traditional ‘Sanger sequencing’ approach (341) but differs due to reversibility of dye terminators. Hence, they are removed after each imaging cycle to make a way for the next reversible dye- terminated nucleotide (342).

At present, the Miseq Illumina platform is capable of producing paired end 300 bp reads. Furthermore, the greatest overall output can be obtained from Hiseq 2500 generating four billion reads with paired end fashion with 125 bases in length each (335). Involvement of separate indexing read is another advantage of Illumina sequencing. Thus, dual indexing which render multiplexing of greater degree of samples in a user friendly manner is possible (335). A summary of the five major NGS platforms stated in Table 2.2.

Table 2.2: Summary of five major NGS platforms (165).

Platform Library Chemistry Read length Bases per Run time

preparation run

1)Roche 454 GS Emulsion PCR Pyrosequencing 400 500 Mb 10 h

FLX Titanium

2)Illumina/ Solexa Bridge PCR Reversible 100 18-35 Gb 4-9 days

terminators

3)SOLiD Emulsion PCR Sequencing by 50 30-50 Gb 7-14 days

ligation

4)Helicos Single molecule Reversible 32 37 Gb 8 days

terminators

5)Sanger PCR and cloning Dye terminators 800 800 bp 3 hours

2.6 Taxonomic Diversity of the Oral Microbiome

A microbial community comprises basically a collection of individual cells. These component cells may or may not bear the same genomes, though considerable subsets of these cells are usually assumed to be clonal. Therefore, it is possible to allocate a frequency to each distinct genome within the community (301). This can be explained by the absolute number of cells which the community carried, or in terms of relative abundance in the population. As it is not practical to completely sequence every genome in every cell of the microbial community, a number of ‘molecular markers’ which more or less uniquely tag a similar genome have been identified. Such a molecular marker could be defined as a specific DNA sequence that identifies the genome that contains it, without the requirement of sequencing the whole genome (301). To be an ideal marker to differentiate populations, certain criteria should be fulfilled: it ought to be present in each member of a population; to differ only and always between individuals with distinct genomes, and ideally should vary proportionally to the evolutionary remoteness among different genomes.

2.6.1 Oral bacteriome

The small or 16S ribosomal RNA gene which is commonly known as the 16S rRNA (Figure 2.4), after transcription (rDNA) accomplishes the criteria of an ideal marker by consisting of highly conserved ubiquitous sequences present in all most all bacteria (301, 335) as well as hyper variable regions that differ between different taxa by greater or lesser frequency over evolutionary time (301, 335). Thus, the major approaches to cost effective high throughput characterization of the human microbiome exploit the microbial 16S ribosomal RNA (rRNA) gene sequences, uniquely found in prokaryotes. This gene consisted of regions which are constant- allowing for amplification, and regions which are variable allowing for identification (Figure 2.5). Hence, considered as a barcode that can be used to characterize the broad spectrum of both cultivable and non-cultivable microbes(301). The patterns of enormously conserved regions scattered with hyper variable regions, makes it possible to design primers to identify the members of a given community (335). Regions of bacterial 16S rRNA gene, where universal primers will anneal are being utilized to amplify diverse fragments of the gene present in all bacteria in a given sample. Subsequently, a population of 16S amplicon will generate which reflects the community composition.

Variable region Conserved region

Figure 2.5: The 16S rRNA Marker Gene- [email protected]

Nevertheless, the potential of taxonomically characterization of microbiota using sequencing data has an inherent limitation due to the lack of universally accepted similarity thresh hold (343) and the differential discriminatory power of the nine 16Sr

RNA hypervariable regions (V1-V9) without universally accepted region(s) (344). It has been reported that amplification of non-representative genomic targets can heavily bias phylogenetic and diversity studies of microbiome leading to inconclusive or inaccurate results (345, 346). Hence, assessment of the diagnostic power of the targeted genetic markers is of utmost importance in precise identification of specific microbiota (347). The 16Sr RNA hypervariable V1- V3 region gained popularity as a commonly used genetic marker for culture independent characterization of microbial consortia and limited to protocols involving the Roche/454 pyrosequencing platforms until recently (347). The latest Illumina sequencing chemistry employing the Miseq with the extension of read length to 300 bp paved way in deep profiling of large number of microbiome samples in a single paired end reaction, providing similar read lengths to the Roche platform at a much cheaper cost (340). Thus, substantial number of researchers have used this technology for various microbes targeting the 16S rRNA, V3-V4 hypervariable region (340). Based on these findings it has been concluded that V1-V3 offers greater phylotype richness and evenness than V3-V4 and provides more representative assessment of population diversity and community composition of oral bacteriome (347).

In metagenomic studies, potential bias can be introduced by the use of universal bacterial primers. Thus, the extent of coverage of universal primers for the bacterial 16S rRNA gene is a crucial aspect in the accurate assessment of microbial diversity in an ecosystem (348). Selective amplification of target sequence due to primer - template mismatches will prevent the correct assessment of community composition in an environmental/clinical sample (349). Target sequences that could not match the primers exactly will amplify to a lesser extent, even below the detection limit and the sequencing data will not represent the true community composition. Hence, a comprehensive evaluation of bacterial primer coverage is utmost importance in the interpretation of sequencing data. Universal primers: 27F, 338F, 338R, 519F, 519R, 907R, 1390R and 1492R which target different regions of the bacterial 16S rRNA gene are the primers widely used in metagenomic studies. Modern advancements of high- throughput NGS facilitate extensive sequencing of hypervariable regions of the bacterial 16S rRNA (348).

2.6.2 Oral mycobiome

There is a lack of universal agreement for a gene of interest in profiling of mycobiome compared with 16S rRNA for profiling of bacteriome. Thus, the fungal ribosomal RNA gene cluster (rRNA) (Figure 2.6) is the region widely used as proxy with sequencing approach principally targeting the 18S small subunit rDNA (SSU), 28S large subunit rDNA (SSU), 28S large subunit rDNA (LSU) or the internal transcribed spacer (ITS) (350). The gradual elimination of 28S as a target sequence for profiling mycobiome has occurred due to the inability of differentiation power for many species. Besides, there is a controversy on the acceptance of 18S or ITS as the optimally useful sequence. Interestingly, the ITS is more diverse, hence provides the most effective locus for greater species level phylogenetic placement of fungi and at present commonly used as the fungal ‘species barcode’ region. On the other hand, the higher conserved regions of 18S facilitate the amplification of rDNA from variety of fungi and offer the detection of non- fungal eukaryotes including parasitic protozoa, Leishmania and Toxoplasma (351, 352).

Figure 2.6: Schematic representation of the nuclear ribosomal repeat unit in fungi which includes the 18S, 5.8S and 28S rRNA genes and the internal transcribed spacers (ITS) 1 and 2.

CHAPTER 3: SAMPLES, DATA COLLECTION AND EXTRACTION OF DNA Overview

This study was designed to achieve the objectives stated in Chapter 1, section1.6. This sub-sample which represented the over whelming majority of OSCC cases in Sri Lanka came from a main unmatched case control study comprised of 134 cases of clinically diagnosed OSCC, subsequently subjected to histopathological confirmation and 134 clinically diagnosed controls with oral mucosal lesions namely; FEPs, Lipoma, Keratoses and Mucoceles. Sample size calculation was based on Kelsey JL, Whitmore AS, Evans AS and Thompson WD: Methods in Observational Epidemiology. Oxford University Press 1966 (Appendix 3.1) (353). Accordingly, the representative sub sample consisted of a homogenous group of 29 cases, Sinhala males over the age of 40 yrs, with a clinical diagnosis of oral squamous cell carcinoma (OSCC) in buccal mucosa or oral tongue who were not on antibiotics prior to 2 months of data collection from a main sample of 134. Control group consisted of 25 Sinhala males over the age of 40 years, with a clinical diagnosis of FEP of same sites who were not on antibiotics prior to2 months of data collection from a main sample of 134mucosal lesions namely; FEPs, Lipoma, Fibroma, Keratoses without dysplasia and Mucoceles (Appendix 3.2). Incisional biopsies of cases and excisional biopsies of controls were collected, transported, stored and dispatched as frozen tissues at -800C. DNA was extracted from frozen specimens using Gentra Puregene Tissue kit (Qiagen, Germany), solid tissue protocol according to the manufacturer’s instructions with a few modifications to ensure complete lysis of Gram positive cell walls of bacteria to obtain maximum yield of microbial DNA. Additional steps were not included to optimize the isolation of fungal DNA. The extracts were stored at -800C for determination of the bacteriome profile, exploration of the mycobiome profile and detection of HPV, EBV & HHV 8 as described in Chapter 6. A pre-administered questionnaire (Appendix 3.3) was used for data collection which predominantly comprised of socio-demographic information, tooth cleaning habits,

61 information on established risk factors: betel chewing, smoking and alcohol consumption, daily fruit and vegetable consumption data. Clinical data were extracted from clinical records and biopsy reports. The clinical oral examinations of these cases and controls were conducted by a Specialist in Dental Public Health comprising of recording decayed teeth, missing teeth, filled teeth and mobile teeth Oral hygiene status was assessed with the simplified oral hygiene index (OHI-S) of Green & Vermillion 1964 (354), while periodontal disease status was assessed by probing pocket depth (PD) and clinical attachment loss (CAL) at 4 sites per anterior teeth and 6 sites per posterior teeth. Periodontal disease status was classified according to Case Definitions for Periodontitis developed by Centre for Disease Control (CDC) Periodontal Disease Surveillance Work Group (Page & Eke, 2007) (356).

3.1 Study design: As described previously, a representative sub sample of 29 cases and 25 controls were selected from the main unmatched case control study sample of 134 cases and 134 controls. Sample size calculation is presented in Appendix 3.1. Explicit inclusion criteria were laid down to select the subsample. For cases inclusion criteria were Sinhalese males aged ≥ 40 years, with histopathologically confirmed OSCC involving buccal mucosa or tongue. For controls, inclusion criteria were Sinhalese males with clinically diagnosed FEPs involving buccal mucosa or tongue.

3.2 Study setting: Selected Oral and Maxillo-Facial (OMF) Units across Sri Lanka were visited, representing six provinces; namely, Western, Southern, Sabaragamuwa, North Western, Uva and Central, from 01/11/2014 to 30/12/14 to assess the feasibility and logistics of study settings. Meticulous assessment of service delivery functions on specific clinic days was carried out, to assess socio-demographic profile and clinical presentations of patients who were attending these clinics especially OSCC cases and FEP control group, with the perusal of biopsy reports for the past 12 months, critical observation of the routine practices and turnover of patients, with regard to attendance pattern of OSCC and FEPs. Based on the findings of this assessment, the inclusion and exclusion criteria were formulated as indicated in 3.8 of this chapter. Logistics,

infrastructure facilities and dynamics of the staff of Oral and Maxillo- Facial (OMF) units were considered. Each OMF unit consisted of an OMF Surgeon, House Officers, Nursing staff and health assistants who were actively involved in routine service provision. Biopsies were performed by House Officers and nursing staff and health assistants assisted for the procedure in these OMF units. As this study was planned to represent Sinhalese males of over 40yrs, North and Eastern provinces were excluded, where the majority of inhabitants were Tamils. The Western province recorded the highest population and population density among all the provinces in the country. Thus, 3 OMF units were selected from it. In Sabaragamuwa province, existing 2 OMF units were selected as this province carries the highest burden of OSCC in Sri Lanka. In remaining 6 provinces, 1 OMF unit from each province was selected (Figure: 3.1).

No Cases/ 01 Case/ 04 Controls 01 Control 10 Cases/08 04 Cases/ Controls 11 Cases/ 01 Control 10 Controls

03 Cases/01 Controls

Figure 3.1: Distribution of Cases and Controls by location of OMF Units by Provinces in Sri Lanka.

The study involved nine OMF units representing six, provinces in Sri Lanka; namely Unit D, The National Dental Hospital (Teaching) Sri Lanka, Colombo (Western Province) Figure: 3.2; Base Hospital, Panadura (Western Province); District General Hospital, Kalutara (Western Province); District General Hospital, Kegalle (Sabaragamuwa Province)Figure: 3.3; Provincial General Hospital, Ratnapura (Sabaragamuwa Province), Figure 3.4; Teaching Hospital – Kandy (Central Province); Provincial General Hospital, Badulla (Uva Province) Figure: 3.5; Teaching Hospital Kurunegala (North Western Province), Figure: 3.6 and Teaching Hospital Karapitiya (Southern Province) Figure: 3.7, between 17/04/15 and 02/08/15.

Figure3.2: Unit D, National Dental Hospital (Teaching) Colombo 7.

Figure 3.3: OMF Unit, District General Hospital, Kegalle

Figure 3.4: OMF unit, Provincial General Hospital, Ratnapura

Figure3.5: OMF Unit, Provincial General Hospital Badulla

Figure3.6: OMF Unit, Teaching Hospital, Kurunegala

Figure 3.7: OMF Unit, Teaching Hospital, Karapitiya

3.3Study period: Study period was 17/04/15 to 02/08/15.

3.4 Study Population: Study population comprised of a total of 29 patients with an initial clinical diagnosis of oral squamous cell carcinoma (OSCC) who met with our inclusion criteria, histologically confirmed subsequently but who had not had definitive treatment at the time of data collection and 25 controls with clinically diagnosed FEP.

3.4.1 Inclusion criteria: Inclusion and exclusion criteria for cases and controls were formulated meticulously as follows;

3.4.1.1 For cases: Sinhala males aged ≥ 40 yrs with histologically confirmed OSCC arising from buccal mucosa or tongue and those who were not on antibiotics for the past two months from the day of data collection. In past microbiome studies patients who were not on antibiotics for past 1 month (73) to 3 months (69) were included to detect microbiome profiles. Thus, patients who were on antibiotics > 2 months were included in this study, assuming that original flora was established after 2 months. This was assessed by recall and cross-checked with clinical records.

3.4.1.2 For controls: Sinhala males aged ≥ 40 yrs with clinically confirmed FEP arising from buccal mucosa or tongue and those who were not on antibiotics for the past two months from the day of data collection. In past microbiome studies patients who were not on antibiotics for past 1 month (73) to 3 months (69) were included to detect microbiome profiles. Thus, patients who were on antibiotics > 2 months were included in this study,

66 assuming that original flora was established after 2 months. This was assessed by recall and cross-checked with clinical records.

Pushalkar et al. 2012 (73) without antibiotics for 1 month

Al-hebshi et al. 2017 (355) without antibiotics for 3 months

Based on above 2 studies, for the present study not having antibiotics for preceding 2 months at the time of sample collection was deemed satisfactory. Nevertheless, in Sri Lanka, antibiotics are regularly available “over the counter” from a range of non- professional sellers. This, and issues with patient recall, are inherent problems in working in a LMIC country. Despite cross-checking with available clinical records, very recent use of antibiotics in some subjects cannot be excluded.

Choice of controls for the present study

The control subjects included in the present study were those with pathology (FEP) which may lead to future carcinoma and is part of future pathology. The ideal control sample would have been buccal and tongue mucosae of normal persons with no oral pathology and could have been obtained through cadaveric biopsies within a specified period of time after death, such as accidents and emergency units. However, this was not possible due to consent and ethical issues. Yet, having controls with FEP could be considered as a limitation within the scope of the present study.

3.4.2 Exclusion criteria

3.4.2.1 For Cases: OSCC cases who had undergone surgery, chemotherapy and/or radio therapy. Furthermore, patients were not physically and psychologically fit enough to provide free informed consent for participation in the study and fully edentulous or with less than four teeth in the mouth as it was not possible to perform periodontal disease classification based on Page & Eke, 2007 (356) and OSCC cases, aged< 40 years.

Despite being an inclusion criterion, all cases were practicing one or more risk habits namely betel chewing, smoking and alcohol consumption. It has been revealed that the

67 oral microbiome is subjected changes with such habits(55), and they are well established/ known risk factors in Sri Lanka (357). Though the oral microbiome is a lesser known risk factor in Sri Lankan context, it has to be assessed with other well known risk factors to have an impact/use.

3.4.2.2 For Controls: Patients who were less than 40 years of age and who had taken antibiotics in past two months.

3.5 Sample size calculation (353) (Appendix 3.1)

This was the first attempt to explore the microbiome profile of OSCC tissues of group of Sri Lankan male patients. Thus, homogenous subsample consistedof 29 OSCC cases compared with a control group of 25 FEP, obtained from a main sample to represents the over whelming majority of OSCC patients in Sri Lanka. The main sample size was calculated using the formula described by Kelsey et al.1996 (353) for unmatched case control studies (Appendix 3.1). Accordingly, the main sample consisted of 134 OSCC cases and 134 FEP controls and other benign mucosal lesion controls. In the calculation, ‘exposure’ was defined as current risk habit of betel chewing + smoking and or alcohol consumption based on pilot data collected from the OMF Unit, District General Hospital, Gampaha. The homogenous sub sample represented the over whelming majority of OSCC cases in Sri Lanka comprised of males > 40 yrs of age who indulged in practicing afore mentioned risk habits and who presented with histologically confirmed OSCC in buccal mucosa or tongue as these are the most affected anatomical sites for oral cancer in Sri Lanka (19, 32, 357).

3.6 Sampling technique: Non-probability consecutive sampling.

3.7 Study instruments: Study instruments consisted of the following components.

3.7.1. A Pre-tested interviewer administered questionnaire: A structured pre-tested interviewer administered questioner was used to collect data (Appendix 3.3). It was developed after extensive literature review. The questionnaire comprised of both open ended and closed ended questions which were broadly categorized into 4 main areas. It was prepared in English language and translated into the Sinhala language. The

68 questionnaire was pre-tested for clarity and to assess the time taken to complete at the OMF Unit of District General Hospital Gampaha. Necessary modifications were made to improve the clarity of the questions.

The questionnaire comprised of socio-demographic information, tooth cleaning practice, risk habit profile, daily consumption of fruits and vegetables, family history and awareness of oral cancer and clinical oral indicators.

Clinical oral examination was conducted by a Specialist in Dental Public Health using sterile mouth mirrors, gauze, and a dental explorer probe to detect dentinal caries and North Carolina Periodontal Probes (Figure 3.8) for periodontal examination while the patient was seated on the dental chair with fixed light. This examination included teeth present, decayed teeth (D), extracted/missing teeth (M) and filled teeth (F). Levels of dental plaque biofilm were recorded with the simplified oral hygiene index (OHI-S) of Green & Vermillion 1964 (354), while periodontal status was assessed as bleeding on probing (BOP), measurement of periodontal pocket depth (PD), and clinical attachment loss (CAL) on 4 sites on anterior teeth, 6 sites on posterior, utilizing all teeth present. Oral hygiene status which combines both debris and calculus index with scoring system was categorized into 3 groups as “Bad”, “Fair” and “Good”. Periodontal disease status was classified as “Severe”, “Moderate” or “Mild/No Periodontitis” based on Page & Eke 2007 (Case Definitions for Use in Population Based Surveillance of Periodontitis) (356). Furthermore, oral mucosa was examined and any growths, ulcerations or discolorations recorded.

Figure 3.8: North Carolina Probe

3.7.2 Biopsy reports: Histological diagnosis was extracted from biopsy report (Figure 3.9).

Figure 3.9: Records

3.7.3 Biopsies: Incisional biopsies of OSCC cases and excisional biopsies of FEP were used as samples in this study. Ethical approval of the study was obtained from the Faculty Research committee, Faculty of Dental Sciences, University of Peradeniya, Sri Lanka (FRC/FDS/UOP/E/2014/32) (Appendix 6)and Griffith University Human Research Ethics Committee, Australia (DOH/18/14/HREC) (Appendix 7). Written inform was taken from each participant.

3.7.4 Data Analysis:

These data were entered and analyzed using SPSS-21 Statistical Package. Percentage distributions were presented as descriptive statistics and Chi-Square Test of Statistical Significance was used as inferential statistics to compare groups with regard to

differences in risk habit profiles, oral hygiene status and periodontal disease status. Furthermore, t-test and Fisher’s exact test to compare groups (cell counts <5) were used to compare means with regard to duration of risk habits, missing teeth, mobile teeth, decayed and filled teeth among cases and controls. Differences in compositional bacterial profile, functional bacteriome profile and compositional fungal profile in OSCC tissues and FEP tissues were compared by Mann-Whitney test of statistical significance. Statistical significance was set at p <0.05.

3.8 Sample Collection, Transport, Storage and Dispatch

3.8.1 Sample Collection by Performing Biopsies

3.8.1.1 For case group: Tissue samples for this study were acquired from incisional biopsies taken for diagnostic purposes by the OMF surgeon or a member of his/her team. As is good clinical practice, these sampled at least one marginal area of the clinical lesion so as to include both surrounding clinically normal and lesional tissue and where surgically safe, included sufficient depth to reach the advancing front of the tumour. The biopsy was laid on a pile of sterile gauze and a small piece of tissue ~ 3 mm3 from the deep surface was excised from a macroscopically visible lesion area closer to the advancing front (Figures 3.10, 3.11& Figure 3.12), avoiding saliva contamination as much as possible by cleaning with sterile gauze swabs. The rest of the biopsy was sent in 10% formal saline for histopathological diagnosis. Only samples with histopathologically-confirmed OSSC (Appendix 3) were entered to the study. A new sterile surgical blade was used for each case. The sample was transferred into a clearly labeled cryostat vial using a sterilized pair of forceps. The cap of the vial was tightened (Figure 3.13) and immediately placed in a box tightly packed with dry ice (-800C). Simultaneously, the main biopsy sample was sent in 10% formal saline for histopathological diagnosis. Specimens of histologically confirmed OSCC were subjected to DNA extraction as described later.

Figure 3.10: Buccal MucosaFigure 3.11: Tongue

Macroscopic appearance of sampled area of OSCC lesion

Figure 3.12: Longitudinal section of site of deep advanced margin of OSCC tissue subjected to Microbiome profiling (Line diagram)

Figure 3.13: Clearly labeled, tightly closed cryostat vials containing OSCC tissue

3.8.1.2 For control group

After excision of clinically diagnosed fibro epithelial polyps, about 3mm3pieceswere removed from an area deep to the centre (depth) of the mass, and avoiding the oral surface of the specimen and saliva as much as possible (Figures 3.14,3.15 &3.16).

The freshly-taken biopsy was laid on a pile of sterile gauze and a small piece of tissue (~3mm3) was excised from the body of the lesion. A new sterile blade was used for each FEP. The sample was transferred into a clearly labelled cryostat vial (Figure 3.17), using a newly sterilized pair of forceps. The cap of the vial was tightened and immediately placed in a box packed with dry ice (-800C).

Figure 3.14: FEP in Buccal MucosaFigure 3.15: FEP inTongue

Figure 3.16: Longitudinal section of site of tissue subjected to microbiome profiling (Line diagram).

Figure 3.17: FEP tissue placed in a cryostat vial

3.8.2 Transport, Storage and Dispatch of Samples

Tissue samples were transported as frozen tissues with sufficient amount of dry ice- 800C in a tightly closed box, sealed with a scotch tape, without allowing spaces to ensure good quality DNA yield. Extra care was taken not to allow breakage of cold chain during transport. All cryostat vials with frozen tissues were immediately transferred to a clearly labeled box (Figure 3.18) and stored at = 800C freezers.

Figure 3.18: Clearly labeled box containing cryostat vials with fresh frozen tissues

Samples from provinces namely Western, Southern, North Western and PGH, Ratnapura (Sabaragamuwa province) securely stored at -800C freezer, of the Molecular Biology Section, Medical Research Institute, Colombo 8, Sri Lanka (Figure 3.19). Samples from provinces Central, Uva and District General Hospital, Kegalle (Sabaragamuwa province) were securely stored at -800C freezer, of the Department of Oral Pathology, Faculty of Dental Science, University of Peradeniya, Sri Lanka. Care was taken to minimize the transport time of fresh frozen tissues in intact dry ice and ensure storage as soon as possible to maintain quality fresh frozen tissues and subsequent good quality DNA yield from these fresh frozen tissues.

Figure 3.19: Medical Research Institute, Colombo, Sri Lanka Stored fresh frozen samples were placed in -800C dry ice in tightly sealed container and transported to TNT International Express, 435, Galle Road, Colombo 03. After documentation work, all cryostat vials containing frozen tissues were carefully wrapped within two layers of non- absorbent cotton wool and it was placed inside a plastic transparent box with a tightly fitting lid. This box of samples was placed in a regifoam box packed with 15 Kg of -800C dry ice. Then the box was closed with a tightly fitting lid and sealed with a gum tape. Subsequently the box was packed in a suitable cardboard cartoon according to TNT courier procedures. Finally, fresh frozen tissues air freight from Sri Lanka to Gold coast in dry ice via TNT currier service.

Samples were transported immediately by courier on dry ice. It reached expected destination, G 40 building, Gold Coast Campus on 10th August 2015 (Figure 3.20),which was accepted by the staff of stores at G 40 they were stored at one of -800C freezer. The

76 duration of transport of frozen tissues from Colombo to Gold coast was 6 days and 6 hours (about 150 hours). Despite careful transportation of the box of samples in dry ice (- 800 C), the possibility of disturbances to the meticulous maintenance of cold chain could not be overruled. Nevertheless, this could be considered as an inherent limitation attributed to logistics and scope of present study.

Figure 3.20: Dispatch of samples from Sri Lanka to Gold Coast

3.9 Extraction of DNA from Tissue Specimens

Tissue samples were finely chopped using a sterile blade. DNA extraction was then performed using Gentra Puregene Tissue kit (Qiagen, Germany) according to the manufacturer’s instructions (solid tissue protocol) [Cat no. 158689] with a few 0 modifications: 1) incubation at 55 C in the lysis buffer was performed overnight. 2) An 0 additional lysis step using 50 units of mutanolysin at 37 C for 1.5 hrs to digest the cell walls of Gram +ve bacteria was performed and tubes were then vortexed where possible speed in maximum speed, periodically in every 30 minutes. Then, tissues were digested 0 by Gentra Puregene Proteinase K, incubating at 55 C for 3’h’. Subsequently, RNA content of digested tissues was removed by Gentra Puregene R nase A, incubating at 0 37 C, in a shaking incubator for 60 minutes. After the complete digestion of tissues, liberated protein content was precipitated by Gentra Puregene Protein Precipitation

Solution, vortexing vigorously for 20 seconds at high speed. This was followed by 0 0 centrifuging at, 4600 RPM (20 C/RT ) for 20 minutes. Subsequently, supernatant of each tube was removed and mixed with isopropanol in a separate set of tubes. Then, contents of each tube were mixed gently by inverting 50 times. Tubes were centrifuged at 4600 0 RPM (4 C), for 30minutes to form the DNA pellets (Figure 3.21). The extracts were stored at -800C.

Figure 3.21:White DNA pellet at the bottom of tube

Afterward, supernatant of each tube was removed carefully. Next the DNA pellet of each tube was resuspended in 70% ethanol and centrifuged at 14000 g for 20 minutes. Later, supernatant of each tube was discarded carefully, taking care that the DNA pellet remained in the tube. Then each tube was drained on clean piece of absorbent paper. Next, pre heated Hydration Solution was added to each tube and mixed carefully till the pellet dissolved. Finally, total DNA concentration and purity was determined by the Nano Drop 1000 Spectrophotometer (Thermofisher Scientific, USA) (Figure 3.22). Afterward, supernatant of each tube was removed carefully. Next the DNA pellet of each tube was resuspended in 70% ethanol and centrifuged at 14000 g for 20 minutes. Later, supernatant of each tube was discarded carefully, taking care that the DNA pellet remained in the tube. Then each tube was drained on clean piece of absorbent paper. Next, pre heated Hydration Solution was added to each tube and mixed carefully till the pellet dissolved. Finally, total DNA concentration and purity was determined by the Nano Drop 1000 Spectrophotometer (Thermofisher Scientific, USA) (Figure 3.22).

Figure 3.22: Nano drop instrument 78

CHAPTER 4: Determination of Bacteriome Profile with prediction of functional content in a group of Sri Lankan

Oral Squamous Cell Carcinoma (OSCC) cases and Fibro

Epithelial Polyp (FEP) controls

4.1 Introduction

The burden of oral cancer, especially Oral Squamous Cell Carcinoma (OSCC) has become a public health challenge with poor prognosis and less than 50% five year survival rate in many parts of the world (358, 359). Moreover, it accounts for the 17th most common malignant neoplasm in global context and 8th in developing regions (360). In Sri Lanka, oral cavity and pharynx cancer combined is the most common (Number 01) cancer among men: with 23.6% of all cancer types and ranks 5thamong women, with 5.9% of all cancer types, according to latest available Sri Lankan cancer incidence data(18). An array of geographic and population specific, well known risk factors, which act individually as well as synergistically account for much of the aetiopathogenesis of oral cancer (12).These factors include; use of different forms of tobacco (smoked and smokeless), betel quid chewing, other forms of areca nut use, heavy consumption of alcohol, human papilloma virus (HPV) infection, nutrient deficiency, exposure to excessive solar radiation/environmental pollutants and genetic predisposition (361, 362). Nevertheless, there is limited information on emerging risk factors, which may contribute to around 15% of OSCC which cannot be explained (35), by the aforementioned risk factors. Microbial dysbiosis closely tied to host inflammation has been demonstrated to play a role in the aetiology of colon, gastric, esophageal, pancreatic, breast and gall bladder carcinomas (148). Hence, it is worthy to explore these lesser known risk factors which may imply cause or consequence applied to different population groups to broaden the horizons of knowledge of epidemiology of OSCC (69).

Given evidence for the well-established role of H. pylori as the causative agent of gastric cancer, as well as possible involvement of some bacteria in other types of malignant neoplasm, interest in investigating the potential role of bacteria in oral carcinogenesis has arisen recently (42, 43). Consequently, considerable numbers of studies have been conducted employing diverse approaches, including conventional culture techniques to metagenomics (69-75, 172-176, 178, 363). Nevertheless, there remains no agreement on involvement of specific bacteriome profiles or single bacterial taxa associated with OSCC cases or healthy controls so far (41, 69, 75). This could be partially explained by the fact that differences in well-defined and other risk factors among different population groups such as betel chewing, smoking, alcohol consumption, HPV status which could have influenced bacterial colonization in OSCC tissues(43, 75, 154). Moreover, differences in staging of OSCC with consequent changes in cancer-related microenvironment may cause lack of uniformity in OSCC associated bacteriome profile. Inherent methodological variations, related to sampling (saliva, surface swabs or tissues), choices of controls (matched or unmatched), controlling for major confounding factors. method of storage (fresh, frozen or fixed), different approaches used for characterization of bacteria (culture based, molecular methods or metagenomics) and other variables used for data analysis (methods used for analysis of clones or type of reference 16S rRNA gene sequences) of bacteriome (41, 69, 300)which have prevented direct comparison across studies(131). Moreover, higher inter- patient variability of community structure in disease associated microbiome may be attributed to inconsistency of results (131). This notion provides the rationale for the importance of determining the functional profile of the microbiome in specific diseases even if by inference, which would be more informative than descriptions of just the community profile (69, 129, 131).

The ubiquities nature of the 16S rRNA gene of prokaryotes paved the way for sequencing multiple samples at greater depth and enabling detection of even incredibly low abundance species (165). Moreover, impressive developments in NGS technologies provide a snapshot of microbial communities associated with health and recognize microbial dysbiosis associated with diseases including OSCC (41, 55, 75,132). So far, three studies have explored the bacteriome profile associated with OSCC by 16S rRNA gene amplification NGS technology (72, 364,365).

These studies were able to classify the majority of sequences to genus level only (366), not reaching species level association of bacteriome in OSCC (69). This limitation was due to employment of the same pipe line which engrosses de novo clustering of sequences into operational taxonomic units (OTUs) and taxonomically assigned them via Bayesian classifier. To overcome this limitation, a robust BLASTIN based algorithm (which utilizes three well curated sets of reference 16S rRNA gene sequences for classification of NGS reads to species level)was tested in a pilot study (178). Later on, modified version of this algorithm was employed to profile the bacteriome within OSCC tissues in a full-scale study very recently (69).

Microbial (bacterial) dysbiosis has been associated with various types of cancer including OSCC (75, 225, 367) and bacteria are suggested to contribute to oral carcinogenesis via inhibition of apoptosis, activation of cell proliferation, promotion of cellular invasion, induction of chronic inflammation, and production of carcinogens (35, 41, 42). The first epidemiological evidence on inflammatory bacteriome functional profile in tissues of OSCC cases was recently undertaken and included deep epithelium matched controls (69). In this study, functional analysis was used to predict involvement of bacterial genes and metabolic pathways with OSCC (69).

The objective of this study was to use NGS combined with a species level taxonomy alignment algorithm and assigned functional analysis to compare the bacteriome profile and functional profile within OSCC tissues with benign intra oral fibro epithelial polyps (FEP) and identify bacterial taxa that may play a role in oral carcinogenesis.

4.2 Materials and Methods Study design (3.1) and study setting (3.2), history taking and clinical examination (3.7), tissue sampling and DNA extraction (3.8) were done as described previously.

4.2.1 Amplicon library preparation and sequencing

Library preparation and sequencing were performed at the Australian Centre for Ecogenomics following the workflow outlined by Illumina as described previously (355).except the polymerase specified with the Q5 Hot Start High – Fidelity 2X Master Mix (New England Biolabs, Ipswitch, MA, USA) was used. In brief, the degenerate

81 primers 27FYM (368) and 519R (369) were utilized to amplify the V1-V3 region of the 16S rRNA gene under standard PCR conditions (Table 4.1). Subsequently, the PCR amplicons (~ 520 bp) were purified, indexed with unique 8-basebarcodes in a 2ndPCR and pooled together in equimolar concentrations. Finally, sequencing of the indexed library was carried out using the v3 2x300 bp chemistry on a MiSeq platform (Illumina, USA) adhering to the manufacturer’s protocol. Details of the Miseq v3 kit is provided in Table 4.1.

Table 4.1: Miseq v3 kit

No. of Kit Size Output 2 × 75 2 × 300 Reagent Kit Reads (cycles) (max.) Output Output

MiSeq 25 M 150, 600 15 Gb 3.8 Gb 15 Gb Reagent Kit v3

Gb = gigabases, M = millions

Table 4.2: Standard PCR conditions

STEP TEMP TIME

Initial Denaturation 98°C 30 seconds

25–35 Cycles 98°C 5–10 seconds

Annealing Temperature *50–72°C 10–30 seconds 55°C

72°C 20–30 seconds/kb

Final Extension 72°C 2 minutes

Hold 4–10°C

4.2.2 Preprocessing of sequencing data

The raw data were preprocessed as explained previously (355). Reads with primer mismatches were removed. Then the primer sequences were trimmed off (69). Next, the software PEAR was used to stitch paired sequences using the following parameters: minimum amplicon length 432bp; maximum amplicon lengths 522 bp; and P- 82 value=0.001. Lastly, the MOTHUR software package version 1.38.1was used (370) to process the merged reads as follows: reads with ambiguous bases, with homopolymers> 8 bases long, that did not achieve a sliding 50-nucleotide Q-score average of ≥35or that poorly aligned to SILVA reference alignment (371) were filtered out. Finally, the remaining reads were verified for chimera using UCHIME (372) by the self- reference approach.

4.2.3 Compositional data analysis

The high-quality, non-chimeric sequences were classified to the species-level according to a combined two BLASTN-based algorithms (178, 355). Individually, each read was subjected to BLASTN-searched at alignment coverage and identity was based on a ≥ 98% match against 4 sets of 16S rRNA reference sequences in preceding order. The Human Oral Microbiome Database (HOMD) version 14.5; a chimera-free version of the Human Oral Microbiome extended database (trusted-HOMDext); a modified version of the Greengene Gold set (modified-GGG); and NCBI’s Microbial 16S set (August 2016 release). http://www.homd.org/index.php?name=HOMD&file=index.

Matches were first ranked by relevance hits from HOMD 14.5 version. Subsequently, reads were classified to the species level, matched on taxonomy of the sequence with the highest % identity and bit score (hit reference sequence) belonging to the highest priority reference set. Reads returning top hits belonging to multiple species were subjected to secondary de novo chimera checking using USEARCH. Singleton OTUs were discarded and a representative sequence for each of the remaining OTUs was BLASTN-searched against the 4 reference sets once more to decide the closest species for taxonomy assignment (69).

The QIIME (Quantitative Insights In-to Microbial Ecology) software package, version 1.9.1 (373) was employed to perform downstream analysis and sub sampling to obtain equal number of reads across the samples. Moreover, generation of taxonomy plots/tables and rarefaction curves as well as calculation of species richness, coverage and a range of alpha and beta diversity indices. Subjects were clustered by the weighted UniFrac distance metric using Principle component analysis (PCoA) (374). Discovery of

83 differentially abundant taxa among the cases and controls was performed by Linear discriminant analysis Effect Size (LEfSe) (375) and G-test.

4.2.4 Functional data analysis

The functional compositions of metagenomes (in OSCC cases and FEP controls) were analysed by PICRUSt (phylogenetic investigation of communities by reconstruction of unobserved states), using their 16S profiles. PICRUSt, a bioinformatics resource which employs an extended ancestral-state reconstruction algorithm to predict which gene families are present and then combines genes families to estimate the composite metagenome. to PICRUSt (phylogenetic investigation of communities by reconstruction of unobserved states)(376). This was a two- step process. Firstly, the gene content inference was done by Wang’s method and Greengenes 97% OTUs (version 13.5). This was used as reference to reclassify the reads by MOTHUR software. Then, reads were assigned to OTUs based on their taxonomy (phylotype command). Secondly, this table was used as an input (metagenome inference) to predict the functional content of microbial communities by matching OTUs in the samples to reference OTUs with known/imputated gene content, normalizing for gene-copy number variations (69).The analysis was conducted based on KEGG orthologs (KO) and pathways. Variations in genes and pathways between the cases and controls were investigated using LEfSe (69).

4.3 Results

4.3.1 Sequencing data processing statistics

Seven samples (4 OSCC cases and 2 FEP controls) were excluded due to poor quality read counts or primer mismatches and were excluded. The sequencing run has generated total of 3,277,451 raw paired reads in all, 53 samples. After removal of primer mismatches, additional reads filtering followed by alignment and chimera checking, a total of final 451,048 (40.27%). High-quality, non-chimeric merged reads were obtained with an average length of 482.5 bp. OF these 65 reads were identified de novo as additional chimeras; 61 did not return BLASTN matches and 47,038 formed singleton OTUs and were thus excluded. The number of classified reads per sample ranged from

4358 to 21251 reads. The means (± SD) read counts of the bacteriome were 9102.79(±3245. 63).Finally, 394,937(35.26%) of the merged reads of 25 OSCC cases and 22 FEP controls were assigned into species level.

4.3.2 Bacteriome Profile (Compositional)

A total of 1072 species level taxa (including 373 potentially novel species) belonging to 272 genera and 19 phyla were detected in 47 (25 OSCC cases and 22 FEP controls) of samples. The abundances and detection frequencies of these taxa, in each of the samples and across the study groups are shown in Supplementary Tables S1-3 (Appendix 4.1- 4.3).

The number of species detected in the cases was 1050 and 1068 in controls, with 1046 species being common to both groups. The number of species varied from 19-166 in OSCC cases and 4-210 in FEP controls. The mean read count for cases was 78.56±46.699 and 93.64±51.649 for controls.

Bacteriome profile by stacked bars showing the distribution of phyla, top 15 genera and top 25 species detected in the study group are illustrated in Figure 4.1.

Figure4.1: The Bacteriome Profile (the % of average abundances of taxa in phylum,

genera and species level [Overall- All samples (47), OSCC -Cases (25), Control -FEP

(22)]

Average abundances of main phyla, genera and species in percentage of total samples are indicated as below From Table 4.3 to 4.9.

Table 4.3: Average abundances of main phyla in the overall bacteriome profile (S1- Appendix 4.1) Phyla Average abundance Sample N (%) (%) n- 47 Firmicutes 38.44 100 Proteobacteria 19.37 100 Actinobacteria 15.57 97.9 Fusobacteria 14.45 93.6 Bacterioidetes 11.58 97.9

Table 4.4: Average abundances of main genera in the overall bacteriome profile (S2- Appendix 4.2) Genus Average abundance (%) Sample N (%) n- 47 Streptococcus 24.23 100 Rothia 12.45 89.4 Leptotrichia 9.65 83.0 Gemella 7.18 97.9 Capnocytophaga 5.48 87.2 Fusobacterium 4.77 85.1 Prevotella 3.94 91.5 Enterobacter 3.86 23.4 Haemophillus 3.43 95.7 Citrobacter 3.25 27.7

Table 4.5: Average abundance of main genera in the OSCC bacteriome profile (S2- Appendix 4.2)

Genus Average abundance (%) Sample N (%) n=47 Leptotrichia 10.47 84.0 Capnocytophaga 9.39 96.0 Fusobacterium 6.98 88.0 Citrobacter 6.20 36.0 Prevotella 5.32 96.0 Haemophillus 3.61 96.0 Pseudomonas 2.41 20.0

Table 4.6: Average abundance of main genera in the OSCC bacteriome profile (S2- Appendix 4.2)

Genus Average abundance Sample N (%) (%) n= 25 Leptotrichia 10.47 84.0 Capnocytophaga 9.39 96.0 Fusobacterium 6.98 88.0 Citrobacter 6.20 36.0 Prevotella 5.32 96.0 Haemophillus 3.61 96.0 Pseudomonas 2.41 20.0

Table 4.7: Average abundance of main genera in the FEP bacteriome profile (S2- Appendix 4.2) Genus Average abundance Sample N (%) (%) n-=22 Streptococcus 27.18 100 Rothia 16.96 95.4 Gemella 8.45 100 Klebsiella 2.21 31.8

Table 4.8: Average abundance of main species in the OSCC bacteriome profile (S3- Appendix 4.3) Species Average Sample N (%) abundance (%) n- 47 Citrobacter koseri 6.20 36 Fusobacterium 5.13 56 nucleatumsubsp.polymorphum Streptococcus dysgalactiae 5.13 24 Pseudomonas aeruginosa 2.41 20

Table 4.9: Average abundance of main species in the FEP bacteriome profile (S3- Appendix 4.3) Species Average Sample N (%) abundance (%) n- 47 Rothia mucilaginosa 13.88 95.4 Streptococcus mitis 10.36 100 Gemella haemolysans 8.16 100 Streptococcus sp. oral taxon 3.99 68.1 070

4.3.3 OSCC vs FEP

4.3.3.1 α-Diversity (Summary statistic of a single population) The number of bacterial species haboured in OSCC cases varied from 19-166 and 4210 in FEP controls. The mean number of species in cases ± (SD) was 78.56±46.699 and the median was 71.The mean number of species in controls ± SD was 93.64±51.649 and the median was 91.50 (Figure 4.2).

Figure 4.2: Mean number of bacterial species present in cases and controls

Table 4.10: Species richness, α-diversity and coverage (mean±SE) calculated from the rarefied biom.

Group Observed Chao1 Shannon Good’s richness index coverage

OSCC 82.9±37.8 111.2±51.5 3.3±0.9 0.994±0.003 FEP 101.6±42.9 125.2±50.9 3.6 ±1.3 0.994±0.003 *Mann-Whitney test, p < 0.05

According to Table 4.10, α-diversity was significantly higher in FEP controls compared with OSCC cases (p<0.05).Thus, OSCC cases demonstrated lower species richness and coverage indicating community shift/ disease associated dysbiotic status compared with FEP controls.

4.3.3.2 β diversity (Summary score between population) and Rarefaction

Figure 4.3: β diversity (Summary score between population) and Rarefaction Curve

According to the rarefaction curve, species richness and diversity were markedly higher in controls compared with cases. Furthermore, sufficient sequencing depth was indicated by

90 rarefaction curves (Figure 4.3A). Two clusters were generated one cluster predominantly comprising OSCC cases and the other one mainly including FEP controls (Figure 4.3B).

4.3.3.3 Differentially abundant taxa

4.3.3.1 By Linear Discriminant Analysis Effect Size (LEfSe)

Figure 4.4: Differentially abundant taxa. Linear Discriminant Analysis EffectSize (LEfSe) analysis showing genera (A) and species (B) that was significantly differentially abundant between the cases and controls (LDA score≥ 3).

The relative abundance of marker genera and species were significantly different (p<0.001) among cases and controls (LDA score ≥ 3) by LEfSe. Accordingly, Capnocytophaga, Pseudomonas and Atopobium were the marker genera associated with OSCC cases with significantly different relative abundance. At species level, Campylobacter concisus, two Prevotella species and a Fusobacterium sp_HOT-204 were the key tone species detected in OSCC cases. Conversely, 7 Streptococcus species and 2,

Rothia species were significantly abundant key stone species in controls (Figure 4.4).

4.3.3.2 By G- Test

Table 4.11: Differentially abundant species as identified by G-test (p<0.001)

Differentially abundant in the Differentially abundant in cases controls

Streptococcus mitis Citrobacter koseri

Rothia mucilaginosa Streptococcus dysgalactiae

Enterobacter cloacae Fusobacterium nucleatum sub polymorphum Leptotrichia trevisanii Capnocytophaga sputigena

Streptococcus oral taxon 070 Capnocytophaga leadbetteri

Lautropia mirabilis Streptococcus agalactiae

Leptotrichia oral taxon 225 Leptotrichia oral taxon 223

Rothia dentocariosa Streptococcus parasanguinis II

Staphylococcus epidermidis Pseudomonas aeruginosa

Leptotrichia oral taxon 215 nov 96.98%

Prevotella veroralis

Table4.11 presents the species with significantly different relative abundances in cases and controls (p<0.001). Accordingly, Citrobacter koseri, Streptococcus dysgalactiae, Fusobacterium nucleatum subsp.polymorphum, Capnocytophaga sputigena, Capnocytophaga leadbetteri, Streptococcus agalactiae, Leptotrichia oral taxon 223, Streptococcus parasanguinis II, Pseudomonas aeruginosa, Leptotrichia oral taxon 215 nov 96.98% and Prevotella veroralis were significantly abundant in OSCC. In contrast,

Streptococcus mitis, Rothia mucilaginosa and Enterobacter cloacae, Leptotrichia trevisanii, Streptococcus oral taxon 070, Lautropia mirabilis, Leptotrichia oral taxon 225, Rothia dentocariosa and Staphylococcus epidermidis were significantly enriched in FEP (Table4.8). A list of taxa exclusively found in either group at prevalence ≥ 15% is given in the Supplementary Table S4 (Appendix 4.4). Interestingly, 0.4% of taxa found in OSCC samples were limited to OSCC cases and 2.1 % of taxa detected in FEP samples were restricted to FEP controls.

4.3.4 Functional Bacteriome Profile

Figure 4.5: Differentially enriched functions. Linear Discriminant Analysis Effect Size (LEfSe) Showing genes (A) and pathways (B) that were significantly differentially enriched between the cases and controls (LDA score≥ 2.25) Mann- Whitney test p<0.001 Figure 4.5 indicates the microbial genes and pathways which were deemed to be prevalent in each of the study groups. Accordingly, at the gene level, genes involved in production of variety of enzymes such as transketolase, pyruateformatelyase, putative proteases and Nitroreductase dihydropteridinereductase were predominant in OSCC

93 cases. In contrast, genes responsible for production of iron complex transport system ATP binding proteins, iron complex transport system permease protein, aspartyl tRNAASN amidotransferase sub unit A, iron complex transport jem substrate binding proteins were more abundant in FEP controls. At pathway level, Furthermore, at bacterial metabolic pathway level; biosynthesis of LPS proteins, LPS biosynthesis, energy metabolism, membrane and intracellular structural molecules, as well as Nitrotoluene degradation were distinctly higher in OSCC tissues. In contrast, pathways; valineleucine and isoleucine biosynthesis, glycolysis /glucogenesis, base excision repair and metabolism of xenobiotic molecules by cytochrome P450 were predominant in FEP tissues.

4.4 Discussion

The present study is the first of this nature conducted in the South Asian Region which carries the highest burden of oral cancer (OSCC) in the world. Moreover, as cancer of the lip, oropharynx and oral cavity denotes the number 1 cancer among males in Sri Lanka, inclusion criteria were meticulously framed to represent the over whelming majority affected by OSCC in Sri Lankan context with regards to age, anatomical location (site), socio-demographic and risk habit profiles. The OSCC cases were older with severe periodontitis and had prolonged and higher intensity of consumption of betel quid (with tobacco and areca nut) and alcohol when compared with FEP controls as described in Chapter 6, Table 6.3.1.2. This may have influenced the significantly different colonization patterns of OSCC tissues compared with FEP controls.

The present study has demonstrated that OSCC cases have significantly lower species richness (p<0.05) and α-diversity (p<0.05) compared with FEP controls, indicating a ‘dysbiotic status’ in OSCC tissues which is in consistent with the finding of two previous studies in which saliva samples have been investigated (72, 75), thus underpinning the importance of shifts in the salivary bacterial composition and differences in species richness reflected in the tumour micro environment. This finding contrasts with a previous study conducted by Al-hebshi et al. 2007 where the OSCC and control samples displayed more or less similar species richness and α-diversity (69), using fresh OSCC

94 biopsies (cases) from Yemeni users of the smokeless tobacco product called Shammah and deep epithelium swabs (matched controls) as well as two previous studies (73, 364).

These differences in findings among studies may be because of inherent limitations of each study due to methodological variations in sample size, sampling methods especially studies conducted using contra lateral side of same patients as controls (70, 71, 73, 74, 172). Such samples are unsatisfactory as controls due to likely field change, habit effect and systemic effects which are operating. Besides, DNA extraction protocols, amplification, purification and quantification protocols, type of NGS platforms used, sequencing depth, type of reference 16S rRNA sequences, pipeline used for bioinformatic analysis and confounding factors may differ (41, 300). Capnocytophaga, Pseudomonas and Atopobium were the key stone genera differentially abundant in cases as indicated by LDA (Fig 4.4.). In previous studies, association of Capnocytophaga species (70, 177)and Pseudomonas species (41) with OSCC had been revealed, this finding was therefore consistent with these studies. Interestingly, association of Atopobium with OSCC has been revealed for the first time in the present study. However, this genus has been identified as a keystone pathogen associated with chronic periodontitis (150, 377)and substantiates the finding of present study. Furthermore, for the first time Campylobacter concisus, Prevotella salivae, Prevotella loescheii and Fusobacterium species HOT 204 were identified as a marker species in OSCC tissues (Figure 4.4). Interestingly, Barrett’s oesophagus patients who are at a risk of adenocarcinoma have shown increased levels of Campylobacter concisus and Campylobacter rectus in oesophageal samples (541). Furthermore, Prevotella and Fusobacterium (70, 71, 74,172) have been associated with OSCC as well as chronic periodontitis. Nevertheless, further studies are warranted to explore the consistency of ‘marker species’ of OSCC tissues found in current study.

The relative abundances of marker species such as Citrobacter koseri, Streptococcus dysgalactiae Fusobacterium nucleatum subsp.polymorphum, and Pseudomonas aeruginosa were significantly different in OSCC tissues by G-test with statistical significance (p<0.05) (Table 4.6.) Genus Citrobacter was found to be dominated in OPSCC HPV negative samples compared with OPSCC HPV positive samples in a study conducted by Guerrero-Preston et al.2016 (75). Interestingly, C. koseri has been reported

95 to be associated with pulmonary adenocarcinoma (378). Moreover, C. koseri was detected as a causative agent of infections, involving gastrointestinal tract, respiratory tract and urinary tract of elderly immuno-compromised hosts (379). There is currently no evidence of association of S. galactiae with any cancer type. However, this bacterium has been identified as a pathogen responsible for invasive and non-invasive infections (380) including endocarditis and acute endoopthalmitis (381). Hence, further studies are needed to explore the possible role of these organisms in initiation and progression of OSCC.

The incidence of F. nucleatum sub.nucleatum was notably higher in OSCC cases in the study conducted by Al-hebshi al.2017 (69) and they provided the first epidemiological evidence for the association of this bacterium with OSCC. Hence, present findings replicated that of Al-hebshi al.2017 (69). In addition, Fusobacterium was identified at substantially higher levels in studies performed by Nagy et al. 1998 (172) and Schmidt et al.2014 (74)using surface swabs from OSCC lesions compared to normal mucosa of the same patients. However, normal mucosa from the same patient was not reliable due to field characterization, habits and other systemic effects of OSCC cases. F. nucleatum has gained attention due to carcinogenic mechanisms demonstrated in promotion of cellular proliferation and invasion in human epithelium and colorectal carcinoma (CRC) cell lines (193, 194)as well as enhanced progression OSCC (190)and CRC in animal models (200) Thus, F. nucleatum has been strongly associated with CRC (38, 181).

The present study reports an association of P.aeruginosa with OSCC and this is consistent with a study conducted recently by Al-hebshi et al. 2017 (69),and there is emerging experimental evidence of a possible role of P.aeruginosa in carcinogenesis (382). Furthermore, this opportunistic pathogen has been shown to create chromosomal instability by activating DNA breaks in epithelial cells (383). Furthermore, P. aeruginosa is equipped with lipopolysaccharides (LPS), flagella and cytotoxins (ExoU) with potent pro inflammatory activity that give rise to neutrophil recruitment via activation of NFκ B signalling pathway. This pro-inflammatory role could play a crucial role of inflammation in carcinogenesis (384, 385). This bacterium is reported to promote cellular invasion and metastasis by secreting factor Las I, which in turn reduces the expression of E-cadherin (382). Moreover, P.aeruginosa is capable of producing carcinogenic metabolites (386).

Thus, it is worthwhile to investigate the potential role of P.aeruginosa in initiation and progression of OSCC using cell cultures and animal models. In the present study, S. mitis and R. mucilaginosa were among the marker species that were significantly different in prevalence in controls as determined by G test (Table 4.8). Thus, the present study is in agreement with the study of Al-hebshi et al.2017 (69), although control samples were deep epithelium swabs of healthy controls in their study. In contrast to this finding, Pushalkar et al. 2012 (73) was able to detect a higher abundance of S. mitis in OSCC tissues and Mager et al. 2003 (399) detected higher abundance of S. mitis in saliva samples of OSCC patients. In parallel with higher abundance of R. mucilaginosa in FEP controls in the present study, Pushalkar et al. 2012 (73) found the same bacterium more frequently in adjacent non tumour mucosa of OSCC patients. Thus, the findings of the present study seem more reliable as due to the effects of field changes, habit effects and systematic effects, adjacent non tumour mucosa is not suitable as controls. Besides, S. mitis and R. mucilaginosa were reported as members of healthy core oral bacteriome in a young Arab population (387).

Bacterial communities in OSCC cases were considerably different from FEP controls in the present study as majority of the cases and controls formed separate two clusters in PCoA. This finding was consistent with the studies conducted by Al-hebshi et al.2017 (69) and Guerrero-Preston et al. (75). Moreover, a recent study reported that the bacteriome of smokeless tobacco products varied qualitatively, quantitative and functionally (414). Therefore, as the OSCC cases of present study reported a significantly high betel chewing habit with tobacco (smokeless tobacco) compared to FEP controls, it could have influenced the differences in bacterial communities in two groups.

Furthermore, OSCC cases were associated with reported a significantly severe and moderate periodontal disease status (Table 4.2). This may be due to the presence of key stone periodontopathic bacteria, for instance, Atopobium, Campylobacter, Prevotella and Fusobacterium (150, 388)were abundantly in OSCC tissues compared with FEP controls.

The genes reported to be prevalent in OSCC cases in the present study was remarkably in consistent with findings of two studies highlighting the pro inflammatory functional profile in OSCC tissues (69)and sub gingival paper point samples of chronic periodontitis

97 patients(389).Inflammatory bacterial LPS have been reported to stimulate carcinogenesis via inflammation. By the activation of the TLR/MyD88/NF-NF-κB patients pathway (389). Moreover, LPS has promoted the invasiveness of pancreatic cancer and lung metastasis in breast cancer through the prostaglandin E2-EP2 path way (390) as well as progression of liver metastasis of colorectal cancer via stimulation of toll receptor TRL4 (391). These over re-presentation of biosynthesis of LPS gene in OSCC cases in the current study may be due to the presence of keystone periodontal pathogens namely, Fusobacterium and Prevotella (388) addition to Pseudomonas described previously. These inflammophilic bacteria have been evolved to endure inflammation as well as to take advantage of it. Inflammatory by products drive the selection and enrichment of these pathogens by providing nutrients (36). Higher incidence of genes associated with nitroreductase activity by K10679 Nitroreductase dihydropteridine reductase enzyme production in functional profile of bacteriome OSCC cases. It has been revealed that bacterial nitroreductase is capable of converting indirect acting carcinogens to proximal carcinogens (392). Interestingly, one of the marker genera, Pseudomonas associated with OSCC cases in the present study has been suggested to employ both oxidative and reductive pathways for bio degradation of nitrotoluenes (393, 394). Intermediate metabolites of these processes are known to be genotoxic, mutagenic and haematotoxic (395, 396). Hence, enrichment of carcinogenic metabolite production in OSCC tissues might be a feature of the associated microbiome. However, investigation of exact mechanisms of carcinogenic metabolites production by oral bacteriome remains to be undertaken. Microbial dysbiosis associated with oral cancer may be a consequence due to alterations in cell surface receptors in oral carcinogenesis (36). Thus, the genes pathways have been co-evolved to adopt the tumour micro environment by means of inflammation and production of carcinogenic metabolites. There may be no active role of these bacteria in causing the tumour but they may be the ones best suited to survival within the tumour tissue. Nevertheless, the present findings support the notion of a role of bacteria in oral carcinogenesis via induction of chronic inflammation and production of carcinogenic metabolites (42, 43).

Genes associated with transporters; amino acid biosynthesis, transcription factors and glycolysis were predicted in functional composition of FEP controls in the present study. Thus, present study is in consistent with the study of Al-hebshi et al. 2017 (69) and Kirst et al. 2015(389) as they found similar functional profiles of bacteriome in matched healthy controls. In addition higher incidence of genes associated with xenobiotic metabolism is prevalent in FEP controls. Xenobiotics are defined as chemical compounds namely pesticides and poly nuclear aromatic hydrocarbons hat is not normally associated with a given environment, or one at a higher concentration than ordinarily found. Such Xenobiotic molecules can potentially be metabolized by the gut microbiota (397). These findings could be plausibly be explained in terms of distribution of FEP controls as the majority came from primarily agricultural rural areas in the country such as Ratnapura and Kurunegala (Table 4.4). Moreover, the majority of controls were indulging in risk habits such as smoking alcohol consumption and betel chewing (Table 4.3). Hence, there could be possible exposure to environmental agrochemicals by them. Moreover, compared to OSCC cases, FEP controls reported significantly higher consumption of ≥ 5 portions of vegetables and fruits (Table 4.3).This could be another possible source of exposure to agro-chemicals. The health promoting benefits of consumption of ≥ 5 portions of vegetables and fruits could be mitigated by agrochemical ingestion via them. Findings of the present study revealed an OSCC associated bacteriome compared to FEP controls in the Sri Lankan context. A plethora of factors such as nutrient availability, pH status of the environment, competition among species for binding sites, inter-species antagonism or cooperation and the differences in receptors present on various tissues may influence colonization patterns of specific bacterial species at different host locations (36). Against this backdrop, it is reasonable to speculate that the tumour microenvironment influences the community structure and function of OSCC associated microbiome in the present study. It has been revealed that aberrations in the cell membrane glycoconjugates of tumour cells (398) could alter the adhesion of different species of streptococci in cancerous tissues compared with healthy controls(177, 399). Furthermore, the micro environment of solid tumours is found to be hypoxic with an acidic extracellular pH (400) and there might be a degree of preference for acid tolerant bacteria. Thus, asaccharolytic or weakly

99 fermentative species namely Fusobacterium and Prevotella species have been found to flourish in OSCC tissues compared with FEP controls in the present study. These bacteria have shown to be competent to flourish at relatively low pH (401). Moreover, a recent study reported that the bacteriome in smokeless tobacco products differed qualitatively, quantitatively and functionally (Al-Hebshi et al.2017). Hence, as the OSCC cases had significantly higher frequency and magnitude of betel chewing practice (p<0.05), bacteriome in betel quid could have influenced the bacteriome profile of OSCC tissues. The findings of the present study as discussed above should be interpreted cautiously without disregarding following limitations. Contamination of tissue samples by saliva cannot be entirely excluded although great care was taken during biopsy to avoid this, and all biopsies were blotted with fresh gauze immediately after excision. Not performing surface contamination by swabbing the lesions/tissues with 70% alcohol to get rid of salivary contamination without affecting the internal tissue microbial flora (402, 403). Nevertheless, PICRUSt (phylogenetic investigation of communities by reconstruction of unobserved states)algorithms used for functional data analysis of the present study to predict the metabolic pathways of bacteria of OSCC tissues merits validation using metabolimics and metatranscriptomics analyses by further research. In conclusion, the present study highlighted an inflammatory and carcinogens metabolizing opportunistic pathogens possibly mediating through polymicrobial synergy and dysbiosis of OSCC tissues compared with FEP controls. Factors related to tumour microenvironment of OSCC tissues, significantly high burden of periodontal diseases and higher frequency of betel chewing and alcohol consumption among OSCC cases could have influenced OSCC associated bacteriome. However, it is not conclusive whether this was a cause or a consequence of OSCC. Nevertheless, a present finding implies that metagenomic sequencing coupled with bacterial functional gene assessment could unravel new aspects of microbial involvement in OSCC with potential therapeutic and public health implications. Finally, based on the novel findings in the present study, further research into functional metagenomics which render high resolution genomic analysis of microbes, connecting them to specific function in the community underpinned by microbial ecological perspectives is much warranted.

100

CHAPTER 5: Exploration of the Mycobiome Profile in a group of Sri Lankan Oral Squamous Cell Carcinoma (OSCC) cases compared with Fibro Epithelial Polyp (FEP) controls

5.1 Introduction

Knowledge of the aetiology of many cancers has been widening in recent decades due to the discovery of oncogenic viruses and recognition that infection-related inflammation can play a significant role (7, 178). Indeed, it has been suggested that infections may explain up to 15% of oral cancer cases (35), which cannot be explained by well- established risk factors such as smoking, smokeless tobacco usage, betel quid chewing , areca nut consumption, other socio-cultural risk factors and HPV infections (206, 361, 404, 405).

The suggestion of a possible causal association between oral candidosis and the risk of transformation of oral potentially malignant disorders (OPMD) dates back to at least 1967 (44, 240) and has been confirmed many times since then (406). Indeed, it has been proposed that Candida albicans plays a significant role in oral carcinogenesis (13).Various, Candida species have been isolated abundantly from the mouths of patients with OSCC compared to controls and fungal hyphae are often described within the epithelium in histological studies. In an early association study, Nagy et al.1998 found C. albicans colonizing the surface of the neoplasm in 8 of 21 cases (172). In a subsequent study, Candida was isolated in 9 (4, C.albicans and 5 non –albicans) out of 30 cancer surfaces (407). Afterwards, Candida species were isolated from 31(30%) of oral cancers (238). Histological stains disclosed fungal hyphae in 18 (17.5%) of oral cancers and 15 (14.6%) “precancerous” lesions (238). The prevalence of C.albicans in oral cancers was reported as 74% using a fluorescence staining technique in another study (408). Recently, Berkovits et al. 2016 isolated Rhodotorula spp. Saccharomyces species and Kloekera species from surfaces of OSCC (409).

101

Recent metagenomic studies with the advent of NGS have revealed microbial communities of amazing complexity (178).To date, several metagenomic studies have described the association between the bacteriome and oral cancer using NGS, but they have provided inconsistent results (4, 25-27). Nevertheless, bacteria are thought to contribute to oral carcinogenesis via inhibition of apoptosis, activation of cell proliferation, promotion of cellular invasion, induction of chronic inflammation, and production of carcinogens (5, 28-29).

Characterization of the mycobiome in oral rinses from 20healthy individuals in United States was first described by Ghannoum et al. in 2010, using a novel pyrosequencing approach (110). This revealed that the ‘basal oral mycobiome’ consisted of15 genera, mostly Candida (22.2%), followed by environmental fungi; Cladosporium (19.4%), Aspergillus (11.1%), Fusarium (5.6%), Glomus (5.6%), Penicillium (4.2%), Alternaria (4.2%), Saccharomycetales(13.9%),Cryptococcus (2.8%), Ophiosoma (2.8%), Phoma (2.8%), Schizosaccharomyces (2.8%) and Zygosaccharomyces (2.8%) (110). Incidence of fungal infections has been increased in the past two decades especially in immunocompromised patients (77) and the mycobiome has gained attention for its association with hepatitis B (85) and cystic fibrosis (87). Fungal dysbiosis with increased species richness and diversity has correlated with Inflammatory Bowel disease (IBD) patients compared to healthy subjects, thus suggesting a possible role of fungi in aetiopathogenesis of IBD (78). However, there are no published studies using NGS to characterize the mycobiome profile associated with oral cancer to date. This is the first study to use NGS combined with a robust BLASTN-based algorithm to profile the mycobiome of oral squamous cell carcinoma tissues up to species level as an unmatched case: control study. The purpose of this research was to determine the fungi associated with oral cancer in a group of Sri Lankan men in the hope of shedding light on their role in aetiopathogenesis of these cancers.

102

5.2 Materials and Methods

Study design (3.1) and study setting (3.2), history taking and clinical examination (3.7), tissue sampling and DNA extraction (3.8) were done as described previously.

5.2.1 Amplicon Library preparation and sequencing

Amplicon library preparation was performed as described in Illumina’s manual 15044223 Rev. B with one exception: the Q5 Hot Start High-Fidelity 2X MasterMix (New England Biolabs, USA) was used instead of that specified in the manual. In brief, the fungal ribosomal internal transcribed spacer 2 (ITS) was amplified using the primersITS3F(GCATCGATGAAGAACGCAGC)andITS4R(TCCTCCGCTTATTRATA TGC)(410), linked to Illumina’s specific adapter sequences 803F and 1392wR, in standard PCR conditions (Table 5.1) The resultant PCR amplicons (~ 250-590bp) were purified using AgencourtAMPure XP beads (Beckman Coulter, USA). A 2ndPCR was then carried out to tag the amplicons with unique 8-base barcodes using Nextera XT v2 Index Kit sets A-D (Illumina, USA). The tagged amplicons were then pooled together in equimolar concentrations and sequenced on MiSeq Sequencing System (Illumina, USA) using v3 2x300 bp, paired-end sequencing chemistry in the Australian Centre for Ecogenomics according to manufacturer’s protocol.

Table 5.1: Standard PCR conditions

STEP TEMP TIME

Initial Denaturation 98°C 30 seconds

25–35 Cycles 98°C 5–10 seconds

Annealing Temperature *50–72°C 10–30 seconds 55°C

72°C 20–30 seconds/kb

Final Extension 72°C 2 minutes

Hold 4–10°C

103

5.2.2 Processing of sequencing data

The raw data were deposited in Sequence Reads Archive (SRA) under project no. PRJNA375780. Reads with primer mismatches were removed before the primer sequences were trimmed off. Paired sequences were then merged with PEAR (411), using the following parameters: minimum amplicon length-213 bp; maximum amplicon lengths-552 bp; and P-value=0.001. Preprocessing of the merged reads was subsequently performed using the mothur software package version 1.38.1 (412). Firstly, to stringently minimize sequencing errors, reads with ambiguous bases, with homopolymers> 8 bases long or that did not achieve a sliding 50-nucleotide Q-score average of ≥30 were filtered out. Secondly, the high quality reads were cleared of chimeras with Uchime (413) using the self-reference approach(344). Finally, sequences representing non-fungal lineages- identified by preliminary taxonomy using mothur’s classify.seqs command – were removed.

5.2.3 Taxonomy assignment algorithm and down-stream analysis

The high quality, non-chimeric reads were classified to the species level employing a previously described BLASTN-based algorithm, modified to analyze fungal ITS instead of bacterial 16S RNA reads(414). A set of 23,423 fungal ITS sequences representing all named species (16,595 species) in UNITE's database version 7.1 (https://unite.ut.ee/repository.php; August 22/2016 dynamic release; untrimmed sequences)(415)was used as reference. The fasta and taxonomy files of this set can be downloaded by using the link below: http://www.homd.org/publication_data/20170221/. Briefly, the reads were individually BLASTN-searched against the reference set at alignment coverage of ≥ 99% and % identity of ≥ 98.5 %. Hits were ranked by % identity and, when equal, by bit score. The reads were then assigned taxonomies of the best hits. Reads with best hits representing more than one species were screened again for chimeras using de novo check at 98% with USEARCH program version v8.1.1861, and, if proved no to be chimeric, assigned multiple-species taxonomy (416). Reads with no matches at the specified criteria underwent secondary de novo chimera checking as above, and then

104 de novo, species-level operational taxonomy unit (OTU) calling at 98% using USEARCH. Singleton OTUs were excluded; the rest were considered potentially novel species and a representative read from each was BLASTN-searched against the same reference sequence set again to determine the closest species for taxonomy assignment. Downstream analysis was performed as previously described (414). In short, the QIIME (Quantitative Insights Into Microbial Ecology) software package version 1.9.1 (373) was employed to perform further analysis including generation of taxonomy plots, rarefaction, calculation of species richness and diversity indices, computing distance matrices, and running principle component analysis (PCoA). Detection of differentially abundant taxa between the cases and controls was done using Linear discriminant analysis Effect Size (LEfSe) (417).

5.3 Results

5.3.1. Sequencing and data processing statistics

Seven samples were ended up with low read counts (<3000) or with very high count (an outlier).The sequencing run generated 1,576,427 raw paired reads. About 14% of these were discarded due to primer mismatches; 96% of the remaining reads were successfully stitched with PEAR. Quality filtration and chimera checking removed around 8% of the merged reads leaving a final of1,063,430 (67.5%) reads, 205-535 bp long. Around 95.7% of these reads from 22 OSCC cases and 25 FEP controls were successfully classified to the species level; 2.3% did not return BLASTN matches and 2% formed singleton OTUs and were thus excluded. The number of classified reads per sample ranged from 3973 to 54849 reads (mean of 21,641±13,942).

5.3.2 Mycobiome profile

A total of 364 species belonging to 162 genera and 2 phyla were detected in the samples. The abundances and detection frequencies of these taxa in each of the samples and across the study group are presented in Supplementary Tables S1-3 (Appendix 5.1-5.3). However, only 125 species and 74 genera were identified in more than one

105 sample; 10 species and 7 genera in ≥ 25% of the samples and 5 species and 4 genera in more than 50%.The number of species per sample ranged from 4 to 29 for the cases and from 8 to 64 for the controls. Mycobiome profile by stacked bars showing the distribution of phyla, top 20 genera and top 20 species are illustrated in Figure 5.1.

Figure 5.1: The Mycobiome profile (The % of average abundances of taxa in phylum, genera and species level)

The abundances of the two phyla identified as well as the genera and species detected in ≥ 15% of the samples are shown inFigure5.1. On average, the phyla Ascomycota and Basidiomycota accounted for 78.4% and 21.6% of the mycobiome, respectively (S1) (Appendix 5.1). At the genus level, Candida was the detected in 100% of the samples and constituted 48% of the average mycobiome. The genera Malassezia,

106

Cladosporium and Aspergillus were identified in ≥75% of the sample with an average abundance of 11%, 6.1% and 3.7%, respectively (S2) (Appendix 5.2). Species-wise, C.albicans was found in all samples at a mean abundance of 44.4%.Malasseziarestricta, Aspergilluspenicillioides and Malassezia globosa were identified in 83%, 70.2% and 68.1% of the samples respectively and accounted for 3.2%, 2.2% and 4.2% of the average mycobiome, respectively. Cladosporium exasperatum and a potentially novel species close to Cladosporium sphaerospermum were also identified in half of the samples at an average abundance of > 2% (S3) (Appendix 5.3). However, the relative abundance of these taxa varied significantly between the samples. In addition, the mycobiome of some of the samples was dominated by taxa other than the above-mentioned. Examples of species abundant in single samples include Rhodotorula mucilaginosa, Sporidiobolus johnsonii, Penicillium toxicarium, Toxicocladosporium irritans, Gibberella intricans, Alternariain fectoria, Ophiocordyceps sinensis, Aspergillus tamarii as well as a number of potentially novel taxa.

5.3.3 OSCC vs FEP

5.3.1 α-Diversity (Summary statistic of a single population)

The number of species per sample varied from 4 to 29 for cases and 8 to 64 for the controls.

Table 5.2: Species richness, α-diversity and coverage (mean±SE) calculated from the rarefied biom.

Group Observed Chao1 Shannon Good’s

richness index coverage

OSCC 11.7±6.4 13.6±7.0 1.5±0.9 0.999±0.000

FEP 17.7±9.8 19.9±12.2 2.1 ±1.2 0.999±0.001

107

Accordingly, the two groups were clearly different in terms of species richness (p<0.001), α-diversity (p<0.001) and coverage (Table 5.2), as these metrics were markedly higher in FEP controls, when compared with case.

5.3.2 β diversity (Summary score between population) and Rarefaction

Figure 5.2: Rarefaction and β=diversity

According to rarefaction curves, species richness and diversity markedly higher in controls compared with cases and show that as few as 1,500 reads per sample denoted sufficient sequencing depth (Figure 5.2A). Besides, in the PCoA, no separate clusters formed for cases and controls as many taxa were shared by both groups (Figure 5.2 B).

108

5.3.3Differentially abundant taxa by Linear Discriminant Analysis Effect Size

(LEfSe)

Figure 5.3: Differentially abundant taxa. Linear Discriminant Analysis Effect Size (LEfSe) analysis showing genera (A) and species (B) that was significantly differentially abundant between the cases and controls (LDA score≥ 3). Mann-Whitney test p<0.001

The genera and species which demonstrate striking difference of abundance in OSCC cases and FEP controls are indicated in Figure 5.3.Presence of genera; Candida, Hannaella and Gibberella are significantly more abundant in OSCC. In contrast, Trametes and Alternaria were strongly associated with FEP. At the species level, Candida albicans, Candida etchelliiand a potentially novel species similar to Hannaella luteola were significantly abundant in OSCC. The keystone species, C. albicans was identified in 100% of samples. Nevertheless, the relative abundance in OSCC was twofold higher (61.2%) than the controls (29.6%). Furthermore, C. etchellsii was identified in 32% of the cases compared to only 8% of the controls. Conversely, a 109 potentially novel Hanseniasporauvarum-like species, in addition to M. restricta, A. tamarii, Cladosporium halotolerans, Alternariaalternata and Malassezia furfur were enriched or even exclusively found in FEP (Supplementary Table 4) (Appendix 5.4) for a list of taxa exclusively found in either group at prevalence ≥ 10%).

5.4 Discussion

To this researcher’s knowledge, this is the first study to explore the mycobiome associated with oral cancer. Use of Illumina’s 2x300 bp sequencing chemistry followed by merging of paired reads ensured full ITS2 amplicons were obtained and thus maximized taxonomic resolution in the present study. This, in addition to limiting the reference set to sequences from named species only, enabled classification of reads to species level. A percentage identity threshold of 98.5% (i.e. similar to that used to generate species hypothesis in UNITE’s dynamic release) and high query alignment coverage (≥ 98%) cutoff were used to increase the reliability of taxonomic assignment and eliminate the possibility of forced classifications by BLASTN. However, this approach carried the risk of assigning reads belonging to species not represented in the reference set to another closely related species. Around 65.6% (239 out of 364) of the species identified were found in single samples suggesting that they might represent transient environmental fungi. Although the scope of the current study was different from that of the previous two oral mycobiome studies in which salivary samples from healthy subjects were analyzed, some comparisons can be made. Ghannoum et al. 2010 (110), using a relative abundance cutoff of 1% and identified 101 species in their samples. Applying the same cutoff to the samples in this present study, 137 species, this is comparable. They also described a basal mycobiome comprising 13 taxa that was present in ≥ 20% of the subjects. Consistently, 7 of these genera, namely Candida, Aspergillus, Cladosporium, Alternaria, Cryptococcus, Gibberella and Saccharomyces were detected at the same cutoff (i.e. ≥ 20%) in cases or controls. Interestingly, Malassezia, which was not detected by Ghannoum et al.2010 (110) was identified in this study in healthy young subjects as the second most common and

110 abundant fungal genus after Candida. This substantiates the more recent findings by Dupuy et al. 2014 (214), who were the first group to describe this genus in the oral cavity and who actually found it to be more abundant than Candida. The same study described a core mycobiome comprising 14 genera, detected in ≥ 50% of the subjects. Four of these (Candida, Malassezia, Aspergillus and Cladosporium) were also found in more than half of the samples in this current study. Combined, these findings provide evidence for the existence of a resident, core oral fungal community. Candida, specifically C. albicans and C. etchellsii, showed the highest association with OSCC representing key stone species of cases in the present study. In the present study 50% of cases were found to be practicing less optimal methods of tooth cleaning and that may be the cause of almost 27% of OSCC cases with poor oral hygiene status compared with 12% of FEP controls. An association between poor oral hygiene and candidiasis is well known (418). In fact, candidiasis has for long been proposed as a risk factor for malignant transformation of oral potentially malignant disorders, including leukoplakia (406). Some strains of C. albicans have high nitrosation potential and have been experimentally shown to induce dysplasia (419). Recently, there is increasing evidence of the association between Candida infection and OSCC (420). Nagy et al. 1998 (172) recovered C. albicans from the surface of 8 out 21 neoplasms, but from none of the control tissues (172). Similarly, Čanković et al. 2010 isolated Candida from 9 (4C. albicans and 5 non–albicans) of the 30 cancer surfaces but from only two of their benign control samples (407). Gall et al. 2013 identified Candida species in 31 out of 48 (65%) oral cancer cases, but the study did not include healthy tissue samples for comparison (238). More recently, Berkovits et al. 2016 isolated Candida species at higher frequency from control tissues than from OSCC, but the “fungal burden” was higher in OSCC (409). In the present study, C. albicans was detected in 100% of the samples, which is probably a reflection of the much higher sensitivity of NGS compared to culture techniques used in previous studies. The difference between the cases and controls in the material used here was in terms of relative abundance (average of 61.2% vs. 29.6%), indicating that a fungal community dysbiosis characterized by overall simplification with increased abundance of C. Albicans was associated with OSCC.

111

C. etchellsii was identified in 32% of the cases vs. 8% of the controls. This is the first time a specific Candida species other than C. albicans has been implicated in oral cancer, a finding worth further investigation. Hannaella and Gibberella species were also overrepresented in OSCC tissues. These species are typically found on plants as commensals and pathogens, respectively (421, 422). In the present study, 27% of cases were consumers of local beverages-toddy and kasippu which made from ingredients of plant origin, when compared with nearly 5% of controls. Therefore, these fungal species probably represent contaminants of the OSCC due to this risk habit rather than members of the oral mycobiome community especially given that they were found in only one control sample. However, their contribution to the carcinogenic process cannot be excluded; in fact one Gibberella species (G. moniliformis) produces a mycotoxin that has been shown to induce liver cancer in rodents (423). Species belonging to Malassezia, Aspergillus, Alternaria, Cladosporium and Hanseniaspora were significantly enriched or exclusively found in the controls. Malassezia speciesare normal colonizers of healthy skin (424) and have been recently found to be dominant members of the salivary mycobiome (214). Aspergillus, Alternaria, and Cladosporium have also been described as core oral fungal taxa (110, 214). Interestingly, some species of these genera, including C. cladosporioides, A. tamarii and A. alternata, which were identified as key stone species of controls are known to produce secondary metabolites with anticancer activity (425-428). The calphostins are one of a group of perylenequinones isolated from C. cladosporioides and have been shown to inhibit cervical cancer HeLa-S3cellsand breast cancer MCF-7 cell lines (429, 430) and calphostins C induced apoptosis in acute lymphoblastic leukemia(431). A.tamarii was able to produce statin a fungal polyketides with anticancer activity. In addition, statins produced by A. tamari have been shown to inhibit growth of C. albicans, which possibly explains why all samples with high abundance of this species had very low levels of C. albicans(432) (ST3) (Appendix 5.3). Interestingly, it has been revealed that production of potent anti-cancer agent lapachol can be produced by A. alternata(433). Furthermore, according to Bladt et al. 2013 (429), Talaromyces spp. exclusively found in our FEP controls are reported to produce γ pyrone compounds enriched with anti-cancerous properties (ST4) (Appendix 5.4).

112

Therefore, while these species may simply represent transient environmental fungi or passenger oral fungal taxa, it is also possible that carriage of some of these species confers some protection against development of oral cancer. Further research to explore these scenarios is thus justified in order to harness their potential for novel prevention and control strategies. The first epidemiological evidence of fungal dysbiosis dominated by C. albicans with decrease species richness and diversity, when compared with FEP controls has been revealed in the present study. There was a significant difference (p<0.05) in consumption of fruits and vegetables of cases and controls as FEP consumed more varieties of fruits and vegetables (Table 5.3). Increased consumption of fruits and vegetables might influence the elevated species richness and diversity to a certain extent in controls. Nevertheless, fungal dysbiosis associated with inflamed mucosa in Crohn’s disease with increased species richness and diversity compared with non-inflamed mucosa has been reported previously (222). Inflamed mucosa was enriched with C. albicans, Candida tropicalis, Gibberella moniliformis, Alternaria brassicicola and Cryptococcus neoformans. Nevertheless, the increased diversity may be due to excess mucin secretion of inflamed tissues (434) which may facilitate the adhesion of transient fungi but they may not associate with Crohn’s disease. Thus, interpretation of increased species richness and diversity needs to be done cautiously and further studies are warranted to explore the consistency of this finding. In the present study, no separate cluster formation of cases and controls was observed, suggesting that the oral mycobiome was not sufficiently distinct between OSCC cases and FEP controls. The reason may be due to degree of similarity of many fungal species identified in cases and controls yet in different relative abundances. Moreover, all of cases and the majority of controls belonged to low socio economic status with more or less similarities in diet, risk habits and life style consider as some factors attribute to composition and structure of oral mycobiome (55, 132).This may be due to the fact that, majority of cases as well as controls came from Sabaragamuwa province, primarily agricultural rural areas in the country such as Ratnapura and Kurunegala (Table 5.4). Nevertheless, key-stone species differentially abundant in case and controls may be explained by differences in immune status, disease condition and oral hygiene status

113 which regard as other factors responsible for colonization patterns of the oral mycobiome (55, 132). The findings of the present study as discussed above should be interpreted cautiously in the light of following limitations. Contamination of tissue samples by saliva cannot be entirely excluded although great care was taken during biopsy to avoid this, and all biopsies were blotted with fresh gauze immediately after excision. Not performing surface contamination by swabbing the lesions/tissues with 70% alcohol to get rid of salivary contamination without affecting the internal tissue microbial flora. No modifications to maximize DNA extraction from fungi per se were performed.Approximately, 10% of samples had <1, 260/230 ratios at the time of sequencing, suggestive of the presence of inhibitors. Nevertheless, these samples amplified successfully after dilution. Furthermore, a few reads were detected in the control sample, while having negligible effect on the results, suggests some sort of contamination at some stage of the laboratory work. The latter could have been due to contamination of the DNA extraction or sequencing reagents by extraneous organisms, now known to be a problem around the world (402, 403). Exclusively, the sub sample selected for exploration of mycobiome represented the fast majority of OSCC cases in Sri Lanka. Nevertheless, majority of cases and controls came from Sabaragamuwa province with more or less similar socio economic status including food habits and risk habits. Hence, it is reasonable to assume the distinct differences observed in mycobiome profile of OSCC cases were mainly due to disease condition. Thus, further cohort studies are much warranted with large sample sizes and rigorous methodology to identify transformation of normal to cancer mycobiome. There must be cross validity of data from cases and controls to exclude confounding factors.

In conclusion, the present study has revealed a dysbiotic mycobiome with low species richness and diversity, dominated by C.albicans at the advancing margin of lesions of OSCC cases compared with depth of lesions of FEP controls. Besides a number of fungal taxa previously identified as producers of anti-cancerous compounds were exclusively found in FEP controls. Hence, further studies warranted to the interesting findings of the present study and to explore for use as risk markers for control and prevention of OSCC.

114

CHAPTER 6:Detection of HPV, EBV and HHV 8 in oral squamous cell carcinoma (OSCC) tissues in a group of Sri Lankan Patients by Polymerase Chain Reaction (PCR) 6.1 Introduction

In 2008, the estimation of global cancer incidence due to chronic infections with viruses, bacteria and micro parasites is calculated at approximately 16% of all cases, subjected to geographic variations and in developing countries it is estimated to be as high as 23% (288, 435). Head and neck squamous cell carcinomas (HNSSC) consist of related group of cancers that include oral cavity, pharynx (oropharynx, nasopharynx, hypopharynx) and larynx(7). Human papillomavirus (HPV) is well established as an etiological agent in the development of cancers of the oropharynx. especially palatine tonsils and base of the tongue ICD 10 [International Classification of Diseases,10th Revision] Codes C01 and G09 - C10 (278). The prevalence of HPV in OSCC is relatively high among men aged 40- 65yrs, with higher socio economic status, exposed to more sexual partners and practicing oral sex compared to HPV- negative Head and Neck Squamous Cell Carcinoma (281-288, 435). Moreover, HPV related HNSCCs have unique biology, and differentiation of these malignant tumours from non-HPV related HNSCCs is important as they have better clinical outcomes (281-283). Presence of HPV in these malignant tumours also represents a public health issue- the need for comprehensive HPV vaccination programs and patients counseling of patients about disease and prognosis. Therefore, the detection of HPV has not only prognostic value for treatment regimens suitable to malignant tumour biology but also an epidemiologic value as well (282, 283).

HPV is a member of the papovaviridae family and more than 120 sub types have been identified, 33% of which are capable of infecting the human genital tract (290). Of these high risk sub types, HPV16 and HPV 18 are associated with cervical, anogenital, oropharyngeal and oral cancer(288, 435). The two viral oncoproteins of high risk HPVs, (E6 and E7) promote tumour progression. E6 inactivates p53 and E7 inhibits retinoblastoma (pRb) tumour suppresser gene products (282).

115

The prevalence of HPV infection in OSCC is reported to range from 17% - 85%, varying by geographic/population specificity, anatomical site, gender, age and method of detection (23, 299). Moreover, the prevalence of HPV in Sri Lankan OSCC patients has been reported previously. In a study conducted by In 2003 Jayasooriya et al. 2003 (23) to investigate the prevalence of HPV of OSCC in Sri Lanka with clinic- pathological parameters, using PCR and direct cycle sequencing , HPV was detected in 37.0 % of samples. Total sample size was 102 (68 FFPE and 34 formalin–fixed unembedded specimens). Overall the sample had a 4: 1 proportion of males to females. Moreover, OSCC cases infected with HPV occurred in roughly equal numbers of patients > 60 yrs and < 60 yrs of age (23). Regarding the site specificity, 37% of buccal mucosa and 50% of tongue cancers harboured HPV. HPV prevalence was 47.6% and 34.6% for females and males respectively. Based on these findings, this study suggested the possibility of HPV contribution in a multifactor model, as a causative agent of OSCC in Sri Lanka (23).

In another study performed using a single PCR assay and sequencing to detect HPV, HSV and EBV in OSCC patients in Sri Lanka and seven other countries, 6 (30%) out of total of 20 Sri Lankan OSCC patients of mean age of 59.10 yrs were infected with HPV. The cancers detected in the tongue (n= 3) (15%), floor of the mouth (n=2) (10%) and other locations including palate, buccal mucosa, lip, gingiva, mandible, alveolus, larynx, maxillary sinus, tonsil, labial sulcus and jaw 15 (75%). However, no firm conclusion was made regarding the relationship between alcohol, tobacco and viral infections (24).

Another case control study (25) was undertaken to explore the serological evidence of the role of oncogenic types of HPV types 16 and 18 in oral and pharyngeal cancer in Sri Lanka using serum samples of 78 oral and pharyngeal cancer (OPC) patients and 51 non cancer controls. In this previous study it was found that HR- HPV16 and/ or HR-HPV18 seropositivity of was 32% for OPC, 24.53% of oral cancer and 2% of non-cancer control subjects (436). Moreover, this prototype study in Sri Lanka indicated a significant risk of 15 fold in developing OPC due to HPV16/18 seropositivity after eliminating variability of other factors such as risk habits (436).

116

At present the molecular detection of HPV DNA is considered as the gold standard(437).Several primer combinations amplifying DNA fragments from various regions of the HPV genome have been used to detect HPV from clinical samples (438). Thus, numbers of amplification techniques have been evolved for the detection of HPV- DNA(439). It has been revealed that nested PCR using consensus primers MY09/MY11 which amplifies a 450 bp fragment of the L1 region, and GP5+/GP6+, which amplifies a 150- bp fragment is considered as a more sensitive technique to detect a wide range of known and novel HPV types (440). Thus nested PCR techniques are superior than single PCR to detect HPV in fresh oral tissue samples (441).

Epstein- Barr virus (EBV) which also known as human herpes virus - 4 (442), is a γ- herpes virus which is widespread in all areas of the world (443). Moreover, this virus exhibits tropism for B lymphocytes and epithelial cells of the upper aero digestive tract. Approximately 90-95% of the global adult populations are seropositive carriers of EBV throughout their lives (442,444,445). However, depending on geographic and immunological heterogeneity, EBV is oncogenic in some individuals (443). Interestingly, EBV latent protein membrane 1 (LMP1), which is an active trans membrane receptor, appears to facilitate malignant transformation by triggering the nuclear –factor- kappa B (NF- K B), c- jun N-terminal kinase (JNK) and phosphatidylinositol 3- kinase (P13K)/ AKT signaling pathways (446). Thus, this virus is known to cause infectious mononucleosis and also human lymphoid and epithelial cancers such as Burkitt’s lymphoma, gastric cancer, T cell lymphoma, Hodgkin’s disease and nasopharyngeal carcinoma (435, 447, 448). Furthermore, EBV has been categorized as a group I carcinogen by the International Agency for Research on Cancer (444). There is a dearth of information on pathogenic role of EBV in OSCC (288, 449). It is uncertain whether the presence of EBV in oral squamous cell epithelium initiates /progresses oral carcinogenesis, or if subsequent changes in neoplasm facilitates EBV infection (450, 451). Nevertheless, a substantial number of published case control studies provide conditional evidence of a considerable association between EBV and OSCC (51, 452-455). Several EBV proteins have been identified in OSCC tissues which links with the tumour phenotype (449). During the past decade, several studies on EBV have been conducted and the prevalence of EBV in OSCC cases has been revealed to vary greatly

117 from 15% - 82.5%(24, 51, 449, 451, 455-462). In contrast, a few studies have reported the total absence of EBV in OSCC samples (463, 464). In these studies, molecular techniques such PCR and in situ hybridization and microarray analysis have been used to detect EBV. The high detection rates may be due to contamination of oral biopsies with saliva as a high proportion of individuals shed EBV in their saliva, which could contribute to misinterpretation of results. Furthermore, inconsistency in EBV prevalence among studies may be due marked heterogeneity in studies due to inherent limitations in collection of specimens, DNA extraction, selection of gene target, detection method, analysis and interpretation of results (449). A multi-country study which included Sri Lanka was undertaken to investigate co- viral infection (HPV, EBV, and HSV) in 155 FFPE OSCC specimens of tongue, floor of the mouth, palate, buccal, lip, gingiva, mandible, alveolus, larynx, maxillary sinus, tonsil, labial sulcus and jaw. This study employed nested and semi-nested PCR, 55% of total samples were positive for EBV, with the highest prevalence (80%) in the United Kingdom. In the same study the prevalence of EBV in Sri Lankan OSCC patents was 35% and co infection with HPV and EBV was 15% (24). In the same study, 35% of Sri Lankan OSCC patients were reported as smokeless tobacco users. Apart from this study, there have been no other published studies on prevalence of EBV in Sri Lankan OSCC patients.

There evidence for possible association between the presence of EBV and tobacco usage in nasopharyngeal carcinoma (465, 466). In a case- control study conducted using data from by Xu et al.2012 (467) in Guangdong province, China, it was revealed that both cigarette smoking and EBV seropositivity were independent risk factors for NPC and being a cigarette smoker was a strong predictor of EBV seropositivity (465). It has been demonstrated the cigarette smoke extract was able to promote EBV DNA replication in EBV positive Alkata, CNE2 and B95-89 cell lines and upregulated not only the early transcription factors Zta and Rta but also the lytic- phase late genes BFRF3 as well as gp(465). Consequently, tobacco may act as an inducer of recurrent EBV reactivation which could lead to genome instability and accelerate tumour progression in NPC (466), In oral cancer, the direct oncogenic effects of tobacco via DNA damage has been well established. Interestingly, in a case control study conducted by Nasher et al. 2014 (468), with 60 cases of OSCC and age/ gender matched 120 controls, to investigate the viral

118 infection and oral habits as risk factors for OSCC, nearly 2-fold higher odds ratio was found in the Shammah users/EBV- positive group compared to the Shammah users/EBV- negative group (468). Thus, further studies with adequate sample size are needed to find out the association between tobacco usage and activation of EBV infections in oral cancer with controlling for confounding factors.

