University of Florida Thesis Or Dissertation Formatting

SKEWED TRYPTOPHAN METABOLISM CONTRIBUTES TO DISEASE PATHOGENESIS IN A LUPUS-PRONE MOUSE MODEL BY IMPACTING T CELL PHENOTYPES

JOSEPHINE MICHELLE BROWN

A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2020

To my father, Joseph Thomas Brown, who has unequivocally inspired me to spend my life working to improve the lives of others through scientific investigation

ACKNOWLEDGMENTS

I would like to thank my mentor, Dr. Laurence Morel, who invested insurmountable time and energy for the past 4 years molding me into a skilled scientist by constantly challenging me. Most of all, I thank her for her immense patience and can only hope of having another mentor as thoughtful and skilled as her.

I thank my committee for their guidance and constructive criticism on my work.

Dr. Graciela Lorca gave me tremendous advice on our microbiology methodologies. Dr.

Christian Jobin was an invaluable resource for advice and suggestions regarding our microbiota assessments and histological techniques. Dr. Todd Brusko provided guidance on the T cell portion of this study and has consistently encouraged me during my time as a PhD student. Without you all, I would not have such diverse technical expertise.

I am forever grateful to my family for their unwavering support. I would absolutely not be where I am today without you. Thank you Haaris for always being my shoulder to cry on, for intelligent conversations about my research, and for constantly encouraging and believing in me, even in my greatest times of weakness. You are truly the most selfless person I know. Thank you Jess for being the most supportive sister, and for your encouragement and honest advice. Thank you to my mother and stepfather for always believing in me and for giving me advice and encouragement during the most difficult times. Thank you to my grandparents for thinking the world of me and for being proud. To my late grandmother, Sara – I am so thankful to have learned so many valuable life lessons from you.

I am grateful to my friends and colleagues Dr. Williams, Dr. Shapiro, Dr. Lin, and

Dr. Zuniga for your constant support and advice.

Finally, thank you to my fellow lab members, Nathalie Kanda, Tracoyia Roach,

Dr. Elshikha, Dr. Abboud, and Dr. Choi, for your help with experiments and for your constructive criticism.

I sincerely owe a portion of my success to all of you.

TABLE OF CONTENTS

page

ACKNOWLEDGMENTS ...... 4

LIST OF TABLES ...... 9

LIST OF FIGURES ...... 10

LIST OF ABBREVIATIONS ...... 12

ABSTRACT ...... 14

CHAPTER

1 INTRODUCTION ...... 16

Overview of Systemic Lupus Erythematosus ...... 16 Overview of The TC Murine Model ...... 18 Endogenous Tryptophan Metabolism ...... 19 Microbial Tryptophan Metabolism ...... 20 Tryptophan Metabolites in Immunity ...... 21 Intestinal Dysbiosis in Human and Murine SLE ...... 22 Potential Mechanisms for Microbiota Contributions to Autoimmunity ...... 24 Evidence for Microbiota Contributions to SLE ...... 25 Dysregulated Tryptophan Metabolism in SLE ...... 27 Mammalian Target of Rapamycin (mTOR) and Relevance in SLE ...... 28

2 MICROBIOTA-ASSOCIATED TRYPTOPHAN CATABOLISM INDUCES AUTOIMMUNE ACTIVATION IN THE TC MURINE MODEL ...... 35

Background ...... 35 Methods ...... 36 Mice and Treatments ...... 36 Assessment of Gut Leakage ...... 37 Gut Microbiota Analysis ...... 38 Metabolomic Analysis ...... 39 Renal Pathology ...... 41 Anti-dsDNA IgG Autoantibody ELISA ...... 41 Statistical Analysis ...... 42 Results ...... 42 Autoimmune TC mice Present Altered Gut Microbial Communities ...... 42 Intestinal Dysbiosis Contributes to Autoimmune Activation via a Mechanism other than Bacterial Translocation ...... 43 Tryptophan Metabolites are Dysregulated in TC Mice ...... 45

Autoimmune Phenotype Severity is Dependent on the Amount of Dietary Tryptophan ...... 45 Increased Dietary Tryptophan Percentage Further Disrupts Gut Microbial Communities in TC Mice ...... 46 Long-Term Antibiotic Treatment Restores Tryptophan Metabolites in TC Mice ...... 47 The TC Microbiota Mediates the Effects of Variations in Dietary Tryptophan on Autoimmune Activation...... 48 Discussion ...... 48

3 THE MICROBIOTA IS LARGELY RESPONSIBLE FOR SKEWED TRYPTOPHAN METABOLISM IN THE LUPUS-PRONE TC MODEL ...... 62

Background ...... 62 Methods ...... 63 Mice and Treatments ...... 63 Analysis of Kynurenine and Tryptophan by HPLC ...... 64 Metabolomic Analysis ...... 64 Gene Expression Analysis ...... 66 Flow Cytometry ...... 67 Bone Marrow Chimeras ...... 67 Anti-dsDNA IgG Autoantibody ELISA ...... 67 Statistical Analysis ...... 68 Results ...... 68 IDO1 and TDO do not Contribute to Kynurenine Accumulation in TC Mice ..... 68 TC Hematopoietic and Non-hematopoietic Compartments Play a Role in Tryptophan Metabolite Alterations ...... 70 The Microbiota Skews Tryptophan Metabolism in TC Mice ...... 71 Discussion ...... 72