Human herpes virus 8 (HHV 8) is an oncogenic virus, better known as Kaposi sarcoma (KS)- associated herpes virus KSHV and was first identified in a KS lesion through representational difference analysis in 1994 (469). This is a γ-herpes virus which is related to EBV. KS is considered to be the commonest HIV-associated malignancy in the world (470). Furthermore, HHV-8 is the etiological agent of uncommon neoplasms such multicentric Castleman’s disease (MCD) and primary effusion lymphoma (PEL) typically associated with HIV infected patients (276, 299,471). Molecular pathological evidence revealed mechanisms of tumorogenisis of HHV -8, via molecular mimicry, viral encoded proteins are said to activated several cellular signaling cascades whilst evading immune surveillance (276).

There are very few published data on involvement of HHV-8 in OSCC patients. In a study conducted to access the viral involvement and chemical factors with oral cancer in Taiwan, of 37 paraffin wax embedded OSCC biopsies, HHV -8 was not detected in any sample (472). In another preliminary investigation of viral associations on HIV- positive head and neck carcinoma patients,HHV-8 was detected in one of 21 tumours, with distinct focal and nuclear staining using (IHC) Immunohistochemistry (473).

Against this backdrop, the present study was designed to assess the HPV, EBV and HHV-8 status in a group of Sri Lankan male, oral squamous cell carcinoma (OSCC) cases confirmed by histopathological diagnosis, which fulfilled the specific inclusion criteria and a control group of clinically diagnosed FEP.

119

6.2 Materials and Methods

6.2.1 Nested MY/GP+PCR

Data and sample collection was carried out as described in Chapter 3: 3.1-3.8 and DNA extractions from biopsy tissues were performed as described in Chapter 3: 3.9. Then, nested MY/GP+PCR (Table 6.1) were performed as follows. Master Mix was prepared

by adding H2O (12.975 µl), Gene Amp 10x buffer II (1x; 2.5 µl), MgCl2 (3.5 mM final; 3.5 µl), dNTP (Fisher 10 mM each; final 0.2 mM; 0.5 µl), MY09+ (100 µM; final 0.5 µM; 0.20 µl), MY11+ (100 µM; final 0.5 µM; 0.20 µl) and AmpliTaq Gold (250U; final 1U; 0.125 µl). The, PCR assay was set up with a total of 56 clearly labelled tubes (54 samples, positive control and negative control) by adding 20 µl of Master Mix / tube. Next, 5 µl of extracted DNA, 5 µl Negative control (MQ water) and 5 µl HeLa cells (HPV-18 positive cell line) (1:1000) were added separately into corresponding Master Mix tube with 25µl of total volume in each tube.

Table 6.2.1: Primers used for Nested MY/GP+PCR(474)

Primers Sequence Fragment size Targeting region of viral genome

MY09 5’CGTCCMARRGGAWACTGATC3’ 450 pb L1 MY11 5’GCMCAGGGWCATAAYAATGG3’ GP5+ 5TTTGTTACTGTGGTAGATACTAC3’ 150 pb L1 GP6+ 5’GAAAAATAAACTGTAAATCATATTC3’

A total of 40 cycles of amplification of MY+PCR were performed on Eppendorf Master- cycler Gradient PCR machine followed by an initial step of denaturation at 94°C for 10 minutes and each amplification cycle for the GP+ PCR involved steps at 94°C for 1 minute and 30 seconds as well as 48°C for 1 minute and 30 seconds. Then, polymerase chain extension was carried out at 72°C for 2 minutes followed by final extension at 72°C for 4 minutes.

120

6.2.2 β-globin PCO PCR 110417

β-globin PCR with the primers PCO3 and PCO4 was performed to ensure the quality of DNA and to confirm the absence of PCR inhibiting agents (23, 475). This PCR mixture consisted of 5μL of extracted sample of DNA, 0.5 μmol/L of PCO3 and PCO4 primers (Sigma-Aldrich), dNTPs at concentrations of 0.2 mmol/L each (Roche), 1 U of AmpliTaq Gold DNA polymerase, 1× PCR Gold buffer, and 2.0 mmol/L MgCl2 (Applied Biosystems). Analysis of PCR products was done by gel electrophoresis (1.5% agarose gel containing ethidium bromide; SeaKem, FMC bioproducts and Sigma) and amplicons detected using UV light irradiation.

6.2.3 HPV type determination

HPV- positive PCR products (15µl from each) were subjected to purification with the AgencourtAMpure PCR purification kit (Agencourt Bioscience) in a magnetic 96-ring SPRI plate as described previously(475) with a reaction mixture of the purified PCR products together with 3.25 μmol/L of single stranded PCR primer provided by the commercially available kit and BigDye Terminator (Applied Biosystems (475).The thermal protocol consisted of an initial step at 96°Cfor 2 minutes, 20 cycles followed, each with 96°C for 10seconds, 50°C for 5 seconds, and 60°C for 2 minutes. The amplicons were purified with the AgencourtCleanSEQ dye-terminator removal kit (Agencourt Bioscience) in a magnetic 96-ring SPRI plate, and analysed with an automated DNA sequencing machine (ABI model 3100). The DNA sequences obtained were compared with available reference sequences in GenBank through the BLAST server as described previously (475).

121

6.2.4 Real Time PCR for EBV Data and sample collection was carried out as described in Chapter 3: 3.1-3.8 and DNA extractions from biopsy tissues were performed as described in Chapter 3: 3.9 sections. The rt PCR assay was set up to (Table 6.2.2) amplify 106 bp of EBV from primer sequences as described previously (Table 6.2.3). PCR was undertaken on samples (27 cases and 26 controls), with positive and negative controls. A 10- µl volume of each test sample was placed into the wells of a white 384 -well plate in an EppendorfepMotion 5075. rt PCR was then performed using a Quant 6- real -time machine. The thermal cycling parameters used were as follows: an initial hold step designed to activate the polymerase enzyme of 950C for 5 minutes, followed by 45 cycles of amplification (5 seconds denaturation at 950C for 5 minutes followed by 30 seconds annealing 0 0 0 (TM)/extension at 55 C) and melt curve stage of 3 steps (95 C for 10 minutes, 50 C for 10 minutes and 950C for 15 minutes). Overall, the run duration was 72 minutes and 24 seconds. Positivity was determined via rt PCR screen and melt curve analysis.

Table 6.2.2: Quantitative PCR reaction mixture for 384 wells plate

Reaction Mixture Volume (µl) d.H20 768 Master Mix 1920 Forward Primer (2µM) 384 Reverse Primer (2 µM) 384 Total Volume 3456 Aliquot Volume 9 DNA template (sample) 1 Reaction Volume 10

Table 6.2.3: Primers used for rt PCR EBV EBNA-1 assay

Assay Primers Annealing Sequence (5’-3’) Reference Nucleotide Amplicon Temperat sequence Position Length ure (0C) EBV EBNA-1 55 CCGGTGTGTTCGTATAGGAC 98,005- 106 bp EBNA- 01.1 NC_009334 98,025 1 GGGAGACGACTCAATGGTGTA EBNA-1 98,110- 01.2 98,090

122

6.2.5Real Time PCR for HHV 8 Data and sample collection was carried out as described in Chapter 3: 3.1-3.8 and DNA extractions from biopsy tissues were performed as described in Chapter 3: 3.9sections.The rt PCR assay was set up to (Table 6.2.2) amplify 106 bp of HHV-8, from previously published primer sequences as described previously (Table 6.2.4). 10 µl volume from each sample of 54 samples (29 cases and 25 controls) was loaded into the wells of a white 384 on the EppendorfepMotion 5075.rt PCR was performed on a Quant Studio 6- real -time machine with an initial step of hold stage of polymerase activation step at 950C for 5 minutes, followed by 45 cycles of amplification (5 seconds 0 0 denaturation at 95 C for 5 minutes; 30 seconds annealing (TM)/extension at 55 C) and melt curve stage of 3 steps (950C for 10 minutes, 500 C for 10 minutes and 950C for 15 minutes). Overall run duration was 72 minutes and 24 seconds. Amplicon detection was determined via rt PCR screen and melt curve analysis.

Table 6.2.4: Primers used for rt PCR EBV HHV-8 assay Assay Primers Annealing Sequence (5’-3’) Reference Nucleotide Amplicon Reference Temperature sequence Position Length (0C) HHV-8 HHV8- 56 AGCCGAAAGGATTCCACCA 47,287- 234 bp (476) ORF26 26-01.1 TT NC_00340 47,304 HHV8_2 9 6 02.1 TCCGTGTTGTCTACGTCCAG 47,519- A 47,499

Positive control was extracted DNA from saliva from a patient known to be HHV-8 positive which yielded amplicons by RT-PCR.

6.3 Results

The studied patients consisted of 29 cases of Oral squamous Cell Carcinoma (OSCC) confirmed by histopathological diagnosis who fulfilled the specific inclusion criteria and, 25 controls with clinically diagnosed FEP. This was a sub-sample of a main unmatched, case- control study comprised of 134 cases with oral cancer and 134 controls with benign mucosal lesions. Both groups of the present study comprised Sinhala males having OSCC

123 and FEP in buccal mucosa or tongue. Thus, 29 OSCC cases and 25 FEP controls included in detection of HPV.

6.3.1 Socio- demographic profile of study group

Results of distribution of Cases and Controls by Oral &Maxillo-Facial Unit Location, socio demographic profile, risk habits, vegetable/fruit consumption, tooth cleaning habits and clinical indicators are described here.

Table 6.3.1.1: Distribution of Cases and Controls by Oral &Maxillo-Facial Unit Location

Variable Cases Controls n=29 n=25 N % N % OMF Unit location Colombo-National Dental 6 (20.7) 5 (16.0) Hospital (Teaching) Sri Lanka* Base Hospital Panadura 3 (10.3) 1(4.0 ) District General Hospital Kalutara 1(3.5) 3 (12.0) District Hospital Kegalle 8 (27.6) 3 (12.0) Provincial General Hospital Ratnapura Teaching Hospital Karapitiya 3(10.3) 7 (28.0) Provincial General Hospital Badulla 3(10.3) 1(4.0) Provincial General Hospital Kurunegala 4 (13.8) 1(4.0) Teaching Hospital Kandy 0 (0.0) 4 (16.0) 1 (3.5) 1 (4.0)

Total 29 (100.0) 25 (100.0) *Former Dental Institute

Distribution of cases and controls by respective Oral &-Facial Unit location presents by Table 04. Accordingly, 20.7% of cases were from Colombo National Dental Hospital (Teaching) Sri Lanka. Moreover 27.6%of OSCC cases were recruited from District General Hospital Kegalle. In contrast, the majority (28.0%) of FEP controls were recruited from the OMF Unit of Provincial General Hospital Ratnapura.16.0% was recruited from Provincial General Hospital of Kurunegala and National Dental Hospital (Teaching) Colombo respectively (Table: 6.3.1.1).

124

Table 6.3.1.2: Distribution of Cases and Controls by Socio-demographic profile

Variable Cases n=29 Controls n=25 p value Age mean ± SD in years 61.62±9.21 49.96 ±13.38 0.0001* (p<0.05)

Gender N % N % Male 29 (100.0) 25 (100) Level of Education N % N % No Schooling 4 (13.9) 1 ( 4.0) 0.171** (p>0.05) Primary Education 9 (31.0) 3 (12.0) Secondary Education 7 (24.1) 10 (40.0) Above Secondary 9 (31.0) 11 (44.0) Education Total 29 (100.0) 25 (100.0) Occupation N % N % 0.014*** (p<0.05) Farmer 15 (51.7) 8 (32.0) Skilled/unskilled manual 12 (41.4) 7 (28.0) categories Clerical/Professional 2 (6.9) 10 (40.0) Total 29 (100.0) 25 (100.0) * t-test to compare means of independent samples ** Fisher’s exact test to compare groups (cell counts <5) *** Chi Square of Statistical Significance Table6.3.1.2 presents the socio-demographic profile of OSCC cases and FEP controls. The mean ± SD age of cases was 61.62±9.21 years whereas the mean ± SD age of the controls was 49.96 ±13.38 years and this difference in age groups was statistically significant (p<0.05). This could be attributed to typical older age group of males affected by OSCC compared to relatively younger age group of males who presented with FEPs (Table: 6.3.1.2).Moreover, a higher proportion of cases with OSCC reported lower levels of educational attainment. A higher level of education was reported for control patients (secondary education or higher compared with OSCC patients (no formal education or attaining primary education) (Table: 6.3.1.2). However, these difference in level of education attained among cases and controls was not statistically significant (p>0.05).

125

Moreover, farmers and skilled/unskilled other manual categories dominated the cases by occupation whereas there was somewhat equal groups as farmers, skilled/unskilled manual categories and more clerical/professional groups among controls, thus making these differences statistically significant (p<0.05). In overall, OSCC cases were older males of low educational attainment and occupational status compared to control group males (Table, 6.3.1.2).

Table 6.3.1.3: Age categories of cases and controls of present study

Age Category Cases Controls Total N (%) N (%) N (%) 28-39 years 0 (0.0) 6(24.0) 6 (11.1) 40-59 years 10 (34.5) 13 (52.0) 23 (42.6) 60-83 years 19 (65.5) 6 (24.0) 25 (46.3) Total 29 (100.0) 25 (100.0) 54 (100.0)

Table 6.3.1.3 presents the age categories of cases and controls. Accordingly, the majority (65.5%) of cases were older males aged 60-83 years. In contrast, the majority 52.0% controls were relatively younger males belonging to 40-59 years.

126

Table 6.3.1.4: Distribution of the Cases and Controls byRisk Habit Profile & Daily Vegetable & Fruit Consumption

Variable Cases Controls p-value n=29 n=25 N % N % Betel Chewing Habit Never 0 (0.0) 4(16.0) 0.003* (p<0.05) Past 5 (20.0) 2(8.0) Sometimes 1(4.0) 7 (28.0) Daily 23(76.0) 12 (48.0) Total 29 (100.0) 25 (100.0) Smoking Habit Never 5 (17.2) 8(32.0) 0.418* (p>0.05) Past 8 (27.6) 6(24.0) Sometimes 4 (13.8) 5(20.0) Daily 12(41.4) 6 (24.0) Total 29 (100.0) 25 (100.0) Alcohol Consumption Never 3 (10.3) 3(12.0) 0.001* (p<0.05) Past 6(20.7) 2(8.0) Sometimes 4(13.8) 16 (64.0) Weekly 16 (55.2) 4 (16.0) Total 29 (100.0) 25 (100.0) Daily Vegetable Consumption

* Fisher’s Exact test Table 6.3.1.4, presents the risk habit profile: betel chewing, smoking and alcohol consumption among cases and controls as well their daily vegetable and fruit consumption assessed as <5, ≥5 portions. Accordingly, the overwhelming majority (76.0 % of OSCC cases were daily betel chewers and 20% reported past betel chewing habit. Moreover, 48.0% of FEP controls were daily betel chewers as well. Among controls, 28.0% chewed betel occasionally. Compared to controls the majority of cases chewed betel daily and these differences were statistically significant (p<0.05). Moreover, 41.4% of cases and 24.0% of controls smoked on a daily basis. Compared to controls, cases were ever smokers but these differences were not statistically significant (p>0.05). With regards to alcohol consumption the majority (55.2%) of cases was weekly drinkers of alcohol whereas the majority (64.0%) of controls was occasional alcohol consumers. Overall, despite both groups were being alcohol consumers, cases reported a significantly higher weekly drinking of alcohol (p< 0.05), (Table 6.3.1.4).

127

6.3.1.5:Distribution of Cases and Controls by tooth cleaning habits & clinical indicators

Variable Cases Controls p-value n=29 n=25 N % N % Tooth cleaning habit Tooth brush & tooth paste 14(48.0) 24 (96.0) 0.0001* (p<0.05) Finger & charcoal/tooth powder 1( 3.5) 0(0.0 ) Brush with toothpaste/charcoal 10 (34.5) 0 (0.0) Finger with charcoal 2 (7.0) 1 (4.0) Chewing Stick 2 (7.0) 0 (0.0) Total 29 (100.0) 25 (100.0) Missing Teeth mean± SD 10.07±9.95 3.96±4.88 0.007" (p<0.05) Mobile Teeth mean± SD 3.45±3.16 0.44±1.12 0.001" (p<0.05) Decayed Teeth mean± SD 0.79±1.72 1.20±1.85 0.406" (p>0.05) Filled Teeth mean± SD 0.03±0.19 0.16±0.47 0.193" (p>0.05) Oral Hygiene Status# Good 3(10.3) 13 (52.0) 0.004* (p<0.05) Fair 20(69.0) 9 (36.0) Poor 6(20.7) 3 (12.0) Total 29 (100.0) 25 (100.0) Periodontal Disease Status## Mild 4(13.8) 17 (68.0) 0.0001** (p<0.05) Moderate 15(51.7) 6 (24.0) Severe 10(34.5) 2 ( 8.0) Total 29 (100.0) 25 (100.0) Site Affected Buccal Mucosa 19(65.5) 21 (84.0) 0.122** (p>0.05) Tongue 10 (34.5) 4 (16.0) Total 29 (100.0) 25 (100.0) Histopathology Well-differentiated SCC 15 (51.7) 0 (0.0) NA Moderately-differentiated SCC 14(48.3) 0 (0.0) Fibro-Epithelial Polyps (FEP) 0 (0.0) 25 (100.0) Total 29(100.0) 25 (100.0) # classified according to Simplified Oral Hygiene Index (OHI-S) of Green & Vermillion 1964.

##Case Definitions for Periodontitis developed by Centre for Disease Control (CDC) Periodontal Disease Surveillance Workgroup (Page and Eke, 2007)

“t-test for independent samples

* Fisher’s Exact Test of Statistical Significance

** Chi-Square Test of Statistical significance NA-Not Applicable Table 6.3.1.5, presents the distribution of cases and controls by tooth cleaning habits and an array of clinical indicators. Accordingly, the overwhelming majority (96.0%) of cases used toothpaste and manual tooth brushing for tooth cleaning while the majority of OSCC cases reported less optimal methods of tooth cleaning such as use of finger and charcoal/tooth powder and use of charcoal with the tooth brush. Furthermore, 7% of cases used to chewing stick to clean teeth while none of the controls used this method. This difference was statistically significant (p <0.05), (Table 6.3.1.5). Furthermore, OSCC cases had significantly more missing teeth and mobile teeth compared to FEP controls (p<0.05) (Table 6.3.1.5).

128

Interestingly, this scenario was further evident from oral hygiene status assessed by OHI- S (Green & Vermillion, 1964) as 20.7% and 69.0% OSCC cases had poor and fair oral hygiene status respectively compared to 12.0% and 36.0% FEP controls in those two categories respectively. The differences in oral hygiene status among cases and controls were statistically significant (p<0.05), (Table 6.3.1.5). Furthermore, OSCC cases reported a significantly severe and moderate periodontal disease status (34.5% and 51.7% respectively) compared to FEP controls as only 8.0% had severe periodontal disease while 24.0% were categorized into moderate periodontal disease using case definitions for periodontitis developed by Centre for Disease Control (CDC) Periodontal Disease Surveillance Group by Page and eke 2007, (Table 6.3.1.4). These differences were statistically highly significant (p<0.05).

Furthermore, there was no significant difference (p>0.05) among OSCC cases and FEP controls with regard to site affected as among both group buccal mucosa was the most involved. Nevertheless for OSCC nearly 2/3 was from buccal mucosa while 1/3 involved tongue. For FEP the overwhelming majority (84.0%) affected buccal mucosa. (Table 6.3.1.5) According to Histopathology, the OSCC were well differentiated OSCC (51.7%) and moderately-differentiated OSCC (48.3%).

6.3.2 Detection of HPV status

Overall 4/54 (1.4 %) of HPV was detected in frozen tissue samples of 29 OSCC cases and 25 FEP controls by nested My/GP + PCR. Thus, HPV was not detected in 50/54 (92.6%) of frozen tissues (Table 6.3.2.1).

129

Table 6.3.2.1: Distribution of β-globin positive and negative amplicon production status of the samples

Status Total βglobin positivity βglobin negativity

Cases2927/29 (93.1%) 2/29 (6.9%)

Controls25 18/25 (72.0%) 7/25 (28.0%)

Overall 54 45/54 (83.3 %) 9/54 (16.7%)

Table 6.3.2.1, presents the descriptive statistics of β-globin positivity of 29 cases and 25 controls. Total of 83.3 % of samples tested were positive for β-globin with 93.1% and 72.0% for OSCC cases and FEP controls and confirmed the presence amplifiable cellular DNA and absence of PCR inhibitors

Table 6.3.2.2: The distribution of Cases and Controls by HPV Status

HPV Status Cases n=29 Controls n=25 Total N (%) N (%) N (%) Positive 1*(3.5) 3**!(12.0) 4(7.4) Negative 28 (96.5) 22 (88.0) 50(92.6) Total 29(100.0) 25 (100.0) 54(100.0) * OMF Unit D, National Dental Hospital (Teaching) Sri Lanka, site -tongue

**OMF Unit, District General Hospital, Kegalle (1)/OMF Unit, Provincial General Hospital, Ratnapura(2)

! Mean age, 47.00 ±11.14

As demonstrated in Table 6.3.2.2, of the total of 54 tissue samples 4 (7.4%) were positive for HPV (Figure 6.3.1). Among the OSCC cases (n=29), only 1 (3.5%) was positive while among FEP controls (n=25), 3 (12.0%) was positive for HPV (Figure 6.3.2). Moreover, the HPV positive case of OSCC presented to OMF Unit D, National Dental Hospital (Teaching) Sri Lanka. Of FEP controls which tested positive for HPV, one (01) presented to the OMF Unit, District General Hospital (Kegalle) while two (02) presented to the OMF Unit, Provincial General Hospital, Ratnapura.

130

HPV status

4 HPV positive HPV negative 50

Figure 6.3.1: HPV status in Overall samples

6.3.3 Identification of HPV types

Five HPV types and one HPV species were identified in four HPV positive subjects, with one subject infected with multiple HPV types (Table6.3.3).

Table 6.3.3: Summary of HPV types present in subjects

Subjects HPV type

Case 41HPV-12 , 1/54 (1.8 %)

Control 32HPV-42, 1/54 (1.8%)

Control 11 * HPV-32, 1/54 (1.8%) , HPV-42, 1/54 (1.8 %)

^HPV-31, 1/54 (1.8%), HPV-44, 1/54 (1.8%) Control 1^HPV α9, 1/54 (1.8%)

Table 6.3.3 presents the HPV types detected in each subject who was infected with HPV. Four subjects of present study including one OSCC case and three FEP controls were infected with six HPV types. One FEP control (Control 11) carried multiple HPV types, HPV-32, HPV-42, HPV-31 and HPV-44. High risk HPV types α9 and 31were identified in each 1.8% of subjects of total of 54. Low risk HPV types 12, 32, 44 were found in 1.8% of subjects. However, HPV- 42 was found in 3.7% of subjects. The risk profiles are illustrated in Figure 6.3.2.

131

6.3.4EBV status

The result of this study was based on analysis of 29 cases of Oral squamous Cell Carcinoma (OSCC) confirmed by histopathological diagnosis who fulfilled the specific inclusion criteria and 25 controls with clinically diagnosed FEP. This was a sub-sample of a main unmatched, case- control study comprised of 134 cases with oral cancer and 134 controls with benign mucosal lesions. Both groups of the present study comprised of Sinhala males having OSCC and FEP in buccal mucosa or tongue. Extracted DNA from two OSCC cases were excluded due to poor quality DNA. One FEP control was duplicated. Thus, 27 OSCC cases and 26 FEP controls were included for detection of EBV.

Table 6.3.4: Distribution of Cases and Controls by EBV Status

EBV Status Cases n=27 Controls n=26 Total p-value N (%) N (%) N (%) Positive 21 (77.8) 13(50.0) 34(64.2) 0.035*(p<0.05) Negative 06 (22.2) 13 (50.0) 19(35.8) Total 27 (100.0) 26 (100.0) 53(100.0) * Chi-square Test of Statistical Significance.

Table 6.3.4 presents the distribution of Cases and Controls by EBV status. As illustrated in Table 6.3.4 the overall prevalence of EBV among 53 tissue samples was 34(64.2%). Among OSCC cases (n=27) EBV positive prevalence was as high as 21(77.8%) while this prevalence among FEP controls was lower 13 (50.0%) than that for the cases and these differences were statistically significant (p<0.05).EBV status in overall samples (53) is illustrated in Figure 6.3.3.

132

EBV Status

19 EBV 34 Negative EBV Positive

Figure 6.3.3: EBV status in Overall samples

6.3.5HHV-8 status

6.4 Discussion The present study was designed target the predominant group of males affected by OSCC in Sri Lankan context, with regards to age, socio-demographic and risk habit profiles (19). The incidence of cancer of the oral cavity and oro-pharynx in Sri Lanka, excluding salivary neoplasms, standardized to the world standard population in the year 2010, was 20.7 100,000 populations (477). Moreover, present study included OSCC in buccal mucosa and tongue. Furthermore, oncogenic viruses have been implicated with the development of OSCC (275, 478). In contrast, past studies using PCR of tissue samples as well as serological techniques have been used to detect HPV DNA and HPV seropositivity of OSCC patients in Sri Lanka, without stringent criteria (23-25). Moreover, OSCC cases

133 had significantly more missing teeth, higher prevalence of poor oral hygiene and moderate and severe periodontal disease compared to controls (Table 6.3.1.5).

Overall HPV prevalence was almost 7% in the present study. Nevertheless, prevalence of HPV infections in Sri Lankan OSCC patients has reported as 37.2% 30.0 % and 39.4% by Jayasooriya et al.2003 (23) Jalouli et al.2012 (24) and Gunasekera et al.2015 (25), respectively. Furthermore, Jayasooriya et al.2003 (23) as well as Jalouli et al.2012 (24) were able to detect, approximately five fold higher prevalence of HPV infections in Sri Lankan OSCC patients using Formalin fixed paraffin wax embedded (FFPE) /formalin- fixed unembedded specimens and FFPE respectively. Hence, frozen tissues of present study were speculated to contain more viral copy numbers compared with archived samples. In the study conducted by Jayasooriya et al. 2003 (23), consensus primers GP 5+/6+which amplify 140 base pairs in the highly conserved L1 region of the HPV genome, were employed in the PCR as it allows detection of most important HPV sub types (23) by best amplification of single HPV infections compared to multiple infections(474). In contrast, Jalouli et al.2012 (24),used MY09/MY11 primers in the highly conserved L1 region of the HPV genome, to facilitate the amplification of multiple HPV infections (474). As a result, in the presented study, nested MY/ GP+ PCR was used to boost the detection of single as well as multiple HPV infections in OSCC cases compared with FEP controls. Even with these conditions, HPV prevalence in OSCC cases was only 1 (3.4%).Similarly, HPV was not detected in OSCC in the north west region of Philippines (26), where majority (57.7%) was in the age category of 51- 70yrs and in Kerala, India (479), the mean age of males was 60.3%, more or similar to the mean age of OSCC cases in present study(Table 6.4.1), including buccal mucosa and tongue, similar sites included in present study . In contrast HPV was detected in 31.0% of oral cancer in Bangladeshi OSCC cases in a recent study (Shaikh et al. 2017 unpublished data) and anatomical locations of OSCC were not stated to compare the sites of present study (Table 6.1.4.1). Furthermore, 10.8% of HPV prevalence was found in OSCC cases of Taiwan (472). In contrast, HPV prevalence was 49.1% in a study conducted by Gillisonn et al. 2008 (480), among HNSCC in Baltimore and this malignancy was independently associated with several measures of sexual behaviour and exposure to marijuana but not the cumulative measures of tobacco smoking, alcohol

134

drinking or poor oral hygiene. Thus, substantiate the low HPV prevalence in present study as all OSCC cases used to one or more risk habits which were not associated with high HPV prevalence in Baltimore study mentioned by Gillison et al.2008 (480). Nevertheless, this OSCC case was 41 yrs old and affected site was tongue and this is in consistent with findings of previous studies as HPV associated OSCC is common among younger males (481) with OSCC in tongue (23). HPV prevalence of OSCC cases in present study was significantly less than that of HPV prevalence (23, 24) revealed in Sri Lankan OSCC cases previously. This observed difference may be due to inherent limitations and variations in age, gender and anatomical locations of OSCC cases among studies.

Table 6.4.1 Prevalence of HPV in South Asia

Study Jayasooriya et al., 2003 Shaiq et al,. Albano et al.,2017 Laprise et al.,2016 2017 (unpublished)

Country Sri Lanka Bangladesh Philiphines Kerala, India

No: of cases 102 196 201 biopsy samples from 350 163 cases

Mean age/age range ≤ 60 years -48% 54.2 years 50years 16.0% Males 60.3 years >60 years-52% 51-70years 57.7% Females 61.4 years >71 years26.3%

Gender Males-79.4% Males 80% Males 67.5% Males- 56% Females-20.6% Females 20% Females 32.5% Females- 44%

Oral Sub-Sites Buccal-60.8% Oral cavity-31.6% Oral cavity-88 Buccal mucosa 35.2% Tongue-7.8% Oropharynx- 20.1% Larynx-60 Tongue- 21.4% Lips-5.9% Larynx- 36.8% Oropharynx-15 Gum- 23.0% Other-25.5% Hypopharynx- 11.5% Floor of the mouth-8.2% Palate- 4.1% Other- 5.1% Habits Betel chewing Not stated Alcohol & Tobacco use Paan chewing Smoking Alcohol Sample FFPE & FF non FFPE Formalin Fixed& Brush biopsy embedded Fresh Frozen

Detection method PCR & typing PCR & typing PCR &real time qPCR PCR & typing

Positivity 37.2% 21% Not Detected Not Detected (Overall)

135

Prevalence of HPV in OSCC patients less than 60yrs and more than 60yrs reported as 40.8% and 34.0% respectively in Jayasooriya et al. 2003 study (23). Females demonstrated a higher HPV prevalence compared with 34.5 % of HPV prevalence in males. Prevalence of HPV infection by site was the tongue (50.0%), other (42.3%), buccal mucosa (37.1%) and lip (0.0%), according to Jayasooriya et al. 2003(23). Information on risk habits of this study population was not adequately explored except that betel chewing habit of 33.3% of OSCC cases and false positive PCR results were suggested as limitations of this study. Consequently, it may be possible to detect significantly higher prevalence of HPV in Sri Lankan OSCC patients in the study conducted by Jayasooriya et al (23) as it represented predominant as well as minor groups affected by OSCC in Sri Lankan context, with regards to age, gender and anatomical location, obviously reported higher HPV prevalence in OSCC cases. Gunasekera et al. 2015 (25) conducted a matched case control study, in which HPV16/18 seropositivity was reported be 39.4% and 51.1 % for oral cancer, and oro pharyngeal cancer respectively. The age range (from 39-74 yrs) of oral and pharyngeal cancer patients was comparable with the age range (from 40-76 yrs) of OSCC cases in the present study. However, in-house established Enzyme Linked Immunosorbent Assay (ELISAs) to detect anti- HPV 16 and anti-HPV IgG antibodies was employed in this study compared to gold standard technique (PCR) utilized in present study. The, higher prevalence of HPV seropositivity may be due to inclusion of all oral cancer patients, irrespective of site due to antibody detection in serum. Moreover, antibody detection is useful only for initial screening of large number of patients and needs further comprehensive analysis to validate results given the inherent limitation of crosses reactions in this type of serological tests. Antibody responses, mostly IgG, provide a general indication of past exposure to HPV(482)(482)(482). However, HPV DNA detection in present study, indicated the presence of current HPV infections in OSCC tissues and provides more valid information on prevalence of HPV infections typical and predominant group of males affected by OSCC in Sri Lankan context. Interestingly, socio demographic, risk habit of the present study revealed statistically significant associations of older males of low educational attainment and occupational status with OSCC, compared to control group. In addition, statistically significant differences were

136

found in betel quid chewing, alcohol consumption and consumption of <5 portions of fruits and vegetables of OSCC cases compared with FEP controls. These factors are considered as well established risk factors for OSCC (2, 4, 12, 22, 31, 362, 405, 483-487). Furthermore, missing teeth, mobile teeth, poor oral hygiene status, severe/moderate periodontitis and poor tooth cleaning practices were statistically significantly higher in OSCC cases compared with FEP controls in the present study and these findings are in consistency with previous studies as these factors are revealed as established risk factors of OSCC (31, 488-497). Thus, it is expected to detect comparatively low HPV prevalence in OSCC cases of present study as HPV was not an etiological agent of OSCC cases. HPV associated OSCC comprised of different risk factor profiles compared with non-HPV associated OSCC (480).

Interestingly, the present study revealed HPV infections in 12.0 % of FEP controls. A prevalence of 1.3 % of HPV 16, among healthy individuals was revealed by a recent systematic reviews, though there are geographic and population specific variations, while there are marked heterogeneity in studies due inherent limitations in collection of specimens, DNA extraction, detection method, analysis and interpretation of result (79, 80). This finding substantiates those of the present study, regarding the prevalence of HPV in benign controls. Nonetheless, controls demonstrated nearly a 3-fold increase of HPV positivity than OSCC cases despite very low prevalence of HPV among cases and controls which makes questionable statistical comparisons. This may be due to the statistically significant difference between the mean age of cases compared with controls in present study. The mean age of controls infected with HPV was 47.00 ±11.14 years, much younger than that of cases with mean age of 61.62±9.21. Interestingly, it has been revealed that HPV associated OSCC common among younger men (481, 498).

After sequencing, HPV-12 was identified in a single OSCC case, 1.8% of total of 54 subjects and this type was detected in skin biopsies of healthy volunteers previously (499), but not in OSCC cases. Thus, possible association of HPV-12 in OSCC cases warrants further investigation. In the present study, high risk HPV species α-9 (500), andtype31 (288) were identified in two FEP controls (1.8% each), out of a total of 54 subjects. The carcinogenic HPV types: 16, 31, 33, 35, 52, 58 and 67 are reported as

137 members of the HPV (α-9) (288, 501). Consistently, Jayasooriya et al. 2003 (23) identified HPV 16 in FFPE tissues and Gunasekera et al. 2015 (25), came across HPV 16seropositivity in Sri Lankan OSCC patients. It has been suggested that the higher prevalence of high risk HPV types, exclusively HPV 16 might be a contributing factor to oral carcinogenesis mainly in younger individuals (498). Moreover, HPV 16 and HPV 31 have been associated with the development of cervical cancer (502). Nevertheless, further studies are needed to explore the possible role of these types in development and progression of OSCC. The presence of low risk HPV types 32, 42 and 44 and multiple HPV infections in intra oral FEP controls in Sri Lankan patients was detected for the first time in the present study and further studies are much warranted to find out the consistency of these findings.

Interestingly, FEP controls, infected with HPV were residents of Sabaragamuwa Province. Socio demographic factors and risk habits of these individuals were more or less similar to other subjects in the control group. Against this back drop, future epidemiological studies are of utmost importance with adequate sample size to find out area specific risk factors which may facilitate infections of benign tumours with HPV, including high risk types.

The present study was targeted for detection of EBV in a cohort of OSCC case that was deemed to be typical of OSCC cases in Sri Lanka with regards to age, socio- demographic factors, risk habits and anatomical sites (19), as cancer of the lip, oropharynx and oral cavity denotes the number 01 cancer among males in Sri Lanka among all the countries across the globe (477). In addition, to well known risk factors for OSCC, it has been speculated that EBV might play a significant role in oral carcinogenesis (452). Approximately 90-95% of the adult population is reported to demonstrate seropositivity for EBV not necessarily shedding virus in saliva (442, 444,445). To this researcher’s knowledge, this is the first study to report highest prevalence of EBV in OSCC cases in Sri Lanka compared with FEP controls.

In the present study, the prevalence of EBV was 64.2% for overall subjects and significantly higher 77.8% for OSCC cases when compared 50.0% for FEP controls. This difference was statistically significant. This result was similar to the findings of

138 a previous study of 8/22 studies which found significant association of EBV with OSCC enhanced by immuno-compromised status (81). Furthermore, it has been revealed that the global prevalence of EBV in OSCC varied from 0 to 100% with geographic and population specificity (51, 449, 503, 504). Nonetheless, higher EBV prevalence of OSCC cases in present study was strengthened by similar findings of studies conducted in Taiwan (82.5%), Okinawa. Japan 76.6% (458), Yamen -73.3% (468) and Hungary-73.8% (454).Such heterogeneity of findings in other studies, for instance Poland- 26.1% (504), Norway/UK/Sweden - 55% (24) and Iran -16.7% (461) could relate to inherent limitations in study designs, sample sizes, inclusion criteria, type of specimens, DNA extraction, detection method, analysis and interpretation of results among these studies (81). Nevertheless, the prevalence of EBV in present study (77.8%) showed almost two fold increase (35.0%) that of past study conducted by Jalouli et al. 2012 (24). This difference may be due to frozen tissue samples used in present study compared with formalin-fixed paraffin - embedded samples used in Jalouli et al. 2012 study. The manner of storing tissue could lead to differential DNA degradation (505). Furthermore, betel quid chewing habit (with tobacco) of 100% of OSCC cases of the present study compared with 35% of cases in past study may be affected with findings (24). Association of EBV with OSCC is found to be boosted by betel quid habit (452). Moreover, nearly 2-fold higher odds ratio was found in the Shammah users/EBV- positive group compared to the Shammah users/EBV- negative group (468) and Shammah is a type of smokeless tobacco product used in Yamen. Findings of present study are consistent with the high prevalence of EBV in oral cancer tissues from most south east-Asian studies implying that there might be an etiological role of EBV in OSCC (54).

In the present study, 50% of FEP controls were infected with EBV and this finding was consistent with that of 90-95% of the adult population that harbour this virus as asymptomatic carriers of EBV (442, 444, 445). Nevertheless, the finding of present study is higher than that of EBV prevalence in 20% ofcytological smears of lateral boarder of tongue of healthy individuals in Brazil (506) and 39.7 % healthy males in Portugal (507). This difference may be due to smoking and betel quid chewing habits of 68% and 76% of FEP controls as these habits reported to upgrade EBV prevalence (452).

139

Further studies are warrented to confirm the consistency of present study with adequate sample size controlling for confounding factors. Nonetheless, limitations of the present study cannot be ignored. Contamination of tissue samples by saliva cannot be entirely excluded, though adequate care was taken to prevent contamination when performing biopsies Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) analysis which was performed to find out the quality of extracted DNA by presence of amplifiable genomic DNA and absence of PCR inhibitors, which expected to facilitate optimum amplification in rt PCR. Out of 53 samples analysed only 25% of samples were positive when analysed GAPDH. Furthermore only 15.1% of the extracted DNA samples yielded nucleic acid in 260/230 ratio < 1. No template controlswere included in these runs and it was not possible to repeat GAPDH analysis with diluted samples to trouble shoot the possible presence of PCR inhibitors by diluting them below their effective concentration, due to unavailability of extracted DNA aliquots. HHV 8 is an oncogenic virus which is the causative agent of Kaposi’s sarcoma (KS), multicentre Castleman’s disease (MCD) and primary effusion lymphoma (PEL) common malignancies in HIV infected patients (276, 277).

In the present study HHV-8 was not detected in OSCC cases and FEP controls. Comparable findings were reported in a study conducted by Yang et al. (472) as HHV-8 was not detected in any of 25 archival FFPE samples. HHV-8 was detected in one of 22 archival FFPE samples of head and neck squamous cell carcinomas in a separate study of HIV positive patients (508). Further studies are needed to establish the reliability of present study as HHV-8 is an oncogenic virus associated with diseases in immuno suppressed patients. In conclusion, the present study revealed the HPV status of a sub sample of 29 OSCC cases, comprising Sinhala males > 40 yrs with clinical diagnosis of oral squamous cell carcinoma (OSCC) in buccal mucosa or oral tongue, typical of the majority of Sri Lankan OSCC cases. In this group, prevalence of HPV was low. Nevertheless, statistically significant differences (p < 0.05) of risk habits of betel quid chewing, alcohol addiction and consumption of < 5 portions of vegetable and fruit were obtained among cases and controls. The relevance of these findings for exploration of possible role of HPV in Sri

140

Lankan OSCC patients; especially females and males less than 40 years old without one or more risk habits of betel quid chewing, smoking and alcohol consumption need further investigation with case-control studies of adequate sample size, employing rigorous methodology with controlling for confounders.

The present study revealed the EBV status of homogenous group of 29 cases, comprising Sinhala males (with the mean age of 61.62±9.21 yrs), and clinical diagnosis of oral squamous cell carcinoma (OSCC) in buccal mucosa or oral tongue. In this group of Sinhala male OSCC cases, detection of EBV was significantly higher when compared with FEP controls, statistically. Thus, the findings of present study might imply an aetiological role of EBV in Sri Lankan OSCC cases. The relevance of these findings for exploration of possible etiological role of EBV in Sri Lankan OSCC patients needs further investigation with adequate sample size with controlling for confounders. The present study confirms the absence of HHV-8 in a homogenous group of 29 cases, comprising Sinhala males (with the mean age of 61.62±9.21 yrs), and clinical diagnosis of oral squamous cell carcinoma (OSCC) in buccal mucosa or oral tongue as expected.

141

CHAPTER 7: GENERAL CONCLUSIONS, RECOMMENDATIONS AND FUTURE DIRECTION

General Conclusions

Meta-genomics has opened up a novel arena in cancer research with an enormous potential to be harnessed for its prevention, control and therapeutic purposes(150). Cancers are of multi factorial aetiology and include genetic, environmental and life-style factors and some of which are potentially modifiable and non-modifiable risk factors. Additionally, there is geographic and population patterning of these risks factors (2). Cancers including oral cancer are multi-faceted, major public health problem with an estimated 14.1 million incidence cases, 8.2 million deaths due to cancer and 32.6 million people living with cancer (509). Against this backdrop, cancers induced by microbes such as gastric cancer (induced by H. pylori) has an estimated 16.1% for global cancer burden (510).

Meta-genomics underpinned by Next Generation Sequencing (NGS) techniques provide an equitable mode of identifying and studying the microbial communities/consortia within their habitat. This approach has revolutionized the landscape of identifying, analyzing, interpreting and targeting the microbial diversity and relative abundance, characterize their genetic potential and most importantly identify their ongoing functions by transcriptomics, proteomics and metabolomics present in the tissue specimens of cancer patients (84, 511). Accordingly, it is possible to investigate the potential causative role of microbes explained by biological plausible pathways for causation: as a “Cause”, or to explore whether it is the altered micro-environment of cancer tissues that makes the microbial consortium to thrive with opportunistic adaptation in it as a “Co-Incidence” to be harnessed for its potential as a prognostic marker and most importantly the potential to use for targeted therapy as a “Cure”. This newly generated understanding could be used to develop hypothetical models of microbial influence on carcinogenesis and therefore warrant further investigations by robust methodologies and larger sample sizes (83). There is a complex, yet a crucial role played by oral microbiota with regard to OSCC. Microbial colonization of OSCC tissues is influenced by risk habit 142 profile (betel chewing, smoking and alcohol consumption) and periodontal disease status and oral hygiene status. Moreover, to the knowledge of researcher there is only one recently published study which assessed bacteria, fungi, viruses and parasites associated with oropharyngeal and OSCC tissues despite some obvious controversies in findings (512). Against this backdrop, the salient findings of present study were concluded as follows:

1. Determination of the structural and functional bacteriome profiles in a group of Sri Lankan male OSCC cases and FEP controls.

1.1 The Bacteriome profile of OSCC enriched with Citrobacter koseri, Fusobacterium nucleatum subsp.polymorphum, Pseudomonas aeruginosa and Atopobium. 1.2 The bacteriome profile associated with OSCC cases compared with FEP controls, included bacteria able to promote inflammation, and degrade nitrotoluene; which are properties that could promote OSCC. Hence, proposing that metagenomic sequencing coupled with bacterial functional gene assessment could unravel new aspects of OSCC pathogenesis and progression with potential therapeutic and public health implications.

1.3 FEP control tissues demonstrated a poly microbial community enriched with Rothia mucilaginosa and Streptococcus mitis and other bacteria capable of xenobiotic metabolism.

1.4 Evidence suggesting possible exposure to environmental pollutants was emerged by the novel findings of nitrotoluene degradation of bacteriome associated with OSCC cases and xenobiotic metabolism of bacteriome associated with FEP controls.

2. Exploration of the mycobiome profile in a group of Sri Lankan male OSCC cases and FEP control 2.1 Dysbiotic mycobiome dominated by C. albicans was identified at the advancing margin of OSCC compared with FEP controls.

143

2.2 A number of fungal taxa capable of producing anti-cancer compounds were present in non-cancerous tissues 2.3 These distinct differences in OSCC cases compared with FEP controls indicated the possibility of developing risk markers for control and prevention of OSCC as well as for making recommendations for clinical management guidelines for better prognosis. For example, exclusive anti-fungal therapy for OSCC as well as for Oral Potentially Malignant Disorders with regular follow-up care. 3. Detection of HPV, EBV and HHV 8 in a group of Sri Lankan male OSCC cases and FEP controls. 3.1 Low prevalence of HPV was encountered but there was a statistically significant higher prevalence of EBV and absence of HHV 8 were detected in OSCC cases when compared with FEP controls. 3.2 Comparatively higher prevalence of HPV, low prevalence of EBV and absence of HHV 8 were detected in FEP controls compared with OSCC cases. 3.3 Possible implications for the aetio- pathogenic role of EBV in oral carcinogenesis in Sri Lankan OSCC patients are suggested.

New Findings that have immerged from the present study

1. Determination of the structural and functional bacteriome profiles in a group of Sri Lankan male OSCC cases and FEP controls.  Bacterial dysbiosis with decreased species diversity and richness was detected at the advancing margin of OSCC tissues in a group of Sri Lankan OSCC patients. The dysbiotic status of OSCC tissues is consistent with the finding of previous two studies in which saliva samples were analysed.  For the first time, an association of C. koseri and Atopobium with OSCC has been revealed.  Present study demonstrated a polymicrobial dysbiosis, enriched with inflammatory and carcinogenic metabolite producers, which could be considered as a novel finding reported for the first time. In a previous metagenomic study inflammatory bacteriome enriched in OSCC has discovered by Al-hebshi et al. 2017 (69) Furthermore, using culture and gas

144

chromatography techniques carcinogenic acetaldehyde producing oral Streptococci have isolated and identified in OSCC tissues previously by Kurkivuori et al.2007 (211). Nevertheless, this is the first time of ‘snap shot discovery’ of two biologically plausible carcinogenic mechanisms of oral bacteriome contributing to oral carcinogenesis were discovered by a single metagenomic study.  Findings of the present study demonstrated nitrotoluene degradation and xenobiotic metabolism in oral cavity by oral bacteriome. In previous reported studies, these processes have been identified to occur in the gut by intestinal bacterial flora. These findings unveil the capability of oral bacteria inhabitants of oral cavity- entry point of gastro intestinal tract.  Findings of present study suggested exposure of both OSCC cases and FEP controls to environmental pollutants, thus warranting further investigations with robust methodologies for environmental pollutants as an emerging risk factor for OSCC patients in Sri Lanka in addition to better known risk factors; betel quid chewing, smoking, alcohol consumption, poor oral hygiene and poor fruit and vegetable consumption.  In conclusion, findings of the present study supported an OSCC associated dysbiotic, pro-inflammatory and pro-carcinogenic metabolite producing bacteriome compared to FEP controls with evidence as a consequence rather than a cause of tumour-microenvironment. Nevertheless, there was inconclusive evidence to disregard this OSCC associated bacteriome as a cause or a bio-marker of OSCC. Further research with robust mythologies warranted in this regard. 2. Exploration of the mycobiome profile in a group of Sri Lankan male OSCC cases and FEP controls.  Fungal dysbiosis dominated by C.albicans was found in OSCC cases compared with controls by metagenomic study for the first time in Sri Lanka. Previous plethora of studies reported the association of Candida in OSCC. Nevertheless, fungal dysbiosis associated with OSSCC was discovered for the first time by the findings of the present study.

145

3. Detection of HPV, EBV and HHV 8 in a group of Sri Lankan male OSCC cases and FEP controls.  Importance of confounding factors (age, gender and site specificity) for the prevalence of OSCC cases was identified by the present study. In previous Sri Lankan studies, approximately 30% of HPV prevalence was reported due to inability of controlling for these confounders.  In the present study possible aetio pathogenic role of EBV in oral carcinogenesis is suggested for the first time in OSCC patients in Sri Lanka. Future studies are warranted with larger sample sizes, robust methodologies, cohort study designs and controlling for confounding effects of established risk factors to find out the reproducibility of new findings of the present study. This will pave the way to use signatures of oral bacteria and oral fungi as risk markers for control and prevention of OSCC in Sri Lanka as well as to find out their contribution in the aetiology of oral cancer.

Recommendations& Future Directions Present study expanded the horizons of existing knowledge on geographic and population specific, multi factorial aetiology of OSCC; by revealing the status of the microbiome to be further explored as an emerging risk factor in the holistic approach of considering a OSCC patient as a ‘Holobiont’ or ‘Supra Organism’ in control and prevention of one of most preventable cancer which has become a serious global public health challenge and in Sri Lanka, being Number 01 cancer among males with high mortality and poor survival rate, in the era of personalized medicine. The following recommendations are made based on methods and practical implications of the present study. • In the present study freshly frozen tissues were used as bio specimens. It was a daunting task, challenge and costly business to maintain the cold chain especially during the dispatching from Colombo to Gold coast, as it took 6 days and 6 hours (about 150 hours) to reach to Gold Coast campus. Therefore, it is recommended to optimize other cost effective methods of preservation of fresh tissues for molecular/metagenomic studies, for instance, with RNA later solution.

146

• In the present study saliva contamination was unable to prevent 100% though extra care taken to avoid it as much as possible. Thus, it is recommended to immerse tissues in sterilized Phosphate Buffered Saline (PBS) to encourage removal of any microbes on the tissue surface before DNA extraction. • In this metagenomic study, possible contamination at some stage of laboratory work was indicated. Nevertheless, it was having negligible effects on bacteriome and mycobiome results as reads of few contaminant species were excluded from final results. Sensitivity to contamination and subsequent biases of findings are inherent limitations of metagenomic studies. Hence, it is strongly recommended to define contaminant present in environment, reagents, kits and equipment use in all DNA extraction procedures, against negative controls. Moreover, any unusual and /or unexpected finding needs to be treated as cautiously as possible contamination may ruin the dignity of unique findings. • In the present study presence of PCR inhibitors indicated in certain samples and it was overcome by dilution in bacteriome and mycobiome profiling. Therefore, it is strongly recommended to optimize sample preparation protocols on removal of PCR inhibitors during sample preparation. Furthermore, development of standardized controls for substantiated evaluation of real time PCR results as well as comparison of efficiencies of different PCR protocols. • The BL A STN-based classification algorithm used in this for species level identification of bacteria and BLASTN-algorithm with UNITE’s named species sequences for fungi are recommended for future metagenomic studies to obtain species level identification with maximum resolution and accuracy. Future work on functional metagenomic studies with cohort study design (including adequate sample size, controlling for confounding effects of established risk factors) could be recommended as a novel arena of ground breaking research into cancers in general and for oral cancer in particular to revolutionize the landscape of time varying microbiome (microbial dysbiosis) in the natural history of carcinogenesis, in order to identify key microbiota or shifts in community structure to determine whether the microbiota are cause or effect of cancer risk due to favourable tumour micro environment for flourishing certain microbes.

147

Present study included only males as the risk factors such as smoking can affect the colonization pattern of oral microbiome and this is a well-known risk factor for OSCC. In Sri Lanka females do not smoke usually.

The incidence of cancer of the oral cavity and oro-pharynx in Sri Lanka, excluding salivary neoplasms, standardized to the world standard population in the year 2010, was 20.7 and 5.4 per 100,000 populations, in males and females respectively. According to the National Cancer Registry 2010, 14.3% of all reported cancers are oral cancer and carrying highest mortality rate among different types of cancers (3 deaths per day). Hence, the burden of OSCC is higher among males compared to females in Sri Lankan context.

Moreover, the main study which comprised of 134 OSCC cases and 134 benign mucosal cases revealed male gender as an independent risk lndicator by unconditional logistic regression analysis (Appendix 3.2). Hence, in order control for the confounding effect of gender only males were selected for the present study. Nevertheless, further studies warranted including females as well.

Subsequently, exploring their causative mechanisms in cell culture and animal models as it is important to identify cause and molecular damage in order to develop personalized therapy for OSCC , disease with multi factorial origin with geographic and population specificity there by harnessing unexplored potential of application metagenomics in cancer research.

148

Rferences: 1. Warnakulasuriya S. Global epidemiology of oral and oropharyngeal cancer. Oral oncology. 2009;45(4):309-16. 2. Gupta B, Lalloo R, Johnson NW. Life course models for upper aero‐digestive tract cancer. International dental journal. 2015;65(3):111-9. 3. Johnson NW, Warnakulasuriya S, Gupta P, Dimba E, Chindia M, Otoh E, et al. Global oral health inequalities in incidence and outcomes for oral cancer causes and solutions. Advances in dental research. 2011;23(2):237-46. 4. Gupta B, Ariyawardana A, Johnson NW. Oral cancer in India continues in epidemic proportions: evidence base and policy initiatives. International dental journal. 2013;63(1):12-25. 5. Daniel FI, Fava M, da Rocha Hoffmann R, Campos MM, Yurgel LS. Main molecular markers of oral squamous cell carcinoma. Applied Cancer Research. 2010;30(3):279-88. 6. Tsantoulis P, Kastrinakis N, Tourvas A, Laskaris G, Gorgoulis V. Advances in the biology of oral cancer. Oral oncology. 2007;43(6):523-34. 7. Stewart B, Wild CP. World cancer report 2014. World. 2016. 8. Argiris A, Karamouzis MV, Raben D, Ferris RL. Head and neck cancer. The Lancet. 2008;371(9625):1695-709. 9. Cancer IAfRo, Organization WH. GLOBOCAN 2012: estimated cancer incidence, mortality and prevalence worldwide in 2012 [en línea]. Dirección URL:

149

20. Gupta B, Kumar N, Johnson NW. A risk factor‐based model for upper aerodigestive tract cancers in India: predicting and validating the receiver operating characteristic curve. Journal of Oral Pathology & Medicine. 2016. 21. Warnakulasuriya S, Johnson N, Van der Waal I. Nomenclature and classification of potentially malignant disorders of the oral mucosa. Journal of oral pathology & medicine. 2007;36(10):575-80. 22. Amarasinghe HK, Usgodaarachchi US, Johnson NW, Lalloo R, Warnakulasuriya S. Betel- quid chewing with or without tobacco is a major risk factor for oral potentially malignant disorders in Sri Lanka: a case-control study. Oral oncology. 2010;46(4):297-301. 23. Jayasooriya PR, Kurose K, Terai M, Sivagnanam K, Siriwardana S, Tilakaratne WM, et al. Human Papillomavirus in Oral Cancer from Sri Lanka: Prevalence and relationship with clinico- pathological parameters. Oral Medicine & Pathology. 2003;8(2):45-50. 24. Jalouli J, Jalouli MM, Sapkota D, Ibrahim SO, Larsson P-A, Sand L. Human papilloma virus, herpes simplex virus and epstein barr virus in oral squamous cell carcinoma from eight different countries. Anticancer research. 2012;32(2):571-80. 25. Gunasekera SK, Perera KA, Fernando C, Udagama PV. A shifting paradigm in the aetiology of oral and pharyngeal cancer in Sri Lanka: a case-control study providing serologic evidence for the role of oncogenic HPV types 16 and 18. Infectious agents and cancer. 2015;10(1):1. 26. Albano PM, Holzinger D, Salvador C, Orosa III J, Racelis S, Leaño M, et al. Low prevalence of human papillomavirus in head and neck squamous cell carcinoma in the northwest region of the Philippines. PloS one. 2017;12(2):e0172240. 27. Bijina B, Ahmed J, Shenoy N, Ongole R, Shenoy S, Baliga S. Detection of human papilloma virus in potentially malignant and malignant lesions of the oral cavity and a study of associated risk factors. South Asian Journal of Cancer. 2016;5(4):179. 28. Dalton CB, Austin CC, Sobel J, Hayes PS, Bibb WF, Graves LM, et al. An outbreak of gastroenteritis and fever due to Listeria monocytogenes in milk. New England Journal of Medicine. 1997;336(2):100-6. 29. Ferlay J, Shin HR, Bray F, Forman D, Mathers C, Parkin DM. Estimates of worldwide burden of cancer in 2008: GLOBOCAN 2008. International journal of cancer. 2010;127(12):2893- 917. 30. Conway DI, Petticrew M, Marlborough H, Berthiller J, Hashibe M, Macpherson L. Socioeconomic inequalities and oral cancer risk: A systematic review and meta‐analysis of case‐control studies. International Journal of Cancer. 2008;122(12):2811-9. 31. Warnakulasuriya S. Significant oral cancer risk associated with low socioeconomic status. Evidence-based dentistry. 2009;10(1):4-5. 32. Siriwardena B, Tilakaratne A, Amaratunga E, Tilakaratne W. Demographic, aetiological and survival differences of oral squamous cell carcinoma in the young and the old in Sri Lanka. Oral oncology. 2006;42(8):831-6. 33. Thornhill M. The sun, the ozone layer and the skin: the role of ultraviolet light in lip and skin cancer. Dental update. 1992;20(6):236-40. 34. Kumar S, Zain R. Aetiology and risk factors for oral cancer–a brief overview. Annal Dent Univ Malaya. 2004;11:41-50. 35. Chocolatewala N, Chaturvedi P, Desale R. The role of bacteria in oral cancer. Indian Journal of Medical and Paediatric Oncology. 2010;31(4):126. 36. Mager D. Bacteria and cancer: cause, coincidence or cure? A review. Journal of translational medicine. 2006;4(1):14.

150

37. Markowska J, Fischer N, Markowski M, Nalewaj J. The role of Chlamydia trachomatis infection in the development of cervical neoplasia and carcinoma. Medycyna wieku rozwojowego. 2004;9(1):83-6. 38. Kostic AD, Gevers D, Pedamallu CS, Michaud M, Duke F, Earl AM, et al. Genomic analysis identifies association of Fusobacterium with colorectal carcinoma. Genome research. 2012;22(2):292-8. 39. Ulger Toprak N, Yagci A, Gulluoglu B, Akin M, Demirkalem P, Celenk T, et al. A possible role of Bacteroides fragilis enterotoxin in the aetiology of colorectal cancer. Clinical microbiology and infection. 2006;12(8):782-6. 40. Boccardo E, Villa L. Viral origins of human cancer. Current medicinal chemistry. 2007;14(24):2526-39. 41. Perera M, Al-hebshi NN, Speicher DJ, Perera I, Johnson NW. Emerging role of bacteria in oral carcinogenesis: a review with special reference to perio-pathogenic bacteria. Journal of Oral Microbiology. 2016;8. 42. Rajeev R, Choudhary K, Panda S, Gandhi N. Role of bacteria in oral carcinogenesis. South Asian journal of cancer. 2012;1(2):78. 43. Perera M, Al-hebshi NN, Speicher DJ, Perera I, Johnson NW. Emerging role of bacteria in oral carcinogenesis: a review with special reference to perio-pathogenic bacteria. Journal of oral microbiology. 2016;8(1):32762. 44. WILLIAMSON DM. Chronic hyperplastic candidiasis and squamous carcinoma. British Journal of Dermatology. 1969;81(2):125-7. 45. Sanjaya P. Evaluation of candidal carriage in oral squamous cell carcinoma. Journal of Cranio-Maxillary Diseases. 2015;4(2):123. 46. Bakri MM, Hussaini HM, Holmes AR, Cannon RD, Rich AM. Revisiting the association between candidal infection and carcinoma, particularly oral squamous cell carcinoma. Journal of oral microbiology. 2010;2. 47. Kang J, He Y, Hetzl D, Jiang H, Jun M, Jun M, et al. A Candid Assessment of the Link between Oral Candida Containing Biofilms and Oral Cancer. Advances in Microbiology. 2016;6(02):115. 48. Roizman B, Frenkel N. The transcription and state of herpes simplex virus DNA in productive infection and in human cervical cancer tissue. Cancer research. 1973;33(6):1402-16. 49. Frenkel N, Roizman B, Cassai E, Nahmias A. A DNA fragment of herpes simplex 2 and its transcription in human cervical cancer tissue. Proceedings of the National Academy of Sciences. 1972;69(12):3784-9. 50. Koffa M, Koumantakis E, Ergazaki M, Tsatsanis C, Spandidos DA. Association of herpesvirus infection with the development of genital cancer. International journal of cancer. 1995;63(1):58-62. 51. Sand LP, Jalouli J, Larsson P-A, Hirsch J-M. Prevalence of Epstein-Barr virus in oral squamous cell carcinoma, oral lichen planus, and normal oral mucosa. Oral Surgery, Oral Medicine, Oral Pathology, Oral Radiology, and Endodontology. 2002;93(5):586-92. 52. GUPTA MM, JAIN R, PARASHARI A, Singh V, Satyanarayana L. HSV‐IgA serum antibodies in cervical intraepithelial neoplasia and invasive cancer patients, and in their spouses: a case control study. Apmis. 1992;100(7‐12):598-604. 53. Shaikh MH, McMillan NA, Johnson NW. HPV-associated head and neck cancers in the Asia Pacific: a critical literature review & meta-analysis. Cancer epidemiology. 2015;39(6):923- 38.

151

54. Polz-Gruszka D, Macielag P, Foltyn S, Polz-Dacewicz M. Oral squamous cell carcinoma (OSCC)-molecular, viral and bacterial concepts. Journal of Pre-Clinical and Clinical Research. 2014;8(2). 55. Kilian M, Chapple I, Hannig M, Marsh P, Meuric V, Pedersen A, et al. The oral microbiome–an update for oral healthcare professionals. British Dental Journal. 2016;221(10):657-66. 56. Aagaard K, Petrosino J, Keitel W, Watson M, Katancik J, Garcia N, et al. The Human Microbiome Project strategy for comprehensive sampling of the human microbiome and why it matters. The FASEB Journal. 2013;27(3):1012-22. 57. Consortium HMP. Structure, function and diversity of the healthy human microbiome. Nature. 2012;486(7402):207-14. 58. Chen T, Yu W-H, Izard J, Baranova OV, Lakshmanan A, Dewhirst FE. The Human Oral Microbiome Database: a web accessible resource for investigating oral microbe taxonomic and genomic information. Database. 2010;2010:baq013. 59. Wade WG. The oral microbiome in health and disease. Pharmacological Research. 2013;69(1):137-43. 60. Rasiah IA, Wong L, Anderson SA, Sissons CH. Variation in bacterial DGGE patterns from human saliva: over time, between individuals and in corresponding dental plaque microcosms. Archives of oral biology. 2005;50(9):779-87. 61. Avila M, Ojcius DM, Yilmaz Ö. The oral microbiota: living with a permanent guest. DNA and cell biology. 2009;28(8):405-11. 62. Sakamoto M, Umeda M, Benno Y. Molecular analysis of human oral microbiota. Journal of periodontal research. 2005;40(3):277-85. 63. Parahitiyawa N, Scully C, Leung W, Yam W, Jin L, Samaranayake L. Exploring the oral bacterial flora: current status and future directions. Oral diseases. 2010;16(2):136-45. 64. Darveau RP. Periodontitis: a polymicrobial disruption of host homeostasis. Nature Reviews Microbiology. 2010;8(7):481-90. 65. Candela M, Guidotti M, Fabbri A, Brigidi P, Franceschi C, Fiorentini C. Human intestinal microbiota: cross-talk with the host and its potential role in colorectal cancer. Critical reviews in microbiology. 2011;37(1):1-14. 66. Arthur JC, Jobin C. The complex interplay between inflammation, the microbiota and colorectal cancer. Gut Microbes. 2013;4(3):253-8. 67. Michaud DS, Izard J. Microbiota, oral microbiome, and pancreatic cancer. Cancer journal (Sudbury, Mass). 2014;20(3):203. 68. Michaud D, Kelsey K, Papathanasiou E, Genco C, Giovannucci E. Periodontal disease and risk of all cancers among male never smokers: an updated analysis of the Health Professionals Follow-up Study. Annals of Oncology. 2016:mdw028. 69. Al-Hebshi NN, Nasher AT, Maryound MV, Homeida HE, Chen T, Idris AM, Johnson NW. 2017 a Inflammatory bacteriome featuring Fusobacterium nucleatum and Psedomonas aeruginosa identified in association of oral squamous cell carcinoma. Sci Rep.12;7 (1):1834. Doi.10.1038.s41598-017-02079-3. 70. Hooper SJ, Crean S-J, Fardy MJ, Lewis MA, Spratt DA, Wade WG, et al. A molecular analysis of the bacteria present within oral squamous cell carcinoma. Journal of medical microbiology. 2007;56(12):1651-9. 71. Hooper SJ, Crean SJ, Lewis MA, Spratt DA, Wade WG, Wilson MJ. Viable bacteria present within oral squamous cell carcinoma tissue. Journal of clinical microbiology. 2006;44(5):1719-25. 72. Pushalkar S, Mane SP, Ji X, Li Y, Evans C, Crasta OR, et al. Microbial diversity in saliva of oral squamous cell carcinoma. FEMS Immunology & Medical Microbiology. 2011;61(3):269-77.

152

73. Pushalkar S, Ji X, Li Y, Estilo C, Yegnanarayana R, Singh B, et al. Comparison of oral microbiota in tumor and non-tumor tissues of patients with oral squamous cell carcinoma. BMC microbiology. 2012;12(1):1. 74. Schmidt BL, Kuczynski J, Bhattacharya A, Huey B, Corby PM, Queiroz EL, et al. Changes in abundance of oral microbiota associated with oral cancer. PLoS One. 2014;9(6):e98741. 75. Guerrero-Preston R, Godoy-Vitorino F, Jedlicka A, Rodríguez-Hilario A, González H, Bondy J, et al. 16S rRNA amplicon sequencing identifies microbiota associated with oral cancer, Human Papilloma Virus infection and surgical treatment. Oncotarget. 2016. 76. Seed PC. The human mycobiome. Cold Spring Harbor perspectives in medicine. 2015;5(5):a019810. 77. Cui L, Morris A, Ghedin E. The human mycobiome in health and disease. Genome medicine. 2013;5(7):1. 78. Sokol H, Leducq V, Aschard H, Pham H-P, Jegou S, Landman C, et al. Fungal microbiota dysbiosis in IBD. Gut. 2016:gutjnl-2015-310746. 79. Kreimer AR, Bhatia RK, Messeguer AL, González P, Herrero R, Giuliano AR. Oral human papillomavirus in healthy individuals: a systematic review of the literature. Sexually transmitted diseases. 2010;37(6):386-91. 80. Kreimer AR, Villa A, Nyitray A, Abrahamsen ME, Papenfuss MR, Smith D, et al. The epidemiology of oral HPV infection among a multinational sample of healthy men. Cancer Epidemiology and Prevention Biomarkers. 2010:cebp. 0682.2010. 81. Patil S. Etiologic Association between Epstein–Barr Virus and Oral Squamous Cell Carcinoma: A Brief Evidence-based Discussion. The Journal of Contemporary Dental Practice. 2017;18(4):261-4. 82. Khan AA, Shrivastava A, Khurshid M. Normal to cancer microbiome transformation and its implication in cancer diagnosis. Biochimica et Biophysica Acta (BBA)-Reviews on Cancer. 2012;1826(2):331-7. 83. Hebert EF, Divi RL, Verma M. Microbiome analysis: trends in cancer epidemiology, challenges and opportunities. Int J Cancer Res Mol Mech. 2015;1(1). 84. Banerjee J, Mishra N, Dhas Y. Metagenomics: A new horizon in cancer research. Meta gene. 2015;5:84-9. 85. Chen Y, Chen Z, Guo R, Chen N, Lu H, Huang S, et al. Correlation between gastrointestinal fungi and varying degrees of chronic hepatitis B virus infection. Diagnostic microbiology and infectious disease. 2011;70(4):492-8. 86. Nelson A, De Soyza A, Bourke S, Perry J, Cummings S. Assessment of sample handling practices on microbial activity in sputum samples from patients with cystic fibrosis. Letters in applied microbiology. 2010;51(3):272-7. 87. Harrison M, Twomey K, McCarthy Y, O'Connell O, Alston M, Febrer M, et al., editors. Fungal microbiota in the adult cystic fibrosis (CF) airway: characterization by second-generation sequencing and correlation with standard culture-based methods and clinical phenotype. IRISH JOURNAL OF MEDICAL SCIENCE; 2012: SPRINGER LONDON LTD 236 GRAYS INN RD, 6TH FLOOR, LONDON WC1X 8HL, ENGLAND. 88. Kuehbacher T, Ott SJ, Helwig U, Mimura T, Rizzello F, Kleessen B, et al. Bacterial and fungal microbiota in relation to probiotic therapy (VSL# 3) in pouchitis. Gut. 2006;55(6):833-41. 89. Ott SJ, Kühbacher T, Musfeldt M, Rosenstiel P, Hellmig S, Rehman A, et al. Fungi and inflammatory bowel diseases: alterations of composition and diversity. Scandinavian journal of gastroenterology. 2008;43(7):831-41. 90. Balkwill F, Mantovani A. Inflammation and cancer: back to Virchow? The lancet. 2001;357(9255):539-45.

153

91. Meurman J. Oral microbiota and cancer. Journal of oral microbiology. 2010;2. 92. Allavena P, Garlanda C, Borrello MG, Sica A, Mantovani A. Pathways connecting inflammation and cancer. Current opinion in genetics & development. 2008;18(1):3-10. 93. Herrera V, Parsonnet J. Helicobacter pylori and gastric adenocarcinoma. Clinical Microbiology and Infection. 2009;15(11):971-6. 94. Casper C, Fitzmaurice C. Infection-related cancers: prioritising an important and eliminable contributor to the global cancer burden. The Lancet Global Health. 2016;4(9):e580- e1. 95. Whitmore SE, Lamont RJ. Oral bacteria and cancer. PLoS Pathog. 2014;10(3):e1003933. 96. Chang AH, Parsonnet J. Role of bacteria in oncogenesis. Clinical microbiology reviews. 2010;23(4):837-57. 97. Turnbaugh PJ, Ley RE, Hamady M, Fraser-Liggett C, Knight R, Gordon JI. The human microbiome project: exploring the microbial part of ourselves in a changing world. Nature. 2007;449(7164):804. 98. Ling Z, Kong J, Jia P, Wei C, Wang Y, Pan Z, et al. Analysis of oral microbiota in children with dental caries by PCR-DGGE and barcoded pyrosequencing. Microbial ecology. 2010;60(3):677-90. 99. Consortium HMP. A framework for human microbiome research. Nature. 2012;486(7402):215-21. 100. Sonnenburg JL, Fischbach MA. Community health care: therapeutic opportunities in the human microbiome. Science translational medicine. 2011;3(78):78ps12-78ps12. 101. Tomkovich S, Jobin C. Microbiota and host immune responses: a love–hate relationship. Immunology. 2016;147(1):1-10. 102. Cho I, Blaser MJ. The human microbiome: at the interface of health and disease. Nature Reviews Genetics. 2012;13(4):260-70. 103. Blaser MJ. Who are we? Indigenous microbes and the ecology of human diseases. EMBO reports. 2006;7(10):956. 104. Haubek D, Ennibi O-K, Poulsen K, Væth M, Poulsen S, Kilian M. Risk of aggressive periodontitis in adolescent carriers of the JP2 clone of Aggregatibacter (Actinobacillus) actinomycetemcomitans in Morocco: a prospective longitudinal cohort study. The Lancet. 2008;371(9608):237-42. 105. Ravel J, Gajer P, Abdo Z, Schneider GM, Koenig SS, McCulle SL, et al. Vaginal microbiome of reproductive-age women. Proceedings of the National Academy of Sciences. 2011;108(Supplement 1):4680-7. 106. Gillings MR, Paulsen IT, Tetu SG. Ecology and evolution of the human microbiota: fire, farming and antibiotics. Genes. 2015;6(3):841-57. 107. Porter J. Antony van Leeuwenhoek: tercentenary of his discovery of bacteria. Bacteriological reviews. 1976;40(2):260. 108. Dewhirst FE, Chen T, Izard J, Paster BJ, Anne CRT, Yu W-H, et al. The Human Oral Microbiome. Journal of Bacteriology. 2010;192(19):5002-17. 109. Arendorf T, Walker D. Oral candidal populations in health and disease. British dental journal. 1979;147(10):267-72. 110. Ghannoum MA, Jurevic RJ, Mukherjee PK, Cui F, Sikaroodi M, Naqvi A, et al. Characterization of the oral fungal microbiome (mycobiome) in healthy individuals. PLoS pathog. 2010;6(1):e1000713. 111. Robles-Sikisaka R, Ly M, Boehm T, Naidu M, Salzman J, Pride DT. Association between living environment and human oral viral ecology. The ISME journal. 2013;7(9):1710-24.

154

112. Dominguez-Bello MG, Costello EK, Contreras M, Magris M, Hidalgo G, Fierer N, et al. Delivery mode shapes the acquisition and structure of the initial microbiota across multiple body habitats in newborns. Proceedings of the National Academy of Sciences. 2010;107(26):11971-5. 113. Lif Holgerson P, Harnevik L, Hernell O, Tanner A, Johansson I. Mode of birth delivery affects oral microbiota in infants. Journal of dental research. 2011;90(10):1183-8. 114. Holgerson PL, Vestman NR, Claesson R, Öhman C, Domellöf M, Tanner AC, et al. Oral microbial profile discriminates breastfed from formula-fed infants. Journal of pediatric gastroenterology and nutrition. 2013;56(2):127. 115. Sampaio-Maia B, Monteiro-Silva F. Acquisition and maturation of oral microbiome throughout childhood: An update. Dent Res J (Isfahan). 2014;11(3):291-301. 116. Crielaard W, Zaura E, Schuller AA, Huse SM, Montijn RC, Keijser BJ. Exploring the oral microbiota of children at various developmental stages of their dentition in the relation to their oral health. BMC medical genomics. 2011;4(1):22. 117. Xu X, He J, Xue J, Wang Y, Li K, Zhang K, et al. Oral cavity contains distinct niches with dynamic microbial communities. Environmental microbiology. 2015;17(3):699-710. 118. Do T, Devine D, Marsh PD. Oral biofilms: molecular analysis, challenges, and future prospects in dental diagnostics. Clinical, cosmetic and investigational dentistry. 2013;5:11-9. 119. Kolenbrander PE, Palmer RJ, Periasamy S, Jakubovics NS. Oral multispecies biofilm development and the key role of cell–cell distance. Nature Reviews Microbiology. 2010;8(7):471-80. 120. Marsh P. Dental plaque: biological significance of a biofilm and community life‐style. Journal of clinical periodontology. 2005;32(s6):7-15. 121. Zijnge V, van Leeuwen MBM, Degener JE, Abbas F, Thurnheer T, Gmür R, et al. Oral biofilm architecture on natural teeth. PloS one. 2010;5(2):e9321. 122. Flemming H-C, Wingender J. The biofilm matrix. Nature Reviews Microbiology. 2010;8(9):623-33. 123. Zaura E, Keijser BJ, Huse SM, Crielaard W. Defining the healthy. BMC microbiology. 2009;9(1):259. 124. Li J, Jia H, Cai X, Zhong H, Feng Q, Sunagawa S, et al. An integrated catalog of reference genes in the human gut microbiome. Nature biotechnology. 2014;32(8):834-41. 125. Carmody RN, Gerber GK, Luevano JM, Gatti DM, Somes L, Svenson KL, et al. Diet dominates host genotype in shaping the murine gut microbiota. Cell host & microbe. 2015;17(1):72-84. 126. Bäckhed F, Fraser CM, Ringel Y, Sanders ME, Sartor RB, Sherman PM, et al. Defining a healthy human gut microbiome: current concepts, future directions, and clinical applications. Cell host & microbe. 2012;12(5):611-22. 127. Shafquat A, Joice R, Simmons SL, Huttenhower C. Functional and phylogenetic assembly of microbial communities in the human microbiome. Trends in microbiology. 2014;22(5):261-6. 128. Qin J, Li R, Raes J, Arumugam M, Burgdorf KS, Manichanh C, et al. A human gut microbial gene catalogue established by metagenomic sequencing. nature. 2010;464(7285):59-65. 129. Turnbaugh PJ, Hamady M, Yatsunenko T, Cantarel BL, Duncan A, Ley RE, et al. A core gut microbiome in obese and lean twins. nature. 2009;457(7228):480-4. 130. Turnbaugh PJ, Gordon JI. The core gut microbiome, energy balance and obesity. The Journal of physiology. 2009;587(17):4153-8. 131. Jorth P, Turner KH, Gumus P, Nizam N, Buduneli N, Whiteley M. Metatranscriptomics of the human oral microbiome during health and disease. MBio. 2014;5(2):e01012-14.

155

132. Zarco M, Vess T, Ginsburg G. The oral microbiome in health and disease and the potential impact on personalized dental medicine. Oral diseases. 2012;18(2):109-20. 133. Rajendhran J, Gunasekaran P. Human microbiomics. Indian journal of microbiology. 2010;50(1):109-12. 134. Gill SR, Pop M, DeBoy RT, Eckburg PB, Turnbaugh PJ, Samuel BS, et al. Metagenomic analysis of the human distal gut microbiome. science. 2006;312(5778):1355-9. 135. Smits LP, Bouter KE, de Vos WM, Borody TJ, Nieuwdorp M. Therapeutic potential of fecal microbiota transplantation. Gastroenterology. 2013;145(5):946-53. 136. Gupta S, Allen-Vercoe E, Petrof EO. Fecal microbiota transplantation: in perspective. Therapeutic advances in gastroenterology. 2016;9(2):229-39. 137. Gophna U, Sommerfeld K, Gophna S, Doolittle WF, van Zanten SJV. Differences between tissue-associated intestinal microfloras of patients with Crohn's disease and ulcerative colitis. Journal of clinical microbiology. 2006;44(11):4136-41. 138. Manichanh C, Rigottier-Gois L, Bonnaud E, Gloux K, Pelletier E, Frangeul L, et al. Reduced diversity of faecal microbiota in Crohn’s disease revealed by a metagenomic approach. Gut. 2006;55(2):205-11. 139. Kassinen A, Krogius-Kurikka L, Mäkivuokko H, Rinttilä T, Paulin L, Corander J, et al. The fecal microbiota of irritable bowel syndrome patients differs significantly from that of healthy subjects. Gastroenterology. 2007;133(1):24-33. 140. Frank DN, Amand ALS, Feldman RA, Boedeker EC, Harpaz N, Pace NR. Molecular- phylogenetic characterization of microbial community imbalances in human inflammatory bowel diseases. Proceedings of the National Academy of Sciences. 2007;104(34):13780-5. 141. Scanlan PD, Shanahan F, Clune Y, Collins JK, O'Sullivan GC, O'Riordan M, et al. Culture‐independent analysis of the gut microbiota in colorectal cancer and polyposis. Environmental microbiology. 2008;10(3):789-98. 142. Spencer MD, Hamp TJ, Reid RW, Fischer LM, Zeisel SH, Fodor AA. Association between composition of the human gastrointestinal microbiome and development of fatty liver with choline deficiency. Gastroenterology. 2011;140(3):976-86. 143. Wang T, Cai G, Qiu Y, Fei N, Zhang M, Pang X, et al. Structural segregation of gut microbiota between colorectal cancer patients and healthy volunteers. The ISME journal. 2012;6(2):320-9. 144. Petersen C, Round JL. Defining dysbiosis and its influence on host immunity and disease. Cellular microbiology. 2014;16(7):1024-33. 145. Trompette A, Gollwitzer ES, Yadava K, Sichelstiel AK, Sprenger N, Ngom-Bru C, et al. Gut microbiota metabolism of dietary fiber influences allergic airway disease and hematopoiesis. Nature medicine. 2014;20(2):159-66. 146. Hsiao EY, McBride SW, Hsien S, Sharon G, Hyde ER, McCue T, et al. Microbiota modulate behavioral and physiological abnormalities associated with neurodevelopmental disorders. Cell. 2013;155(7):1451-63. 147. Garrett WS. Cancer and the microbiota. Science. 2015;348(6230):80-6. 148. Sheflin AM, Whitney AK, Weir TL. Cancer-promoting effects of microbial dysbiosis. Current oncology reports. 2014;16(10):1-9. 149. Baker JL, Bor B, Agnello M, Shi W, He X. Ecology of the oral microbiome: beyond bacteria. Trends in microbiology. 2017. 150. Ai D, Huang R, Wen J, Li C, Zhu J, Xia LC. Integrated metagenomic data analysis demonstrates that a loss of diversity in oral microbiota is associated with periodontitis. BMC genomics. 2017;18(1):1041.

156

151. Hajishengallis G, Darveau RP, Curtis MA. The keystone pathogen hypothesis. Nature reviews Microbiology. 2012;10(10):717. 152. Schwabe RF, Jobin C. The microbiome and cancer. Nature Reviews Cancer. 2013;13(11):800-12. 153. Gupta P, Warnakulasuriya S. Global epidemiology of areca nut usage. Addiction biology. 2002;7(1):77-83. 154. Hernandez BY, Zhu X, Goodman MT, Gatewood R, Mendiola P, Quinata K, et al. Betel nut chewing, oral premalignant lesions, and the oral microbiome. PloS one. 2017;12(2):e0172196. 155. Chang JS, Lo H-I, Wong T-Y, Huang C-C, Lee W-T, Tsai S-T, et al. Investigating the association between oral hygiene and head and neck cancer. Oral oncology. 2013;49(10):1010- 7. 156. Kerr AR. The Oral Microbiome and Cancer. American Dental Hygienists Association. 2015;89(suppl 1):20-3. 157. Aas JA, Paster BJ, Stokes LN, Olsen I, Dewhirst FE. Defining the normal bacterial flora of the oral cavity. Journal of clinical microbiology. 2005;43(11):5721-32. 158. Bik E, Long C, Armitage G, Loomer P, Emerson J, Mongodin E. Bacterial diversity in the oral cavity of 10 healthy individuals. The ISME journal. 2010; 4 (8): 962–74. Epub 2010/03/26. ismej201030 [pii] doi: 10.1038/ismej. 2010.30 PMID: 20336157. 159. Kumar PS, Matthews CR, Joshi V, de Jager M, Aspiras M. Tobacco smoking affects bacterial acquisition and colonization in oral biofilms. Infection and immunity. 2011;79(11):4730-8. 160. Wu J, Peters BA, Dominianni C, Zhang Y, Pei Z, Yang L, et al. Cigarette smoking and the oral microbiome in a large study of American adults. The ISME journal. 2016;10(10):2435-46. 161. Meyer MS, Joshipura K, Giovannucci E, Michaud DS. A review of the relationship between tooth loss, periodontal disease, and cancer. Cancer Causes & Control. 2008;19(9):895- 907. 162. Hayashi C, Gudino C, Gibson III F, Genco C. REVIEW: Pathogen‐induced inflammation at sites distant from oral infection: bacterial persistence and induction of cell‐specific innate immune inflammatory pathways. Molecular oral microbiology. 2010;25(5):305-16. 163. Nagaraja V, Eslick G. Systematic review with meta‐analysis: the relationship between chronic Salmonella typhi carrier status and gall‐bladder cancer. Alimentary pharmacology & therapeutics. 2014;39(8):745-50. 164. Hooper SJ, Wilson MJ, Crean SJ. Exploring the link between microorganisms and oral cancer: a systematic review of the literature. Head & neck. 2009;31(9):1228-39. 165. Siqueira JF, Fouad AF, Roˆcas IN. Pyrosequencing as a tool for better understanding of human microbiomes. Journal of oral microbiology. 2012;4. 166. Marsh PD, Head DA, Devine DA. Prospects of oral disease control in the future–an opinion. Journal of oral microbiology. 2014;6. 167. Takahashi N, Nyvad B. The role of bacteria in the caries process ecological perspectives. Journal of Dental Research. 2011;90(3):294-303. 168. Socransky S, Haffajee A, Cugini M, Smith C, Kent R. Microbial complexes in subgingival plaque. Journal of clinical periodontology. 1998;25(2):134-44. 169. Al‐hebshi N, Al‐Alimi A, Taiyeb‐Ali T, Jaafar N. Quantitative analysis of classical and new putative periodontal pathogens in subgingival biofilm: a case–control study. Journal of periodontal research. 2015;50(3):320-9. 170. Lloyd-Price J, Abu-Ali G, Huttenhower C. The healthy human microbiome. Genome medicine. 2016;8(1):1.

157

171. Flynn KJ, Baxter NT, Schloss PD. Metabolic and community synergy of oral bacteria in colorectal cancer. mSphere. 2016;1(3):e00102-16. 172. Nagy K, Sonkodi I, Szöke I, Nagy E, Newman H. The microflora associated with human oral carcinomas. Oral oncology. 1998;34(4):304-8. 173. Katz J, Onate MD, Pauley KM, Bhattacharyya I, Cha S. Presence of Porphyromonas gingivalis in gingival squamous cell carcinoma. International journal of oral science. 2011;3(4):209. 174. Tateda M, Shiga K, Saijo S, Sone M, Hori T, Yokoyama J, et al. Streptococcus anginosus in head and neck squamous cell carcinoma: implication in carcinogenesis. International journal of molecular medicine. 2000;6(6):699-1402. 175. Sasaki M, Yamaura C, Ohara‐Nemoto Y, Tajika S, Kodama Y, Ohya T, et al. Streptococcus anginosus infection in oral cancer and its infection route. Oral diseases. 2005;11(3):151-6. 176. Morita E, Narikiyo M, Yano A, Nishimura E, Igaki H, Sasaki H, et al. Different frequencies of Streptococcus anginosus infection in oral cancer and esophageal cancer. Cancer science. 2003;94(6):492-6. 177. Mager D, Haffajee A, Devlin P, Norris C, Posner M, Goodson J. The salivary microbiota as a diagnostic indicator of oral cancer: a descriptive, non-randomized study of cancer-free and oral squamous cell carcinoma subjects. Journal of translational medicine. 2005;3(1):27. 178. Al-Hebshi NN, Nasher AT, Idris AM, Chen T. Robust species taxonomy assignment algorithm for 16S rRNA NGS reads: application to oral carcinoma samples. Journal of oral microbiology. 2015;7. 179. Ahn J, Segers S, Hayes RB. Periodontal disease, Porphyromonas gingivalis serum antibody levels and orodigestive cancer mortality. Carcinogenesis. 2012:bgs112. 180. Woo BH, Kim D, Choi J, Kim S, Park B, Song J, et al. Oral cancer cells sustainedly infected with Porphyromonas gingivalis exhibit resistance to Taxol and have higher metastatic potential. Oncotarget. 2017. 181. Castellarin M, Warren RL, Freeman JD, Dreolini L, Krzywinski M, Strauss J, et al. Fusobacterium nucleatum infection is prevalent in human colorectal carcinoma. Genome research. 2012;22(2):299-306. 182. Xie H, Onsongo G, Popko J, de Jong EP, Cao J, Carlis JV, et al. Proteomics analysis of cells in whole saliva from oral cancer patients via value-added three-dimensional peptide fractionation and tandem mass spectrometry. Molecular & Cellular Proteomics. 2008;7(3):486- 98. 183. Nakhjiri SF, Park Y, Yilmaz O, Chung WO, Watanabe K, El-Sabaeny A, et al. Inhibition of epithelial cell apoptosis by Porphyromonas gingivalis. FEMS microbiology letters. 2001;200(2):145-9. 184. Yilmaz Ö, Jungas T, Verbeke P, Ojcius DM. Activation of the phosphatidylinositol 3- kinase/Akt pathway contributes to survival of primary epithelial cells infected with the periodontal pathogen Porphyromonas gingivalis. Infection and immunity. 2004;72(7):3743-51. 185. Mao S, Park Y, Hasegawa Y, Tribble GD, James CE, Handfield M, et al. Intrinsic apoptotic pathways of gingival epithelial cells modulated by Porphyromonas gingivalis. Cellular microbiology. 2007;9(8):1997-2007. 186. Yao L, Jermanus C, Barbetta B, Choi C, Verbeke P, Ojcius D, et al. Porphyromonas gingivalis infection sequesters pro‐apoptotic Bad through Akt in primary gingival epithelial cells. Molecular oral microbiology. 2010;25(2):89-101. 187. Moffatt CE, Lamont RJ. Porphyromonas gingivalis induction of microRNA-203 expression controls suppressor of cytokine signaling 3 in gingival epithelial cells. Infection and immunity. 2011;79(7):2632-7.

158

188. Kuboniwa M, Hasegawa Y, Mao S, Shizukuishi S, Amano A, Lamont RJ, et al. P. gingivalis accelerates gingival epithelial cell progression through the cell cycle. Microbes and Infection. 2008;10(2):122-8. 189. Groeger S, Domann E, Gonzales JR, Chakraborty T, Meyle J. B7-H1 and B7-DC receptors of oral squamous carcinoma cells are upregulated by Porphyromonas gingivalis. Immunobiology. 2011;216(12):1302-10. 190. Gallimidi AB, Fischman S, Revach B, Bulvik R, Maliutina A, Rubinstein AM, et al. Periodontal pathogens Porphyromonas gingivalis and Fusobacterium nucleatum promote tumor progression in an oral-specific chemical carcinogenesis model. Oncotarget. 2015;6(26):22613- 23. 191. Pan C, Xu X, Tan L, Lin L, Pan Y. The effects of Porphyromonas gingivalis on the cell cycle progression of human gingival epithelial cells. Oral diseases. 2014;20(1):100-8. 192. Zhou Y, Sztukowska M, Wang Q, Inaba H, Potempa J, Scott DA, et al. Noncanonical activation of β-catenin by Porphyromonas gingivalis. Infection and immunity. 2015;83(8):3195- 203. 193. Uitto V-J, Baillie D, Wu Q, Gendron R, Grenier D, Putnins EE, et al. Fusobacterium nucleatum increases collagenase 3 production and migration of epithelial cells. Infection and immunity. 2005;73(2):1171-9. 194. Rubinstein MR, Wang X, Liu W, Hao Y, Cai G, Han YW. Fusobacterium nucleatum promotes colorectal carcinogenesis by modulating E-cadherin/β-catenin signaling via its FadA adhesin. Cell host & microbe. 2013;14(2):195-206. 195. Inaba H, Sugita H, Kuboniwa M, Iwai S, Hamada M, Noda T, et al. Porphyromonas gingivalis promotes invasion of oral squamous cell carcinoma through induction of proMMP9 and its activation. Cellular microbiology. 2014;16(1):131-45. 196. Inaba H, Amano A, Lamont RJ, Murakami Y. Involvement of protease-activated receptor 4 in over-expression of matrix metalloproteinase 9 induced by Porphyromonas gingivalis. Medical microbiology and immunology. 2015;204(5):605-12. 197. Ha NH, Woo BH, Ha ES, Choi JI, Kim SJ, Park BS, et al. Prolonged and repetitive exposure to Porphyromonas gingivalis increases aggressiveness of oral cancer cells by promoting acquisition of cancer stem cell properties. Tumor Biology. 2015;36(12):9947-60. 198. Grivennikov SI, Greten FR, Karin M. Immunity, inflammation, and cancer. Cell. 2010;140(6):883-99. 199. Landskron G, De la Fuente M, Thuwajit P, Thuwajit C, Hermoso MA. Chronic inflammation and cytokines in the tumor microenvironment. Journal of immunology research. 2014;2014. 200. Kostic AD, Chun E, Robertson L, Glickman JN, Gallini CA, Michaud M, et al. Fusobacterium nucleatum potentiates intestinal tumorigenesis and modulates the tumor- immune microenvironment. Cell host & microbe. 2013;14(2):207-15. 201. Andrian E, Grenier D, Rouabhia M. In vitro models of tissue penetration and destruction by Porphyromonas gingivalis. Infection and immunity. 2004;72(8):4689-98. 202. Narikiyo M, Tanabe C, Yamada Y, Igaki H, Tachimori Y, Kato H, et al. Frequent and preferential infection of Treponema denticola, Streptococcus mitis, and Streptococcus anginosus in esophageal cancers. Cancer science. 2004;95(7):569-74. 203. Yumoto H, Nakae H, Yamada M, Fujinaka K, Shinohara C, Ebisu S, et al. Soluble products from Eikenella corrodens stimulate oral epithelial cells to induce inflammatory mediators. Oral microbiology and immunology. 2001;16(5):296-305. 204. Zakhari S. Overview: how is alcohol metabolized by the body? Alcohol Research & Health. 2006;29(4):245-55.

159

205. Seitz H, Gärtner U, Egerer G, Simanowski U. Ethanol metabolism in the gastrointestinal tract and its possible consequences. Alcohol and alcoholism (Oxford, Oxfordshire) Supplement. 1993;2:157-62. 206. Secretan B, Straif K, Baan R, Grosse Y, El Ghissassi F, Bouvard V, et al. A review of human carcinogens—Part E: tobacco, areca nut, alcohol, coal smoke, and salted fish. The lancet oncology. 2009;10(11):1033-4. 207. Seitz HK, Cho CH. Contribution of alcohol and tobacco use in gastrointestinal cancer development. Cancer Epidemiology: Modifiable Factors. 2009:217-41. 208. Homann N, Tillonen J, Meurman JH, Rintamäki H, Lindqvist C, Rautio M, et al. Increased salivary acetaldehyde levels in heavy drinkers and smokers: a microbiological approach to oral cavity cancer. Carcinogenesis. 2000;21(4):663-8. 209. Väkeväinen S, Mentula S, Nuutinen H, Salmela K, Jousimies-Somer H, Färkkilä M, et al. Ethanol-derived microbial production of carcinogenic acetaldehyde in achlorhydric atrophic gastritis. Scandinavian journal of gastroenterology. 2002;37(6):648-55. 210. Salaspuro MP. Acetaldehyde, microbes, and cancer of the digestive tract. Critical reviews in clinical laboratory sciences. 2003;40(2):183-208. 211. Kurkivuori J, Salaspuro V, Kaihovaara P, Kari K, Rautemaa R, Grönroos L, et al. Acetaldehyde production from ethanol by oral streptococci. Oral oncology. 2007;43(2):181-6. 212. Muto M, Hitomi Y, Ohtsu A, Shimada H, Kashiwase Y, Sasaki H, et al. Acetaldehyde production by non‐pathogenic Neisseria in human oral microflora: Implications for carcinogenesis in upper aerodigestive tract. International journal of cancer. 2000;88(3):342-50. 213. Xu H, Dongari-Bagtzoglou A. Shaping the oral mycobiota: interactions of opportunistic fungi with oral bacteria and the host. Current opinion in microbiology. 2015;26:65-70. 214. Dupuy AK, David MS, Li L, Heider TN, Peterson JD, Montano EA, et al. Redefining the human oral mycobiome with improved practices in amplicon-based taxonomy: discovery of Malassezia as a prominent commensal. PLoS One. 2014;9(3):e90899. 215. Huffnagle GB, Noverr MC. The emerging world of the fungal microbiome. Trends in microbiology. 2013;21(7):334-41. 216. Walsh TJ, Dixon DM. Spectrum of mycoses. Medical Microbiology. 1996:919-25. 217. Suhr MJ. Characterization and Investigation of Fungi Inhabiting the Gastrointestinal Tract of Healthy and Diseased Humans. 2015. 218. Sarvikivi E, Lyytikäinen O, Soll DR, Pujol C, Pfaller MA, Richardson M, et al. Emergence of fluconazole resistance in a Candida parapsilosis strain that caused infections in a neonatal intensive care unit. Journal of clinical microbiology. 2005;43(6):2729-35. 219. Muñoz P, Rojas L, Cervera C, Garrido G, Fariñas MC, Valerio M, et al. Poor compliance with antifungal drug use guidelines by transplant physicians: a framework for educational guidelines and an international consensus on patient safety. Clinical transplantation. 2012;26(1):87-96. 220. Mackie RI, Sghir A, Gaskins HR. Developmental microbial ecology of the neonatal gastrointestinal tract. The American journal of clinical nutrition. 1999;69(5):1035s-45s. 221. Beck JM, Young VB, Huffnagle GB. The microbiome of the lung. Translational Research. 2012;160(4):258-66. 222. Li Q, Wang C, Tang C, He Q, Li N, Li J. Dysbiosis of gut fungal microbiota is associated with mucosal inflammation in Crohn’s disease. Journal of clinical gastroenterology. 2014;48(6):513-23. 223. Zhang E, Tanaka T, Tajima M, Tsuboi R, Nishikawa A, Sugita T. Characterization of the skin fungal microbiota in patients with atopic dermatitis and in healthy subjects. Microbiology and immunology. 2011;55(9):625-32.

160

224. Perfect JR, Casadevall A, Heitman J, Filler S, Edwards J, Mitchell A. Fungal molecular pathogenesis: what can it do and why do we need it? Molecular principles of fungal pathogenesis. 2006:3-11. 225. Xuan C, Shamonki JM, Chung A, DiNome ML, Chung M, Sieling PA, et al. Microbial dysbiosis is associated with human breast cancer. PloS one. 2014;9(1):e83744. 226. Bernhardt H, Knoke M. Mycological aspects of gastrointestinal microflora. Scandinavian journal of gastroenterology. 1997;32(sup222):102-6. 227. Bernhardt H. Fungi in the intestine--normal flora or pathogens? Zeitschrift fur arztliche Fortbildung und Qualitatssicherung. 1998;92(3):154-6. 228. Landlinger C, Preuner S, Willinger B, Haberpursch B, Racil Z, Mayer J, et al. Species- specific identification of a wide range of clinically relevant fungal pathogens by use of Luminex xMAP technology. Journal of clinical Microbiology. 2009;47(4):1063-73. 229. Shehata AS, Mukherjee PK, Aboulatta HN, El Akhras AI, Abbadi SH, Ghannoum MA. Single-step PCR using (GACA) 4 primer: utility for rapid identification of dermatophyte species and strains. Journal of clinical microbiology. 2008;46(8):2641-5. 230. Borman AM, Linton CJ, Miles S-J, Johnson EM. Molecular identification of pathogenic fungi. Journal of Antimicrobial Chemotherapy. 2008;61(suppl 1):i7-i12. 231. Underhill DM, Iliev ID. The mycobiota: interactions between commensal fungi and the host immune system. Nature Reviews Immunology. 2014;14(6):405-16. 232. Diaz PI, Strausbaugh LD, Dongari-Bagtzoglou A. Fungal-bacterial interactions and their relevance to oral health: linking the clinic and the bench. 2014. 233. Kõljalg U, Nilsson RH, Abarenkov K, Tedersoo L, Taylor AF, Bahram M, et al. Towards a unified paradigm for sequence‐based identification of fungi. Molecular ecology. 2013;22(21):5271-7. 234. Shankar J, Solis NV, Mounaud S, Szpakowski S, Liu H, Losada L, et al. Using Bayesian modelling to investigate factors governing antibiotic-induced Candida albicans colonization of the GI tract. Scientific reports. 2015;5:8131. 235. Mukherjee PK, Chandra J, Retuerto M, Sikaroodi M, Brown RE, Jurevic R, et al. Oral mycobiome analysis of HIV-infected patients: identification of Pichia as an antagonist of opportunistic fungi. PLoS Pathog. 2014;10(3):e1003996. 236. Xu H, Sobue T, Thompson A, Xie Z, Poon K, Ricker A, et al. Streptococcal co‐infection augments Candida pathogenicity by amplifying the mucosal inflammatory response. Cellular microbiology. 2014;16(2):214-31. 237. McFarland LV, Bernasconi P. Saccharomyces boulardii'. A Review of an Innovative Biotherapeutic Agent. Microbial ecology in health and disease. 1993;6(4):157-71. 238. Gall F, Colella G, Di Onofrio V, Rossiello R, Angelillo IF, Liguori G. Candida spp. in oral cancer and oral precancerous lesions. New Microbiol. 2013;36(3):283-8. 239. Naglik JR, Challacombe SJ, Hube B. Candida albicans secreted aspartyl proteinases in virulence and pathogenesis. Microbiology and molecular biology reviews. 2003;67(3):400-28. 240. Cawson R. Leukoplakia and oral cancer. Proceedings of the Royal Society of Medicine. 1969;62(6):610. 241. McCullough M, Jaber M, Barrett A, Bain L, Speight P, Porter S. Oral yeast carriage correlates with presence of oral epithelial dysplasia. Oral oncology. 2002;38(4):391-3. 242. Sanjaya P, Gokul S, Patil BG, Raju R. Candida in oral pre-cancer and oral cancer. Medical hypotheses. 2011;77(6):1125-8. 243. Arzmi M, Alshwaimi E, Harun WW, Razak FA, Farina F, McCullough M, et al. Gaining more insight into the determinants of Candida species pathogenicity in the oral cavity. European Journal of Inflammation. 2014;12(2):227-35.

161

244. Nørgaard M, Thomsen RW, Farkas DK, Mogensen MF, Sørensen HT. Candida infection and cancer risk: a Danish nationwide cohort study. European journal of internal medicine. 2013;24(5):451-5. 245. Rodriguez MJ, Schneider J, Moragues MD, Martinez-Conde R, Ponton J, Aguirre JM. Cross-reactivity between Candida albicans and oral squamous cell carcinoma revealed by monoclonal antibody C7. Anticancer research. 2007;27(5B):3639-43. 246. Scully C, Ei-Kabir M, Samaranayake LP. Candida and oral candidosis: a review. Critical Reviews in Oral Biology & Medicine. 1994;5(2):125-57. 247. Reibel J. Prognosis of oral pre-malignant lesions: significance of clinical, histopathological, and molecular biological characteristics. Critical Reviews in Oral Biology & Medicine. 2003;14(1):47-62. 248. Alnuaimi AD, O'Brien-Simpson NM, Reynolds EC, McCullough MJ. Clinical isolates and laboratory reference Candida species and strains have varying abilities to form biofilms. FEMS yeast research. 2013;13(7):689-99. 249. Williams D, Lewis M. Pathogenesis and treatment of oral candidosis. Journal of oral microbiology. 2011;3. 250. Krogh P, Hald B, Holmstrup P. Possible mycological etiology of oral mucosal cancer: catalytic potential of infecting Candida aibicans and other yeasts in production of N- nitrosobenzylmethylamine. Carcinogenesis. 1987;8(10):1543-8. 251. Krogh P. The role of yeasts in oral cancer by means of endogenous nitrosation. Acta Odontologica Scandinavica. 1990;48(1):85-8. 252. Alnuaimi AD, Wiesenfeld D, O’Brien-Simpson NM, Reynolds EC, McCullough MJ. Oral Candida colonization in oral cancer patients and its relationship with traditional risk factors of oral cancer: a matched case-control study. Oral oncology. 2015;51(2):139-45. 253. Sitheeque M, Samaranayake L. Chronic hyperplastic candidosis/candidiasis (candidal leukoplakia). Critical Reviews in Oral Biology & Medicine. 2003;14(4):253-67. 254. Jawhara S, Mogensen E, Maggiotto F, Fradin C, Sarazin A, Dubuquoy L, et al. Murine model of dextran sulfate sodium-induced colitis reveals Candida glabrata virulence and contribution of β-mannosyltransferases. Journal of Biological Chemistry. 2012;287(14):11313- 24. 255. Netea MG, Gow NA, Munro CA, Bates S, Collins C, Ferwerda G, et al. Immune sensing of Candida albicans requires cooperative recognition of mannans and glucans by lectin and Toll-like receptors. The Journal of clinical investigation. 2006;116(6):1642-50. 256. Saijo S, Ikeda S, Yamabe K, Kakuta S, Ishigame H, Akitsu A, et al. Dectin-2 recognition of α-mannans and induction of Th17 cell differentiation is essential for host defense against Candida albicans. Immunity. 2010;32(5):681-91. 257. Iliev ID, Funari VA, Taylor KD, Nguyen Q, Reyes CN, Strom SP, et al. Interactions between commensal fungi and the C-type lectin receptor Dectin-1 influence colitis. Science. 2012;336(6086):1314-7. 258. Schreurs J. Cytokines in infectious disease: the battle between host and pathogen. Current opinion in biotechnology. 1993;4(6):727-33. 259. Nakamura T, Matsumoto K, Kiritoshi A, Tano Y, Nakamura T. Induction of hepatocyte growth factor in fibroblasts by tumor-derived factors affects invasive growth of tumor cells: in vitro analysis of tumor-stromal interactions. Cancer research. 1997;57(15):3305-13. 260. Rich AM, Reade PC. Epithelial–mesenchymal interactions in experimental oral mucosal carcinogenesis. Journal of oral pathology & medicine. 2001;30(7):389-97. 261. Collings A, Holmes A, Shepherd M. Secretion of end-products of metabolism by Candida species. Biomedical letters. 1991;46(184):285-96.

162

262. Alnuaimi AD, Ramdzan AN, Wiesenfeld D, O'Brien‐Simpson NM, Kolev SD, Reynolds EC, et al. Candida virulence and ethanol‐derived acetaldehyde production in oral cancer and non‐cancer subjects. Oral diseases. 2016;22(8):805-14. 263. Orozco AS, Zhou X, Filler SG. Mechanisms of the proinflammatory response of endothelial cells to Candida albicans infection. Infection and immunity. 2000;68(3):1134-41. 264. Karin M. Nuclear factor-κB in cancer development and progression. Nature. 2006;441(7092):431-6. 265. Mantovani A, Allavena P, Sica A, Balkwill F. Cancer-related inflammation. Nature. 2008;454(7203):436-44. 266. Netea M, Sutmuller R, Hermann C, Van der Graaf C, Van der Meer J, Adema G, et al. Toll- like receptor 2 inhibits cellular responses against Candida albicans through pathways mediated by IL-10 and CD4+ CD25+ regulatory T cells. J Immunol. 2004;172:3712-8. 267. Magee P. Nitrosamines and human cancer: introduction and overview. European Journal of Cancer Prevention. 1996;5:7-10. 268. Nieminen MT, Uittamo J, Salaspuro M, Rautemaa R. Acetaldehyde production from ethanol and glucose by non-Candidaalbicans yeasts in vitro. Oral oncology. 2009;45(12):e245- e8. 269. Uittamo J, Siikala E, Kaihovaara P, Salaspuro M, Rautemaa R. Chronic candidosis and oral cancer in APECED‐patients: Production of carcinogenic acetaldehyde from glucose and ethanol by Candida albicans. International Journal of Cancer. 2009;124(3):754-6. 270. Gainza‐Cirauqui M, Nieminen M, Novak Frazer L, Aguirre‐Urizar J, Moragues M, Rautemaa R. Production of carcinogenic acetaldehyde by Candida albicans from patients with potentially malignant oral mucosal disorders. Journal of Oral Pathology & Medicine. 2013;42(3):243-9. 271. Scully C. Oral squamous cell carcinoma; from an hypothesis about a virus, to concern about possible sexual transmission. Oral oncology. 2002;38(3):227-34. 272. Campisi G, Panzarella V, Giuliani M, Lajolo C, Di Fede O, Falaschini S, et al. Human papillomavirus: Its identikit and controversial role in oral oncogenesis, premalignant and malignant lesions (Review). Molecular biology. 2007;43:7. 273. Andrews E, Seaman WT, Webster-Cyriaque J. Oropharyngeal carcinoma in non-smokers and non-drinkers: a role for HPV. Oral oncology. 2009;45(6):486-91. 274. Rao SVK, Mejia G, Roberts-Thomson K, Logan R. Epidemiology of oral cancer in Asia in the past decade-an update (2000-2012). Asian Pacific Journal of Cancer Prevention. 2013;14(10):5567-77. 275. McLaughlin-Drubin ME, Munger K. Viruses associated with human cancer. Biochimica et Biophysica Acta (BBA)-Molecular Basis of Disease. 2008;1782(3):127-50. 276. Sunil M, Reid E, Lechowicz MJ. Update on HHV-8-associated malignancies. Current infectious disease reports. 2010;12(2):147-54. 277. Dupin N, Fisher C, Kellam P, Ariad S, Tulliez M, Franck N, et al. Distribution of human herpesvirus-8 latently infected cells in Kaposi’s sarcoma, multicentric Castleman’s disease, and primary effusion lymphoma. Proceedings of the National Academy of Sciences. 1999;96(8):4546- 51. 278. Statistics NCfH. International classification of diseases, 10th Revision. National Center for Health Statistics, Hyattsville. 2007. 279. Bouvard V, Baan R, Straif K, Grosse Y, Secretan B, El Ghissassi F, et al. A review of human carcinogens—Part B: biological agents. The lancet oncology. 2009;10(4):321-2. 280. Rautava J, Syrjänen S. Biology of human papillomavirus infections in head and neck carcinogenesis. Head and neck pathology. 2012;6(1):3-15.

163

281. Thomas J, Primeaux T. Is p16 immunohistochemistry a more cost-effective method for identification of human papilloma virus–associated head and neck squamous cell carcinoma? Annals of diagnostic pathology. 2012;16(2):91-9. 282. Duncan LD, Winkler M, Carlson ER, Heidel RE, Kang E, Webb D. P16 immunohistochemistry can be used to detect human papillomavirus in oral cavity squamous cell carcinoma. Journal of Oral and Maxillofacial Surgery. 2013;71(8):1367-75. 283. Lewis Jr JS. p16 Immunohistochemistry as a standalone test for risk stratification in oropharyngeal squamous cell carcinoma. Head and neck pathology. 2012;6(1):75-82. 284. Lewis Jr JS, Thorstad WL, Chernock RD, Haughey BH, Yip JH, Zhang Q, et al. p16 positive oropharyngeal squamous cell carcinoma: an entity with a favorable prognosis regardless of tumor HPV status. The American journal of surgical pathology. 2010;34(8). 285. Pannone G, Rodolico V, Santoro A, Lo Muzio L, Franco R, Botti G, et al. Evaluation of a combined triple method to detect causative HPV in oral and oropharyngeal squamous cell carcinomas: p16 Immunohistochemistry, Consensus PCR HPV-DNA, and In Situ Hybridization. Infect Agent Cancer. 2012;7(4). 286. Schlecht NF, Brandwein-Gensler M, Nuovo GJ, Li M, Dunne A, Kawachi N, et al. A comparison of clinically utilized human papillomavirus detection methods in head and neck cancer. Modern Pathology. 2011;24(10):1295-305. 287. Chen ZW, Weinreb I, Kamel-Reid S, Perez-Ordoñez B. Equivocal p16 immunostaining in squamous cell carcinoma of the head and neck: staining patterns are suggestive of HPV status. Head and neck pathology. 2012;6(4):422-9. 288. Arteaga CL, Adamson PC, Engelman JA, Foti M, Gaynor RB, Hilsenbeck SG, et al. AACR cancer progress report 2014. Clinical Cancer Research. 2014;20(19 Supplement):S1-S112. 289. Shojaeian Jalouli M. Oral cancer with special reference to virus detection and quantitative gene expression. 2016. 290. Hennessey P, Westra W, Califano J. Human papillomavirus and head and neck squamous cell carcinoma: recent evidence and clinical implications. Journal of dental research. 2009;88(4):300-6. 291. Cardoso J, Calonje E. Cutaneous manifestations of human papillomaviruses: a review. Acta dermatovenerologica Alpina, Pannonica, et Adriatica. 2011;20(3):145-54. 292. Stoler MH. Human papillomaviruses and cervical neoplasia: a model for carcinogenesis. International journal of gynecological pathology. 2000;19(1):16-28. 293. Miralles-Guri C, Bruni L, Cubilla A, Castellsague X, Bosch FX, De Sanjose S. Human papillomavirus prevalence and type distribution in penile carcinoma. Journal of Clinical Pathology. 2009;62(10):870-8. 294. Bodily J, Laimins LA. Persistence of human papillomavirus infection: keys to malignant progression. Trends in microbiology. 2011;19(1):33-9. 295. Klussmann JP, Gültekin E, Weissenborn SJ, Wieland U, Dries V, Dienes HP, et al. Expression of p16 protein identifies a distinct entity of tonsillar carcinomas associated with human papillomavirus. The American journal of pathology. 2003;162(3):747-53. 296. Vidal L, Gillison ML. Human papillomavirus in HNSCC: recognition of a distinct disease type. Hematology/oncology clinics of North America. 2008;22(6):1125-42. 297. Hemminki K, Dong C, Frisch M. Tonsillar and other upper aerodigestive tract cancers among cervical cancer patients and their husbands. European Journal of Cancer Prevention. 2000;9(6):433-7. 298. Soave DF, Celes MRN, Oliveira-Costa JP, da Silveira GG, Zanetti BR, Oliveira LR, et al. The Role of Human Papillomavirus in Pre-Cancerous Lesions and Oral Cancers. Ch. 2013;9:241-67.

164

299. Bertolus C, Goudot P, Gessain A, Berthet N. Clinical relevance of systematic human papillomavirus (HPV) diagnosis in oral squamous cell carcinoma. Infectious agents and cancer. 2012;7(1):1. 300. Clooney AG, Fouhy F, Sleator RD, O’Driscoll A, Stanton C, Cotter PD, et al. Comparing apples and oranges?: next generation sequencing and its impact on Microbiome analysis. PloS one. 2016;11(2):e0148028. 301. Morgan XC, Huttenhower C. Human microbiome analysis. PLoS Comput Biol. 2012;8(12):e1002808. 302. Krishnan K, Chen T, Paster B. A practical guide to the oral microbiome and its relation to health and disease. Oral diseases. 2016. 303. Pedersen AML. Oral Infections and General Health: Springer; 2016. 304. Hook E, Roddy R, Lukehart SA, Hom J, Holmes KK, Tam M. Detection of Treponema pallidum in lesion exudate with a pathogen-specific monoclonal antibody. Journal of clinical microbiology. 1985;22(2):241-4. 305. Theilade E, Wright W, Jensen SB, Löe H. Experimental gingivitis in man. Journal of periodontal research. 1966;1(1):1-13. 306. Hancock H, Sigurdsson A, Trope M, Moiseiwitsch J. Bacteria isolated after unsuccessful endodontic treatment in a North American population. Oral Surgery, Oral Medicine, Oral Pathology, Oral Radiology, and Endodontology. 2001;91(5):579-86. 307. Pussinen PJ, Vilkuna-Rautiainen T, Alfthan G, Mattila K, Asikainen S. Multiserotype enzyme-linked immunosorbent assay as a diagnostic aid for periodontitis in large-scale studies. Journal of clinical microbiology. 2002;40(2):512-8. 308. Amann RI, Ludwig W, Schleifer K-H. Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiological reviews. 1995;59(1):143-69. 309. Handelsman J. Metagenomics: application of genomics to uncultured microorganisms. Microbiology and molecular biology reviews. 2004;68(4):669-85. 310. Li L, Hsiao W, Nandakumar R, Barbuto S, Mongodin E, Paster B, et al. Analyzing endodontic infections by deep coverage pyrosequencing. Journal of dental research. 2010;89(9):980-4. 311. Diaz PI, Dupuy A, Abusleme L, Reese B, Obergfell C, Choquette L, et al. Using high throughput sequencing to explore the biodiversity in oral bacterial communities. Molecular oral microbiology. 2012;27(3):182-201. 312. Sanger F, Coulson AR. A rapid method for determining sequences in DNA by primed synthesis with DNA polymerase. Journal of molecular biology. 1975;94(3):441IN19447- 446IN20448. 313. Pace NR, Olsen GJ, Woese CR. Ribosomal RNA phylogeny and the primary lines of evolutionary descent. Cell. 1986;45(3):325-6. 314. Ward DM, Weller R, Bateson MM. 16S rRNA sequences reveal numerous uncultured microorganisms in a natural community. Nature. 1990;345(6270):63. 315. Alexander BD, Pfaller MA. Contemporary tools for the diagnosis and management of invasive mycoses. Clinical infectious diseases. 2006;43(Supplement 1):S15-S27. 316. Merz W, Roberts G. Algorithms for detection and identification of fungi. Manual of clinical microbiology Washington DC: American Society for Microbiology. 2003:1668-85. 317. Hageage GJ, Harrington BJ. Use of calcofluor white in clinical mycology. Laboratory Medicine. 1984;15(2):109-12. 318. Marloth RH. An apparatus for the study of matforming fungi in culture solutions. Science (New York, NY). 1929;69(1794):524-5.

165

319. Odds FC, Bernaerts R. CHROMagar Candida, a new differential isolation medium for presumptive identification of clinically important Candida species. Journal of clinical microbiology. 1994;32(8):1923-9. 320. Kaufman L. Laboratory methods for the diagnosis and confirmation of systemic mycoses. Clinical infectious diseases. 1992;14(Supplement 1):S23-S9. 321. Yeo SF, Wong B. Current status of nonculture methods for diagnosis of invasive fungal infections. Clinical microbiology reviews. 2002;15(3):465-84. 322. Musher B, Fredricks D, Leisenring W, Balajee SA, Smith C, Marr KA. Aspergillus galactomannan enzyme immunoassay and quantitative PCR for diagnosis of invasive aspergillosis with bronchoalveolar lavage fluid. Journal of clinical microbiology. 2004;42(12):5517-22. 323. Kawazu M, Kanda Y, Nannya Y, Aoki K, Kurokawa M, Chiba S, et al. Prospective comparison of the diagnostic potential of real-time PCR, double-sandwich enzyme-linked immunosorbent assay for galactomannan, and a (1→ 3)-β-d-glucan test in weekly screening for invasive aspergillosis in patients with hematological disorders. Journal of clinical microbiology. 2004;42(6):2733-41. 324. Iwen PC, Hinrichs S, Rupp M. Utilization of the internal transcribed spacer regions as molecular targets to detect and identify human fungal pathogens. Medical Mycology. 2002;40(1):87-109. 325. Duthie R, Denning DW. Aspergillus fungemia: report of two cases and review. Clinical infectious diseases. 1995;20(3):598-605. 326. Victor LY, Muder RR, Poorsattar A. Significance of isolation of Aspergillus from the respiratory tract in diagnosis of invasive pulmonary aspergillosis. Results from a three-year prospective study. The American journal of medicine. 1986;81(2):249-54. 327. Perfect J, Cox G, Lee J, Kauffman C, De Repentigny L, Chapman S, et al. The impact of culture isolation of Aspergillus species: a hospital-based survey of aspergillosis. Clinical Infectious Diseases. 2001;33(11):1824-33. 328. Rigby S, Procop GW, Haase G, Wilson D, Hall G, Kurtzman C, et al. Fluorescence in situ hybridization with peptide nucleic acid probes for rapid identification of Candida albicans directly from blood culture bottles. Journal of clinical microbiology. 2002;40(6):2182-6. 329. Wilson D, Joyce M, Hall L, Reller L, Roberts G, Hall G, et al. Multicenter evaluation of a Candida albicans peptide nucleic acid fluorescent in situ hybridization probe for characterization of yeast isolates from blood cultures. Journal of clinical microbiology. 2005;43(6):2909-12. 330. Upton A, Leisenring W, Marr KA. (1→ 3) β-d-glucan assay in the diagnosis of invasive fungal infections. Clinical infectious diseases. 2006;42(7):1054-6. 331. Hsiao CR, Huang L, Bouchara J-P, Barton R, Li HC, Chang TC. Identification of medically important molds by an oligonucleotide array. Journal of clinical microbiology. 2005;43(8):3760- 8. 332. Chemaly R, Procop G. Molecular detection and characterization of fungal pathogens. Molecular microbiology Washington, DC: American Society for Microbiology. 2004:551-60. 333. Sohrabi M, Nair RG, Samaranayake LP, Zhang L, Zulfiker AHM, Ahmetagic A, et al. The yield and quality of cellular and bacterial DNA extracts from human oral rinse samples are variably affected by the cell lysis methodology. Journal of microbiological methods. 2016;122:64-72. 334. Kumar S, Krishnani KK, Bhushan B, Brahmane MP. Metagenomics: retrospect and prospects in high throughput age. Biotechnology research international. 2015;2015. 335. Hodkinson BP, Grice EA. Next-generation sequencing: a review of technologies and tools for wound microbiome research. Advances in wound care. 2015;4(1):50-8.

166

336. Mardis ER. Next-generation sequencing platforms. Annual review of analytical chemistry. 2013;6:287-303. 337. Buermans H, Den Dunnen J. Next generation sequencing technology: advances and applications. Biochimica et Biophysica Acta (BBA)-Molecular Basis of Disease. 2014;1842(10):1932-41. 338. Horz H-P, Conrads G. Diagnosis and anti-infective therapy of periodontitis. Expert review of anti-infective therapy. 2007;5(4):703-15. 339. Lange V, Böhme I, Hofmann J, Lang K, Sauter J, Schöne B, et al. Cost-efficient high- throughput HLA typing by MiSeq amplicon sequencing. BMC genomics. 2014;15(1):63. 340. Fadrosh DW, Ma B, Gajer P, Sengamalay N, Ott S, Brotman RM, et al. An improved dual- indexing approach for multiplexed 16S rRNA gene sequencing on the Illumina MiSeq platform. Microbiome. 2014;2(1):6. 341. Sanger F, Nicklen S, Coulson AR. DNA sequencing with chain-terminating inhibitors. Proceedings of the national academy of sciences. 1977;74(12):5463-7. 342. Bentley DR, Balasubramanian S, Swerdlow HP, Smith GP, Milton J, Brown CG, et al. Accurate whole human genome sequencing using reversible terminator chemistry. nature. 2008;456(7218):53-9. 343. Janda JM, Abbott SL. 16S rRNA gene sequencing for bacterial identification in the diagnostic laboratory: pluses, perils, and pitfalls. Journal of clinical microbiology. 2007;45(9):2761-4. 344. Schloss PD, Gevers D, Westcott SL. Reducing the effects of PCR amplification and sequencing artifacts on 16S rRNA-based studies. PloS one. 2011;6(12):e27310. 345. Chakravorty S, Helb D, Burday M, Connell N, Alland D. A detailed analysis of 16S ribosomal RNA gene segments for the diagnosis of pathogenic bacteria. Journal of microbiological methods. 2007;69(2):330-9. 346. Klindworth A, Pruesse E, Schweer T, Peplies J, Quast C, Horn M, et al. Evaluation of general 16S ribosomal RNA gene PCR primers for classical and next-generation sequencing- based diversity studies. Nucleic acids research. 2013;41(1):e1-e. 347. Zheng W, Tsompana M, Ruscitto A, Sharma A, Genco R, Sun Y, et al. An accurate and efficient experimental approach for characterization of the complex oral microbiota. Microbiome. 2015;3(1):48. 348. Mao D-P, Zhou Q, Chen C-Y, Quan Z-X. Coverage evaluation of universal bacterial primers using the metagenomic datasets. BMC microbiology. 2012;12(1):66. 349. Polz MF, Cavanaugh CM. Bias in template-to-product ratios in multitemplate PCR. Applied and environmental Microbiology. 1998;64(10):3724-30. 350. Schoch CL, Seifert KA, Huhndorf S, Robert V, Spouge JL, Levesque CA, et al. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proceedings of the National Academy of Sciences. 2012;109(16):6241-6. 351. Dollive S, Peterfreund GL, Sherrill-Mix S, Bittinger K, Sinha R, Hoffmann C, et al. A tool kit for quantifying eukaryotic rRNA gene sequences from human microbiome samples. Genome biology. 2012;13(7):R60. 352. Findley K, Oh J, Yang J, Conlan S, Deming C, Meyer JA, et al. Topographic diversity of fungal and bacterial communities in human skin. Nature. 2013;498(7454):367-70. 353. Kelsey JL. Methods in observational epidemiology: Oxford University Press, USA; 1996. 354. Greene JC, Vermillion JR. The oral hygiene index: a method for classifying oral hygiene status. The Journal of the American Dental Association. 1960;61(2):172-9.

167

355. Al-hebshi NN, Alharbi FA, Mahri M, Chen T. Differences in the bacteriome of smokeless tobacco products with different oral carcinogenicity: compositional and predicted functional analysis. Genes. 2017;8(4):106. 356. Page RC, Eke PI. Case definitions for use in population-based surveillance of periodontitis. Journal of periodontology. 2007;78(7S):1387-99. 357. Amarasinghe H, Johnson NW, Lalloo R, Kumaraarachchi M, Warnakulasuriya S. Derivation and validation of a risk-factor model for detection of oral potentially malignant disorders in populations with high prevalence. British journal of cancer. 2010;103(3):303-9. 358. Wang B, Zhang S, Yue K, Wang X-D. The recurrence and survival of oral squamous cell carcinoma: a report of 275 cases. Chin J Cancer. 2013;32(11):614-8. 359. Sklenicka S, Gardiner S, Dierks EJ, Potter BE, Bell RB. Survival analysis and risk factors for recurrence in oral squamous cell carcinoma: does surgical salvage affect outcome? Journal of oral and maxillofacial surgery. 2010;68(6):1270-5. 360. Ferlay J, Soerjomataram I, Ervik M, Dikshit R, Eser S, Mathers C, et al. Cancer Incidence and Mortality Worldwide: IARC CancerBase No. 11. Lyon, France: International Agency for Research on Cancer. GLOBOCAN 2012 v1. 0, 2013. 2013. 361. Petti S. Lifestyle risk factors for oral cancer. Oral oncology. 2009;45(4):340-50. 362. Gupta B, Johnson NW, Kumar N. Global epidemiology of head and neck cancers: a continuing challenge. Oncology. 2016;91(1):13-23. 363. Thomas AM, Gleber-netto FO, Amorim MG, Francisco ALN, Carvalho MB, Kowalski LP, et al. A Metagenomic Survey Of Bacterial Populations In Oral Cavity Cancer. Head & Neck. 2015;37:E102-E3. 364. Schmidt BL, Dierks EJ, Homer L, Potter B. Tobacco smoking history and presentation of oral squamous cell carcinoma. Journal of oral and maxillofacial surgery. 2004;62(9):1055-8. 365. Guerrero-Preston R, Baez A, Blanco A, Berdasco M, Fraga M, Esteller M. Global DNA methylation: a common early event in oral cancer cases with exposure to environmental carcinogens or viral agents. Puerto Rico health sciences journal. 2009;28(1). 366. Schloss PD, Westcott SL. Assessing and improving methods used in operational taxonomic unit-based approaches for 16S rRNA gene sequence analysis. Applied and environmental microbiology. 2011;77(10):3219-26. 367. Gao Z, Guo B, Gao R, Zhu Q, Qin H. Microbiota disbiosis is associated with colorectal cancer. Frontiers in microbiology. 2015;6:20. 368. Frank JA, Reich CI, Sharma S, Weisbaum JS, Wilson BA, Olsen GJ. Critical evaluation of two primers commonly used for amplification of bacterial 16S rRNA genes. Applied and environmental microbiology. 2008;74(8):2461-70. 369. Lane DJ, Pace B, Olsen GJ, Stahl DA, Sogin ML, Pace NR. Rapid determination of 16S ribosomal RNA sequences for phylogenetic analyses. Proceedings of the National Academy of Sciences. 1985;82(20):6955-9. 370. Schloss PD, Westcott SL, Ryabin T, Hall JR, Hartmann M, Hollister EB, et al. Introducing mothur: open-source, platform-independent, community-supported software for describing and comparing microbial communities. Applied and environmental microbiology. 2009;75(23):7537- 41. 371. Pruesse E, Quast C, Knittel K, Fuchs BM, Ludwig W, Peplies J, et al. SILVA: a comprehensive online resource for quality checked and aligned ribosomal RNA sequence data compatible with ARB. Nucleic acids research. 2007;35(21):7188-96. 372. Edgar RC, Haas BJ, Clemente JC, Quince C, Knight R. UCHIME improves sensitivity and speed of chimera detection. Bioinformatics. 2011;27(16):2194-200.

168

373. Caporaso JG, Kuczynski J, Stombaugh J, Bittinger K, Bushman FD, Costello EK, et al. QIIME allows analysis of high-throughput community sequencing data. Nature methods. 2010;7(5):335-6. 374. Lozupone C, Lladser ME, Knights D, Stombaugh J, Knight R. UniFrac: an effective distance metric for microbial community comparison. The ISME journal. 2011;5(2):169. 375. Segata N, Izard J, Waldron L, Gevers D, Miropolsky L, Garrett WS, et al. Metagenomic biomarker discovery and explanation. Genome biology. 2011;12(6):R60. 376. Langille MG, Zaneveld J, Caporaso JG, McDonald D, Knights D, Reyes JA, et al. Predictive functional profiling of microbial communities using 16S rRNA marker gene sequences. Nature biotechnology. 2013;31(9):814-21. 377. Moore W, Holdeman L, Smibert R, Hash D, Burmeister J, Ranney R. Bacteriology of severe periodontitis in young adult humans. Infection and Immunity. 1982;38(3):1137-48. 378. Pennington K, Van Zyl M, Escalante P. Citrobacter koseri Pneumonia As Initial Presentation of Underlying Pulmonary Adenocarcinoma. Clinical Medicine Insights Case Reports. 2016;9:87. 379. Dzeing-Ella A, Szwebel T, Loubinoux J, Coignard S, Bouvet A, Le Jeunne C, et al. Infective endocarditis due to Citrobacter koseri in an immunocompetent adult. Journal of clinical microbiology. 2009;47(12):4185-6. 380. Takahashi T, Asami R, Tanabe K, Hirono Y, Nozawa Y, Chiba N, et al. Clinical aspects of invasive infection with Streptococcus dysgalactiae subsp. equisimilis in elderly patients. Journal of infection and chemotherapy. 2010;16(1):68-71. 381. Yong AS-M, Lau SY, Woo TH, Li JY, Yong TY. Streptococcus dysgalactiae endocarditis presenting as acute endophthalmitis. Infectious disease reports. 2012;4(1). 382. Markou P, Apidianakis Y. Pathogenesis of intestinal Pseudomonas aeruginosa infection in patients with cancer. Model organisms in inflammation and cancer. 2014:6. 383. Elsen S, Collin-Faure V, Gidrol X, Lemercier C. The opportunistic pathogen Pseudomonas aeruginosa activates the DNA double-strand break signaling and repair pathway in infected cells. Cellular and molecular life sciences. 2013;70(22):4385-97. 384. Gellatly SL, Hancock RE. Pseudomonas aeruginosa: new insights into pathogenesis and host defenses. Pathogens and disease. 2013;67(3):159-73. 385. de Lima CDM, Calegari-Silva TC, Pereira RMS, Santos SAdOL, Lopes UG, Plotkowski M- CM, et al. ExoU activates NF-κB and increases IL-8/KC secretion during Pseudomonas aeruginosa infection. PloS one. 2012;7(7):e41772. 386. Alvarez MA, Kitts CL, Unkefer PJ, Botsford JL. Pseudomonas aeruginosa strain MA01 aerobically metabolizes the aminodinitrotoluenes produced by 2, 4, 6-trinitrotoluene nitro group reduction. Canadian journal of microbiology. 1995;41(11):984-91. 387. Al-hebshi NN, Abdulhaq A, Albarrag A, Basode VK, Chen T. Species-level core oral bacteriome identified by 16S rRNA pyrosequencing in a healthy young Arab population. Journal of oral microbiology. 2016;8. 388. Wang J, Qi J, Zhao H, He S, Zhang Y, Wei S, et al. Metagenomic sequencing reveals microbiota and its functional potential associated with periodontal disease. Scientific reports. 2013;3:1843. 389. Kirst ME, Li EC, Alfant B, Chi Y-Y, Walker C, Magnusson I, et al. Dysbiosis and alterations in predicted functions of the subgingival microbiome in chronic periodontitis. Applied and environmental microbiology. 2015;81(2):783-93. 390. Li S, Xu X, Jiang M, Bi Y, Xu J, Han M. Lipopolysaccharide induces inflammation and facilitates lung metastasis in a breast cancer model via the prostaglandin E2-EP2 pathway. Molecular medicine reports. 2015;11(6):4454-62.

169

391. Hsu RY, Chan CH, Spicer JD, Rousseau MC, Giannias B, Rousseau S, et al. LPS-induced TLR4 signaling in human colorectal cancer cells increases β1 integrin-mediated cell adhesion and liver metastasis. Cancer research. 2011;71(5):1989-98. 392. Goldin BR, Gorbach SL. The effect of milk and lactobacillus feeding on human intestinal bacterial enzyme activity. The American journal of clinical nutrition. 1984;39(5):756-61. 393. Spanggord RJ, Spain J, Nishino S, Mortelmans K. Biodegradation of 2, 4-dinitrotoluene by a Pseudomonas sp. Applied and Environmental Microbiology. 1991;57(11):3200-5. 394. Haigler BE, Spain J. Biodegradation of 4-nitrotoluene by Pseudomonas sp. strain 4NT. Applied and environmental microbiology. 1993;59(7):2239-43. 395. Grummt T, Wunderlich HG, Chakraborty A, Kundi M, Majer B, Ferk F, et al. Genotoxicity of nitrosulfonic acids, nitrobenzoic acids, and nitrobenzylalcohols, pollutants commonly found in ground water near ammunition facilities. Environmental and molecular mutagenesis. 2006;47(2):95-106. 396. Arora PK, Sharma A. New metabolic pathway for degradation of 2-nitrobenzoate by Arthrobacter sp. SPG. Frontiers in microbiology. 2015;6:551. 397. Claus SP, Guillou H, Ellero-Simatos S. The gut microbiota: a major player in the toxicity of environmental pollutants? npj Biofilms and Microbiomes. 2016;2:16003. 398. Hakomori S-i. Tumor malignancy defined by aberrant glycosylation and sphingo (glyco) lipid metabolism. Cancer research. 1996;56(23):5309-18. 399. Mager DL, Ximenez‐Fyvie LA, Haffajee AD, Socransky SS. Distribution of selected bacterial species on intraoral surfaces. Journal of clinical periodontology. 2003;30(7):644-54. 400. Raghunand N, Gatenby R, and, Gillies R. Microenvironmental and cellular consequences of altered blood flow in tumours. The British journal of radiology. 2003;76(suppl_1):S11-S22. 401. Takahashi N. Acid‐neutralizing activity during amino acid fermentation by Porphyromonas gingivalis, Prevotella intermedia and Fusobacterium nucleatum. Molecular Oral Microbiology. 2003;18(2):109-13. 402. Glassing A, Dowd SE, Galandiuk S, Davis B, Chiodini RJ. Inherent bacterial DNA contamination of extraction and sequencing reagents may affect interpretation of microbiota in low bacterial biomass samples. Gut pathogens. 2016;8(1):24. 403. Salter SJ, Cox MJ, Turek EM, Calus ST, Cookson WO, Moffatt MF, et al. Reagent and laboratory contamination can critically impact sequence-based microbiome analyses. BMC biology. 2014;12(1):87. 404. Syrjänen S. Human papillomavirus (HPV) in head and neck cancer. Journal of clinical virology. 2005;32:59-66. 405. Gupta B, Johnson NW. Systematic review and meta-analysis of association of smokeless tobacco and of betel quid without tobacco with incidence of oral cancer in South Asia and the Pacific. PloS one. 2014;9(11):e113385. 406. Sankari SL, Gayathri K, Balachander N, Malathi L. Candida in potentially malignant oral disorders. Journal of pharmacy & bioallied sciences. 2015;7(Suppl 1):S162. 407. Čanković M, Bokor-Bratić M. Candida albicans infection in patients with oral squamous cell carcinoma. Vojnosanitetski pregled. 2010;67(9):766-70. 408. Jahanshahi G, Shirani S. Detection of Candida albicans in oral squamous cell carcinoma by fluorescence staining technique. Dental research journal. 2015;12(2):115. 409. Berkovits C, Tóth A, Szenzenstein J, Deák T, Urbán E, Gácser A, et al. Analysis of oral yeast microflora in patients with oral squamous cell carcinoma. SpringerPlus. 2016;5(1):1257. 410. White JR, Nagarajan N, Pop M. Statistical methods for detecting differentially abundant features in clinical metagenomic samples. PLoS Comput Biol. 2009;5(4):e1000352.

170

411. Zhang J, Kobert K, Flouri T, Stamatakis A. PEAR: a fast and accurate Illumina Paired-End reAd mergeR. Bioinformatics. 2014;30(5):614-20. 412. Schloss PD, Westcott SL, Ryabin T, Hall JR, Hartmann M, Hollister EB, et al. Introducing mothur: open-source, platform-independent, community-supported software for describing and comparing microbial communities. Appl Environ Microbiol. 2009;75(23):7537-41. 413. Edgar RC, Haas BJ, Clemente JC, Quince C, Knight R. UCHIME improves sensitivity and speed of chimera detection. Bioinformatics. 2011;27(16):2194-200. 414. Al-hebshi NN. Composition and imputed functions of the bacteriome in smokeless tobacco products with different oral carcinogenicity. Genes. 2017:In press. 415. Koljalg U, Nilsson RH, Abarenkov K, Tedersoo L, Taylor AF, Bahram M, et al. Towards a unified paradigm for sequence-based identification of fungi. Mol Ecol. 2013;22(21):5271-7. 416. Edgar RC. Search and clustering orders of magnitude faster than BLAST. Bioinformatics. 2010;26(19):2460-1. 417. Segata N, Izard J, Waldron L, Gevers D, Miropolsky L, Garrett WS, et al. Metagenomic biomarker discovery and explanation. Genome Biol. 2011;12(6):R60. 418. Muzurovic S, Babajic E, Masic T, Smajic R, Selmanagic A. The relationship between oral hygiene and oral colonisation with Candida species. Medical Archives. 2012;66(6):415. 419. O'Grady JF, Reade PC. Candida albicans as a promoter of oral mucosal neoplasia. Carcinogenesis. 1992;13(5):783-6. 420. Mohd Bakri M, Mohd Hussaini H, Rachel Holmes A, David Cannon R, Mary Rich A. Revisiting the association between candidal infection and carcinoma, particularly oral squamous cell carcinoma. J Oral Microbiol. 2010;2. 421. Landell MF, Brandao LR, Barbosa AC, Ramos JP, Safar SV, Gomes FC, et al. Hannaella pagnoccae sp. nov., a tremellaceous yeast species isolated from plants and soil. Int J Syst Evol Microbiol. 2014;64(Pt 6):1970-7. 422. Sidhu GS. Gibberella spp., pathogens of many crop species. In: Sidhu GS, editor. Genetics of Plant Pathogenic Fungi. Advances in plant Pathology. Volume 6. London: Academic Press Limited; 1988. p. 159-67. 423. Howard PC, Eppley RM, Stack ME, Warbritton A, Voss KA, Lorentzen RJ, et al. Fumonisin b1 carcinogenicity in a two-year feeding study using F344 rats and B6C3F1 mice. Environ Health Perspect. 2001;109 Suppl 2:277-82. 424. Prohic A, Jovovic Sadikovic T, Krupalija-Fazlic M, Kuskunovic-Vlahovljak S. Malassezia species in healthy skin and in dermatological conditions. Int J Dermatol. 2016;55(5):494-504. 425. Bladt TT, Frisvad JC, Knudsen PB, Larsen TO. Anticancer and antifungal compounds from Aspergillus, Penicillium and other filamentous fungi. Molecules. 2013;18(9):11338-76. 426. Lou J, Fu L, Peng Y, Zhou L. Metabolites from Alternaria fungi and their bioactivities. Molecules. 2013;18(5):5891-935. 427. Nidhiya KA, Satya E, Nitya MR, Saranya A, Suganthi R. In vitro anticancer potential of statin from Aspergillus tamarii grd119. Asian J Pharm Clin Res. 2015;8(5):147-53. 428. Raj KG, Sambantham S, Manikanadan R, Arulvasu C, Pandi M. Fungal taxol extracted from Cladosporium oxysporum induces apoptosis in T47D human breast cancer cell line. Asian Pac J Cancer Prev. 2014;15(16):6627-32. 429. Bladt TT, Frisvad JC, Knudsen PB, Larsen TO. Anticancer and antifungal compounds from Aspergillus, Penicillium and other filamentous fungi. Molecules. 2013;18(9):11338-76. 430. 高橋千加子, 義平邦利, 名取信策, 梅田誠. The structures of toxic metabolites of Aspergillus candidus. I. The compounds A and E, cytotoxic p-terphenyls. Chemical and Pharmaceutical Bulletin. 1976;24(4):613-20.

171

431. Zhu D-M, Narla R-K, Fang W-H, Chia N-C, Uckun FM. Calphostin C triggers calcium- dependent apoptosis in human acute lymphoblastic leukemia cells. Clinical cancer research. 1998;4(12):2967-76. 432. Perera M, Al-hebshi NN, Perera I, Ipe D, Ulett G, Speicher DJ, et al. A Dysbiotic Mycobiome Dominated by Candida albicans is Identified within Oral Squamous Cell Carcinomas. 2017. 433. Govindappa M. First report of anticancer agent, lapachol producing endophyte, Aspergillus niger of Tabebuia argentea and its in vitro cytotoxicity assays. Bangladesh Journal of Pharmacology. 2014;9(1):129-39. 434. Ehsanullah M, Filipe MI, Gazzard B. Mucin secretion in inflammatory bowel disease: correlation with disease activity and dysplasia. Gut. 1982;23(6):485-9. 435. Stewart B, Wild CP. World cancer report 2014. World. 2015. 436. Gunasekera SK, Perera KA, Fernando C, Udagama PV. A shifting paradigm in the aetiology of oral and pharyngeal cancer in Sri Lanka: a case-control study providing serologic evidence for the role of oncogenic HPV types 16 and 18. Infectious agents and cancer. 2015;10(1):12. 437. Erhart SMM, Rivero ERC, Bazzo ML, Onofre ASC. Comparative evaluation of the GP5+/6+, MY09/11 and PGMY09/11 primer sets for HPV detection by PCR in oral squamous cell carcinomas. Experimental and molecular pathology. 2016;100(1):13-6. 438. Qu W, Jiang G, Cruz Y, Chang CJ, Ho G, Klein RS, et al. PCR detection of human papillomavirus: comparison between MY09/MY11 and GP5+/GP6+ primer systems. Journal of clinical microbiology. 1997;35(6):1304-10. 439. Marocchio LS, Lima J, Sperandio FF, Corrêa L, de Sousa SO. Oral squamous cell carcinoma: an analysis of 1,564 cases showing advances in early detection. Journal of oral science. 2010;52(2):267-73. 440. Torrente MC, Ampuero S, Abud M, Ojeda JM. Molecular detection and typing of human papillomavirus in laryngeal carcinoma specimens. Acta oto-laryngologica. 2005;125(8):888-93. 441. Jalouli M, Jalouli J, Ibrahim SO, Hirsch J-M, Sand L. Comparison Between Single PCR and Nested PCR in Detection of Human Papilloma Viruses in Paraffin-embedded OSCC and Fresh Oral Mucosa. In Vivo. 2015;29(1):65-70. 442. Thompson MP, Kurzrock R. Epstein-Barr virus and cancer. Clinical Cancer Research. 2004;10(3):803-21. 443. Andersson J. An Overview of Epstein-Barr Virus: from Discovery to Future Directions for Treatment and Prevention. Herpes: the journal of the IHMF. 2000;7(3):76-82. 444. Prabhu SR, Wilson DF. Evidence of Epstein–Barr virus association with head and neck cancers: a review. J Can Dent Assoc. 2016;82(g2):1488-2159. 445. Shah K, Young LS. Epstein–Barr virus and carcinogenesis: beyond Burkitt’s lymphoma. Clinical Microbiology and Infection. 2009;15(11):982-8. 446. Kieser A, Sterz KR. The Latent Membrane Protein 1 (LMP1). Epstein Barr Virus Volume 2: Springer; 2015. p. 119-49. 447. Raab-Traub N, editor Epstein–Barr virus in the pathogenesis of NPC. Seminars in cancer biology; 2002: Elsevier. 448. Young LS, Rickinson AB. Epstein–Barr virus: 40 years on. Nature Reviews Cancer. 2004;4(10):757-68. 449. Yen C-Y, Lu M-C, Tzeng C-C, Huang J-Y, Chang H-W, Chen R-S, et al. Detection of EBV infection and gene expression in oral cancer from patients in Taiwan by microarray analysis. BioMed Research International. 2009;2009.

172

450. Horiuchi K, Mishima K, Ichijima K, Sugimura M, Ishida T, Kirita T. Epstein-Barr virus in the proliferative diseases of squamous epithelium in the oral cavity. Oral Surgery, Oral Medicine, Oral Pathology, Oral Radiology, and Endodontology. 1995;79(1):57-63. 451. Gupta K, Metgud R. Evidences suggesting involvement of viruses in oral squamous cell carcinoma. Pathology research international. 2013;2013. 452. Acharya S, Ekalaksananan T, Vatanasapt P, Loyha K, Phusingha P, Promthet S, et al. Association of Epstein‐Barr virus infection with oral squamous cell carcinoma in a case–control study. Journal of Oral Pathology & Medicine. 2015;44(4):252-7. 453. D'Costa J, Saranath D, Sanghvi V, Mehta AR. Epstein‐Barr virus in tobacco‐induced oral cancers and oral lesions in patients from India. Journal of oral pathology & medicine. 1998;27(2):78-82. 454. Kis A, Fehér E, Gáll T, Tar I, Boda R, Tóth ED, et al. Epstein–Barr virus prevalence in oral squamous cell cancer and in potentially malignant oral disorders in an eastern Hungarian population. European journal of oral sciences. 2009;117(5):536-40. 455. Higa M, Kinjo T, Kamiyama K, Chinen K, Iwamasa T, Arasaki A, et al. Epstein–Barr virus (EBV)-related oral squamous cell carcinoma in Okinawa, a subtropical island, in southern Japan—simultaneously infected with human papillomavirus (HPV). Oral oncology. 2003;39(4):405-14. 456. González-Moles M, Gutiérrez J, Ruiz I, Fernández J, Rodriguez M, Aneiros J. Epstein-Barr virus and oral squamous cell carcinoma in patients without HIV infection: viral detection by polymerase chain reaction. Microbios. 1997;96(383):23-31. 457. Kobayashi I, Shima K, Saito I, Kiyoshima T, Matsuo K, Ozeki S, et al. Prevalence of Epstein–Barr virus in oral squamous cell carcinoma. The Journal of pathology. 1999;189(1):34-9. 458. Tsuhako K, Nakazato I, Miyagi J, Iwamasa T, Arasaki A, Hiratsuka H, et al. Comparative study of oral squamous cell carcinoma in Okinawa, Southern Japan and Sapporo in Hokkaido, Northern Japan; with special reference to human papillomavirus and Epstein‐Barr virus infection. Journal of oral pathology & medicine. 2000;29(2):70-9. 459. Jang HS, Cho JO, Yoon CY, Kim HJ, Park JC. Demonstration of Epstein–Barr virus in odontogenic and nonodontogenic tumors by the polymerase chain reaction (PCR). Journal of oral pathology & medicine. 2001;30(10):603-10. 460. Shimakage M, Horii K, Tempaku A, Kakudo K, Shirasaka T, Sasagawa T. Association of Epstein-Barr virus with oral cancers. Human pathology. 2002;33(6):608-14. 461. Saravani S, Miri-Moghaddam E, Sanadgol N, Kadeh H, Nazeri MR. Human Herpesvirus 6 and Epstein-Barr virus Infections at Different Histopathological Grades of Oral Squamous Cell Carcinomas. International journal of preventive medicine. 2014;5(10). 462. Began J, Jiménez Y, Murillo J, Poveda R, Diaz JM, Sanchis J, et al. Epstein-Barr virus in oral proliferative verrucous leukoplakia and squamous cell carcinoma: A preliminary study. MEDICINA ORAL PATOLOGIA ORAL Y CIRUGIA BUCAL. 2008;13(2):110. 463. Tsang NM, Chang KP, Lin SY, Hao SP, Tseng CK, Kuo Tt, et al. Detection of Epstein‐Barr Virus–Derived Latent Membrane Protein‐1 Gene in Various Head and Neck Cancers: Is It Specific for Nasopharyngeal Carcinoma? The Laryngoscope. 2003;113(6):1050-4. 464. Iamaroon A, Khemaleelakul U, Pongsiriwet S, Pintong J. Co‐expression of p53 and Ki67 and lack of EBV expression in oral squamous cell carcinoma. Journal of oral pathology & medicine. 2004;33(1):30-6. 465. Xu F-H, Xiong D, Xu Y-F, Cao S-M, Xue W-Q, Qin H-D, et al. An epidemiological and molecular study of the relationship between smoking, risk of nasopharyngeal carcinoma, and Epstein–Barr virus activation. Journal of the National Cancer Institute. 2012;104(18):1396-410.

173

466. Fang CY, Lee CH, Wu CC, Chang YT, Yu SL, Chou SP, et al. Recurrent chemical reactivations of EBV promotes genome instability and enhances tumor progression of nasopharyngeal carcinoma cells. International journal of cancer. 2009;124(9):2016-25. 467. Xu F-H, Xiong D, Xu Y-F, Cao S-M, Xue W-Q, Qin H-D, et al. An epidemiological and molecular study of the relationship between smoking, risk of nasopharyngeal carcinoma, and Epstein–Barr virus activation. Journal of the National Cancer Institute. 2012. 468. Nasher AT, Al-hebshi NN, Al-Moayad EE, Suleiman AM. Viral infection and oral habits as risk factors for oral squamous cell carcinoma in Yemen: a case-control study. Oral surgery, oral medicine, oral pathology and oral radiology. 2014;118(5):566-72. e1. 469. Chang Y, Cesarman E, Pessin MS, Lee F. Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi's sarcoma. Science. 1994;266(5192):1865. 470. Cancer IAfRo. Cancer in Africa: epidemiology and prevention. IARC scientific Publications. 2003(153):1. 471. Speicher D, Johnson NW. Comparison of salivary collection and processing methods for quantitative HHV‐8 detection. Oral diseases. 2014;20(7):720-8. 472. Yang Y-Y, Koh L-W, Tsai J-H, Tsai C-H, Wong EF-C, Lin S-J, et al. Involvement of viral and chemical factors with oral cancer in Taiwan. Japanese journal of clinical oncology. 2004;34(4):176-83. 473. McLemore MS, Haigentz Jr M, Smith RV, Nuovo GJ, Alos L, Cardesa A, et al. Head and neck squamous cell carcinomas in HIV-positive patients: a preliminary investigation of viral associations. Head and neck pathology. 2010;4(2):97-105. 474. Venceslau EM, Bezerra MM, Lopes ACM, Souza ÉV, Onofre ASC, Melo CMd, et al. HPV detection using primers MY09/MY11 and GP5+/GP6+ in patients with cytologic and/or colposcopic changes. Jornal Brasileiro de Patologia e Medicina Laboratorial. 2014;50(4):280-5. 475. Antonsson A, Nancarrow DJ, Brown IS, Green AC, Drew PA, Watson DI, et al. High-risk human papillomavirus in esophageal squamous cell carcinoma. Cancer Epidemiology and Prevention Biomarkers. 2010;19(8):2080-7. 476. Hammock L, Reisenauer A, Wang W, Cohen C, Birdsong G, Folpe AL. Latency-associated nuclear antigen expression and human herpesvirus-8 polymerase chain reaction in the evaluation of Kaposi sarcoma and other vascular tumors in HIV-positive patients. Modern pathology. 2005;18(4):463-8. 477. Ferlay J, Soerjomataram I, Dikshit R, Eser S, Mathers C, Rebelo M, et al. Cancer incidence and mortality worldwide: sources, methods and major patterns in GLOBOCAN 2012. International journal of cancer. 2015;136(5):E359-E86. 478. Rao SK, Mejia G, Roberts-Thomson K, Logan R. Epidemiology of oral cancer in Asia in the past decade-an update (2000-2012). Asian Pac J Cancer Prev. 2013;14(10):5567-77. 479. Laprise C, Puthiyannal Shahul H, Arekunnath Madathil S, Soman Thekkepurakkal A, Castonguay G, Varghese I, et al. Periodontal diseases and risk of oral cancer in Southern India: Results from the HeNCe Life study. International journal of cancer. 2016. 480. Gillison ML, D'souza G, Westra W, Sugar E, Xiao W, Begum S, et al. Distinct risk factor profiles for human papillomavirus type 16–positive and human papillomavirus type 16–negative head and neck cancers. Journal of the National Cancer Institute. 2008;100(6):407-20. 481. Fakhry C, D’Souza G. Discussing the diagnosis of HPV-OSCC: Common questions and answers. Oral oncology. 2013;49(9):863-71. 482. Kerishnan JP, Gopinath SC, Kai SB, Tang T-H, Ng HL-C, Rahman ZAA, et al. Detection of Human Papillomavirus 16-Specific IgG and IgM Antibodies in Patient Sera: A Potential Indicator of Oral Squamous Cell Carcinoma Risk Factor. International journal of medical sciences. 2016;13(6):424.

174

483. Gupta B, Kumar N, Johnson N. Relationship of Lifetime Exposure to Tobacco, Alcohol and Second Hand Tobacco Smoke with Upper aero-digestive tract cancers in India: a Case- Control Study with a Life-Course Perspective. Asian Pacific journal of cancer prevention: APJCP. 2017;18(2):347. 484. Amarasinghe HK, Usgodaarachchi U, Kumaraarachchi M, Johnson NW, Warnakulasuriya S. Diet and risk of oral potentially malignant disorders in rural Sri Lanka. Journal of Oral Pathology & Medicine. 2013;42(9):656-62. 485. Garavello W, Lucenteforte E, Bosetti C, Talamini R, Levi F, Tavani A, et al. Diet diversity and the risk of laryngeal cancer: a case–control study from Italy and Switzerland. Oral oncology. 2009;45(1):85-9. 486. De Stefani E, Deneo-Pellegrini H, Mendilaharsu M, Ronco A. Diet and risk of cancer of the upper aerodigestive tract—I. Foods. Oral oncology. 1999;35(1):17-21. 487. De Stefani E, Oreggia F, Boffetta P, Deneo-Pellegrini H, Ronco A, Mendilaharsu M. Tomatoes, tomato-rich foods, lycopene and cancer of the upper aerodigestive tract: a case- control in Uruguay. Oral oncology. 2000;36(1):47-53. 488. Guha N, Boffetta P, Wünsch Filho V, Neto JE, Shangina O, Zaridze D, et al. Oral health and risk of squamous cell carcinoma of the head and neck and esophagus: results of two multicentric case-control studies. American journal of epidemiology. 2007;166(10):1159-73. 489. Zheng T, Boyle P, Hu H, Duan J, Jiang P, Ma D, et al. Dentition, oral hygiene, and risk of oral cancer: a case-control study in Beijing, People's Republic of China. Cancer Causes & Control. 1990;1(3):235-41. 490. Maier H, Zöller J, Herrmann A, Kreiss M, Heller W-D. Dental status and oral hygiene in patients with head and neck cancer. Otolaryngology--Head and Neck Surgery. 1993;108(6):655- 61. 491. Velly A, Franco E, Schlecht N, Pintos J, Kowalski LP, Oliveira BVd, et al. Relationship between dental factors and risk of upper aerodigestive tract cancer. Oral oncology. 1998;34(4):284-91. 492. Rosenquist K, Wennerberg J, Schildt E-B, Bladström A, Göran Hansson B, Andersson G. Oral status, oral infections and some lifestyle factors as risk factors for oral and oropharyngeal squamous cell carcinoma. A population-based case-control study in southern Sweden. Acta oto- laryngologica. 2005;125(12):1327-36. 493. Smith ML, Mott A, Marques C, Maor Y, de Andrade M, Rodrigues V, et al. Position paper: epidemiology of periodontal diseases. Journal of periodontology. 2005;76(8):1406-19. 494. Michaud DS, Joshipura K, Giovannucci E, Fuchs CS. A prospective study of periodontal disease and pancreatic cancer in US male health professionals. Journal of the National Cancer Institute. 2007;99(2):171-5. 495. Michaud DS, Liu Y, Meyer M, Giovannucci E, Joshipura K. Periodontal disease, tooth loss, and cancer risk in male health professionals: a prospective cohort study. The lancet oncology. 2008;9(6):550-8. 496. Fitzpatrick SG, Katz J. The association between periodontal disease and cancer: a review of the literature. Journal of dentistry. 2010;38(2):83-95. 497. Wen B-W, Tsai C-S, Lin C-L, Chang Y-J, Lee C-F, Hsu C-H, et al. Cancer risk among gingivitis and periodontitis patients: a nationwide cohort study. Qjm. 2014;107(4):283-90. 498. Kaminagakura E, Villa LL, Andreoli MA, Sobrinho JS, Vartanian JG, Soares FA, et al. High‐risk human papillomavirus in oral squamous cell carcinoma of young patients. International journal of cancer. 2012;130(8):1726-32.

175

499. Forslund O, Antonsson A, Nordin P, Stenquist B, Hansson BG. A broad range of human papillomavirus types detected with a general PCR method suitable for analysis of cutaneous tumours and normal skin. Journal of General Virology. 1999;80(9):2437-43. 500. Schiffman M, Rodriguez AC, Chen Z, Wacholder S, Herrero R, Hildesheim A, et al. A population-based prospective study of carcinogenic human papillomavirus variant lineages, viral persistence, and cervical neoplasia. Cancer research. 2010;70(8):3159-69. 501. Tota JE, Jiang M, Ramanakumar AV, Walter SD, Kaufman JS, Coutlée F, et al. Epidemiologic Evaluation of Human Papillomavirus Type Competition and the Potential for Type Replacement Post-Vaccination. PloS one. 2016;11(12):e0166329. 502. Elasbali AM, Hussein ARA, Gadelkarim AH. Cervical and oral screening for HR-HPV types 16 and 18 among Sudanese women cervical lesions. Infectious agents and cancer. 2012;7(1):17. 503. Bagan L, Ocete-Monchon M-D, Leopoldo-Rodado M, Murillo-Cortes J, Díaz-Fernández J- M, Medina-Gonzalez R, et al. Prevalence of salivary epstein-barr virus in potentially malignant oral disorders and oral squamous cell carcinoma. Medicina oral, patologia oral y cirugia bucal. 2016;21(2):e157. 504. Polz-Gruszka D, Morshed K, Stec A, Polz-Dacewicz M. Prevalence of Human papillomavirus (HPV) and Epstein-Barr virus (EBV) in oral and oropharyngeal squamous cell carcinoma in south-eastern Poland. Infectious agents and cancer. 2015;10(1):37. 505. Srinivasan M, Sedmak D, Jewell S. Effect of fixatives and tissue processing on the content and integrity of nucleic acids. The American journal of pathology. 2002;161(6):1961-71. 506. Milagres A, Dias EP, Tavares DdS, Cavalcante RM, Dantas VA, Oliveira SPd, et al. Prevalence of oral hairy leukoplakia and epithelial infection by Epstein-Barr virus in pregnant women and diabetes mellitus patients: cytopathologic and molecular study. Memórias do Instituto Oswaldo Cruz. 2007;102(2):159-64. 507. Sousa H, Silva J, Azevedo L, Pinto-Correia AL, Catarino R, Pinto D, et al. Epstein-Barr virus in healthy individuals from Portugal. Acta Médica Portuguesa. 2011;24(5):707-12. 508. McLemore MS, Haigentz M, Smith RV, Nuovo GJ, Alos L, Cardesa A, et al. Head and neck squamous cell carcinomas in HIV-positive patients: a preliminary investigation of viral associations. Head and neck pathology. 2010;4(2):97-105. 509. Cancer IAfRo. GLOBOCAN 2012: estimated cancer incidence, mortality and prevalence worldwide in 2012. 2012. 510. De Martel C, Ferlay J, Franceschi S, Vignat J, Bray F, Forman D, et al. Global burden of cancers attributable to infections in 2008: a review and synthetic analysis. The lancet oncology. 2012;13(6):607-15. 511. Foxman B, Martin ET. Use of the microbiome in the practice of epidemiology: a primer on-omic technologies. American journal of epidemiology. 2015:kwv102. 512. Benerjee S, Tian T, Wei Z, Peck KN, Shin N, Chalian AA et al. Microbial signatures associated with oropharyngeal and oral squamous cell carcinomas. Scientific Reports 2017;7:4036.

176

Annexture1

Classification of Risk Factors for Oral Cancer

Type Risk Status Mechanism Studies providing Remarks Evidence 1. Well-defined Risk Factors

1.1 Life style related Betel Quid OR [95% CI] Carcinogenic, (1, 2) Ancient Chewing with =10.1 [3.4- Mutagenic and cultural and or without 29.7] Genotoxic Potential (1-13) religious Tobacco of Tobacco & Areca- practice Nut Practiced in South Asian Countries: India, Sri Betel chewing Lanka, with tobacco Pakistan. OR[95% Bangladesh CI]=7.46[5.86- 9.50] Betel chewing without tobacco OR[95% CI]=2.82[2.35- 3.40]

Tobacco OR [95% Carcinogenic, (2, 3, 14-26) Tobacco Smoking & CI]=2.75 Mutagenic and consumption is Smokeless [1.55-4.87] Genotoxic Potential a major cause Tobacco of Tobacco for global burden of Non- Communicable Diseases including oral cancer (4, 15, 27-36) Alcohol is Alcohol OR [95% Carcinogenic, considered to Consumption CI]=2.7 [1.2- Mutagenic and be a Group 1 6.3] Genotoxic Potential Carcinogen of Alcohol

[1]

Areca nut An estimated Arecoline, Commercially chewing 600 million of arecaidine, guvacine, (3, 4, 7, 13, 18, 37-44) prepared areca global guacoline are among nut packets population four alkaloids with chewing is chew areca nut carcinogenic popular among properties. younger males in Sri Lanka

Dietary & Daily Fruits & (45-65) Daily Nutritional Vegetable consumption Factors Consumption of ≥5 portions OR [95% of fruits & CI]=0.5 [0.3- vegetables has 0.9] recommended. 1.2 Socio-Demographic

Male Gender OR [95% CI]= Males are more (27) In Sri Lanka 2.1 [1-4.4] addicted to risk cancer of the habits which are oral cavity, lip well-defined risk and pharynx is factors of OSCC the most common cancer type among males. Low 50%(RR=1.5 Low levels of (66-75) Social gradient Socioeconomic [95% CI=1.4- Education, in oral cancer Status 1.5] Occupation, Income OR [95% increase the risk for CI]=1.5 [1.60- indulgence in risky Low 2.15] habits such betel Educational chewing, smoking & attainment 1.84 [95% alcohol consumption CI=1.47-2.31] Low Occupational 2.41 [CI=1.59- Social Class 3.65] 1.3 Genetic Gene Not Applicable Development of (6, 76-89) Provides an expression OSCC is a multi-step ideal candidate profiles in oral process involving for disease

[2] cancer cases genes related to cell biomarkers compared to cycle, growth and controls control,apoptosis, therapeutic DNA damage targets in oral response and cellular cancer. regulators. 2, Other Risk Factors

2,1 Infection & Inflammation HPV HPV Prevalence of HPV (15, 90-105) HPV related infections in OSCC varies in Head & Neck account for different regions. Squamous Cell 20% 0f oral Carcinomas cancers. HPV have a better 16 is causally prognosis. associated with OSCC Candida Candida is There are various (106-111) Treatment for associated mechanisms Candida with OSCC associated with infection Candida influencing influences OSCC prognosis of OSCC Oral Hygiene Zheng et al., Poor oral hygiene is (6, 76, 112-128) Status 1990 associated with 7 fold increase inadequate/infrequent in developing tooth brushing, high oral cancer burden of periodontal among people disease and more who never missing teeth. brushed their teeth Periodontitis 2-5 fold Periodontal increase in risk Underlying long- (118, 129, 130) disease is of oral cancer term chronic associated among oral inflammation in with small but cancer patients periodontal disease a significant with due to proteolytic, increase in risk periodontitis periodontopathic of oral cancer compared to bacteria interact with Tobacco and those without host immune alcohol use periodontitis response. attenuated the OR [95% effect. CI]=4.36 [3.16-6.01]

[3]

3, Environmental

Solar Exposure to UV light related Not Radiation solar radiation mutations (4, 6, 131-136) recognized as is considered an important to be a risk risk factor factor for lip cancer

Environmental Pollution of Heavy metals such as Pollution water, air, soil Chromium and (4, 6, 28, 137-143) Indoor air- could increase Nickel found in soil pollution is the risk for could cause postulated as a OSCC carcinogenesis. risk factor for (142) Upper Aero OR [95% Indoor-air pollution Digestive CI]=2.73[1.8- Tract Cancers 4.2]

1. Amarasinghe HK, Usgodaarachchi US, Johnson NW, Lalloo R, Warnakulasuriya S. Betel-quid chewing with or without tobacco is a major risk factor for oral potentially malignant disorders in Sri Lanka: a case-control study. Oral oncology. 2010;46(4):297-301. 2. Gupta B, Johnson NW. Systematic review and meta-analysis of association of smokeless tobacco and of betel quid without tobacco with incidence of oral cancer in South Asia and the Pacific. PloS one. 2014;9(11):e113385. 3. Gupta B, Ariyawardana A, Johnson NW. Oral cancer in India continues in epidemic proportions: evidence base and policy initiatives. International dental journal. 2013;63(1):12-25. 4. Johnson NW, Jayasekara P, Amarasinghe A. Squamous cell carcinoma and precursor lesions of the oral cavity: epidemiology and aetiology. Periodontology 2000. 2011;57(1):19-37. 5. Siriwardena B, Tilakaratne A, Amaratunga E, Tilakaratne W. Demographic, aetiological and survival differences of oral squamous cell carcinoma in the young and the old in Sri Lanka. Oral oncology. 2006;42(8):831-6. 6. Kumar S, Zain R. Aetiology and risk factors for oral cancer–a brief overview. Annal Dent Univ Malaya. 2004;11:41-50. 7. Humans IWGotEoCRt, Organization WH, Cancer IAfRo. Betel-quid and areca-nut chewing and some areca-nut-derived nitrosamines: IARC; 2004. 8. Secretan B, Straif K, Baan R, Grosse Y, El Ghissassi F, Bouvard V, et al. A review of human carcinogens—Part E: tobacco, areca nut, alcohol, coal smoke, and salted fish. The lancet oncology. 2009;10(11):1033-4. 9. Jeng J, Kuo M, Hahn LJ, Kuo M. Genotoxic and non-genotoxic effects of betel quid ingredients on oral mucosal fibroblasts in vitro. Journal of dental research. 1994;73(5):1043-9. 10. Jeng J, Chang M, Hahn L. Role of areca nut in betel quid-associated chemical carcinogenesis: current awareness and future perspectives. Oral oncology. 2001;37(6):477-92.

[4]

11. Zaidi J, Arif M, Fatima I, Qureshi I. Radiochemical neutron activation analysis for trace elements of basic ingredients of pan. Journal of radioanalytical and nuclear chemistry. 2002;253(3):459-64. 12. Bhide S, Padma P, Amonkar A. Antimutagenic and anticarcinogenic effects of betel leaf extract against the tobacco-specific nitrosamine 4-(N-nitrosomethylamino)-1-(3-pyridyl)-1-butanone (NNK). IARC scientific publications. 1990(105):520-4. 13. Shah G, Chaturvedi P, Vaishampayan S. Arecanut as an emerging etiology of oral cancers in India. Indian journal of medical and paediatric oncology: official journal of Indian Society of Medical & Paediatric Oncology. 2012;33(2):71. 14. Gupta B, Kumar N, Johnson NW. A risk factor‐based model for upper aerodigestive tract cancers in India: predicting and validating the receiver operating characteristic curve. Journal of Oral Pathology & Medicine. 2016. 15. Stewart B, Wild CP. World cancer report 2014. World. 2016. 16. Khalili J. Oral cancer: risk factors, prevention and diagnostic. Exp Oncol. 2008;30(4):259-64. 17. Humans IWGotEoCRt, Organization WH, Cancer IAfRo. Smokeless tobacco and some tobacco- specific N-nitrosamines: World Health Organization; 2007. 18. Smoke T. Tobacco Smoke and Involuntary Smoking. IARC Monographs on the Evaluation of Carcinogenic Risks to Humans. 2004;83. 19. Organization WH. WHO report on the global tobacco epidemic, 2013: enforcing bans on tobacco advertising, promotion and sponsorship: World Health Organization; 2013. 20. Mpower W. A policy package to reverse the tobacco epidemic. Geneva: World Health Organization. 2008. 21. Hamilton E. Tobacco: A major international health hazard (IARC. No. 74): edited by D. Zaridze and R. Peto, Oxford University Press, 1986, 324 pp. Price:£ 20.00. Elsevier; 1988. 22. Eriksen M, Mackay J, Ross H. The tobacco atlas: American Cancer Society; 2013. 23. Jahanshahi G, Shirani S. Detection of Candida albicans in oral squamous cell carcinoma by fluorescence staining technique. Dental research journal. 2015;12(2):115. 24. Control CfD, Prevention. How tobacco smoke causes disease: The biology and behavioral basis for smoking-attributable disease: A report of the surgeon general. 2010. 25. Daftary D. Temporal role of tobacco in oral carcinogenesis: a hypothesis for the need to prioritize on precancer. Indian journal of cancer. 2010;47(5):105. 26. Jayalekshmi PA, Gangadharan P, Akiba S, Koriyama C, Nair RRK. Oral cavity cancer risk in relation to tobacco chewing and bidi smoking among men in Karunagappally, Kerala, India: Karunagappally cohort study. Cancer science. 2011;102(2):460-7. 27. Amarasinghe H, Johnson NW, Lalloo R, Kumaraarachchi M, Warnakulasuriya S. Derivation and validation of a risk-factor model for detection of oral potentially malignant disorders in populations with high prevalence. British journal of cancer. 2010;103(3):303-9. 28. Rao SVK, Mejia G, Roberts-Thomson K, Logan R. Epidemiology of oral cancer in Asia in the past decade-an update (2000-2012). Asian Pacific Journal of Cancer Prevention. 2013;14(10):5567-77. 29. Humans IWGotEoCRt. IARC monographs on the evaluation of carcinogenic risks to humans. Ingested nitrate and nitrite, and cyanobacterial peptide toxins. IARC monographs on the evaluation of carcinogenic risks to humans/World Health Organization, International Agency for Research on Cancer. 2010;94:v. 30. Humans IWGotEoCRt. A Review of Human Carcinogens: Personal Habits and Indoor Combustions: IARC; 2012. 31. Tramacere I, Negri E, Bagnardi V, Garavello W, Rota M, Scotti L, et al. A meta-analysis of alcohol drinking and oral and pharyngeal cancers. Part 1: overall results and dose-risk relation. Oral oncology. 2010;46(7):497-503.

[5]

32. Zeka A, Gore R, Kriebel D. Effects of alcohol and tobacco on aerodigestive cancer risks: a meta- regression analysis. Cancer Causes & Control. 2003;14(9):897-906. 33. Cancer IAfRo. Alcohol consumption and ethyl carbamate. IARC monographs on the evaluation of carcinogenic risks to humans. 2010;96. 34. Baan R, Straif K, Grosse Y, Secretan B, El Ghissassi F, Bouvard V, et al. Carcinogenicity of alcoholic beverages. The lancet oncology. 2007;8(4):292-3. 35. Group IW. Schistosomes, liver flukes and Helicobacter pylori. IARC working group on the evaluation of carcinogenic risks to humans. Lyon, 7-14 June 1994. IARC Monogr Eval Carcinog Risks Hum. 1994;61:1-241. 36. Seitz H, Gärtner U, Egerer G, Simanowski U. Ethanol metabolism in the gastrointestinal tract and its possible consequences. Alcohol and alcoholism (Oxford, Oxfordshire) Supplement. 1993;2:157-62. 37. Humans IWGotEoCRt, Organization WH, Cancer IAfRo. Betel-quid and Areca-nut Chewing and Some Areca-nut-derived Nitrosamines: IARC Monographs on the Evaluation of Carcinogenic Risks to Human: World Health Organization; 2004. 38. Gupta P, Warnakulasuriya S. Global epidemiology of areca nut usage. Addiction biology. 2002;7(1):77-83. 39. Lord G, Lim C, Warnakulasuriya S, Peters T. Chemical and analytical aspects of areca nut. Addiction biology. 2002;7(1):99-102. 40. Warnakulasuriya S, Trivedy C, Peters TJ. Areca nut use: an independent risk factor for oral cancer: The health problem is under-recognised. BMJ: British Medical Journal. 2002;324(7341):799. 41. Muttagi SS, Chaturvedi P, Gaikwad R, Singh B, Pawar P. Head and neck squamous cell carcinoma in chronic areca nut chewing Indian women: Case series and review of literature. Indian Journal of Medical and Paediatric Oncology. 2012;33(1):32. 42. Nair J, Ohshima H, Nair U, Bartsch H. Endogenous formation of nitrosamines and oxidative DNA- damaging agents in tobacco users. Critical reviews in toxicology. 1996;26(2):149-61. 43. Carossa S, Pera P, Doglio P, Lombardo S, Colagrande P, Brussino L, et al. Oral nitric oxide during plaque deposition. European journal of clinical investigation. 2001;31(10):876-9. 44. Nair U, Bartsch H, Nair J. Alert for an epidemic of oral cancer due to use of the betel quid substitutes gutkha and pan masala: a review of agents and causative mechanisms. Mutagenesis. 2004;19(4):251-62. 45. Amarasinghe HK, Usgodaarachchi U, Kumaraarachchi M, Johnson NW, Warnakulasuriya S. Diet and risk of oral potentially malignant disorders in rural Sri Lanka. Journal of Oral Pathology & Medicine. 2013;42(9):656-62. 46. Soler M, Bosetti C, Franceschi S, Negri E, Zambon P, Talamini R, et al. Fiber intake and the risk of oral, pharyngeal and esophageal cancer. International Journal of Cancer. 2001;91(3):283-7. 47. De Stefani E, Ronco A, Mendilaharsu M, Deneo-Pellegrini H. Diet and risk of cancer of the upper aerodigestive tract—II. Nutrients. Oral oncology. 1999;35(1):22-6. 48. De Stefani E, Oreggia F, Boffetta P, Deneo-Pellegrini H, Ronco A, Mendilaharsu M. Tomatoes, tomato-rich foods, lycopene and cancer of the upper aerodigestive tract: a case-control in Uruguay. Oral oncology. 2000;36(1):47-53. 49. de Munter L, Maasland DH, van den Brandt PA, Kremer B, Schouten LJ. Vitamin and carotenoid intake and risk of head-neck cancer subtypes in the Netherlands Cohort Study. The American journal of clinical nutrition. 2015:ajcn106096. 50. Garavello W, Lucenteforte E, Bosetti C, Talamini R, Levi F, Tavani A, et al. Diet diversity and the risk of laryngeal cancer: a case–control study from Italy and Switzerland. Oral oncology. 2009;45(1):85-9. 51. Garavello W, Lucenteforte E, Bosetti C, La Vecchia C. The role of foods and nutrients on oral and pharyngeal cancer risk. Minerva stomatologica. 2008;58(1-2):25-34.

[6]

52. Llewellyn CD, Linklater K, Bell J, Johnson NW, Warnakulasuriya S. An analysis of risk factors for oral cancer in young people: a case-control study. Oral oncology. 2004;40(3):304-13. 53. Wynder EL, Bross IJ. Aetiological factors in mouth cancer. British medical journal. 1957;1(5028):1137. 54. Schwartz JL, Shklar G, Flynn E, Trickler D. The administration of beta carotene to prevent and regress oral carcinoma in the hamster cheek pouch and the associated enhancement of the immune response. Antioxidant Nutrients and Immune Functions: Springer; 1990. p. 77-93. 55. Schwartz J, Shklar G. Regression of experimental oral carcinomas by local injection of β‐carotene and canthaxanthin. 1988. 56. Shklar G, Schwartz JL, Trickler DP, Reid S. Prevention of experimental cancer and immunostimulation by vitamin E (immunosurveillance). Journal of oral pathology & medicine. 1990;19(2):60-4. 57. Warnakulasuriya S, Wilson M. Food, nutrition and oral cancer. Food constituents and oral health: current status and future prospects. 2009:273-95. 58. Machlin LJ, Bendich A. Free radical tissue damage: protective role of antioxidant nutrients. The FASEB Journal. 1987;1(6):441-5. 59. Pavia M, Pileggi C, Nobile CG, Angelillo IF. Association between fruit and vegetable consumption and oral cancer: a meta-analysis of observational studies. The American journal of clinical nutrition. 2006;83(5):1126-34. 60. Turati F, Rossi M, Pelucchi C, Levi F, La Vecchia C. Fruit and vegetables and cancer risk: a review of southern European studies. British Journal of Nutrition. 2015;113(S2):S102-S10. 61. Bosetti C, Filomeno M, Riso P, Polesel J, Levi F, Talamini R, et al. Cruciferous vegetables and cancer risk in a network of case–control studies. Annals of Oncology. 2012:mdr604. 62. Freedman N, Park Y, Subar A, Hollenbeck A, Leitzmann M, Schatzkin A, et al. Fruit and vegetable intake and head and neck cancer in a large United States prospective cohort study. Cancer Research. 2007;67(9 Supplement):849-. 63. Nagao T, Ikeda N, Warnakulasuriya S, Fukano H, Yuasa H, Yano M, et al. Serum antioxidant micronutrients and the risk of oral leukoplakia among Japanese. Oral oncology. 2000;36(5):466-70. 64. Sankaranarayanan R, Mathew B, Varghese C, Sudhakaran P, Menon V, Jayadeep A, et al. Chemoprevention of oral leukoplakia with vitamin A and beta carotene: an assessment. Oral oncology. 1997;33(4):231-6. 65. Papadimitrakopoulou VA, Lee JJ, William WN, Martin JW, Thomas M, Kim ES, et al. Randomized trial of 13-cis retinoic acid compared with retinyl palmitate with or without beta-carotene in oral premalignancy. Journal of Clinical Oncology. 2009;27(4):599-604. 66. Rao SK, Mejia GC, Roberts-Thomson K, Logan RM, Kamath V, Kulkarni M, et al. Estimating the effect of childhood socioeconomic disadvantage on oral cancer in India using marginal structural models. Epidemiology. 2015;26(4):509-17. 67. Conway DI, Petticrew M, Marlborough H, Berthiller J, Hashibe M, Macpherson L. Socioeconomic inequalities and oral cancer risk: A systematic review and meta‐analysis of case‐control studies. International Journal of Cancer. 2008;122(12):2811-9. 68. Johnson NW, Warnakulasuriya S, Gupta P, Dimba E, Chindia M, Otoh E, et al. Global oral health inequalities in incidence and outcomes for oral cancer causes and solutions. Advances in dental research. 2011;23(2):237-46. 69. Watt R, Listl S, Peres M, Heilmann A. Social inequalities in oral health: from evidence to action. International Centre for Oral Health Inequalities Research & Policy. 2015. 70. Chelimo C, Elwood JM. Sociodemographic differences in the incidence of oropharyngeal and oral cavity squamous cell cancers in New Zealand. Australian and New Zealand journal of public health. 2015;39(2):162-7.

[7]

71. Dantas TS, de Barros Silva PG, Sousa EF, da Cunha MdP, de Aguiar ASW, Costa FWG, et al. Influence of Educational Level, Stage, and Histological Type on Survival of Oral Cancer in a Brazilian Population: A Retrospective Study of 10 Years Observation. Medicine. 2016;95(3):e2314. 72. Auluck A, Walker BB, Hislop G, Lear SA, Schuurman N, Rosin M. Socio-economic deprivation: a significant determinant affecting stage of oral cancer diagnosis and survival. BMC cancer. 2016;16(1):569. 73. Chu K, Habbous S, Kuang Q, Boyd K, Mirshams M, Liu F-F, et al. Socioeconomic status, human papillomavirus, and overall survival in head and neck squamous cell carcinomas in Toronto, Canada. Cancer epidemiology. 2016;40:102-12. 74. Mathur S, Conway DI, Worlledge-Andrew H, Macpherson LM, Ross AJ. Assessment and prevention of behavioural and social risk factors associated with oral cancer: protocol for a systematic review of clinical guidelines and systematic reviews to inform Primary Care dental professionals. Systematic reviews. 2015;4(1):1. 75. Boing A, Antunes JF, de Carvalho MB, de Góis Filho JF, Kowalski L, Michaluart P, et al. How much do smoking and alcohol consumption explain socioeconomic inequalities in head and neck cancer risk? Journal of epidemiology and community health. 2011;65(8):709-14. 76. Scully C. Oral cancer aetiopathogenesis; past, present and future aspects. Med Oral Patol Oral Cir Bucal. 2011;16(3):e306-e11. 77. Gasche JA, Goel A. Epigenetic mechanisms in oral carcinogenesis. Future Oncology. 2012;8(11):1407-25. 78. Viswanathan M, Sangiliyandi G, Vinod SS, Mohanprasad BK, Shanmugam G. Genomic instability and tumor-specific alterations in oral squamous cell carcinomas assessed by inter-(simple sequence repeat) PCR. Clinical cancer research. 2003;9(3):1057-62. 79. Fong Y, Chou S-J, Hung K-F, Wu H-T, Kao S-Y. An investigation of the differential expression of Her2/neu gene expression in normal oral mucosa, epithelial dysplasia, and oral squamous cell carcinoma in Taiwan. Journal of the Chinese Medical Association. 2008;71(3):123-7. 80. De Vicente J, Esteban I, Germana P, Germana A, Vega J. Expression of ErbB-3 and ErbB-4 protooncogene proteins in oral squamous cell carcinoma: a pilot study. Medicina oral: organo oficial de la Sociedad Espanola de Medicina Oral y de la Academia Iberoamericana de Patologia y Medicina Bucal. 2002;8(5):374-81. 81. Piyathilake CJ, Bell WC, Jones J, Henao OL, Heimburger DC, Niveleau A, et al. Pattern of nonspecific (or global) DNA methylation in oral carcinogenesis. Head & neck. 2005;27(12):1061-7. 82. Guerrero-Preston R, Baez A, Blanco A, Berdasco M, Fraga M, Esteller M. Global DNA methylation: a common early event in oral cancer cases with exposure to environmental carcinogens or viral agents. Puerto Rico health sciences journal. 2009;28(1). 83. Baba S, Yamada Y, Hatano Y, Miyazaki Y, Mori H, Shibata T, et al. Global DNA hypomethylation suppresses squamous carcinogenesis in the tongue and esophagus. Cancer science. 2009;100(7):1186- 91. 84. Gasche JA, Hoffmann J, Boland CR, Goel A. Interleukin‐6 promotes tumorigenesis by altering DNA methylation in oral cancer cells. International Journal of Cancer. 2011;129(5):1053-63. 85. Serrano M, Hannon GJ, Beach D. A new regulatory motif in cell-cycle control causing specific inhibition of cyclin D/CDK4. nature. 1993;366(6456):704-7. 86. Agarwal P, Lutful Kabir F, DeInnocentes P, Bird RC. Tumor suppressor gene p16/INK4A/CDKN2A and its role in cell cycle exit, differentiation, and determination of cell fate. Tumor Suppressor Genes Rijeka, Croatia: InTech Open Access Pub. 2012:1-34. 87. Liggett W, Sidransky D. Role of the p16 tumor suppressor gene in cancer. Journal of Clinical Oncology. 1998;16(3):1197-206.

[8]

88. Kato K, Hara A, Kuno T, Mori H, Yamashita T, Toida M, et al. Aberrant promoter hypermethylation of p16 and MGMT genes in oral squamous cell carcinomas and the surrounding normal mucosa. Journal of cancer research and clinical oncology. 2006;132(11):735-43. 89. Johnson N. Tobacco use and oral cancer: a global perspective. Journal of Dental Education. 2001;65(4):328-39. 90. Jayasooriya PR, Kurose K, Terai M, Sivagnanam K, Siriwardana S, Tilakaratne WM, et al. Human Papillomavirus in Oral Cancer from Sri Lanka: Prevalence and relationship with clinico-pathological parameters. Oral Medicine & Pathology. 2003;8(2):45-50. 91. Jalouli J, Jalouli MM, Sapkota D, Ibrahim SO, Larsson P-A, Sand L. Human papilloma virus, herpes simplex virus and epstein barr virus in oral squamous cell carcinoma from eight different countries. Anticancer research. 2012;32(2):571-80. 92. Gunasekera SK, Perera KA, Fernando C, Udagama PV. A shifting paradigm in the aetiology of oral and pharyngeal cancer in Sri Lanka: a case-control study providing serologic evidence for the role of oncogenic HPV types 16 and 18. Infectious agents and cancer. 2015;10(1):1. 93. Shaikh MH, McMillan NA, Johnson NW. HPV-associated head and neck cancers in the Asia Pacific: a critical literature review & meta-analysis. Cancer epidemiology. 2015;39(6):923-38. 94. Rautava J, Syrjänen S. Biology of human papillomavirus infections in head and neck carcinogenesis. Head and neck pathology. 2012;6(1):3-15. 95. Thomas J, Primeaux T. Is p16 immunohistochemistry a more cost-effective method for identification of human papilloma virus–associated head and neck squamous cell carcinoma? Annals of diagnostic pathology. 2012;16(2):91-9. 96. Duncan LD, Winkler M, Carlson ER, Heidel RE, Kang E, Webb D. P16 immunohistochemistry can be used to detect human papillomavirus in oral cavity squamous cell carcinoma. Journal of Oral and Maxillofacial Surgery. 2013;71(8):1367-75. 97. Lewis Jr JS, Thorstad WL, Chernock RD, Haughey BH, Yip JH, Zhang Q, et al. p16 positive oropharyngeal squamous cell carcinoma: an entity with a favorable prognosis regardless of tumor HPV status. The American journal of surgical pathology. 2010;34(8). 98. Shojaeian Jalouli M. Oral cancer with special reference to virus detection and quantitative gene expression. 2016. 99. Cardoso J, Calonje E. Cutaneous manifestations of human papillomaviruses: a review. Acta dermatovenerologica Alpina, Pannonica, et Adriatica. 2011;20(3):145-54. 100. Stoler MH. Human papillomaviruses and cervical neoplasia: a model for carcinogenesis. International journal of gynecological pathology. 2000;19(1):16-28. 101. Miralles-Guri C, Bruni L, Cubilla A, Castellsague X, Bosch FX, De Sanjose S. Human papillomavirus prevalence and type distribution in penile carcinoma. Journal of Clinical Pathology. 2009;62(10):870-8. 102. Bodily J, Laimins LA. Persistence of human papillomavirus infection: keys to malignant progression. Trends in microbiology. 2011;19(1):33-9. 103. Klussmann JP, Gültekin E, Weissenborn SJ, Wieland U, Dries V, Dienes HP, et al. Expression of p16 protein identifies a distinct entity of tonsillar carcinomas associated with human papillomavirus. The American journal of pathology. 2003;162(3):747-53. 104. Vidal L, Gillison ML. Human papillomavirus in HNSCC: recognition of a distinct disease type. Hematology/oncology clinics of North America. 2008;22(6):1125-42. 105. Soave DF, Nunes Celes M, Oliveira-Costa JP, da Silveira GG, Zanetti BR, Oliveira LR. The role of human papilloma virus in precancerous lesions and oral cancer. Ch. 2013;9:241-67. 106. WILLIAMSON DM. Chronic hyperplastic candidiasis and squamous carcinoma. British Journal of Dermatology. 1969;81(2):125-7.

[9]

107. Bakri MM, Hussaini HM, Holmes AR, Cannon RD, Rich AM. Revisiting the association between candidal infection and carcinoma, particularly oral squamous cell carcinoma. Journal of oral microbiology. 2010;2. 108. Kang J, He Y, Hetzl D, Jiang H, Jun M, Jun M, et al. A Candid Assessment of the Link between Oral Candida Containing Biofilms and Oral Cancer. Advances in Microbiology. 2016;6(02):115. 109. Gall F, Colella G, Di Onofrio V, Rossiello R, Angelillo IF, Liguori G. Candida spp. in oral cancer and oral precancerous lesions. New Microbiol. 2013;36(3):283-8. 110. Jenkinson HF, Douglas LJ. Interactions between Candida species and bacteria in mixed infections. 2002. 111. Akpan A, Morgan R. Oral candidiasis. Postgraduate medical journal. 2002;78(922):455-9. 112. Marshall JR, Graham S, Haughey BP, Shedd D, O'Shea R, Brasure J, et al. Smoking, alcohol, dentition and diet in the epidemiology of oral cancer. European Journal of Cancer Part B: Oral Oncology. 1992;28(1):9-15. 113. Guha N, Boffetta P, Wünsch Filho V, Neto JE, Shangina O, Zaridze D, et al. Oral health and risk of squamous cell carcinoma of the head and neck and esophagus: results of two multicentric case-control studies. American journal of epidemiology. 2007;166(10):1159-73. 114. Divaris K, Olshan AF, Smith J, Bell ME, Weissler MC, Funkhouser WK, et al. Oral health and risk for head and neck squamous cell carcinoma: the Carolina Head and Neck Cancer Study. Cancer Causes & Control. 2010;21(4):567-75. 115. Rosenquist K. Risk factors in oral and oropharyngeal squamous cell carcinoma: a population- based case-control study in southern Sweden. Swedish dental journal Supplement. 2004(179):1-66. 116. Rosenquist K, Wennerberg J, Schildt E-B, Bladström A, Göran Hansson B, Andersson G. Oral status, oral infections and some lifestyle factors as risk factors for oral and oropharyngeal squamous cell carcinoma. A population-based case-control study in southern Sweden. Acta oto-laryngologica. 2005;125(12):1327-36. 117. Tezal M, Grossi SG, Genco RJ. Is periodontitis associated with oral neoplasms? Journal of periodontology. 2005;76(3):406-10. 118. Tezal M, Sullivan MA, Hyland A, Marshall JR, Stoler D, Reid ME, et al. Chronic periodontitis and the incidence of head and neck squamous cell carcinoma. Cancer Epidemiology Biomarkers & Prevention. 2009;18(9):2406-12. 119. Zheng T, Boyle P, Hu H, Duan J, Jiang P, Ma D, et al. Dentition, oral hygiene, and risk of oral cancer: a case-control study in Beijing, People's Republic of China. Cancer Causes & Control. 1990;1(3):235-41. 120. Garrote LF, Herrero R, Reyes RO, Vaccarella S, Anta JL, Ferbeye L, et al. Risk factors for cancer of the oral cavity and oro-pharynx in Cuba. British Journal of Cancer. 2001;85(1):46. 121. Shamami MS, Shamami MS, Amini S. Periodontal disease and tooth loss as risks for cancer: A systematic review of the literature. Iranian journal of cancer prevention. 2011;4(4):189. 122. Javed F, Warnakulasuriya S. Is there a relationship between periodontal disease and oral cancer? A systematic review of currently available evidence. Critical reviews in oncology/hematology. 2016;97:197-205. 123. Fujita K, Kaku T, Sasaki M, Onoe T. Experimental Production of Lingual Carcinomas in Hamsters by Local Application of 9, 10-Dimethyl-l, 2-Benzanthracene. Journal of dental research. 1973;52(2). 124. Lockhart P, Norris C, Pulliam C. Dental factors in the genesis of squamous cell carcinoma of the oral cavity. Oral oncology. 1998;34(2):133-9. 125. Maier H, Zöller J, Herrmann A, Kreiss M, Heller W-D. Dental status and oral hygiene in patients with head and neck cancer. Otolaryngology--Head and Neck Surgery. 1993;108(6):655-61.

[10]

126. Ansai T, Takata Y, Yoshida A, Soh I, Awano S, Hamasaki T, et al. Association between tooth loss and orodigestive cancer mortality in an 80-year-old community-dwelling Japanese population: a 12-year prospective study. BMC public health. 2013;13(1):1. 127. Talamini R, Vaccarella S, Barbone F, Tavani A, La Vecchia C, Herrero R, et al. Oral hygiene, dentition, sexual habits and risk of oral cancer. British journal of cancer. 2000;83(9):1238. 128. Velly A, Franco E, Schlecht N, Pintos J, Kowalski LP, Oliveira BVd, et al. Relationship between dental factors and risk of upper aerodigestive tract cancer. Oral oncology. 1998;34(4):284-91. 129. Javed F, Warnakulasuriya S. Is there a relationship between periodontal disease and oral cancer? A systematic review of currently available evidence. Critical reviews in oncology/hematology. 2015. 130. Tezal M, Sullivan MA, Reid ME, Marshall JR, Hyland A, Loree T, et al. Chronic periodontitis and the risk of tongue cancer. Archives of Otolaryngology–Head & Neck Surgery. 2007;133(5):450-4. 131. Sankaranarayanan R. Oral cancer in India: an epidemiologic and clinical review. Oral surgery, oral medicine, oral pathology. 1990;69(3):325-30. 132. Wiklund K, Dich J. Cancer risks among male farmers in Sweden. European journal of cancer prevention. 1995;4(1):81-90. 133. Humans IWGotEoCRt. Household use of solid fuels and high-temperature frying. IARC monographs on the evaluation of carcinogenic risks to humans/World Health Organization, International Agency for Research on Cancer. 2010;95:1. 134. Pukkala E, Söderholm A-L, Lindqvist C. Cancers of the lip and oropharynx in different social and occupational groups in Finland. European Journal of Cancer Part B: Oral Oncology. 1994;30(3):209-15. 135. Antoniades D, Styanidis K, Papanayotou P, Trigonidis G. Squamous cell carcinoma of the lips in a northern Greek population. Evaluation of prognostic factors on 5-year survival rate—I. European Journal of Cancer Part B: Oral Oncology. 1995;31(5):333-9. 136. Alho OP, Keränen MR, Kantola S, Riihimäki S, Jokinen K, Alho P, et al. Lip cancer in Northern Finland: changing incidence and clinical characteristics. Journal of oral pathology & medicine. 2000;29(7):299-302. 137. Chiang C-T, Hwang Y-H, Su C-C, Tsai K-Y, Lian I-B, Yuan T-H, et al. Elucidating the underlying causes of oral cancer through spatial clustering in high-risk areas of Taiwan with a distinct gender ratio of incidence. Geospatial health. 2010;4(2):231-42. 138. Wake M. The urban/rural divide in head and neck cancer—the effect of atmospheric pollution. Clinical Otolaryngology & Allied Sciences. 1993;18(4):298-302. 139. Dietz A, Senneweld E, Maier H. Indoor air pollution by emissions of fossil fuel single stoves: possibly a hitherto underrated risk factor in the development of carcinomas in the head and neck. Otolaryngology--Head and Neck Surgery. 1995;112(2):308-15. 140. Sapkota A, Gajalakshmi V, Jetly DH, Roychowdhury S, Dikshit RP, Brennan P, et al. Indoor air pollution from solid fuels and risk of hypopharyngeal/laryngeal and lung cancers: a multicentric case– control study from India. International journal of epidemiology. 2008;37(2):321-8. 141. Franco EL, Kowalski LP, Oliveira BV, Curado MP, Pereira RN, Silva ME, et al. Risk factors for oral cancer in Brazil: a case‐control study. International Journal of Cancer. 1989;43(6):992-1000. 142. Pintos J, Franco EL, Kowalski LP, Oliveira BV, Curado MP. Use of wood stoves and risk of cancers of the upper aero-digestive tract: a case-control study. International Journal of Epidemiology. 1998;27(6):936-40. 143. Zheng Y, Tuppin P, Hubert A, Jeannel D, Pan Y, Zeng Y, et al. Environmental and dietary risk factors for nasopharyngeal carcinoma: a case-control study in Zangwu County, Guangxi, China. British journal of cancer. 1994;69(3):508.

[11]

ournal of ral APPENDIX 1 icr obiology

REVIEW ARTICLE Emerging role of bacteria in oral carcinogenesis: a review with special reference to perio-pathogenic bacteria

$ $ Manosha Perera1* , Nezar Noor Al-hebshi2,3* , David J. Speicher4, Irosha Perera5 and Newell W. Johnson4

1School of Dentistry and Oral Health, Griffith University, Queensland, Southport, Australia; 2Department of Preventive Dentistry, College of Dentistry, Jazan University, Jazan, Saudi Arabia; 3Kornberg School of Dentistry, Temple University, Philadelphia, USA; 4Menzies Health Institute Queensland, Griffith University, Queensland, Southport, Australia; 5Community Dental Unit, Dental Institute, Colombo, Sri Lanka

Oral cancer, primarily oral squamous cell carcinoma (OSCC), continues to be a major global health problem with high incidence and low survival rates. While the major risk factors for this malignancy, mostly lifestyle related, have been identified, around 15% of oral cancer cases remain unexplained. In light of evidence implicating bacteria in the aetiology of some cancer types, several epidemiological studies have been conducted in the last decade, employing methodologies ranging from traditional culture techniques to 16S rRNA metagenomics, to assess the possible role of bacteria in OSCC. While these studies have demonstrated differences in microbial composition between cancerous and healthy tissues, they have failed to agree on specific bacteria or patterns of oral microbial dysbiosis to implicate in OSCC. On the contrary, some oral taxa, particularly Porphyromonas gingivalis and Fusobacterium nucleatum, show strong oral carcinogenic potential in vitro and in animal studies. Bacteria are thought to contribute to oral carcinogenesis via inhibition of apoptosis, activation of cell proliferation, promotion of cellular invasion, induction of chronic inflammation, and production of carcinogens. This narrative review provides a critical analysis of and an update on the association between bacteria and oral carcinogenesis and the possible mechanisms underlying it. Keywords: bacteria; carcinoma; dysbiosis; inflammation; microbiome; mouth; squamous cell

*Correspondence to: Nezar Noor Al-hebshi, Kornberg School of Dentistry, Temple University, 3223 North Broad Street, Philadelphia, PA 19140, USA, Email: [email protected]; Manosha Perera, School of Dentistry and Oral Health, Griffith University, Queensland 4222, Australia, Email: [email protected]

Received: 30 June 2016; Revised: 23 August 2016; Accepted: 25 August 2016; Published: 26 September 2016

ral cancer encompasses malignant neoplasms, developing countries as well as minority ethnic groups in predominantly oral squamous cell carcinoma developed countries (1, 2). Although the oral cavity is O (OSCC), evolving from the lining mucosae of accessible to direct examination, oral cancer is usually the lips and the mouth (oral cavity) including the anterior detected at late stages (3). Despite advances in surgery, two-thirds of the tongue as defined by the International radiation and chemotherapy, the 5-year survival rates Classification of Disease (1). Along with oropharyngeal remain below 50%, one of the lowest for major cancers cancer, it constitutes an important global public health (4, 5). Furthermore, patients who survive a first cancer of problem, ranking the eighth most common cancer in the the oral cavity are at very high risk of developing a world. In 2012, an estimated 300,400 new cases of and recurrent or second primary oral cancer (4, 6). 145,400 deaths from oral cancer were reported (2). Two- thirds of all cases are recorded in developing countries; Risk factors for oral cancer the Indian subcontinent alone accounts for one-third of Oral cancer is of multifactorial origin; several risk factors the global burden (2). Oral cancer has a predilection for act individually or in combinations in the pathogenesis of males and socially disadvantaged population groups in the disease, and the mix varies from one population to

$Both authors contributed equally to the manuscript.

Journal of Oral Microbiology 2016. # 2016 Manosha Perera et al. This is an Open Access article distributed under the terms of the Creative Commons 1 Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/), permitting all non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. Citation: Journal of Oral Microbiology 2016, 8: 32762 - http://dx.doi.org/10.3402/jom.v8.32762 (page number not for citation purpose)

Manosha Perera et al.

another. The major risk factors of OSCC, the most of microbial and human attributes’ (35). The ‘human extensively studied, include smoking of cigarettes, cigars, microbiome’ is a term used to define all microorganisms in beedies and pipes, smokeless tobacco usage, betel quid the human body and their collective genomes (36). (with or without tobacco) chewing, other forms of areca Microbial communities found in the different body nut usage, heavy alcohol consumption and human habitats (e.g. upper respiratory tract, mouth, skin, gut papillomavirus (HPV) infection (7-10). Tobacco smoking and urogenital tract) contribute to the overall microbiome. and alcohol consumption alone account for a population The oral cavity has several distinct niches that provide attributable risk of 74% (11). Viral infections particularly unique conditions and nutrients for populating microbes, explain the elevated incidence of cancer among the young predominately bacteria (37). Each niche (e.g. hard palate, population (12, 13) and non-smoking females (14). soft palate, lateral and dorsal surfaces of the tongue, and Genetic susceptibility of the individual arising from tooth surfaces above and below the gingival margin) polymorphisms in carcinogen metabolising enzymes and displays site specificity and distinct bacterial profile (38). DNA repair mechanisms (15-17), often in a background Once established, the oral microbial communities main- of dietary micronutrient deficiencies, is another factor tain a stable composition ‘microbial homeostasis’ and associated with oral carcinogenesis (13). Lesser known exhibit commensal and mutualistic relation with the host risk factors include exposure to excessive solar radiation/ (39). The host provides its microbial communities with an UV light, sulphur dioxide, pesticides, mists from strong environment where they can flourish; in return, microbes inorganic acids and burning of fossil fuels (18, 19). protect the host as they colonise specific surfaces and Periodontitis has also been shown in several studies to prevent adherence and/or hinder growth of pathogenic be associated with increased risk of OSCC (20), with a bacteria (40). possible underlying mechanism being long-term chronic The human mouth harbours one of the most diverse inflammation (21). microbiota; at least 687 species/phylotypes have been identified, for each of which a reference 16S rRNA Can bacteria be a risk factor of oral cancer? sequence is available in the Human Oral Microbiome Approximately 15% of oral cancers cannot be explained Database (HOMD 14.5; www.homd.org) (41). These by the aforementioned major risk factors (22), which has species belong to 185 genera and 12 phyla, namely evoked the need to explore for other potential risk Firmicutes, Fusobacteria, Proteobacteria, Actinobacteria, factors. In the last two decades, significant evidence has Bacteroidetes, Chlamydiae, Chloroflexi, Spirochaetes, emerged implicating bacteria in the aetiology of some SR1, Synergistetes, Saccharibacteria (TM7) and cancer types such as Helicobacter pylori in gastric cancer Gracilibacteria (GN02). Thirty-two percent of these and mucosa-associated lymphoid tissue (MALT) lym- species remain uncultivated and 14% have not been named. phomas (23), Chlamydia trachomatis in cervical cancer Prior to 2000, the composition of the oral microbiome (24), Salmonella typhi in gallbladder cancer (25) and both had been assessed via culture methods or close-ended Bacteroides fragilis and Fusobacterium nucleatum in colon molecular techniques, mainly checkerboard DNA-DNA cancer (26, 27). This has recently inspired and triggered a hybridisation and polymerase chain reaction (PCR). After considerable amount of research into the possible role of 2000, clonal analysis of 16S rRNA gene with Sanger bacteria in oral oncogenesis, which has indeed provided sequencing was employed to identify uncultivable species some evidence to support such a role. Relevant work has in oral samples and assess diversity of the oral microbiota been already reviewed in a number of publications (42). Recently, the advent of high throughput, next- (28-30). However, the overwhelmingly growing literature generation sequencing (NGS) has enabled analysis of the keeps calling for new, updated reviews. microbial communities at unprecedented depth and Therefore, this narrative review aims to dissect existing breadth, providing unmatched opportunity for profiling literature on the association between bacteria and oral the oral microbiome in health and identifying microbial cancer and to provide an in-depth update about the shifts associated with disease (43). underlying mechanisms, with particular focus on the work done on Porphyromonas gingivalis and F. nucleatum. Oral microbiome dysbiosis and disease Under certain circumstances, the homeostatic state of oral The healthy oral microbiome bacterial flora can be lost, resulting in an ‘ecological shift’ Bacteria living within the body of an average healthy adult or ‘dysbiosis’ characterised by increased abundance of human outnumber the human cells by at least 10-folds pathogenic bacteria and expression of virulence properties (31, 32). Furthermore, the collective genome of these (39, 40). Subsequently, these pathogens become capable of bacteria (metagenome) surpasses the human genome by causing diseases within and beyond the oral cavity, orders of magnitude (>150-folds in terms of gene content) reverting the oral microbiota relationship with the host (33, 34). Therefore, humans can be thought of as ‘Super- from mutualistic to parasitic (44). A consortium of organisms whose metabolism represents an amalgamation microbes rather than one species is usually involved in

2 Citation: Journal of Oral Microbiology 2016, 8: 32762 - http://dx.doi.org/10.3402/jom.v8.32762 (page number not for citation purpose)

Bacteria and oral cancer

causing disease (45). Classic examples of oral microbial In 2006, Hooper et al. (61), using culture methods, dysbiosis include dental caries and periodontal infections. isolated 80 bacterial species from within the tissue of 20 In caries, the ecological shift favours growth of acidogenic OSCC biopsies. Further analysis of 10 specimens using and aciduric species, namely mutans streptococci, lacto- 16S rRNA Sanger sequencing identified an additional 28 bacilli and Bifidobacteria (46). In periodontal diseases, bacterial species (59). These studies provided some proteolytic bacteria that challenge the host inflammatory evidence for tumour specificity of bacteria, as some response are in play (47). The leading bacteria at period- species were exclusively found in either the cancerous or ontal destruction sites include members of the so-called non-cancerous tissues. However, the majority of bacteria red complex, namely P. gingivalis, Tannerella forsythia and identified in the tumours were saccharolytic and aciduric Treponema denticola (48), as well as a number of new taxa (Table 1), suggesting a selection process by the tumour such as oral Synergistetes and Saccharibacteria (TM7) microenvironment rather than a potential association (49). Currently, there is increasing interest in the possible with carcinogenesis. In 2012, Pushalkar et al. (58), also role of microbial dysbiosis in cancers. using 16S rRNA Sanger sequencing, detected 80 bacterial species in 10 specimens of OSCC, 35 species of which Oral microbial dysbiosis in oral cancer reported for the first time in OSCC, thus expanding the The relationship between bacterial profiles and OSCC bacterial diversity within OSCC tissues to 140 species. In has been thoroughly studied (Table 1). In the first this study, however, a totally different panel of species association study, Nagy et al. (50) performed culture- was found to be associated with the tumours (Table 1). based analysis of surface swabs and found the levels of A caveat of conventional culture methods and Sanger Porphyromonas spp., Fusobacterium spp. and other bac- sequencing is low analysis depth, that is, the limited terial species to be significantly higher on OSCC tissue number of strains/clones that can be affordably analysed, compared with adjacent healthy mucosa. In a subsequent which hampers reproducible detection of possibly relevant study using immunohistochemistry for detection of P. species, particularly those with relatively low abundance. gingivalis, Katz et al. (51) found that sections of gingival This limitation has been surpassed by the advent of NGS, squamous cell carcinoma displayed higher staining which allows the study of microbial communities at intensity than those of healthy gingival tissue samples, unprecedented depth and breadth (43). To date, three indicating a higher colonisation of cancerous tissues by studies have employed NGS to characterise the oral this bacterium. Interestingly and consistent with the bacteriome associated OSCC. In one study, Pushalkar above findings, both P. gingivalis and F. nucleatum have et al. (62) identified in salivary samples from three OSCC been linked recently to pancreatic and colorectal cancers cases and two healthy controls 860 operational taxonomic (CRC), respectively (26, 52-54). units (OTUs) matching known species; 244 and 398 of Streptococcus anginosus has also been implicated in these were exclusively present in the OSCC and control OSCC. In one study, S. anginosus was detected by PCR in samples, respectively. However, the comparison between all head and neck squamous cell carcinoma, including the two groups was limited to the genus level; the genera OSCC, samples studied (55). Consistently, Sasaki et al. Streptococcus, Rothia, Gemella, Peptostreptococcus, (56) detected S. anginosus in 19/42 (45%) OSCC samples, Porphyromonas, Micromonas and Lactobacillus were but in none of the leukoplakia, lymphoma or rhabdo- found to be more abundant in the OSCC cases, whereas myosarcoma samples tested. However, Morita et al. (57) Prevotella, Neisseria, Leptotrichia, Capnocytophaga, identified S. anginosus in only 5/38 (13%) of their OSCC Actinobacillus and Oribacterium were higher in the con- samples. In addition, more recent studies have identified trols. In a larger-scale study, Schmidt et al. (63) analysed S. anginosus in non-tumorous oral tissue at equal and swabs of lesion surface and contra-lateral normal mucosa even higher frequency compared with tissue from the from 18 OSCC patients, eight pre-cancer cases and nine tumours, suggesting that S. anginosus is a normal healthy controls. In contrast to the study by Pushalkar coloniser of the oral mucosa (58, 59). et al., the abundance of genera Streptococcus and Rothia Mager et al. (60) studied the differences in salivary was significantly lower in the tumour samples compared counts of 40 common oral bacteria between 45 OSCC with contra-lateral normal as well as to the pre-cancer cases and 229 cancer-free controls using checkerboard samples; instead, the tumours were associated with sig- DNA-DNA hybridisation. They found Capnocytophaga nificantly higher proportions of the genus Fusobacterium. gingivalis, Prevotella melaninogenica and S. mitis to be In addition, the phylum Bacteroidetes was notably more significantly elevated in the saliva of cases. When used as abundant in both cancerous and normal tissues of OSCC diagnostic markers, these three bacterial species were patients compared with pre-cancer and healthy control found to differentiate between cases and controls with subjects, suggesting that higher colonisation with this 80% sensitivity and 83% specificity. However, these phylum may be associated with increased risk of OSCC, results have not been replicated in any subsequent study. and thus serve as a biomarker.

Citation: Journal of Oral Microbiology 2016, 8: 32762 - http://dx.doi.org/10.3402/jom.v8.32762 3 (page number not for citation purpose)

Manosha

(page 4 Table 1. Summary of epidemiological studies that assessed the association between bacteria and oral cancer

number

Study N Technology used Case sample Control sample Taxa associated with oral cancer Perera

not for

Nagy et al., 1998 (50) 21 Cultivation; biochemical Tumour surface swabs Contagious mucosa surface Fusobacterium, Porphyromonas, Actinomyces, et citation

identification swabs Propionibacterium spp. and Candida albicans al.

purpose) Katz et al., 2011 (51) 15 Immunohistochemical FFPE gingival FFPE normal tissue Porphyromonas gingivalis staining carcinoma tissue

Tateda et al., 2000 (55) 270 Cultivation, PCR and Tumour tissue, gingival None Streptococcus anginosus Southern-blot smears & oropharyngeal swabs Sasaki et al., 2005 (56) 49 PCR Fresh tumour tissue, Fresh tissue, leukoplakia, S. anginosus dental plaque & saliva lymphoma & rhabdomyosarcoma Morita et al., 2003 (57) 63 Real-time PCR Fresh tumour tissue Fresh non-cancerous tissue Association with S. anginosus ruled out Mager et al., 2005 (60) 274 Checkerboard DNA-DNA Unstimulated saliva Unstimulated saliva Capnocytophaga gingivalis, Prevotella melaninogenica and S.

Citation: hybridisation mitis Hooper et al., 2006 (61) 51 Cultivation; 16S rRNA gene Fresh tumour tissue Fresh contagious tissue Micrococcus luteus, P. melaninogenica, Exiguobacterium

sequencing oxidotolerans, Fusobacterium naviforme, Staphylococcus Jour aureus and Veillonella parvula nal

Hooper et al., 2007 (59) 20 16S rRNA metagenomics Fresh tumour tissue Fresh contagious tissue Ralstonia insidiosa, Fusobacterium naviforme, of

Oral (Sanger sequencing) Peptostreptococcus micros, Clavibacter michiganensis

Microbiology subsp. tessellarius, Capnocytophaga sp. oral strain S3 and

Prevotella sp. oral clone BE073 Pushalkar et al., 2012 (58) 20 16S rRNA metagenomics Fresh tumour tissue Fresh contagious tissue Parvimonas sp. oral taxon 110, Eubacterium infirmum, (Sanger sequencing) & DGGE Eubacterium brachy, Gemella haemolysans, Gemella

2016, morbillorum, Gemella sanguinis, Johnsonella ignava,

8 Peptostreptococcus stomatis, S. gordonii, S. parasanguinis I

32762 and S. salivarius Pushalkar et al., 2011 (62) 05 16S rRNA metagenomics Stimulated saliva Stimulated saliva Genera Streptococcus, Rothia, Gemella,

http://dx.doi.org/10.3402/jom.v8.32762 (NGS; Roche’s 454) & DGGE Peptostreptococcus, Lactobacillus, Micromonas and Porphyromonas Schmidt et al., 2014 (63) 94 16S rRNA metagenomics Tumour surface swabs Surface swabs: contra-lateral Genus Fusobacterium and phylum Bacteriodetes (NGS; Illumina) normal; healthy and pre-cancer (Streptococcus and Rothia showed inverse association) subjects Al-Hebshi et al., 2015 (64) 03 16S rRNA metagenomics Fresh tumour tissue None Bacteroides fragilis (NGS; Roche’s 454)

PCR: polymerase chain reaction; FFPE: formalin-fixed, paraffin-embedded; DGGE: denaturing gradient gel electrophoresis; NGS: next-generation sequencing.

Bacteria and oral cancer

A limitation to the studies by Pushalkar et al. (62) and evidence to support a role for P. gingivalis and F. nucleatum Schmidt et al. (63), as the case with most oral microbiome in oral cancer, the carcinogenic properties of these two studies employing NGS, was the low taxonomic resolu- species, particularly P. gingivalis, have been extensively tion, that is, failure to reliably classify NGS sequences demonstrated in vitro and in experimental animals as beyond the genus level, which hinders accurate assessment detailed in the section below. of the possible association between bacteria and oral cancer. This limitation been overcome in a third study by Possible mechanisms by which oral bacteria Al-hebshi et al. (64) utilising a novel bioinformatic contribute to oral carcinogenesis algorithm that exploits well-curated databases of 16S Oral bacteria possibly contribute to oral carcinogenesis rRNA reference sequences, including the HOMD, for the via a number of mechanisms including inhibition of classification of individual NGS reads to the species level. apoptosis, activation of cell proliferation, promotion of By applying the algorithm to three samples of OSCC cellular invasion, induction of chronic inflammation and DNA, the study revealed the presence of 228 bacterial production of carcinogens (Fig. 1). species, of which 35 species were present in all samples. Two Inhibition of apoptosis of the samples contained B. fragilis, a bacterium seldom P. gingivalis represses chemically induced apoptosis in detected in the oral cavity. Interestingly, six proteins from primary cultures of gingival epithelial cells (GECs) (66), this species had been identified in saliva of OSCC in an which seems to be mediated by various mechanisms. P. earlier study (65). Furthermore, B. fragilis has been gingivalis stimulates JAK1/STAT3 and PI3K/Akt signal- recently implicated in colon cancer (27). Together, these ling, which controls intrinsic mitochondrial apoptosis findings are suggestive of a rolef o B. fragilis in oral pathways (67, 68). At the mitochondrial membrane, the carcinogenesis, a possibility worth further investigation. activity of proapoptotic BAD (BCL-2-associated death It is evident, therefore, that there is currently no promoter) is suppressed resulting in elevated BCL2 (anti- consensus among studies on which bacterial species are apoptotic): BAX (proapoptotic) ratio, which in turn linked to oral cancer. In addition, due to the cross- deceases the release of the apoptosis effector cytochrome sectional nature of these studies, it is not possible to tell c (69). Downstream, activity of both caspase-9 and the whether any microbial dysbiosis identified is involved in executioner caspase-3 is blocked (68, 69). In a different the aetiology of oral cancer or just a consequence of it. mechanism, P. gingivalis has been shown to upregulate Nevertheless, and despite the lack of strong epidemiological microRNA-203 in GECs, which through downregulation

Fig. 1. The possible mechanisms by which oral bacteria contribute to oral carcinogenesis. ROS, reactive oxygen species; RNI, reactive nitrogen intermediates, MMPs, matrix metalloproteinases; PAR, protease-associated receptor; EMT, epithelial to mesenchymal transition.

Citation: Journal of Oral Microbiology 2016, 8: 32762 - http://dx.doi.org/10.3402/jom.v8.32762 5 (page number not for citation purpose)

Manosha Perera et al.

of SOCS3 (suppressor of cytokine signalling 3) increases cells by F. nucleatum increases the production of MMP- the activity of STAT3 (signal transducer and activator of 13 (collagenase 3) through the activation of mitogen- transcription 3) and, in turn, inhibits apoptosis (70). activated protein kinase p38 and promotes cellular Furthermore, P. gingivalis secretes a nucleoside diphos- migration, possibly via stimulation of Etk/BMX, S6 phate kinase (NDK), which prevents ATP-dependent kinase p70 and RhoA kinase (77). apoptosis mediated through purinergic receptor P2X7 on GECs (71); NDK might also interfere with an anticancer Induction of inflammation immune response mediated by ATP activation of P2X7 Chronic inflammation, triggered by infections or envir- receptors on dendritic cells (29, 72). In 2015, Binder onmental exposures, plays a pivotal role in all stages of Gallimidi et al. (73) reported that chronic coinfection carcinogenesis including induction, progression, invasion with P. gingivalis and F. nucleatum promotes progression and metastasis (82). Reactive oxygen species (ROS), of chemically induced oral cancer in a murine model via reactive nitrogen intermediates (RNI) and cytokines activation of the IL6/STAT3 axis. produced by inflammatory cells are believed to contribute to initiation of cancer by inducing mutations, genomic Activation of cell proliferation instability and epigenetic alterations. Inflammatory cyto- In addition to its anti-apoptotic properties, P. gingivalis kines then activate key transcription factors such as accelerates progression of GECs through the S and G2 STAT3 and NF-kB within the premalignant cells; this in phases of the cell cycle via upregulation of cyclins (A, D turn supports pro-malignant processes including prolif- and E), activation (phosphorylation) of cyclin-dependent eration, angiogenesis, and invasion and metastasis, and kinases (CDKs) and diminishing the level of p53 tumour most importantly, results in a sustained tumour-promoting suppressor (74, 75). These effects are dependent on the inflammation within the tumour microenvironment possession of fimbriae (FimA adhesin). Since bacterial (82, 83). lipopolysaccharide (LPS) has been reported to dysregu- Chronic inflammation has, therefore, been anticipated late p53, a similar role by P. gingivalis LPS is possible as one of the potential pathways by which bacteria (29). P. gingivalis may also contribute to a proliferative contribute to oral carcinogenesis (30). Indeed, this phenotype in GECs through activation of b-catenin via a provides a plausible explanation for the strong associa- gingipain-dependent proteolytic process (76). tion between periodontitis and higher risk of OSCC (20). F. nucleatum also promotes cell proliferation. In human A pro-inflammatory potential is documented for some epithelial cells, infection by F. nucleatum results in oral bacterial species. F. nucleatum has been found to be upregulation of 12 kinases, the majority of which are associated with high cytokine levels in CRC and to create involved in cell proliferation and cell survival signalling as an inflammatory microenvironment supportive of tu- well as DNA repair (77). A strong relationship between mour progression (84, 85). In GECs as well as OSCC cell F. nucleatum and CRC is particularly evident. In vitro, lines, P. gingivalis upregulates B7-H1 and B7-DC recep- fusobacterial adhesion FadA has been found to bind to tors, both of which are known to contribute to chronic E-cadherin on CRC cells and in turn activate the b-catenin inflammation (72). Increased production of IL-1, IL-6, signalling pathway (78). Downstream, this results in IL-8 and TNF-a in response to P. gingivalis infection has elevated transcriptional activity of oncogenes and pro- been documented in engineered human oral mucosa (86). inflammatory cytokines, and subsequently enhanced CRC Similar pro-inflammatory properties have been reported cell proliferation. Consistently, expression levels of the for other oral bacteria including Eikenella corrodens, S. FadA gene in colon tissue from patients with CRC have anginosus and S. mitis (87, 88). been shown to be >10-fold higher than those in normal individuals (78). Production of carcinogens Promoting cellular migration and invasion Ethanol itself is not a carcinogen but its metabolites Both P. gingivalis and F. nucleatum promote cellular acetaldehyde, hydroxyl ethyl radicals and hydroxyl radi- invasion in OSCC. Using an OSCC cell line, P. gingivalis cals are carcinogenic (89, 90). The International Agency infection was demonstrated to upregulate expression of for Research on Cancer classified acetaldehyde associated pro-matrix metalloproteinase-9 (pro-MMP-9) by the with alcohol consumption as a Group 1 carcinogen in activation of the ERK1/2-ETS1, p38/HSP27 and PAR/ humans, with the capability to cause sister chromatid NF-kB pathways; gingipains then cleave the proenzyme exchanges, point mutations, DNA adducts and hyper- into active MMP-9, enhancing cellular invasion (79, 80). proliferation of epithelium (8, 91). It is well established Repeated exposure to P. gingivalis can also increase that certain bacteria and Candida spp. in the oral cavity invasiveness of OSCC cells by triggering epithelial to possess the enzyme alcohol dehydrogenase (ADH), which mesenchymal transition (EMT), acquisition of stemness catalyses the production of mutagenic amounts of and enhanced production of MMP-1 and MMP-10 (81). acetaldehyde under aerobic or microaerophilic conditions In a similar fashion, the infection of human epithelial (30, 92-94). Examples of such oral bacteria include

6 Citation: Journal of Oral Microbiology 2016, 8: 32762 - http://dx.doi.org/10.3402/jom.v8.32762 (page number not for citation purpose)

Bacteria and oral cancer

S. salivarius, S. intermedius, S. mitis (95) and non- order to plan personalised therapy. Further work on the pathogenic Neisseria spp. (96). oral bacteriome associated with oral cancers has an exciting future and can generate hypotheses for exploring Conclusion and future directions mechanisms in cell and animal models. There is an increased interest in the potential role of bacteria in oral cancer as evident from the increasing Conflict of interest and funding number of publications addressing the topic. However, There is no conflict of interest in the present study for any published studies disagree on which specific bacteria or of the authors. Perera M is supported by a Griffith patterns of oral microbial dysbiosis to associate with oral University Postgraduate Research Scholarship. cancer. This is probably due to the significant methodological variation between studies with respect to sampling References

(e.g. deep tissue biopsy vs. surface swab), selection of control tissues and microbial profiling technology. 16S 1. Warnakulasuriya S. Global epidemiology of oral and rRNA metagenomics with NGS has great potential in oropharyngeal cancer. Oral Oncol 2009; 45: 309-16. exploring the oral microbiome shifts associated with oral 2. Ferlay J, Soerjomataram I, Ervik M, Dikshit R, Eser S, Mathers cancer, but currently lacks adequate standardisation, C, et al. GLOBOCAN 2012 v1.0, Cancer Incidence and Mortality Worldwide: IARC CancerBase No. 11. Lyon, France: particularly in terms of DNA extraction, selection of International Agency for Research on Cancer. primers and hypervariable region for amplification, and 3. Silverman S. Demographics and occurrence of oral and bioinformatics. In addition, 16S rRNA microbial profil- pharyngeal cancers. The outcomes, the trends, the challenge. ing does not inform about microbial gene expression and J Am Dent Assoc 2001; 132: 7S-11S. microbial function. Therefore, future work should, in 4. Alfano MC, Horowitz AM. Professional and community efforts to prevent morbidity and mortality from oral cancer. J Am Dent addition to methodological standardisation, embody full Assoc 2001; 132: 24S-9S. metagenomics or metatranscriptomics analysis into case- 5. Wang B, Zhang S, Yue K, Wang XD. The recurrence and control studies to fully explain the role of the oral survival of oral squamous cell carcinoma: a report of 275 cases. microbiome in oral cancer and generate information of Chin J Cancer 2013; 32: 614-18. translational value, for example, identify diagnostic and 6. Vazquez-Mahia I, Seoane J, Varela-Centelles P, Tomas I, Alvarez Garcia A, Lopez Cedrun JL. Predictors for tumor prognostic markers. recurrence after primary definitive surgery for oral cancer. The oral carcinogenic properties of P. gingivalis and F. J Oral Maxillofac Surg 2012; 70: 1724-32. nucleatum are well documented in vitro as well as in 7. Petti S. Lifestyle risk factors for oral cancer. Oral Oncol 2009; experimental animals; many of the mechanisms under- 45: 340-50. 8. Secretan B, Straif K, Baan R, Grosse Y, El Ghissassi F, Bouvard lying these have been elucidated. It has been suggested, V, et al. A review of human carcinogens - part E: tobacco, areca therefore, that the detection of P. gingivalis and F. nut, alcohol, coal smoke, and salted fish. Lancet Oncol 2009; 10: nucleatum in oral potentially malignant conditions could 1033-4. be used as a marker of risk of malignant transformation. 9. Syrja¨nen S. Human papillomavirus (HPV) in head and neck - Virulence factors such as FimA of P. gingivalis and FadA cancer. J Clin Virol 2005; 32: 59 66. 10. Gupta B, Johnson NW. Systematic review and meta-analysis of of F. nucleatum may also serve as novel targets for association of smokeless tobacco and of betel quid without therapeutic intervention of oral cancer. However, it is tobacco with incidence of oral cancer in South Asia and the important to note that a strong epidemiological evidence Pacific. PLoS One 2014; 9: e113385. for the association of P. gingivalis and F. nucleatum with 11. Petersen PE. Oral cancer prevention and control - the approach of the World Health Organization. Oral Oncol 2009; 45: oral cancer is still lacking. Large-scale, well-designed 454-60. longitudinal studies that involve follow-up of microbiota 12. Llewellyn CD, Linklater K, Bell J, Johnson NW, associated with precancerous lesions while adequately Warnakulasuriya S. An analysis of risk factors for oral cancer control for the confounding effects of established risk in young people: a case-control study. Oral oncol 2004; 40: factors are required to demonstrate if these two or other 304-13. species contribute or even have an exclusive role in oral 13. Llewellyn C, Johnson NW, Warnakulasuriya K. Risk factors for oral cancer in newly diagnosed patients aged 45 years and carcinogenesis in a subset of patients. Such an approach younger: a case-control study in Southern England. J Oral will also help resolve the legitimate hen and egg question: Pathol Med 2004; 33: 525-32. which species, if any, is i nvolved in carcinogenesis (driver) 14. Bleyer A, editor. Cancer of the oral cavity and pharynx in young and which is simply an adapter to the cancer tissue females: increasing incidence, role of human papilloma virus, (passenger)? and lack of survival improvement. Semin Oncol 2009; 36: 451-9. There are a number of well-established risk factors for 15. Kietthubthew S, Sriplung H, Au WW, Ishida T. Polymorphism oral cancers and a presumed multifactorial aetiology. The in DNA repair genes and oral squamous cell carcinoma in balance of risk factors varies from individual to indivi- Thailand. Int J Hyg Environ Health 2006; 209: 21-9. dual. In the age of personalised medicine, it is important 16. Bau D, Tsai M, Huang C, Lee C, Tseng H, Lo Y, et al. to isolate causes and the molecular damage caused, in Relationship between polymorphisms of nucleotide excision

Citation: Journal of Oral Microbiology 2016, 8: 32762 - http://dx.doi.org/10.3402/jom.v8.32762 7 (page number not for citation purpose)

Manosha Perera et al.

repair genes and oral cancer risk in Taiwan: evidence for 37. Dewhirst FE, Chen T, Izard J, Paster BJ, Tanner AC, Yu WH, modification of smoking habit. Chin J Physiol 2007; 50: 294. et al. The human oral microbiome. J Bacteriol 2010; 192: 17. Hatagima A, Costa EC, Marques CF, Koifman RJ, Boffetta P, 5002-17. Koifman S. Glutathione S-transferase polymorphisms and oral 38. Aas JA, Paster BJ, Stokes LN, Olsen I, Dewhirst FE. Defining cancer: a case-control study in Rio de Janeiro, Brazil. Oral the normal bacterial flora of the oral cavity. J Clin Microbiol Oncol 2008; 44: 200-7. 2005; 43: 5721-32. 18. Thornhill MH. The sun, the ozone layer and the skin: the role of 39. Do T, Devine D, Marsh PD. Oral biofilms: molecular analysis, ultraviolet light in lip and skin cancer. Dent Update 1993; 20: challenges, and future prospects in dental diagnostics. Clin 236-40. Cosmet Investig Dent 2013; 5: 11-19. 19. Kumar SKS, Zain RB. Aetiology and risk factors for oral 40. Zarco MF, Vess TJ, Ginsburg GS. The oral microbiome in cancer - a brief overview. Annal Dent Univ Malaya 2004; 11: health and disease and the potential impact on personalized - 41 50. dental medicine. Oral Dis 2012; 18: 109-20. 20. Meyer MS, Joshipura K, Giovannucci E, Michaud DS. 41. Chen T, Yu W-H, Izard J, Baranova OV, Lakshmanan A, A review of the relationship between tooth loss, periodontal Dewhirst FE. The Human Oral Microbiome Database: a web - disease, and cancer. Cancer Causes Control 2008; 19: 895 907. accessible resource for investigating oral microbe taxonomic 21. Hayashi C, Gudino C, Gibson F III, Genco C. Review: and genomic information. Database 2010; 2010: baq013. pathogen-induced inflammation at sites distant from oral 42. Sakamoto M, Umeda M, Benno Y. Molecular analysis of infection: bacterial persistence and induction of cell-specific human oral microbiota. J Periodontal Res 2005; 40: 277-85. innate immune inflammatory pathways. Mol Oral Microbiol 43. Siqueira JF Jr., Fouad AF, Rocas IN. Pyrosequencing as a tool - 2010; 25: 305 16. for better understanding of human microbiomes. J Oral 22. Chocolatewala N, Chaturvedi P, Desale R. The role of bacteria Microbiol 2012; 4, 10743, doi: http://dx.doi.org/10.3402/jom. in oral cancer. Indian J Med Paediatr Oncol 2010; 31: 126. v4i0.10743 23. Mager D. Bacteria and cancer: cause, coincidence or cure? A 44. Parahitiyawa N, Scully C, Leung W, Yam W, Jin L, review. J Transl Med 2006; 4: 14. Samaranayake L. Exploring the oral bacterial flora: current 24. Markowska J, Fischer N, Markowski M, Nalewaj J. The role of status and future directions. Oral Dis 2010; 16: 136-45. Chlamydia trachomatis infection in the development of cervical 45. Darveau RP. Periodontitis: a polymicrobial disruption of host neoplasia and carcinoma. Med Wieku Rozwoj 2005; 9: 83-6. homeostasis. Nat Rev Microbiol 2010; 8: 481-90. 25. Nagaraja V, Eslick G. Systematic review with meta-analysis: the 46. Takahashi N, Nyvad B. The role of bacteria in the caries relationship between chronic Salmonella typhi carrier status and process: ecological perspectives. J Dent Res 2011; 90: 294-303. gall-bladder cancer. Aliment Pharmacol Ther 2014; 39: 745-50. 47. Kolenbrander PE, Palmer RJ, Periasamy S, Jakubovics NS. doi: http://dx.doi.org/10.1111/apt.12655 Oral multispecies biofilm development and the key role of cell- 26. Kostic AD, Gevers D, Pedamallu CS, Michaud M, Duke F, Earl cell distance. Nat Rev Microbiol 2010; 8: 471-80. AM, et al. Genomic analysis identifies association of 48. Socransky SS, Haffajee AD, Cugini MA, Smith C, Kent RL Jr. Fusobacterium with colorectal carcinoma. Genome Res 2012; Microbial complexes in subgingival plaque. J Clin Periodontol 22: 292-8. 1998; 25: 134-44. 27. Toprak NU, Yagci A, Gulluoglu BM, Akin ML, Demirkalem P, 49. Al-hebshi NN, Al-Alimi A, Taiyeb-Ali T, Jaafar N. Quantitative Celenk T, et al. A possible role of Bacteroides fragilis analysis of classical and new putative periodontal pathogens in enterotoxin in the aetiology of colorectal cancer. Clin Microbiol Infect 2006; 12: 782-6. subgingival biofilm: a case-control study. J Periodontal Res 28. Meurman JH. Oral microbiota and cancer. J Oral Microbiol 2015; 50: 320-9. 2010; 2, 5195, doi: http://dx.doi.org/10.3402/jom.v2i0.5195 50. Nagy K, Sonkodi I, Szo¨ ke I, Nagy E, Newman H. The 29. Whitmore SE, Lamont RJ. Oral bacteria and cancer. PLoS microflora associated with human oral carcinomas. Oral Oncol - Pathog 2014; 10: e1003933. 1998; 34: 304 8. 51. Katz J, Onate MD, Pauley KM, Bhattacharyya I, Cha S. 30. Hooper SJ, Wilson MJ, Crean SJ. Exploring the link between microorganisms and oral cancer: a systematic review of the Presence of Porphyromonas gingivalis in gingival squamous cell - literature. Head Neck 2009; 31: 1228-39. carcinoma. Int J Oral Sci 2011; 3: 209 15. 31. Bultman SJ. Emerging roles of the microbiome in cancer. 52. Ahn J, Segers S, Hayes RB. Periodontal disease, Porphyromonas Carcinogenesis 2014; 35: 249-55. gingivalis serum antibody levels and orodigestive cancer mor- - 32. Plottel CS, Blaser MJ. Microbiome and malignancy. Cell Host tality. Carcinogenesis 2012; 33: 1055 8. Microbe 2011; 10: 324-35. 53. Castellarin M, Warren RL, Freeman JD, Dreolini L, 33. Aagaard K, Petrosino J, Keitel W, Watson M, Katancik J, Krzywinski M, Strauss J, et al. Fusobacterium nucleatum Garcia N, et al. The Human Microbiome Project strategy for infection is prevalent in human colorectal carcinoma. Genome - comprehensive sampling of the human microbiome and why it Res 2012; 22: 299 306. matters. FASEB J 2013; 27: 1012-22. 54. Michaud DS, Izard J. Microbiota, oral microbiome, and pancreatic cancer. Cancer J 2014; 20: 203-6. 34. Human Microbiome Project Consortium. Structure, function 55. Tateda M, Shiga K, Saijo S, Sone M, Hori T, Yokoyama J, et al. and diversity of the healthy human microbiome. Nature 2012; Streptococcus anginosus in head and neck squamous cell 486: 207-14. carcinoma: implication in carcinogenesis. Int J Mol Med 2000; 35. Gill SR, Pop M, Deboy RT, Eckburg PB, Turnbaugh PJ, Samuel - BS, et al. Metagenomic analysis of the human distal gut 6: 699 703. microbiome. Science 2006; 312: 1355-9. 56. Sasaki M, Yamaura C, Ohara-Nemoto Y, Tajika S, Kodama Y, 36. Turnbaugh PJ, Ley RE, Hamady M, Fraser-Liggett C, Knight Ohya T, et al. Streptococcus anginosus infection in oral cancer - R, Gordon JI. The human microbiome project: exploring the and its infection route. Oral Dis 2005; 11: 151 6. microbial part of ourselves in a changing world. Nature 2007; 57. Morita E, Narikiyo M, Yano A, Nishimura E, Igaki H, Sasaki 449: 804. H, et al. Different frequencies of Streptococcus anginosus

8 Citation: Journal of Oral Microbiology 2016, 8: 32762 - http://dx.doi.org/10.3402/jom.v8.32762 (page number not for citation purpose)

Bacteria and oral cancer

infection in oral cancer and esophageal cancer. Cancer Sci 2003; tumor progression in an oral-specific chemical carcinogenesis 94: 492-6. model. Oncotarget 2015; 6: 22613-23. 58. Pushalkar S, Ji X, Li Y, Estilo C, Yegnanarayana R, Singh B, 74. Kuboniwa M, Hasegawa Y, Mao S, Shizukuishi S, Amano A, et al. Comparison of oral microbiota in tumor and non-tumor Lamont RJ, et al. P. gingivalis accelerates gingival epithelial cell tissues of patients with oral squamous cell carcinoma. BMC progression through the cell cycle. Microbes Infect 2008; 10: Microbiol 2012; 12: 144. 122-8. 59. Hooper SJ, Crean S-J, Fardy MJ, Lewis MA, Spratt DA, Wade 75. Pan C, Xu X, Tan L, Lin L, Pan Y. The effects of WG, et al. A molecular analysis of the bacteria present within oral Porphyromonas gingivalis on the cell cycle progression of human squamous cell carcinoma. J Med Microbiol 2007; 56: 1651-9. gingival epithelial cells. Oral Dis 2014; 20: 100-8. 60. Mager D, Haffajee A, Devlin P, Norris C, Posner M, Goodson J. 76. Zhou Y, Sztukowska M, Wang Q, Inaba H, Potempa J, Scott The salivary microbiota as a diagnostic indicator of oral cancer: a DA, et al. Noncanonical activation of beta-catenin by descriptive, non-randomized study of cancer-free and oral Porphyromonas gingivalis. Infect Immun 2015; 83: 3195-203. squamous cell carcinoma subjects. J Transl Med 2005; 3: 27. 77. Uitto V-J, Baillie D, Wu Q, Gendron R, Grenier D, Putnins EE, 61. Hooper SJ, Crean SJ, Lewis MA, Spratt DA, Wade WG, Wilson et al. Fusobacterium nucleatum increases collagenase 3 produc- MJ. Viable bacteria present within oral squamous cell carcinoma tion and migration of epithelial cells. Infect Immun 2005; 73: tissue. J Clin Microbiol 2006; 44: 1719-25. 1171-9. 62. Pushalkar S, Mane SP, Ji X, Li Y, Evans C, Crasta OR, et al. 78. Rubinstein MR, Wang X, Liu W, Hao Y, Cai G, Han YW. Microbial diversity in saliva of oral squamous cell carcinoma. Fusobacterium nucleatum promotes colorectal carcinogenesis by FEMS Immunol Med Microbiol 2011; 61: 269-77. modulating E-cadherin/b-catenin signaling via its FadA adhesin. 63. Schmidt BL, Kuczynski J, Bhattacharya A, Huey B, Corby PM, Cell Host Microbe 2013; 14: 195-206. Queiroz EL, et al. Changes in abundance of oral microbiota 79. Inaba H, Sugita H, Kuboniwa M, Iwai S, Hamada M, Noda T, associated with oral cancer. PLoS One 2014; 9: e98741. et al. Porphyromonas gingivalis promotes invasion of oral 64. Al-Hebshi NN, Nasher AT, Idris AM, Chen T. Robust species squamous cell carcinoma through induction of proMMP9 and taxonomy assignment algorithm for 16S rRNA NGS reads: its activation. Cell Microbiol 2014; 16: 131-45. application to oral carcinoma samples. J Oral Microbiol 2015; 80. Inaba H, Amano A, Lamont RJ, Murakami Y. Involvement of 7: 28934, doi: http://dx.doi.org/10.3402/jom.v7.28934 protease-activated receptor 4 in over-expression of matrix 65. Xie H, Onsongo G, Popko J, de Jong EP, Cao J, Carlis JV, et al. metalloproteinase 9 induced by Porphyromonas gingivalis. Med Proteomics analysis of cells in whole saliva from oral cancer Microbiol Immunol 2015; 204: 605-12. patients via value-added three-dimensional peptide fractiona- 81. Ha NH, Woo BH, Kim da J, Ha ES, Choi JI, Kim SJ, et al. tion and tandem mass spectrometry. Mol Cell Proteomics 2008; Prolonged and repetitive exposure to Porphyromonas gingivalis 7: 486-98. increases aggressiveness of oral cancer cells by promoting 66. Nakhjiri SF, Park Y, Yilmaz O, Chung WO, Watanabe K, El- acquisition of cancer stem cell properties. Tumour Biol 2015; Sabaeny A, et al. Inhibition of epithelial cell apoptosis by 36: 9947-60. Porphyromonas gingivalis. FEMS Microbiol Lett 2001; 200: 82. Grivennikov SI, Greten FR, Karin M. Immunity, inflammation, 145-9. and cancer. Cell 2010; 140: 883-99. 67. Yilmaz O¨ , Jungas T, Verbeke P, Ojcius DM. Activation of the 83. Landskron G, De la Fuente M, Thuwajit P, Thuwajit C, phosphatidylinositol 3-kinase/Akt pathway contributes to sur- Hermoso MA. Chronic inflammation and cytokines in vival of primary epithelial cells infected with the periodontal the tumor microenvironment. J Immunol Res 2014; 2014: pathogen Porphyromonas gingivalis. Infect Immun 2004; 72: 149185. 3743-51. 84. Kostic AD, Chun E, Robertson L, Glickman JN, Gallini CA, 68. Mao S, Park Y, Hasegawa Y, Tribble GD, James CE, Handfield Michaud M, et al. Fusobacterium nucleatum potentiates intest- M, et al. Intrinsic apoptotic pathways of gingival epithelial cells inal tumorigenesis and modulates the tumor-immune micro- modulated by Porphyromonas gingivalis. Cell Microbiol 2007; 9: - 1997-2007. environment. Cell Host Microbe 2013; 14: 207 15. 69. Yao L, Jermanus C, Barbetta B, Choi C, Verbeke P, Ojcius D, 85. McCoy AN, Araujo-Perez F, Azcarate-Peril A, Yeh JJ, Sandler et al. Porphyromonas gingivalis infection sequesters pro-apoptotic RS, Keku TO. Fusobacterium is associated with colorectal Bad through Akt in primary gingival epithelial cells. Mol Oral adenomas. PLoS One 2013; 8: e53653. Microbiol 2010; 25: 89-101. 86. Andrian E, Grenier D, Rouabhia M. In vitro models of tissue 70. Moffatt CE, Lamont RJ. Porphyromonas gingivalis induction of penetration and destruction by Porphyromonas gingivalis. Infect - microRNA-203 expression controls suppressor of cytokine Immun 2004; 72: 4689 98. signaling 3 in gingival epithelial cells. Infect Immun 2011; 79: 87. Narikiyo M, Tanabe C, Yamada Y, Igaki H, Tachimori Y, Kato 2632-7. H, et al. Frequent and preferential infection of Treponema 71. Yilmaz O¨ , Yao L, Maeda K, Rose TM, Lewis EL, Duman M, denticola, Streptococcus mitis, and Streptococcus anginosus in et al. ATP scavenging by the intracellular pathogen esophageal cancers. Cancer Sci 2004; 95: 569-74. Porphyromonas gingivalis inhibits P2X7-mediated host-cell 88. Yumoto H, Nakae H, Yamada M, Fujinaka K, Shinohara C, apoptosis. Cell Microbiol 2008; 10: 863-75. Ebisu S, et al. Soluble products from Eikenella corrodens 72. Groeger S, Domann E, Gonzales JR, Chakraborty T, Meyle J. stimulate oral epithelial cells to induce inflammatory mediators. B7-H1 and B7-DC receptors of oral squamous carcinoma cells Oral Microbiol Immunol 2001; 16: 296-305. are upregulated by Porphyromonas gingivalis. Immunobiology 89. Zakhari S. Overview: how is alcohol metabolized by the body? - 2011; 216: 1302-10. Alcohol Res Health 2006; 29: 245 54. 73. Binder Gallimidi A, Fischman S, Revach B, Bulvik R, 90. Seitz H, Ga¨rtner U, Egerer G, Simanowski UA. Ethanol Maliutina A, Rubinstein AM, et al. Periodontal pathogens metabolism in the gastrointestinal tract and its possible - Porphyromonas gingivalis and Fusobacterium nucleatum promote consequences. Alcohol Alcohol Suppl 1994; 2: 157 62.

Citation: Journal of Oral Microbiology 2016, 8: 32762 - http://dx.doi.org/10.3402/jom.v8.32762 9 (page number not for citation purpose)

Manosha Perera et al.

91. Seitz HK, Cho CH. Contribution of alcohol and tobacco use in 94. Salaspuro MP. Acetaldehyde, microbes, and cancer of the gastrointestinal cancer development. Methods Mol Biol 2009; digestive tract. Crit Rev Clin Lab Sci 2003; 40: 183-208. 472: 217-41. 95. Kurkivuori J, Salaspuro V, Kaihovaara P, Kari K, Rautemaa R, 92. Homann N, Tillonen J, Meurman JH, Rintama¨ki H, Lindqvist Gro¨ nroos L, et al. Acetaldehyde production from ethanol by C, Rautio M, et al. Increased salivary acetaldehyde levels in oral streptococci. Oral Oncol 2007; 43: 181-6. heavy drinkers and smokers: a microbiological approach to oral 96. Muto M, Hitomi Y, Ohtsu A, Shimada H, Kashiwase Y, cavity cancer. Carcinogenesis 2000; 21: 663-8. Sasaki H, et al. Acetaldehyde production by non-pathogenic 93. Va¨keva¨inen S, Mentula S, Nuutinen H, Salmela K, Jousimies- Neisseria in human oral microflora: implications for carcino- Somer H, Fa¨rkkila¨ M, et al. Ethanol-derived microbial produc- genesis in upper aerodigestive tract. Int J Cancer 2000; 88: tion of carcinogenic acetaldehyde in achlorhydric atrophic 342-50. gastritis. Scand J Gastroenterol 2002; 37: 648-55.

10 Citation: Journal of Oral Microbiology 2016, 8: 32762 - http://dx.doi.org/10.3402/jom.v8.32762 (page number not for citation purpose) Appendix 2

Approval from JOM for https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5039235/S p 26, 2016 ... Emerging role of bacteria in oral carcinogenesis: a review with special 1,*† reference to perio-pathogenic bacteria. Manosha Perera, Nezar.

Academic Journals ZJOM Peer Review

[email protected]>

Dear Manosha Perera,

According to our records, your paper was published under a CC-BY-NC license. This permits all non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. So, as long as you cite the original article, you should be okay to use it.

Sincerely,

Dustin Martinez Peer Review Assistant Journal of Oral Microbiology

Appendix 3.2

Table 1- Adjusted Odds Ratio and Corresponding 95% Confidence Intervals for Oral Squamous Cell Carcinoma by Well Established and Emerging Risk Factors

Variable OSCC Benign Adjusted OR P-value Cases Mucosal (95% CI) Disease Controls N % N % Age Categories 18-40 years 5 (3.7) 47 (35.1) 1 41-60 years 68 (50.7) 66 (49.2) 5.43 (1.62-18.18) 0.006* 61-89 years 61 (45.6) 21 (15.7) 11.15 (3.06-40.62) 0.001* Gender Female 18 (13.4) 52 (38.8) 1 Male 116 (86.6) 82 (61.2) 3.17 (1.08-9.27) 0.034* Level of Education Less than GCE.Ordinary 106 (79.1) 54 (40.3) 1 Level GCE Ordinary Level & above 28 (20.9) 80 (59.7) 0.25 (0.11-0.54) 0.001* Betel Chewing Never 14 (10.5) 74 (55.2) 1 Ever 120 (89.5) 60 (44.8) 1.92 (0.77-4.80) 0.163 Smoking Never 39 (29.1) 99 (73.9) 1 Ever 95 (70.9) 35 (26.1) 2.09 (0.82-5.33) 0.120 Alcohol Consumption Never 36 (26.9) 87 (64.9) 1 Ever 98 (73.1) 47 (35.1) 1.01 (0.36-2.80) 0.984 Daily Consumption of Fruits No 96 (71.6) 69 (51.5) 1 Yes 38 (28.4) 65 (49.5) 0.500 (0.24-1.04) 0.065 Periodontal Disease status** No/mild periodontitis 19 (14.2) 101 (75.4) 1 Moderate periodontitis 69 (51.5) 28 (20.9) 3.83 (1.56-9.25) 0.003* Severe periodontitis 46 (34.3) 5 ( 3.7) 7.15 (1.87-27.39) 0.004* Oral Hygiene Status*** Good 71 (53.0) 16 (11.9) 1 Fair 52 (38.8) 65 (48.6) 1.51 (0.57-4.03) 0.404 Poor 11 ( 8.2) 53 (39.5) 1.74 (0.46-6.57) 0.410 *p< 0.05, Hosmer- Lemeshow Goodness of Fit Index was used to assess the overall model fit. Unconditional Logistic Regression Model explained 84.3% of variability.

** Periodontal disease categorization was based on Case Definitions for Periodontitis developed by Centre for Disease Control (CDC) Periodontal Disease Surveillance Workgroup (Page and Eke, 2007) ***Classified according to Simplified Oral Hygiene Index (OHI-S) of Green & Vermillion 1964.

As shown in Table 1 the findings of the main study comprised of 134 Histologically Confirmed Cases of Oral Squamous Cell Carcinoma Cases (OSCC) and 134 Controls with Benign Mucosal Disease. Unconditional Logistic Regression revealed that Age, Gender, Level of Education and Periodontal Disease Status emerged as independent risk factors with statistically significant (p<0.05) Odds Ratios. Accordingly, individuals over 60 years of age, male gender, level of Education below GCE Ordinary Level and Moderate and Periodontal Disease were more at risk for developing OSCC compared to Controls presented with benign mucosal conditions namely fibro-epithelial polyps, mucocels, lichenoid reaction, keratosis without dysplasia etc. APPENDIX 3.3 Index Number

DATA COLLECTION FORM

The Microbiome Profile of Oral Squamous Cell Carcinoma Tissues

of a Group of Sri Lankan Patients

Date: Registration Number:

Hospital: OMF Clinic:

Socio-demographic Information

1. Name 2. Gender: Male Female:

3. Age in years: 4. Date of Birth:

5. Contact Address:

6. Contact Phone Number:

7. 7.1 Area of Residence: 7.2 MOH Area:

8. Ethnic Group: Sinhala Tamil Muslim Other

9. Occupation:

10. Level of Education:No formal education

Grade 1-5

Grade 6-10

Passed GCE O/L

Passed GCE A/L

Technical Education/Diploma/Vocational Training Course/University Degree

Tooth Cleaning Habit

11. 11.1 Tooth Cleaning Device- Use of a tooth brush No Yes

11.2 Tooth Paste No Yes

11.3 Tooth Powder/Charcoal No Yes

Established Risk Factors

Ever Betel Chewer: An individual who reported betel chewing with 100 quids during his or her lifetime.

Ever Smoker: An Individual who reported smoking at least 100 Beedi/Cigarettes/Cigars during his or her lifetime.

12. 12.1 Betel Chewing Habit

Betel Chewing 0-3 Age Started Duration of Number per Years day With Tobacco (Betel leaf+ Lime+ Arecanut+ Tobacco/ Betel Leaf+ Lime Tobacco) Without Tobacco (Betel Leaf+ Areca Nut+ Lime)/Betel Leaf+ areca Nut) 0= Never

1 = Past (Ever betel chewer who has discontinued the habit for more than 01 calendar year prior to the date of data collection

2 = Occasional (Ever betel chewer who do not practice the habit daily)

3 = Daily (Ever betel chewer who practice the habit on a daily basis)

12.2 If stopped the habit of betel chewing abstinence in months ……………….

12.3 Sleeping with Betel Quid No Yes Sometimes

12.4 Average duration of Betel Quid Chewing in Minutes: ………………………

13. 13.1 Smoking Habit

Smoking 0-3 Age Started Duration of Number per day Years Cigarettes Beedi Cigar Other…Specify

13.2 If Stopped Smoking duration of abstinence in months ……………………….

14. 14.1 Alcohol Consumption Habit

Alcohol 0-3 Age Started Duration of Amount in Consumption Years Standard Measures Arrack Kasippu Beer Toddy Wine Whiskey Other…Specify

0 = Never

1= Past Drinker (Ever Drinker who has continued drinking for more than one calendar year prior to data collection)

2= occasionally (2-3 times per year)

3= Infrequent Current Drinker (Not drinking once a week)

4= Frequent current drinker (Drinking at least once a week)

14.2 If stopped drinking duration of abstinence in months ………………………………..

Areca nut consumption habit

14.3 Do you chew areca nut packets? Never In the Past

Daily If so Number…………

Fruit & Vegetable consumption habit

15. 1 Do you consume fruits on a daily basis? No Yes Number of varieties/ portions per day?

15.2 Do you consume vegetables on a daily basis? No Yes Number of varieties/ portions per day?

Family History & Awareness

16. Do you have a family history on cancer/oral cancer?

No Yes Do not know

17. Have you heard about mouth cancer/pre cancer before?

No Yes Do not know

18. Whatcauses mouth cancer/pre cancer as you know?

Factor No Yes Don’t know Betel Quid Chewing Smoking Alcohol consumption Vitamin deficiency Poor Oral Hygiene

19. Past Medical History

Allergy/Asthma Bleeding disorders Heart Disease

Hypertension Diabetes Stroke

Respiratory Disease Liver Disease GIT disease

Any other…..Specify?

Clinical Oral Examination

20. 1Teeth Present:

20.2 Decayed Teeth:

20.3 Missing Teeth (due to extractions and periodontal disease)

20.4 Filled Teeth:

20.5 Mobile Teeth:

20.6 OHI-S Green & Vermillion 1964 Debri Index Calculus Index

Labial/Buccal Surface Labial/Buccal Surface 16 11 26 16 11 26

46 31 36 Lingual Surface 46 31 36 Lingual Surface

If first molar is absent examine second or third molar.If incisors missing substitute with opposite from mid line.

Score Criteria for debri index Criteria for calculus index 0 No debris or stain present No calculus present 1 Soft debri covering not more than Supra gingival calculus covering not more than one one third of the tooth surface or third of exposed surface presence of extrinsic stains without other debri regardless of surface area covered. 2 Soft debris covering more than Supra gingival calculus covering more than one third one thirds but not more than two but not more than two thirds of the exposed tooth thirds of the exposed tooth surface or the presence of individual flecks of surface. subgingival calculus around the cervical portion of tooth or both 3 Soft debris covering more than Supra gingival calculus covering more than two thirds two thirds of the exposed surface of the exposed tooth surface or a continuous heavy

band of sub gingival calculus around the cervical portion of the tooth or both

21. Periodontal Examination

Periodontal Disease Classification based on Page & Eke 2007 (Case Definitions for Use in Population Based Surveillance of Periodontitis)

Posterior Tooth (6 surfaces) Anterior Tooth (4 surfaces)

DB B MB Labial

D M Distal Mesial

DL L ML Lingual

18 17 16 15 14 13 12 11 21 22 23 24 25 26 27 28

48 47 46 45 44 43 42 41 31 32 33 34 35 36 37 38

Bleeding On Probing (BOP): reported as “present” if there was bleeding within 15s after probing at a particular site of periodontal probe.

Probing Pocket Depth (PD) : PPD was defined as the distance from free gingival margin to the bottom of the pocket in mm.

Clinical Attachment Loss (CAL) was defined as the distance from Cemento-Enamel Junction (CEJ) to the bottom of the pocket in mm.

Disease Category Clinical Definition CAL PD Severe Periodontitis ≥ 2 interproximal sites with ≥ 1 interproximal site with CAL≥ 6 mm (not on the same PD ≥ 5mm tooth) AND Moderate Periodontitis ≥ 2 interproximal sites with ≥ 2 interproximal site with CAL≥ 4 mm (not on the same PD ≥ 5mm (not on the same tooth) OR tooth) No or Mild Periodontitis Neither Moderate Nor Severe Periodontitis + third molars excluded

22. Oral Mucosal Examination

Condition Location Side 1-Left 2-Right

1=Leukoplakia 1=Vermillion Boarder ……………………

2=Speckled Leukoplakia 2= Commissures …………………….

3=Nodulo-Speckled Leukoplakia 3=Lips …………………….

4=Lichen Planus 4=Sulci …………………….

5=Erythroplakia 5=Buccal Mucosa …………………….

6=Oral Submucous Fibrosis 6=Floor of the mouth …………………….

7=Denture Stomatitis 7= Tongue …………………….

8=Ulcer 8= Hard & Soft Palate …………………….

9=Angular Cheilitis 9=Alveolar Ridges/Gingivae …………………….

9=Oral Cancer

10. Any Other…Specify?

Antibiotic History

23. Have you taken antibiotics during past 2 months?

No Yes Can’t Remember

24. Clinical Diagnosis :

25. Details: Date of Incisional Date of Reference Histopathological Biopsy Reporting Biopsy Number of the Diagnosis Biopsy Report

Appendix 3 : H & E Stain of OSCC tissues

APPENDIX 4.1

Status Cancer Cancer Cancer Cancer Cancer Cancer ID C1 C2 C3 C4 C5 C6 Firmicutes 56.0925% 21.4669% 5.7685% 37.7386% 53.8492% 9.9007% Proteobacteria 10.3714% 60.7185% 91.6800% 0.4590% 18.3789% 1.4046% Actinobacteria 0.3475% 17.2928% 0.0740% 27.8711% 22.3594% 0.3312% Fusobacteria 28.4752% 0.0000% 0.0247% 0.3025% 1.3531% 53.9683% Bacteroidetes 4.6699% 0.5218% 2.4159% 33.5976% 3.9674% 32.2485% Spirochaetes 0.0000% 0.0000% 0.0123% 0.0000% 0.0131% 1.9756% Saccharibacteria_(TM7) 0.0000% 0.0000% 0.0123% 0.0313% 0.0525% 0.0000% Synergistetes 0.0000% 0.0000% 0.0123% 0.0000% 0.0263% 0.1713% SR1 0.0434% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% Angiosperms 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% Deinococcus-Thermus 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% Acidobacteria 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% Planctomycetes 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% Gracilibacteria_(GN02) 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% [Thermi] 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% Deferribacteres 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% Chloroflexi 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% Thermotogae 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% Cyanobacteria 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% Cancer Cancer Cancer Cancer Cancer Cancer Cancer Cancer C7 C8 C9 C10 C11 C12 C14 C15 37.4858% 18.2707% 43.3552% 74.5533% 43.4697% 21.8709% 34.9559% 34.5590% 10.8236% 2.9928% 1.9543% 0.5540% 0.1265% 59.3259% 15.9752% 0.8709% 22.9505% 6.0902% 0.0000% 12.7591% 0.0422% 1.3634% 0.9474% 0.2765% 9.3597% 49.5943% 11.2101% 4.5211% 27.0631% 12.1947% 37.5531% 47.3873% 18.0865% 23.0521% 43.3396% 7.1480% 21.5661% 5.2263% 10.1111% 16.8786% 1.1617% 0.0000% 0.1094% 0.1430% 7.7042% 0.0000% 0.1960% 0.0276% 0.0567% 0.0000% 0.0313% 0.2144% 0.0281% 0.0189% 0.1470% 0.0000% 0.0756% 0.0000% 0.0000% 0.1072% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0980% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0163% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% Cancer Cancer Cancer Cancer Cancer Cancer Cancer Cancer C17 C18 C19 C20 C21 C22 C23 C24 14.6332% 55.4126% 43.6194% 46.2165% 17.8393% 43.4751% 40.1444% 21.3242% 79.9475% 11.4266% 18.6341% 19.7451% 20.0618% 9.8510% 21.7766% 1.7310% 0.3308% 8.1538% 9.2950% 0.9721% 3.1692% 11.1051% 32.0032% 2.7480% 1.9848% 7.4685% 10.6344% 8.6574% 0.2492% 1.6630% 4.7323% 68.7223% 3.1037% 16.3077% 17.8098% 24.3037% 58.6805% 33.8877% 1.3435% 4.5007% 0.0000% 0.0280% 0.0074% 0.0920% 0.0000% 0.0091% 0.0000% 0.0541% 0.0000% 1.1329% 0.0000% 0.0131% 0.0000% 0.0000% 0.0000% 0.2272% 0.0000% 0.0559% 0.0000% 0.0000% 0.0000% 0.0091% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.6924% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% Cancer Cancer Cancer Control Control Control Control Control C25 C26 C27 N1 N2 N3 N4 N5 22.6694% 38.2088% 37.7830% 38.7661% 80.0214% 43.9389% 5.0783% 25.0560% 2.3434% 6.0156% 5.4396% 42.1501% 11.2062% 31.6947% 92.0740% 11.2873% 24.7173% 54.1854% 7.3508% 17.0465% 6.0845% 10.1069% 0.0237% 16.8142% 34.1009% 0.4950% 15.8189% 1.3237% 1.6582% 5.6183% 0.0712% 40.1576% 14.8446% 0.9901% 33.5931% 0.5064% 0.9495% 8.1374% 2.7527% 5.4783% 0.7030% 0.0000% 0.0147% 0.0000% 0.0000% 0.0305% 0.0000% 0.0195% 0.2955% 0.1050% 0.0000% 0.1842% 0.0401% 0.1679% 0.0000% 1.0314% 0.3158% 0.0000% 0.0000% 0.0000% 0.0000% 0.2137% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0230% 0.0134% 0.0763% 0.0000% 0.1362% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0153% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0267% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0102% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0195% Control Control Control Control Control Control Control Control N6 N8 N9 N11 N14 N15 N16 N17 46.9530% 37.1743% 24.0290% 93.4974% 72.4260% 54.9762% 52.9197% 43.1834% 11.0889% 0.6409% 35.8663% 3.6498% 9.7085% 1.4606% 2.6095% 23.8116% 40.6993% 61.7807% 17.4603% 1.3005% 2.6093% 16.4572% 14.3613% 0.5996% 0.0000% 0.3483% 10.5539% 0.8670% 13.5637% 18.8010% 20.8029% 32.3483% 1.1788% 0.0139% 11.9048% 0.6013% 1.0813% 8.2371% 9.1058% 0.0571% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0510% 0.1642% 0.0000% 0.0799% 0.0279% 0.0844% 0.0000% 0.1410% 0.0000% 0.0365% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0139% 0.0000% 0.0000% 0.1410% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.3291% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1013% 0.0000% 0.0000% 0.0170% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0839% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% Control Control Control Control Control Control Control Control N18 N19 N20 N21 N22 N23 N25 N26 46.0547% 53.7388% 68.0625% 37.1574% 2.0602% 24.2725% 15.7201% 57.8945% 1.1973% 4.6868% 14.9707% 19.0249% 91.8400% 7.8274% 2.4807% 10.7647% 12.5998% 40.8919% 11.0653% 27.1511% 6.0998% 62.9197% 80.5980% 8.6528% 6.2714% 0.3489% 1.1282% 13.2887% 0.0000% 2.0915% 0.5484% 6.6200% 33.3181% 0.2123% 4.7733% 2.9955% 0.0000% 2.8470% 0.4961% 15.0463% 0.4789% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0316% 0.0342% 0.0303% 0.0000% 0.2390% 0.0000% 0.0420% 0.0000% 0.9901% 0.0342% 0.0455% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0114% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0637% 0.0000% 0.0000% 0.0914% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0392% 0.0000% 0.0000% 0.0000% 0.0000% 0.0797% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0261% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0455% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% Control Control N27 N28 Overall OSSC Control 18.2010% 29.3095% 38.44% 34.99% 42.20% 2.5120% 24.4875% 19.37% 18.90% 19.87% 2.1272% 23.3886% 15.57% 10.67% 20.91% 69.7038% 10.1361% 14.45% 17.50% 11.14% 6.2509% 7.5447% 11.58% 17.29% 5.37% 0.4066% 0.4920% 0.29% 0.49% 0.07% 0.7768% 0.7217% 0.15% 0.09% 0.20% 0.0218% 2.9851% 0.08% 0.03% 0.14% 0.0000% 0.0000% 0.02% 0.03% 0.01% 0.0000% 0.2460% 0.01% 0.00% 0.02% 0.0000% 0.0984% 0.01% 0.00% 0.02% 0.0000% 0.3608% 0.01% 0.00% 0.02% 0.0000% 0.1640% 0.00% 0.00% 0.01% 0.0000% 0.0000% 0.00% 0.00% 0.01% 0.0000% 0.0000% 0.00% 0.00% 0.00% 0.0000% 0.0000% 0.00% 0.00% 0.00% 0.0000% 0.0656% 0.00% 0.00% 0.00% 0.0000% 0.0000% 0.00% 0.00% 0.00% 0.0000% 0.0000% 0.00% 0.00% 0.00% Status Cancer Cancer Cancer Cancer Cancer Cancer Cancer ID C1 C2 C3 C4 C5 C6 C7 Firmicutes 1 1 1 1 1 1 1 Proteobacteria 1 1 1 1 1 1 1 Actinobacteria 1 1 1 1 1 1 1 Bacteroidetes 1 1 1 1 1 1 1 Fusobacteria 1 0 1 1 1 1 1 Saccharibacteria_(TM7) 0 0 1 1 1 0 1 Spirochaetes 0 0 1 0 1 1 1 Synergistetes 0 0 1 0 1 1 1 SR1 1 0 0 0 0 0 0 Angiosperms 0 0 0 0 0 0 0 Deinococcus-Thermus 0 0 0 0 0 0 0 Gracilibacteria_(GN02) 0 0 0 0 0 0 0 Chloroflexi 0 0 0 0 0 0 0 Planctomycetes 0 0 0 0 0 0 0 [Thermi] 0 0 0 0 0 0 0 Acidobacteria 0 0 0 0 0 0 0 Deferribacteres 0 0 0 0 0 0 0 Thermotogae 0 0 0 0 0 0 0 Cyanobacteria 0 0 0 0 0 0 0 Number of phyla identified 6 4 8 6 8 7 8 Cancer Cancer Cancer Cancer Cancer Cancer Cancer Cancer Cancer C8 C9 C10 C11 C12 C14 C15 C17 C18 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 0 1 1 1 1 1 0 0 1 0 1 1 1 0 1 1 0 1 0 0 1 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 6 8 7 6 9 6 5 9 Cancer Cancer Cancer Cancer Cancer Cancer Cancer Cancer Cancer C19 C20 C21 C22 C23 C24 C25 C26 C27 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 0 1 0 0 0 1 1 1 0 1 1 0 1 0 1 1 0 1 0 0 0 1 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 6 7 5 7 5 8 9 6 6 Control Control Control Control Control Control Control Control Control N1 N2 N3 N4 N5 N6 N8 N9 N11 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 0 1 1 1 1 1 1 0 1 1 1 1 0 0 0 1 0 1 0 0 0 0 0 0 1 0 0 0 0 0 0 1 1 1 0 1 0 0 0 0 0 0 1 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 7 8 10 5 9 5 7 7 6 Control Control Control Control Control Control Control Control Control N14 N15 N16 N17 N18 N19 N20 N21 N22 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 0 1 1 1 1 1 1 1 1 0 1 0 1 0 1 1 0 1 0 0 1 1 0 1 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 8 7 7 5 9 8 5 8 3 Control Control Control Control Control N23 N25 N26 N27 N28 Overall OSSC Control 1 1 1 1 1 100.00% 100.00% 100.00% 1 1 1 1 1 100.00% 100.00% 100.00% 1 1 1 1 1 97.92% 96.00% 100.00% 1 1 1 1 1 97.92% 100.00% 95.65% 1 1 1 1 1 93.75% 96.00% 91.30% 1 0 1 1 1 62.50% 56.00% 69.57% 0 0 1 1 1 50.00% 64.00% 34.78% 0 0 0 1 1 27.08% 32.00% 21.74% 0 0 0 0 0 14.58% 8.00% 21.74% 0 1 0 0 1 14.58% 4.00% 26.09% 0 0 0 0 1 6.25% 0.00% 13.04% 0 0 0 0 0 6.25% 0.00% 13.04% 0 0 0 0 1 6.25% 8.00% 4.35% 0 1 0 0 1 4.17% 0.00% 8.70% 0 1 0 0 0 4.17% 0.00% 8.70% 0 0 0 0 1 2.08% 0.00% 4.35% 0 0 0 0 0 2.08% 4.00% 0.00% 0 0 0 0 0 2.08% 0.00% 4.35% 0 0 0 0 0 2.08% 0.00% 4.35% 6 8 7 8 13 19 12 18 APPENDIX 4.2

Status Cancer Cancer Cancer Cancer ID C1 C2 C3 C4 Streptococcus 55.0174% 14.4007% 1.2819% 19.8081% Rothia 0.0543% 16.7859% 0.0740% 0.9492% Leptotrichia 0.5756% 0.0000% 0.0000% 0.0417% Gemella 0.0760% 1.3864% 2.7980% 0.3546% Capnocytophaga 1.1838% 0.0745% 0.1849% 0.0000% Fusobacterium 27.2589% 0.0000% 0.0247% 0.2608% Prevotella 1.7268% 0.1640% 0.3944% 33.5976% Enterobacter 0.0000% 0.0298% 0.0493% 0.0000% Haemophilus 0.6190% 0.2534% 1.0107% 0.0000% Citrobacter 0.0000% 0.0000% 85.5787% 0.0000% Granulicatella 0.0977% 0.0000% 1.0970% 0.0522% Klebsiella 0.0000% 0.1342% 0.0000% 0.0000% Pseudomonas 0.0000% 60.2862% 0.0000% 0.0000% Lautropia 0.0000% 0.0000% 0.0000% 0.0000% Neisseria 0.1846% 0.0000% 0.1479% 0.0000% Porphyromonas 1.1512% 0.2087% 1.7380% 0.0000% Veillonella 0.0000% 0.2236% 0.0000% 5.3719% Atopobium 0.0326% 0.0000% 0.0000% 23.7196% Staphylococcus 0.0000% 0.0149% 0.0000% 0.0000% Propionibacterium 0.0000% 0.0149% 0.0000% 0.0000% Actinomyces 0.2281% 0.1938% 0.0000% 0.4485% Morganella 0.0000% 0.0000% 0.0000% 0.0000% Campylobacter 8.3189% 0.0000% 0.0370% 0.4590% Parvimonas 0.6299% 0.0745% 0.0493% 0.0417% Lachnoanaerobaculum 0.0000% 0.0000% 0.0000% 0.1773% Brachybacterium 0.0000% 0.0000% 0.0000% 0.0000% Catonella 0.0217% 0.0000% 0.0000% 0.0000% Stomatobaculum 0.0109% 0.0000% 0.0000% 1.9923% Treponema 0.0000% 0.0000% 0.0123% 0.0000% Oribacterium 0.0869% 0.0000% 0.0247% 0.5215% Alloprevotella 0.5321% 0.0149% 0.0000% 0.0000% Sphingomonas 0.0000% 0.0000% 0.0000% 0.0000% Bacteroidetes_[G-5] 0.0000% 0.0000% 0.0123% 0.0000% Aggregatibacter 0.0000% 0.0000% 0.0000% 0.0000% Peptostreptococcus 0.0652% 0.0000% 0.0863% 0.0313% Salmonella 0.0000% 0.0000% 1.7503% 0.0000% Lactobacillus 0.0000% 5.3667% 0.0000% 2.8580% Eikenella 0.9448% 0.0000% 0.0493% 0.0000% Kingella 0.0109% 0.0000% 0.0000% 0.0000% Delftia 0.0000% 0.0000% 0.0000% 0.0000% Tannerella 0.0326% 0.0000% 0.0000% 0.0000% Afipia 0.0000% 0.0000% 0.0000% 0.0000% Burkholderiales_[G] 0.0000% 0.0000% 0.0000% 0.0000% Corynebacterium 0.0000% 0.0000% 0.0000% 0.0000% Flavitalea 0.0000% 0.0000% 0.0000% 0.0000% Selenomonas 0.0000% 0.0000% 0.0000% 0.1982% Bergeyella 0.0109% 0.0596% 0.0000% 0.0000% TM7_[G-1] 0.0000% 0.0000% 0.0000% 0.0000% Solobacterium 0.0000% 0.0000% 0.3205% 0.6050% Acinetobacter 0.0000% 0.0000% 0.0000% 0.0000% Cardiobacterium 0.0000% 0.0000% 0.0000% 0.0000% Fretibacterium 0.0000% 0.0000% 0.0123% 0.0000% Arthrobacter 0.0000% 0.0000% 0.0000% 0.0000% Alloscardovia 0.0000% 0.1491% 0.0000% 0.0000% Scardovia 0.0000% 0.0298% 0.0000% 0.0000% multigenus 0.0000% 0.0000% 3.0198% 0.0000% Abiotrophia 0.0000% 0.0000% 0.0000% 0.0000% Corynebacterium 0.0326% 0.0000% 0.0000% 0.0000% Shuttleworthia 0.0000% 0.0000% 0.0000% 3.2648% Ruminococcaceae_[G-2] 0.0109% 0.0000% 0.0000% 1.3038% Filifactor 0.0000% 0.0000% 0.0370% 0.0000% Serratia 0.0000% 0.0000% 0.0000% 0.0000% Arcanobacterium 0.0000% 0.0000% 0.0000% 0.0000% Leuconostoc 0.0000% 0.0000% 0.0000% 0.0000% Ralstonia 0.0000% 0.0000% 0.0000% 0.0000% Cronobacter 0.0000% 0.0000% 0.0370% 0.0000% Stenotrophomonas 0.0000% 0.0000% 0.0000% 0.0000% Achromobacter 0.0000% 0.0000% 0.0000% 0.0000% Brevundimonas 0.0109% 0.0000% 0.0000% 0.0000% Alphaproteobacteria_[G] 0.0000% 0.0000% 0.0000% 0.0000% Mogibacterium 0.0109% 0.0000% 0.0000% 0.2503% Paracoccus 0.0000% 0.0000% 0.0000% 0.0000% Methylobacterium 0.0000% 0.0000% 0.0000% 0.0000% Lachnospiraceae_[G-3] 0.0109% 0.0000% 0.0000% 0.0000% Peptococcus 0.0000% 0.0000% 0.0123% 0.0000% Quadrisphaera 0.0000% 0.0000% 0.0000% 0.0000% Olsenella 0.0000% 0.0000% 0.0000% 1.1787% Microbacterium 0.0000% 0.0000% 0.0000% 0.0000% Caulobacter 0.0000% 0.0000% 0.0000% 0.0000% Peptoniphilaceae_[G-1] 0.0000% 0.0000% 0.0000% 0.0000% Mycobacterium 0.0000% 0.0000% 0.0000% 0.0000% Proteus 0.0000% 0.0000% 0.0000% 0.0000% Bacteroidales_[G-2] 0.0326% 0.0000% 0.0000% 0.0000% Klebsiella 0.0000% 0.0000% 0.0000% 0.0000% Mycoplasma 0.0000% 0.0000% 0.0000% 0.0000% Bifidobacterium 0.0000% 0.0745% 0.0000% 0.4694% Rothia 0.0000% 0.0000% 0.0000% 0.0000% Cronobacter 0.0000% 0.0000% 0.0000% 0.0000% Dolosigranulum 0.0000% 0.0000% 0.0000% 0.0000% Cryptobacterium 0.0000% 0.0000% 0.0000% 0.8553% Bacteroides 0.0000% 0.0000% 0.0000% 0.0000% SR1_[G-1] 0.0434% 0.0000% 0.0000% 0.0000% Lachnospiraceae_[G-2] 0.0109% 0.0000% 0.0000% 0.0000% Lachnospiraceae_[G-7] 0.0000% 0.0000% 0.0000% 0.5320% Eggerthia 0.0000% 0.0000% 0.0247% 0.0000% Defluvibacter 0.0000% 0.0000% 0.0000% 0.0000% Asticcacaulis 0.0000% 0.0000% 0.0000% 0.0000% Bacteroidetes_[G-3] 0.0000% 0.0000% 0.0247% 0.0000% Moraxella 0.0217% 0.0149% 0.0000% 0.0000% Brevibacterium 0.0000% 0.0000% 0.0000% 0.0000% Sphingobium 0.0109% 0.0000% 0.0000% 0.0000% Mycobacterium 0.0000% 0.0000% 0.0000% 0.0000% Bulleidia 0.0000% 0.0000% 0.0000% 0.0000% TM7_[G-5] 0.0000% 0.0000% 0.0000% 0.0000% Streptobacillus 0.6407% 0.0000% 0.0000% 0.0000% Johnsonella 0.0000% 0.0000% 0.0000% 0.0000% Ottowia 0.2281% 0.0000% 0.0000% 0.0000% Peptostreptococcaceae_[XI][G-9] 0.0000% 0.0000% 0.0000% 0.0000% Manihot 0.0000% 0.0000% 0.0000% 0.0000% Gluconobacter 0.0000% 0.0000% 0.0000% 0.0000% Peptostreptococcaceae_[XI][G-6] 0.0000% 0.0000% 0.0000% 0.0000% Limnobacter 0.0000% 0.0000% 0.0000% 0.0000% Pseudoramibacter 0.0000% 0.0000% 0.0000% 0.0000% Brachybacterium 0.0000% 0.0149% 0.0000% 0.0000% Slackia 0.0000% 0.0000% 0.0000% 0.1982% Bosea 0.0000% 0.0000% 0.0000% 0.0000% Kocuria 0.0000% 0.0298% 0.0000% 0.0000% Firmicutes_[G] 0.0000% 0.0000% 0.0000% 0.0000% Megasphaera 0.0109% 0.0000% 0.0000% 0.0626% TM7_[G-2] 0.0000% 0.0000% 0.0000% 0.0000% Pedobacter 0.0000% 0.0000% 0.0000% 0.0000% Fusobacteria_[G-1] 0.0000% 0.0000% 0.0000% 0.0000% Deinococcus 0.0000% 0.0000% 0.0000% 0.0000% Flavobacterium 0.0000% 0.0000% 0.0000% 0.0000% Rhizobium 0.0000% 0.0000% 0.0000% 0.0000% Kytococcus 0.0000% 0.0000% 0.0000% 0.0000% Lachnospiraceae_[G] 0.0326% 0.0000% 0.0000% 0.0000% Propionibacterium 0.0000% 0.0000% 0.0000% 0.0000% Reyranella 0.0000% 0.0000% 0.0000% 0.0000% TM7_[G-6] 0.0000% 0.0000% 0.0000% 0.0000% TM7_[G-3] 0.0000% 0.0000% 0.0000% 0.0313% Actinomycetales_[G] 0.0000% 0.0000% 0.0000% 0.0000% Schlegelella 0.0000% 0.0000% 0.0000% 0.0000% Peptostreptococcaceae_[XI][G-7] 0.0000% 0.0000% 0.0123% 0.0000% Porphyrobacter 0.0000% 0.0000% 0.0000% 0.0000% Terriglobus 0.0000% 0.0000% 0.0000% 0.0000% Methylobacterium 0.0000% 0.0000% 0.0000% 0.0000% Dialister 0.0000% 0.0000% 0.0000% 0.1147% Bradyrhizobium 0.0000% 0.0000% 0.0000% 0.0000% Amnibacterium 0.0000% 0.0000% 0.0000% 0.0000% Belnapia 0.0000% 0.0000% 0.0000% 0.0000% Bacteroidaceae_[G-1] 0.0000% 0.0000% 0.0000% 0.0000% Actinobaculum 0.0000% 0.0000% 0.0000% 0.0000% Sneathia 0.0000% 0.0000% 0.0000% 0.0000% Anaerococcus 0.0000% 0.0000% 0.0000% 0.0000% Oxalobacteraceae_[G] 0.0000% 0.0000% 0.0000% 0.0000% Peptostreptococcaceae_[G] 0.0000% 0.0000% 0.0123% 0.0000% Yersinia 0.0000% 0.0000% 0.0000% 0.0000% Alcaligenes 0.0000% 0.0000% 0.0000% 0.0000% Peptoniphilus 0.0000% 0.0000% 0.0000% 0.0939% Leptothrix 0.0000% 0.0000% 0.0000% 0.0000% Porphyromonas 0.0000% 0.0000% 0.0616% 0.0000% Diaphorobacter 0.0000% 0.0000% 0.0000% 0.0000% Peptostreptococcaceae_[XI][G-1] 0.0000% 0.0000% 0.0000% 0.0104% Williamsia 0.0000% 0.0000% 0.0000% 0.0000% Erwinia 0.0000% 0.0000% 0.0000% 0.0000% Agrobacterium 0.0000% 0.0000% 0.0000% 0.0000% Rhodobacter 0.0000% 0.0000% 0.0000% 0.0000% Mobiluncus 0.0000% 0.0000% 0.0000% 0.0000% Burkholderiaceae_[G] 0.0000% 0.0000% 0.0000% 0.0000% Cupriavidus 0.0000% 0.0000% 0.0000% 0.0000% Actinobacillus 0.0000% 0.0000% 0.0000% 0.0000% Kluyvera 0.0000% 0.0000% 0.0000% 0.0000% Massilia 0.0000% 0.0000% 0.0000% 0.0000% Anaeroglobus 0.0000% 0.0000% 0.0000% 0.0000% Peptostreptococcaceae_[XI][G-5] 0.0000% 0.0000% 0.0000% 0.0000% Selenomonas 0.0000% 0.0000% 0.0000% 0.0000% Novosphingobium 0.0000% 0.0000% 0.0000% 0.0000% Geodermatophilus 0.0000% 0.0000% 0.0000% 0.0000% Pseudokineococcus 0.0000% 0.0000% 0.0000% 0.0000% Mannheimia 0.0000% 0.0000% 0.0000% 0.0000% Lactococcus 0.0000% 0.0000% 0.0000% 0.0000% Comamonadaceae_[G] 0.0000% 0.0000% 0.0000% 0.0000% Peptostreptococcaceae_[XI][G-4] 0.0000% 0.0000% 0.0123% 0.0000% Zoogloea 0.0000% 0.0000% 0.0000% 0.0000% Isosphaera 0.0000% 0.0000% 0.0000% 0.0000% Kocuria 0.0000% 0.0000% 0.0000% 0.0000% Janibacter 0.0000% 0.0000% 0.0000% 0.0000% Hydrogenophaga 0.0000% 0.0000% 0.0000% 0.0000% Micrococcus 0.0000% 0.0000% 0.0000% 0.0000% Clostridiales_[F-1][G-1] 0.0000% 0.0000% 0.0000% 0.0000% Desulfovibrio 0.0000% 0.0000% 0.0000% 0.0000% Halomonas 0.0000% 0.0000% 0.0000% 0.0000% Streptomyces 0.0000% 0.0000% 0.0000% 0.0000% Cupriavidus 0.0000% 0.0000% 0.0000% 0.0000% GN02_[G-2] 0.0000% 0.0000% 0.0000% 0.0000% Arsenicicoccus 0.0000% 0.0000% 0.0000% 0.0000% Marmoricola 0.0000% 0.0000% 0.0000% 0.0000% Hephaestia 0.0000% 0.0000% 0.0000% 0.0000% Deinococcus 0.0000% 0.0000% 0.0000% 0.0000% Dietzia 0.0000% 0.0000% 0.0000% 0.0000% Veillonella 0.0000% 0.0000% 0.0000% 0.0522% Calditerrivibrio 0.0000% 0.0000% 0.0000% 0.0000% Avibacterium 0.0000% 0.0000% 0.0000% 0.0000% Clostridium 0.0000% 0.0000% 0.0000% 0.0000% Lacnoclostridium 0.0000% 0.0000% 0.0000% 0.0000% Lachnospiraceae_[G-8] 0.0000% 0.0000% 0.0000% 0.0000% Anaeromyxobacter 0.0000% 0.0000% 0.0000% 0.0000% Aeromonas 0.0000% 0.0000% 0.0000% 0.0000% Propionivibrio 0.0000% 0.0000% 0.0000% 0.0000% Dietzia 0.0000% 0.0000% 0.0000% 0.0000% Barrientosiimonas 0.0000% 0.0000% 0.0000% 0.0000% GN02_[G-1] 0.0000% 0.0000% 0.0000% 0.0000% Chryseobacterium 0.0000% 0.0000% 0.0000% 0.0000% Psychrobacter 0.0000% 0.0000% 0.0000% 0.0000% Clostridium 0.0000% 0.0000% 0.0000% 0.0000% Micrococcus 0.0000% 0.0000% 0.0000% 0.0000% Roseiflexus 0.0000% 0.0000% 0.0000% 0.0000% Tepidiphilus 0.0000% 0.0000% 0.0000% 0.0000% Peptostreptococcaceae_[XI][G-2] 0.0000% 0.0000% 0.0000% 0.0000% Veillonellaceae_[G-1] 0.0000% 0.0000% 0.0000% 0.0000% Hymenobacter 0.0000% 0.0000% 0.0000% 0.0000% Capnocytophaga 0.0000% 0.0000% 0.0000% 0.0000% Tissierella 0.0000% 0.0000% 0.0000% 0.0000% Shewanella 0.0000% 0.0000% 0.0000% 0.0000% Pyramidobacter 0.0000% 0.0000% 0.0000% 0.0000% Peptoniphilus 0.0000% 0.0000% 0.0000% 0.0000% Rheinheimera 0.0000% 0.0000% 0.0000% 0.0000% Nocardioides 0.0000% 0.0000% 0.0000% 0.0000% Finegoldia 0.0000% 0.0000% 0.0000% 0.0313% Eubacterium 0.0000% 0.0000% 0.0000% 0.0000% Erythrobacter 0.0000% 0.0000% 0.0000% 0.0000% Chitinibacter 0.0000% 0.0000% 0.0000% 0.0000% Desulfobulbus 0.0000% 0.0000% 0.0000% 0.0000% Gardnerella 0.0000% 0.0000% 0.0000% 0.0000% Aureimonas 0.0000% 0.0000% 0.0000% 0.0000% Fervidobacterium 0.0000% 0.0000% 0.0000% 0.0000% Sphingobacterium 0.0000% 0.0000% 0.0000% 0.0000% Centipeda 0.0000% 0.0000% 0.0000% 0.0000% Propionigenium 0.0000% 0.0000% 0.0000% 0.0000% Angustibacter 0.0000% 0.0000% 0.0000% 0.0417% Alishewanella 0.0000% 0.0000% 0.0000% 0.0000% Rhodopirellula 0.0000% 0.0000% 0.0000% 0.0000% Hippea 0.0000% 0.0000% 0.0000% 0.0000% Butyrivibrio 0.0000% 0.0000% 0.0000% 0.0000% Serratia 0.0000% 0.0000% 0.0000% 0.0000% Erysipelotrichaceae_[G-1] 0.0000% 0.0000% 0.0000% 0.0000% Lysinibacillus 0.0000% 0.0000% 0.0000% 0.0000% Cellulophaga 0.0000% 0.0000% 0.0000% 0.0000% Enterococcus 0.0000% 0.0000% 0.0000% 0.0000% Ruminoclostridium 0.0000% 0.0000% 0.0000% 0.0000% Spirosoma 0.0000% 0.0000% 0.0000% 0.0000% Bdellovibrio 0.0000% 0.0000% 0.0000% 0.0000% Salinicola 0.0000% 0.0000% 0.0000% 0.0000% Paludibacter 0.0000% 0.0000% 0.0000% 0.0000% Seonamhaeicola 0.0000% 0.0000% 0.0000% 0.0000% Blautia 0.0000% 0.0000% 0.0000% 0.0000% Anaerococcus 0.0000% 0.0000% 0.0000% 0.0000% Peptoniphilus 0.0000% 0.0000% 0.0000% 0.0000% Anaerolineae_[G-1] 0.0000% 0.0000% 0.0000% 0.0000% Clostridiales_[G] 0.0000% 0.0000% 0.0000% 0.0000% Streptomyces 0.0000% 0.0000% 0.0000% 0.0000% Olsenella 0.0000% 0.0000% 0.0000% 0.0104% Treponema 0.0000% 0.0000% 0.0000% 0.0000% Hydrogenophilus 0.0217% 0.0000% 0.0000% 0.0000% Prevotella 0.0000% 0.0000% 0.0000% 0.0000% Synechococcus 0.0000% 0.0000% 0.0000% 0.0000% Ruminococcaceae_[G-1] 0.0000% 0.0000% 0.0000% 0.0000% Erwinia 0.0000% 0.0000% 0.0000% 0.0000% Rubellimicrobium 0.0000% 0.0000% 0.0000% 0.0000% Roseomonas 0.0000% 0.0000% 0.0000% 0.0000% Nitrosomonas 0.0000% 0.0000% 0.0000% 0.0000% Aquabacterium 0.0000% 0.0000% 0.0000% 0.0000% Methyloversatilis 0.0000% 0.0000% 0.0000% 0.0000% Faecalibacterium 0.0000% 0.0000% 0.0000% 0.0000% Calycanthus 0.0000% 0.0000% 0.0000% 0.0000% TM7_[G-4] 0.0000% 0.0000% 0.0123% 0.0000% Dialister 0.0000% 0.0000% 0.0000% 0.0104% Raoultella 0.0000% 0.0000% 0.0000% 0.0000% Cellulomonas 0.0000% 0.0000% 0.0000% 0.0000% Brochothrix 0.0000% 0.0000% 0.0000% 0.0000% Eubacterium_[XI][G] 0.0000% 0.0000% 0.0000% 0.0000% Cancer Cancer Cancer Cancer Cancer Cancer Cancer Cancer Cancer C5 C6 C7 C8 C9 C10 C11 C12 C14 38.7677% 0.5253% 21.5338% 13.8731% 10.8349% 64.7427% 0.3234% 5.0748% 21.5943% 20.9012% 0.0000% 22.2705% 6.0553% 0.0000% 5.7362% 0.0000% 0.0189% 0.4900% 1.1429% 0.0000% 1.9645% 49.4023% 7.8643% 2.5197% 14.4805% 12.1947% 8.7390% 6.5423% 0.4111% 3.8818% 3.5512% 30.1438% 3.3238% 34.0363% 10.6419% 2.1072% 0.4992% 31.1294% 4.9679% 20.8097% 42.4797% 0.1966% 8.2806% 4.1280% 0.2614% 0.1839% 53.9683% 6.9607% 0.1920% 3.3458% 2.0014% 12.5826% 0.0000% 28.8141% 3.0741% 0.1370% 11.0502% 1.9283% 0.0782% 5.4503% 0.4499% 0.8710% 1.7478% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0379% 0.0000% 8.7888% 0.0343% 9.1046% 1.1343% 0.0625% 0.0357% 0.0422% 2.3859% 14.4071% 0.0131% 0.0000% 0.0094% 0.0000% 0.0156% 0.0179% 0.0000% 30.2215% 0.0000% 5.6621% 0.0571% 2.3989% 0.2967% 0.0469% 1.0722% 0.0281% 1.9693% 0.4574% 0.0000% 0.0000% 0.0000% 0.0087% 0.0000% 0.2680% 0.0000% 0.0379% 0.0000% 0.0000% 0.0114% 0.0094% 0.0087% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0657% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 1.3794% 0.0114% 0.0378% 0.6369% 0.7192% 0.0000% 0.0141% 0.0568% 0.4737% 0.2233% 0.3883% 1.2845% 0.1134% 0.7036% 0.7327% 0.0562% 0.0000% 5.4721% 1.4976% 0.0000% 2.1345% 0.3316% 0.0938% 2.3767% 0.0000% 0.5491% 4.0673% 0.0525% 0.0000% 0.0756% 0.0000% 0.0000% 2.7341% 0.0141% 0.2272% 0.0163% 0.0131% 0.0000% 0.0189% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0525% 0.0000% 0.0000% 0.0087% 0.0000% 0.0357% 0.0000% 0.0189% 0.0163% 0.1445% 0.0114% 0.3022% 0.0175% 0.0000% 4.0386% 0.0141% 0.8900% 0.4247% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 23.2910% 0.0000% 8.0399% 1.3018% 0.5383% 0.2967% 0.0000% 0.0715% 0.0562% 0.2083% 0.8004% 0.2233% 1.1077% 3.8629% 0.0000% 1.5322% 0.0715% 0.3936% 1.5906% 0.3267% 0.0394% 0.0343% 0.5950% 0.0436% 0.3127% 0.2859% 1.3496% 0.0000% 1.4211% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 5.6983% 0.1228% 0.0000% 0.0000% 0.0000% 4.9065% 1.0225% 1.7478% 0.0131% 0.0000% 0.0094% 0.0000% 0.0000% 1.0543% 0.0141% 0.0000% 0.0163% 0.0131% 1.9756% 1.1617% 0.0000% 0.1094% 0.1430% 7.7042% 0.0000% 0.1960% 0.4598% 0.6281% 0.0472% 0.0087% 0.0000% 0.7148% 0.0703% 0.0000% 0.0653% 0.0263% 0.0343% 0.5195% 0.0000% 0.0625% 0.1072% 4.3863% 0.0189% 1.2904% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0567% 0.0000% 0.0156% 0.1251% 8.2806% 0.0000% 1.2414% 0.0525% 0.0000% 0.0000% 0.8900% 1.0319% 0.0000% 0.0000% 0.0000% 0.0000% 0.0920% 0.0000% 0.7272% 0.1309% 0.1407% 0.0357% 0.2249% 0.0000% 0.1960% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0156% 0.0000% 0.1968% 0.0000% 0.0000% 0.0000% 0.0457% 0.4345% 0.0000% 0.0625% 0.0000% 0.0141% 0.2272% 0.0000% 0.0131% 0.0000% 0.4628% 0.0175% 0.0000% 0.0179% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1485% 0.0094% 0.0000% 0.0000% 0.1430% 0.0141% 0.0000% 0.0817% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0189% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0357% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0087% 0.0000% 0.0179% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0179% 0.0000% 0.0189% 0.0000% 0.0657% 0.0571% 0.5383% 0.0000% 0.1563% 0.0179% 1.3778% 0.0000% 0.6207% 0.1051% 0.0000% 0.0944% 0.2007% 0.0000% 0.0000% 0.0703% 0.1894% 0.0163% 0.0131% 0.0000% 0.0094% 0.0000% 0.0313% 0.2144% 0.0141% 0.0189% 0.0163% 0.0788% 0.2170% 0.5856% 0.0000% 0.0000% 0.2144% 0.0844% 1.0036% 0.0490% 0.0000% 0.0000% 0.2267% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0263% 0.1713% 0.0756% 0.0000% 0.0000% 0.1072% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0263% 0.0000% 0.0283% 0.0000% 0.0000% 0.0715% 0.0000% 0.1515% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0179% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0179% 0.0000% 0.0000% 0.0000% 0.0131% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1133% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 1.0127% 0.0000% 0.0000% 0.1606% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0490% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0179% 0.0000% 0.1704% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0357% 0.0000% 0.0189% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0394% 0.0114% 0.2550% 0.0175% 0.0000% 0.3038% 0.0000% 0.0000% 0.0327% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0131% 0.3083% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1633% 0.0000% 0.0000% 0.0189% 0.0000% 0.0000% 0.0000% 0.0562% 0.0000% 0.7187% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1485% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0189% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0131% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0263% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 1.3634% 0.0000% 0.0000% 0.3768% 0.0094% 0.0000% 0.0000% 0.1251% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 1.2876% 0.0000% 0.0000% 0.6395% 0.0283% 0.0000% 0.0000% 0.0000% 0.0000% 0.0189% 0.0000% 0.0000% 0.0000% 0.0189% 0.0000% 0.0000% 0.0357% 0.0141% 0.0189% 0.0000% 1.1298% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0357% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0756% 0.0000% 0.0000% 0.0000% 0.0141% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0394% 0.0571% 0.0378% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0490% 0.0131% 0.0228% 0.0000% 0.0000% 0.0156% 0.0000% 0.1125% 0.0000% 0.1470% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0263% 0.0000% 0.0189% 0.0000% 0.0000% 0.0357% 0.0141% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0179% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0131% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0327% 0.0394% 0.0000% 0.0189% 0.0000% 0.0000% 0.0000% 0.0141% 0.0000% 0.0163% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0281% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0343% 0.0000% 0.0000% 0.0000% 0.0357% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2361% 0.0000% 0.0000% 0.0357% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0394% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0657% 0.0000% 0.0661% 0.0175% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0920% 0.0000% 0.0661% 0.0000% 0.0000% 0.1251% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0131% 0.0000% 0.4345% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0131% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0141% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0283% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1143% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0378% 0.0000% 0.0000% 0.0179% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0131% 0.0000% 0.0000% 0.0000% 0.0000% 0.2144% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0131% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0490% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0422% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0788% 0.0114% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0163% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0189% 0.0000% 0.0000% 0.0536% 0.0141% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1713% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0357% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1133% 0.0000% 0.0000% 0.0179% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0094% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0844% 0.0000% 0.0327% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1797% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0283% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0625% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0472% 0.0000% 0.0000% 0.0000% 0.0281% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0189% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0980% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0980% 0.0000% 0.0000% 0.0000% 0.0000% 0.0156% 0.0000% 0.0281% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0131% 0.0000% 0.0000% 0.0000% 0.0156% 0.0000% 0.0281% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0685% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0283% 0.0000% 0.0000% 0.0000% 0.0141% 0.0000% 0.0000% 0.0000% 0.0114% 0.0000% 0.0000% 0.0000% 0.0357% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0189% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0141% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0179% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0179% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0343% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0313% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0163% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% Cancer Cancer Cancer Cancer Cancer Cancer Cancer Cancer Cancer C15 C17 C18 C19 C20 C21 C22 C23 C24 32.6928% 7.3458% 25.4545% 33.2131% 11.5476% 12.2683% 32.5245% 33.8079% 14.9302% 0.0829% 0.2043% 1.0490% 8.3824% 0.4861% 0.0000% 9.2603% 30.7399% 2.0556% 33.7296% 1.9654% 6.9650% 10.5829% 0.1051% 0.0000% 1.6085% 4.7123% 63.7455% 0.4009% 0.0000% 13.1329% 4.9529% 19.2591% 1.4451% 0.6089% 3.8701% 2.4776% 16.1183% 2.9967% 4.8531% 0.1398% 5.1498% 58.6107% 8.2061% 0.6216% 0.9521% 13.6577% 0.0097% 0.5035% 0.0074% 8.5523% 0.0000% 0.0545% 0.0201% 4.9767% 0.2765% 0.0195% 8.6014% 17.6479% 8.3421% 0.0000% 25.4635% 0.6016% 0.5518% 0.0000% 15.8397% 0.0000% 0.0000% 0.0000% 0.0000% 0.0636% 0.0000% 0.0541% 0.4562% 0.0097% 8.6853% 16.0877% 7.0547% 5.2023% 2.3173% 7.6198% 0.1298% 0.0000% 37.0792% 0.0000% 0.0000% 0.0000% 2.0231% 0.0000% 0.0000% 0.0000% 0.0415% 5.9155% 4.0280% 5.1663% 0.8276% 4.1260% 1.2995% 2.0854% 0.6924% 0.0000% 16.1510% 0.0000% 0.0000% 0.0000% 0.0000% 1.9629% 0.0000% 0.1082% 0.0000% 0.0584% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0138% 0.0000% 0.1538% 0.0000% 0.0000% 0.0000% 0.5998% 4.6320% 0.1515% 0.2074% 0.0097% 0.4755% 2.4654% 0.6831% 12.8264% 2.5173% 9.5248% 0.2705% 0.1521% 0.0000% 2.0839% 0.0074% 8.1319% 0.0000% 0.1000% 0.0201% 1.9582% 0.1521% 0.0097% 1.6364% 0.1472% 2.2990% 0.0000% 6.2250% 0.0000% 1.3416% 0.0138% 0.0097% 1.6783% 0.0147% 0.0000% 0.0000% 0.0000% 0.0201% 0.0757% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0273% 0.0000% 0.0866% 0.0000% 0.0195% 0.0140% 0.0074% 0.0000% 0.0000% 0.1818% 0.0000% 0.2056% 0.1244% 0.0973% 1.4126% 0.8243% 0.4861% 0.0000% 1.4268% 1.2031% 0.2488% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1935% 0.0000% 0.0420% 0.0589% 0.1182% 0.0000% 0.0000% 0.0000% 0.2164% 0.1382% 0.0000% 0.1119% 0.0000% 0.0788% 0.0000% 0.0000% 0.0000% 0.1190% 0.0829% 0.0097% 0.0140% 0.0000% 9.6164% 0.0000% 0.0000% 0.0000% 0.1082% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0691% 0.0000% 0.2517% 0.0000% 0.0525% 0.0000% 0.0000% 0.0000% 0.0433% 0.0138% 0.0000% 5.1329% 0.1030% 0.0000% 0.0000% 0.0000% 0.0000% 0.0866% 0.0276% 0.0000% 0.0280% 0.0074% 0.0920% 0.0000% 0.0091% 0.0000% 0.0541% 0.0276% 0.0000% 3.7902% 0.0221% 0.0000% 0.0000% 0.0000% 0.0000% 0.6383% 0.0691% 0.0097% 0.2797% 0.0147% 0.4992% 0.0000% 0.0091% 0.0000% 0.0649% 0.0000% 0.0097% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0829% 0.0000% 0.0280% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1265% 0.0140% 0.0000% 2.6143% 0.0000% 0.0000% 0.0000% 0.7249% 0.0829% 0.0000% 0.7692% 0.0074% 1.5502% 0.0000% 0.0182% 0.0000% 0.0000% 0.0000% 7.3069% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0420% 0.0000% 0.0788% 0.0000% 0.0000% 0.0201% 0.0000% 0.0000% 0.0000% 0.3357% 0.0000% 4.1251% 0.0100% 0.3635% 0.0000% 0.0216% 0.0000% 0.0000% 0.0000% 0.0000% 5.0447% 0.0000% 2.0084% 0.0000% 0.0108% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0138% 0.0000% 0.0280% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.9304% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0415% 0.0000% 0.1538% 0.0000% 0.0000% 0.0000% 0.0182% 0.0000% 0.0866% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0415% 0.0000% 0.0699% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.1659% 0.0778% 0.3357% 0.0000% 2.0100% 0.0100% 0.0182% 0.1003% 0.0000% 0.0000% 0.0000% 0.9930% 0.0000% 0.0131% 0.0000% 0.0000% 0.0000% 0.1731% 0.0276% 0.0000% 0.1958% 0.0000% 0.0000% 0.0000% 0.0000% 0.0201% 0.0325% 0.0000% 0.0000% 0.0420% 0.0074% 0.0000% 0.0000% 0.0091% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0216% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0091% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 1.6084% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 1.8322% 0.0074% 0.0000% 0.0000% 0.1636% 0.0201% 0.0000% 0.0000% 0.7589% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 1.3329% 0.0699% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1082% 0.0138% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.0000% 0.0000% 0.1259% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.0553% 0.0000% 0.1818% 0.0000% 0.0263% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.0000% 0.0000% 1.5944% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 3.1692% 0.0000% 0.0000% 0.0000% 0.1659% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 2.7354% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 2.5783% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1119% 0.0074% 0.0000% 0.0000% 0.0091% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2350% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0974% 0.1521% 0.0000% 0.0000% 0.0000% 0.2496% 0.0000% 0.0000% 0.0000% 0.3570% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1399% 0.0000% 0.0000% 0.0000% 0.0091% 0.0000% 0.0216% 0.0000% 0.0000% 0.0000% 0.0147% 0.0000% 0.0000% 0.0364% 0.0201% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0273% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0325% 0.0000% 0.0195% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0097% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2607% 0.0000% 0.0000% 0.0000% 0.1538% 0.0000% 0.0000% 0.0000% 0.0091% 0.0000% 0.0216% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0979% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.6924% 0.0138% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0216% 0.0276% 0.0000% 0.0280% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0691% 0.0000% 0.0280% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0074% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0091% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0074% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0097% 0.0140% 0.0000% 0.5780% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1399% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0216% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.0000% 0.0000% 0.0420% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0138% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0802% 0.0000% 0.0000% 0.0000% 0.0420% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0097% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0280% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0866% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0216% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0280% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0559% 0.0000% 0.0000% 0.0000% 0.0091% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0368% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0442% 0.0000% 0.2492% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0420% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1708% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0280% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1051% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0074% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0263% 0.0000% 0.0000% 0.0000% 0.0000% 0.0553% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0727% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0598% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0559% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0263% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0091% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% Cancer Cancer Cancer Control Control Control Control Control Control C25 C26 C27 N1 N2 N3 N4 N5 N6 10.7896% 24.0849% 31.2702% 20.3154% 64.9906% 31.1298% 2.3849% 15.1017% 16.0240% 22.4962% 52.2127% 7.0567% 13.1676% 5.8037% 6.8092% 0.0000% 11.5695% 34.6254% 32.3484% 0.4275% 6.5128% 0.8633% 1.5646% 3.3130% 0.0000% 37.1412% 0.0000% 0.1732% 2.0927% 2.7051% 4.8227% 12.1958% 2.2443% 1.1628% 0.4671% 29.8701% 0.2343% 0.0300% 22.6110% 0.1496% 0.1337% 1.8321% 0.1068% 1.7126% 0.0000% 1.7524% 0.0675% 9.2620% 0.4604% 0.0936% 2.3053% 0.0593% 3.0164% 0.0000% 6.8976% 0.9151% 2.9109% 0.0230% 0.0267% 1.7252% 2.6459% 1.4693% 0.0000% 0.0000% 4.4179% 0.0147% 0.0000% 0.0000% 0.0000% 91.4452% 0.0000% 0.0000% 0.8966% 1.0351% 2.9109% 4.2127% 4.8542% 5.7099% 0.1424% 5.1474% 0.5594% 0.0000% 0.0000% 0.0147% 0.0000% 0.0000% 0.0000% 0.0000% 0.5449% 0.0000% 4.9210% 6.8857% 0.5587% 0.5064% 2.3536% 6.5954% 0.2373% 3.4738% 0.4196% 0.0000% 0.4275% 0.4704% 30.1105% 0.0000% 0.0000% 0.2610% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0267% 0.0153% 0.0000% 0.0876% 0.1598% 0.4992% 0.0000% 0.0000% 3.0502% 4.0920% 23.4809% 0.0000% 0.9633% 1.0589% 0.3974% 0.0000% 1.6907% 3.9250% 1.9658% 1.7405% 0.0119% 0.2141% 0.5594% 7.2440% 0.0000% 6.9685% 0.1842% 0.6954% 3.9237% 0.0000% 0.1168% 0.0000% 3.1686% 4.3729% 1.0585% 0.1266% 0.1337% 1.1145% 0.9136% 0.7103% 0.2997% 0.9577% 0.6376% 0.1029% 0.0000% 0.0000% 0.0763% 0.0237% 0.0195% 0.0000% 0.0102% 0.0000% 0.0000% 12.8223% 0.0267% 0.0153% 0.0000% 0.3406% 0.1199% 0.0102% 0.0525% 0.0000% 0.7366% 0.0267% 0.0153% 0.0000% 1.3720% 1.5185% 1.1819% 1.2526% 0.0882% 0.4719% 0.1738% 2.0153% 0.0000% 1.1774% 0.7393% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1751% 0.0000% 0.1019% 0.0825% 0.3381% 0.0230% 0.0802% 0.0763% 0.0000% 0.2725% 0.1399% 0.5807% 0.0600% 0.6910% 0.0230% 0.0000% 0.7634% 0.0000% 0.0681% 0.0000% 0.0204% 0.0900% 0.4852% 0.0345% 0.0267% 0.1374% 0.0000% 2.4034% 0.1598% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1732% 0.0150% 0.0000% 0.0000% 0.0134% 0.0000% 0.0000% 0.0292% 0.0000% 0.1325% 0.0900% 0.0147% 0.0576% 0.0134% 0.1832% 0.0000% 0.6033% 0.0000% 0.7030% 0.0000% 0.0147% 0.0000% 0.0000% 0.0305% 0.0000% 0.0195% 0.0000% 0.7132% 0.3375% 0.0000% 0.0115% 0.0802% 0.2443% 0.0000% 0.1362% 0.0000% 0.0408% 0.0150% 0.0735% 0.0000% 0.0401% 0.1527% 0.0000% 0.1849% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.3308% 2.3177% 0.1936% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.4483% 0.0000% 0.0000% 0.3338% 0.0134% 0.0763% 0.0000% 0.2433% 0.0000% 0.0000% 0.0000% 0.2793% 0.0000% 0.0134% 0.4275% 0.1542% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0134% 0.0000% 0.0000% 0.0584% 0.0000% 0.0000% 0.0000% 0.0000% 0.0115% 0.0267% 0.0305% 0.0593% 0.0000% 0.1598% 0.0000% 0.0000% 0.0000% 0.1381% 0.0401% 0.1832% 0.0000% 0.0195% 0.0000% 0.0000% 0.0300% 0.0000% 0.0230% 0.0000% 0.0305% 0.0000% 0.5741% 1.3387% 0.0306% 0.0075% 0.0000% 0.0460% 0.0134% 0.2901% 0.0000% 1.4693% 0.0000% 0.0000% 0.0075% 0.0000% 0.0576% 0.0134% 0.0000% 0.0000% 0.1070% 0.4396% 0.0000% 0.0000% 0.0000% 0.0230% 0.0000% 0.0458% 0.0000% 0.3211% 0.1399% 0.0306% 0.0150% 0.0000% 1.7841% 0.0134% 0.4733% 0.0000% 2.1310% 0.0000% 0.0000% 0.0075% 0.0000% 0.0806% 0.0267% 0.1221% 0.0000% 0.4963% 1.0789% 0.3566% 0.0000% 0.0147% 0.0000% 0.0000% 0.2137% 0.0000% 0.5838% 0.0000% 0.0000% 0.0000% 0.1470% 0.0230% 0.0134% 0.0000% 0.0000% 0.0000% 0.0400% 0.2853% 0.0375% 0.0000% 0.0921% 0.0000% 0.1374% 0.0000% 0.9536% 0.0000% 0.1325% 0.0225% 0.2058% 0.0000% 0.0000% 0.1985% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0115% 0.0000% 0.0000% 0.0000% 0.3211% 0.0000% 0.0000% 0.0000% 0.0000% 0.0576% 0.0000% 0.0611% 0.0000% 0.3698% 0.0000% 0.3158% 0.0000% 0.0000% 0.0000% 0.0000% 0.2137% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1399% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.7641% 0.0000% 0.0147% 0.0230% 0.1605% 0.0000% 0.0237% 0.0778% 0.0200% 0.0204% 0.0000% 0.0000% 0.4489% 0.0267% 0.4580% 0.0000% 0.1168% 0.3596% 0.0102% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0306% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0876% 0.0000% 0.0000% 0.0075% 0.0294% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0075% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0119% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0115% 0.0000% 0.0305% 0.0000% 0.2822% 0.1399% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0460% 0.0267% 0.0305% 0.0000% 0.1362% 0.5195% 0.0000% 0.0000% 0.0000% 0.0230% 0.0401% 0.0000% 0.0000% 0.1849% 0.1199% 0.0000% 0.0000% 0.0000% 0.0691% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.5094% 0.0825% 0.0441% 0.0000% 0.0000% 0.0153% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0763% 0.0000% 0.0000% 0.1998% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.7592% 0.0000% 0.0000% 0.1323% 0.0230% 0.0000% 0.0916% 0.0000% 0.0681% 0.0000% 0.0204% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 1.9780% 0.0102% 0.0075% 0.0294% 0.0000% 0.0000% 0.0763% 0.0000% 0.0000% 0.0000% 0.0102% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.8591% 0.0000% 0.0000% 0.0000% 0.0115% 0.0000% 0.0000% 0.0000% 0.0000% 0.1998% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0075% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0292% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0195% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1898% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0292% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.8233% 0.0000% 0.0000% 0.0611% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0230% 0.0134% 0.0763% 0.0000% 0.1362% 0.0000% 0.0204% 0.0000% 0.0000% 0.0000% 0.0000% 0.0305% 0.0000% 0.7590% 0.0000% 0.0204% 0.0000% 0.0441% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0204% 0.0000% 0.0000% 0.0000% 0.0000% 0.1221% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.9191% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2038% 0.0075% 0.0000% 0.0000% 0.0000% 0.0305% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0681% 0.2597% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0134% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0230% 0.0000% 0.0000% 0.0000% 0.0000% 0.0599% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0102% 0.0450% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0375% 0.0000% 0.0000% 0.0000% 0.2443% 0.0000% 0.0389% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0153% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0075% 0.0147% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0294% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1362% 0.1998% 0.0000% 0.0000% 0.0000% 0.0115% 0.0000% 0.0000% 0.0000% 0.0681% 0.0000% 0.0000% 0.0000% 0.0294% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0204% 0.0075% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0400% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0119% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0267% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.3996% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0588% 0.0000% 0.0000% 0.0763% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.3453% 0.0000% 0.0458% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0150% 0.0000% 0.0921% 0.0401% 0.0153% 0.0000% 0.0000% 0.0000% 0.0000% 0.0075% 0.0000% 0.0000% 0.0000% 0.0153% 0.0000% 0.0778% 0.0799% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0458% 0.0000% 0.0389% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2198% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0200% 0.0204% 0.0075% 0.0147% 0.0000% 0.0000% 0.0305% 0.0000% 0.0000% 0.0000% 0.0000% 0.0150% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0195% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0230% 0.0000% 0.0611% 0.0000% 0.1557% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.3016% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1542% 0.0584% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1946% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0115% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0102% 0.0075% 0.0000% 0.0000% 0.0000% 0.0458% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0134% 0.0000% 0.0000% 0.0000% 0.0799% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0599% 0.0000% 0.0000% 0.0294% 0.0230% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0973% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0204% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1798% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1798% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0115% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0599% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1265% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1199% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0458% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0147% 0.0000% 0.0000% 0.0305% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0147% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0294% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0102% 0.0000% 0.0000% 0.0000% 0.0000% 0.0153% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0147% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0599% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0588% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0584% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0487% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0458% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0267% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0441% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0204% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0294% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0294% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0292% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0102% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0134% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0195% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0195% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0153% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% Control Control Control Control Control Control Control Control Control N8 N9 N11 N14 N15 N16 N17 N18 N19 29.3995% 17.7812% 69.9622% 49.5769% 12.6698% 12.4088% 42.0985% 27.2292% 45.5635% 61.6692% 7.2273% 0.7971% 0.2351% 16.2364% 13.9599% 0.2855% 10.5245% 40.1941% 0.2926% 6.5518% 0.5873% 12.2473% 1.6814% 2.7372% 32.3483% 5.3136% 0.1972% 0.1951% 0.5066% 6.7823% 20.0517% 36.6678% 31.0401% 0.3426% 7.6625% 0.8949% 0.0000% 9.7096% 0.0979% 0.2351% 3.5666% 4.1058% 0.0143% 0.0114% 0.0303% 0.0557% 4.0020% 0.2797% 1.3164% 17.1196% 18.0657% 0.0000% 0.9578% 0.1517% 0.0000% 0.0169% 0.0699% 0.0470% 2.4117% 1.6971% 0.0286% 32.1893% 0.0607% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.5991% 3.4279% 2.3214% 1.8101% 0.9851% 1.6058% 21.6988% 0.4333% 1.0466% 0.0139% 0.2026% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2123% 1.0032% 1.6380% 11.2712% 1.4339% 0.8662% 1.2226% 0.4140% 0.8894% 0.8949% 0.0000% 0.0844% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1013% 0.0559% 0.1410% 0.0000% 0.0000% 0.0000% 0.0000% 0.1972% 0.0000% 15.7717% 0.0000% 2.4213% 0.0679% 0.0182% 0.0999% 0.0000% 0.0000% 0.0000% 8.1560% 0.6712% 1.3634% 0.1698% 0.3285% 1.8986% 0.2737% 0.5005% 0.0139% 1.9757% 0.2377% 0.1881% 0.9001% 1.4599% 0.0000% 0.7412% 0.0303% 0.6131% 0.8274% 0.3356% 0.0235% 0.0849% 0.3102% 0.3141% 6.5792% 0.3489% 0.0000% 0.0000% 0.0000% 0.0000% 0.0679% 0.0000% 0.0000% 0.7640% 0.0000% 5.8102% 2.1108% 4.5169% 0.1646% 0.0510% 0.2920% 0.0000% 0.0000% 5.9609% 0.0000% 8.1054% 0.2797% 1.2929% 0.0000% 0.0000% 0.0000% 0.1368% 0.2427% 0.0418% 0.9625% 0.1259% 0.3996% 0.1529% 0.3832% 0.2712% 0.5473% 0.1213% 0.0000% 0.2195% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2195% 0.0000% 0.0000% 0.2208% 0.5474% 0.0000% 0.2509% 0.0455% 0.0000% 0.0000% 0.0699% 0.0470% 2.5645% 3.4307% 0.0000% 0.1824% 0.0303% 0.0279% 0.0000% 0.0839% 0.3291% 0.2038% 0.4197% 0.0000% 0.0684% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0340% 0.0365% 0.0000% 1.2201% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0510% 0.0365% 0.0000% 0.3535% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0510% 0.1642% 0.0000% 0.4561% 0.0000% 0.0000% 0.0000% 0.0000% 0.0235% 0.0170% 0.0000% 0.0000% 0.4561% 0.0000% 0.0000% 0.0000% 0.0420% 0.0000% 1.1209% 1.2044% 0.0000% 0.2395% 0.0152% 0.0139% 0.1689% 0.0699% 0.3056% 0.0000% 0.0182% 0.0000% 0.0000% 1.0769% 0.0000% 0.0000% 0.0000% 0.0000% 0.1359% 0.3467% 0.0000% 0.0684% 0.0000% 0.0000% 0.7261% 0.0000% 0.1175% 0.0000% 0.0000% 0.0000% 0.2281% 0.0910% 0.0000% 0.0000% 0.0000% 0.0000% 0.7813% 1.7153% 0.0000% 0.0342% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0338% 0.0000% 0.0000% 0.0170% 0.0182% 0.0000% 0.0798% 0.0152% 0.0000% 1.4691% 0.0000% 0.0000% 0.0170% 0.0365% 0.0000% 0.0000% 0.0000% 0.0000% 0.4559% 0.0000% 0.0000% 0.0000% 0.0000% 0.0857% 0.0000% 0.0000% 0.0000% 0.0169% 0.0000% 0.5877% 0.0000% 0.0182% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0340% 0.1460% 0.0000% 0.0228% 0.0000% 0.0000% 0.0000% 0.0000% 0.4231% 0.0000% 0.0000% 0.0000% 0.0114% 0.1668% 0.0139% 0.1182% 0.1538% 0.6582% 0.0000% 0.0182% 0.0000% 0.0000% 0.2730% 0.0000% 0.1351% 0.0420% 0.0235% 0.0000% 0.0000% 0.0000% 0.2623% 0.0607% 0.0000% 0.0000% 0.0420% 0.3996% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0169% 0.0280% 0.0000% 0.0000% 0.0365% 0.0143% 0.7754% 0.0152% 0.0000% 0.0844% 0.1119% 0.2116% 0.0679% 0.1460% 0.0143% 0.0000% 0.0303% 0.0279% 0.0675% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0228% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1698% 0.3467% 0.0000% 0.0456% 0.0000% 0.0000% 0.2195% 0.0420% 0.0470% 0.0000% 0.0000% 0.0000% 0.0000% 0.1062% 0.0000% 3.6474% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0342% 0.0455% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0912% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.5404% 0.0000% 0.0235% 0.0849% 0.2190% 0.0000% 0.0000% 0.0000% 0.0000% 0.3546% 0.0420% 0.1410% 0.0000% 0.0182% 0.0428% 0.0684% 0.1213% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1698% 0.2372% 0.0000% 0.0228% 0.0000% 0.0000% 0.0000% 0.0699% 0.0000% 0.2038% 0.6569% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.4701% 0.0000% 0.0000% 0.0000% 0.0000% 0.0758% 0.0000% 0.0338% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0303% 0.0000% 0.1351% 0.0979% 0.0470% 0.0000% 0.0000% 0.0000% 0.0000% 0.0455% 0.0000% 0.0844% 0.0280% 0.0705% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1182% 0.0000% 0.1175% 0.0000% 0.0000% 0.0000% 0.0000% 0.1062% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0979% 0.0000% 0.0170% 0.0182% 0.0000% 0.0570% 0.0000% 0.0000% 0.0000% 0.0420% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0169% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0607% 0.0000% 0.0000% 0.0000% 0.7287% 0.0340% 0.0365% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.1698% 0.2007% 0.0000% 0.0114% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0418% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0228% 0.0000% 0.0000% 0.0000% 0.0000% 0.2116% 0.0000% 0.0000% 0.0000% 0.0228% 0.0455% 0.0000% 0.0507% 0.0000% 0.2586% 0.0000% 0.0000% 0.0000% 0.0000% 0.0607% 0.0279% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0235% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0507% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0547% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1482% 0.0000% 0.0000% 0.0507% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0114% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1026% 0.0152% 0.0000% 0.0000% 0.0000% 0.0000% 0.0170% 0.0000% 0.0000% 0.0570% 0.0000% 0.0279% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0570% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1013% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0607% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0228% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0507% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0182% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0114% 0.0303% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.3884% 0.0000% 0.0000% 0.0000% 0.0547% 0.0000% 0.0114% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0418% 0.0000% 0.0979% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1410% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0169% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0303% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.1646% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0279% 0.0169% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0758% 0.0279% 0.0338% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0675% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0152% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.3291% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0338% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0675% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0169% 0.0000% 0.1410% 0.0000% 0.0365% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.3377% 0.0000% 0.0470% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0940% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.1410% 0.0000% 0.0000% 0.0000% 0.0000% 0.0910% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0235% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0507% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0510% 0.0912% 0.0000% 0.0000% 0.0000% 0.0000% 0.0675% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0235% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0286% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0228% 0.0000% 0.0000% 0.0000% 0.0699% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0303% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0169% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0152% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1668% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0338% 0.0000% 0.0705% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1062% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0456% 0.0000% 0.0000% 0.0169% 0.0000% 0.1646% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1259% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0507% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0844% 0.0000% 0.0705% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0507% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0570% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1013% 0.0000% 0.0000% 0.0170% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1175% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0705% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0839% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0114% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0342% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0170% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0705% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0675% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0340% 0.0182% 0.0000% 0.0000% 0.0000% 0.0000% 0.0507% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0169% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0470% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0470% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0455% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0455% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0228% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0169% 0.0000% 0.0235% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0303% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0303% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0303% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0280% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0169% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0228% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0182% 0.0000% 0.0000% 0.0000% 0.0000% 0.0169% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0169% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0152% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0139% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% Control Control Control Control Control Control Control N20 N21 N22 N23 N25 N26 N28 Overall OSSC 46.4526% 29.5889% 1.9592% 21.5725% 12.1426% 27.8650% 16.7295% 24.48% 21.51% 1.7357% 8.9388% 6.0594% 62.8078% 79.8015% 1.2692% 5.1501% 12.69% 8.29% 0.0000% 11.0421% 0.0000% 1.7417% 0.5484% 6.2197% 9.3161% 8.41% 10.47% 18.7893% 3.3461% 0.0202% 0.8534% 0.9792% 13.9404% 1.2301% 7.33% 6.01% 1.3886% 0.1115% 0.0000% 0.0839% 0.0000% 3.9867% 0.0000% 5.57% 9.39% 1.1282% 2.2467% 0.0000% 0.3497% 0.0000% 0.3897% 0.8201% 4.84% 6.98% 0.2387% 0.8286% 0.0000% 1.2381% 0.1567% 8.0841% 0.8201% 3.97% 5.32% 0.0000% 0.0000% 73.1165% 0.0000% 0.0000% 0.0053% 0.0000% 3.94% 0.82% 2.0395% 0.4621% 0.0000% 7.7574% 0.6789% 8.1315% 0.3444% 3.49% 3.61% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 3.32% 6.20% 0.8028% 1.8324% 0.0808% 0.9303% 2.0368% 4.2764% 5.7733% 2.10% 1.99% 0.0000% 0.6055% 17.5520% 0.0000% 0.0914% 0.0000% 0.0000% 1.45% 0.78% 2.1914% 0.3027% 0.0000% 0.0000% 0.0783% 0.0000% 1.1809% 1.38% 2.41% 0.0000% 2.0873% 0.0000% 0.0140% 0.0653% 0.1527% 0.0000% 1.27% 0.24% 0.2387% 0.0637% 0.0000% 0.0140% 0.1436% 0.3792% 0.0820% 1.22% 1.39% 0.8028% 0.3346% 0.0000% 1.3500% 0.0653% 2.3383% 0.0000% 1.15% 1.55% 0.4556% 0.3346% 0.0000% 0.3078% 0.0914% 1.7116% 0.0000% 1.12% 1.48% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 1.6537% 0.0000% 0.70% 1.22% 0.1085% 0.3346% 0.0000% 0.0000% 0.0914% 0.0000% 0.0000% 0.70% 0.01% 7.3769% 0.3665% 0.0000% 0.0140% 0.0783% 0.0000% 7.1675% 0.62% 0.03% 0.0000% 0.4302% 0.0202% 0.0699% 0.5614% 1.6905% 0.2132% 0.55% 0.60% 0.0000% 0.0159% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.50% 0.93% 0.0000% 0.0000% 0.0000% 0.0210% 0.0000% 0.0737% 0.2788% 0.50% 0.85% 0.0000% 0.0000% 0.0000% 0.0070% 0.0783% 0.2370% 0.0000% 0.41% 0.47% 0.0000% 0.1912% 0.0000% 0.0839% 0.0522% 0.0369% 0.4428% 0.41% 0.59% 0.0000% 11.7909% 0.0000% 0.0000% 0.0000% 0.0000% 6.9706% 0.40% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1791% 0.0000% 0.33% 0.56% 0.0000% 0.2231% 0.0000% 0.1469% 0.0000% 4.4923% 0.2132% 0.32% 0.35% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0316% 0.4920% 0.29% 0.49% 0.0000% 0.1434% 0.0000% 0.0000% 0.0261% 3.5391% 0.0000% 0.27% 0.33% 0.0000% 0.1115% 0.0000% 0.0000% 0.0000% 0.2739% 0.9349% 0.26% 0.32% 0.9330% 2.1192% 0.0000% 0.0000% 0.1567% 0.0263% 4.1004% 0.25% 0.00% 0.0000% 0.1115% 0.0000% 0.0000% 0.0000% 0.0105% 0.3772% 0.24% 0.40% 0.0000% 0.0000% 0.0000% 0.0000% 0.0522% 0.0053% 0.0984% 0.17% 0.24% 0.1953% 0.0000% 0.0000% 0.1889% 0.1567% 0.5793% 0.1804% 0.19% 0.18% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.19% 0.36% 0.0651% 0.0000% 0.0000% 0.0070% 0.0000% 0.0790% 0.0328% 0.19% 0.34% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2949% 0.1804% 0.19% 0.27% 0.0000% 0.2549% 0.0000% 0.0000% 0.0392% 0.0000% 0.0000% 0.19% 0.30% 2.5602% 0.3505% 0.0000% 0.0000% 0.1175% 0.0000% 2.9523% 0.18% 0.00% 0.0000% 1.0994% 0.0000% 0.0000% 0.0000% 0.0105% 2.3946% 0.15% 0.06% 1.2150% 3.9356% 0.0000% 0.0070% 0.0914% 0.0000% 1.5909% 0.17% 0.00% 2.6470% 0.2549% 0.0000% 0.0070% 0.1958% 0.0105% 2.2634% 0.15% 0.00% 1.2367% 0.1275% 0.0000% 0.0140% 0.0653% 0.2475% 0.0000% 0.15% 0.01% 1.8008% 0.1912% 0.0000% 0.0000% 0.1697% 0.0105% 1.4105% 0.13% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0948% 0.0656% 0.11% 0.14% 0.1953% 0.1753% 0.0000% 0.1749% 0.0000% 0.2581% 0.1968% 0.11% 0.14% 0.0000% 0.0000% 0.0000% 0.0350% 0.0000% 0.9058% 0.2460% 0.09% 0.07% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1527% 0.0000% 0.10% 0.15% 0.3905% 1.9917% 0.0000% 0.0000% 0.0392% 0.0158% 1.3777% 0.10% 0.01% 0.0000% 0.0159% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.09% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 2.9851% 0.09% 0.03% 0.0000% 2.0076% 0.0000% 0.0000% 0.0000% 0.0000% 1.7386% 0.08% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 1.6747% 0.0000% 0.08% 0.08% 0.0000% 0.0478% 0.0000% 0.0000% 0.0000% 1.6642% 0.0000% 0.08% 0.08% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.08% 0.15% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1422% 0.0000% 0.08% 0.09% 0.2604% 0.7967% 0.0000% 0.0140% 0.0392% 0.0211% 0.0000% 0.07% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0474% 0.0000% 0.07% 0.14% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1685% 0.0000% 0.07% 0.11% 0.0000% 0.1593% 0.0000% 0.0000% 0.0000% 0.0000% 1.9682% 0.07% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 1.6115% 0.0000% 0.07% 0.06% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.07% 0.13% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.06% 0.12% 0.3688% 0.0159% 0.0000% 0.0000% 0.1958% 0.0053% 1.0825% 0.06% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.06% 0.11% 0.0000% 0.4143% 0.0000% 0.0000% 0.1045% 0.0000% 0.9021% 0.05% 0.00% 0.7594% 0.1753% 0.0000% 0.0000% 0.0392% 0.0053% 0.9021% 0.05% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 1.7878% 0.05% 0.00% 0.0000% 1.6093% 0.0000% 0.0000% 0.0000% 0.0000% 0.5412% 0.05% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0843% 0.0000% 0.04% 0.07% 0.0000% 1.8164% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.05% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 1.2957% 0.05% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.04% 0.04% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.04% 0.06% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.04% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1738% 0.0000% 0.04% 0.06% 0.3038% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2132% 0.04% 0.00% 0.0000% 0.0637% 0.0000% 0.0070% 0.0522% 0.0053% 0.9677% 0.04% 0.00% 0.0000% 0.2549% 0.0000% 0.0000% 0.0000% 0.0000% 1.2957% 0.03% 0.00% 0.0000% 0.7011% 0.0000% 0.0000% 0.0000% 0.0000% 0.7217% 0.03% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.03% 0.06% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0105% 0.6725% 0.03% 0.02% 0.0000% 0.0000% 0.0404% 0.0000% 0.0000% 0.0000% 0.0000% 0.03% 0.05% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.03% 0.04% 0.0000% 0.0000% 0.0202% 0.0000% 0.0000% 0.1685% 0.0000% 0.03% 0.03% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.03% 0.05% 0.0000% 0.0000% 1.1311% 0.0000% 0.0000% 0.0000% 0.0000% 0.02% 0.00% 1.1282% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.02% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0737% 0.0000% 0.02% 0.04% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0105% 0.0000% 0.02% 0.04% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.02% 0.03% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.02% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0263% 0.0000% 0.02% 0.03% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0211% 0.2296% 0.02% 0.02% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.02% 0.00% 0.3905% 0.0956% 0.0000% 0.0000% 0.0000% 0.0000% 0.2296% 0.02% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0105% 0.3444% 0.02% 0.01% 0.2170% 0.0000% 0.0000% 0.0000% 0.1436% 0.0053% 0.0000% 0.02% 0.00% 0.1519% 0.5895% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.02% 0.00% 0.0000% 0.3505% 0.0000% 0.0000% 0.0000% 0.0000% 0.2788% 0.02% 0.00% 0.0000% 0.0956% 0.0000% 0.0000% 0.0000% 0.0000% 0.5248% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0105% 0.0000% 0.01% 0.03% 0.0000% 0.2071% 0.0000% 0.0000% 0.0000% 0.0790% 0.0000% 0.01% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.03% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0211% 0.0000% 0.01% 0.00% 0.2821% 0.0000% 0.0000% 0.0000% 0.0000% 0.0316% 0.0000% 0.01% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0637% 0.0000% 0.0000% 0.0914% 0.0000% 0.2460% 0.01% 0.00% 0.0000% 0.5577% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.4920% 0.01% 0.00% 0.0000% 0.0478% 0.0000% 0.0000% 0.0000% 0.0000% 0.4920% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0105% 0.5084% 0.01% 0.00% 0.0000% 0.4621% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0105% 0.0000% 0.01% 0.02% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.1115% 0.0000% 0.0000% 0.0000% 0.0000% 0.1148% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.1749% 0.0000% 0.0000% 0.0000% 0.01% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0105% 0.0000% 0.01% 0.02% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.4756% 0.01% 0.00% 0.0868% 0.0000% 0.0000% 0.0000% 0.0914% 0.0000% 0.2132% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.02% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0984% 0.01% 0.00% 0.2604% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1804% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.4143% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0263% 0.0000% 0.01% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.3471% 0.0000% 0.0000% 0.0000% 0.0522% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0319% 0.0000% 0.0070% 0.0000% 0.0053% 0.0000% 0.01% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0217% 0.1753% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.2868% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.1275% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.3608% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0392% 0.0000% 0.0492% 0.01% 0.00% 0.0000% 0.0319% 0.0000% 0.0000% 0.0000% 0.0211% 0.0000% 0.01% 0.01% 0.1085% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1640% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.3280% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.3280% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0316% 0.0000% 0.01% 0.01% 0.0000% 0.0159% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0105% 0.0000% 0.01% 0.01% 0.0000% 0.2071% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0158% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2788% 0.01% 0.00% 0.0651% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0328% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.01% 0.0000% 0.1434% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0474% 0.0000% 0.00% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2460% 0.01% 0.00% 0.0000% 0.2390% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.1085% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.01% 0.0000% 0.0797% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2132% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2132% 0.00% 0.00% 0.0000% 0.2071% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0421% 0.0000% 0.00% 0.01% 0.0000% 0.0319% 0.0000% 0.0000% 0.0000% 0.0000% 0.1476% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.01% 0.0000% 0.1115% 0.0000% 0.0000% 0.0653% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.1753% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1640% 0.00% 0.00% 0.0000% 0.0956% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.1519% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0053% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.1275% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.1275% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1148% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0261% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0261% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0820% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0820% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0797% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0797% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0797% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0656% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0653% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0053% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0478% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0319% 0.0000% 0.0000% 0.0131% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0392% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0392% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0159% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0053% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0319% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0261% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0105% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0053% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0053% 0.0000% 0.00% 0.00% Control 27.86% 17.68% 6.08% 8.82% 1.24% 2.40% 2.44% 7.48% 3.36% 0.04% 2.23% 2.21% 0.21% 2.42% 1.03% 0.70% 0.71% 0.12% 1.49% 1.31% 0.48% 0.02% 0.10% 0.34% 0.21% 0.85% 0.07% 0.29% 0.06% 0.21% 0.20% 0.53% 0.05% 0.09% 0.20% 0.00% 0.02% 0.10% 0.06% 0.39% 0.25% 0.37% 0.32% 0.30% 0.26% 0.08% 0.08% 0.11% 0.04% 0.21% 0.19% 0.15% 0.18% 0.08% 0.08% 0.00% 0.06% 0.15% 0.00% 0.03% 0.14% 0.07% 0.00% 0.00% 0.12% 0.00% 0.11% 0.11% 0.10% 0.10% 0.01% 0.10% 0.10% 0.04% 0.02% 0.09% 0.01% 0.08% 0.08% 0.07% 0.06% 0.00% 0.03% 0.00% 0.01% 0.02% 0.00% 0.05% 0.05% 0.00% 0.00% 0.01% 0.04% 0.00% 0.02% 0.04% 0.04% 0.02% 0.03% 0.03% 0.03% 0.03% 0.00% 0.01% 0.00% 0.02% 0.01% 0.02% 0.03% 0.03% 0.02% 0.02% 0.02% 0.02% 0.00% 0.02% 0.02% 0.01% 0.00% 0.02% 0.02% 0.00% 0.02% 0.02% 0.02% 0.02% 0.01% 0.02% 0.02% 0.02% 0.01% 0.02% 0.02% 0.01% 0.02% 0.02% 0.02% 0.00% 0.01% 0.01% 0.01% 0.00% 0.01% 0.00% 0.01% 0.01% 0.01% 0.01% 0.01% 0.00% 0.01% 0.00% 0.01% 0.00% 0.01% 0.01% 0.01% 0.01% 0.00% 0.01% 0.01% 0.01% 0.01% 0.01% 0.00% 0.01% 0.00% 0.01% 0.01% 0.01% 0.00% 0.01% 0.01% 0.01% 0.00% 0.01% 0.01% 0.01% 0.01% 0.01% 0.00% 0.01% 0.01% 0.01% 0.01% 0.01% 0.01% 0.01% 0.01% 0.01% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% APPENDIX 4.3

Status Cancer Cancer Cancer Cancer ID C1 C2 C3 C4 Rothia mucilaginosa 0.0543% 16.4431% 0.0740% 0.9492% Gemella haemolysans 0.0000% 1.3864% 2.7980% 0.3442% Streptococcus mitis 0.3258% 1.0286% 0.3205% 0.0626% Citrobacter koseri 0.0000% 0.0000% 85.5787% 0.0000% Fusobacterium nucleatum subsp. polymorphum 22.5782% 0.0000% 0.0000% 0.0000% Streptococcus sp. oral taxon 431 0.0543% 0.0149% 0.2465% 0.0000% Streptococcus dysgalactiae 0.0000% 0.0000% 0.0000% 0.0000% Haemophilus parainfluenzae 0.0326% 0.0000% 0.0000% 0.0000% Capnocytophaga sputigena 0.0326% 0.0596% 0.0000% 0.0000% Capnocytophaga leadbetteri 0.8036% 0.0149% 0.1849% 0.0000% Prevotella melaninogenica 1.2272% 0.0000% 0.0000% 0.0000% Leptotrichia hongkongensis 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus sp. oral taxon 423 0.0000% 7.6476% 0.0123% 0.0000% Enterobacter cloacae 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus agalactiae 54.5287% 4.2934% 0.0123% 14.3110% Leptotrichia trevisanii 0.0000% 0.0000% 0.0000% 0.0000% Granulicatella adiacens 0.0869% 0.0000% 1.0970% 0.0209% Streptococcus sp. oral taxon 070 0.0000% 0.0000% 0.5300% 0.0000% Enterobacter hormaechei 0.0000% 0.0000% 0.0247% 0.0000% Rothia dentocariosa 0.0000% 0.3429% 0.0000% 0.0000% Klebsiella pneumoniae 0.0000% 0.1342% 0.0000% 0.0000% Pseudomonas aeruginosa 0.0000% 60.2564% 0.0000% 0.0000% Lautropia mirabilis 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus parasanguinis II 0.0109% 0.6857% 0.0000% 0.0104% Leptotrichia sp. oral taxon 225 0.0000% 0.0000% 0.0000% 0.0000% Leptotrichia sp. oral taxon 223 0.0000% 0.0000% 0.0000% 0.0000% Veillonella parvula group 0.0000% 0.2236% 0.0000% 4.1515% Streptococcus tigurinus 0.0000% 0.0000% 0.0370% 3.1710% Porphyromonas sp. oral taxon 279 1.0752% 0.0000% 0.1479% 0.0000% Leptotrichia sp. oral taxon 215 0.0109% 0.0000% 0.0000% 0.0000% Streptococcus sp. oral taxon 064 0.0000% 0.0149% 0.0000% 0.0209% Streptococcus oralis 0.0000% 0.0000% 0.0000% 0.0000% Leptotrichia sp. oral taxon 215 nov 96.98% 0.3149% 0.0000% 0.0000% 0.0000% Morganella morganii 0.0000% 0.0000% 0.0000% 0.0000% Neisseria flavescens subflava 0.1738% 0.0000% 0.0247% 0.0000% Prevotella veroralis 0.0000% 0.0000% 0.0000% 21.7273% Propionibacterium acnes 0.0000% 0.0149% 0.0000% 0.0000% Fusobacterium nucleatum subsp. nucleatum 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus parasanguinis I 0.0000% 0.0000% 0.0000% 0.3651% Streptococcus sp. oral taxon 058 0.0543% 0.0000% 0.0000% 0.0000% Atopobium rimae 0.0000% 0.0000% 0.0000% 17.5237% Brachybacterium rhamnosum 0.0000% 0.0000% 0.0000% 0.0000% Leptotrichia wadei 0.0000% 0.0000% 0.0000% 0.0417% Neisseria mucosa 0.0000% 0.0000% 0.0000% 0.0000% Parvimonas micra 0.0000% 0.0745% 0.0493% 0.0417% Leptotrichia sp. oral taxon 221 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus salivarius 0.0109% 0.6261% 0.0000% 0.0000% Fusobacterium nucleatum subsp. animalis 0.0000% 0.0000% 0.0000% 0.2608% Streptococcus sanguinis 0.0000% 0.0000% 0.0000% 0.0000% Staphylococcus epidermidis 0.0000% 0.0000% 0.0000% 0.0000% Granulicatella elegans 0.0109% 0.0000% 0.0000% 0.0000% Catonella morbi 0.0217% 0.0000% 0.0000% 0.0000% Lachnoanaerobaculum umeaense 0.0000% 0.0000% 0.0000% 0.1669% Atopobium parvulum 0.0326% 0.0000% 0.0000% 6.1229% Rothia aeria 0.0000% 0.0000% 0.0000% 0.0000% Haemophilus haemolyticus 0.0326% 0.1491% 0.0863% 0.0000% Streptococcus multispecies spp3 2 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus australis 0.0000% 0.0149% 0.0000% 0.0000% Enterobacter cancerogenus 0.0000% 0.0000% 0.0000% 0.0000% Staphylococcus gallinarum 0.0000% 0.0000% 0.0000% 0.0000% Leptotrichia shahii 0.0000% 0.0000% 0.0000% 0.0000% Stomatobaculum longum 0.0109% 0.0000% 0.0000% 1.9923% Streptococcus dentisani 0.0000% 0.0000% 0.0000% 0.0000% Campylobacter concisus 0.2606% 0.0000% 0.0000% 0.4590% Fusobacterium sp. oral taxon 370 0.0000% 0.0000% 0.0247% 0.0000% Leptotrichia buccalis 0.0760% 0.0000% 0.0000% 0.0000% Prevotella nanceiensis 0.0217% 0.0000% 0.0000% 0.0209% Oribacterium sinus 0.0543% 0.0000% 0.0000% 0.5215% Fusobacterium nucleatum subsp. vincentii 0.2281% 0.0000% 0.0000% 0.0000% Porphyromonas endodontalis 0.0000% 0.0000% 0.0493% 0.0000% Leptotrichia sp. oral taxon 215 nov 97.84% 0.0000% 0.0000% 0.0000% 0.0000% Leptotrichia sp. oral taxon 417 0.0652% 0.0000% 0.0000% 0.0000% Prevotella salivae 0.0109% 0.0000% 0.0000% 6.9260% Streptococcus cristatus 0.0000% 0.0000% 0.0000% 0.0000% Bacteroidetes [G-5] sp. oral taxon 511 0.0000% 0.0000% 0.0123% 0.0000% Campylobacter sp. oral taxon 044 8.0474% 0.0000% 0.0000% 0.0000% Capnocytophaga gingivalis 0.0977% 0.0000% 0.0000% 0.0000% Peptostreptococcus stomatis 0.0652% 0.0000% 0.0863% 0.0000% Eikenella corrodens 0.9448% 0.0000% 0.0493% 0.0000% Gemella morbillorum 0.0000% 0.0000% 0.0000% 0.0104% Kingella oralis 0.0000% 0.0000% 0.0000% 0.0000% Fusobacterium sp. HOT 204 4.1051% 0.0000% 0.0000% 0.0000% Haemophilus parahaemolyticus 0.0652% 0.0000% 0.0123% 0.0000% Alloprevotella sp. oral taxon 473 0.1846% 0.0000% 0.0000% 0.0000% Gemella sanguinis 0.0000% 0.0000% 0.0000% 0.0000% Delftia acidovorans 0.0000% 0.0000% 0.0000% 0.0000% Leptotrichia sp. oral taxon 212 0.0109% 0.0000% 0.0000% 0.0000% Prevotella oris 0.0000% 0.1640% 0.0000% 1.6063% Streptococcus gordonii 0.0000% 0.0000% 0.0000% 0.0000% Salmonella Paratyphi ss enterica 0.0000% 0.0000% 0.0000% 0.0000% Burkholderiales [G] sp. Oral Taxon A57 0.0000% 0.0000% 0.0000% 0.0000% Actinomyces odontolyticus 0.0543% 0.1938% 0.0000% 0.2086% Afipia broomeae 0.0000% 0.0000% 0.0000% 0.0000% Fusobacterium periodonticum 0.3475% 0.0000% 0.0000% 0.0000% Streptococcus sp. oral taxon 066 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus infantis 0.0000% 0.0000% 0.0000% 0.0000% Neisseria elongata 0.0000% 0.0000% 0.0000% 0.0000% Fusobacterium necrophorum 0.0000% 0.0000% 0.0000% 0.0000% Propionibacterium sp. oral taxon 194 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus anginosus 0.0000% 0.0000% 0.0370% 1.1057% Capnocytophaga granulosa 0.1195% 0.0000% 0.0000% 0.0000% Treponema sp. oral taxon 257 0.0000% 0.0000% 0.0000% 0.0000% Flavitalea sp. oral taxon 320 nov 87.10% 0.0000% 0.0000% 0.0000% 0.0000% Veillonella atypica 0.0000% 0.0000% 0.0000% 1.2204% Capnocytophaga gingivalis nov 90.87% 0.0543% 0.0000% 0.0000% 0.0000% Leptotrichia sp. oral taxon 221 nov 86.95% 0.0000% 0.0000% 0.0000% 0.0000% Leptotrichia sp. oral taxon 392 0.0652% 0.0000% 0.0000% 0.0000% Streptococcus sp. oral taxon 066 nov 97.79% 0.0000% 0.0000% 0.0000% 0.0000% Solobacterium moorei 0.0000% 0.0000% 0.3205% 0.6050% Prevotella intermedia 0.0000% 0.0000% 0.2219% 0.0000% Prevotella sp. oral taxon 314 0.0326% 0.0000% 0.0000% 0.0000% Leptotrichia sp. oral taxon 219 0.0000% 0.0000% 0.0000% 0.0000% Haemophilus sp. oral taxon 036 0.4887% 0.1044% 0.5793% 0.0000% Haemophilus parainfluenzae nov 97.14% 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus constellatus 0.0217% 0.0447% 0.0863% 0.2921% Bergeyella sp. oral taxon 322 0.0000% 0.0596% 0.0000% 0.0000% Tannerella sp. oral taxon 286 0.0326% 0.0000% 0.0000% 0.0000% Stomatobaculum sp. oral taxon 097 0.0000% 0.0000% 0.0000% 0.0000% Prevotella sp. oral taxon 313 0.1412% 0.0000% 0.0000% 0.1043% Leptotrichia hofstadii 0.0000% 0.0000% 0.0000% 0.0000% Lactobacillus gasseri 0.0000% 1.5206% 0.0000% 2.3678% Cardiobacterium hominis 0.0000% 0.0000% 0.0000% 0.0000% Alloscardovia omnicolens 0.0000% 0.1491% 0.0000% 0.0000% Scardovia wiggsiae 0.0000% 0.0298% 0.0000% 0.0000% Arthrobacter sanguinis 0.0000% 0.0000% 0.0000% 0.0000% Leptotrichia sp. oral taxon 498 0.0000% 0.0000% 0.0000% 0.0000% Capnocytophaga sp. oral taxon 902 0.0000% 0.0000% 0.0000% 0.0000% Abiotrophia defectiva 0.0000% 0.0000% 0.0000% 0.0000% Aggregatibacter segnis 0.0000% 0.0000% 0.0000% 0.0000% Lactobacillus crispatus 0.0000% 3.2797% 0.0000% 0.0000% Ruminococcaceae [G-2] sp. oral taxon 085 0.0109% 0.0000% 0.0000% 1.3038% Porphyromonas gingivalis 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus sp. oral taxon 070 nov 94.80% 0.0000% 0.0000% 0.0000% 0.0000% Prevotella multiformis 0.0000% 0.0000% 0.0000% 1.9193% Campylobacter showae 0.0109% 0.0000% 0.0000% 0.0000% Prevotella pallens 0.0977% 0.0000% 0.0000% 0.0000% Filifactor alocis 0.0000% 0.0000% 0.0370% 0.0000% Serratia rubidaea 0.0000% 0.0000% 0.0000% 0.0000% Arcanobacterium haemolyticum 0.0000% 0.0000% 0.0000% 0.0000% Prevotella denticola 0.0000% 0.0000% 0.0000% 0.0209% Shuttleworthia satelles 0.0000% 0.0000% 0.0000% 3.0145% Pseudomonas pseudoalcaligenes 0.0000% 0.0000% 0.0000% 0.0000% Leptotrichia sp. oral taxon 463 nov 96.76% 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus vestibularis 0.0000% 0.0298% 0.0000% 0.0000% Corynebacterium matruchotii 0.0000% 0.0000% 0.0000% 0.0000% Parvimonas sp. oral taxon 393 0.5213% 0.0000% 0.0000% 0.0000% Lachnoanaerobaculum saburreum 0.0000% 0.0000% 0.0000% 0.0104% Leuconostoc lactis 0.0000% 0.0000% 0.0000% 0.0000% Capnocytophaga sp. oral taxon 335 0.0000% 0.0000% 0.0000% 0.0000% Treponema socranskii 0.0000% 0.0000% 0.0000% 0.0000% Ralstonia pickettii 0.0000% 0.0000% 0.0000% 0.0000% Acinetobacter baumannii 0.0000% 0.0000% 0.0000% 0.0000% Cronobacter sakazakii 0.0000% 0.0000% 0.0370% 0.0000% TM7 [G-1] sp. oral taxon 346 0.0000% 0.0000% 0.0000% 0.0000% Sphingomonas paucimobilis 0.0000% 0.0000% 0.0000% 0.0000% Actinomyces viscosus 0.0000% 0.0000% 0.0000% 0.0000% Enterobacter aerogenes 0.0000% 0.0149% 0.0000% 0.0000% Neisseria flava 0.0109% 0.0000% 0.0000% 0.0000% Fretibacterium sp. oral taxon 360 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus sp. oral taxon 061 0.0000% 0.0000% 0.0000% 0.0000% Porphyromonas sp. oral taxon 930 0.0000% 0.0000% 1.5407% 0.0000% Achromobacter xylosoxidans 0.0000% 0.0000% 0.0000% 0.0000% Leptotrichia sp. oral taxon 463 0.0000% 0.0000% 0.0000% 0.0000% Actinomyces sp. oral taxon 175 nov 97.97% 0.0000% 0.0000% 0.0000% 0.0000% Actinomyces lingnae [NVP] 0.0326% 0.0000% 0.0000% 0.0522% Porphyromonas catoniae 0.0000% 0.0000% 0.0000% 0.0000% Tannerella forsythia 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus sp. oral taxon 074 0.0000% 0.0000% 0.0000% 0.0000% Stenotrophomonas maltophilia 0.0000% 0.0000% 0.0000% 0.0000% Porphyromonas sp. oral taxon 284 0.0000% 0.0000% 0.0000% 0.0000% Prevotella histicola 0.0109% 0.0000% 0.0000% 0.0313% Corynebacterium multispecies spp10 2 0.0000% 0.0000% 0.0000% 0.0000% Alphaproteobacteria [G] sp. Oral Taxon B70 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus sp. oral taxon 431 nov 97.78% 0.0000% 0.0000% 0.0000% 0.0000% Actinomyces sp. oral taxon 169 0.0000% 0.0000% 0.0000% 0.0000% Lachnospiraceae [G-3] sp. oral taxon 100 0.0109% 0.0000% 0.0000% 0.0000% multigenus multispecies spp22 4 0.0000% 0.0000% 2.0091% 0.0000% Neisseria pharyngis 0.0000% 0.0000% 0.0000% 0.0000% Quadrisphaera granulorum 0.0000% 0.0000% 0.0000% 0.0000% Capnocytophaga sp. oral taxon 412 0.0000% 0.0000% 0.0000% 0.0000% Paracoccus marcusii Oral Taxon D41 0.0000% 0.0000% 0.0000% 0.0000% Staphylococcus aureus 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus mutans 0.0000% 0.0000% 0.0000% 0.0000% Staphylococcus hominis 0.0000% 0.0000% 0.0000% 0.0000% Alloprevotella tannerae 0.3041% 0.0149% 0.0000% 0.0000% Mogibacterium diversum 0.0109% 0.0000% 0.0000% 0.2503% Actinomyces sp. oral taxon 180 0.0977% 0.0000% 0.0000% 0.0313% Selenomonas sputigena 0.0000% 0.0000% 0.0000% 0.1147% Peptoniphilaceae [G-1] sp. oral taxon 113 0.0000% 0.0000% 0.0000% 0.0000% Veillonella multispecies spp7 2 0.0000% 0.0000% 0.0000% 0.0000% Aggregatibacter sp. oral taxon 512 0.0000% 0.0000% 0.0000% 0.0000% Treponema medium 0.0000% 0.0000% 0.0000% 0.0000% Tannerella sp. oral taxon 808 0.0000% 0.0000% 0.0000% 0.0000% Neisseria bacilliformis 0.0000% 0.0000% 0.0000% 0.0000% Capnocytophaga sp. oral taxon 326 0.0000% 0.0000% 0.0000% 0.0000% Peptococcus sp. oral taxon 167 0.0000% 0.0000% 0.0123% 0.0000% TM7 [G-1] sp. oral taxon 349 0.0000% 0.0000% 0.0000% 0.0000% Bacteroidetes [G-5] sp. oral taxon 505 0.0000% 0.0000% 0.0000% 0.0000% Haemophilus pittmaniae 0.0000% 0.0000% 0.0000% 0.0000% Acinetobacter lwoffii 0.0000% 0.0000% 0.0000% 0.0000% Fusobacterium sp. oral taxon 203 0.0000% 0.0000% 0.0000% 0.0000% Mycobacterium sp. str. HE5 0.0000% 0.0000% 0.0000% 0.0000% Bacteroidales [G-2] sp. oral taxon 274 0.0326% 0.0000% 0.0000% 0.0000% Propionibacterium propionicum 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus australis nov 97.98% 0.0000% 0.0000% 0.0000% 0.0000% Oribacterium sp. oral taxon 078 0.0000% 0.0000% 0.0000% 0.0000% Olsenella sp. oral taxon 809 0.0000% 0.0000% 0.0000% 1.0744% Corynebacterium durum 0.0000% 0.0000% 0.0000% 0.0000% Neisseria sicca 0.0000% 0.0000% 0.0000% 0.0000% Leptotrichia sp. oral taxon 218 0.0109% 0.0000% 0.0000% 0.0000% Klebsiella oxytoca 0.0000% 0.0000% 0.0000% 0.0000% Methylobacterium sp. Oral Taxon C71 0.0000% 0.0000% 0.0000% 0.0000% Selenomonas dianae 0.0000% 0.0000% 0.0000% 0.0000% Sphingomonas aromaticivorans Oral Taxon A01 0.0000% 0.0000% 0.0000% 0.0000% Actinomyces sp. oral taxon 172 0.0217% 0.0000% 0.0000% 0.0000% Brevundimonas diminuta nov 78.59% 0.0000% 0.0000% 0.0000% 0.0000% Neisseria sp. oral taxon 020 0.0000% 0.0000% 0.0000% 0.0000% Rothia amarae 0.0000% 0.0000% 0.0000% 0.0000% Aggregatibacter sp. oral taxon 513 0.0000% 0.0000% 0.0000% 0.0000% Lachnoanaerobaculum orale 0.0000% 0.0000% 0.0000% 0.0000% Prevotella sp. oral taxon 317 0.0000% 0.0000% 0.0000% 0.0000% Afipia sp. genosp. 4 0.0000% 0.0000% 0.0000% 0.0000% Sphingomonas echinoides 0.0000% 0.0000% 0.0000% 0.0000% Mycoplasma salivarium 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus sp. oral taxon 431 nov 94.16% 0.0000% 0.0000% 0.0000% 0.0000% Cronobacter muytjensii 0.0000% 0.0000% 0.0000% 0.0000% Dolosigranulum pigrum 0.0000% 0.0000% 0.0000% 0.0000% Bifidobacterium dentium 0.0000% 0.0745% 0.0000% 0.4694% Cryptobacterium curtum 0.0000% 0.0000% 0.0000% 0.8553% Sphingomonas sp. oral taxon 004 nov 80.22% 0.0000% 0.0000% 0.0000% 0.0000% Alloprevotella sp. oral taxon 912 0.0000% 0.0000% 0.0000% 0.0000% Aggregatibacter aphrophilus 0.0000% 0.0000% 0.0000% 0.0000% Neisseria sp. oral taxon 018 0.0000% 0.0000% 0.0000% 0.0000% Caulobacter crescentus 0.0000% 0.0000% 0.0000% 0.0000% Actinomyces sp. oral taxon 170 0.0000% 0.0000% 0.0000% 0.0000% Aggregatibacter paraphrophilus 0.0000% 0.0000% 0.0000% 0.0000% Treponema denticola 0.0000% 0.0000% 0.0000% 0.0000% Atopobium sp. oral taxon 199 0.0000% 0.0000% 0.0000% 0.0000% Eggerthia catenaformis 0.0000% 0.0000% 0.0247% 0.0000% Capnocytophaga leadbetteri nov 97.68% 0.0000% 0.0000% 0.0000% 0.0000% Defluvibacter lusatiensis nov 91.47% 0.0000% 0.0000% 0.0000% 0.0000% Oribacterium asaccharolyticum 0.0326% 0.0000% 0.0000% 0.0000% Bacteroides heparinolyticus 0.0000% 0.0000% 0.0000% 0.0000% Lactobacillus fermentum 0.0000% 0.3429% 0.0000% 0.4590% Asticcacaulis excentricus 0.0000% 0.0000% 0.0000% 0.0000% Alloprevotella sp. oral taxon 913 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus infantarius 0.0000% 0.0000% 0.0000% 0.0000% Microbacterium testaceum 0.0000% 0.0000% 0.0000% 0.0000% Prevotella veroralis nov 96.76% 0.0000% 0.0000% 0.0000% 0.8553% Prevotella sp. oral taxon 526 0.0000% 0.0000% 0.0000% 0.0000% Alloprevotella sp. oral taxon 308 0.0109% 0.0000% 0.0000% 0.0000% Haemophilus paraphrohaemolyticus 0.0000% 0.0000% 0.0000% 0.0000% Treponema sp. oral taxon 231 0.0000% 0.0000% 0.0000% 0.0000% Proteus mirabilis 0.0000% 0.0000% 0.0000% 0.0000% Lachnospiraceae [G-2] sp. oral taxon 096 0.0109% 0.0000% 0.0000% 0.0000% Porphyromonas sp. oral taxon 275 0.0000% 0.0000% 0.0000% 0.0000% Sphingomonas sp. oral taxon 004 nov 96.30% 0.0000% 0.0000% 0.0000% 0.0000% Capnocytophaga sp. oral taxon 864 0.0000% 0.0000% 0.0000% 0.0000% Actinomyces meyeri 0.0000% 0.0000% 0.0000% 0.1565% SR1 [G-1] sp. oral taxon 345 0.0000% 0.0000% 0.0000% 0.0000% Gemella bergeri 0.0760% 0.0000% 0.0000% 0.0000% Methylobacterium sp. Oral Taxon B84 0.0000% 0.0000% 0.0000% 0.0000% Leptotrichia sp. Oral Taxon B57 0.0000% 0.0000% 0.0000% 0.0000% Prevotella shahii 0.0217% 0.0000% 0.0000% 0.0000% Sphingomonas sp. oral taxon 004 nov 96.98% 0.0000% 0.0000% 0.0000% 0.0000% Fretibacterium fastidiosum 0.0000% 0.0000% 0.0123% 0.0000% Bergeyella sp. oral taxon 422 0.0000% 0.0000% 0.0000% 0.0000% Aggregatibacter sp. oral taxon 458 0.0000% 0.0000% 0.0000% 0.0000% Prevotella baroniae 0.0000% 0.0000% 0.0000% 0.0000% multigenus multispecies spp15 2 0.0000% 0.0000% 0.0000% 0.0000% Sphingomonas sp. oral taxon 004 nov 97.23% 0.0000% 0.0000% 0.0000% 0.0000% Porphyromonas sp. oral taxon 284 nov 97.76% 0.0000% 0.0000% 0.0000% 0.0000% Delftia acidovorans nov 92.28% 0.0000% 0.0000% 0.0000% 0.0000% Neisseria multispecies spp6 2 0.0000% 0.0000% 0.0000% 0.0000% Capnocytophaga sputigena nov 97.30% 0.0000% 0.0000% 0.0000% 0.0000% Prevotella maculosa 0.0000% 0.0000% 0.0000% 0.0000% Staphylococcus saprophyticus 0.0000% 0.0000% 0.0000% 0.0000% Salmonella multispecies spp11 2 0.0000% 0.0000% 0.6533% 0.0000% TM7 [G-1] sp. oral taxon 347 0.0000% 0.0000% 0.0000% 0.0000% Actinomyces graevenitzii 0.0217% 0.0000% 0.0000% 0.0000% Lachnospiraceae [G-7] sp. oral taxon 086 0.0000% 0.0000% 0.0000% 0.5320% Moraxella osloensis 0.0000% 0.0149% 0.0000% 0.0000% TM7 [G-5] sp. oral taxon 356 0.0000% 0.0000% 0.0000% 0.0000% Streptobacillus hongkongensis 0.6407% 0.0000% 0.0000% 0.0000% Bulleidia extructa 0.0000% 0.0000% 0.0000% 0.0000% Bacteroidetes [G-3] sp. oral taxon 365 0.0000% 0.0000% 0.0247% 0.0000% Prevotella denticola nov 93.27% 0.0000% 0.0000% 0.0000% 0.0000% Corynebacterium sp. Oral Taxon A16 0.0000% 0.0000% 0.0000% 0.0000% Ottowia sp. oral taxon 894 0.2281% 0.0000% 0.0000% 0.0000% Peptostreptococcaceae [XI][G-9] [Eubacterium] brachy 0.0000% 0.0000% 0.0000% 0.0000% Actinomyces lingnae [NVP] nov 94.85% 0.0000% 0.0000% 0.0000% 0.0000% Brevundimonas diminuta nov 95.85% 0.0000% 0.0000% 0.0000% 0.0000% Manihot esculenta Oral Taxon C60 0.0000% 0.0000% 0.0000% 0.0000% multigenus multispecies spp9 2 0.0000% 0.0000% 0.5670% 0.0000% Actinomyces sp. oral taxon 175 0.0000% 0.0000% 0.0000% 0.0000% Prevotella aurantiaca 0.0000% 0.0000% 0.0000% 0.0000% Selenomonas infelix 0.0000% 0.0000% 0.0000% 0.0104% Proteus vulgaris 0.0000% 0.0000% 0.0000% 0.0000% Prevotella sp. oral taxon 306 0.0543% 0.0000% 0.0000% 0.0000% Corynebacterium mucifaciens 0.0000% 0.0000% 0.0000% 0.0000% Limnobacter sp. str. MED105 0.0000% 0.0000% 0.0000% 0.0000% Fusobacterium nucleatum subsp. animalis nov 97.65% 0.0000% 0.0000% 0.0000% 0.0000% Corynebacterium accolens 0.0000% 0.0000% 0.0000% 0.0000% Johnsonella ignava 0.0000% 0.0000% 0.0000% 0.0000% Slackia exigua 0.0000% 0.0000% 0.0000% 0.1982% Pseudoramibacter alactolyticus 0.0000% 0.0000% 0.0000% 0.0000% Bosea vestrisii 0.0000% 0.0000% 0.0000% 0.0000% Prevotella sp. oral taxon 300 0.0000% 0.0000% 0.0000% 0.0000% Brachybacterium sp. Oral Taxon A83 0.0000% 0.0149% 0.0000% 0.0000% Salmonella multispecies spp13 7 0.0000% 0.0000% 0.5054% 0.0000% Actinomyces sp. oral taxon 448 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus sp. oral taxon 058 nov 96.76% 0.0000% 0.0000% 0.0000% 0.0730% Pseudomonas otitidis 0.0000% 0.0000% 0.0000% 0.0000% Peptostreptococcaceae [XI][G-6] [Eubacterium] minutum 0.0000% 0.0000% 0.0000% 0.0000% Selenomonas noxia 0.0000% 0.0000% 0.0000% 0.0000% Capnocytophaga multispecies sppn1 2 nov 96.63% 0.0000% 0.0000% 0.0000% 0.0000% TM7 [G-2] sp. oral taxon 350 nov 86.15% 0.0000% 0.0000% 0.0000% 0.0000% Fusobacteria [G-1] sp. Oral Taxon A71 0.0000% 0.0000% 0.0000% 0.0000% Fusobacterium gonidiaformans 0.0000% 0.0000% 0.0000% 0.0000% Staphylococcus warneri 0.0000% 0.0000% 0.0000% 0.0000% Kingella denitrificans 0.0109% 0.0000% 0.0000% 0.0000% Corynebacterium tuscaniense nov 91.60% 0.0000% 0.0000% 0.0000% 0.0000% Fusobacterium simiae 0.0000% 0.0000% 0.0000% 0.0000% Fretibacterium sp. oral taxon 361 0.0000% 0.0000% 0.0000% 0.0000% Actinomyces naeslundii 0.0000% 0.0000% 0.0000% 0.0000% Flavobacterium cauense 0.0000% 0.0000% 0.0000% 0.0000% Capnocytophaga sp. oral taxon 332 0.0000% 0.0000% 0.0000% 0.0000% Leptotrichia multispecies spp2 2 0.0000% 0.0000% 0.0000% 0.0000% Firmicutes [G] sp. Oral Taxon C68 nov 84.85% 0.0000% 0.0000% 0.0000% 0.0000% Sphingobium yanoikuyae 0.0109% 0.0000% 0.0000% 0.0000% Streptococcus sp. oral taxon 056 0.0000% 0.0000% 0.0000% 0.0000% Veillonella sp. oral taxon 780 0.0000% 0.0000% 0.0000% 0.0000% Haemophilus sputorum 0.0000% 0.0000% 0.0000% 0.0000% Leptotrichia sp. oral taxon 225 nov 87.66% 0.0000% 0.0000% 0.0000% 0.0000% Prevotella dentalis 0.0000% 0.0000% 0.0000% 0.0000% Actinomyces sp. oral taxon 169 nov 97.36% 0.0000% 0.0000% 0.0000% 0.0000% Kytococcus sedentarius nov 90.85% 0.0000% 0.0000% 0.0000% 0.0000% Gluconobacter oxydans 0.0000% 0.0000% 0.0000% 0.0000% Bacteroidetes [G-5] sp. oral taxon 505 nov 95.45% 0.0000% 0.0000% 0.0000% 0.0000% Mycobacterium brisbanense 0.0000% 0.0000% 0.0000% 0.0000% Porphyromonas sp. oral taxon 278 0.0000% 0.0000% 0.0000% 0.0000% Corynebacterium urealyticum 0.0000% 0.0000% 0.0000% 0.0000% Actinomyces sp. oral taxon 171 0.0000% 0.0000% 0.0000% 0.0000% Capnocytophaga gingivalis nov 97.90% 0.0109% 0.0000% 0.0000% 0.0000% Propionibacterium granulosum 0.0000% 0.0000% 0.0000% 0.0000% Rhizobium loti nov 83.64% 0.0000% 0.0000% 0.0000% 0.0000% Reyranella multispecies spp28 2 0.0000% 0.0000% 0.0000% 0.0000% Capnocytophaga haemolytica 0.0000% 0.0000% 0.0000% 0.0000% TM7 [G-6] sp. oral taxon 870 0.0000% 0.0000% 0.0000% 0.0000% Leptotrichia goodfellowii 0.0000% 0.0000% 0.0000% 0.0000% TM7 [G-3] sp. oral taxon 351 0.0000% 0.0000% 0.0000% 0.0313% Actinomycetales [G] sp. Oral Taxon C05 0.0000% 0.0000% 0.0000% 0.0000% Acinetobacter sp. str. DR1 0.0000% 0.0000% 0.0000% 0.0000% Staphylococcus caprae 0.0000% 0.0149% 0.0000% 0.0000% Streptococcus multispecies sppn1 2 nov 97.79% 0.0000% 0.0000% 0.0000% 0.0000% Mogibacterium timidum 0.0000% 0.0000% 0.0000% 0.0000% Caulobacter sp. Oral Taxon C49 0.0000% 0.0000% 0.0000% 0.0000% Peptostreptococcaceae [XI][G-7] [Eubacterium] yurii subsps. yurii & 0.0000% 0.0000% 0.0123% 0.0000% Fusobacterium nucleatum ss animalis 0.0000% 0.0000% 0.0000% 0.0000% Prevotella oulorum 0.0000% 0.0000% 0.0000% 0.0730% Brevibacterium casei 0.0000% 0.0000% 0.0000% 0.0000% Terriglobus aquaticus 0.0000% 0.0000% 0.0000% 0.0000% Gemella haemolysans nov 97.80% 0.0000% 0.0000% 0.0000% 0.0000% Parvimonas micra nov 97.49% 0.0000% 0.0000% 0.0000% 0.0000% Peptococcus sp. oral taxon 168 0.0000% 0.0000% 0.0000% 0.0000% Treponema vincentii 0.0000% 0.0000% 0.0000% 0.0000% Microbacterium flavescens 0.0000% 0.0000% 0.0000% 0.0000% Sphingomonas sp. oral taxon 004 nov 96.29% 0.0000% 0.0000% 0.0000% 0.0000% Sphingomonas sp. oral taxon 004 nov 80.80% 0.0000% 0.0000% 0.0000% 0.0000% Cardiobacterium valvarum 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus sp. str. C300 0.0109% 0.0000% 0.0000% 0.0000% Haemophilus haemolyticus nov 94.70% 0.0000% 0.0000% 0.3328% 0.0000% Deinococcus sp. Oral Taxon C45 nov 88.87% 0.0000% 0.0000% 0.0000% 0.0000% Amnibacterium kyonggiense 0.0000% 0.0000% 0.0000% 0.0000% Belnapia moabensis 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus sp. oral taxon 057 0.0000% 0.0000% 0.0000% 0.0730% Leptotrichia sp. AF189244.1 0.0000% 0.0000% 0.0000% 0.0000% Bacteroidaceae [G-1] sp. oral taxon 272 0.0000% 0.0000% 0.0000% 0.0000% Prevotella sp. oral taxon 475 0.0000% 0.0000% 0.0000% 0.0000% Olsenella sp. oral taxon 807 0.0000% 0.0000% 0.0000% 0.1043% multigenus multispecies spp21 3 0.0000% 0.0000% 0.3205% 0.0000% Sphingomonas echinoides nov 93.09% 0.0000% 0.0000% 0.0000% 0.0000% Megasphaera micronuciformis 0.0109% 0.0000% 0.0000% 0.0104% Streptococcus sp. oral taxon 423 nov 97.18% 0.0000% 0.0000% 0.0000% 0.0000% Oribacterium multispecies spp17 2 0.0000% 0.0000% 0.0000% 0.0000% Selenomonas sp. oral taxon 138 nov 94.30% 0.0000% 0.0000% 0.0000% 0.0000% Catonella morbi nov 92.81% 0.0000% 0.0000% 0.0000% 0.0000% Parvimonas sp. oral taxon 393 nov 97.08% 0.0000% 0.0000% 0.0000% 0.0000% Enterobacter sp. str. HCB 0.0000% 0.0149% 0.0000% 0.0000% Propionibacterium acidifaciens 0.0000% 0.0000% 0.0000% 0.0000% Oxalobacteraceae [G] sp. Oral Taxon C91 0.0000% 0.0000% 0.0000% 0.0000% Sphingomonas sp. oral taxon 004 nov 92.94% 0.0000% 0.0000% 0.0000% 0.0000% Selenomonas sp. oral taxon 134 0.0000% 0.0000% 0.0000% 0.0522% Streptococcus multispecies spp16 2 0.0000% 0.0000% 0.0000% 0.0000% Shuttleworthia satelles nov 97.93% 0.0000% 0.0000% 0.0000% 0.2295% Fretibacterium sp. oral taxon 359 0.0000% 0.0000% 0.0000% 0.0000% Haemophilus sp. oral taxon 908 0.0000% 0.0000% 0.0000% 0.0000% Prevotella multispecies spp1 2 0.0000% 0.0000% 0.0000% 0.0000% Porphyromonas catoniae nov 97.36% 0.0000% 0.0000% 0.0000% 0.0000% Fusobacterium canifelinum 0.0000% 0.0000% 0.0000% 0.0000% Pseudomonas fluorescens 0.0000% 0.0000% 0.0000% 0.0000% Treponema maltophilum 0.0000% 0.0000% 0.0000% 0.0000% Treponema sp. oral taxon 268 0.0000% 0.0000% 0.0000% 0.0000% Sphingomonas phyllosphaerae 0.0000% 0.0000% 0.0000% 0.0000% Sphingobium limneticum 0.0000% 0.0000% 0.0000% 0.0000% Alcaligenes sp. str. CO14 0.0000% 0.0000% 0.0000% 0.0000% Leptotrichia sp. oral taxon 215 nov 97.41% 0.0000% 0.0000% 0.0000% 0.0000% Prevotella saccharolytica 0.0000% 0.0000% 0.0000% 0.0000% Tannerella sp. oral taxon 916 0.0000% 0.0000% 0.0000% 0.0000% Haemophilus parahaemolyticus nov 96.56% 0.0000% 0.0000% 0.0000% 0.0000% Lachnospiraceae [G] sp. Oral Taxon B32 0.0326% 0.0000% 0.0000% 0.0000% Leptotrichia shahii nov 97.19% 0.0000% 0.0000% 0.0000% 0.0000% Prevotella sp. oral taxon 443 0.0109% 0.0000% 0.1726% 0.0000% Anaerococcus lactolyticus nov 90.85% 0.0000% 0.0000% 0.0000% 0.0000% Treponema lecithinolyticum 0.0000% 0.0000% 0.0123% 0.0000% Diaphorobacter nitroreducens Oral Taxon A07 0.0000% 0.0000% 0.0000% 0.0000% Corynebacterium simulans Oral Taxon A35 0.0000% 0.0000% 0.0000% 0.0000% Dialister invisus 0.0000% 0.0000% 0.0000% 0.1043% Lactobacillus multispecies sppn1 2 nov 83.19% 0.0000% 0.0000% 0.0000% 0.0000% Bradyrhizobium sp. str. LMG10689 0.0000% 0.0000% 0.0000% 0.0000% Delftia acidovorans nov 91.34% 0.0000% 0.0000% 0.0000% 0.0000% Prevotella fusca 0.0000% 0.0000% 0.0000% 0.0000% Porphyromonas uenonis 0.0000% 0.0000% 0.0000% 0.0000% Salmonella Schwarzengrund ss enterica 0.0000% 0.0000% 0.2465% 0.0000% Williamsia muralis 0.0000% 0.0000% 0.0000% 0.0000% TM7 [G-1] sp. oral taxon 869 0.0000% 0.0000% 0.0000% 0.0000% Lachnospiraceae [G-7] sp. oral taxon 163 0.0000% 0.0000% 0.0000% 0.0000% Erwinia rhapontici 0.0000% 0.0000% 0.0000% 0.0000% Peptostreptococcaceae [G] sp. Oral Taxon B61 0.0000% 0.0000% 0.0123% 0.0000% Capnocytophaga sp. oral taxon 380 0.0000% 0.0000% 0.0000% 0.0000% Actinomyces sp. oral taxon 877 0.0000% 0.0000% 0.0000% 0.0000% Sphingomonas roseiflava 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus sanguinis nov 94.95% 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus parasanguinis I nov 95.98% 0.0000% 0.0000% 0.0000% 0.0000% Actinomyces urogenitalis 0.0000% 0.0000% 0.0000% 0.0000% Abiotrophia defectiva nov 96.83% 0.0000% 0.0000% 0.0000% 0.0000% Brevibacterium avium 0.0000% 0.0000% 0.0000% 0.0000% Neisseria oralis 0.0000% 0.0000% 0.0000% 0.0000% Porphyrobacter tepidarius nov 94.25% 0.0000% 0.0000% 0.0000% 0.0000% Burkholderiaceae [G] sp. Oral Taxon D14 0.0000% 0.0000% 0.0000% 0.0000% Parvimonas sp. oral taxon 110 0.1086% 0.0000% 0.0000% 0.0000% Propionibacterium sp. oral taxon 915 nov 92.11% 0.0000% 0.0000% 0.0000% 0.0000% Rothia mucilaginosa nov 97.66% 0.0000% 0.0000% 0.0000% 0.0000% Microbacterium flavescens nov 93.38% 0.0000% 0.0000% 0.0000% 0.0000% Pedobacter sp. oral taxon 933 nov 97.93% 0.0000% 0.0000% 0.0000% 0.0000% Fusobacterium gonidiaformans nov 87.87% 0.0000% 0.0000% 0.0000% 0.0000% Actinobacillus ureae nov 77.62% 0.0000% 0.0000% 0.0000% 0.0000% Microbacterium flavescens nov 92.41% 0.0000% 0.0000% 0.0000% 0.0000% Mycobacterium mucogenicum 0.0000% 0.0000% 0.0000% 0.0000% Granulicatella elegans nov 95.60% 0.0000% 0.0000% 0.0000% 0.0000% Campylobacter gracilis 0.0000% 0.0000% 0.0000% 0.0000% Pseudomonas mosselii Oral Taxon A88 0.0000% 0.0000% 0.0000% 0.0000% Porphyromonas bennonis 0.0000% 0.2087% 0.0000% 0.0000% Kluyvera ascorbata nov 95.52% 0.0000% 0.0000% 0.0000% 0.0000% Massilia brevitalea 0.0000% 0.0000% 0.0000% 0.0000% Sneathia amnii [NVP] 0.0000% 0.0000% 0.0000% 0.0000% Anaeroglobus geminatus 0.0000% 0.0000% 0.0000% 0.0000% Staphylococcus haemolyticus 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus sp. Oral Taxon B66 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus sanguinis nov 97.79% 0.0000% 0.0000% 0.0000% 0.0000% Paracoccus caeni 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus agalactiae nov 95.78% 0.0000% 0.0000% 0.0000% 0.1982% Schlegelella aquatica 0.0000% 0.0000% 0.0000% 0.0000% Porphyromonas sp. Oral Taxon B43 0.0000% 0.0000% 0.0000% 0.0000% Kocuria marina 0.0000% 0.0000% 0.0000% 0.0000% Peptoniphilus indolicus nov 97.71% 0.0000% 0.0000% 0.0000% 0.0626% Peptostreptococcaceae [XI][G-5] [Eubacterium] saphenum 0.0000% 0.0000% 0.0000% 0.0000% Actinomyces oris 0.0000% 0.0000% 0.0000% 0.0000% Peptostreptococcaceae [XI][G-1] [Eubacterium] infirmum 0.0000% 0.0000% 0.0000% 0.0104% Prevotella enoeca 0.0000% 0.0000% 0.0000% 0.0000% Fusobacterium multispecies spp30 2 0.0000% 0.0000% 0.0000% 0.0000% Prevotella sp. oral taxon 472 0.0000% 0.0000% 0.0000% 0.0000% Geodermatophilus brasiliensis 0.0000% 0.0000% 0.0000% 0.0000% Pseudokineococcus lusitanus 0.0000% 0.0000% 0.0000% 0.0000% Mannheimia haemolytica nov 89.07% 0.0000% 0.0000% 0.0000% 0.0000% Schlegelella thermodepolymerans nov 88.64% 0.0000% 0.0000% 0.0000% 0.0000% Stenotrophomonas hibiscicola 0.0000% 0.0000% 0.0000% 0.0000% Bacteroidetes [G-3] sp. oral taxon 280 0.0000% 0.0000% 0.0000% 0.0000% Lactococcus lactis 0.0000% 0.0000% 0.0000% 0.0000% Capnocytophaga sp. oral taxon 336 0.0000% 0.0000% 0.0000% 0.0000% Oribacterium sp. oral taxon 102 0.0000% 0.0000% 0.0000% 0.0000% Comamonadaceae [G] sp. Oral Taxon B87 0.0000% 0.0000% 0.0000% 0.0000% Actinomyces sp. oral taxon 525 0.0000% 0.0000% 0.0000% 0.0000% Leptotrichia sp. oral taxon 417 nov 95.40% 0.0000% 0.0000% 0.0000% 0.0000% Selenomonas sp. Oral Taxon G55 0.0000% 0.0000% 0.0000% 0.0000% Fusobacterium multispecies spp4 2 0.0000% 0.0000% 0.0000% 0.0000% Ralstonia pickettii nov 88.87% 0.0000% 0.0000% 0.0000% 0.0000% Zoogloea oryzae nov 81.58% 0.0000% 0.0000% 0.0000% 0.0000% Leuconostoc citreum 0.0000% 0.0000% 0.0000% 0.0000% Sphingomonas sp. Oral Taxon B65 0.0000% 0.0000% 0.0000% 0.0000% Novosphingobium multispecies spp31 2 0.0000% 0.0000% 0.0000% 0.0000% Actinobaculum sp. oral taxon 848 0.0000% 0.0000% 0.0000% 0.0000% Propionibacterium sp. oral taxon 192 nov 90.79% 0.0000% 0.0000% 0.0000% 0.0000% Prevotella bivia nov 79.38% 0.0000% 0.0000% 0.0000% 0.0000% Isosphaera pallida nov 89.06% 0.0000% 0.0000% 0.0000% 0.0000% Caulobacter sp. oral taxon 002 nov 83.26% 0.0000% 0.0000% 0.0000% 0.0000% Sphingomonas sp. oral taxon 004 nov 95.15% 0.0000% 0.0000% 0.0000% 0.0000% Kocuria kristinae 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus pyogenes nov 90.58% 0.0000% 0.0000% 0.0000% 0.0000% Prevotella veroralis nov 96.95% 0.0000% 0.0000% 0.0000% 0.1565% Leptothrix sp. oral taxon 025 nov 90.98% 0.0000% 0.0000% 0.0000% 0.0000% Janibacter sp. Oral Taxon D01 0.0000% 0.0000% 0.0000% 0.0000% Treponema sp. oral taxon 257 nov 97.75% 0.0000% 0.0000% 0.0000% 0.0000% Yersinia mollaretii nov 87.68% 0.0000% 0.0000% 0.0000% 0.0000% Agrobacterium tumefaciens nov 83.94% 0.0000% 0.0000% 0.0000% 0.0000% Corynebacterium sp. Oral Taxon B71 0.0000% 0.0000% 0.0000% 0.0000% Fusobacterium periodonticum nov 97.14% 0.0000% 0.0000% 0.0000% 0.0000% Brevibacterium iodinum 0.0000% 0.0000% 0.0000% 0.0000% Gemella morbillorum nov 94.40% 0.0000% 0.0000% 0.0000% 0.0000% Hydrogenophaga multispecies spp27 2 0.0000% 0.0000% 0.0000% 0.0000% Prevotella bivia 0.0000% 0.0000% 0.0000% 0.0313% Corynebacterium afermentans 0.0000% 0.0000% 0.0000% 0.0000% Sphingomonas sp. oral taxon 004 nov 80.58% 0.0000% 0.0000% 0.0000% 0.0000% Salmonella multispecies spp18 2 0.0000% 0.0000% 0.1479% 0.0000% Prevotella sp. oral taxon 396 nov 83.92% 0.0000% 0.0000% 0.0000% 0.0000% Prevotella buccae 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus intermedius 0.0000% 0.0000% 0.0000% 0.0000% Gluconobacter cerinus 0.0000% 0.0000% 0.0000% 0.0000% Porphyromonas sp. oral taxon 277 nov 97.76% 0.0000% 0.0000% 0.0000% 0.0000% Brevundimonas diminuta 0.0109% 0.0000% 0.0000% 0.0000% Actinomyces sp. oral taxon 175 nov 97.76% 0.0000% 0.0000% 0.0000% 0.0000% Methylobacterium hispanicum 0.0000% 0.0000% 0.0000% 0.0000% Fusobacterium sp. oral taxon 370 nov 97.64% 0.0000% 0.0000% 0.0000% 0.0000% Arthrobacter pityocampae 0.0000% 0.0000% 0.0000% 0.0000% Lachnospiraceae [G-2] sp. oral taxon 088 nov 93.15% 0.0000% 0.0000% 0.0000% 0.0000% Peptostreptococcaceae [XI][G-4] sp. oral taxon 369 0.0000% 0.0000% 0.0123% 0.0000% Micrococcus luteus 0.0000% 0.0000% 0.0000% 0.0000% Salmonella multispecies spp24 2 0.0000% 0.0000% 0.1356% 0.0000% Lactobacillus rhamnosus 0.0000% 0.1342% 0.0000% 0.0000% Capnocytophaga gingivalis nov 96.25% 0.0652% 0.0000% 0.0000% 0.0000% Treponema sp. oral taxon 237 0.0000% 0.0000% 0.0000% 0.0000% Clostridiales [F-1][G-1] sp. oral taxon 093 0.0000% 0.0000% 0.0000% 0.0000% Leptotrichia sp. oral taxon 847 0.0000% 0.0000% 0.0000% 0.0000% Acinetobacter septicus 0.0000% 0.0000% 0.0000% 0.0000% Alloprevotella sp. oral taxon 913 nov 97.97% 0.0000% 0.0000% 0.0000% 0.0000% Pseudomonas gingeri 0.0000% 0.0000% 0.0000% 0.0000% Porphyrobacter tepidarius nov 94.92% 0.0000% 0.0000% 0.0000% 0.0000% Desulfovibrio vulgaris 0.0000% 0.0000% 0.0000% 0.0000% Halomonas stevensii 0.0000% 0.0000% 0.0000% 0.0000% Staphylococcus warneri nov 92.81% 0.0000% 0.0000% 0.0000% 0.0000% Streptomyces griseus 0.0000% 0.0000% 0.0000% 0.0000% Mobiluncus mulieris 0.0000% 0.0000% 0.0000% 0.0000% Capnocytophaga leadbetteri nov 97.89% 0.0000% 0.0000% 0.0000% 0.0000% Selenomonas artemidis 0.0000% 0.0000% 0.0000% 0.0000% Granulicatella adiacens nov 96.61% 0.0000% 0.0000% 0.0000% 0.0000% Neisseria elongata nov 90.47% 0.0000% 0.0000% 0.1233% 0.0000% Streptococcus anginosus nov 95.87% 0.0000% 0.0000% 0.0000% 0.0000% Prevotella sp. oral taxon 305 nov 93.93% 0.0000% 0.0000% 0.0000% 0.0000% SR1 [G-1] sp. oral taxon 874 0.0109% 0.0000% 0.0000% 0.0000% Sphingomonas glacialis 0.0000% 0.0000% 0.0000% 0.0000% Cupriavidus metallidurans 0.0000% 0.0000% 0.0000% 0.0000% Leptotrichia sp. oral taxon 223 nov 95.48% 0.0000% 0.0000% 0.0000% 0.0000% Corynebacterium mucifaciens nov 95.93% 0.0000% 0.0000% 0.0000% 0.0000% GN02 [G-2] sp. oral taxon 873 0.0000% 0.0000% 0.0000% 0.0000% Fusobacterium necrophorum nov 92.37% 0.0000% 0.0000% 0.0000% 0.0000% Arsenicicoccus bolidensis nov 89.66% 0.0000% 0.0000% 0.0000% 0.0000% Porphyromonas somerae 0.0000% 0.0000% 0.0000% 0.0000% Bergeyella sp. oral taxon 319 nov 76.98% 0.0000% 0.0000% 0.0000% 0.0000% Brevundimonas diminuta nov 96.77% 0.0000% 0.0000% 0.0000% 0.0000% Marmoricola scoriae 0.0000% 0.0000% 0.0000% 0.0000% Staphylococcus kloosii 0.0000% 0.0000% 0.0000% 0.0000% Granulicatella adiacens nov 89.15% 0.0000% 0.0000% 0.0000% 0.0000% Hephaestia caeni 0.0000% 0.0000% 0.0000% 0.0000% Cupriavidus gilardii nov 88.50% 0.0000% 0.0000% 0.0000% 0.0000% Acinetobacter sp. oral taxon 408 nov 90.57% 0.0000% 0.0000% 0.0000% 0.0000% Olsenella sp. oral taxon 939 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus sp. oral taxon 431 nov 97.38% 0.0000% 0.0000% 0.0000% 0.0000% Actinomyces cardiffensis 0.0000% 0.0000% 0.0000% 0.0000% Sphingomonas echinoides nov 96.30% 0.0000% 0.0000% 0.0000% 0.0000% TM7 [G-1] sp. oral taxon 352 0.0000% 0.0000% 0.0000% 0.0000% Deinococcus maricopensis nov 76.47% 0.0000% 0.0000% 0.0000% 0.0000% Johnsonella sp. oral taxon 166 0.0000% 0.0000% 0.0000% 0.0000% Leptotrichia sp. oral taxon 215 nov 97.18% 0.0000% 0.0000% 0.0000% 0.0000% Kingella oralis nov 97.76% 0.0000% 0.0000% 0.0000% 0.0000% Catonella sp. oral taxon 451 0.0000% 0.0000% 0.0000% 0.0000% Corynebacterium kroppenstedtii 0.0000% 0.0000% 0.0000% 0.0000% Cardiobacterium hominis nov 97.73% 0.0000% 0.0000% 0.0000% 0.0000% Actinomyces israelii nov 94.92% 0.0000% 0.0000% 0.0000% 0.0000% Sphingomonas sp. oral taxon 004 nov 95.59% 0.0000% 0.0000% 0.0000% 0.0000% Veillonella sp. Oral Taxon C09 0.0000% 0.0000% 0.0000% 0.0522% Sphingomonas echinoides nov 94.63% 0.0000% 0.0000% 0.0000% 0.0000% Granulicatella sp. Oral Taxon D03 0.0000% 0.0000% 0.0000% 0.0000% Deinococcus sp. Oral Taxon C45 nov 90.21% 0.0000% 0.0000% 0.0000% 0.0000% Sphingomonas sp. oral taxon 006 nov 83.70% 0.0000% 0.0000% 0.0000% 0.0000% Cupriavidus gilardii nov 89.66% 0.0000% 0.0000% 0.0000% 0.0000% Aggregatibacter sp. oral taxon 513 nov 79.22% 0.0000% 0.0000% 0.0000% 0.0000% Calditerrivibrio nitroreducens nov 78.46% 0.0000% 0.0000% 0.0000% 0.0000% Avibacterium volantium nov 79.57% 0.0000% 0.0000% 0.0000% 0.0000% Mobiluncus curtisii 0.0000% 0.0000% 0.0000% 0.0000% Leptotrichia sp. oral taxon 215 nov 97.82% 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus gallolyticus 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus pneumoniae 0.0000% 0.0000% 0.0000% 0.0000% Kocuria sp. oral taxon 189 nov 89.71% 0.0000% 0.0000% 0.0000% 0.0000% Bacteroidetes [G-5] sp. oral taxon 511 nov 97.93% 0.0000% 0.0000% 0.0000% 0.0000% Selenomonas sp. oral taxon 892 0.0000% 0.0000% 0.0000% 0.0000% Brevundimonas vesicularis Oral Taxon C59 0.0000% 0.0000% 0.0000% 0.0000% Caulobacter sp. oral taxon 002 nov 84.28% 0.0000% 0.0000% 0.0000% 0.0000% Pedobacter duraquae 0.0000% 0.0000% 0.0000% 0.0000% Peptostreptococcus anaerobius nov 81.80% 0.0000% 0.0000% 0.0000% 0.0000% Selenomonas flueggei 0.0000% 0.0000% 0.0000% 0.0000% Selenomonas sp. oral taxon 126 nov 97.46% 0.0000% 0.0000% 0.0000% 0.0000% Corynebacterium tuscaniense nov 78.53% 0.0000% 0.0000% 0.0000% 0.0000% Methylobacterium isbiliense 0.0000% 0.0000% 0.0000% 0.0000% Rhodobacter capsulatus nov 87.87% 0.0000% 0.0000% 0.0000% 0.0000% Treponema pectinovorum 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus pyogenes 0.0000% 0.0000% 0.0000% 0.0000% Selenomonas sp. oral taxon 126 0.0000% 0.0000% 0.0000% 0.0000% Selenomonas sp. oral taxon 892 nov 97.46% 0.0000% 0.0000% 0.0000% 0.0000% Haemophilus sp. oral taxon 908 nov 97.96% 0.0000% 0.0000% 0.0000% 0.0000% Clostridium perfringens nov 81.48% 0.0000% 0.0000% 0.0000% 0.0000% Prevotella pleuritidis 0.0000% 0.0000% 0.0000% 0.0000% Pedobacter sp. oral taxon 321 nov 82.15% 0.0000% 0.0000% 0.0000% 0.0000% Microbacterium flavescens nov 87.63% 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus gordonii nov 97.24% 0.0000% 0.0000% 0.0000% 0.0000% multigenus multispecies spp23 2 0.0000% 0.0000% 0.0863% 0.0000% Streptococcus sp. str. M334 0.0000% 0.0000% 0.0000% 0.0000% Megasphaera sp. oral taxon 841 nov 86.21% 0.0000% 0.0000% 0.0000% 0.0000% Lacnoclostridium sp. str. L2 50 nov 79.92% 0.0000% 0.0000% 0.0000% 0.0000% Lachnospiraceae [G] sp. Oral Taxon B18 0.0000% 0.0000% 0.0000% 0.0000% Cronobacter sakazakii nov 86.23% 0.0000% 0.0000% 0.0000% 0.0000% Campylobacter rectus 0.0000% 0.0000% 0.0000% 0.0000% Lachnospiraceae [G-8] sp. oral taxon 500 0.0000% 0.0000% 0.0000% 0.0000% Fusobacterium gonidiaformans nov 91.63% 0.0000% 0.0000% 0.0000% 0.0000% Bradyrhizobium elkanii nov 86.36% 0.0000% 0.0000% 0.0000% 0.0000% Anaeromyxobacter sp. str. K nov 80.69% 0.0000% 0.0000% 0.0000% 0.0000% Aeromonas taiwanensis 0.0000% 0.0000% 0.0000% 0.0000% Prevotella melaninogenica nov 97.36% 0.0000% 0.0000% 0.0000% 0.0000% Delftia acidovorans nov 90.30% 0.0000% 0.0000% 0.0000% 0.0000% Solobacterium moorei nov 96.75% 0.0000% 0.0000% 0.0000% 0.0000% Neisseria multispecies sppn1 2 nov 96.54% 0.0000% 0.0000% 0.0000% 0.0000% Agrobacterium tumefaciens nov 87.30% 0.0000% 0.0000% 0.0000% 0.0000% Propionivibrio sp. Oral Taxon C33 0.0000% 0.0000% 0.0000% 0.0000% Veillonella parvula group nov 96.09% 0.0000% 0.0000% 0.0000% 0.0000% Dialister pneumosintes 0.0000% 0.0000% 0.0000% 0.0000% Dietzia papillomatosis 0.0000% 0.0000% 0.0000% 0.0000% Barrientosiimonas humi 0.0000% 0.0000% 0.0000% 0.0000% GN02 [G-1] sp. oral taxon 871 0.0000% 0.0000% 0.0000% 0.0000% Neisseria sp. oral taxon 018 nov 97.96% 0.0000% 0.0000% 0.0000% 0.0000% Lactobacillus salivarius 0.0000% 0.0000% 0.0000% 0.0104% Bulleidia extructa nov 93.09% 0.0000% 0.0000% 0.0000% 0.0000% Campylobacter sp. Oral Taxon G43 0.0000% 0.0000% 0.0000% 0.0000% Prevotella loescheii 0.0000% 0.0000% 0.0000% 0.0000% Sphingomonas sp. oral taxon 004 nov 95.61% 0.0000% 0.0000% 0.0000% 0.0000% Moraxella atlantae 0.0000% 0.0000% 0.0000% 0.0000% Actinobaculum sp. oral taxon 848 nov 96.53% 0.0000% 0.0000% 0.0000% 0.0000% Sphingomonas sp. Oral Taxon A74 0.0000% 0.0000% 0.0000% 0.0000% Methylobacterium rhodesianum 0.0000% 0.0000% 0.0000% 0.0000% Atopobium sp. oral taxon 416 0.0000% 0.0000% 0.0000% 0.0313% Corynebacterium jeikeium 0.0000% 0.0000% 0.0000% 0.0000% Alloprevotella rava 0.0326% 0.0000% 0.0000% 0.0000% Capnocytophaga sp. oral taxon 903 0.0000% 0.0000% 0.0000% 0.0000% Aggregatibacter multispecies sppn1 2 nov 97.76% 0.0000% 0.0000% 0.0000% 0.0000% Porphyromonas sp. oral taxon 279 nov 97.96% 0.0760% 0.0000% 0.0000% 0.0000% Mycoplasma faucium 0.0000% 0.0000% 0.0000% 0.0000% Rhodobacter capsulatus nov 87.72% 0.0000% 0.0000% 0.0000% 0.0000% Olsenella uli 0.0000% 0.0000% 0.0000% 0.0000% Bacteroides zoogleoformans nov 96.93% 0.0000% 0.0000% 0.0000% 0.0000% Campylobacter hominis 0.0000% 0.0000% 0.0000% 0.0000% Lachnospiraceae [G-7] sp. oral taxon 163 nov 78.45% 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus anginosus nov 93.53% 0.0000% 0.0000% 0.0000% 0.0000% Actinomyces massiliensis 0.0000% 0.0000% 0.0000% 0.0000% Chryseobacterium culicis 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus multispecies sppn1 2 nov 96.79% 0.0000% 0.0000% 0.0000% 0.0000% Cardiobacterium valvarum nov 95.28% 0.0000% 0.0000% 0.0000% 0.0000% Prevotella multispecies spp29 2 0.0000% 0.0000% 0.0000% 0.0000% Fretibacterium sp. oral taxon 358 0.0000% 0.0000% 0.0000% 0.0000% Selenomonas flueggei nov 97.44% 0.0000% 0.0000% 0.0000% 0.0000% Haemophilus sp. oral taxon 908 nov 97.14% 0.0000% 0.0000% 0.0000% 0.0000% Psychrobacter sp. str. 13983 0.0000% 0.0000% 0.0000% 0.0000% Pseudomonas putida 0.0000% 0.0000% 0.0000% 0.0000% Lactobacillus jensenii nov 77.95% 0.0000% 0.0000% 0.0000% 0.0000% Capnocytophaga multispecies spp19 2 0.0000% 0.0000% 0.0000% 0.0000% Staphylococcus epidermidis nov 94.21% 0.0000% 0.0000% 0.0000% 0.0000% Treponema sp. oral taxon 262 0.0000% 0.0000% 0.0000% 0.0000% Corynebacterium mucifaciens nov 97.63% 0.0000% 0.0000% 0.0000% 0.0000% Corynebacterium tuscaniense nov 94.23% 0.0000% 0.0000% 0.0000% 0.0000% Lachnoanaerobaculum sp. oral taxon 496 0.0000% 0.0000% 0.0000% 0.0000% Clostridium difficile 0.0000% 0.0000% 0.0000% 0.0000% Fusobacterium nucleatum subsp. polymorphum nov 97.80% 0.0000% 0.0000% 0.0000% 0.0000% Kocuria polaris Oral Taxon A70 0.0000% 0.0000% 0.0000% 0.0000% Micrococcus lylae 0.0000% 0.0000% 0.0000% 0.0000% Pedobacter sp. oral taxon 321 nov 87.10% 0.0000% 0.0000% 0.0000% 0.0000% Brevundimonas diminuta nov 83.45% 0.0000% 0.0000% 0.0000% 0.0000% SR1 [G-1] sp. oral taxon 875 0.0326% 0.0000% 0.0000% 0.0000% Leptotrichia sp. oral taxon 417 nov 97.84% 0.0000% 0.0000% 0.0000% 0.0000% Porphyromonas multispecies sppn1 2 nov 97.76% 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus agalactiae nov 95.40% 0.0000% 0.0000% 0.0000% 0.0000% Roseiflexus sp. str. RS 1 nov 83.19% 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus cristatus nov 97.38% 0.0000% 0.0000% 0.0000% 0.0000% Tepidiphilus succinatimandens 0.0000% 0.0000% 0.0000% 0.0000% Prevotella sp. oral taxon 942 0.0652% 0.0000% 0.0000% 0.0000% Prevotella marshii 0.0000% 0.0000% 0.0000% 0.0000% Stomatobaculum sp. oral taxon 373 0.0000% 0.0000% 0.0000% 0.0000% Prevotella sp. oral taxon 315 0.0000% 0.0000% 0.0000% 0.0000% Fusobacterium sp. oral taxon 370 nov 97.81% 0.0000% 0.0000% 0.0000% 0.0000% Peptostreptococcaceae [XI][G-2] sp. oral taxon 091 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus sp. oral taxon 431 nov 96.18% 0.0000% 0.0000% 0.0000% 0.0000% Staphylococcus epidermidis nov 86.44% 0.0000% 0.0000% 0.0000% 0.0000% Leptotrichia sp. oral taxon 879 nov 95.68% 0.0000% 0.0000% 0.0000% 0.0000% Porphyromonas sp. Oral Taxon C34 0.0000% 0.0000% 0.0616% 0.0000% Porphyromonas endodontalis nov 85.66% 0.0000% 0.0000% 0.0000% 0.0000% Parvimonas micra nov 97.90% 0.0000% 0.0000% 0.0000% 0.0000% Sphingomonas echinoides nov 84.49% 0.0000% 0.0000% 0.0000% 0.0000% Sphingomonas echinoides nov 96.07% 0.0000% 0.0000% 0.0000% 0.0000% Selenomonas noxia nov 97.84% 0.0000% 0.0000% 0.0000% 0.0000% Mycobacterium tuberculosis nov 87.81% 0.0000% 0.0000% 0.0000% 0.0000% Hymenobacter roseosalivarius nov 86.90% 0.0000% 0.0000% 0.0000% 0.0000% Rhodobacter capsulatus nov 89.14% 0.0000% 0.0000% 0.0000% 0.0000% Haemophilus haemolyticus nov 97.96% 0.0000% 0.0000% 0.0000% 0.0000% Capnocytophaga cynodegmi nov 85.63% 0.0000% 0.0000% 0.0000% 0.0000% Sneathia sanguinegens 0.0000% 0.0000% 0.0000% 0.0000% Lactobacillus harbinensis 0.0000% 0.0596% 0.0000% 0.0000% Bergeyella sp. oral taxon 931 nov 89.25% 0.0000% 0.0000% 0.0000% 0.0000% Tissierella coagulans 0.0000% 0.0000% 0.0000% 0.0000% Selenomonas sp. oral taxon 919 0.0000% 0.0000% 0.0000% 0.0000% Shewanella xiamenensis 0.0000% 0.0000% 0.0000% 0.0000% Yersinia pestis nov 90.71% 0.0000% 0.0000% 0.0000% 0.0000% Prevotella veroralis nov 97.35% 0.0000% 0.0000% 0.0000% 0.0000% Capnocytophaga sp. oral taxon 338 0.0000% 0.0000% 0.0000% 0.0000% Peptostreptococcaceae [G] sp. Oral Taxon B17 0.0000% 0.0000% 0.0000% 0.0000% Afipia sp. genosp. 4 nov 89.52% 0.0000% 0.0000% 0.0000% 0.0000% Lachnospiraceae [G] sp. Oral Taxon A17 0.0000% 0.0000% 0.0000% 0.0000% Porphyromonas pasteri 0.0000% 0.0000% 0.0000% 0.0000% Leptotrichia sp. oral taxon 221 nov 97.39% 0.0000% 0.0000% 0.0000% 0.0000% Ralstonia sp. oral taxon 406 0.0000% 0.0000% 0.0000% 0.0000% Bifidobacterium dentium nov 97.67% 0.0000% 0.0000% 0.0000% 0.0000% Treponema parvum 0.0000% 0.0000% 0.0000% 0.0000% Pyramidobacter piscolens 0.0000% 0.0000% 0.0000% 0.0000% Acinetobacter sp. Oral Taxon C13 0.0000% 0.0000% 0.0000% 0.0000% Lactobacillus paracasei 0.0000% 0.0000% 0.0000% 0.0209% Peptococcus sp. oral taxon 168 nov 97.84% 0.0000% 0.0000% 0.0000% 0.0000% Campylobacter ureolyticus 0.0000% 0.0000% 0.0370% 0.0000% Corynebacterium pseudodiphtheriticum 0.0000% 0.0000% 0.0000% 0.0000% Bergeyella sp. oral taxon 900 0.0109% 0.0000% 0.0000% 0.0000% Fusobacterium nucleatum subsp. nucleatum nov 97.65% 0.0000% 0.0000% 0.0000% 0.0000% Gemella sanguinis nov 78.43% 0.0000% 0.0000% 0.0000% 0.0000% Megasphaera sp. oral taxon 123 0.0000% 0.0000% 0.0000% 0.0522% Peptoniphilus coxii 0.0000% 0.0000% 0.0000% 0.0000% Treponema sp. oral taxon 230 0.0000% 0.0000% 0.0000% 0.0000% Bergeyella sp. oral taxon 931 0.0000% 0.0000% 0.0000% 0.0000% Selenomonas sp. oral taxon 138 0.0000% 0.0000% 0.0000% 0.0000% Peptostreptococcaceae [XI][G-6] [Eubacterium] nodatum 0.0000% 0.0000% 0.0000% 0.0000% Selenomonas sp. oral taxon 892 nov 97.26% 0.0000% 0.0000% 0.0000% 0.0000% Sphingomonas sp. oral taxon 004 nov 95.40% 0.0000% 0.0000% 0.0000% 0.0000% Rheinheimera mesophila 0.0000% 0.0000% 0.0000% 0.0000% Yersinia kristensenii 0.0000% 0.0000% 0.0000% 0.0000% Treponema sp. oral taxon 258 0.0000% 0.0000% 0.0000% 0.0000% Salmonella multispecies spp25 3 0.0000% 0.0000% 0.0493% 0.0000% Methylobacterium persicinum 0.0000% 0.0000% 0.0000% 0.0000% Anaerococcus prevotii nov 77.91% 0.0000% 0.0000% 0.0000% 0.0000% Nocardioides exalbidus 0.0000% 0.0000% 0.0000% 0.0000% Prevotella sp. oral taxon 305 0.0109% 0.0000% 0.0000% 0.0000% Finegoldia magna 0.0000% 0.0000% 0.0000% 0.0313% Corynebacterium mucifaciens nov 92.39% 0.0000% 0.0000% 0.0000% 0.0000% Corynebacterium tuscaniense nov 97.01% 0.0000% 0.0000% 0.0000% 0.0000% Propionibacterium sp. oral taxon 193 0.0000% 0.0000% 0.0000% 0.0000% Capnocytophaga sp. oral taxon 338 nov 84.95% 0.0000% 0.0000% 0.0000% 0.0000% Eubacterium limosum 0.0000% 0.0000% 0.0000% 0.0000% Actinomyces sp. oral taxon 897 0.0000% 0.0000% 0.0000% 0.0000% Peptoniphilus indolicus 0.0000% 0.0000% 0.0000% 0.0209% Bergeyella sp. oral taxon 931 nov 92.95% 0.0000% 0.0000% 0.0000% 0.0000% Flavitalea sp. oral taxon 320 nov 87.12% 0.0000% 0.0000% 0.0000% 0.0000% Afipia broomeae nov 95.88% 0.0000% 0.0000% 0.0000% 0.0000% Erythrobacter gaetbuli 0.0000% 0.0000% 0.0000% 0.0000% Chitinibacter tainanensis 0.0000% 0.0000% 0.0000% 0.0000% Capnocytophaga sputigena nov 97.08% 0.0000% 0.0000% 0.0000% 0.0000% Gemella haemolysans nov 96.39% 0.0000% 0.0000% 0.0000% 0.0000% Desulfobulbus sp. oral taxon 041 0.0000% 0.0000% 0.0000% 0.0000% Lactobacillus nasuensis nov 79.74% 0.0000% 0.0000% 0.0000% 0.0000% Leptotrichia sp. oral taxon 417 nov 97.39% 0.0000% 0.0000% 0.0000% 0.0000% Gardnerella vaginalis 0.0000% 0.0000% 0.0000% 0.0000% Caulobacter sp. oral taxon 002 nov 82.38% 0.0000% 0.0000% 0.0000% 0.0000% Aureimonas frigidaquae 0.0000% 0.0000% 0.0000% 0.0000% Pseudomonas otitidis nov 88.55% 0.0000% 0.0000% 0.0000% 0.0000% Pseudomonas pseudoalcaligenes nov 97.31% 0.0000% 0.0000% 0.0000% 0.0000% Pseudomonas stutzeri Oral Taxon A68 0.0000% 0.0000% 0.0000% 0.0000% Fervidobacterium islandicum 0.0000% 0.0000% 0.0000% 0.0000% Leptothrix sp. oral taxon 025 nov 88.39% 0.0000% 0.0000% 0.0000% 0.0000% Oribacterium sp. oral taxon 102 nov 96.45% 0.0000% 0.0000% 0.0000% 0.0000% Prevotella oralis 0.0000% 0.0000% 0.0000% 0.0000% Leptotrichia sp. oral taxon 392 nov 95.07% 0.0000% 0.0000% 0.0000% 0.0000% Sneathia amnii [NVP] nov 82.75% 0.0000% 0.0000% 0.0000% 0.0000% Propionigenium modestum nov 87.53% 0.0000% 0.0000% 0.0000% 0.0000% Haemophilus influenzae 0.0000% 0.0000% 0.0000% 0.0000% Peptostreptococcus anaerobius 0.0000% 0.0000% 0.0000% 0.0313% Actinobaculum sp. oral taxon 183 0.0000% 0.0000% 0.0000% 0.0000% Prevotella micans 0.0109% 0.0000% 0.0000% 0.0000% Paracoccus sediminis 0.0000% 0.0000% 0.0000% 0.0000% Bifidobacterium breve 0.0000% 0.0000% 0.0000% 0.0000% Angustibacter luteus nov 77.94% 0.0000% 0.0000% 0.0000% 0.0417% Atopobium rimae nov 97.86% 0.0000% 0.0000% 0.0000% 0.0417% Prevotella oulorum nov 95.74% 0.0000% 0.0000% 0.0000% 0.0417% Prevotella sp. oral taxon 292 0.0000% 0.0000% 0.0000% 0.0417% Bergeyella sp. oral taxon 322 nov 95.53% 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus sp. oral taxon 070 nov 94.02% 0.0000% 0.0000% 0.0000% 0.0000% Prevotella sp. oral taxon 309 0.0109% 0.0000% 0.0000% 0.0000% Alishewanella agri 0.0000% 0.0000% 0.0000% 0.0000% Prevotella salivae nov 97.97% 0.0000% 0.0000% 0.0000% 0.0000% Sphingomonas sp. oral taxon 004 nov 96.54% 0.0000% 0.0000% 0.0000% 0.0000% Selenomonas sp. oral taxon 136 0.0000% 0.0000% 0.0000% 0.0209% Streptococcus sobrinus 0.0000% 0.0000% 0.0000% 0.0000% Kocuria sp. oral taxon 189 nov 92.48% 0.0000% 0.0000% 0.0000% 0.0000% Rothia mucilaginosa nov 94.54% 0.0000% 0.0000% 0.0000% 0.0000% Rhodopirellula baltica nov 88.28% 0.0000% 0.0000% 0.0000% 0.0000% Methylobacterium platani 0.0000% 0.0000% 0.0000% 0.0000% Hippea alviniae nov 77.65% 0.0000% 0.0000% 0.0000% 0.0000% Leptothrix sp. oral taxon 025 nov 90.26% 0.0000% 0.0000% 0.0000% 0.0000% Cardiobacterium hominis nov 84.90% 0.0000% 0.0000% 0.0000% 0.0000% Salmonella multispecies spp8 5 0.0000% 0.0000% 0.0000% 0.0000% Acinetobacter baumannii nov 95.14% 0.0000% 0.0000% 0.0000% 0.0000% Selenomonas sp. oral taxon 137 0.0000% 0.0000% 0.0000% 0.0000% Selenomonas sp. oral taxon 481 0.0000% 0.0000% 0.0000% 0.0000% Acinetobacter sp. Oral Taxon C99 0.0000% 0.0000% 0.0000% 0.0000% Serratia proteamaculans 0.0000% 0.0000% 0.0000% 0.0000% Flavitalea sp. oral taxon 320 nov 86.79% 0.0000% 0.0000% 0.0000% 0.0000% multigenus multispecies spp20 2 0.0000% 0.0000% 0.0370% 0.0000% Actinobaculum sp. oral taxon 848 nov 93.89% 0.0000% 0.0000% 0.0000% 0.0000% Granulicatella adiacens nov 79.80% 0.0000% 0.0000% 0.0000% 0.0313% Fusobacterium nucleatum subsp. polymorphum nov 95.60% 0.0000% 0.0000% 0.0000% 0.0000% Actinomyces dentalis 0.0000% 0.0000% 0.0000% 0.0000% Microbacterium flavescens nov 87.21% 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus parasanguinis II nov 85.80% 0.0000% 0.0000% 0.0000% 0.0000% Veillonella denticariosi 0.0000% 0.0000% 0.0000% 0.0000% Lysinibacillus fusiformis nov 87.10% 0.0000% 0.0000% 0.0000% 0.0000% Selenomonas sp. oral taxon 937 0.0000% 0.0000% 0.0000% 0.0000% Gemella sp. oral taxon 928 0.0000% 0.0000% 0.0000% 0.0000% Cronobacter sakazakii nov 85.80% 0.0000% 0.0000% 0.0000% 0.0000% Peptostreptococcaceae [XI][G-4] multispecies spp26 2 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus downei nov 80.69% 0.0000% 0.0000% 0.0000% 0.0000% Peptococcus sp. oral taxon 167 nov 78.48% 0.0000% 0.0000% 0.0000% 0.0000% Peptococcus sp. oral taxon 167 nov 94.35% 0.0000% 0.0000% 0.0000% 0.0000% Sphingomonas sp. oral taxon 004 nov 94.02% 0.0000% 0.0000% 0.0000% 0.0000% Peptoniphilus lacrimalis 0.0000% 0.0000% 0.0000% 0.0104% Corynebacterium singulare 0.0000% 0.0000% 0.0000% 0.0000% Capnocytophaga sp. oral taxon 324 0.0000% 0.0000% 0.0000% 0.0000% Olsenella sp. oral taxon 809 nov 89.41% 0.0000% 0.0000% 0.0000% 0.0000% Cellulophaga algicola nov 83.89% 0.0000% 0.0000% 0.0000% 0.0000% Parvimonas micra nov 92.39% 0.0000% 0.0000% 0.0000% 0.0000% Actinomyces odontolyticus nov 90.61% 0.0000% 0.0000% 0.0000% 0.0000% Fusobacterium nucleatum 0.0000% 0.0000% 0.0000% 0.0000% Veillonellaceae [G-1] sp. oral taxon 132 0.0000% 0.0000% 0.0000% 0.0000% Staphylococcus lentus 0.0000% 0.0000% 0.0000% 0.0000% Lactobacillus iners 0.0000% 0.0000% 0.0000% 0.0000% Firmicutes [G] sp. Oral Taxon A55 nov 82.39% 0.0000% 0.0000% 0.0000% 0.0000% Rhizobium loti nov 85.98% 0.0000% 0.0000% 0.0000% 0.0000% Sphingomonas ginsengisoli An et al. 2013 0.0000% 0.0000% 0.0000% 0.0000% Acinetobacter guangdongensis 0.0000% 0.0000% 0.0000% 0.0000% Stenotrophomonas maltophilia nov 92.90% 0.0000% 0.0000% 0.0000% 0.0000% Dietzia cinnamea nov 93.21% 0.0000% 0.0000% 0.0000% 0.0000% Treponema amylovorum 0.0000% 0.0000% 0.0000% 0.0000% Fretibacterium sp. oral taxon 362 0.0000% 0.0000% 0.0000% 0.0000% Leptothrix sp. oral taxon 025 nov 79.43% 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus pyogenes nov 89.88% 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus sp. oral taxon 423 nov 82.84% 0.0000% 0.0000% 0.0000% 0.0000% Leptotrichia sp. oral taxon 215 nov 95.27% 0.0000% 0.0000% 0.0000% 0.0000% Leptotrichia sp. oral taxon 225 nov 96.97% 0.0000% 0.0000% 0.0000% 0.0000% Haemophilus parainfluenzae nov 96.94% 0.0000% 0.0000% 0.0000% 0.0000% Corynebacterium argentoratense 0.0326% 0.0000% 0.0000% 0.0000% Sphingobacterium multivorum 0.0000% 0.0000% 0.0000% 0.0000% Enterococcus faecalis 0.0000% 0.0000% 0.0000% 0.0000% Sphingomonas echinoides nov 84.75% 0.0000% 0.0000% 0.0000% 0.0000% Erysipelotrichaceae [G-1] sp. oral taxon 905 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus peroris 0.0000% 0.0000% 0.0000% 0.0000% Capnocytophaga sputigena nov 95.63% 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus agalactiae nov 95.62% 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus constellatus nov 97.83% 0.0000% 0.0000% 0.0000% 0.0313% Streptococcus sp. oral taxon 057 nov 80.79% 0.0000% 0.0000% 0.0000% 0.0313% Ruminoclostridium papyrosolvens nov 78.12% 0.0000% 0.0000% 0.0000% 0.0000% Selenomonas sp. oral taxon 442 0.0000% 0.0000% 0.0000% 0.0000% Selenomonas sputigena nov 92.91% 0.0000% 0.0000% 0.0000% 0.0000% Yersinia pestis nov 94.70% 0.0000% 0.0000% 0.0000% 0.0000% Prevotella sp. oral taxon 304 0.0000% 0.0000% 0.0000% 0.0000% Leptotrichia sp. oral taxon 215 nov 95.49% 0.0000% 0.0000% 0.0000% 0.0000% Dietzia cinnamea nov 91.04% 0.0000% 0.0000% 0.0000% 0.0000% Peptostreptococcaceae [XI][G-1] sp. oral taxon 383 0.0000% 0.0000% 0.0000% 0.0000% Propionibacterium avidum 0.0000% 0.0000% 0.0000% 0.0000% Spirosoma linguale nov 87.08% 0.0000% 0.0000% 0.0000% 0.0000% Sphingomonas multispecies spp32 2 0.0000% 0.0000% 0.0000% 0.0000% Bdellovibrio sp. oral taxon 039 nov 78.66% 0.0000% 0.0000% 0.0000% 0.0000% Salinicola zeshunii 0.0000% 0.0000% 0.0000% 0.0000% Fusobacterium gonidiaformans nov 88.37% 0.0000% 0.0000% 0.0000% 0.0000% Capnocytophaga leadbetteri nov 96.64% 0.0000% 0.0000% 0.0000% 0.0000% Kocuria sp. oral taxon 189 nov 91.14% 0.0000% 0.0298% 0.0000% 0.0000% Lactobacillus jensenii nov 83.24% 0.0000% 0.0298% 0.0000% 0.0000% Pseudomonas aeruginosa nov 94.68% 0.0000% 0.0298% 0.0000% 0.0000% Treponema sp. oral taxon 270 0.0000% 0.0000% 0.0000% 0.0000% Propionibacterium acidifaciens nov 96.37% 0.0000% 0.0000% 0.0000% 0.0000% Paludibacter propionicigenes nov 78.96% 0.0000% 0.0000% 0.0000% 0.0000% Porphyromonas asaccharolytica 0.0000% 0.0000% 0.0000% 0.0000% Porphyromonas endodontalis nov 93.36% 0.0000% 0.0000% 0.0000% 0.0000% Seonamhaeicola aphaedonensis nov 79.16% 0.0000% 0.0000% 0.0000% 0.0000% Blautia luti 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus parasanguinis II nov 91.37% 0.0000% 0.0000% 0.0000% 0.0000% Haemophilus parainfluenzae nov 95.29% 0.0000% 0.0000% 0.0000% 0.0000% Peptostreptococcaceae [XI][G-1] [Eubacterium] sulci 0.0000% 0.0000% 0.0000% 0.0000% Kocuria sp. oral taxon 189 nov 95.56% 0.0000% 0.0000% 0.0000% 0.0000% Selenomonas sp. oral taxon 936 nov 96.65% 0.0000% 0.0000% 0.0000% 0.0000% Bacteroidetes [G-5] sp. oral taxon 511 nov 97.71% 0.0000% 0.0000% 0.0000% 0.0000% Capnocytophaga leadbetteri nov 96.62% 0.0000% 0.0000% 0.0000% 0.0000% Gemella haemolysans nov 94.61% 0.0000% 0.0000% 0.0000% 0.0000% Peptococcus sp. oral taxon 168 nov 80.08% 0.0000% 0.0000% 0.0000% 0.0000% Staphylococcus warneri nov 93.82% 0.0000% 0.0000% 0.0000% 0.0000% Anaerococcus octavius 0.0000% 0.0000% 0.0000% 0.0000% Fusobacterium multispecies spp5 2 0.0000% 0.0000% 0.0000% 0.0000% Kocuria sp. oral taxon 189 nov 86.12% 0.0000% 0.0000% 0.0000% 0.0000% Firmicutes [G] sp. Oral Taxon C68 nov 84.55% 0.0000% 0.0000% 0.0000% 0.0000% Peptoniphilus sp. Oral Taxon A87 0.0000% 0.0000% 0.0000% 0.0000% Capnocytophaga sputigena nov 96.65% 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus pyogenes nov 93.55% 0.0000% 0.0000% 0.0000% 0.0000% Leptotrichia sp. oral taxon 219 nov 88.21% 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus cristatus nov 83.99% 0.0000% 0.0000% 0.0000% 0.0000% Deinococcus sp. Oral Taxon C45 nov 89.38% 0.0000% 0.0000% 0.0000% 0.0000% Anaerolineae [G-1] sp. oral taxon 439 0.0000% 0.0000% 0.0000% 0.0000% Prevotella sp. oral taxon 942 nov 91.56% 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus sp. oral taxon 431 nov 97.17% 0.0000% 0.0000% 0.0000% 0.0000% Clostridiales [G] sp. Oral Taxon C07 nov 80.51% 0.0000% 0.0000% 0.0000% 0.0000% Stomatobaculum sp. oral taxon 910 0.0000% 0.0000% 0.0000% 0.0000% Peptococcus sp. oral taxon 167 nov 87.40% 0.0000% 0.0000% 0.0000% 0.0000% Megasphaera sp. oral taxon 841 nov 85.60% 0.0000% 0.0000% 0.0000% 0.0000% Leptotrichia sp. oral taxon 221 nov 97.84% 0.0000% 0.0000% 0.0000% 0.0000% Dietzia cinnamea nov 79.57% 0.0000% 0.0000% 0.0000% 0.0000% Streptomyces rhizophilus 0.0000% 0.0000% 0.0000% 0.0000% Afipia sp. genosp. 4 nov 89.16% 0.0000% 0.0000% 0.0000% 0.0000% Prevotella denticola nov 97.96% 0.0000% 0.0000% 0.0000% 0.0000% Bacteroidetes [G-3] sp. oral taxon 436 0.0000% 0.0000% 0.0000% 0.0000% Oribacterium parvum nov 81.05% 0.0000% 0.0000% 0.0247% 0.0000% Enterobacter hormaechei nov 90.93% 0.0000% 0.0000% 0.0247% 0.0000% Prevotella oulorum nov 89.60% 0.0000% 0.0000% 0.0000% 0.0000% Klebsiella variicola 0.0000% 0.0000% 0.0000% 0.0000% Actinomyces sp. oral taxon 178 0.0000% 0.0000% 0.0000% 0.0000% Gemella haemolysans nov 82.23% 0.0000% 0.0000% 0.0000% 0.0000% Olsenella sp. Oral Taxon C46 0.0000% 0.0000% 0.0000% 0.0104% Eikenella sp. oral taxon 011 nov 90.38% 0.0000% 0.0000% 0.0000% 0.0000% Proteus sp. Oral Taxon C50 0.0000% 0.0000% 0.0000% 0.0000% Corynebacterium mucifaciens nov 95.26% 0.0000% 0.0000% 0.0000% 0.0000% Corynebacterium urealyticum nov 95.76% 0.0000% 0.0000% 0.0000% 0.0000% Mycobacterium neoaurum nov 90.61% 0.0000% 0.0000% 0.0000% 0.0000% Alloprevotella tannerae nov 93.17% 0.0000% 0.0000% 0.0000% 0.0000% Centipeda periodontii nov 97.45% 0.0000% 0.0000% 0.0000% 0.0000% Fusobacterium nucleatum subsp. polymorphum nov 90.83% 0.0000% 0.0000% 0.0000% 0.0000% Fusobacterium nucleatum subsp. polymorphum nov 96.48% 0.0000% 0.0000% 0.0000% 0.0000% Fusobacterium nucleatum subsp. polymorphum nov 97.57% 0.0000% 0.0000% 0.0000% 0.0000% Treponema sp. Oral Taxon G85 0.0000% 0.0000% 0.0000% 0.0000% Selenomonas sp. oral taxon 920 0.0000% 0.0000% 0.0000% 0.0000% Leptotrichia sp. oral taxon 879 nov 91.86% 0.0000% 0.0000% 0.0000% 0.0000% Leptotrichia sp. oral taxon 215 nov 95.06% 0.0217% 0.0000% 0.0000% 0.0000% Hydrogenophilus islandicus nov 81.84% 0.0217% 0.0000% 0.0000% 0.0000% Haemophilus parainfluenzae nov 96.75% 0.0000% 0.0000% 0.0000% 0.0000% Moraxella sp. Oral Taxon B07 0.0217% 0.0000% 0.0000% 0.0000% Centipeda periodontii 0.0000% 0.0000% 0.0000% 0.0000% Veillonella atypica nov 97.06% 0.0000% 0.0000% 0.0000% 0.0000% Prevotella bivia nov 96.73% 0.0000% 0.0000% 0.0000% 0.0209% Prevotella veroralis nov 96.16% 0.0000% 0.0000% 0.0000% 0.0209% Streptococcus sp. oral taxon 064 nov 83.53% 0.0000% 0.0000% 0.0000% 0.0209% Streptococcus sp. oral taxon 074 nov 81.87% 0.0000% 0.0000% 0.0000% 0.0209% Streptococcus tigurinus nov 94.81% 0.0000% 0.0000% 0.0000% 0.0209% Shuttleworthia satelles nov 94.86% 0.0000% 0.0000% 0.0000% 0.0209% Actinomyces gerencseriae 0.0000% 0.0000% 0.0000% 0.0000% Actinomyces johnsonii 0.0000% 0.0000% 0.0000% 0.0000% Prevotella nigrescens nov 92.11% 0.0000% 0.0000% 0.0000% 0.0000% Butyrivibrio sp. oral taxon 455 0.0000% 0.0000% 0.0000% 0.0000% Klebsiella aerogenes 0.0000% 0.0000% 0.0000% 0.0000% Klebsiella quasipneumoniae 0.0000% 0.0000% 0.0000% 0.0000% Methylobacterium radiotolerans 0.0000% 0.0000% 0.0000% 0.0000% Capnocytophaga leadbetteri nov 97.26% 0.0000% 0.0000% 0.0000% 0.0000% Granulicatella adiacens nov 94.40% 0.0000% 0.0000% 0.0000% 0.0000% Mogibacterium diversum nov 97.52% 0.0000% 0.0000% 0.0000% 0.0000% Synechococcus sp. str. CC9902 0.0000% 0.0000% 0.0000% 0.0000% Lactobacillus acidophilus 0.0000% 0.0000% 0.0000% 0.0000% Ruminococcaceae [G-1] sp. oral taxon 075 0.0000% 0.0000% 0.0000% 0.0000% Selenomonas sp. oral taxon 478 0.0000% 0.0000% 0.0000% 0.0000% Achromobacter pulmonis 0.0000% 0.0000% 0.0000% 0.0000% Klebsiella pneumoniae nov 97.33% 0.0000% 0.0000% 0.0000% 0.0000% multigenus multispecies spp12 2 0.0000% 0.0000% 0.0000% 0.0000% multigenus multispecies spp14 3 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus mutans nov 81.89% 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus sp. oral taxon 061 nov 82.87% 0.0000% 0.0000% 0.0000% 0.0000% Mogibacterium multispecies sppn1 2 nov 91.38% 0.0000% 0.0000% 0.0000% 0.0000% Prevotella pallens nov 97.56% 0.0000% 0.0000% 0.0000% 0.0000% Prevotella sp. oral taxon 475 nov 97.76% 0.0000% 0.0000% 0.0000% 0.0000% Gemella sanguinis nov 81.71% 0.0000% 0.0000% 0.0000% 0.0000% Aggregatibacter sp. oral taxon 949 0.0000% 0.0000% 0.0000% 0.0000% Leptotrichia sp. oral taxon 219 nov 86.68% 0.0000% 0.0000% 0.0000% 0.0000% Fusobacterium sp. oral taxon 205 0.0000% 0.0000% 0.0000% 0.0000% Erwinia billingiae 0.0000% 0.0000% 0.0000% 0.0000% Treponema sp. oral taxon 517 0.0000% 0.0000% 0.0000% 0.0000% Butyrivibrio sp. oral taxon 080 0.0000% 0.0000% 0.0000% 0.0000% Veillonellaceae [G-1] sp. oral taxon 129 0.0000% 0.0000% 0.0000% 0.0000% Brachybacterium sp. Oral Taxon D23 0.0000% 0.0000% 0.0000% 0.0000% Corynebacterium pilbarense 0.0000% 0.0000% 0.0000% 0.0000% Rubellimicrobium roseum 0.0000% 0.0000% 0.0000% 0.0000% Roseomonas cervicalis 0.0000% 0.0000% 0.0000% 0.0000% Novosphingobium arabidopsis 0.0000% 0.0000% 0.0000% 0.0000% Stenotrophomonas rhizophila 0.0000% 0.0000% 0.0000% 0.0000% Actinomyces georgiae 0.0000% 0.0000% 0.0000% 0.0000% Sphingomonas mucosissima 0.0000% 0.0000% 0.0000% 0.0000% Pseudomonas stutzeri 0.0000% 0.0000% 0.0000% 0.0000% Prevotella sp. oral taxon 301 0.0000% 0.0000% 0.0000% 0.0000% Fusobacterium nucleatum ss vincentii 0.0000% 0.0000% 0.0000% 0.0000% Rothia mucilaginosa nov 97.25% 0.0000% 0.0000% 0.0000% 0.0000% Nitrosomonas marina nov 86.57% 0.0000% 0.0000% 0.0000% 0.0000% Kocuria sp. oral taxon 189 0.0000% 0.0000% 0.0000% 0.0000% Lachnoanaerobaculum sp. oral taxon 083 0.0000% 0.0000% 0.0000% 0.0000% Aquabacterium citratiphilum 0.0000% 0.0000% 0.0000% 0.0000% Pedobacter nutrimenti 0.0000% 0.0000% 0.0000% 0.0000% Sphingomonas oligophenolica 0.0000% 0.0000% 0.0000% 0.0000% Methyloversatilis universalis 0.0000% 0.0000% 0.0000% 0.0000% Prevotella multisaccharivorax 0.0000% 0.0000% 0.0000% 0.0000% Prevotella sp. oral taxon 515 0.0000% 0.0000% 0.0000% 0.0000% Gemella haemolysans nov 94.62% 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus pyogenes nov 94.19% 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus sp. str. 2136FAA 0.0000% 0.0000% 0.0000% 0.0000% Haemophilus parainfluenzae nov 96.95% 0.0000% 0.0000% 0.0000% 0.0000% Porphyromonas catoniae nov 80.44% 0.0000% 0.0000% 0.0000% 0.0000% Prevotella denticola nov 92.71% 0.0000% 0.0000% 0.0000% 0.0000% Faecalibacterium prausnitzii nov 76.94% 0.0000% 0.0000% 0.0000% 0.0000% Leptotrichia sp. oral taxon 879 nov 95.21% 0.0000% 0.0000% 0.0000% 0.0000% Capnocytophaga ochracea 0.0000% 0.0000% 0.0000% 0.0000% Bacteroides fragilis 0.0000% 0.0000% 0.0000% 0.0000% Corynebacterium mucifaciens nov 91.63% 0.0000% 0.0000% 0.0000% 0.0000% Staphylococcus sp. clonebottae7 0.0000% 0.0000% 0.0000% 0.0000% Stomatobaculum sp. oral taxon 097 nov 95.05% 0.0000% 0.0000% 0.0000% 0.0000% Methylobacterium variabile 0.0000% 0.0000% 0.0000% 0.0000% Porphyrobacter tepidarius 0.0000% 0.0000% 0.0000% 0.0000% Pseudomonas umsongensis 0.0000% 0.0000% 0.0000% 0.0000% Calycanthus floridus Oral Taxon D07 0.0000% 0.0000% 0.0000% 0.0000% Leptotrichia sp. oral taxon 879 0.0000% 0.0000% 0.0000% 0.0000% Prevotella disiens 0.0000% 0.0000% 0.0000% 0.0000% Sphingobacterium detergens 0.0000% 0.0000% 0.0000% 0.0000% Salmonella Newport ss enterica 0.0000% 0.0000% 0.0123% 0.0000% TM7 [G-4] sp. oral taxon 355 0.0000% 0.0000% 0.0123% 0.0000% Leuconostoc pseudomesenteroides Oral Taxon A60 0.0000% 0.0000% 0.0000% 0.0000% Corynebacterium macginleyi 0.0000% 0.0000% 0.0000% 0.0000% Kingella sp. oral taxon 012 0.0000% 0.0000% 0.0000% 0.0000% Dietzia cinnamea 0.0000% 0.0000% 0.0000% 0.0000% Prevotella timonensis 0.0000% 0.0000% 0.0000% 0.0000% Catonella sp. oral taxon 164 0.0000% 0.0000% 0.0000% 0.0000% Veillonellaceae [G-1] sp. oral taxon 135 0.0000% 0.0000% 0.0000% 0.0000% Treponema sp. oral taxon 249 0.0000% 0.0000% 0.0000% 0.0000% Micrococcus sp. Oral Taxon B64 0.0000% 0.0000% 0.0000% 0.0000% Prevotella sp. Oral Taxon B62 0.0000% 0.0000% 0.0000% 0.0000% Paracoccus koreensis 0.0000% 0.0000% 0.0000% 0.0000% Neisseria meningitidis 0.0000% 0.0000% 0.0000% 0.0000% Prevotella sp. Oral Taxon D21 0.0000% 0.0000% 0.0000% 0.0000% Prevotella sp. oral taxon 376 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus lutetiensis 0.0000% 0.0000% 0.0000% 0.0000% Pseudoramibacter alactolyticus nov 93.79% 0.0000% 0.0000% 0.0000% 0.0000% Sneathia sanguinegens nov 84.06% 0.0000% 0.0000% 0.0000% 0.0000% Dialister sp. oral taxon 119 0.0000% 0.0000% 0.0000% 0.0104% Dialister propionicifaciens 0.0000% 0.0000% 0.0000% 0.0104% Selenomonas sp. Oral Taxon F98 0.0000% 0.0000% 0.0000% 0.0000% Selenomonas sp. oral taxon 146 0.0000% 0.0000% 0.0000% 0.0000% Selenomonas sp. oral taxon 149 0.0000% 0.0000% 0.0000% 0.0000% Treponema sp. oral taxon 236 0.0000% 0.0000% 0.0000% 0.0000% Treponema sp. oral taxon 238 0.0000% 0.0000% 0.0000% 0.0000% Actinomyces sp. Oral Taxon 171 0.0000% 0.0000% 0.0000% 0.0000% Sphingomonas sanguinis 0.0000% 0.0000% 0.0000% 0.0000% Salmonella Agona ss enterica 0.0000% 0.0000% 0.0000% 0.0000% Raoultella ornithinolytica 0.0000% 0.0000% 0.0000% 0.0000% Klebsiella sp. Oral Taxon A36 0.0000% 0.0000% 0.0000% 0.0000% Haemophilus aegyptius 0.0000% 0.0000% 0.0000% 0.0000% Actinomyces turicensis 0.0000% 0.0000% 0.0000% 0.0000% Streptococcus lactarius 0.0000% 0.0000% 0.0000% 0.0000% Acinetobacter sp. Oral Taxon A58 0.0000% 0.0000% 0.0000% 0.0000% Actinomyces sp. Oral Taxon 180 0.0000% 0.0000% 0.0000% 0.0000% Cellulomonas cellulans Oral Taxon D36 0.0000% 0.0000% 0.0000% 0.0000% Prevotella nigrescens 0.0000% 0.0000% 0.0000% 0.0000% Brochothrix thermosphacta 0.0000% 0.0000% 0.0000% 0.0000% Atopobium sp. oral taxon 810 0.0000% 0.0000% 0.0000% 0.0000% Eubacterium [XI][G] sp. Oral Taxon B60 0.0000% 0.0000% 0.0000% 0.0000% Erysipelotrichaceae [G-1] sp. oral taxon 904 0.0000% 0.0000% 0.0000% 0.0000% TM7 [G-1] sp. oral taxon 348 0.0000% 0.0000% 0.0000% 0.0000% Cancer Cancer Cancer Cancer Cancer Cancer Cancer Cancer Cancer C5 C6 C7 C8 C9 C10 C11 C12 C14 19.9947% 0.0000% 22.2327% 6.0553% 0.0000% 4.6283% 0.0000% 0.0189% 0.4247% 6.4635% 0.0000% 3.8345% 3.5424% 30.1438% 3.1808% 33.9097% 9.8845% 0.0653% 0.4204% 0.1370% 2.6634% 0.4188% 0.1251% 5.2001% 0.0000% 0.3408% 0.2614% 0.0131% 0.0000% 0.0094% 0.0000% 0.0156% 0.0179% 0.0000% 30.2215% 0.0000% 0.0920% 52.6664% 0.4722% 0.0349% 3.1582% 0.0179% 0.0000% 0.0000% 28.0464% 19.8896% 0.0000% 13.6947% 11.2381% 0.0156% 0.0000% 0.0000% 0.0189% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 56.2009% 0.0000% 0.0000% 13.9497% 7.9217% 0.0000% 8.5946% 0.9947% 0.0156% 0.0000% 0.0000% 1.3823% 14.1130% 0.1839% 8.9757% 2.3706% 20.8010% 39.5247% 0.0000% 0.0000% 1.8178% 0.1307% 0.1051% 20.8633% 2.3045% 0.0000% 1.7355% 0.0000% 8.2525% 0.0000% 0.0327% 2.5355% 0.0457% 5.1851% 0.0175% 0.0000% 2.3231% 0.0141% 0.5302% 0.7514% 0.4335% 0.0000% 0.9728% 49.1406% 0.1094% 0.0179% 0.0281% 0.0000% 0.2940% 0.0657% 0.1713% 0.0283% 0.3403% 0.0000% 0.0179% 0.0000% 0.1515% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 3.8492% 0.0000% 0.0000% 0.0000% 10.3502% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0472% 0.0000% 0.0000% 0.0000% 13.9604% 0.0000% 0.0000% 5.5307% 0.0457% 1.2184% 0.2967% 0.0469% 0.5540% 0.0281% 1.9693% 0.4247% 0.8408% 0.1827% 0.0000% 0.0000% 0.0000% 0.2323% 0.2531% 0.0000% 4.6553% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0379% 0.0000% 0.8539% 0.0000% 0.0189% 0.0000% 0.0000% 1.1079% 0.0000% 0.0000% 0.0653% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2680% 0.0000% 0.0379% 0.0000% 0.0000% 0.0114% 0.0094% 0.0087% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0657% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0131% 0.0000% 0.5572% 0.0524% 0.0000% 0.8935% 0.0000% 0.0000% 0.0000% 0.0525% 0.0000% 0.0000% 0.0000% 0.2971% 0.0000% 0.0000% 11.8538% 0.0000% 0.0131% 0.0000% 0.0000% 0.0000% 0.0000% 2.2159% 0.0562% 0.0000% 0.1633% 0.2365% 0.0000% 2.0684% 0.2879% 0.0938% 1.9478% 0.0000% 0.5491% 3.9856% 10.5229% 0.0228% 0.9067% 0.0000% 0.0000% 0.1966% 0.0000% 0.0000% 0.2614% 0.1576% 0.0000% 0.3306% 0.1134% 0.7036% 0.0179% 0.0141% 0.0000% 5.1127% 0.0000% 0.0000% 0.5478% 0.0960% 2.9393% 0.2323% 0.0000% 0.0000% 0.0327% 0.0394% 0.0114% 0.1133% 1.2913% 0.0000% 0.2502% 0.0000% 0.1326% 0.0490% 0.0000% 0.0000% 0.0094% 0.0000% 0.0000% 0.5182% 0.0000% 0.0379% 0.2123% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 1.9438% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 23.2910% 0.0000% 1.1298% 0.0000% 0.0378% 0.6195% 0.7192% 0.0000% 0.0141% 0.0379% 0.0327% 0.0000% 0.0000% 0.0661% 0.0000% 0.0000% 0.0893% 0.0000% 0.0000% 0.0490% 0.0394% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0189% 0.0000% 0.0131% 0.0000% 0.0000% 0.0000% 0.0313% 0.0000% 0.0000% 0.0000% 0.0000% 0.3678% 0.0000% 0.7178% 0.4101% 0.0313% 0.0357% 0.0141% 1.9693% 0.0817% 0.1445% 0.0000% 1.1334% 0.0000% 0.0156% 0.0357% 0.0000% 0.0000% 0.0000% 0.0131% 0.0000% 0.0189% 0.0000% 0.0000% 0.1072% 0.0141% 0.0000% 0.0163% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1051% 0.0000% 0.0378% 0.0785% 0.0000% 0.0536% 0.0141% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0087% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0263% 1.0734% 3.8629% 0.0000% 1.5322% 0.0715% 0.0141% 1.5906% 0.3267% 0.3284% 0.0000% 0.0094% 0.0000% 0.0000% 0.0000% 0.0141% 0.0000% 0.0163% 0.1971% 0.0000% 0.0000% 0.0000% 0.0000% 0.2144% 0.0281% 0.0000% 0.0163% 0.0525% 0.0000% 2.1723% 0.0000% 0.0469% 0.1787% 0.0281% 0.0000% 0.4900% 0.6174% 0.0000% 0.0283% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.4410% 0.0131% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1051% 0.0114% 1.1806% 0.0000% 0.0000% 0.5182% 0.0000% 0.0000% 0.0327% 0.0000% 5.3786% 0.0472% 0.0000% 0.0000% 0.0000% 4.9065% 1.0225% 1.7478% 0.0131% 0.0228% 0.5950% 0.0436% 0.3127% 0.0536% 1.1809% 0.0000% 1.2414% 0.0263% 0.0000% 0.0472% 0.0000% 0.0000% 2.6269% 0.0000% 0.2272% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.4335% 0.0343% 0.4533% 0.0175% 0.0313% 0.0000% 0.0000% 0.1704% 0.0163% 0.0000% 0.0000% 0.8972% 0.0349% 0.0000% 0.1787% 0.0000% 0.0000% 0.0000% 0.0263% 0.0000% 0.0094% 0.0262% 0.0000% 0.0000% 0.0000% 0.0000% 0.0163% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0094% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0094% 0.0000% 0.0000% 0.0000% 0.0141% 0.0000% 0.0000% 0.0000% 0.0000% 0.0094% 0.0000% 0.0000% 0.0000% 0.0000% 0.0189% 0.0000% 7.9086% 0.0000% 0.1322% 0.2967% 0.0000% 0.0715% 0.0422% 0.2083% 0.1960% 0.0000% 0.2398% 0.0000% 0.0000% 0.0000% 0.0000% 10.0942% 0.0000% 0.0000% 0.0131% 0.0000% 0.0944% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 1.0578% 0.4101% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.4598% 0.0000% 0.0472% 0.0087% 0.0000% 0.2859% 0.0141% 0.0000% 0.0327% 0.0000% 0.0000% 3.7590% 0.0000% 0.1094% 1.6619% 0.0844% 0.0000% 0.0327% 0.0394% 0.0000% 0.7272% 0.0000% 0.0000% 0.2859% 0.0422% 0.0000% 0.3267% 0.0000% 0.0000% 0.0000% 0.0000% 3.4709% 0.0000% 0.0000% 0.0000% 0.0000% 0.0263% 0.0000% 0.0944% 0.0087% 0.0000% 0.0000% 0.0000% 0.0000% 0.0817% 0.0263% 0.0000% 0.6139% 0.0524% 0.0000% 0.1966% 0.0000% 0.2840% 0.0980% 0.0394% 0.0000% 0.0472% 0.0087% 0.0000% 0.0000% 0.0000% 0.0000% 0.0490% 0.0000% 0.0000% 0.0567% 0.0000% 0.0156% 0.1251% 8.2525% 0.0000% 0.0000% 0.1314% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0131% 0.0000% 0.0000% 0.0000% 0.0000% 0.0357% 0.0000% 2.3102% 0.0490% 0.0920% 0.0000% 0.7272% 0.1309% 0.1407% 0.0357% 0.2249% 0.0000% 0.1960% 0.0000% 0.0457% 0.4345% 0.0000% 0.0625% 0.0000% 0.0141% 0.2272% 0.0000% 0.0657% 0.4111% 0.0189% 0.0000% 0.0000% 0.0000% 0.0703% 0.7385% 1.9765% 0.0131% 0.0000% 0.4061% 0.0175% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1485% 0.1606% 0.0087% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0327% 0.0000% 0.0343% 0.0000% 0.0000% 0.0000% 0.0000% 4.2879% 0.0189% 0.0000% 0.0000% 0.0000% 0.0000% 0.0087% 0.0000% 0.1072% 0.0000% 0.0000% 0.0653% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 3.5119% 0.0000% 0.0000% 1.2467% 0.0000% 0.0000% 0.3753% 0.0703% 0.0000% 0.0653% 0.0657% 0.0000% 0.0000% 0.0000% 0.0000% 0.0357% 0.0141% 1.7042% 0.0980% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0357% 0.0000% 0.0000% 0.0000% 0.0000% 0.0114% 0.0472% 0.0175% 0.0000% 0.6433% 0.0000% 0.0757% 0.4084% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0189% 0.0000% 0.0000% 0.0799% 0.2172% 0.1483% 0.0000% 0.0179% 2.1650% 0.0000% 0.0980% 0.0263% 0.0000% 0.1606% 0.0000% 0.0000% 0.0000% 0.0000% 0.0189% 0.0000% 0.0525% 0.0000% 0.1889% 0.0000% 0.1094% 0.0000% 0.0000% 0.0379% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0131% 0.0000% 0.0472% 0.0000% 0.1094% 0.0000% 0.0141% 0.0379% 0.0327% 0.0788% 0.2170% 0.2833% 0.0087% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 5.6516% 0.0000% 0.0163% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0179% 0.0000% 0.0189% 0.0000% 1.1955% 0.0000% 0.0661% 0.0000% 0.0000% 0.3574% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0944% 0.0000% 0.0000% 0.0000% 0.0000% 0.2840% 0.0000% 0.0000% 0.0000% 0.0000% 0.0175% 0.0000% 0.0000% 0.0000% 0.0000% 0.0327% 0.0000% 0.0000% 0.0283% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0788% 0.2170% 0.5761% 0.0000% 0.0000% 0.2144% 0.0281% 1.0036% 0.0490% 0.0131% 0.0000% 0.3967% 0.0000% 0.0000% 0.0000% 0.1265% 0.0000% 0.0000% 0.0000% 0.0000% 0.3117% 0.0000% 0.0156% 0.0000% 0.0000% 0.0000% 0.2614% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0568% 0.0000% 0.0263% 0.0000% 0.0000% 0.0087% 0.0000% 0.0000% 0.0141% 0.0000% 0.0000% 0.3284% 0.0000% 0.0567% 0.0000% 0.0000% 0.0000% 0.0000% 0.4355% 0.0000% 0.0131% 0.0000% 0.2078% 0.0000% 0.0000% 0.0000% 0.0000% 0.5491% 0.0000% 0.1051% 0.0000% 0.0944% 0.2007% 0.0000% 0.0000% 0.0703% 0.1894% 0.0000% 0.0000% 0.1370% 0.0094% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0163% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 1.0186% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.5383% 0.5759% 0.0000% 0.0000% 0.0141% 0.0000% 0.0000% 0.0131% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0263% 0.0000% 0.0283% 0.0000% 0.0000% 0.0715% 0.0000% 0.1515% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0179% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0657% 0.0000% 0.0283% 0.0000% 0.0000% 0.0000% 0.3655% 0.0000% 0.0490% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0179% 0.0000% 0.0000% 0.0000% 0.0525% 0.0000% 0.0000% 0.3141% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1133% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 1.0127% 0.0131% 0.0114% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0163% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.3217% 0.0000% 0.0000% 1.1434% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0357% 0.0000% 0.0000% 0.0000% 0.0000% 1.2904% 0.4061% 0.0000% 0.0000% 0.0000% 0.0141% 0.0000% 0.5880% 0.0000% 0.0000% 0.7556% 0.8202% 0.0000% 0.0536% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1606% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0394% 0.0000% 0.0378% 0.0000% 0.0000% 1.2152% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0525% 0.0000% 0.0000% 0.0000% 0.9381% 0.0000% 0.0000% 0.0000% 1.8295% 0.0000% 0.0000% 0.0472% 0.0524% 0.0000% 0.0357% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0087% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.3796% 0.0000% 0.0000% 0.0263% 0.0114% 0.0000% 0.0000% 0.0000% 0.0715% 0.0000% 0.0000% 0.0327% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0490% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 1.9756% 0.1228% 0.0000% 0.0469% 0.0357% 0.0141% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2267% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1430% 0.0141% 0.0000% 0.0163% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0788% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0327% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0357% 0.0000% 0.0000% 0.0000% 0.0131% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0189% 0.0000% 0.0000% 0.0000% 0.2267% 0.0000% 0.0000% 0.4289% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.7684% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0094% 0.0000% 0.0000% 0.6791% 0.0000% 0.5681% 0.0000% 0.0000% 0.1142% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1430% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.3153% 0.0000% 0.0189% 0.0175% 0.0000% 0.4825% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.7505% 0.0000% 0.0000% 0.0000% 0.0131% 0.3083% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1633% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2102% 0.0000% 0.0000% 0.0087% 0.0000% 0.0000% 0.0000% 0.0000% 0.0817% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0131% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0189% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0657% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0263% 0.0000% 0.0094% 0.0000% 0.0625% 0.0715% 0.0844% 0.0000% 0.0000% 0.0263% 0.0114% 0.2456% 0.0175% 0.0000% 0.2859% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0094% 0.0000% 0.0000% 0.0179% 0.0000% 0.0000% 0.0000% 0.0263% 0.0000% 0.3683% 0.0000% 0.1094% 0.0000% 0.0000% 0.0000% 0.0490% 0.0131% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0817% 0.0000% 0.0000% 0.0000% 0.5759% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0179% 1.4059% 0.0000% 0.0000% 0.0000% 0.0114% 0.0000% 0.0000% 0.0000% 0.1430% 0.0141% 0.0000% 0.0653% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0394% 0.0000% 0.0094% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0189% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.7187% 0.0131% 0.0000% 0.0094% 0.0000% 0.0313% 0.0357% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 1.2414% 0.0000% 0.0000% 0.0000% 0.0000% 0.0156% 0.0000% 0.0141% 0.3977% 0.2123% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0263% 0.2398% 0.0283% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0817% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.3768% 0.0094% 0.0000% 0.0000% 0.1251% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0357% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0179% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.3753% 0.0000% 0.0000% 0.0163% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0131% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0189% 0.3267% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 1.2876% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0094% 0.0000% 0.0000% 0.0000% 0.6889% 0.0000% 0.4084% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 1.1298% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 1.0319% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1430% 0.1687% 0.0000% 0.1470% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.6395% 0.0283% 0.0000% 0.0000% 0.0000% 0.0000% 0.0189% 0.0000% 0.8933% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0189% 0.0000% 0.0000% 0.0357% 0.0141% 0.0189% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0357% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1606% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.5064% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0163% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.5572% 0.0000% 0.0000% 0.0357% 0.0281% 0.0000% 0.0000% 0.0131% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0131% 0.0228% 0.0000% 0.0000% 0.0156% 0.0000% 0.1125% 0.0000% 0.1470% 0.0000% 0.9250% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.3426% 0.0000% 0.0000% 0.0000% 0.0357% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1039% 0.0000% 0.0000% 0.0357% 0.0000% 0.0000% 0.6697% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0263% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2456% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0141% 0.0000% 0.0000% 0.0000% 0.0000% 0.1039% 0.0000% 0.0156% 0.0179% 0.0141% 0.0000% 0.0653% 0.0263% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.8142% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2078% 0.0000% 0.0000% 0.1966% 0.0000% 0.0189% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0131% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0131% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.6534% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0131% 0.0000% 0.0189% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1889% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.3430% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0394% 0.0114% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0228% 0.0000% 0.0000% 0.6410% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0799% 0.0283% 0.0000% 0.0156% 0.1608% 0.0000% 0.0000% 0.0653% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2323% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0179% 0.0000% 0.0000% 0.0000% 0.0394% 0.0000% 0.0189% 0.0000% 0.0000% 0.0000% 0.0141% 0.0000% 0.0163% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0131% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0327% 0.0131% 0.0000% 0.0094% 0.0000% 0.0000% 0.0000% 0.0141% 0.0000% 0.0000% 0.0131% 0.0000% 0.0472% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0327% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0343% 0.0000% 0.0000% 0.0000% 0.0357% 0.0000% 0.0000% 0.0000% 0.0525% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0536% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0228% 0.0283% 0.0000% 0.0000% 0.0000% 0.3655% 0.0000% 0.0817% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.5491% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2361% 0.0000% 0.0000% 0.0357% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1251% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.4204% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.4847% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0131% 0.0000% 0.4345% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0179% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2284% 0.0000% 0.0000% 0.0000% 0.1251% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0657% 0.0000% 0.0661% 0.0175% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0657% 0.0000% 0.0000% 0.0436% 0.0000% 0.0715% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1047% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0094% 0.0000% 0.0313% 0.1787% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.4110% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2502% 0.0000% 0.0000% 0.0000% 0.0657% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0490% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0283% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1143% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0131% 0.0000% 0.0000% 0.0000% 0.0000% 0.0179% 0.0000% 0.0000% 0.0327% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0281% 0.0000% 0.0327% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0536% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0281% 0.0189% 0.0000% 0.1971% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0281% 0.0000% 0.0000% 0.0000% 0.0000% 0.1889% 0.0000% 0.0469% 0.0000% 0.0000% 0.0000% 0.0817% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0283% 0.0436% 0.0000% 0.0000% 0.0000% 0.0000% 0.0490% 0.0131% 0.0000% 0.0000% 0.0000% 0.0000% 0.2144% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1322% 0.0000% 0.0000% 0.0893% 0.0000% 0.0000% 0.0163% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0661% 0.0000% 0.0000% 0.1251% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0653% 0.0000% 0.2512% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.3093% 0.0000% 0.0000% 0.0000% 0.3083% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0087% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0263% 0.0000% 0.0000% 0.0000% 0.0156% 0.0000% 0.0141% 0.0000% 0.0653% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0163% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0131% 0.1485% 0.0567% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0131% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1142% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0163% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0661% 0.0000% 0.0000% 0.0000% 0.1546% 0.0000% 0.0163% 0.0000% 0.0000% 0.0283% 0.0000% 0.0000% 0.0000% 0.2249% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1700% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0657% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0422% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0850% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0179% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0156% 0.0000% 0.1265% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0131% 0.1599% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0394% 0.0114% 0.0378% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0490% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0422% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0490% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2272% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0357% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0131% 0.0000% 0.0189% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0114% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0131% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1133% 0.0000% 0.0000% 0.0179% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0394% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0094% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0357% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0189% 0.0000% 0.0000% 0.0536% 0.0141% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0422% 0.0000% 0.0000% 0.0000% 0.0000% 0.1511% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0567% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0163% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1797% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0131% 0.0000% 0.0094% 0.0000% 0.0000% 0.0357% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0156% 0.1608% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0179% 0.0562% 0.0000% 0.0163% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0175% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0844% 0.0000% 0.0327% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1704% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0625% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1251% 0.0000% 0.0000% 0.0327% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1546% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0568% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1125% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0141% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1406% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0472% 0.0000% 0.0000% 0.0000% 0.0281% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1143% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1028% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1256% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0094% 0.0000% 0.0000% 0.0179% 0.0000% 0.0000% 0.0000% 0.0263% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0349% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1028% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1142% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0131% 0.0000% 0.0283% 0.0000% 0.0000% 0.0000% 0.0141% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0357% 0.0000% 0.0189% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0281% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1094% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0567% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0756% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0179% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0980% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0980% 0.0000% 0.0685% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0263% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0379% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0343% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0472% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0156% 0.0000% 0.0281% 0.0000% 0.0000% 0.0000% 0.0000% 0.0189% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0189% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0536% 0.0000% 0.0000% 0.0327% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0657% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0141% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0189% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0131% 0.0000% 0.0000% 0.0000% 0.0156% 0.0000% 0.0281% 0.0000% 0.0000% 0.0000% 0.0685% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0131% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0094% 0.0000% 0.0000% 0.0000% 0.0562% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0378% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0263% 0.0000% 0.0283% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0094% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0141% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0756% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0457% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0263% 0.0000% 0.0000% 0.0000% 0.0469% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0357% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0715% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0715% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0703% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0131% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0562% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0179% 0.0000% 0.0000% 0.0000% 0.0000% 0.0685% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0685% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0657% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0653% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0131% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0141% 0.0000% 0.0327% 0.0131% 0.0000% 0.0000% 0.0000% 0.0000% 0.0357% 0.0000% 0.0000% 0.0163% 0.0000% 0.0000% 0.0189% 0.0000% 0.0156% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0228% 0.0000% 0.0000% 0.0000% 0.0000% 0.0422% 0.0000% 0.0000% 0.0000% 0.0000% 0.0283% 0.0000% 0.0000% 0.0000% 0.0141% 0.0000% 0.0000% 0.0000% 0.0000% 0.0283% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0422% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0472% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0378% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0131% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0163% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0179% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0357% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0163% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0163% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0163% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0163% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0490% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0378% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0263% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0469% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0163% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0189% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0163% 0.0000% 0.0343% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0394% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0357% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0131% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0394% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0394% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0228% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0357% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0357% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0283% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0131% 0.0114% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0343% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0343% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0343% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0179% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0189% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0228% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0327% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0327% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0327% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0327% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0327% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0179% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0094% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0313% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0313% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0313% 0.0000% 0.0000% 0.0000% 0.0000% 0.0131% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0313% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0094% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0131% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0163% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0283% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0281% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0281% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0281% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0281% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0131% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0163% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0263% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0263% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0263% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0094% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0228% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0228% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0228% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0141% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0094% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0189% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0189% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0189% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0179% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0179% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0163% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0163% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0094% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0141% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0131% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0114% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0114% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0114% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0087% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0087% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% Cancer Cancer Cancer Cancer Cancer Cancer Cancer Cancer Cancer C15 C17 C18 C19 C20 C21 C22 C23 C24 0.0829% 0.2043% 1.0210% 8.0291% 0.4861% 0.0000% 0.7088% 30.5996% 1.9366% 0.3041% 0.0000% 12.8252% 4.7174% 19.2065% 1.4451% 0.5180% 1.3836% 2.0448% 0.0138% 0.3892% 0.9650% 4.3936% 0.5255% 1.0963% 0.5089% 28.6545% 9.8561% 0.0000% 37.0792% 0.0000% 0.0000% 0.0000% 2.0231% 0.0000% 0.0000% 0.0000% 12.8560% 0.0000% 0.0699% 0.0000% 2.0888% 0.0000% 0.0000% 0.0000% 3.3647% 0.0000% 0.0000% 0.0000% 0.0294% 0.0000% 0.0000% 0.7543% 0.0000% 0.5626% 31.6008% 0.0000% 0.0000% 23.7857% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.3179% 0.0097% 7.9720% 16.0730% 6.0825% 4.7538% 1.9084% 0.1805% 0.0216% 15.4963% 0.0000% 0.0000% 0.0000% 0.0920% 0.0000% 0.0000% 0.0201% 0.0108% 0.0138% 0.0195% 3.4545% 0.0000% 0.4598% 58.5609% 0.2090% 0.0000% 0.2813% 0.0829% 0.0097% 4.9650% 17.1107% 0.0263% 0.0000% 25.1908% 0.0000% 0.1298% 0.7879% 0.0195% 1.0909% 4.6070% 0.0000% 0.0000% 1.5631% 0.0000% 0.3029% 0.0138% 1.3524% 1.0350% 0.5814% 9.8923% 11.1620% 0.0091% 4.0706% 0.0757% 0.0000% 2.6756% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 19.7954% 1.9167% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0276% 5.9155% 3.7343% 5.1590% 0.0657% 4.0861% 1.2995% 2.0453% 0.2380% 0.0276% 0.0000% 1.2867% 0.0000% 0.0000% 0.0000% 0.0000% 0.0201% 0.1082% 0.0000% 12.4732% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0541% 0.0000% 0.0000% 0.0140% 0.3533% 0.0000% 0.0000% 8.5514% 0.0000% 0.1082% 0.0000% 16.1218% 0.0000% 0.0000% 0.0000% 0.0000% 1.9629% 0.0000% 0.1082% 0.0000% 0.0584% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0138% 0.0000% 0.1538% 0.0000% 0.0000% 0.0000% 0.5998% 4.6320% 0.1515% 0.0000% 0.0292% 2.7413% 0.0883% 0.0131% 0.0000% 29.2712% 0.0000% 0.0216% 0.0415% 0.0000% 0.6154% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0325% 0.0138% 0.0000% 0.1958% 0.0074% 0.0000% 0.0000% 0.0364% 0.0000% 44.7366% 0.1244% 0.0097% 1.3566% 0.1472% 2.1808% 0.0000% 5.3526% 0.0000% 1.2766% 0.0000% 5.2150% 0.7972% 0.0442% 0.1971% 0.0000% 0.0000% 0.0401% 0.3570% 0.0553% 0.0000% 1.5105% 0.0000% 6.3452% 0.0000% 0.0000% 0.0000% 0.2380% 12.0404% 0.0000% 0.2378% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.4760% 0.2074% 0.0778% 0.1399% 0.0810% 0.0525% 0.0000% 0.1636% 0.0401% 0.5301% 0.0000% 0.0000% 8.2797% 0.0147% 0.0131% 0.0000% 0.0091% 0.6818% 0.0000% 0.0415% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1659% 0.0000% 0.0839% 0.0294% 0.1051% 12.8264% 0.0000% 0.0000% 0.0649% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.0000% 0.0000% 0.0000% 0.0074% 6.3452% 0.0000% 0.0364% 0.0000% 0.7465% 0.0138% 0.0292% 3.5524% 1.9135% 0.0000% 0.0000% 0.3635% 0.0000% 0.0108% 0.0000% 0.0389% 0.0000% 0.0515% 0.4598% 0.0000% 0.0000% 0.0201% 2.6831% 0.0000% 0.0097% 0.4615% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0097% 0.0000% 1.0377% 0.0000% 0.0000% 0.0000% 0.0000% 0.3138% 0.0415% 0.0000% 0.0280% 2.4360% 0.0131% 0.0000% 2.1628% 9.4045% 0.0000% 0.1382% 0.0000% 0.1119% 0.0000% 0.0788% 0.0000% 0.0000% 0.0000% 0.1082% 0.0276% 0.0000% 0.0000% 1.0303% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.0000% 0.0000% 0.1399% 0.2208% 0.0000% 0.0000% 0.0273% 0.0000% 0.0974% 0.0138% 0.0000% 0.1399% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.4111% 0.0276% 0.0097% 0.0559% 0.2649% 0.2496% 0.0000% 0.0273% 0.0000% 0.0433% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0273% 0.0000% 0.0757% 0.0138% 0.0000% 0.2797% 0.0000% 0.5518% 0.0000% 0.0000% 0.0401% 0.4544% 0.0691% 0.0000% 0.2517% 0.0000% 0.0394% 0.0000% 0.0000% 0.0000% 0.0433% 0.0691% 0.0097% 0.0000% 0.0000% 9.6033% 0.0000% 0.0000% 0.0000% 0.0433% 0.0138% 0.0000% 0.7273% 0.0147% 0.0000% 0.0000% 0.0000% 0.0000% 0.0757% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0420% 0.0000% 0.0131% 0.0000% 0.0273% 7.4393% 0.0000% 0.0000% 0.0097% 0.8392% 0.1104% 0.0000% 0.0000% 0.0091% 0.0000% 0.0108% 0.0000% 0.0000% 0.1958% 0.0221% 0.0131% 0.0000% 0.0000% 0.0000% 0.0108% 0.0000% 0.6908% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 4.4615% 0.1251% 0.0525% 0.0000% 0.0000% 0.0000% 0.3895% 0.0138% 0.0000% 4.0140% 0.1030% 0.0000% 0.0000% 0.0000% 0.0000% 0.0433% 0.0000% 0.0000% 0.0000% 0.0662% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0968% 0.0000% 0.0140% 0.0589% 0.0263% 0.0000% 0.0000% 0.0000% 0.0541% 0.1521% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1515% 0.0000% 0.0000% 0.0280% 0.0957% 0.0000% 0.0000% 0.0000% 0.0000% 6.1885% 0.0000% 0.0000% 0.0559% 0.0000% 8.1582% 0.0000% 0.0000% 0.6016% 0.0000% 0.0138% 0.0000% 3.7622% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2813% 0.4838% 0.0097% 0.1678% 0.0000% 0.0000% 0.0000% 0.0182% 0.0201% 0.0757% 0.0553% 0.0000% 0.0559% 0.0074% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 2.6831% 0.0276% 0.0000% 0.0979% 0.4636% 0.0000% 0.0000% 0.0091% 0.0000% 2.2504% 0.0138% 0.0000% 0.0839% 0.0368% 0.0131% 0.0000% 0.0000% 0.0000% 0.0108% 0.0000% 0.0000% 0.5035% 0.0147% 0.0131% 0.0000% 0.0091% 0.0000% 0.4003% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.5115% 0.0000% 0.1119% 0.0000% 0.0131% 0.0000% 0.1545% 0.6016% 0.0325% 0.0829% 0.0000% 0.7692% 0.0074% 1.5502% 0.0000% 0.0182% 0.0000% 0.0000% 0.0000% 0.0000% 0.3357% 0.0000% 4.1251% 0.0100% 0.3635% 0.0000% 0.0216% 0.0968% 0.0000% 0.0000% 0.0000% 0.0525% 0.0000% 0.0818% 2.4865% 0.4111% 0.0000% 0.0000% 0.0000% 0.0000% 4.9921% 0.0000% 2.0084% 0.0000% 0.0108% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0216% 0.1106% 0.0000% 0.0839% 0.0000% 0.0394% 0.0000% 0.0000% 0.0000% 0.0757% 0.0000% 0.0000% 0.2378% 0.0000% 0.0788% 0.0000% 0.0000% 0.0000% 0.0433% 0.0000% 0.0000% 0.0699% 0.1398% 0.0000% 0.0000% 0.0000% 0.0000% 0.0216% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0553% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 1.2308% 0.0074% 0.0000% 0.0000% 0.0454% 0.0000% 0.0108% 0.0000% 0.1849% 0.0699% 0.2061% 0.1051% 0.0000% 0.0000% 0.1604% 0.0108% 0.0000% 7.2582% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0415% 0.0778% 0.4755% 0.6476% 0.0000% 0.0000% 0.0091% 1.1831% 0.1082% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0829% 0.0000% 0.0979% 0.0000% 0.0394% 0.0000% 0.0000% 0.0000% 0.1190% 0.0000% 0.0000% 0.9510% 0.0074% 0.0000% 0.0000% 0.3544% 0.0000% 0.0108% 0.0000% 0.0000% 0.3357% 0.0000% 0.0000% 0.0000% 0.0091% 0.0000% 0.0325% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0097% 0.3916% 0.0074% 0.0000% 0.0000% 0.0364% 0.0602% 0.0108% 0.0691% 2.9675% 0.7832% 0.1398% 0.0131% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0138% 0.0000% 0.2797% 0.0000% 0.0657% 0.0000% 0.0000% 0.0000% 0.0649% 0.0000% 0.0000% 0.0000% 0.0000% 4.5717% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 4.7123% 0.0000% 0.6082% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 2.9319% 0.0000% 0.0000% 2.3357% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0276% 0.0000% 0.1958% 0.0000% 0.0000% 0.0000% 0.0000% 0.0201% 0.0325% 0.0000% 0.0000% 0.0000% 0.0000% 0.0131% 0.0000% 0.1181% 0.0000% 0.0000% 0.0276% 0.0000% 0.0000% 0.0294% 0.0000% 0.0000% 0.0000% 0.0000% 0.0325% 0.0138% 0.0000% 0.0140% 0.0000% 0.0525% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.5874% 0.0000% 0.9065% 0.4485% 0.0364% 0.0000% 0.0325% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0839% 0.0000% 0.0000% 0.0000% 0.0182% 0.0000% 0.0000% 0.1244% 0.0778% 0.3357% 0.0000% 2.0100% 0.0100% 0.0000% 0.1003% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.8763% 0.0000% 0.0000% 1.1189% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0433% 0.0000% 0.0000% 0.0000% 0.1178% 0.0131% 0.0000% 0.0000% 0.0000% 0.0757% 0.0138% 0.0000% 0.0140% 3.0394% 0.0000% 0.0000% 0.0000% 0.0000% 0.1515% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 1.6084% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 1.8322% 0.0074% 0.0000% 0.0000% 0.1636% 0.0201% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0415% 0.0000% 0.0000% 0.0589% 0.0000% 0.0000% 0.0000% 0.0000% 0.7681% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 3.5260% 0.0000% 0.0000% 0.0000% 1.1092% 0.0699% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1082% 0.0000% 0.1265% 0.0000% 0.0000% 2.4698% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0553% 0.0000% 0.1818% 0.0000% 0.0263% 0.0000% 0.0000% 0.0000% 0.0000% 0.0415% 0.0000% 0.5035% 0.0000% 0.0000% 0.0000% 0.1000% 0.0000% 0.0216% 0.5253% 0.0000% 0.0000% 1.0818% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.7552% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.0968% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1298% 0.0000% 0.0000% 0.4336% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0325% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.0000% 0.0000% 1.5944% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 3.1692% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.5315% 0.0442% 0.0000% 0.0000% 0.0182% 0.0000% 0.0000% 0.0000% 0.0000% 0.0699% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0138% 0.0000% 0.1818% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.0000% 0.0000% 0.2098% 0.0147% 0.0000% 0.0000% 0.3908% 0.0000% 0.0000% 0.0000% 0.0000% 0.1538% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0866% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 2.7354% 0.0000% 0.0000% 0.0000% 0.0000% 0.2098% 0.0000% 0.0000% 0.0000% 2.4446% 0.0000% 0.0325% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0541% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 2.5783% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.5874% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0325% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0415% 0.0097% 0.0140% 0.0000% 0.0000% 0.0000% 1.3813% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0364% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0866% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1259% 0.0000% 0.0000% 0.0000% 0.3544% 0.0000% 0.0541% 0.0000% 0.0000% 0.0000% 0.0000% 0.0525% 0.0000% 0.0000% 0.0201% 0.0108% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 2.3585% 0.0000% 0.0000% 0.5175% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0138% 0.0000% 0.0420% 0.0221% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.4003% 0.0000% 0.0000% 0.0280% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 1.5633% 0.0000% 0.0000% 0.0000% 0.0000% 0.0691% 0.0000% 0.0420% 0.2134% 0.0000% 0.0000% 0.0000% 0.0000% 0.0433% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0182% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0138% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0097% 0.0000% 0.0221% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2350% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0974% 0.0000% 0.0195% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1082% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0097% 0.0000% 0.0000% 0.0000% 0.0000% 1.8175% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1545% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0074% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0979% 0.0074% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1119% 0.0589% 0.0525% 0.0000% 0.0000% 0.0000% 0.0216% 0.0138% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0273% 0.0000% 0.0000% 0.0138% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.8361% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0657% 0.0000% 0.0000% 0.0000% 0.7249% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0138% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0097% 0.1678% 0.0000% 0.0131% 0.0000% 0.3544% 0.0401% 0.0000% 0.0000% 0.0000% 0.1958% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2056% 0.1521% 0.0000% 0.0000% 0.0000% 0.2233% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.4056% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1406% 0.0829% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0276% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.3453% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0138% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0325% 0.0000% 0.0195% 0.0000% 0.0000% 0.0000% 0.0000% 0.0091% 0.0000% 0.1947% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0221% 0.0000% 0.0000% 0.0000% 0.0000% 0.3246% 0.0000% 0.0000% 0.1119% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0138% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1958% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0195% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0280% 0.0589% 0.0131% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0138% 0.0000% 0.0000% 0.0000% 0.0131% 0.0000% 0.0000% 0.0000% 0.0216% 0.0000% 0.0000% 0.0140% 0.0000% 0.0788% 0.0000% 0.0000% 0.0000% 0.0216% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0097% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2607% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1538% 0.0000% 0.0000% 0.0000% 0.0091% 0.0000% 0.0000% 0.0000% 0.0000% 0.0979% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0276% 0.0097% 0.0140% 0.0000% 0.0000% 0.0000% 0.0091% 0.0000% 0.0108% 0.0000% 0.0000% 0.0000% 0.0000% 0.0788% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0216% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0276% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.4895% 0.0000% 0.0000% 0.0000% 0.0000% 0.0201% 0.0000% 0.0691% 0.0000% 0.0280% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0138% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0325% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0280% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0074% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0138% 0.0000% 0.0140% 0.0074% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.3916% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.4204% 0.0000% 0.0000% 0.0000% 0.0108% 0.0000% 0.0000% 0.0000% 0.0000% 0.0131% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0138% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0216% 0.0000% 0.0000% 0.0000% 0.0000% 0.1051% 0.0000% 0.0000% 0.0000% 0.5409% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0559% 0.0000% 0.0000% 0.0000% 0.0182% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.5950% 0.0000% 0.0000% 0.1958% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0276% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0091% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0138% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.7005% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.3570% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.5518% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0280% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0216% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1399% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0216% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0097% 0.0140% 0.0000% 0.4992% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0280% 0.0662% 0.0000% 0.0000% 0.0727% 0.0000% 0.0216% 0.0276% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0420% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0138% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.4204% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0979% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0541% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0138% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1399% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0273% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0097% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0147% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.3895% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0802% 0.0000% 0.0000% 0.0000% 0.0000% 0.0074% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0525% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0091% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.3895% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0216% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0091% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0699% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0280% 0.0810% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.3029% 0.0000% 0.0000% 0.0280% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0100% 0.0000% 0.0201% 0.0108% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0138% 0.0000% 0.0000% 0.0221% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.0000% 0.0000% 0.0559% 0.0000% 0.0000% 0.0000% 0.0091% 0.0000% 0.0000% 0.0553% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0091% 0.0000% 0.0216% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0280% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1797% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0273% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0074% 0.0000% 0.0000% 0.1727% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0182% 0.0000% 0.0000% 0.0000% 0.0000% 0.0559% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0138% 0.0000% 0.0000% 0.0000% 0.0131% 0.0000% 0.0000% 0.0000% 0.0866% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0091% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0325% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0541% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0866% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0074% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.0000% 0.0000% 0.0140% 0.0000% 0.0788% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0839% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0280% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0273% 0.0000% 0.0000% 0.0000% 0.0000% 0.0699% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1545% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2238% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1404% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2102% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0216% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1894% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0280% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1708% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0325% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0280% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0138% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0541% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0091% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0280% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1051% 0.0000% 0.0000% 0.0000% 0.0000% 0.1659% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0138% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0091% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0074% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0280% 0.0000% 0.0000% 0.0000% 0.0091% 0.0000% 0.0000% 0.0138% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0280% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0074% 0.0000% 0.0199% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0974% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1190% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0276% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0131% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0525% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0131% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0968% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0280% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0788% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0263% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0147% 0.0000% 0.0000% 0.0000% 0.0201% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0131% 0.0000% 0.0000% 0.0401% 0.0108% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0553% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0280% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0280% 0.0000% 0.0131% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0138% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0802% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0788% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0788% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0097% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0138% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0138% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0276% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0727% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0368% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0280% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0325% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0662% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0657% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0195% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0598% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0598% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0420% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0559% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0201% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0541% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0182% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0525% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0201% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0091% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0294% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0276% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0442% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0216% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0216% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0415% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0415% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0138% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0389% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0280% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0368% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0138% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0364% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0364% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0364% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0131% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0074% 0.0131% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0131% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0299% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0280% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.0276% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0276% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0276% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0263% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0263% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0263% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0147% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0097% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0199% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0199% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0195% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0195% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0195% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0091% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0147% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0147% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0147% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0091% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0138% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0108% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0097% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0097% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0091% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0074% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0074% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% Cancer Cancer Cancer Control Control Control Control Control Control C25 C26 C27 N1 N2 N3 N4 N5 N6 21.8441% 52.1152% 6.9832% 7.9305% 3.6240% 1.5878% 0.0000% 10.7424% 34.5455% 0.1528% 0.0600% 1.2055% 4.6386% 11.5806% 1.2366% 1.1628% 0.4087% 29.8501% 3.2399% 0.5626% 1.4702% 13.8927% 47.7668% 12.9466% 1.5069% 2.5883% 14.2657% 0.0000% 0.0000% 0.0147% 0.0000% 0.0000% 0.0000% 0.0000% 0.5449% 0.0000% 0.1121% 0.0000% 2.7492% 0.0806% 0.0134% 0.9008% 0.0000% 2.3840% 0.0000% 0.7030% 0.1200% 20.6263% 0.2878% 0.6954% 0.3206% 0.1305% 0.0097% 0.0999% 0.0000% 0.0000% 2.7198% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.5706% 1.0126% 2.8815% 2.4632% 3.0623% 4.3206% 0.1424% 1.8293% 0.4995% 0.0204% 0.0000% 22.4787% 0.0576% 0.0535% 0.0153% 0.1068% 0.2919% 0.0000% 0.2038% 0.0300% 0.0000% 0.0115% 0.0134% 0.6718% 0.0000% 0.7201% 0.0000% 2.8324% 0.4875% 0.5734% 0.0000% 0.0267% 0.2748% 2.6459% 0.2335% 0.0000% 0.1019% 0.0300% 0.1176% 0.0691% 0.1738% 0.0916% 0.0000% 1.8682% 0.0000% 1.2634% 0.0300% 1.3231% 1.0820% 5.4293% 8.2595% 0.1424% 1.5666% 0.0400% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 91.1960% 0.0000% 0.0000% 0.0000% 0.0450% 0.0147% 0.0000% 0.0134% 0.0611% 0.0000% 0.1654% 0.5594% 0.0102% 0.0000% 0.0000% 0.0000% 0.0267% 0.0000% 0.0000% 0.0000% 0.0000% 2.6490% 6.8857% 0.5440% 0.3223% 1.9123% 5.9084% 0.1898% 3.1916% 0.3197% 0.2343% 0.0450% 0.0147% 0.0000% 0.0000% 0.8550% 0.0000% 2.2185% 0.0000% 0.0000% 4.3879% 0.0147% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.3158% 0.0975% 0.0735% 0.3453% 1.7518% 5.1756% 0.0000% 0.3698% 0.0799% 0.0000% 0.4275% 0.4557% 30.1105% 0.0000% 0.0000% 0.2610% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.4992% 0.0000% 0.0000% 3.0502% 4.0920% 23.4809% 0.0000% 0.9633% 1.0589% 0.2547% 13.5014% 0.2352% 0.0230% 0.9495% 0.0305% 0.0119% 0.7687% 0.3596% 0.7132% 0.0075% 0.0441% 0.0460% 0.0267% 0.0305% 0.0000% 13.9340% 0.0000% 0.0000% 0.0000% 0.0000% 0.2762% 0.0000% 0.1985% 0.0000% 0.0000% 0.0000% 2.7815% 3.5704% 0.3822% 0.1266% 0.1204% 1.0840% 0.9136% 0.4379% 0.2997% 0.0306% 0.0000% 0.1029% 0.1036% 0.4413% 0.1069% 0.0000% 0.7395% 0.0000% 6.2863% 0.0000% 0.1617% 0.1381% 0.6820% 1.0687% 0.0000% 0.0000% 0.0000% 4.5950% 0.0600% 5.1308% 0.0115% 0.0535% 0.4885% 0.0000% 0.0876% 0.0000% 0.0509% 0.0225% 0.0588% 0.0345% 1.7919% 0.0153% 0.0119% 0.0292% 0.0000% 0.0000% 0.0000% 0.0147% 0.0000% 2.9286% 0.0916% 0.0000% 0.0097% 0.0799% 23.1075% 0.0000% 0.0294% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1751% 0.0000% 0.3464% 0.0000% 0.0000% 1.9452% 0.3076% 0.7939% 0.0000% 0.0876% 0.5195% 0.0102% 0.0075% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0525% 0.0000% 0.7136% 0.0134% 0.0153% 0.0000% 1.3720% 1.5185% 0.0000% 0.0000% 0.0000% 0.0806% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1630% 0.0300% 1.1908% 0.0000% 0.0134% 0.1374% 0.5814% 0.0389% 0.0000% 0.5196% 0.0525% 0.0588% 0.7366% 0.8960% 0.0000% 0.0000% 0.2919% 0.0000% 0.0509% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0195% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2751% 0.2025% 0.3234% 0.0000% 0.0535% 0.0153% 0.0000% 7.3270% 0.0000% 0.0000% 0.0000% 0.0735% 1.4042% 0.0535% 0.1985% 0.0119% 0.0000% 0.0000% 0.2751% 0.0450% 0.6910% 0.0000% 0.0000% 0.7023% 0.0000% 0.0681% 0.0000% 0.0000% 0.0000% 0.1617% 0.0000% 0.8558% 0.2748% 0.0000% 6.2859% 0.0000% 0.1732% 1.9052% 0.0441% 0.0000% 0.0000% 0.0458% 0.0000% 0.2822% 0.0000% 0.0000% 0.0000% 0.0000% 0.0691% 0.0000% 0.2290% 0.0000% 0.2627% 0.0000% 0.0000% 0.0150% 0.0294% 0.4029% 0.6419% 1.6641% 0.0000% 1.1385% 0.0200% 0.0102% 0.0000% 0.0000% 11.1878% 0.0267% 0.0000% 0.0000% 0.0000% 0.0000% 2.2720% 0.0000% 0.0147% 0.1842% 0.4413% 0.6870% 0.0356% 0.2822% 0.0999% 0.1528% 0.0150% 0.0000% 0.0000% 0.0134% 0.0000% 0.0000% 0.0292% 0.0000% 0.0000% 0.0000% 0.2646% 0.0345% 0.0267% 0.1069% 0.0000% 0.2530% 0.1598% 0.9068% 0.6376% 0.1029% 0.0000% 0.0000% 0.0763% 0.0237% 0.0000% 0.0000% 0.3362% 0.0000% 0.0000% 4.8918% 0.4279% 0.0458% 0.0000% 0.4573% 0.0000% 0.1325% 0.0000% 0.0000% 1.0474% 0.6954% 0.8702% 0.0000% 0.1460% 0.0000% 0.4687% 6.0906% 0.0735% 0.0230% 0.5884% 0.0153% 0.0000% 0.0681% 0.0000% 0.8355% 0.0225% 0.0000% 1.7150% 0.2407% 0.4580% 0.0000% 0.4865% 0.1199% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2492% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0225% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 1.4304% 0.0000% 0.0102% 0.0750% 0.0147% 0.0460% 0.0134% 0.0000% 0.0000% 0.4963% 0.0000% 0.0713% 0.1125% 0.1323% 0.0921% 0.7355% 0.2443% 0.0000% 2.6467% 0.0000% 0.0611% 0.0750% 0.1764% 0.0000% 0.0802% 0.0000% 0.0000% 0.1070% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 2.7305% 0.0000% 0.7057% 0.1151% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0153% 0.0000% 0.0000% 0.0000% 0.4585% 0.3225% 0.0000% 0.0000% 0.0802% 0.1832% 0.0000% 0.0389% 0.0000% 0.0000% 0.0600% 0.0000% 0.0806% 0.0267% 0.9160% 0.0356% 0.0000% 0.0000% 0.0611% 0.0000% 6.6451% 0.0000% 0.0134% 0.3359% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0576% 0.0000% 1.9084% 0.0000% 0.0000% 0.0000% 0.2241% 0.0375% 0.0000% 0.0115% 0.1471% 0.0000% 0.0000% 3.0846% 0.0000% 0.0306% 0.0075% 0.2499% 0.0000% 0.0000% 0.0000% 0.0000% 0.0195% 0.0000% 0.3260% 0.1050% 0.0294% 0.1611% 0.0936% 0.1069% 0.0000% 1.0801% 0.0200% 0.1936% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0204% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1399% 0.0102% 0.0000% 0.0294% 0.0115% 0.0134% 0.1527% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2793% 0.0000% 0.0134% 0.4275% 0.1542% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0115% 0.0267% 0.0305% 0.0356% 0.0000% 0.1598% 0.0000% 0.0000% 0.0000% 0.0115% 0.0936% 0.3206% 0.0000% 0.0097% 0.0200% 0.0000% 0.0000% 0.0000% 0.0806% 0.0401% 0.1832% 0.0000% 0.0195% 0.0000% 0.0000% 0.0000% 0.0000% 0.0115% 0.0134% 0.0153% 0.0000% 0.1946% 0.0000% 0.0000% 0.0150% 0.0000% 0.4949% 0.6419% 0.2443% 0.0000% 3.0067% 0.0000% 0.0204% 0.0000% 0.0294% 0.0000% 0.0401% 0.0000% 0.0000% 0.1362% 0.0000% 0.0204% 2.0327% 1.4849% 0.1727% 0.5215% 0.6870% 0.0000% 0.0487% 0.0000% 0.0000% 0.0300% 0.0000% 0.0230% 0.0000% 0.0305% 0.0000% 0.5060% 0.6593% 0.3668% 0.0000% 0.0000% 0.0460% 0.0000% 0.0763% 0.0000% 0.0000% 0.0000% 0.2038% 0.0075% 0.0294% 0.0000% 0.0000% 0.0458% 0.0000% 0.2725% 0.0000% 0.0102% 0.0075% 0.0294% 0.0460% 0.7489% 1.6794% 0.0000% 0.0292% 0.0799% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0230% 0.0000% 0.0458% 0.0000% 0.3211% 0.1399% 0.1121% 0.3750% 0.0294% 0.1151% 0.0535% 0.2290% 0.0000% 0.1070% 0.6793% 0.0000% 0.0000% 0.0000% 0.0000% 0.0134% 0.0000% 0.0000% 0.0000% 0.4396% 1.4875% 0.0075% 0.1764% 0.1036% 0.0401% 0.1679% 0.0000% 0.1168% 0.0000% 0.0102% 0.1425% 0.0147% 0.0000% 0.2006% 2.9008% 0.0000% 0.3406% 0.0000% 1.5385% 0.1200% 0.0000% 1.0129% 0.3209% 0.0000% 0.0000% 0.2141% 0.2997% 0.0102% 0.0000% 1.6172% 0.0000% 0.0267% 0.0763% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 6.2188% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0230% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0204% 0.0000% 0.0000% 0.0000% 0.0000% 0.1069% 0.0000% 0.3016% 0.0000% 0.0000% 0.0000% 0.1029% 0.0115% 0.0134% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0075% 0.0000% 0.0576% 0.0267% 0.1221% 0.0000% 0.4963% 1.0789% 0.3362% 0.2250% 0.6616% 0.0000% 0.0000% 0.0000% 0.0000% 0.2335% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0102% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1223% 0.0000% 0.0000% 0.1381% 0.0000% 0.0305% 0.0000% 0.1654% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1325% 0.0225% 0.1911% 0.0000% 0.0000% 0.1985% 0.0000% 0.0000% 0.0000% 0.1630% 0.0000% 0.0000% 0.0000% 0.0000% 0.3969% 0.0000% 0.0000% 0.0000% 0.8558% 0.0000% 0.5734% 0.0000% 0.0000% 0.0000% 0.0000% 0.2238% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1630% 0.0000% 0.0147% 0.0000% 0.4279% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0115% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0102% 0.0000% 0.0000% 0.0000% 0.0000% 0.0305% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0882% 0.0115% 0.0134% 0.0000% 0.0000% 0.0000% 0.0000% 0.0306% 0.0000% 0.0000% 0.0460% 0.0134% 0.1985% 0.0000% 1.4693% 0.0000% 0.1223% 0.0150% 0.0000% 0.0115% 0.0000% 0.1832% 0.0000% 0.1070% 0.0000% 0.4992% 0.0000% 0.8821% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0204% 0.0000% 0.0000% 0.0000% 0.2273% 0.0611% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0576% 0.0000% 0.0000% 0.0000% 0.2238% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0102% 0.0675% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 1.3623% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0267% 0.0000% 0.0000% 0.0000% 0.0000% 0.7641% 0.0000% 0.0147% 0.0230% 0.1605% 0.0000% 0.0237% 0.0778% 0.0200% 0.2751% 0.0000% 0.0000% 0.0000% 0.0134% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0389% 0.0000% 0.0306% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0876% 0.0000% 0.0102% 0.0000% 0.0000% 0.0000% 0.0000% 2.0611% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.3234% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0306% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0882% 0.0230% 0.0000% 0.0611% 0.0000% 0.0292% 0.0000% 0.1630% 0.0075% 0.1029% 0.0000% 0.0000% 0.0305% 0.0000% 0.0778% 0.0000% 0.0000% 0.0075% 0.0294% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0075% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2547% 0.0000% 0.0441% 0.0000% 0.0000% 0.0000% 0.0000% 0.0389% 0.0000% 0.0102% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0153% 0.0000% 0.0000% 0.0799% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0306% 0.8251% 0.0147% 0.0000% 0.2942% 0.0000% 0.0000% 0.0097% 0.0000% 0.0102% 0.0000% 0.0000% 0.0000% 0.0134% 0.0305% 0.0000% 1.9364% 0.0000% 0.0102% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0204% 0.0000% 0.0000% 0.0000% 0.0000% 0.0153% 0.0000% 2.1504% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.3362% 0.0000% 0.0147% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0115% 0.0000% 0.0305% 0.0000% 0.2822% 0.1399% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0097% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1221% 0.0000% 0.1751% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.9008% 0.0000% 0.0000% 0.0000% 0.0000% 0.0300% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.5064% 1.5646% 0.0000% 0.0000% 0.0876% 0.0400% 0.0611% 0.0000% 0.0000% 0.0000% 0.0000% 0.1221% 0.0000% 0.0000% 0.0000% 0.0000% 0.0525% 0.1617% 0.6791% 0.0134% 0.0611% 0.0000% 0.0487% 0.0000% 0.0509% 0.0000% 0.0147% 0.0345% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0230% 0.0401% 0.0000% 0.0000% 0.1654% 0.1199% 0.0102% 0.0000% 0.0000% 0.0345% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0584% 0.0000% 0.1732% 0.4050% 0.0441% 0.0000% 0.0134% 0.1069% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1985% 0.0000% 0.1168% 0.0000% 0.0000% 0.0075% 0.0000% 0.0000% 0.0000% 0.0458% 0.0000% 0.0000% 0.0000% 0.4279% 0.0000% 0.0735% 0.0000% 0.1070% 0.0000% 0.0000% 0.0000% 0.0599% 0.0000% 0.0000% 0.0000% 0.0460% 0.0267% 0.0305% 0.0000% 0.1362% 0.4995% 0.4075% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2853% 0.2400% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0584% 0.0000% 0.0000% 0.0000% 0.0000% 1.4273% 0.0000% 0.0611% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 2.1317% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2647% 0.0669% 0.0458% 0.0000% 0.4768% 0.0000% 0.0000% 0.0000% 0.1323% 0.0230% 0.0000% 0.0916% 0.0000% 0.0681% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0306% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 1.9780% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0763% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0153% 0.0000% 0.0000% 0.0000% 0.0000% 0.0075% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0292% 0.0000% 0.0000% 0.0000% 0.0000% 1.3006% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0204% 0.0075% 0.0441% 0.0000% 0.0000% 0.0458% 0.0000% 0.0487% 0.0000% 0.4687% 0.0825% 0.0294% 0.0000% 0.0000% 0.0153% 0.0000% 0.0000% 0.0000% 0.2241% 0.0000% 0.0000% 0.0000% 0.0267% 0.0611% 0.0000% 0.0000% 0.0000% 0.0917% 0.0000% 0.0000% 0.0000% 0.0000% 0.0153% 0.0000% 0.1849% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.5776% 0.0000% 0.0000% 0.0000% 0.0305% 0.0000% 0.0389% 0.0000% 0.1121% 0.0000% 0.0000% 0.0115% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0458% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.6718% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0230% 0.0134% 0.3206% 0.0000% 0.3406% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2853% 0.0000% 0.0000% 0.0000% 0.0000% 0.0153% 0.0000% 0.0778% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0305% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2725% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0763% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0075% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0292% 0.0000% 0.0102% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2649% 0.2700% 0.0000% 0.0000% 0.0000% 0.5344% 0.0000% 0.0000% 0.0200% 0.0102% 0.0000% 0.0000% 0.0115% 0.0000% 0.0611% 0.0000% 0.0973% 0.0000% 0.0102% 0.0000% 0.0294% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0204% 0.0000% 0.0000% 0.1957% 0.0267% 0.4580% 0.0000% 0.0292% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 1.3331% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0195% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0408% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.6011% 0.1725% 0.0000% 0.0576% 0.0000% 0.0458% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0230% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1460% 0.0000% 0.0000% 0.0900% 0.2205% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0815% 0.0150% 0.0000% 0.0115% 0.0000% 0.0305% 0.0000% 0.4379% 0.0000% 0.0000% 0.0075% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1070% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.5395% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1898% 0.0000% 0.0000% 0.0000% 0.0000% 0.2499% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0292% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0230% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0115% 0.0000% 0.0000% 0.0000% 0.0000% 0.0400% 0.0102% 0.0000% 0.0000% 0.0115% 0.0134% 0.4122% 0.0000% 0.0292% 0.0200% 0.0000% 0.0000% 0.0000% 0.2993% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0204% 0.0000% 0.0000% 0.0000% 0.0000% 0.1221% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.9191% 0.2241% 0.0075% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.8233% 0.0000% 0.0000% 0.0611% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.8591% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.4427% 0.0000% 0.0000% 0.0000% 0.0000% 0.0075% 0.0000% 0.0000% 0.0000% 0.1069% 0.0000% 0.0000% 0.0000% 0.0306% 0.0000% 0.0000% 0.1957% 0.0000% 0.0458% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0305% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0305% 0.0000% 0.7590% 0.0000% 0.0000% 0.0000% 0.0000% 0.0115% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2433% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0763% 0.0000% 0.1362% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.7592% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.7336% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0611% 0.0000% 0.0000% 0.0230% 0.0000% 0.0000% 0.0000% 0.0973% 0.0000% 0.0000% 0.0000% 0.0147% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.6993% 0.3260% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.6793% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0389% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0815% 0.0000% 0.0000% 0.0000% 0.0000% 0.0305% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1199% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0921% 0.0000% 0.0000% 0.0000% 0.5449% 0.0000% 0.0204% 0.2925% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0204% 0.0000% 0.0441% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0681% 0.2597% 0.0102% 0.0450% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1325% 0.0075% 0.0000% 0.0000% 0.0000% 0.0305% 0.0000% 0.0000% 0.0000% 0.0102% 0.0075% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0102% 0.0000% 0.0000% 0.0230% 0.0000% 0.3359% 0.0000% 0.0487% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0375% 0.0000% 0.0000% 0.0000% 0.2443% 0.0000% 0.0389% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0153% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0681% 0.0000% 0.5502% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0204% 0.1275% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0345% 0.0000% 0.0000% 0.0000% 0.0000% 0.2997% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0115% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0102% 0.0000% 0.0000% 0.0230% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0294% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1362% 0.1998% 0.0000% 0.0075% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0195% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0204% 0.0000% 0.0000% 0.0000% 0.0000% 0.1374% 0.0000% 0.2627% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0119% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0576% 0.0000% 0.0000% 0.0000% 0.3406% 0.0000% 0.0000% 0.0000% 0.0000% 0.0460% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0237% 0.0584% 0.0000% 0.0102% 0.0000% 0.0000% 0.0000% 0.0000% 0.0916% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0115% 0.0000% 0.0305% 0.0000% 0.2919% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0487% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0294% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0134% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0115% 0.0000% 0.1679% 0.0000% 0.0000% 0.0000% 0.0509% 0.0000% 0.0147% 0.0000% 0.0134% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0267% 0.0000% 0.0000% 0.0778% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0204% 0.0000% 0.0000% 0.0000% 0.0000% 0.1679% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0204% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0115% 0.0000% 0.0458% 0.0000% 0.0584% 0.0400% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1985% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.3453% 0.0000% 0.0458% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.3996% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.3969% 0.0000% 0.0000% 0.0000% 0.0000% 0.0150% 0.0000% 0.0921% 0.0401% 0.0153% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0576% 0.0000% 0.0458% 0.0000% 0.0000% 0.0000% 0.0000% 0.0075% 0.0000% 0.0000% 0.0000% 0.0153% 0.0000% 0.0778% 0.0799% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1832% 0.0000% 0.0000% 0.0000% 0.0306% 0.0000% 0.0147% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0115% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0147% 0.0000% 0.0000% 0.0153% 0.0000% 0.0876% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0204% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0400% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1426% 0.0000% 0.0000% 0.0000% 0.0267% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0305% 0.0000% 0.0000% 0.0000% 0.0000% 0.0075% 0.0000% 0.0000% 0.0000% 0.0763% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0204% 0.0075% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0400% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0204% 0.0075% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2343% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.3016% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2997% 0.0306% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1069% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0204% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2940% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2595% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0115% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0195% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2797% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0916% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0195% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1985% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0763% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2627% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1528% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0115% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2532% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0204% 0.0075% 0.0147% 0.0000% 0.0000% 0.0153% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0150% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0195% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0681% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0735% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1557% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0306% 0.0000% 0.0000% 0.0000% 0.0000% 0.0305% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0400% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0147% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0102% 0.0000% 0.0000% 0.0115% 0.0134% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2198% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0150% 0.0000% 0.0230% 0.0000% 0.0611% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0075% 0.0000% 0.0000% 0.0000% 0.0153% 0.0000% 0.1362% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0267% 0.0000% 0.0000% 0.0681% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0973% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1611% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1998% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0292% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0153% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1176% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0102% 0.0000% 0.0000% 0.0115% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1798% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1798% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0458% 0.0000% 0.0389% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0200% 0.0713% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0102% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1654% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0230% 0.0000% 0.0611% 0.0000% 0.0584% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1598% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1598% 0.0000% 0.0000% 0.0000% 0.0115% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1557% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1542% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0134% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0075% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1460% 0.0000% 0.1528% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1036% 0.0000% 0.0000% 0.0000% 0.0000% 0.0200% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1069% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0115% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0204% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0345% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1399% 0.0204% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0599% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0681% 0.0000% 0.1325% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0204% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0799% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1265% 0.0000% 0.0000% 0.0000% 0.0000% 0.0230% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0305% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0119% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0763% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0134% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1199% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1199% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0584% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1176% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0147% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0458% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1151% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0147% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0375% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0204% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0115% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1070% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0763% 0.0000% 0.0195% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0876% 0.0000% 0.0000% 0.0000% 0.0147% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0999% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0294% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0267% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0611% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0345% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0882% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0876% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0876% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0102% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0294% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0147% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0204% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0102% 0.0000% 0.0000% 0.0000% 0.0000% 0.0153% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0147% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0799% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0153% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0115% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0778% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0778% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0458% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0763% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0763% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0735% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0153% 0.0000% 0.0195% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0611% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0713% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0292% 0.0400% 0.0000% 0.0000% 0.0000% 0.0691% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0681% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0230% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0305% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0147% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0147% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0204% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0611% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0153% 0.0000% 0.0292% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0599% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0599% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0599% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0599% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0588% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0588% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0584% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0584% 0.0000% 0.0204% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0576% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0441% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0408% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0204% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0115% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0134% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0075% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0115% 0.0000% 0.0000% 0.0000% 0.0000% 0.0400% 0.0204% 0.0000% 0.0147% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0075% 0.0147% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0487% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0097% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0458% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0267% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0441% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0075% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0195% 0.0000% 0.0102% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0305% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0400% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0267% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0389% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0389% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0389% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0230% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0153% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0345% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0345% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0147% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0204% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0102% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0102% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0306% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0305% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0305% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0134% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0204% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0294% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0294% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0294% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0294% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0292% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0102% 0.0075% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0115% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0267% 0.0000% 0.0000% 0.0000% 0.0000% 0.0102% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0147% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0102% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0147% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0134% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0237% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0230% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0230% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0230% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0153% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0147% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0204% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0204% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0200% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0102% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0195% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0195% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0195% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0195% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0195% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0153% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0153% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0147% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0147% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0119% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0115% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0115% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0102% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0102% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0102% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0102% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0102% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0097% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0075% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% Control Control Control Control Control Control Control Control Control N8 N9 N11 N14 N15 N16 N17 N18 N19 33.6352% 0.7430% 0.3496% 0.0705% 16.1855% 13.8869% 0.1428% 9.6579% 20.6128% 0.1951% 0.2702% 6.6984% 19.4405% 36.2092% 30.2920% 0.3426% 7.4344% 0.7887% 2.5359% 1.8237% 14.2358% 40.5266% 0.5605% 0.1095% 0.0286% 4.2303% 7.2804% 0.0139% 0.2026% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2123% 0.0000% 1.3847% 0.0000% 0.6582% 3.9572% 4.3796% 0.0000% 0.3649% 0.1517% 0.0000% 0.1182% 2.2934% 2.8679% 2.1060% 2.5547% 34.9036% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 4.2873% 0.0455% 0.5991% 2.0770% 2.3214% 0.8698% 0.7982% 1.4051% 18.3155% 0.2395% 0.9252% 0.0000% 4.3229% 0.0559% 0.1175% 1.1719% 1.3321% 0.0000% 0.0000% 0.0000% 0.0000% 0.1520% 0.0280% 0.0000% 2.3777% 2.7555% 0.0000% 0.0114% 0.0303% 0.0000% 0.0000% 0.0000% 0.0470% 0.0849% 0.1277% 0.0000% 28.7685% 0.0303% 0.0000% 0.4390% 0.0699% 0.0000% 0.0000% 0.0000% 25.5103% 0.1140% 0.0000% 0.0139% 7.0415% 23.8428% 1.2694% 2.8363% 2.9927% 0.0000% 0.2737% 0.0607% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0169% 0.0000% 0.7522% 0.0000% 0.0000% 0.0000% 0.0000% 0.0152% 0.0000% 0.0000% 0.0839% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 1.0032% 1.6042% 9.7888% 0.7287% 0.8492% 1.2226% 0.4140% 0.7640% 0.8949% 18.6150% 0.0507% 2.9926% 0.0000% 1.0870% 1.1496% 0.0143% 10.9920% 30.0622% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 28.0201% 0.6586% 0.1119% 0.0000% 0.0000% 0.0547% 0.1428% 0.6727% 19.5207% 0.0000% 0.0844% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 15.7717% 0.0000% 2.4213% 0.0679% 0.0182% 0.0999% 0.0000% 0.0000% 0.1254% 0.0169% 0.0839% 0.0235% 0.1698% 0.1460% 0.0000% 0.0114% 0.1517% 0.0139% 0.5235% 0.1538% 10.2022% 0.0679% 0.2920% 0.0000% 0.0342% 0.0455% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1710% 0.0152% 0.5991% 0.8274% 0.3216% 0.0000% 0.0849% 0.3102% 0.2855% 6.3626% 0.3337% 0.0000% 0.0000% 0.0280% 0.0000% 2.3777% 1.6606% 1.8701% 1.1973% 0.0000% 0.0000% 0.8781% 0.0420% 0.1410% 0.6793% 1.0036% 0.0000% 0.6499% 0.0303% 0.0000% 0.0000% 0.2657% 0.0000% 0.4416% 0.5839% 0.0000% 0.0684% 0.0000% 0.0139% 0.1857% 17.6898% 0.0705% 0.3736% 0.0912% 0.4283% 0.2965% 0.0758% 0.0000% 0.0000% 2.9786% 0.0000% 0.1359% 0.0000% 0.0000% 0.0684% 0.0000% 0.0000% 0.0000% 0.0000% 0.2586% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2195% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0844% 0.5594% 0.7522% 0.0340% 0.0365% 0.1285% 0.2737% 0.4399% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0684% 0.0000% 0.0000% 1.1145% 0.2797% 1.2929% 0.0000% 0.0000% 0.0000% 0.0000% 0.2427% 0.0000% 0.0000% 0.0000% 0.1175% 6.5727% 6.7336% 0.0000% 0.0000% 0.0000% 0.0000% 0.0338% 0.0000% 0.0705% 0.4246% 0.6204% 0.1856% 1.5051% 0.0000% 1.1843% 0.4728% 4.1253% 0.1410% 0.1189% 0.0730% 0.0286% 0.2851% 0.8646% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0456% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0279% 0.0000% 0.0000% 0.0000% 0.0340% 0.0365% 0.5425% 4.2873% 0.0303% 0.0000% 1.5535% 0.1119% 0.0000% 0.0000% 0.0000% 0.1142% 0.0000% 0.0000% 0.0000% 0.0000% 0.0699% 0.0470% 1.6135% 2.4453% 0.0000% 0.0228% 0.0303% 0.0139% 0.0000% 0.0000% 0.0000% 0.0000% 0.0365% 5.1249% 0.0000% 0.0303% 5.6848% 0.0000% 0.0000% 0.0940% 0.0170% 0.0182% 0.0286% 0.3763% 5.3997% 0.0418% 0.0000% 0.0000% 0.0235% 5.0102% 5.8212% 0.0000% 0.0000% 0.0000% 0.3205% 4.6099% 0.6013% 0.2116% 0.0340% 0.1825% 3.8401% 0.0228% 0.2882% 0.0000% 0.1857% 4.1812% 0.1646% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 1.4543% 0.7052% 0.0000% 0.0000% 0.0000% 0.1254% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0340% 0.0365% 0.0000% 1.2201% 0.0000% 0.0000% 0.0000% 0.0839% 0.1646% 0.1189% 0.2372% 0.0000% 0.0228% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0679% 0.0000% 0.0000% 0.7184% 0.0000% 0.0139% 5.8257% 0.3356% 0.1646% 0.0170% 0.0182% 0.0000% 0.1938% 0.0607% 0.0000% 0.0338% 0.0000% 0.1881% 0.0000% 0.0000% 0.0000% 0.0228% 0.0000% 0.0836% 0.0000% 0.0280% 0.0940% 0.0000% 0.0000% 0.0000% 0.0000% 0.1365% 0.0000% 0.0000% 0.0000% 0.0705% 1.4606% 1.8613% 0.0000% 0.0342% 0.0152% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 5.4480% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 5.6272% 0.0000% 0.1182% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2623% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0340% 0.0000% 0.0000% 0.2737% 0.0000% 0.1393% 0.2195% 0.0559% 2.6328% 0.0170% 0.0000% 0.0000% 0.0114% 0.3185% 0.0000% 0.0507% 0.0000% 0.0000% 0.0000% 0.0182% 0.0000% 0.2395% 0.0455% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0114% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0182% 0.0000% 0.0228% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0182% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0235% 0.0170% 0.0000% 0.0000% 0.1368% 0.0000% 0.0139% 0.7768% 0.1398% 0.0000% 0.3397% 0.3285% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1538% 0.0000% 0.1189% 0.4015% 0.0000% 0.0228% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.5774% 0.9124% 0.0000% 0.0000% 0.0000% 0.0697% 0.0000% 0.0000% 0.0000% 0.2378% 0.3285% 0.7994% 0.0228% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2509% 0.0000% 0.0000% 0.8612% 0.3216% 0.0000% 0.0679% 0.0547% 0.2141% 1.5051% 0.0152% 0.0000% 0.0000% 0.0000% 0.0000% 0.1359% 0.3102% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2038% 0.4380% 0.0000% 0.0114% 0.0000% 0.0000% 4.6775% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.7813% 1.7153% 0.0000% 0.0228% 0.0000% 0.0000% 1.4691% 0.0000% 0.0000% 0.0170% 0.0365% 0.0000% 0.0000% 0.0000% 0.0000% 0.1857% 0.0699% 0.3996% 0.1868% 0.4197% 0.0000% 0.0000% 0.0607% 0.0000% 0.1520% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 1.5535% 0.0000% 0.0235% 0.5095% 0.5474% 0.0000% 0.0000% 0.0000% 0.0000% 0.7599% 0.0000% 0.1410% 0.0000% 0.0000% 0.0000% 0.0114% 0.0910% 0.0000% 0.0000% 0.0000% 0.0000% 1.1039% 1.2044% 0.0000% 0.1254% 0.0000% 0.0000% 0.0507% 0.0000% 0.2116% 0.1698% 0.3102% 0.0000% 0.0912% 0.0455% 0.0000% 0.0169% 0.0000% 0.5877% 0.0000% 0.0182% 0.0000% 0.0000% 0.0000% 0.0000% 1.0638% 0.0000% 1.7866% 0.1019% 0.0365% 0.0000% 0.0570% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1019% 0.1460% 0.0000% 0.0798% 0.0000% 0.0000% 0.4390% 0.0420% 0.0470% 0.5265% 0.4927% 0.0000% 0.0570% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0139% 0.1182% 0.1538% 0.6582% 0.0000% 0.0182% 0.0000% 0.0000% 0.2730% 0.0139% 0.0000% 0.0000% 0.1175% 0.0170% 0.1825% 0.0428% 0.0684% 0.0455% 0.0000% 0.0000% 0.0000% 0.2351% 0.0000% 0.0000% 0.0000% 0.0114% 0.1668% 0.0000% 0.0000% 0.0000% 0.4937% 0.0170% 0.0912% 0.0000% 0.1140% 0.0000% 0.0279% 0.0338% 0.0000% 0.0000% 0.0340% 0.0000% 0.0000% 0.0456% 0.0455% 0.0000% 0.0000% 0.2377% 0.3996% 0.1189% 0.0547% 0.0000% 0.0000% 0.0152% 0.0000% 4.3566% 0.0000% 0.1646% 0.0000% 0.0000% 0.0000% 0.0000% 0.0607% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 6.1635% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2787% 0.0000% 0.0000% 0.0000% 0.0340% 0.1460% 0.0857% 1.7902% 0.1365% 0.0000% 0.2026% 0.0000% 0.1175% 0.0170% 0.0182% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2737% 0.0000% 0.0000% 0.0000% 0.0280% 0.3526% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0139% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0286% 0.1368% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.1529% 0.3102% 0.0000% 0.0000% 0.0000% 0.0418% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0152% 0.0000% 0.0000% 0.0000% 0.0000% 0.1698% 0.3467% 0.0000% 0.0456% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 2.0380% 1.1496% 0.0000% 0.1026% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0679% 0.2190% 0.0000% 1.9612% 0.0000% 0.0000% 4.4073% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0705% 0.0000% 0.0000% 0.0000% 0.0456% 0.0000% 0.0000% 0.0338% 0.0000% 0.0000% 0.1868% 0.2007% 2.9550% 0.1140% 0.0000% 0.0139% 0.0000% 0.0140% 0.0000% 0.0170% 0.0547% 0.0571% 0.0228% 0.0000% 0.0000% 0.0844% 0.0000% 0.0000% 0.0679% 0.1460% 0.0143% 0.0000% 0.0303% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0182% 0.0000% 0.0228% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0170% 0.0365% 0.0000% 0.0798% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0114% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0114% 0.0152% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 3.4617% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0912% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2509% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.5404% 0.0000% 0.0235% 0.0849% 0.2190% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1175% 0.0000% 0.0000% 0.0000% 0.0798% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0152% 0.0000% 0.0000% 0.0000% 0.0000% 0.1698% 0.2372% 0.0000% 0.0228% 0.0000% 0.0139% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1689% 0.0000% 0.0000% 0.0170% 0.0912% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0280% 0.0000% 0.0170% 0.0000% 0.0000% 0.0570% 0.0000% 0.0000% 0.0000% 0.0699% 0.0000% 0.2038% 0.6569% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.4333% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0675% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0607% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0139% 0.0169% 0.0699% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2578% 0.0000% 0.0338% 0.0280% 0.0000% 0.0000% 0.0000% 0.0000% 0.0684% 0.0607% 0.0000% 0.0000% 0.0000% 0.0000% 0.9511% 0.9854% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0510% 0.0912% 0.0000% 0.0456% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0114% 0.0000% 0.0000% 0.0000% 0.0140% 0.4701% 0.0000% 0.0000% 0.0000% 0.0000% 0.0758% 0.0000% 0.0844% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0152% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0139% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0182% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0999% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1285% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0114% 0.0000% 0.0000% 0.0000% 0.0000% 0.1881% 0.0000% 0.0000% 0.0286% 0.0000% 0.2882% 0.0000% 0.0000% 0.0000% 0.0470% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0844% 0.0280% 0.0705% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1254% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0340% 0.0912% 0.0000% 0.0114% 0.0000% 0.0000% 0.8950% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0342% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0340% 0.0000% 0.0000% 0.0114% 0.0303% 0.0000% 0.0844% 0.0699% 0.0470% 0.0000% 0.0000% 0.0000% 0.0000% 0.0455% 0.0000% 0.2026% 0.0420% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0844% 0.0000% 0.0235% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0507% 0.0140% 0.0000% 0.0000% 0.0000% 0.0571% 0.0000% 0.0758% 0.0000% 0.0000% 0.0000% 0.7287% 0.0340% 0.0365% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 1.4989% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0143% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 1.4522% 0.0000% 0.0000% 0.0510% 0.2920% 0.0000% 0.0000% 0.0455% 0.0000% 1.5873% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1520% 0.1818% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0420% 0.0000% 0.0000% 0.0000% 0.0000% 0.0912% 0.0152% 0.0000% 0.0000% 0.0000% 0.0000% 0.0170% 0.0182% 0.0000% 0.0570% 0.0000% 0.0000% 0.0000% 0.0000% 0.1175% 0.0000% 0.0365% 0.0143% 0.1368% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0143% 0.5131% 0.0000% 0.0279% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0342% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0912% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0170% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.1359% 0.1642% 0.0000% 0.0114% 0.0000% 0.0139% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0228% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0114% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.3997% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0235% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2871% 0.1398% 0.0000% 0.4416% 0.0912% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0507% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.8105% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0456% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0170% 0.0730% 0.0000% 0.0228% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0570% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2195% 0.0420% 0.0940% 0.0000% 0.0182% 0.0428% 0.0684% 0.0303% 0.0000% 0.0000% 0.0000% 0.4466% 0.0510% 0.1277% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0280% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0169% 0.0000% 0.0000% 0.0000% 0.0182% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.9287% 0.0000% 0.0000% 0.0679% 0.1642% 0.0000% 0.0000% 0.0000% 0.0000% 0.0507% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0279% 0.0000% 0.0000% 0.1646% 0.0340% 0.0730% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0228% 0.0000% 0.0000% 0.0000% 0.0000% 0.1410% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.4399% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0912% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0152% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0338% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.9794% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1646% 0.0000% 0.0000% 0.0000% 0.0000% 0.0152% 0.0279% 0.2195% 0.0000% 0.0000% 0.0000% 0.0000% 0.0571% 0.0684% 0.0000% 0.0000% 0.6586% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0342% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0279% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0570% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2281% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1013% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0607% 0.0000% 0.0000% 0.0000% 0.0000% 0.0170% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0143% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.5235% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0170% 0.1095% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.3040% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1857% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0340% 0.0182% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0114% 0.0000% 0.0000% 0.0000% 0.1119% 0.0470% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0338% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1026% 0.0910% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0342% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0286% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0170% 0.0000% 0.0000% 0.0000% 0.0000% 0.2508% 0.0169% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2578% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0182% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0228% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0114% 0.0303% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0182% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0114% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0182% 0.0000% 0.2166% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.1254% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0418% 0.0000% 0.0979% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0510% 0.0365% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1410% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0979% 0.0235% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1482% 0.0152% 0.0000% 0.0000% 0.0000% 0.0470% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0228% 0.0000% 0.0000% 0.3884% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.1646% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0303% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.4559% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0169% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.4675% 0.0000% 0.0000% 0.0675% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.3040% 0.0000% 0.0000% 0.0000% 0.0000% 0.0857% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0169% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0570% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0279% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0507% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2533% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0235% 0.0000% 0.0000% 0.0000% 0.0000% 0.0152% 0.0000% 0.0000% 0.0000% 0.1881% 0.0000% 0.0000% 0.0000% 0.0000% 0.0303% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0365% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0675% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0169% 0.0000% 0.1410% 0.0000% 0.0365% 0.0000% 0.0000% 0.0000% 0.0279% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0607% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.3377% 0.0000% 0.0470% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1013% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2026% 0.0420% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0152% 0.1811% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0152% 0.0000% 0.0000% 0.0979% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0507% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0510% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0679% 0.0000% 0.0000% 0.1140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1596% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0455% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.3056% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1857% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1958% 0.0235% 0.0510% 0.0000% 0.0000% 0.0114% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.3291% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0420% 0.0235% 0.0000% 0.0000% 0.0143% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1570% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0418% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.3185% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0684% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0342% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0912% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0228% 0.0000% 0.1254% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0303% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0114% 0.0455% 0.0000% 0.0000% 0.0000% 0.2821% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0342% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0170% 0.0182% 0.0000% 0.0000% 0.0000% 0.0000% 0.0338% 0.0420% 0.0705% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0182% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0170% 0.1642% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0340% 0.1277% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0675% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0170% 0.0182% 0.0000% 0.0000% 0.0000% 0.0000% 0.0507% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0699% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0303% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0114% 0.0000% 0.0000% 0.0000% 0.0000% 0.0235% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0675% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0170% 0.0000% 0.0000% 0.0342% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0510% 0.0912% 0.0000% 0.0000% 0.0000% 0.0000% 0.0507% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0342% 0.0000% 0.0000% 0.0844% 0.0559% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0705% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0114% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1857% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0338% 0.0000% 0.0705% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0340% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2116% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1062% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0228% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1999% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0228% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0758% 0.0000% 0.0000% 0.0000% 0.0235% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0170% 0.0000% 0.0000% 0.0456% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0182% 0.0000% 0.0000% 0.0000% 0.0000% 0.0169% 0.0000% 0.0000% 0.0000% 0.0000% 0.0143% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0940% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0280% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1570% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0456% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1529% 0.0182% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1646% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0507% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0844% 0.0000% 0.0705% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0169% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0152% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0169% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0139% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1365% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0340% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0679% 0.0547% 0.0000% 0.0000% 0.0000% 0.0000% 0.0507% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0455% 0.0000% 0.0000% 0.0000% 0.1410% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1410% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1026% 0.0152% 0.0000% 0.0000% 0.1259% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0507% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0570% 0.0000% 0.1115% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0758% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1115% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0152% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0280% 0.0000% 0.0170% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0170% 0.0365% 0.0000% 0.0684% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0338% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1013% 0.0000% 0.0000% 0.0170% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1175% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1175% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1175% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0705% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1142% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0839% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0547% 0.0000% 0.0114% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0342% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0338% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0182% 0.0143% 0.0000% 0.0000% 0.0000% 0.0000% 0.0699% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0570% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0607% 0.0000% 0.0000% 0.0000% 0.0940% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0912% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0912% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0910% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0910% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0910% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0182% 0.0000% 0.0228% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0170% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0280% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0152% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0228% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0338% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0303% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0340% 0.0000% 0.0000% 0.0342% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0798% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0675% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0684% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0169% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0607% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0169% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0547% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0758% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0228% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0169% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0705% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0705% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0705% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0699% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0182% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0675% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0675% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0675% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0114% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0340% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0607% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0607% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0114% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0571% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0570% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0280% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0152% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0456% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0340% 0.0182% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0340% 0.0182% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0340% 0.0182% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0507% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0507% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0507% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0342% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0169% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0470% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0470% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0470% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0470% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0470% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0228% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0170% 0.0182% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0455% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0455% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0455% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0455% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0455% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0455% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0286% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0170% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0114% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0420% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0169% 0.0000% 0.0235% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0228% 0.0152% 0.0000% 0.0000% 0.0000% 0.0235% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0170% 0.0182% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0170% 0.0182% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0170% 0.0182% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0340% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0340% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0338% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0338% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0338% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0338% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0338% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0338% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0338% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0170% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0182% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0169% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0169% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0303% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0303% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0303% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0303% 0.0000% 0.0000% 0.0000% 0.0000% 0.0170% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0286% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0286% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0169% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0280% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0280% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0279% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0279% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0169% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0143% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0114% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0235% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0228% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0228% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0228% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0114% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0114% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0182% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0182% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0182% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0169% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0169% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0169% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0169% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0169% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0169% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0152% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0152% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0152% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0139% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0114% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0114% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% Control Control Control Control Control Control Control N20 N21 N22 N23 N25 N26 N28 Overall OSSC 1.5622% 8.4608% 5.9584% 62.7868% 79.7101% 1.2482% 4.8712% 10.92% 7.80% 18.5290% 3.3461% 0.0202% 0.3637% 0.3134% 13.5928% 0.9349% 6.96% 5.58% 40.2256% 23.8368% 0.3434% 0.4127% 0.4309% 0.8479% 7.7743% 6.41% 2.52% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 3.32% 6.20% 1.1282% 1.2428% 0.0000% 0.0140% 0.0000% 0.0421% 0.0000% 3.09% 5.13% 1.2150% 0.0000% 0.4646% 19.4740% 0.6659% 0.0211% 0.1968% 2.90% 2.72% 0.0000% 0.0637% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 2.82% 5.13% 0.0651% 0.2231% 0.0000% 7.7154% 0.6659% 7.6153% 0.3444% 2.79% 2.99% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 2.54% 4.48% 0.6292% 0.0637% 0.0000% 0.0000% 0.0000% 2.5911% 0.0000% 2.29% 3.90% 0.2387% 0.1115% 0.0000% 1.1752% 0.0000% 4.2711% 0.0000% 2.17% 2.56% 0.0000% 6.6762% 0.0000% 0.2448% 0.0000% 0.9796% 3.3951% 2.11% 2.38% 0.0217% 0.5099% 0.5049% 0.0000% 0.1958% 0.9585% 0.5905% 2.06% 1.57% 0.0000% 0.0000% 0.4646% 0.0000% 0.0000% 0.0000% 0.0000% 2.01% 0.11% 2.3215% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 1.5909% 1.98% 3.50% 0.0000% 0.5577% 0.0000% 0.0000% 0.4570% 0.0000% 1.1317% 0.81% 1.43% 0.8028% 0.3505% 0.0808% 0.8534% 2.0368% 3.9604% 1.5909% 1.76% 1.76% 0.1736% 0.0478% 0.0000% 0.0490% 0.0000% 1.3272% 0.3936% 1.67% 0.34% 0.0000% 0.0000% 59.4021% 0.0000% 0.0000% 0.0053% 0.0000% 1.63% 0.68% 0.1736% 0.4780% 0.1010% 0.0140% 0.0653% 0.0158% 0.2788% 1.49% 0.48% 0.0000% 0.6055% 17.5520% 0.0000% 0.0914% 0.0000% 0.0000% 1.45% 0.78% 0.0000% 0.0637% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 1.29% 2.41% 0.0000% 2.0873% 0.0000% 0.0140% 0.0653% 0.1527% 0.0000% 1.27% 0.24% 0.0434% 0.2868% 0.0202% 0.1819% 4.1911% 3.0598% 0.0000% 1.26% 1.94% 0.0000% 0.0797% 0.0000% 0.0070% 0.0914% 0.5582% 0.0000% 0.85% 0.55% 0.0000% 0.0478% 0.0000% 0.0000% 0.0000% 0.0527% 0.5577% 1.04% 1.90% 0.4122% 0.2709% 0.0000% 0.0630% 0.0914% 1.4220% 0.0000% 0.96% 1.23% 0.2604% 0.0000% 0.0000% 0.0000% 0.0000% 0.8848% 0.0000% 0.67% 0.88% 0.5641% 0.2549% 0.0000% 1.3430% 0.0131% 1.9223% 0.0000% 0.67% 0.89% 0.0000% 0.3983% 0.0000% 0.0000% 0.0000% 0.2317% 0.0000% 0.62% 1.06% 0.0434% 1.5456% 0.5049% 0.0280% 0.1567% 0.0632% 0.4592% 0.58% 0.13% 0.3038% 0.2390% 0.0202% 0.0000% 0.3395% 9.3059% 0.0000% 0.56% 0.39% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.55% 1.02% 0.0000% 0.0159% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.50% 0.93% 0.2387% 0.0637% 0.0000% 0.0000% 0.1436% 0.0263% 0.0000% 0.49% 0.66% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0105% 0.0000% 0.47% 0.88% 7.1599% 0.3027% 0.0000% 0.0140% 0.0783% 0.0000% 6.9378% 0.45% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0053% 0.0000% 0.44% 0.29% 0.0000% 0.1115% 0.0000% 0.8954% 0.0261% 3.8077% 0.0164% 0.42% 0.45% 0.8462% 0.5417% 0.0000% 0.2518% 0.2350% 0.0000% 0.6069% 0.36% 0.21% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.5003% 0.0000% 0.40% 0.73% 0.0000% 11.7909% 0.0000% 0.0000% 0.0000% 0.0000% 6.9706% 0.40% 0.00% 0.0000% 0.8286% 0.0000% 1.4689% 0.0000% 0.0000% 1.0333% 0.39% 0.10% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0158% 0.0000% 0.38% 0.57% 0.0000% 0.0000% 0.0000% 0.0070% 0.0783% 0.2159% 0.0000% 0.33% 0.40% 0.0000% 0.8604% 0.0000% 0.0000% 0.0000% 0.0105% 1.4597% 0.35% 0.06% 0.2387% 0.3346% 0.0202% 0.0000% 0.0522% 0.1264% 0.1312% 0.35% 0.15% 0.0000% 0.4461% 0.0000% 0.0070% 0.0000% 0.1211% 0.1476% 0.34% 0.15% 0.0000% 0.2231% 0.0000% 0.0000% 0.0000% 0.0685% 0.0000% 0.34% 0.07% 0.0000% 0.1593% 0.0000% 0.0000% 0.0392% 0.0000% 0.0000% 0.34% 0.01% 0.0000% 1.4818% 0.0000% 0.0769% 0.0000% 0.3107% 4.0020% 0.33% 0.22% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1791% 0.0000% 0.32% 0.55% 0.0000% 0.0000% 0.0000% 0.0699% 0.0000% 0.0000% 0.4428% 0.33% 0.54% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.7320% 0.0000% 0.28% 0.46% 0.0000% 0.0000% 0.0000% 0.0000% 0.0261% 0.0000% 0.0000% 0.27% 0.01% 0.3905% 0.0000% 0.0000% 0.0000% 0.0000% 0.0211% 0.0000% 0.27% 0.36% 0.0000% 0.4143% 0.0000% 0.0070% 0.0522% 1.0744% 0.9349% 0.26% 0.35% 0.0000% 0.0000% 0.0000% 0.0210% 4.0214% 0.2633% 0.0000% 0.25% 0.05% 0.0000% 0.0000% 10.5635% 0.0000% 0.0000% 0.0000% 0.0000% 0.24% 0.03% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.24% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 4.1763% 0.0000% 0.24% 0.20% 0.0000% 0.2231% 0.0000% 0.0070% 0.0000% 3.4390% 0.0000% 0.23% 0.25% 0.0000% 0.8286% 0.0000% 0.0560% 0.0392% 0.0158% 1.9518% 0.22% 0.02% 0.0000% 0.0000% 0.0000% 0.0210% 0.0000% 0.0421% 0.0000% 0.23% 0.41% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.23% 0.43% 0.0000% 0.3983% 0.0000% 0.0000% 0.0000% 0.0105% 0.0000% 0.22% 0.40% 0.0000% 0.0000% 0.0000% 0.0140% 0.0522% 0.0369% 0.0000% 0.22% 0.41% 0.0000% 0.0000% 0.0000% 0.0000% 0.0261% 3.4285% 0.0000% 0.22% 0.25% 0.0000% 0.4780% 0.0000% 0.0000% 0.0000% 0.1211% 0.0000% 0.21% 0.27% 0.0000% 0.0797% 0.0000% 0.0000% 0.0000% 0.0421% 0.0000% 0.20% 0.33% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0105% 0.0000% 0.20% 0.25% 0.0000% 0.3505% 0.0000% 0.0000% 0.0000% 0.0843% 1.0333% 0.20% 0.14% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.2159% 0.0000% 0.19% 0.35% 0.0000% 0.0637% 0.0000% 0.0560% 0.0653% 0.6214% 1.7058% 0.18% 0.06% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.19% 0.35% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.19% 0.33% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1422% 0.0000% 0.19% 0.16% 0.1953% 0.0000% 0.0000% 0.1889% 0.0653% 0.5793% 0.1804% 0.19% 0.18% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2949% 0.1804% 0.19% 0.27% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0053% 0.0000% 0.17% 0.26% 0.0000% 0.2549% 0.0000% 0.0000% 0.0392% 0.0000% 0.0000% 0.17% 0.30% 0.0000% 0.0797% 0.0000% 0.0000% 0.0000% 0.0105% 0.4592% 0.17% 0.18% 1.5839% 0.2390% 0.0000% 0.0000% 0.0131% 0.1159% 0.0000% 0.17% 0.02% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1633% 0.0000% 0.16% 0.20% 0.1085% 0.0000% 0.0000% 0.4896% 0.6659% 0.1106% 0.0000% 0.16% 0.16% 2.5602% 0.3346% 0.0000% 0.0000% 0.0522% 0.0000% 2.7719% 0.16% 0.00% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.15% 0.16% 0.0000% 0.0797% 0.0000% 0.0070% 0.0000% 1.2482% 0.0000% 0.15% 0.20% 0.0217% 0.1912% 0.0000% 0.0280% 0.0392% 0.0316% 0.0820% 0.15% 0.11% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.15% 0.29% 2.6470% 0.2549% 0.0000% 0.0070% 0.1958% 0.0105% 2.2634% 0.15% 0.00% 0.0000% 0.0000% 0.0000% 0.0210% 0.1436% 0.4108% 0.0000% 0.15% 0.19% 0.7160% 3.9356% 0.0000% 0.0070% 0.0653% 0.0000% 1.1973% 0.14% 0.00% 0.0000% 0.0000% 0.0000% 0.3288% 0.0000% 0.0632% 0.0000% 0.14% 0.20% 0.0000% 0.0319% 0.0808% 0.0560% 0.0000% 1.1428% 0.0000% 0.14% 0.07% 0.3471% 0.0478% 0.0000% 0.0000% 0.0000% 0.4477% 0.0000% 0.13% 0.10% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.13% 0.07% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.13% 0.25% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.13% 0.00% 0.0000% 0.0000% 0.0000% 0.0070% 0.0000% 0.5635% 0.1640% 0.12% 0.08% 0.0000% 0.0000% 0.0000% 0.0280% 0.0000% 0.7584% 0.0000% 0.13% 0.19% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.13% 0.23% 1.8008% 0.1912% 0.0000% 0.0000% 0.1697% 0.0105% 1.4105% 0.12% 0.00% 0.0000% 0.0478% 0.0000% 0.2168% 0.0000% 0.2897% 0.0000% 0.12% 0.18% 0.6509% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.11% 0.19% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0053% 0.0000% 0.11% 0.20% 0.0000% 0.1912% 0.0000% 0.0000% 0.0000% 0.0105% 0.0000% 0.10% 0.15% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 2.4278% 0.0000% 0.10% 0.09% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1527% 0.0000% 0.10% 0.15% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.10% 0.04% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.10% 0.09% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0158% 0.0000% 0.10% 0.01% 0.0000% 0.0000% 0.0000% 0.0280% 0.0000% 0.3634% 0.0000% 0.09% 0.14% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.09% 0.03% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0158% 0.0492% 0.03% 0.05% 0.0000% 0.0000% 0.0000% 0.1749% 0.0000% 0.2581% 0.0000% 0.09% 0.14% 0.0000% 1.0198% 0.0000% 0.0000% 0.0000% 0.0000% 0.2132% 0.09% 0.04% 0.0000% 0.0000% 0.0000% 0.1259% 0.0000% 1.0270% 0.2132% 0.09% 0.09% 0.0000% 0.0319% 0.0000% 0.0000% 0.0000% 0.0263% 0.0000% 0.06% 0.12% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.08% 0.13% 0.0000% 0.0000% 0.0000% 0.0070% 0.0000% 0.0000% 0.0000% 0.08% 0.16% 0.0000% 0.0159% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.08% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 1.6747% 0.0000% 0.08% 0.08% 0.0000% 0.0478% 0.0000% 0.0000% 0.0000% 1.6642% 0.0000% 0.08% 0.08% 0.0000% 2.0076% 0.0000% 0.0000% 0.0000% 0.0000% 1.7386% 0.08% 0.00% 0.0000% 0.4621% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.08% 0.06% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.08% 0.14% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1422% 0.0000% 0.07% 0.08% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0053% 0.0000% 0.07% 0.13% 0.0651% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0328% 0.07% 0.13% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1685% 0.0000% 0.07% 0.11% 0.2387% 0.0000% 0.0000% 0.0000% 0.0000% 0.3739% 0.0000% 0.07% 0.03% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.07% 0.14% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.6320% 0.0000% 0.07% 0.11% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2788% 0.07% 0.10% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.3371% 0.3116% 0.07% 0.10% 0.0000% 0.1593% 0.0000% 0.0000% 0.0000% 0.0000% 1.9682% 0.07% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 1.6115% 0.0000% 0.07% 0.06% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.07% 0.13% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.4793% 0.0000% 0.07% 0.09% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0369% 0.0000% 0.07% 0.12% 2.0829% 0.0000% 0.0000% 0.0000% 0.0783% 0.0000% 0.7381% 0.07% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0737% 0.0000% 0.07% 0.12% 0.3688% 0.0319% 0.0000% 0.0210% 0.0131% 0.1843% 0.0820% 0.06% 0.07% 0.3038% 0.0000% 0.0000% 0.0140% 0.0000% 0.2475% 0.0000% 0.06% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0211% 0.0000% 0.06% 0.04% 0.0000% 0.1912% 0.0000% 0.0070% 0.0000% 0.0369% 0.0000% 0.06% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.06% 0.11% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0895% 0.0000% 0.06% 0.11% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0053% 0.0000% 0.06% 0.10% 0.3688% 0.0159% 0.0000% 0.0000% 0.1567% 0.0053% 1.0825% 0.06% 0.00% 0.1085% 1.9917% 0.0000% 0.0000% 0.0000% 0.0000% 0.1804% 0.06% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.06% 0.10% 0.0000% 0.0000% 0.0000% 0.0350% 0.0000% 0.5161% 0.2460% 0.04% 0.03% 0.0000% 1.7686% 0.0000% 0.0000% 0.0000% 0.0000% 0.7873% 0.05% 0.00% 0.0000% 0.0000% 0.0202% 0.0000% 0.0000% 0.0000% 0.0000% 0.05% 0.06% 0.0000% 0.0000% 2.4238% 0.0000% 0.0000% 0.0000% 0.0000% 0.05% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.05% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 2.1978% 0.05% 0.00% 0.0000% 0.0159% 0.0000% 0.0000% 0.0000% 0.0948% 0.0000% 0.05% 0.03% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.05% 0.09% 0.7594% 0.1753% 0.0000% 0.0000% 0.0392% 0.0053% 0.9021% 0.05% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.05% 0.09% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.8690% 0.0000% 0.05% 0.05% 0.0000% 0.0000% 0.0000% 0.0000% 0.0261% 0.0105% 0.0000% 0.05% 0.08% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.04% 0.02% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0053% 2.1814% 0.05% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 1.3318% 0.0000% 0.0000% 0.05% 0.03% 0.0000% 0.3824% 0.0000% 0.0000% 0.1045% 0.0000% 0.8037% 0.05% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0522% 0.0000% 0.0000% 0.05% 0.08% 0.0000% 0.2231% 0.0000% 0.0000% 0.1045% 0.0843% 0.0000% 0.05% 0.07% 0.4556% 0.0478% 0.0000% 0.0000% 0.0653% 0.0000% 0.0000% 0.05% 0.00% 0.0000% 1.6093% 0.0000% 0.0000% 0.0000% 0.0000% 0.5412% 0.05% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.05% 0.09% 0.0000% 0.2390% 0.0000% 0.0140% 0.0261% 0.0000% 0.0000% 0.04% 0.03% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.04% 0.04% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.04% 0.08% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0820% 0.04% 0.02% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.04% 0.00% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.04% 0.07% 0.0000% 1.8164% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.04% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.04% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0053% 0.0000% 0.04% 0.01% 0.0000% 0.1115% 0.0000% 0.0000% 0.0261% 0.0000% 0.0000% 0.04% 0.00% 0.0000% 0.1115% 0.0000% 0.0000% 0.0000% 0.0105% 0.6889% 0.04% 0.03% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0685% 0.0000% 0.04% 0.06% 0.0000% 0.0956% 0.0000% 0.0000% 0.0653% 0.1685% 0.0820% 0.03% 0.03% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0105% 0.0000% 0.03% 0.03% 0.0000% 0.2549% 0.0000% 0.0000% 0.0000% 0.0000% 1.2957% 0.03% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.03% 0.06% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.03% 0.06% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.03% 0.06% 0.0000% 0.0797% 0.0000% 0.0000% 0.0000% 0.0053% 0.0000% 0.01% 0.01% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.1738% 0.0000% 0.03% 0.02% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2423% 0.0000% 0.03% 0.02% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.03% 0.05% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.3792% 0.0000% 0.03% 0.04% 0.0000% 0.1115% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.03% 0.05% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.03% 0.04% 0.0000% 0.0000% 0.0000% 0.0000% 0.0392% 0.0000% 1.0825% 0.03% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.03% 0.02% 0.0000% 0.7011% 0.0000% 0.0000% 0.0000% 0.0000% 0.7217% 0.03% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0105% 0.6725% 0.03% 0.02% 0.0000% 0.0159% 0.0000% 0.0000% 0.0000% 0.0000% 0.0656% 0.03% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.1567% 0.0000% 0.0000% 0.03% 0.02% 0.0000% 0.1434% 0.0000% 0.0000% 0.0000% 0.0421% 0.0000% 0.02% 0.03% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1369% 0.0000% 0.03% 0.05% 0.0000% 0.0000% 0.0000% 0.0000% 0.0131% 0.0211% 0.0000% 0.03% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1633% 0.0000% 0.03% 0.02% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.03% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.03% 0.05% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 1.2957% 0.03% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0656% 0.03% 0.05% 0.0000% 0.0000% 0.0000% 0.0000% 0.0261% 0.0000% 1.2301% 0.03% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.1436% 0.0685% 0.0000% 0.03% 0.04% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 1.2137% 0.03% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.03% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.03% 0.05% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.03% 0.04% 0.0000% 0.0000% 0.0000% 0.0070% 0.0522% 0.0000% 0.0000% 0.03% 0.03% 0.0000% 0.1434% 0.0000% 0.0000% 0.0000% 0.0263% 0.0000% 0.02% 0.01% 0.4990% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.3936% 0.02% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0053% 0.1640% 0.02% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.02% 0.04% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.02% 0.05% 0.0000% 0.0000% 1.1311% 0.0000% 0.0000% 0.0000% 0.0000% 0.02% 0.00% 1.1282% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.02% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1685% 0.0000% 0.02% 0.03% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0737% 0.0000% 0.02% 0.04% 0.5858% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.4428% 0.02% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0421% 0.2460% 0.02% 0.03% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.02% 0.00% 0.0000% 0.0637% 0.0000% 0.0070% 0.0522% 0.0053% 0.6397% 0.02% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0653% 0.0000% 0.0000% 0.02% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.02% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0053% 0.2624% 0.02% 0.03% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.4161% 0.0000% 0.02% 0.02% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0211% 0.2296% 0.02% 0.02% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.02% 0.04% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.02% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.02% 0.03% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0105% 0.0000% 0.02% 0.03% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0632% 0.0000% 0.02% 0.03% 0.3905% 0.0956% 0.0000% 0.0000% 0.0000% 0.0000% 0.2296% 0.02% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0105% 0.0000% 0.02% 0.03% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.4740% 0.0000% 0.02% 0.02% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.02% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.02% 0.03% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0105% 0.3444% 0.02% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0316% 0.0000% 0.02% 0.03% 0.0000% 0.0000% 0.0000% 0.0070% 0.0000% 0.0158% 0.0000% 0.02% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2296% 0.01% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.02% 0.03% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.02% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.03% 0.0000% 0.2071% 0.0000% 0.0000% 0.0000% 0.0000% 0.6233% 0.02% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0632% 0.0000% 0.01% 0.00% 0.0000% 0.0637% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.02% 0.02% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.02% 0.02% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2107% 0.2952% 0.02% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.02% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.02% 0.03% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.02% 0.03% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.7381% 0.02% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.4428% 0.02% 0.01% 0.1953% 0.1753% 0.0000% 0.0000% 0.0000% 0.0000% 0.1968% 0.02% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0522% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1001% 0.0000% 0.02% 0.02% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.03% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.03% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.02% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.03% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0158% 0.0000% 0.01% 0.02% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.03% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0653% 0.0000% 0.0000% 0.01% 0.02% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.02% 0.2170% 0.0000% 0.0000% 0.0000% 0.0653% 0.0053% 0.0000% 0.01% 0.00% 0.0000% 0.2071% 0.0000% 0.0000% 0.0000% 0.0790% 0.0000% 0.01% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.03% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0105% 0.0000% 0.01% 0.02% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.3444% 0.01% 0.01% 0.0000% 0.0000% 0.0000% 0.0280% 0.0000% 0.0263% 0.0000% 0.01% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.2821% 0.0000% 0.0000% 0.0000% 0.0000% 0.0316% 0.0000% 0.01% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0158% 0.0000% 0.01% 0.02% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.5741% 0.01% 0.00% 0.0000% 0.0637% 0.0000% 0.0000% 0.0914% 0.0000% 0.2460% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.02% 0.0000% 0.0319% 0.0000% 0.0070% 0.0000% 0.0632% 0.0000% 0.01% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.02% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0053% 0.0000% 0.01% 0.02% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.02% 0.0000% 0.1753% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.01% 0.0000% 0.1593% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0478% 0.0000% 0.0000% 0.0000% 0.0000% 0.4920% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.4773% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0053% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0105% 0.0000% 0.01% 0.02% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.5084% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2370% 0.0000% 0.01% 0.01% 0.0000% 0.4621% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.02% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.02% 0.0000% 0.0956% 0.0000% 0.0000% 0.0000% 0.0000% 0.3772% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.4920% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0158% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.02% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.4756% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.02% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.4621% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0263% 0.0000% 0.01% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.3444% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.2604% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1804% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.02% 0.0000% 0.1275% 0.0000% 0.0000% 0.0000% 0.0000% 0.2788% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.1749% 0.0000% 0.0000% 0.0000% 0.01% 0.01% 0.0000% 0.3505% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0434% 0.0159% 0.0000% 0.0070% 0.0000% 0.0000% 0.0000% 0.01% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.4264% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0053% 0.0000% 0.01% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.02% 0.0000% 0.4143% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.4143% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.3772% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.4100% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.02% 0.2604% 0.0797% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0527% 0.0000% 0.01% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.3471% 0.0000% 0.0000% 0.0000% 0.0522% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0637% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0319% 0.0000% 0.0070% 0.0000% 0.0053% 0.0000% 0.01% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.2821% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.1085% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0105% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.3280% 0.01% 0.00% 0.0000% 0.2868% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0527% 0.0000% 0.01% 0.01% 0.0000% 0.3665% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.3608% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0211% 0.0000% 0.01% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0053% 0.0000% 0.01% 0.01% 0.3038% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.3471% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0070% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.3280% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.3280% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0053% 0.0000% 0.01% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0316% 0.0000% 0.01% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0053% 0.0000% 0.01% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0053% 0.0000% 0.01% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.01% 0.0000% 0.0000% 0.2626% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0105% 0.0000% 0.01% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.01% 0.0434% 0.0956% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0053% 0.0000% 0.01% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2788% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2788% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0316% 0.0000% 0.01% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.01% 0.0000% 0.2071% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.01% 0.0000% 0.1434% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0319% 0.0000% 0.0000% 0.0000% 0.0158% 0.0000% 0.01% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0053% 0.0000% 0.01% 0.01% 0.1085% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0820% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1804% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1633% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2460% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0263% 0.0000% 0.01% 0.01% 0.0000% 0.2390% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.01% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.1085% 0.0000% 0.0000% 0.0420% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0632% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0522% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.1593% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.01% 0.0000% 0.2231% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0797% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.01% 0.2170% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0070% 0.0000% 0.0000% 0.0000% 0.00% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2132% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2132% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2132% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.2132% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0956% 0.0000% 0.0000% 0.0000% 0.0000% 0.1148% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0105% 0.0000% 0.00% 0.00% 0.0651% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0492% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.01% 0.0000% 0.2071% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0421% 0.0000% 0.00% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0261% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0478% 0.0000% 0.0000% 0.1306% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.01% 0.0217% 0.1753% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1148% 0.00% 0.00% 0.0651% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0319% 0.0000% 0.0000% 0.0000% 0.0000% 0.1476% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0474% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0319% 0.0000% 0.0000% 0.0000% 0.0000% 0.0984% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0105% 0.0000% 0.00% 0.01% 0.0000% 0.1115% 0.0000% 0.0000% 0.0653% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0579% 0.0000% 0.00% 0.00% 0.0000% 0.1753% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1312% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1640% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1640% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1640% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0956% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.1085% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.01% 0.1519% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.1519% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.1519% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0637% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0159% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.1434% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0053% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0158% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.01% 0.0000% 0.0478% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.1275% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.1275% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.1275% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.01% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0316% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0105% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0261% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1148% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1148% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1148% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.1148% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.1115% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0053% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0261% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0158% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0797% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0105% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0656% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0984% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0984% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0984% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0984% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0956% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0105% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0914% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0914% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0105% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0868% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0217% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0053% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0263% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0211% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0820% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0820% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0820% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0159% 0.0000% 0.0000% 0.0653% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0053% 0.0000% 0.00% 0.00% 0.0000% 0.0797% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0797% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0797% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0783% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0783% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0158% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0316% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0421% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0656% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0653% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0053% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0210% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0637% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0070% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0158% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0158% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0392% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0492% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0478% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0478% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0478% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0478% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0478% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0105% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0105% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0105% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0053% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0159% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0202% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0263% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0053% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0392% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0392% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0392% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0105% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0159% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0053% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0211% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0053% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0328% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0319% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0319% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0319% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0053% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0263% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0261% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0261% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0261% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0105% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0070% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0210% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0131% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0131% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0202% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0202% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0053% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0053% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0053% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0070% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0164% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0164% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0053% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0053% 0.0000% 0.00% 0.00% 0.0000% 0.0159% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0053% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0053% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0140% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0131% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0105% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0105% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0105% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0105% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0105% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0053% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0053% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0053% 0.0000% 0.00% 0.00% 0.0000% 0.0000% 0.0000% 0.0000% 0.0000% 0.0053% 0.0000% 0.00% 0.00% Control 14.47% 8.53% 10.83% 0.04% 0.76% 3.11% 0.20% 2.57% 0.34% 0.46% 1.73% 1.80% 2.62% 4.17% 0.25% 0.10% 1.76% 3.18% 2.70% 2.64% 2.21% 0.00% 2.42% 0.48% 1.19% 0.06% 0.65% 0.44% 0.43% 0.12% 1.09% 0.75% 0.01% 0.02% 0.29% 0.00% 0.96% 0.61% 0.38% 0.53% 0.03% 0.85% 0.71% 0.16% 0.24% 0.68% 0.58% 0.55% 0.65% 0.72% 0.45% 0.07% 0.08% 0.07% 0.57% 0.16% 0.16% 0.49% 0.49% 0.50% 0.27% 0.21% 0.45% 0.03% 0.00% 0.03% 0.01% 0.18% 0.15% 0.05% 0.16% 0.28% 0.02% 0.32% 0.02% 0.04% 0.23% 0.20% 0.10% 0.08% 0.03% 0.16% 0.33% 0.13% 0.17% 0.34% 0.14% 0.09% 0.21% 0.00% 0.32% 0.10% 0.31% 0.07% 0.22% 0.16% 0.21% 0.00% 0.28% 0.16% 0.05% 0.01% 0.26% 0.04% 0.03% 0.00% 0.05% 0.11% 0.04% 0.17% 0.11% 0.20% 0.04% 0.16% 0.01% 0.04% 0.14% 0.08% 0.00% 0.01% 0.00% 0.17% 0.08% 0.08% 0.17% 0.09% 0.00% 0.06% 0.01% 0.01% 0.03% 0.12% 0.00% 0.03% 0.03% 0.04% 0.14% 0.07% 0.00% 0.04% 0.00% 0.14% 0.00% 0.06% 0.12% 0.09% 0.12% 0.00% 0.00% 0.00% 0.12% 0.11% 0.00% 0.05% 0.12% 0.05% 0.11% 0.11% 0.11% 0.06% 0.00% 0.11% 0.00% 0.05% 0.01% 0.06% 0.10% 0.07% 0.10% 0.01% 0.02% 0.10% 0.10% 0.00% 0.06% 0.04% 0.00% 0.07% 0.09% 0.00% 0.09% 0.08% 0.07% 0.08% 0.05% 0.01% 0.04% 0.03% 0.07% 0.00% 0.00% 0.00% 0.01% 0.04% 0.04% 0.01% 0.02% 0.01% 0.02% 0.07% 0.05% 0.06% 0.03% 0.04% 0.04% 0.02% 0.01% 0.06% 0.04% 0.06% 0.00% 0.06% 0.00% 0.06% 0.02% 0.06% 0.05% 0.00% 0.01% 0.02% 0.03% 0.05% 0.05% 0.01% 0.00% 0.05% 0.05% 0.01% 0.00% 0.05% 0.01% 0.00% 0.05% 0.05% 0.04% 0.04% 0.01% 0.02% 0.02% 0.00% 0.04% 0.01% 0.00% 0.00% 0.04% 0.00% 0.02% 0.04% 0.00% 0.04% 0.01% 0.04% 0.02% 0.00% 0.04% 0.00% 0.04% 0.03% 0.01% 0.01% 0.02% 0.03% 0.00% 0.00% 0.03% 0.02% 0.03% 0.02% 0.01% 0.00% 0.03% 0.00% 0.03% 0.00% 0.00% 0.00% 0.03% 0.00% 0.03% 0.00% 0.00% 0.03% 0.01% 0.00% 0.00% 0.02% 0.01% 0.02% 0.01% 0.02% 0.00% 0.03% 0.03% 0.00% 0.01% 0.00% 0.00% 0.00% 0.02% 0.02% 0.02% 0.00% 0.02% 0.02% 0.00% 0.02% 0.02% 0.01% 0.02% 0.00% 0.02% 0.00% 0.02% 0.02% 0.02% 0.00% 0.02% 0.00% 0.02% 0.02% 0.02% 0.02% 0.00% 0.02% 0.02% 0.02% 0.00% 0.02% 0.01% 0.02% 0.02% 0.01% 0.01% 0.02% 0.01% 0.00% 0.02% 0.02% 0.02% 0.02% 0.00% 0.02% 0.01% 0.01% 0.02% 0.02% 0.02% 0.02% 0.02% 0.01% 0.01% 0.02% 0.02% 0.02% 0.02% 0.00% 0.02% 0.01% 0.00% 0.01% 0.02% 0.02% 0.01% 0.01% 0.00% 0.00% 0.02% 0.02% 0.02% 0.01% 0.01% 0.00% 0.01% 0.01% 0.01% 0.01% 0.01% 0.00% 0.00% 0.01% 0.00% 0.01% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.01% 0.00% 0.01% 0.01% 0.00% 0.01% 0.00% 0.00% 0.01% 0.00% 0.01% 0.00% 0.01% 0.00% 0.00% 0.01% 0.01% 0.01% 0.01% 0.00% 0.01% 0.01% 0.01% 0.01% 0.00% 0.01% 0.00% 0.01% 0.01% 0.00% 0.00% 0.01% 0.01% 0.01% 0.00% 0.00% 0.01% 0.01% 0.00% 0.01% 0.01% 0.01% 0.01% 0.01% 0.01% 0.00% 0.00% 0.00% 0.01% 0.01% 0.01% 0.01% 0.00% 0.01% 0.00% 0.01% 0.01% 0.01% 0.01% 0.01% 0.01% 0.00% 0.01% 0.01% 0.00% 0.01% 0.01% 0.00% 0.00% 0.01% 0.01% 0.01% 0.01% 0.00% 0.01% 0.00% 0.01% 0.00% 0.01% 0.00% 0.00% 0.00% 0.00% 0.00% 0.01% 0.01% 0.00% 0.01% 0.01% 0.00% 0.01% 0.00% 0.00% 0.01% 0.01% 0.01% 0.00% 0.01% 0.00% 0.00% 0.00% 0.01% 0.01% 0.01% 0.01% 0.01% 0.01% 0.01% 0.01% 0.01% 0.00% 0.00% 0.01% 0.01% 0.00% 0.01% 0.01% 0.01% 0.00% 0.01% 0.01% 0.01% 0.00% 0.01% 0.01% 0.00% 0.00% 0.00% 0.00% 0.01% 0.01% 0.01% 0.01% 0.01% 0.00% 0.01% 0.01% 0.01% 0.01% 0.00% 0.00% 0.00% 0.00% 0.00% 0.01% 0.00% 0.00% 0.01% 0.01% 0.01% 0.01% 0.01% 0.01% 0.00% 0.00% 0.00% 0.00% 0.00% 0.01% 0.00% 0.00% 0.01% 0.01% 0.00% 0.01% 0.01% 0.00% 0.01% 0.00% 0.01% 0.01% 0.01% 0.01% 0.01% 0.01% 0.01% 0.01% 0.00% 0.01% 0.00% 0.01% 0.00% 0.01% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% APPENDIX 4.4

Table S4.List of taxa exclusively identified in either group at prevalence ≥ 15%

Exclusively in OSCC % Exclusively in Controls % Actinomyces cardiffensis 24.00% Ralstoniapic kettii 52.17%

Streptococcus sp. oral taxon 070 nov 94.80% 20.00% Achromobacterxylosoxidans 52.17%

Treponema lecithinolyticum 16.00% Stenotrophomonasmaltophilia 52.17%

Prevotella loescheii 16.00% Caulobactercrescentus 39.13%

Pseudomonas pseudoalcaligenes 30.43%

Cardiobacteriumhominis 26.09%

Leptotrichiagoodfellowii 26.09%

Staphylococcus hominis 21.74%

Acinetobacter lwoffii 21.74%

Bergeyella sp. oral taxon 422 21.74%

Pseudomonas fluorescens 21.74%

Actinomycesmassiliensis 21.74%

Neisseria sp. oral taxon 020 17.39%

Sphingomonasechinoides 17.39%

Corynebacterium mucifaciens 17.39%

Boseavestrisii 17.39%

Diaphorobacternitroreducens Oral Taxon A07 17.39%

Sphingomonasroseiflava 17.39%

Pseudomonas mosselii Oral Taxon A88 17.39%

Stenotrophomonashibiscicola 17.39%

Actinobaculum sp. oral taxon 848 17.39%

Agrobacterium tumefaciensnov 83.94% 17.39%

No the G-test is another way to identify differentially abundant taxa between the two groups; i.e., it is supplementary to LEfSe. Find attached the table listing taxa that were exclusively identified in either group at >15%. APPENDIX 5.1

Status Cancer Cancer Cancer Cancer Cancer Cancer Cancer Cancer ID C2 C3 C4 C5 C6 C8 C9 C10 Ascomycota 33.987% 40.418% 39.436% 99.347% 86.916% 99.974% 64.104% 48.330% Basidiomycota 66.013% 59.582% 60.564% 0.653% 13.084% 0.026% 35.896% 51.670%

Cancer Cancer Cancer Cancer Cancer Cancer Cancer Cancer Cancer C11 C12 C14 C15 C17 C18 C19 C20 C21 48.100% 78.886% 99.981% 99.971% 93.485% 99.794% 98.988% 62.500% 99.571% 51.900% 21.114% 0.019% 0.029% 6.515% 0.206% 1.012% 37.500% 0.429%

Cancer Cancer Cancer Cancer Cancer Control Control Control Control C22 C23 C24 C26 C27 N1 N2 N3 N4 99.944% 90.004% 99.826% 99.927% 99.954% 34.538% 88.226% 92.526% 95.956% 0.056% 9.996% 0.174% 0.073% 0.046% 65.462% 11.774% 7.474% 4.044%

Control Control Control Control Control Control Control Control Control N5 N6 N7 N8 N9 N11 N12 N13 N14 72.688% 92.412% 72.268% 65.296% 72.934% 4.949% 64.195% 45.111% 19.175% 27.312% 7.588% 27.732% 34.704% 27.066% 95.051% 35.805% 54.889% 80.825%

Control Control Control Control Control Control Control Control Control N15 N16 N17 N18 N19 N20 N21 N23 N24 98.312% 99.676% 99.683% 90.962% 83.098% 88.453% 53.988% 99.926% 99.765% 1.688% 0.324% 0.317% 9.038% 16.902% 11.547% 46.012% 0.074% 0.235%

Control Control Control Overall OSCC Control N25 N26 N27 77.242% 92.946% 99.961% 78.462% 81.066% 76.171% 22.758% 7.054% 0.039% 21.538% 18.934% 23.829% APPENDIX 5.2

Status Cancer Cancer Cancer Cancer Cancer Cancer ID C2 C3 C4 C5 C6 C8 Candida 33.83799% 1.16121% 2.23624% 99.12599% 85.95894% 99.96718% Malassezia 4.42272% 14.24682% 14.54022% 0.51115% 10.36907% 0.02188% Cladosporium 0.01788% 2.25034% 12.46172% 0.01262% 0.00187% 0.00182% Aspergillus 0.00000% 1.27332% 0.14846% 0.02524% 0.30288% 0.00547% Didymella 0.00000% 0.00000% 0.00000% 0.00316% 0.00000% 0.00000% Pseudorobillarda 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Ophiocordyceps 0.00000% 0.52054% 0.00000% 0.00000% 0.00000% 0.00000% Rhodotorula 54.23496% 0.00000% 0.00928% 0.00000% 0.00000% 0.00000% Eremascus 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Sarcinomyces 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Alternaria 0.00000% 0.00000% 24.58012% 0.00000% 0.00000% 0.00000% Talaromyces 0.00000% 0.00000% 0.00000% 0.00000% 0.35897% 0.00000% Penicillium 0.04172% 25.61864% 0.00000% 0.00000% 0.21688% 0.00000% Skeletocutis 0.00000% 0.00000% 46.00538% 0.00000% 0.00000% 0.00000% Mycoacia 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Trametes 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Peniophora 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Xenocamarosporium 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Hanseniaspora 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Sporidiobolus 0.00000% 31.12037% 0.00000% 0.00000% 0.00000% 0.00000% Gibberella 0.00000% 0.00801% 0.00000% 0.00000% 0.00000% 0.00000% Exidia 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Xenasma 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Aureobasidium 0.00000% 0.00000% 0.00000% 0.00631% 0.00000% 0.00000% Coniosporium 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Davidsoniella 0.00000% 0.00000% 0.00000% 0.00000% 0.00187% 0.00000% Pseudoseptoria 0.00000% 6.36662% 0.00000% 0.00000% 0.00000% 0.00000% Hannaella 0.00000% 0.00000% 0.00928% 0.00316% 0.00000% 0.00182% Meyerozyma 0.00000% 0.00000% 0.00000% 0.00000% 0.07292% 0.00000% Sympodiomycopsis 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Toxicocladosporium 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Colletotrichum 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Gymnopus 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Trichoderma 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% multigenus 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Debaryomyces 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Campanella 0.00000% 11.89237% 0.00000% 0.00000% 0.00000% 0.00000% Botryobasidium 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Rhizochaete 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Mycena 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Zygophiala 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Xylographa 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Cystidiodontia 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Amylosporus 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Neosetophoma 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Kodamaea 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Saccharomyces 0.08941% 0.22423% 0.00000% 0.00316% 0.00000% 0.00000% Phanerochaete 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Cordana 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Phaeosphaeriopsis 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Sidera 7.35531% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Cryptococcus 0.00000% 0.04004% 0.00000% 0.13568% 0.00000% 0.00000% Curvularia 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Coniochaeta 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Sistotrema 0.00000% 1.10515% 0.00000% 0.00000% 0.00000% 0.00000% Acremonium 0.00000% 0.00000% 0.00000% 0.00631% 0.00000% 0.00000% Ochrocladosporium 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Xanthoporia 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Neodevriesia 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Comoclathris 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Phyllotopsis 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Setophaeosphaeria 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Hymenochaete 0.00000% 0.24826% 0.00000% 0.00000% 0.00000% 0.00000% Eupenidiella 0.00000% 0.02402% 0.00000% 0.01262% 0.00000% 0.00000% Phaeococcomyces 0.00000% 0.00000% 0.00000% 0.09466% 0.00000% 0.00000% Vamsapriya 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Dioszegia 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Periconia 0.00000% 0.00000% 0.00000% 0.00000% 0.00187% 0.00000% Ilyonectria 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Gaeumannomyces 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Gloeodontia 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Phaeothecoidea 0.00000% 2.97109% 0.00000% 0.00000% 0.00000% 0.00000% Geastrumia 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Brevicellicium 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Tubeufia 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Hydnopolyporus 0.00000% 0.00000% 0.00000% 0.00000% 2.56329% 0.00000% Clavulinopsis 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Passalora 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Phlebia 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Tremella 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Exophiala 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Melnikomyces 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% multigenus 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Darksidea 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Strelitziana 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Cyphellophora 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Hyphopichia 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Marasmius 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Incertomyces 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Lasiodiplodia 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Ramichloridium 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Fusarium 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Ophiostoma 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Quambalaria 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Chaetomium 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Cylindrobasidium 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Stachybotrys 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Sporobolomyces 0.00000% 0.24826% 0.00000% 0.00000% 0.00000% 0.00182% Wallemia 0.00000% 0.67270% 0.00000% 0.00000% 0.00000% 0.00000% Uwebraunia 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Xenopenidiella 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Cytospora 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Rectipilus 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% multigenus 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Diatrype 0.00000% 0.00000% 0.00000% 0.02209% 0.00000% 0.00000% Acanthostigma 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Botrytis 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Basidiodendron 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Pestalotiopsis 0.00000% 0.00000% 0.00000% 0.00316% 0.00000% 0.00000% Neophysalospora 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Podosphaera 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Microascus 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Fuscoporia 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Clavispora 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Phaeocryptopus 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Amyloxenasma 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Leptospora 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Piloderma 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Ophiosphaerella 0.00000% 0.00000% 0.00000% 0.00947% 0.00000% 0.00000% Sarocladium 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Celerioriella 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% multigenus 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Antrodiella 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Pseudochaete 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Rhodosporidium 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Nigrospora 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Pertusaria 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Ceriporia 0.00000% 0.00000% 0.00000% 0.00000% 0.14957% 0.00000% Lodderomyces 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Microdochium 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Hyphodontia 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Phoma 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Resinicium 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Cystocoleus 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Stagonosporopsis 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Verrucoconiothyrium 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Rhinocladiella 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Omnidemptus 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Mycosphaerella 0.00000% 0.00000% 0.00928% 0.00000% 0.00000% 0.00000% Pichia 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Myrmecridium 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Cadophora 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Penidiella 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Valsa 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Fibrodontia 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Devriesia 0.00000% 0.00000% 0.00000% 0.01578% 0.00000% 0.00000% Coniothyrium 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Pyrenochaeta 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Neofusicoccum 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Epicoccum 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Xenobotrytis 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Stenella 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Suillus 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Ramopenidiella 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Marasmiellus 0.00000% 0.00801% 0.00000% 0.00000% 0.00000% 0.00000% Phyllosticta 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Knufia 0.00000% 0.00000% 0.00000% 0.00631% 0.00000% 0.00000% Issatchenkia 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Lophodermium 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Cyberlindnera 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Sterigmatomyces 0.00000% 0.00000% 0.00000% 0.00316% 0.00000% 0.00000% Pilatoporus 0.00000% 0.00000% 0.00000% 0.00000% 0.00187% 0.00000% Cancer Cancer Cancer Cancer Cancer Cancer Cancer Cancer C9 C10 C11 C12 C14 C15 C17 C18 11.87251% 2.33865% 0.57891% 54.94921% 99.26025% 99.95754% 89.67395% 99.76047% 7.85857% 22.42597% 35.69091% 10.30593% 0.01913% 0.02919% 2.50136% 0.06137% 0.38845% 3.94457% 0.00000% 0.00000% 0.15305% 0.00000% 0.00000% 0.00198% 0.91633% 22.31967% 2.36597% 3.46090% 0.01913% 0.00000% 0.06352% 0.00990% 0.00000% 0.00000% 0.00000% 0.00000% 0.00319% 0.00265% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.06049% 0.00000% 0.00000% 0.00000% 1.05714% 0.00000% 0.00000% 0.00000% 0.00000% 0.07324% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 3.62350% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00319% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 1.68320% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.52857% 0.00000% 0.14349% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00591% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.09112% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 2.45020% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 1.47299% 0.00000% 0.00000% 0.34928% 36.21948% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 31.84263% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.02517% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 19.37737% 5.53738% 0.00000% 0.08609% 0.00000% 0.05747% 0.00000% 25.58765% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00302% 0.00000% 0.00000% 0.00000% 0.95646% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 18.79282% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 15.77828% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01061% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 14.06375% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 2.23108% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 1.27563% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.07126% 0.00000% 0.00000% 0.00000% 10.80203% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 9.28769% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 1.69323% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01782% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 3.25361% 0.00000% 0.00000% 0.00000% 0.00000% 0.97695% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01913% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.65442% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.16899% 0.00000% 0.00302% 0.00000% 0.00000% 4.77980% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.23592% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 3.76614% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 3.04556% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 2.13944% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 1.91291% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 1.24917% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 1.09562% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.02551% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.10630% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00319% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.04464% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.19362% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01275% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00319% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.07864% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01594% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00957% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00638% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00396% 0.00000% 0.00000% 0.00000% 0.00000% 0.00319% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Cancer Cancer Cancer Cancer Cancer Cancer Cancer Cancer C19 C20 C21 C22 C23 C24 C26 C27 98.72446% 5.80249% 99.42767% 95.78888% 4.33754% 99.53835% 94.20443% 99.43193% 0.18793% 20.44144% 0.42463% 0.05615% 9.99606% 0.14627% 0.03790% 0.02840% 0.24391% 0.00000% 0.09231% 0.00000% 45.01183% 0.17826% 0.00541% 0.22723% 0.00800% 24.78004% 0.02308% 0.56148% 0.00000% 0.00000% 1.00698% 0.04588% 0.00400% 31.10589% 0.00462% 0.00000% 0.00000% 0.00457% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00758% 0.00000% 0.00000% 0.00000% 0.01371% 0.00000% 0.00000% 0.16794% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00462% 0.00000% 40.63486% 0.00000% 3.14006% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.15441% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.03519% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.77204% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01972% 0.00000% 0.00812% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00271% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00218% 0.00000% 15.14715% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.39442% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.06773% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00457% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.65576% 0.00000% 0.00000% 0.00000% 0.00000% 0.00914% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.02285% 0.00000% 0.00437% 0.00800% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00462% 0.00000% 0.00000% 0.00914% 0.00000% 0.01748% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.38683% 0.00000% 0.84222% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.94053% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00914% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 1.55920% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 1.02471% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01529% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.97087% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.07019% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.14202% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.28074% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.12633% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.15441% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.09826% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.07019% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.02275% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.02285% 0.00000% 0.00000% 0.00000% 0.00000% 0.01846% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01828% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01748% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01371% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00914% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Control Control Control Control Control Control Control Control N1 N2 N3 N4 N5 N6 N7 N8 11.59682% 0.06831% 40.97849% 79.66700% 6.89544% 0.01502% 1.92525% 13.18052% 63.89692% 11.76703% 7.33864% 0.03872% 13.33765% 7.58759% 14.32616% 0.00000% 21.71243% 7.85907% 6.64898% 4.14749% 19.93094% 12.60260% 18.31823% 37.30926% 0.55395% 0.00360% 9.37224% 0.43024% 20.53523% 0.00000% 1.92525% 1.18611% 0.00000% 0.00000% 0.00000% 0.03872% 0.00000% 0.00000% 2.83126% 0.29320% 0.00000% 80.28761% 0.00589% 0.00430% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00360% 0.00000% 2.23723% 0.00000% 51.28629% 9.98018% 0.00000% 0.00000% 0.00000% 0.00000% 0.48187% 10.90968% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00430% 0.00000% 10.13013% 0.00000% 0.00000% 0.01204% 0.00360% 29.37224% 0.00000% 0.02158% 0.00501% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 11.30895% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.31407% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00360% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.51198% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01291% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00360% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 21.28340% 0.00000% 0.00000% 0.00000% 0.03012% 0.00000% 0.00000% 19.83296% 0.00000% 0.01204% 0.00000% 6.14795% 0.30547% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00860% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.74861% 0.00000% 0.00000% 8.50793% 0.00000% 0.00000% 0.00000% 0.13557% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 12.87399% 0.01204% 0.00000% 0.00000% 0.17640% 0.00000% 0.00000% 0.00000% 0.00000% 0.01204% 0.00000% 0.00000% 0.00000% 0.00000% 0.01001% 0.00000% 12.52082% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 2.90204% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 2.84882% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 10.03003% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 9.42809% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01291% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.71966% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 7.82783% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 1.07588% 0.24655% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.23663% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 4.47339% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 3.97108% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 4.40260% 0.00000% 1.56551% 0.00000% 0.00000% 0.61524% 0.22661% 0.00000% 0.00000% 0.00000% 0.28902% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 3.77684% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 3.61399% 0.00000% 0.00000% 0.01416% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 3.39916% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 2.83803% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.29256% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 1.11001% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01721% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.91640% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.37861% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.19268% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.50551% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.63245% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.33128% 0.00000% 0.00000% 0.00000% 0.29986% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.53780% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.48617% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.40873% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01721% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.40442% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.02581% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.39582% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.14451% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.19791% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.11186% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01721% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.08663% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.04247% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01721% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01721% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01416% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01291% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01291% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01291% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00860% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Control Control Control Control Control Control Control Control N9 N11 N12 N13 N14 N15 N16 N17 2.11820% 0.04509% 17.78408% 0.14485% 0.09018% 60.42257% 98.33493% 98.92013% 15.35042% 95.05129% 35.50905% 45.31816% 6.41701% 1.67611% 0.21517% 0.31186% 30.33473% 2.93090% 0.00000% 0.00000% 2.76235% 21.89566% 0.07283% 0.00000% 1.18550% 0.01127% 11.51709% 28.47387% 5.36333% 5.81917% 0.03972% 0.25135% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00993% 0.00465% 11.64575% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00465% 0.00872% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.48473% 0.00000% 0.00000% 0.00000% 0.00000% 0.12248% 0.00000% 0.00000% 0.00000% 15.69114% 3.15572% 0.00000% 0.00000% 0.27144% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.54297% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.53173% 0.00000% 0.00000% 0.00000% 43.63283% 0.01180% 0.00331% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 30.77507% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 1.34240% 1.47672% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00931% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.06516% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 12.01372% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.46199% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.02979% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 12.40411% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 10.21618% 0.00000% 0.00000% 0.06208% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 10.24233% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 7.18931% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 9.05335% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 2.45859% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.81939% 0.00000% 0.00000% 0.00000% 4.91243% 0.00000% 0.00000% 0.00000% 0.54045% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 4.45939% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 6.16658% 0.00000% 0.00000% 0.01655% 0.00000% 0.00872% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 4.66632% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.17434% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 3.72478% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 3.13502% 0.00000% 0.07082% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 2.38265% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.08277% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.19935% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.50755% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.95401% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.83682% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.09600% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.41841% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.55613% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.05221% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.21728% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.43288% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.37483% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.39226% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.36213% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.29561% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.23172% 0.00000% 0.20049% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.20049% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.19177% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.03104% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Control Control Control Control Control Control Control Control N18 N19 N20 N21 N23 N24 N25 N26 66.77960% 33.81945% 24.59093% 0.00598% 99.63184% 99.36442% 30.47017% 0.15581% 8.95307% 12.86277% 1.80770% 0.55011% 0.07416% 0.16302% 14.50810% 3.72539% 0.00000% 0.02917% 11.06436% 0.00000% 0.02119% 0.05365% 22.96326% 0.07082% 5.08216% 0.32084% 21.08462% 1.41713% 0.14832% 0.00000% 2.37060% 1.36456% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 91.21299% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01458% 2.82063% 0.00000% 0.00000% 0.25382% 0.00000% 0.03305% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 47.66802% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.33542% 0.00000% 1.05238% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 16.44070% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 21.07336% 0.00000% 0.00000% 0.00000% 0.00619% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01558% 45.46161% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 2.27521% 0.00000% 0.00000% 0.00000% 0.00000% 2.29473% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.03708% 0.00000% 0.00000% 0.03777% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 10.69143% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 5.86330% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 14.39405% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.07292% 0.00000% 0.00000% 0.00000% 0.02064% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.02833% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00619% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 3.96675% 1.48044% 0.00000% 0.00000% 0.00000% 0.00000% 1.03404% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 7.19973% 0.01458% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 8.01287% 0.01458% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 8.06796% 0.00000% 0.00000% 4.87093% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 1.26227% 0.00000% 0.00000% 0.00206% 0.00000% 0.00000% 0.00000% 0.80210% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 5.76054% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00825% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.80210% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 4.69067% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.08470% 0.00000% 0.00000% 0.00000% 0.00000% 0.06191% 0.18175% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 3.77716% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.02270% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01580% 0.00000% 0.00000% 0.00000% 2.96089% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 2.68038% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 2.44663% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 2.18170% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 2.08820% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 2.02439% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 1.99115% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01651% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 1.84764% 0.00000% 0.00000% 0.00000% 0.00000% 1.34677% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.51669% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.02064% 0.96405% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.07792% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.61251% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.08741% 0.00000% 0.12643% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.16042% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.07292% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.04249% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.03117% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00598% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Control Overall OSCC Control N27 98.95190% 48.16791% 62.63340% 35.43828% 0.02421% 10.96028% 7.01468% 14.43241% 0.00000% 6.07917% 2.95424% 8.82912% 0.00000% 3.74026% 2.60619% 4.73825% 0.00242% 2.67035% 1.41491% 3.77514% 0.00000% 1.70846% 0.00000% 3.21191% 0.00000% 1.43046% 0.02738% 2.66518% 0.00000% 1.42444% 2.52466% 0.45625% 0.00000% 1.26209% 0.00000% 2.37274% 0.00000% 1.22439% 2.15468% 0.40573% 0.43812% 1.20066% 1.11742% 1.27390% 0.00000% 1.04393% 0.09984% 1.87472% 0.00000% 1.03161% 1.20679% 0.87746% 0.00000% 0.97904% 2.09142% 0.00014% 0.00000% 0.96954% 0.00414% 1.81909% 0.00000% 0.95089% 0.00000% 1.78767% 0.00000% 0.83652% 0.17993% 1.41432% 0.00000% 0.77806% 1.66222% 0.00000% 0.00000% 0.73927% 1.44739% 0.11613% 0.00000% 0.66267% 1.41571% 0.00000% 0.00000% 0.55114% 1.17447% 0.00261% 0.00000% 0.54442% 1.16307% 0.00000% 0.00000% 0.45291% 0.00000% 0.85148% 0.00000% 0.42341% 0.00169% 0.79452% 0.00000% 0.41358% 0.04360% 0.73917% 0.00000% 0.39989% 0.85430% 0.00000% 0.00000% 0.36312% 0.28939% 0.42800% 0.00000% 0.33601% 0.71784% 0.00000% 0.00000% 0.33399% 0.00390% 0.62446% 0.00000% 0.32516% 0.68851% 0.00542% 0.00000% 0.30906% 0.66027% 0.00000% 0.00000% 0.30626% 0.00000% 0.57576% 0.00000% 0.27391% 0.00000% 0.51496% 0.00000% 0.27001% 0.00021% 0.50744% 0.00000% 0.26747% 0.00000% 0.50285% 0.00000% 0.26629% 0.10141% 0.41138% 0.00000% 0.25303% 0.54056% 0.00000% 0.00000% 0.24245% 0.09145% 0.37533% 0.00000% 0.22983% 0.49100% 0.00000% 0.00000% 0.21792% 0.00000% 0.40969% 0.00000% 0.21358% 0.00000% 0.40153% 0.00000% 0.21340% 0.00000% 0.40120% 0.00000% 0.20060% 0.00000% 0.37712% 0.00000% 0.19761% 0.42217% 0.00000% 0.00000% 0.19262% 0.00000% 0.36213% 0.00000% 0.19010% 0.07820% 0.28857% 0.00000% 0.17809% 0.01557% 0.32110% 0.00000% 0.17193% 0.00000% 0.32323% 0.00000% 0.17126% 0.00000% 0.32197% 0.00000% 0.16655% 0.00000% 0.31311% 0.00000% 0.15650% 0.33433% 0.00000% 0.00000% 0.14945% 0.20171% 0.10347% 0.00000% 0.13943% 0.00087% 0.26136% 0.00000% 0.13910% 0.00000% 0.26150% 0.00000% 0.13249% 0.07998% 0.17871% 0.00000% 0.13169% 0.00029% 0.24733% 0.00242% 0.12523% 0.06369% 0.17938% 0.00000% 0.10170% 0.21726% 0.00000% 0.00000% 0.10156% 0.00000% 0.19093% 0.00000% 0.09980% 0.00000% 0.18763% 0.00000% 0.09928% 0.00000% 0.18665% 0.00000% 0.09367% 0.00000% 0.17610% 0.01452% 0.09254% 0.06476% 0.11698% 0.00000% 0.08637% 0.00208% 0.16055% 0.00000% 0.08238% 0.00430% 0.15109% 0.00000% 0.08036% 0.00000% 0.15107% 0.00000% 0.08013% 0.17119% 0.00000% 0.00000% 0.07723% 0.00008% 0.14513% 0.00000% 0.07232% 0.00000% 0.13597% 0.00000% 0.06869% 0.00000% 0.12914% 0.00000% 0.06480% 0.13843% 0.00000% 0.00000% 0.06355% 0.13505% 0.00063% 0.00000% 0.06300% 0.00000% 0.11844% 0.00000% 0.06038% 0.00000% 0.11352% 0.00000% 0.05703% 0.00000% 0.10722% 0.00000% 0.05454% 0.11651% 0.00000% 0.00000% 0.05206% 0.00000% 0.09787% 0.00000% 0.05069% 0.00000% 0.09531% 0.00000% 0.04728% 0.09725% 0.00331% 0.00000% 0.04642% 0.00000% 0.08727% 0.00000% 0.04443% 0.00000% 0.08353% 0.00000% 0.04307% 0.00000% 0.08098% 0.00000% 0.04236% 0.00000% 0.07965% 0.00000% 0.04070% 0.08695% 0.00000% 0.00000% 0.03975% 0.07087% 0.01236% 0.00000% 0.03931% 0.00000% 0.07391% 0.00000% 0.02865% 0.00000% 0.05387% 0.00000% 0.02658% 0.05678% 0.00000% 0.00000% 0.02604% 0.04658% 0.00797% 0.00000% 0.02364% 0.05050% 0.00000% 0.00000% 0.02362% 0.00000% 0.04440% 0.00000% 0.02234% 0.00116% 0.04097% 0.00000% 0.02132% 0.00000% 0.04008% 0.00000% 0.02066% 0.04413% 0.00000% 0.00000% 0.02030% 0.00000% 0.03816% 0.00000% 0.01950% 0.00000% 0.03666% 0.00000% 0.01780% 0.00000% 0.03347% 0.00000% 0.01768% 0.01620% 0.01898% 0.00000% 0.01597% 0.03058% 0.00312% 0.00000% 0.01456% 0.00334% 0.02444% 0.00000% 0.01378% 0.00646% 0.02022% 0.00000% 0.01346% 0.00000% 0.02530% 0.00000% 0.01343% 0.00000% 0.02525% 0.00000% 0.01303% 0.00000% 0.02450% 0.56641% 0.01252% 0.00100% 0.02266% 0.00000% 0.01183% 0.00000% 0.02225% 0.00000% 0.01144% 0.00000% 0.02151% 0.00000% 0.01034% 0.00000% 0.01945% 0.00000% 0.00987% 0.00014% 0.01844% 0.00000% 0.00954% 0.00000% 0.01793% 0.00000% 0.00921% 0.00000% 0.01732% 0.00000% 0.00860% 0.00000% 0.01618% 0.00000% 0.00852% 0.00000% 0.01603% 0.00000% 0.00842% 0.00000% 0.01583% 0.00000% 0.00835% 0.00000% 0.01569% 0.00000% 0.00770% 0.00000% 0.01449% 0.00000% 0.00692% 0.01479% 0.00000% 0.00000% 0.00629% 0.00000% 0.01182% 0.00000% 0.00596% 0.00617% 0.00578% 0.00000% 0.00493% 0.00000% 0.00927% 0.00000% 0.00427% 0.00000% 0.00802% 0.00000% 0.00427% 0.00000% 0.00802% 0.00000% 0.00421% 0.00000% 0.00792% 0.00000% 0.00412% 0.00880% 0.00000% 0.00000% 0.00408% 0.00000% 0.00767% 0.00000% 0.00356% 0.00760% 0.00000% 0.00000% 0.00341% 0.00000% 0.00642% 0.00000% 0.00318% 0.00680% 0.00000% 0.00000% 0.00238% 0.00000% 0.00447% 0.00000% 0.00216% 0.00461% 0.00000% 0.00000% 0.00204% 0.00357% 0.00069% 0.00000% 0.00184% 0.00000% 0.00347% 0.00000% 0.00155% 0.00000% 0.00292% 0.00000% 0.00149% 0.00319% 0.00000% 0.00000% 0.00139% 0.00103% 0.00170% 0.00000% 0.00090% 0.00000% 0.00170% 0.00000% 0.00066% 0.00000% 0.00125% 0.00000% 0.00066% 0.00000% 0.00124% 0.00000% 0.00054% 0.00115% 0.00000% 0.00000% 0.00049% 0.00104% 0.00000% 0.00000% 0.00039% 0.00084% 0.00000% 0.00000% 0.00039% 0.00083% 0.00000% 0.00000% 0.00037% 0.00079% 0.00000% 0.00000% 0.00037% 0.00000% 0.00069% 0.00000% 0.00037% 0.00000% 0.00069% 0.00000% 0.00034% 0.00072% 0.00000% 0.00000% 0.00030% 0.00000% 0.00057% 0.00000% 0.00029% 0.00062% 0.00000% 0.00000% 0.00027% 0.00000% 0.00052% 0.00000% 0.00027% 0.00000% 0.00052% 0.00000% 0.00027% 0.00000% 0.00052% 0.00000% 0.00020% 0.00043% 0.00000% 0.00000% 0.00019% 0.00042% 0.00000% 0.00000% 0.00018% 0.00000% 0.00034% 0.00000% 0.00017% 0.00036% 0.00000% 0.00000% 0.00014% 0.00029% 0.00000% 0.00000% 0.00013% 0.00029% 0.00000% 0.00000% 0.00013% 0.00000% 0.00024% 0.00000% 0.00008% 0.00018% 0.00000% 0.00000% 0.00007% 0.00014% 0.00000% 0.00000% 0.00007% 0.00014% 0.00000% 0.00000% 0.00004% 0.00008% 0.00000% APPENDIX 5.3

Status Cancer Cancer Cancer Cancer Cancer ID C2 C3 C4 C5 C6 Candida albicans 33.42075% 0.64067% 1.94859% 99.04395% 85.73832% Malassezia globosa 0.00000% 3.09922% 2.88578% 0.07888% 6.03896% Malassezia restricta 0.00000% 2.88300% 0.00000% 0.16407% 4.32263% Didymella glomerata_nov_98.36% 0.00000% 0.00000% 0.00000% 0.00316% 0.00000% Cladosporium sphaerospermum_nov_98.32 0.01788% 0.84087% 0.00000% 0.00316% 0.00000% Aspergillus penicillioides 0.00000% 1.27332% 0.14846% 0.01262% 0.00187% Cladosporium exasperatum 0.00000% 0.56058% 12.43389% 0.00000% 0.00000% Candida tropicalis 0.19670% 0.00000% 0.28765% 0.00000% 0.00000% Pseudorobillarda siamensis_nov_93.02% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Rhodotorula mucilaginosa 54.23496% 0.00000% 0.00928% 0.00000% 0.00000% Ophiocordyceps sinensis 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Eremascus albus_nov_79.67% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Sarcinomyces crustaceus_nov_86.06% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Aspergillus tamarii 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Skeletocutis diluta 0.00000% 0.00000% 46.00538% 0.00000% 0.00000% Mycoacia aurea_nov_96.78% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Cladosporium exasperatum_nov_97.97% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Malassezia restricta_nov_98.37% 0.00000% 0.20021% 0.00000% 0.00631% 0.00748% Trametes hirsuta_nov_92.98% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Talaromyces funiculosus 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Xenocamarosporium acaciae_nov_79.68% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Malassezia restricta_nov_80.65% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Hanseniaspora guilliermondii_nov_96.64% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Malassezia caprae_nov_84.69% 0.00000% 0.00000% 8.38823% 0.10728% 0.00000% Alternaria alternata 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Candida parapsilosis 0.00000% 0.00000% 0.00000% 0.01262% 0.00748% Sporidiobolus johnsonii 0.00000% 28.70185% 0.00000% 0.00000% 0.00000% Peniophora laxitexta_nov_98.24% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Alternaria infectoria 0.00000% 0.00000% 24.45022% 0.00000% 0.00000% Gibberella intricans 0.00000% 0.00801% 0.00000% 0.00000% 0.00000% Exidia glandulosa_nov_96.14% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Penicillium toxicarium 0.00000% 24.81781% 0.00000% 0.00000% 0.21688% Candida nivariensis 0.00596% 0.00000% 0.00000% 0.00000% 0.00000% Cladosporium sphaerospermum 0.00000% 0.84888% 0.00000% 0.00631% 0.00000% Xenasma rimicola_nov_85.51% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Aureobasidium pullulans_nov_97.35% 0.00000% 0.00000% 0.00000% 0.00631% 0.00000% Coniosporium apollinis_nov_85.22% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Davidsoniella australis_nov_94.46% 0.00000% 0.00000% 0.00000% 0.00000% 0.00187% Candida salmanticensis_nov_79.52% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Penicillium thomii 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Pseudoseptoria collariana_nov_98.05% 0.00000% 6.35861% 0.00000% 0.00000% 0.00000% Meyerozyma caribbica 0.00000% 0.00000% 0.00000% 0.00000% 0.07292% Sympodiomycopsis kandeliae_nov_87.73% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Toxicocladosporium irritans 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Colletotrichum multispecies_spp11_4 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Hannaella luteola_nov_98.13% 0.00000% 0.00000% 0.00928% 0.00316% 0.00000% Cladosporium oxysporum 0.00000% 0.00000% 0.00928% 0.00316% 0.00000% Gymnopus iocephalus_nov_89.06% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% multigenus multispecies_spp14_2 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Trichoderma multispecies_spp6_2 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Malassezia furfur 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Aspergillus restrictus 0.00000% 0.00000% 0.00000% 0.00316% 0.29914% Campanella caesia_nov_90.97% 0.00000% 11.89237% 0.00000% 0.00000% 0.00000% Malassezia japonica 0.00000% 0.00000% 0.00000% 0.04733% 0.00000% Rhizochaete americana_nov_92.44% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Mycena maurella_nov_87.22% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Peniophora pini_nov_95.93% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Botryobasidium conspersum_nov_87.66% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Zygophiala wisconsinensis_nov_84.29% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Xylographa bjoerkii_nov_86.50% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Debaryomyces udenii_nov_84.75% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Malassezia slooffiae 0.00000% 0.00000% 3.26622% 0.00947% 0.00000% Cystidiodontia laminifera_nov_94.77% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Amylosporus bracei_nov_93.24% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Neosetophoma samarorum_nov_94.75% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Malassezia globosa_nov_95.21% 0.00000% 8.06439% 0.00000% 0.00000% 0.00000% Kodamaea ohmeri_nov_89.32% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Saccharomyces kudriavzevii 0.08941% 0.22423% 0.00000% 0.00316% 0.00000% Phanerochaete chrysosporium_nov_95.51% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Cordana ellipsoidea_nov_93.96% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Phaeosphaeriopsis triseptata_nov_91.45% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Talaromyces minioluteus_nov_95.58% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Sidera lowei_nov_85.53% 7.35531% 0.00000% 0.00000% 0.00000% 0.00000% Malassezia globosa_nov_97.50% 0.00000% 0.00000% 0.00000% 0.04417% 0.00000% Coniochaeta africana_nov_95.42% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Acremonium charticola_nov_93.50% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Aspergillus niger 0.00000% 0.00000% 0.00000% 0.00631% 0.00187% Candida etchellsii 0.00596% 0.00000% 0.00000% 0.05364% 0.00000% Curvularia heteropogonis_nov_97.12% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Xanthoporia radiata_nov_88.64% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Neodevriesia hilliana_nov_96.05% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Comoclathris spartii_nov_89.04% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Phyllotopsis nidulans_nov_83.20% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Ochrocladosporium frigidarii_nov_98.03% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Sistotrema muscicola_nov_85.71% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Malassezia slooffiae_nov_96.34% 4.42272% 0.00000% 0.00000% 0.01578% 0.00000% Setophaeosphaeria hemerocallidis 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Eupenidiella venezuelensis_nov_94.06% 0.00000% 0.02402% 0.00000% 0.01262% 0.00000% Malassezia restricta_nov_94.10% 0.00000% 0.00000% 0.00000% 0.03786% 0.00000% Vamsapriya indica_nov_89.03% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Dioszegia takashimae_nov_97.24% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Phaeococcomyces aloes_nov_97.98% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Penicillium phoeniceum 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Candida blattae 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Ilyonectria mors-panacis_nov_91.43% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Ophiocordyceps sinensis_nov_97.02% 0.00000% 0.52054% 0.00000% 0.00000% 0.00000% Candida dubliniensis 0.20862% 0.00000% 0.00000% 0.00000% 0.00000% Cryptococcus diffluens 0.00000% 0.04004% 0.00000% 0.00000% 0.00000% Periconia macrospinosa_nov_94.90% 0.00000% 0.00000% 0.00000% 0.00000% 0.00187% Gaeumannomyces radicicola_nov_91.28% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Gloeodontia subasperispora 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Phaeothecoidea melaleuca_nov_94.00% 0.00000% 2.97109% 0.00000% 0.00000% 0.00000% Geastrumia polystigmatis_nov_91.72% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Didymella glomerata 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Brevicellicium olivascens_nov_82.89% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Aspergillus penicillioides_nov_96.98% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Candida vanderwaltii_nov_89.34% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Hanseniaspora uvarum_nov_98.04% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Tubeufia cerea_nov_84.31% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Hydnopolyporus fimbriatus_nov_96.61% 0.00000% 0.00000% 0.00000% 0.00000% 2.56329% Candida metapsilosis 0.00000% 0.00000% 0.00000% 0.00000% 0.21127% Debaryomyces multispecies_spp7_2 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Clavulinopsis laeticolor_nov_79.40% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Sporidiobolus johnsonii_nov_98.44% 0.00000% 2.41852% 0.00000% 0.00000% 0.00000% Passalora passaloroides_nov_91.53% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Tremella globispora_nov_93.02% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Trametes ellipsospora 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Phlebia acanthocystis 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Exophiala oligosperma_nov_95.77% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Talaromyces rotundus_nov_95.06% 0.00000% 0.00000% 0.00000% 0.00000% 0.35897% Melnikomyces vietnamensis_nov_84.62% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% multigenus multispecies_spp10_2 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Darksidea delta_nov_89.32% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Hannaella kunmingensis 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Cyphellophora sessilis_nov_87.57% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Hymenochaete cana_nov_92.07% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Hymenochaete cana_nov_96.84% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Peniophora aurantiaca_nov_95.94% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Strelitziana albiziae_nov_88.52% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Hyphopichia burtonii_nov_93.26% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Botryobasidium conspersum_nov_87.37% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Cryptococcus mangaliensis 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Marasmius purpureostriatus_nov_92.42% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Aspergillus penicillioides_nov_98.48% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Talaromyces funiculosus_nov_98.36% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Lasiodiplodia theobromae 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Ramichloridium eucleae_nov_96.42% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Sistotrema coronilla_nov_80.51% 0.00000% 1.10515% 0.00000% 0.00000% 0.00000% Cryptococcus cistialbidi 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Malassezia caprae_nov_97.35% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Ophiostoma pulvinisporum_nov_89.67% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Cryptococcus victoriae 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Chaetomium multispecies_sppn1_2_nov_9 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Quambalaria pitereka 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Cylindrobasidium evolvens_nov_95.05% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Ochrocladosporium adansoniae_nov_97.36 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Aspergillus austroafricanus 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Stachybotrys parvispora_nov_81.60% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Curvularia verruculosa 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Curvularia intermedia 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Penicillium solitum 0.00000% 0.80083% 0.00000% 0.00000% 0.00000% Aspergillus caesiellus 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Aspergillus amstelodami 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Incertomyces vagans_nov_85.19% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Wallemia mellicola 0.00000% 0.67270% 0.00000% 0.00000% 0.00000% Uwebraunia australiensis 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Sistotrema coroniferum_nov_95.48% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Xenopenidiella rigidophora_nov_96.01% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Cytospora rhizophorae_nov_94.67% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% multigenus multispecies_sppn1_2_nov_95. 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Diatrype enteroxantha_nov_93.79% 0.00000% 0.00000% 0.00000% 0.02209% 0.00000% Candida albicans_nov_92.15% 0.00000% 0.00000% 0.00000% 0.00947% 0.00000% Acanthostigma perpusillum_nov_95.99% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Penicillium citrinum 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Botrytis multispecies_spp13_2 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Trametes cubensis_nov_95.95% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Penicillium steckii 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Candida santamariae 0.00000% 0.28029% 0.00000% 0.00000% 0.00000% Hymenochaete tongbiguanensis_nov_92.26 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Fusarium neocosmosporiellum_nov_98.11% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Trametes cubensis_nov_88.92% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Fusarium oxysporum 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Meyerozyma guilliermondii 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Basidiodendron eyrei_nov_84.50% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Rhodotorula dairenensis 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Pestalotiopsis arceuthobii_nov_97.77% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Neophysalospora eucalypti_nov_96.99% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Podosphaera gunnerae_nov_96.17% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Alternaria multispecies_spp16_2 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Microascus niger 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Clavispora lusitaniae 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Phaeocryptopus gaeumannii_nov_98.26% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Ochrocladosporium adansoniae_nov_87.99 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Fuscoporia senex 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Aspergillus ibericus 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Amyloxenasma grisellum_nov_89.28% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Incertomyces vagans_nov_85.28% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Rectipilus idahoensis_nov_84.23% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Leptospora rubella_nov_90.30% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Penicillium mallochii 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Rectipilus idahoensis_nov_83.94% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Piloderma olivaceum_nov_86.69% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Cladosporium halotolerans 0.00000% 0.00000% 0.00000% 0.00000% 0.00187% Strelitziana africana_nov_93.46% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Periconia pseudobyssoides_nov_96.71% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Coniosporium apollinis_nov_94.23% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Aspergillus flavus 0.00000% 0.00000% 0.00000% 0.00316% 0.00000% Aspergillus multispecies_spp1_2 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Didymella glomerata_nov_98.35% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Hymenochaete rubiginosa_nov_91.83% 0.00000% 0.24826% 0.00000% 0.00000% 0.00000% Sporobolomyces gracilis_nov_97.46% 0.00000% 0.24826% 0.00000% 0.00000% 0.00000% Malassezia dermatis 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Cryptococcus anemochoreius_nov_95.24% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Candida sake 0.00000% 0.24025% 0.00000% 0.00000% 0.00000% Coniochaeta lignicola 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Sporobolomyces ruberrimus 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Sarocladium implicatum_nov_95.67% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Celerioriella prunicola_nov_90.91% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% multigenus multispecies_spp15_2 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Incertomyces vagans_nov_92.64% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Antrodiella citrea_nov_86.05% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Pseudochaete rigidula 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Rhodosporidium diobovatum 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Trichoderma multispecies_spp2_2 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Hanseniaspora uvarum 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Pertusaria albescens_nov_80.88% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Phaeococcomyces catenatus 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Talaromyces aurantiacus 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Ceriporia lacerata 0.00000% 0.00000% 0.00000% 0.00000% 0.14957% Ophiosphaerella agrostidis_nov_98.35% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Sporobolomyces ruberrimus_nov_98.30% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Cryptococcus victoriae_nov_96.21% 0.00000% 0.00000% 0.00000% 0.13568% 0.00000% Sympodiomycopsis kandeliae_nov_82.51% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Kodamaea ohmeri_nov_88.89% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Alternaria metachromatica 0.00000% 0.00000% 0.12991% 0.00000% 0.00000% Ophiosphaerella agrostidis 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Ochrocladosporium adansoniae_nov_97.06 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Penicillium griseolum_nov_91.05% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Lodderomyces elongisporus 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Aspergillus nomius 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Sporobolomyces roseus 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Aspergillus penicillioides_nov_96.44% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Setophaeosphaeria hemerocallidis_nov_98 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Sporobolomyces elongatus_nov_87.98% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Phaeococcomyces eucalypti_nov_94.37% 0.00000% 0.00000% 0.00000% 0.09466% 0.00000% Mycoacia nothofagi_nov_94.77% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Phoma calidophila 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Nigrospora oryzae 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Nigrospora oryzae_nov_97.67% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Phlebia chrysocreas_nov_95.31% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Hyphodontia subalutacea_nov_81.69% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Wallemia hederae 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Microdochium bolleyi_nov_92.41% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Trichoderma orientale 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Resinicium saccharicola 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Cystocoleus ebeneus_nov_86.09% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Candida apicola 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Stagonosporopsis multispecies_spp5_2 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Saccharomyces mikatae 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Debaryomyces prosopidis 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Aspergillus tamarii_nov_97.46% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Gibberella zeae 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Periconia macrospinosa_nov_97.79% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Hymenochaete nanospora 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Toxicocladosporium banksiae 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Hymenochaete cana_nov_92.57% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Penicillium corylophilum 0.04172% 0.00000% 0.00000% 0.00000% 0.00000% Colletotrichum salsolae 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Verrucoconiothyrium nitidae 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Candida spencermartinsiae 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Rhinocladiella similis 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Omnidemptus affinis 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Aureobasidium pullulans 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Quambalaria multispecies_spp12_2 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Aureobasidium microstictum 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Exidia glandulosa 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Penicillium phoeniceum_nov_98.35% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Colletotrichum multispecies_spp9_4 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Aureobasidium melanogenum 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Microdochium citrinidiscum_nov_93.27% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Talaromyces flavovirens 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Kodamaea ohmeri 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Aspergillus puulaauensis 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Fuscoporia torulosa_nov_91.28% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Aspergillus restrictus_nov_98.45% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Cladosporium multispecies_spp8_2 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Pichia kluyveri 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Hymenochaete rheicolor 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Hanseniaspora opuntiae 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Cladosporium salinae 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Hannaella kunmingensis_nov_98.13% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Myrmecridium schulzeri_nov_97.28% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Mycoacia aurea 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Penidiella aggregata_nov_90.70% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Uwebraunia dekkeri 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Valsa fabianae 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Ophiocordyceps sinensis_nov_98.36% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Hymenochaete cana_nov_93.10% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Hyphodontia aspera_nov_95.24% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Fibrodontia brevidens_nov_95.29% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Cladosporium arthropodii 0.00000% 0.00000% 0.00928% 0.00000% 0.00000% Candida dubliniensis_nov_91.50% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Acremonium implicatum 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Fusarium multispecies_spp4_2 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Pseudoseptoria collariana 0.00000% 0.00801% 0.00000% 0.00000% 0.00000% Ophiostoma arduennense 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Devriesia shakazului_nov_95.86% 0.00000% 0.00000% 0.00000% 0.01578% 0.00000% Cryptococcus amylolyticus_nov_97.01% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Penicillium spinulosum 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Hymenochaete cana_nov_94.07% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Peniophora laxitexta 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Coniothyrium sidae 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Pyrenochaeta keratinophila_nov_96.72% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Aspergillus penicillioides_nov_98.22% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Cryptococcus neoformans 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Toxicocladosporium banksiae_nov_98.32% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Neofusicoccum batangarum 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Epicoccum nigrum 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Xenobotrytis acaducospora_nov_87.66% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Phanerochaete chrysosporium_nov_88.71% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Peniophora albobadia 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Trichoderma atroviride 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Candida dubliniensis_nov_98.36% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Aspergillus bombycis 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Amyloxenasma allantosporum 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Candida orthopsilosis 0.00000% 0.00000% 0.00000% 0.00000% 0.00187% Candida nivariensis_nov_98.42% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Candida tropicalis_nov_97.57% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% multigenus multispecies_spp3_2 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Mycosphaerella pseudovespa_nov_89.51% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Stenella araguata_nov_85.99% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Fusarium nelsonii_nov_98.10% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Ophiosphaerella agrostidis_nov_89.54% 0.00000% 0.00000% 0.00000% 0.00947% 0.00000% Cladosporium grevilleae 0.00000% 0.00000% 0.00928% 0.00000% 0.00000% Mycosphaerella tassiana 0.00000% 0.00000% 0.00928% 0.00000% 0.00000% Cadophora melinii 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Cadophora melinii_nov_98.31% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Suillus flavidus_nov_94.07% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Trichoderma pseudokoningii 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Cladosporium exasperatum_nov_98.31% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Ramopenidiella cycadicola_nov_85.28% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Pseudoseptoria collariana_nov_92.31% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Aspergillus ibericus_nov_97.46% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Aspergillus unilateralis_nov_98.42% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Pestalotiopsis coffeae-arabicae_nov_91.94% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Sporobolomyces ruberrimus_nov_97.74% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Saccharomyces cerevisiae 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Trichoderma calamagrostidis_nov_78.55% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Sistotrema coroniferum_nov_83.51% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Marasmiellus candidus 0.00000% 0.00801% 0.00000% 0.00000% 0.00000% Dioszegia zsoltii_var._yunnanensis 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Phyllosticta capitalensis 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Mycosphaerella cryptica_nov_87.46% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Knufia aspidiotus_nov_87.54% 0.00000% 0.00000% 0.00000% 0.00631% 0.00000% Candida pararugosa 0.00000% 0.00000% 0.00000% 0.00631% 0.00000% Acremonium acutatum_nov_91.96% 0.00000% 0.00000% 0.00000% 0.00631% 0.00000% Issatchenkia orientalis 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Chaetomium carinthiacum 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Rhodotorula nothofagi 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Candida zeylanoides 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Strelitziana africana 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Hymenochaete attenuata 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Candida tropicalis_nov_98.27% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Ophiocordyceps sinensis_nov_98.02% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Malassezia restricta_nov_98.11% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Lophodermium agathidis_nov_94.31% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Hannaella luteola 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Alternaria longissima 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Cyberlindnera jadinii 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Pestalotiopsis coffeae-arabicae 0.00000% 0.00000% 0.00000% 0.00316% 0.00000% Sterigmatomyces halophilus 0.00000% 0.00000% 0.00000% 0.00316% 0.00000% Marasmius hypophaeus 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Peniophora lycii 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Pilatoporus bondartsevae 0.00000% 0.00000% 0.00000% 0.00000% 0.00187% Cancer Cancer Cancer Cancer Cancer Cancer Cancer Cancer C8 C9 C10 C11 C12 C14 C15 C17 99.76846% 6.56375% 0.01519% 0.02517% 34.63265% 99.25069% 99.95754% 89.63463% 0.00000% 0.22908% 0.02278% 17.41757% 2.96480% 0.00000% 0.00000% 2.02650% 0.01823% 0.99602% 19.88231% 0.00000% 3.72077% 0.01913% 0.02919% 0.47487% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00319% 0.00265% 0.00000% 0.00182% 0.38845% 1.77297% 0.00000% 0.00000% 0.00957% 0.00000% 0.00000% 0.00000% 0.00000% 12.29689% 0.85578% 3.46090% 0.00638% 0.00000% 0.06352% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.14349% 0.00000% 0.00000% 0.00000% 2.71912% 0.00000% 0.00000% 20.31656% 0.00000% 0.00000% 0.00302% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 1.05714% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.06049% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 3.62350% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00591% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 6.51394% 0.00000% 7.90335% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.34928% 36.21948% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 31.82271% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 2.52088% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.05695% 0.55374% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.02517% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 19.37737% 5.53738% 0.00000% 0.08609% 0.00000% 0.00000% 0.00000% 25.55777% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01913% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00319% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.95646% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 18.79282% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01061% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 14.06375% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00182% 0.00000% 13.87244% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 2.16021% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00547% 0.39841% 5.25437% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 10.37000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 10.80203% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 2.45020% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 9.28769% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 1.69323% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.11952% 0.00000% 0.00000% 3.62036% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 4.12301% 1.51019% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 2.58964% 2.26651% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01913% 0.00000% 0.00000% 0.00000% 0.00000% 4.77980% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00302% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00365% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 3.75854% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 3.25361% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 3.04556% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 2.18127% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 2.13944% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 1.68320% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 1.91291% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 1.88307% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.23592% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 1.46997% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 1.27563% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 1.24614% 0.00000% 0.00000% 0.63781% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 1.09562% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.97695% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.16899% 0.00000% 0.00000% 0.00000% 0.51793% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00319% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.65442% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00638% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.52857% 0.00000% 0.00000% 0.00000% 0.00000% 0.19690% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.04464% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01275% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.19362% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.12435% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00182% 0.00000% 0.10630% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.09112% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01275% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.07864% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00319% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.04980% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.05747% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.03630% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00302% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.02988% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00759% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01139% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01992% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01898% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01594% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00957% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00957% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00957% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00759% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00638% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00638% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00182% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00380% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00319% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00319% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00302% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00302% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Cancer Cancer Cancer Cancer Cancer Cancer Cancer Cancer C18 C19 C20 C21 C22 C23 C24 C26 99.70108% 98.70447% 5.80249% 99.38613% 95.31162% 4.33754% 99.48350% 94.20443% 0.00594% 0.00000% 12.06007% 0.00000% 0.00000% 9.99606% 0.00000% 0.03790% 0.03761% 0.18793% 8.38137% 0.39232% 0.05615% 0.00000% 0.07313% 0.00000% 0.00000% 0.00400% 31.10589% 0.00462% 0.00000% 0.00000% 0.00457% 0.00000% 0.00198% 0.00400% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00271% 0.00990% 0.00800% 24.78004% 0.01385% 0.09826% 0.00000% 0.00000% 0.99345% 0.00000% 0.23991% 0.00000% 0.09231% 0.00000% 0.01972% 0.17369% 0.00271% 0.00000% 0.00000% 0.00000% 0.03692% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.07324% 0.16794% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00758% 0.00000% 0.00000% 0.00000% 0.01371% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00462% 0.00000% 40.63486% 0.00000% 3.14006% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 44.97240% 0.00457% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00914% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.03231% 0.00000% 0.00000% 0.05942% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00914% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.77204% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00271% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 15.14715% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.39442% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00923% 0.08422% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.07126% 0.65576% 0.00000% 0.00000% 0.00000% 0.00000% 0.00914% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01782% 0.00800% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01782% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00457% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00792% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.03657% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00914% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.02969% 0.01200% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.89502% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.03519% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 1.55920% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00462% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.94053% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.71589% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.18248% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.67378% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.07019% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01386% 0.00400% 0.00000% 0.00000% 0.47726% 0.00000% 0.00914% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00462% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.38683% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.35093% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.28074% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.19652% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00457% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.15441% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.12633% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.12633% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.08422% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.07019% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.07019% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.07019% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.02275% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.04551% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01972% 0.00000% 0.00812% 0.00000% 0.00000% 0.03034% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.02807% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.02285% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.02285% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01972% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01846% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00400% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01371% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01353% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00914% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00792% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00914% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00914% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00914% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00396% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Cancer Control Control Control Control Control Control Control C27 N1 N2 N3 N4 N5 N6 N7 98.89226% 11.59682% 0.06831% 40.97259% 79.16362% 0.08633% 0.01502% 1.91110% 0.00000% 0.07225% 3.55204% 4.14383% 0.00000% 0.03237% 7.58759% 6.44111% 0.02403% 44.68931% 8.21499% 3.02387% 0.00000% 6.46380% 0.00000% 3.85051% 0.00000% 0.00000% 0.00000% 0.00000% 0.03872% 0.00000% 0.00000% 0.00000% 0.00218% 0.00000% 0.00000% 6.60183% 0.02151% 15.48505% 0.00501% 17.99264% 0.02622% 0.00000% 0.00360% 9.34866% 0.05593% 8.40617% 0.00000% 0.00000% 0.22504% 10.85019% 7.85907% 0.00000% 4.09155% 4.37035% 0.00501% 0.00000% 0.52656% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 80.28761% 0.00589% 0.00430% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 10.90968% 0.00000% 0.00000% 0.00000% 0.00000% 0.00360% 0.00000% 2.22002% 0.00000% 51.28629% 9.98018% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00430% 0.00000% 10.13013% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 11.71900% 0.00000% 1.75538% 0.00000% 0.00000% 0.00360% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 3.52842% 0.00000% 0.00000% 0.00000% 1.16543% 0.00000% 1.74122% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 7.60764% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.17094% 0.03012% 5.67605% 0.00000% 0.00000% 0.00000% 0.01204% 0.00360% 29.30150% 0.00000% 0.02158% 0.00501% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.50338% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00589% 0.02581% 0.00000% 12.59259% 0.28313% 0.00000% 0.00000% 0.00360% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 19.80464% 0.00000% 0.01204% 0.00000% 6.14795% 0.02581% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 4.55379% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00218% 0.00000% 0.00000% 0.00000% 0.74861% 0.00000% 0.00000% 8.50793% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 10.85019% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01204% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01204% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 7.22543% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 2.29332% 0.01966% 0.55395% 0.00000% 0.02358% 0.00000% 0.33452% 0.00000% 0.14156% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00437% 0.04817% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 2.90204% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 2.84882% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 10.03003% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 6.35838% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 9.42809% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 7.82783% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 3.43153% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00437% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 3.97108% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 4.47339% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 4.30351% 0.00000% 0.28902% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 1.97495% 0.00000% 0.00000% 0.00860% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 3.77684% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 3.39916% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 2.25531% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 3.27410% 0.00000% 0.00000% 0.01416% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 2.83126% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 2.83803% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01416% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 1.56551% 0.00000% 0.00000% 0.00000% 0.22661% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.26977% 0.00000% 0.00000% 0.01529% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 1.11001% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 1.07588% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01721% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.91640% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.19268% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.14202% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.50551% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.63245% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.53780% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.52059% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.51198% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.48617% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.48187% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.40012% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01721% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.07073% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.40442% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.39582% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.35710% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.33128% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.31407% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.04126% 0.00000% 0.07554% 0.00000% 0.04247% 0.00000% 0.00000% 0.00000% 0.00000% 0.28826% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.28396% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.27965% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.02831% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.23663% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.23233% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.19791% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.17640% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.14451% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.13768% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.13557% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.11186% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.05395% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.09909% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00655% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01079% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.05593% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.05462% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.05163% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.04247% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.03012% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.02831% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00437% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.02581% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01204% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.02151% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01748% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01721% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01721% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01721% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01721% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01721% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00218% 0.00000% 0.00000% 0.00589% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01529% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01416% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00218% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01311% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01291% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01291% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01291% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01291% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01291% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01079% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01001% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00860% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00860% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00860% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00860% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00860% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00860% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00860% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00430% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00430% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Control Control Control Control Control Control Control Control N8 N9 N11 N12 N13 N14 N15 N16 13.18052% 0.01743% 0.04509% 0.03547% 0.02069% 0.09018% 60.42257% 98.30845% 0.00000% 4.53278% 51.75290% 25.97848% 16.24418% 0.00949% 0.38952% 0.00000% 0.00000% 6.93863% 2.52508% 3.81932% 10.98810% 6.35056% 0.61379% 0.21186% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 23.45572% 0.54916% 2.91963% 0.00000% 0.00000% 0.00000% 21.84844% 0.07283% 0.84627% 0.67992% 0.00000% 0.00000% 21.35541% 5.36333% 4.72144% 0.01324% 13.79356% 29.78556% 0.00000% 0.00000% 0.00000% 2.76235% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00993% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 11.64575% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00872% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01127% 11.48161% 3.62131% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.18305% 2.00654% 0.00000% 17.87894% 0.05696% 0.57838% 0.00331% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 41.47325% 0.01180% 0.00000% 0.00000% 0.00000% 0.00000% 15.12357% 3.04190% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 32.82606% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 3.29498% 1.17236% 5.71125% 0.15520% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.46218% 0.00000% 0.00000% 0.00000% 0.00000% 0.12248% 0.00000% 2.10077% 0.00000% 17.74861% 0.00000% 0.00000% 0.00000% 0.00331% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 27.49063% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 21.28340% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 12.01372% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00666% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 12.87399% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 12.52082% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 12.39540% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.03104% 0.00000% 0.09443% 0.00000% 0.00000% 0.47071% 0.00000% 0.00000% 0.14485% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.02069% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 10.24233% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 3.15630% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 7.18931% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 9.92852% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 9.05335% 0.00000% 0.00000% 0.00000% 0.78909% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.71966% 0.00000% 0.00000% 0.00000% 0.00000% 2.45859% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.27144% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.40098% 2.70544% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.54045% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 6.16658% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.08277% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.12416% 0.00000% 0.00000% 0.00662% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 4.91243% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 4.66632% 0.00000% 0.00000% 0.00000% 0.00000% 0.00872% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 4.45939% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 3.72478% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 3.13502% 0.00000% 0.07082% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.03332% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 2.83497% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 1.31625% 1.33018% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.27894% 0.00000% 0.00000% 0.06208% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 2.38265% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 2.15957% 0.00000% 0.00331% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.17434% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.11391% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.03487% 0.00000% 0.00000% 0.32074% 0.00000% 0.20066% 0.00000% 0.00000% 0.00000% 0.00000% 0.55575% 0.11381% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 1.02581% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.94926% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.11381% 0.00000% 0.00000% 0.00000% 0.00000% 0.83682% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.81939% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.69641% 0.00000% 0.33984% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.20066% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.40098% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01655% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.55613% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.54297% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.53173% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.50755% 0.00000% 0.00000% 0.46199% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.02979% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.05221% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.21728% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.02255% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.39226% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.37483% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.35178% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.29986% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.29561% 0.00000% 0.00000% 0.00000% 0.00000% 0.05331% 0.00000% 0.01127% 0.00000% 0.00000% 0.00000% 0.04721% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01182% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.25988% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.24800% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.24655% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.23172% 0.00000% 0.20049% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.20049% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.19935% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.19177% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.02615% 0.14654% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.02365% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.09600% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.08663% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.08277% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00872% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.03104% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01182% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.02648% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01743% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01655% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01424% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01035% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00872% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00475% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Control Control Control Control Control Control Control Control N17 N18 N19 N20 N21 N23 N24 N25 98.91082% 63.69643% 27.02348% 3.17906% 0.00598% 99.58416% 21.16591% 20.46622% 0.01396% 4.43842% 0.21875% 0.09350% 0.00000% 0.02119% 0.00000% 14.20782% 0.14895% 1.58394% 7.87516% 1.69861% 0.53217% 0.05297% 0.09905% 0.30028% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 3.03880% 0.00000% 0.02119% 0.03714% 14.05768% 0.02793% 1.02490% 0.00000% 0.12467% 1.41713% 0.04238% 0.00000% 2.37060% 0.00000% 0.00000% 0.02917% 0.04675% 0.00000% 0.00000% 0.01651% 8.86606% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00265% 54.62031% 10.00395% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.24969% 0.00000% 0.00465% 0.00000% 0.00000% 0.00000% 47.66802% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00465% 0.00000% 0.00000% 20.60153% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01558% 45.44367% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.07913% 0.00000% 0.10209% 0.01558% 0.01794% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 12.10846% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 1.98204% 1.96879% 0.00000% 0.00000% 0.00000% 0.05984% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 1.50771% 6.78139% 0.24934% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 1.05238% 0.00000% 0.00000% 0.00000% 0.06516% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 22.71564% 0.00000% 0.00000% 0.00000% 0.00000% 7.97881% 0.00000% 0.00000% 0.00000% 0.01580% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00465% 0.00000% 0.01458% 14.04083% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 17.42745% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 10.68352% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 5.86330% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 14.32113% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01862% 0.00000% 2.69797% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.07913% 4.00644% 0.32084% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00465% 0.94867% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 2.27521% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 3.96675% 1.48044% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00619% 0.00000% 0.00931% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.03724% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 7.06420% 0.01458% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 7.94511% 0.01458% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 8.06796% 0.00000% 0.00000% 4.87093% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 4.06732% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 5.76054% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.80210% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 4.69067% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 3.61912% 0.00000% 0.00000% 3.60216% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 3.44398% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01458% 2.82063% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.83368% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.02270% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01580% 0.00000% 0.00000% 0.00000% 2.96089% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 2.82063% 0.00000% 0.00000% 0.00000% 0.00000% 0.00931% 0.00000% 0.00000% 0.00000% 0.00000% 0.03708% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 2.68038% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 1.50771% 0.00000% 0.82593% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 2.44663% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 2.18170% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 2.08820% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 2.02439% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 1.99115% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 1.84764% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.08470% 0.00000% 0.00000% 0.00000% 0.00000% 0.05984% 0.17384% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01651% 0.00000% 0.00000% 1.34677% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 1.26227% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.24934% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.02064% 0.94824% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.03388% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.80210% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.13964% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.61251% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.03117% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.04238% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.51669% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.08741% 0.00000% 0.12643% 0.43288% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.33542% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01580% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01558% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.26492% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.16042% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.15804% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.13552% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.03117% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.10595% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.07792% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.07292% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.07292% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.05929% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.05929% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.04675% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00206% 0.00790% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00619% 0.00000% 0.00000% 0.00000% 0.04375% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.03117% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.02917% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.02917% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01558% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01694% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01794% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00790% 0.00465% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00790% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01580% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01458% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00206% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01238% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00413% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00847% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01032% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.01032% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00847% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00825% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00825% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00598% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00465% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00265% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00413% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00413% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00413% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% 0.00000% Control Control Overall OSCC Control N26 N27 0.15581% 98.95190% 44.37315% 61.20290% 29.56296% 0.07555% 0.00000% 4.18445% 2.58471% 5.59223% 0.04249% 0.02178% 3.22783% 1.89376% 4.40181% 91.18466% 0.00242% 2.60327% 1.41491% 3.64903% 0.00000% 0.00000% 2.32239% 0.13844% 4.24427% 1.36456% 0.00000% 2.15352% 2.00225% 2.28664% 0.07082% 0.00000% 2.05188% 0.63142% 3.30188% 0.00000% 0.00000% 1.88752% 1.09484% 2.58508% 0.00000% 0.00000% 1.70846% 0.00000% 3.21191% 0.00000% 0.00000% 1.41409% 2.52466% 0.43678% 0.03305% 0.00000% 1.35861% 0.00372% 2.55091% 0.00000% 0.00000% 1.26209% 0.00000% 2.37274% 0.00000% 0.00000% 1.22439% 2.15468% 0.40573% 0.00000% 0.00000% 1.04670% 0.00000% 1.96779% 0.00000% 0.00000% 0.97904% 2.09142% 0.00014% 0.00000% 0.00000% 0.96722% 0.00000% 1.81837% 0.00000% 0.00000% 0.95696% 2.04441% 0.00000% 1.73285% 0.00242% 0.93048% 0.66547% 1.16369% 0.00000% 0.00000% 0.88266% 0.00000% 1.65940% 0.00000% 0.00000% 0.80599% 0.00000% 1.51526% 0.00000% 0.00000% 0.77806% 1.66222% 0.00000% 0.00000% 0.00000% 0.69843% 0.00000% 1.31304% 0.00000% 0.00000% 0.67708% 1.44649% 0.00000% 0.00000% 0.00000% 0.66659% 0.50491% 0.80886% 0.00000% 0.00000% 0.63677% 0.00000% 1.19714% 0.00000% 0.00000% 0.62839% 0.02909% 1.15578% 0.00000% 0.00000% 0.61121% 1.30577% 0.00000% 0.00000% 0.00000% 0.58491% 0.00000% 1.09963% 0.00000% 0.43812% 0.55193% 1.11137% 0.05962% 0.00000% 0.00000% 0.54992% 1.17186% 0.00261% 0.00000% 0.00000% 0.54378% 1.16172% 0.00000% 0.00000% 0.00000% 0.53306% 1.13881% 0.00000% 0.00000% 0.00000% 0.48351% 0.00042% 0.90863% 0.00000% 0.00000% 0.46292% 0.03887% 0.83608% 0.00000% 0.00000% 0.45291% 0.00000% 0.85148% 0.00000% 0.00000% 0.42151% 0.00029% 0.79219% 0.00000% 0.00000% 0.40763% 0.04360% 0.72798% 0.00000% 0.00000% 0.39989% 0.85430% 0.00000% 0.00000% 0.00000% 0.39604% 0.00000% 0.74455% 0.00000% 0.00000% 0.37080% 0.00000% 0.69710% 0.00000% 0.00000% 0.36260% 0.28903% 0.42734% 0.00000% 0.00000% 0.32352% 0.00390% 0.60479% 0.00000% 0.00000% 0.32228% 0.68851% 0.00000% 0.00000% 0.00000% 0.30762% 0.65719% 0.00000% 0.00000% 0.00000% 0.30470% 0.00000% 0.57285% 0.00000% 0.00000% 0.29546% 0.63121% 0.00000% 0.00000% 0.00000% 0.27722% 0.09876% 0.43427% 0.00000% 0.00000% 0.27391% 0.00000% 0.51496% 0.02833% 0.00000% 0.26726% 0.00000% 0.50245% 0.00000% 0.00000% 0.26399% 0.00000% 0.49630% 0.00000% 0.00000% 0.26300% 0.00000% 0.49443% 0.00000% 0.00000% 0.25849% 0.27608% 0.24302% 0.00000% 0.00000% 0.25303% 0.54056% 0.00000% 0.00000% 0.00000% 0.24349% 0.47371% 0.04089% 0.00000% 0.00000% 0.22983% 0.49100% 0.00000% 0.00000% 0.00000% 0.21792% 0.00000% 0.40969% 2.29473% 0.00000% 0.21652% 0.11137% 0.30905% 1.03404% 0.00000% 0.21531% 0.03346% 0.37533% 0.00000% 0.00000% 0.21358% 0.00000% 0.40153% 0.00000% 0.00000% 0.21340% 0.00000% 0.40120% 0.00000% 0.00000% 0.21138% 0.00000% 0.39739% 0.00000% 0.00000% 0.20518% 0.14889% 0.25471% 0.00000% 0.00000% 0.20060% 0.00000% 0.37712% 0.00000% 0.00000% 0.19761% 0.42217% 0.00000% 0.00000% 0.00000% 0.19262% 0.00000% 0.36213% 0.00000% 0.00000% 0.18916% 0.36656% 0.03305% 0.00000% 0.00000% 0.18664% 0.07696% 0.28315% 0.00000% 0.00000% 0.17664% 0.01557% 0.31839% 0.00000% 0.00000% 0.17166% 0.00000% 0.32272% 0.00000% 0.00000% 0.17126% 0.00000% 0.32197% 0.00000% 0.00000% 0.16655% 0.00000% 0.31311% 0.00000% 0.00000% 0.16533% 0.00000% 0.31081% 0.00000% 0.00000% 0.15650% 0.33433% 0.00000% 0.00000% 0.00000% 0.14708% 0.17302% 0.12426% 0.00000% 0.00000% 0.13406% 0.00000% 0.25204% 0.00000% 0.00000% 0.13120% 0.00000% 0.24666% 0.00000% 0.00000% 0.12179% 0.25643% 0.00331% 0.00000% 0.00000% 0.10841% 0.22566% 0.00523% 0.00000% 0.00000% 0.10493% 0.00087% 0.19650% 0.00000% 0.00000% 0.10170% 0.21726% 0.00000% 0.00000% 0.00000% 0.10156% 0.00000% 0.19093% 0.00000% 0.00000% 0.09980% 0.00000% 0.18763% 0.00000% 0.00000% 0.09928% 0.00000% 0.18665% 0.00000% 0.00242% 0.09548% 0.00014% 0.17938% 0.00000% 0.00000% 0.09488% 0.00000% 0.17838% 0.00000% 0.00000% 0.09451% 0.20192% 0.00000% 0.00000% 0.00000% 0.09156% 0.00000% 0.17214% 0.00000% 0.00000% 0.08637% 0.00208% 0.16055% 1.87450% 0.00000% 0.08289% 0.00172% 0.15432% 0.00000% 0.00000% 0.08036% 0.00000% 0.15107% 0.00000% 0.00000% 0.07997% 0.17084% 0.00000% 0.00000% 0.00000% 0.07700% 0.00000% 0.14476% 0.00000% 0.00000% 0.07664% 0.00000% 0.14409% 0.00000% 0.00000% 0.07328% 0.00000% 0.13776% 0.00000% 0.00000% 0.07232% 0.00000% 0.13597% 0.00000% 0.00000% 0.07140% 0.02366% 0.11341% 0.00000% 0.00000% 0.07105% 0.01138% 0.12356% 0.00000% 0.00000% 0.07008% 0.14971% 0.00000% 0.00000% 0.00000% 0.07000% 0.00008% 0.13153% 0.00000% 0.00000% 0.06869% 0.00000% 0.12914% 0.00000% 0.00000% 0.06480% 0.13843% 0.00000% 0.00000% 0.00000% 0.06355% 0.13505% 0.00063% 0.00000% 0.00000% 0.06300% 0.00000% 0.11844% 0.02833% 0.00000% 0.06155% 0.00000% 0.11572% 0.00000% 0.00000% 0.06038% 0.00000% 0.11352% 0.00000% 0.00000% 0.06032% 0.00000% 0.11340% 0.00000% 0.00000% 0.06001% 0.00000% 0.11283% 0.03777% 0.00000% 0.05810% 0.00000% 0.10922% 0.00000% 0.00000% 0.05703% 0.00000% 0.10722% 0.00000% 0.00000% 0.05454% 0.11651% 0.00000% 0.00000% 0.00000% 0.05445% 0.00960% 0.09391% 0.00000% 0.00000% 0.05367% 0.09915% 0.01364% 0.00000% 0.00000% 0.05206% 0.00000% 0.09787% 0.00000% 0.00000% 0.05146% 0.10993% 0.00000% 0.00000% 0.00000% 0.05069% 0.00000% 0.09531% 0.00000% 0.00000% 0.04642% 0.00000% 0.08727% 0.00000% 0.00000% 0.04602% 0.00000% 0.08652% 0.00000% 0.00000% 0.04552% 0.09725% 0.00000% 0.00000% 0.00000% 0.04443% 0.00000% 0.08353% 0.00000% 0.00000% 0.04345% 0.09283% 0.00000% 0.00000% 0.00000% 0.04307% 0.00000% 0.08098% 0.00000% 0.00000% 0.04236% 0.00000% 0.07965% 0.00000% 0.00000% 0.04070% 0.08695% 0.00000% 0.00000% 0.00000% 0.04007% 0.08559% 0.00000% 0.00000% 0.00000% 0.03931% 0.00000% 0.07391% 0.00000% 0.00000% 0.03813% 0.00000% 0.07168% 0.00000% 0.00000% 0.03455% 0.05141% 0.01971% 0.00000% 0.00000% 0.03445% 0.06842% 0.00456% 0.00000% 0.00000% 0.03353% 0.07087% 0.00066% 0.00000% 0.00000% 0.02865% 0.00000% 0.05387% 0.00000% 0.00000% 0.02714% 0.05798% 0.00000% 0.00000% 0.00000% 0.02686% 0.00000% 0.05049% 0.00000% 0.00000% 0.02651% 0.05664% 0.00000% 0.00000% 0.00000% 0.02541% 0.02899% 0.02225% 0.00000% 0.00000% 0.02529% 0.00000% 0.04755% 0.00000% 0.00000% 0.02364% 0.05050% 0.00000% 0.00000% 0.00000% 0.02362% 0.00000% 0.04440% 0.00000% 0.00000% 0.02351% 0.05023% 0.00000% 0.00000% 0.00000% 0.02289% 0.00000% 0.04304% 0.00000% 0.00000% 0.02183% 0.00000% 0.04103% 0.00000% 0.00000% 0.02098% 0.00000% 0.03944% 0.00000% 0.00000% 0.02088% 0.04462% 0.00000% 0.00000% 0.00000% 0.02020% 0.00000% 0.03797% 0.00000% 0.00000% 0.02001% 0.04275% 0.00000% 0.00000% 0.00000% 0.01950% 0.00000% 0.03666% 0.00000% 0.00000% 0.01883% 0.04022% 0.00000% 0.00000% 0.00000% 0.01804% 0.03184% 0.00591% 0.00000% 0.00000% 0.01780% 0.00000% 0.03347% 0.00000% 0.00000% 0.01743% 0.00000% 0.03278% 0.00000% 0.00000% 0.01707% 0.00000% 0.03208% 0.00000% 0.00000% 0.01704% 0.03640% 0.00000% 0.00000% 0.00000% 0.01482% 0.00000% 0.02786% 0.00000% 0.00000% 0.01447% 0.00000% 0.02721% 0.00000% 0.00000% 0.01434% 0.03063% 0.00000% 0.00000% 0.00000% 0.01431% 0.03058% 0.00000% 0.00000% 0.00000% 0.01419% 0.00334% 0.02375% 0.00000% 0.00000% 0.01392% 0.02975% 0.00000% 0.00000% 0.00000% 0.01378% 0.00646% 0.02022% 0.00000% 0.00000% 0.01346% 0.00000% 0.02530% 0.00000% 0.00000% 0.01303% 0.00000% 0.02450% 0.00000% 0.56641% 0.01252% 0.00100% 0.02266% 0.00000% 0.00000% 0.01208% 0.02364% 0.00191% 0.00000% 0.00000% 0.01183% 0.00000% 0.02225% 0.00000% 0.00000% 0.01155% 0.00000% 0.02172% 0.00000% 0.00000% 0.01144% 0.00000% 0.02151% 0.00000% 0.00000% 0.01131% 0.00000% 0.02127% 0.00000% 0.00000% 0.01125% 0.02403% 0.00000% 0.00000% 0.00000% 0.01115% 0.02190% 0.00170% 0.00000% 0.00000% 0.01108% 0.00000% 0.02082% 0.00000% 0.00000% 0.01099% 0.00000% 0.02067% 0.00000% 0.00000% 0.01089% 0.00000% 0.02048% 0.00000% 0.00000% 0.01080% 0.00000% 0.02030% 0.00000% 0.00000% 0.01046% 0.00000% 0.01967% 0.00000% 0.00000% 0.01034% 0.00000% 0.01945% 0.00000% 0.00000% 0.01025% 0.00000% 0.01927% 0.00000% 0.00000% 0.00962% 0.00000% 0.01809% 0.00000% 0.00000% 0.00954% 0.00000% 0.01793% 0.00000% 0.00000% 0.00921% 0.00000% 0.01732% 0.00000% 0.00000% 0.00912% 0.00000% 0.01715% 0.00000% 0.00000% 0.00860% 0.00000% 0.01618% 0.00000% 0.00000% 0.00842% 0.00000% 0.01583% 0.00000% 0.00000% 0.00835% 0.00000% 0.01569% 0.00000% 0.00000% 0.00823% 0.01758% 0.00000% 0.00000% 0.00000% 0.00798% 0.00000% 0.01499% 0.00000% 0.00000% 0.00760% 0.00000% 0.01428% 0.00000% 0.00000% 0.00748% 0.00000% 0.01407% 0.00000% 0.00000% 0.00747% 0.01595% 0.00000% 0.00000% 0.00000% 0.00705% 0.00000% 0.01325% 0.00000% 0.00000% 0.00692% 0.01479% 0.00000% 0.00000% 0.00000% 0.00668% 0.00000% 0.01256% 0.00000% 0.00000% 0.00638% 0.00000% 0.01199% 0.00000% 0.00000% 0.00629% 0.00000% 0.01182% 0.00000% 0.00000% 0.00614% 0.00008% 0.01147% 0.00000% 0.00000% 0.00613% 0.00000% 0.01153% 0.00000% 0.00000% 0.00604% 0.00000% 0.01136% 0.00000% 0.00000% 0.00595% 0.00000% 0.01119% 0.00000% 0.00000% 0.00571% 0.00966% 0.00223% 0.00000% 0.00000% 0.00564% 0.00000% 0.01060% 0.00000% 0.00000% 0.00553% 0.00000% 0.01040% 0.00000% 0.00000% 0.00528% 0.01128% 0.00000% 0.00000% 0.00000% 0.00528% 0.01128% 0.00000% 0.00000% 0.00000% 0.00528% 0.00000% 0.00992% 0.00000% 0.00000% 0.00525% 0.00000% 0.00986% 0.00000% 0.00000% 0.00511% 0.01092% 0.00000% 0.00000% 0.00000% 0.00503% 0.00000% 0.00947% 0.00000% 0.00000% 0.00494% 0.00000% 0.00929% 0.00000% 0.00000% 0.00493% 0.00000% 0.00927% 0.00000% 0.00000% 0.00427% 0.00000% 0.00802% 0.00000% 0.00000% 0.00427% 0.00000% 0.00802% 0.00000% 0.00000% 0.00424% 0.00000% 0.00797% 0.00000% 0.00000% 0.00421% 0.00000% 0.00792% 0.00000% 0.00000% 0.00412% 0.00880% 0.00000% 0.00000% 0.00000% 0.00408% 0.00000% 0.00767% 0.00000% 0.00000% 0.00385% 0.00021% 0.00706% 0.00000% 0.00000% 0.00367% 0.00000% 0.00691% 0.00000% 0.00000% 0.00341% 0.00000% 0.00642% 0.00000% 0.00000% 0.00336% 0.00000% 0.00632% 0.00000% 0.00000% 0.00329% 0.00702% 0.00000% 0.00000% 0.00000% 0.00318% 0.00680% 0.00000% 0.00000% 0.00000% 0.00307% 0.00000% 0.00578% 0.00000% 0.00000% 0.00293% 0.00000% 0.00551% 0.00000% 0.00000% 0.00289% 0.00617% 0.00000% 0.00000% 0.00000% 0.00288% 0.00000% 0.00542% 0.00000% 0.00000% 0.00288% 0.00000% 0.00542% 0.00000% 0.00000% 0.00276% 0.00590% 0.00000% 0.00000% 0.00000% 0.00269% 0.00574% 0.00000% 0.00000% 0.00000% 0.00269% 0.00574% 0.00000% 0.00000% 0.00000% 0.00265% 0.00565% 0.00000% 0.00000% 0.00000% 0.00238% 0.00000% 0.00447% 0.00000% 0.00000% 0.00231% 0.00000% 0.00435% 0.00000% 0.00000% 0.00230% 0.00491% 0.00000% 0.00000% 0.00000% 0.00225% 0.00000% 0.00424% 0.00000% 0.00000% 0.00211% 0.00000% 0.00396% 0.00000% 0.00000% 0.00204% 0.00000% 0.00384% 0.00000% 0.00000% 0.00201% 0.00430% 0.00000% 0.00000% 0.00000% 0.00194% 0.00414% 0.00000% 0.00000% 0.00000% 0.00184% 0.00000% 0.00347% 0.00000% 0.00000% 0.00179% 0.00383% 0.00000% 0.00000% 0.00000% 0.00176% 0.00377% 0.00000% 0.00000% 0.00000% 0.00176% 0.00000% 0.00331% 0.00000% 0.00000% 0.00167% 0.00357% 0.00000% 0.00000% 0.00000% 0.00166% 0.00000% 0.00312% 0.00000% 0.00000% 0.00156% 0.00334% 0.00000% 0.00000% 0.00000% 0.00155% 0.00000% 0.00292% 0.00000% 0.00000% 0.00155% 0.00000% 0.00292% 0.00000% 0.00000% 0.00149% 0.00319% 0.00000% 0.00000% 0.00000% 0.00140% 0.00030% 0.00237% 0.04249% 0.00000% 0.00139% 0.00103% 0.00170% 0.00000% 0.00000% 0.00126% 0.00000% 0.00237% 0.00000% 0.00000% 0.00125% 0.00226% 0.00035% 0.00000% 0.00000% 0.00122% 0.00000% 0.00230% 0.00000% 0.00000% 0.00122% 0.00261% 0.00000% 0.00000% 0.00000% 0.00119% 0.00000% 0.00224% 0.00000% 0.00000% 0.00118% 0.00207% 0.00040% 0.00000% 0.00000% 0.00116% 0.00248% 0.00000% 0.00000% 0.00000% 0.00110% 0.00000% 0.00207% 0.00000% 0.00000% 0.00102% 0.00190% 0.00025% 0.00000% 0.00000% 0.00093% 0.00000% 0.00175% 0.00000% 0.00000% 0.00090% 0.00000% 0.00170% 0.00000% 0.00000% 0.00077% 0.00165% 0.00000% 0.00000% 0.00000% 0.00066% 0.00000% 0.00125% 0.00000% 0.00000% 0.00066% 0.00000% 0.00124% 0.00000% 0.00000% 0.00066% 0.00140% 0.00000% 0.00000% 0.00000% 0.00065% 0.00138% 0.00000% 0.00000% 0.00000% 0.00064% 0.00000% 0.00120% 0.00000% 0.00000% 0.00064% 0.00136% 0.00000% 0.00000% 0.00000% 0.00062% 0.00000% 0.00117% 0.00000% 0.00000% 0.00062% 0.00000% 0.00117% 0.00000% 0.00000% 0.00060% 0.00000% 0.00113% 0.00000% 0.00000% 0.00060% 0.00128% 0.00000% 0.00000% 0.00000% 0.00058% 0.00000% 0.00110% 0.00000% 0.00000% 0.00058% 0.00124% 0.00000% 0.00000% 0.00000% 0.00056% 0.00000% 0.00106% 0.00000% 0.00000% 0.00055% 0.00000% 0.00103% 0.00000% 0.00000% 0.00052% 0.00035% 0.00068% 0.00000% 0.00000% 0.00050% 0.00052% 0.00048% 0.00000% 0.00000% 0.00049% 0.00104% 0.00000% 0.00000% 0.00000% 0.00046% 0.00000% 0.00086% 0.00000% 0.00000% 0.00042% 0.00091% 0.00000% 0.00000% 0.00000% 0.00042% 0.00090% 0.00000% 0.00000% 0.00000% 0.00040% 0.00086% 0.00000% 0.00000% 0.00000% 0.00039% 0.00084% 0.00000% 0.00000% 0.00000% 0.00038% 0.00000% 0.00072% 0.00000% 0.00000% 0.00037% 0.00079% 0.00000% 0.00000% 0.00000% 0.00037% 0.00000% 0.00070% 0.00000% 0.00000% 0.00037% 0.00000% 0.00069% 0.00000% 0.00000% 0.00037% 0.00000% 0.00069% 0.00000% 0.00000% 0.00037% 0.00000% 0.00069% 0.00000% 0.00000% 0.00037% 0.00000% 0.00069% 0.00000% 0.00000% 0.00037% 0.00000% 0.00069% 0.00000% 0.00000% 0.00037% 0.00042% 0.00032% 0.00000% 0.00000% 0.00036% 0.00028% 0.00042% 0.00000% 0.00000% 0.00035% 0.00000% 0.00066% 0.00000% 0.00000% 0.00034% 0.00072% 0.00000% 0.00000% 0.00000% 0.00034% 0.00036% 0.00032% 0.00000% 0.00000% 0.00034% 0.00000% 0.00063% 0.00000% 0.00000% 0.00034% 0.00072% 0.00000% 0.00000% 0.00000% 0.00033% 0.00070% 0.00000% 0.00000% 0.00000% 0.00031% 0.00000% 0.00058% 0.00000% 0.01452% 0.00031% 0.00000% 0.00058% 0.00000% 0.00000% 0.00030% 0.00000% 0.00057% 0.00000% 0.00000% 0.00030% 0.00000% 0.00057% 0.00000% 0.00000% 0.00029% 0.00062% 0.00000% 0.00000% 0.00000% 0.00029% 0.00062% 0.00000% 0.00000% 0.00000% 0.00028% 0.00051% 0.00008% 0.00000% 0.00000% 0.00028% 0.00060% 0.00000% 0.00000% 0.00000% 0.00027% 0.00000% 0.00052% 0.00000% 0.00000% 0.00027% 0.00000% 0.00052% 0.00000% 0.00000% 0.00027% 0.00000% 0.00052% 0.00000% 0.00000% 0.00027% 0.00000% 0.00052% 0.00000% 0.00000% 0.00027% 0.00000% 0.00052% 0.00000% 0.00000% 0.00026% 0.00000% 0.00050% 0.00000% 0.00000% 0.00026% 0.00036% 0.00017% 0.00000% 0.00000% 0.00023% 0.00000% 0.00043% 0.00000% 0.00000% 0.00022% 0.00000% 0.00041% 0.00000% 0.00000% 0.00022% 0.00008% 0.00034% 0.00000% 0.00000% 0.00022% 0.00000% 0.00041% 0.00000% 0.00000% 0.00022% 0.00000% 0.00041% 0.00000% 0.00000% 0.00021% 0.00000% 0.00040% 0.00000% 0.00000% 0.00020% 0.00043% 0.00000% 0.00000% 0.00000% 0.00020% 0.00043% 0.00000% 0.00000% 0.00000% 0.00020% 0.00043% 0.00000% 0.00000% 0.00000% 0.00020% 0.00043% 0.00000% 0.00000% 0.00000% 0.00020% 0.00042% 0.00000% 0.00000% 0.00000% 0.00020% 0.00042% 0.00000% 0.00000% 0.00000% 0.00019% 0.00042% 0.00000% 0.00000% 0.00000% 0.00019% 0.00042% 0.00000% 0.00000% 0.00000% 0.00019% 0.00042% 0.00000% 0.00000% 0.00000% 0.00019% 0.00000% 0.00035% 0.00000% 0.00000% 0.00018% 0.00000% 0.00034% 0.00000% 0.00000% 0.00018% 0.00000% 0.00034% 0.00000% 0.00000% 0.00018% 0.00000% 0.00034% 0.00000% 0.00000% 0.00018% 0.00000% 0.00034% 0.00000% 0.00000% 0.00018% 0.00000% 0.00034% 0.00000% 0.00000% 0.00018% 0.00000% 0.00034% 0.00000% 0.00000% 0.00018% 0.00000% 0.00034% 0.00000% 0.00000% 0.00018% 0.00000% 0.00034% 0.00000% 0.00000% 0.00018% 0.00000% 0.00033% 0.00000% 0.00000% 0.00018% 0.00000% 0.00033% 0.00000% 0.00000% 0.00017% 0.00036% 0.00000% 0.00000% 0.00000% 0.00016% 0.00035% 0.00000% 0.00000% 0.00000% 0.00014% 0.00029% 0.00000% 0.00000% 0.00000% 0.00014% 0.00029% 0.00000% 0.00000% 0.00000% 0.00013% 0.00029% 0.00000% 0.00000% 0.00000% 0.00013% 0.00029% 0.00000% 0.00000% 0.00000% 0.00013% 0.00029% 0.00000% 0.00000% 0.00000% 0.00013% 0.00000% 0.00024% 0.00000% 0.00000% 0.00010% 0.00000% 0.00019% 0.00000% 0.00000% 0.00010% 0.00000% 0.00019% 0.00000% 0.00000% 0.00010% 0.00008% 0.00011% 0.00000% 0.00000% 0.00009% 0.00000% 0.00017% 0.00000% 0.00000% 0.00009% 0.00000% 0.00017% 0.00000% 0.00000% 0.00009% 0.00000% 0.00017% 0.00000% 0.00000% 0.00009% 0.00000% 0.00017% 0.00000% 0.00000% 0.00009% 0.00000% 0.00017% 0.00000% 0.00000% 0.00008% 0.00018% 0.00000% 0.00000% 0.00000% 0.00008% 0.00017% 0.00000% 0.00000% 0.00000% 0.00007% 0.00014% 0.00000% 0.00000% 0.00000% 0.00007% 0.00014% 0.00000% 0.00000% 0.00000% 0.00007% 0.00014% 0.00000% 0.00000% 0.00000% 0.00007% 0.00014% 0.00000% 0.00000% 0.00000% 0.00006% 0.00014% 0.00000% 0.00000% 0.00000% 0.00006% 0.00014% 0.00000% 0.00000% 0.00000% 0.00004% 0.00008% 0.00000% APPENDIX 5.4

Table S4.List of taxa exclusively identified in either group at prevalence ≥ 10%

Exclusively in OSCC % Exclusively in Controls % Hannaella luteola_nov_98.13% 18.2% Aspergillus tamarii 28.0%

Penicilliumtoxicarium 13.6% Alternariaalternata 28.0%

Malassezia slooffiae_nov_96.34% 13.6% Malassezia furfur 24.0%

Aureobasidium pullulans 13.6% Hanseniaspora uvarum_nov_98.04% 20.0%

Talaromycesfuniculosus 16.0%

Candida salmanticensis_nov_79.52% 16.0%

Talaromyces funiculosus_nov_98.36% 16.0%

Neophysalospora eucalypti_nov_96.99% 16.0%

Pseudorobillarda siamensis_nov_93.02% 12.0%

Eremascus albus_nov_79.67% 12.0%

multigenus multispecies_spp14_2 12.0%

Cordana ellipsoidea_nov_93.96% 12.0%

Talaromyces minioluteus_nov_95.58% 12.0%

Gaeumannomyces radicicola_nov_91.28% 12.0%

Didymellaglomerata 12.0%

Ophiostoma pulvinisporum_nov_89.67% 12.0%

Aspergillus amstelodami 12.0%

Alternaria multispecies_spp16_2 12.0%

Aspergillus nomius 12.0% APPENDIX 6 APPENDIX 7

GRIFFITH UNIVERSITY HUMAN RESEARCH ETHICS COMMITTEE 16-Apr-2015 Dear Emeritus Professor Johnson

I write further to the additional information provided in relation to the provisional approval granted to your application for ethical clearance for your project "The microbiome profile of oral squamous cell carcinoma tissues in a group of Sri Lankan patients." (GU Ref No: DOH/18/14/HREC).

The additional information was considered by Office for Research.

This is to confirm that this response has addressed the comments and concerns of the HREC.

All conditions have been addressed. The research can commence in full, immediately.

Consequently, you are authorised to immediately commence this research on this basis.

The standard conditions of approval attached to our previous correspondence about this protocol continue to apply.

Regards

Rick Williams Manager, Research Ethics Office for Research Bray Centre, N54 Room 0.15 Nathan Campus Griffith University ph: 07 3735 4375 fax: 07 373 57994 email: [email protected] web:

Cc:

Researchers are reminded that the Griffith University Code for the Responsible Conduct of Research provides guidance to researchers in areas such as conflict of interest, authorship, storage of data, & the training of research students. You can find further information, resources and a link to the University's Code by visiting http://policies.griffith.edu.au/pdf/Code%20for%20the%20Responsible%20Conduct%20of%20Research.pdf PRIVILEGED, PRIVATE AND CONFIDENTIAL This email and any files transmitted with it are intended solely for the use of the addressee(s) and may contain information which is confidential or privileged. If you receive this email and you are not the addressee(s) [or responsible for delivery of the email to the addressee(s)], please disregard the contents of the email, delete the email and notify the author immediately

Appendix 07 Griffith Ethics Full Approval.txt[18-Jun-17 7:05:28 PM]