4 SKEWED TRYPTOPHAN METABOLISM IN THE LUPUS-PRONE TC MOUSE PROMOTES PRO-INFLAMMATORY T CELL PHENOTYPES ...... 82

Background ...... 82 Methods ...... 83 Mice and Treatments ...... 83 Flow Cytometry ...... 84 Cellular Assays ...... 85 Immunofluorescence Staining ...... 85 Western Blots ...... 86 Statistical Analysis ...... 87 Results ...... 87 High Dietary Tryptophan Impairs Treg Suppressive Function in vitro ...... 87 High Dietary Tryptophan Activates mTOR in TC CD4+ T Cells in vivo ...... 88 Tryptophan Metabolites Impact CD4+ T Cell Polarization in vitro ...... 89 Discussion ...... 89

5 CONCLUSIONS ...... 96

LIST OF REFERENCES ...... 106

BIOGRAPHICAL SKETCH ...... 120

LIST OF TABLES

Table page

2-1 Mouse primer sequences used for qRT-PCR analysis of tight junction genes ...... 61

3-1 Mouse primer sequences used for qRT-PCR analysis of endogenous tryptophan catabolism genes ...... 81

LIST OF FIGURES

Figure page

1-1 Pathogenesis of SLE...... 31

1-2 Overview of disease pathogenesis in the B6.Sle1.Sle2.Sle3 (TC) murine model. .. 32

1-3 Overview of endogenous and microbial tryptophan catabolism pathways emphasizing kynurenine synthesis...... 33

1-4 Overview of signaling events upstream and downstream of mTORC1 in T cells. ... 34

2-1 Autoimmune TC mice present altered gut microbial communities...... 54

2-2 TC mice do not display signs of a compromised intestinal barrier...... 55

2-3 TC mice have minimal bacterial translocation that does not contribute to autoimmune activation...... 56

2-4 TC mice have intrinsically skewed tryptophan metabolism toward the kynurenine pathway...... 57

2-5 Dietary tryptophan percentage modifies autoimmune activation...... 58

2-6 Increased dietary tryptophan alters microbial communities, allowing for further expansions of Lactobacillus and Paraprevotella in TC mice...... 59

2-7 Broad-spectrum antibiotic treatment restores tryptophan metabolite alterations in TC mice...... 60

3-1 Endogenous enzyme expression in the tryptophan catabolism pathway in TC and B6 mice...... 76

3-2 Assessment of IDO1 protein levels in immune cell subsets in TC and B6 mice...... 77

3-3 Tryptophan metabolite concentrations from bone marrow chimeras ...... 78

3-4 Tryptophan metabolite concentrations from TC and TC.Rag-/- mice ...... 79

3-5 Serum and fecal tryptophan metabolites from GF and SPF TC mice...... 80

4-1 Dietary tryptophan modifies Treg suppressive capacity...... 92

4-2 High dietary tryptophan promotes mTOR activation in TC effector T cells in vivo. .. 93

4-3 High dietary tryptophan increases mTOR expression in TC CD4+ T cells...... 94

4-4 Exogenous tryptophan and kynurenine promote CD4+ T cell Th1 and impair Treg polarization in vitro...... 95

5-1 Working model depicting the mechanism of skewed tryptophan metabolism and related contributions to immune phenotypes in murine lupus...... 105

LIST OF ABBREVIATIONS

4E-BP1 4E-binding protein 1

ACR American College of Rheumtology

AhR Aryl hydrocarbon receptor

CFUs Colony forming units dsDNA Double stranded DNA

EAE Experimental Autoimmune Encephalomyelitis

FMT Fecal microbiota transfer

GCN2 General control non-derepressible 2

GF Germ free

IDO Indoleamine dioxygenase

KP Kynurenine pathway

Kyn Kynurenine

MLN Mesentric lymph node mTORC1 mTOR complex 1

OXPHOS Oxidative phosphorylation

S6K P70 ribosomal S6 kinase pDC Plasmacytoid dendritic cell

RA Rheumatiod Arthritis

SCFA Short chain fatty acid

SLE Systemic Lupus Erythemtosus

SLEDIA SLE Disease Activity Index

SLICC Systemic Lupus International Collaborating Clinics

SPF Specific pathogen free

T1 IFN Type 1 interferon (IFN alpha)

TC Triple congenic mouse (B6.Sle1.Sle2.Sle3)

TLR Toll-like receptor

Treg Regulatory T cell

TRP Tryptophan

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy

SKEWED TRYPTOPHAN METABOLISM CONTRIBUTES TO DISEASE PATHOGENESIS IN A LUPUS-PRONE MOUSE MODEL BY IMPACTING T CELL PHENOTYPES

Josephine Michelle Brown

December 2020

Chair: Laurence Morel Major: Medical Sciences—Immunology and Microbiology

There is strong evidence from human and murine studies associating microbial dysbiosis with autoimmunity. Previous reports highlight altered gut microbial communities in SLE patients relative to healthy controls as well as several mechanisms by which microbial dysbiosis may contribute to lupus pathogenesis in patients and mouse models. Therefore, we sought to use the TC mouse model and its closely related

B6 congenic control to understand the mechanisms by which microbial dysbiosis could impact disease pathogenesis in lupus. Here, we demonstrate that perturbed microbial communities in TC mice amplify disease through the production of microbial metabolites that impact immune cell phenotypes.

Tryptophan is a precursor for the synthesis of numerous bioactive metabolites from endogenous and microbial enzymes. Skewed tryptophan metabolism toward the kynurenine pathway (KP) is observed in lupus patients and TC mice. There were dramatic differences between tryptophan metabolites in TC mice raised under GF conditions compared to mice raised under normal SPF conditions, implying microbiota involvement in skewed tryptophan metabolites. We also found decreased levels of the

enzyme IDO1 in TC immune cells, suggesting that IDO1 is not responsible for kynurenine accumulation in TC mice. Overall, these data together imply that the TC microbiota is largely responsible for skewing tryptophan metabolites. Additionally, low dietary tryptophan confers protection from autoimmune activation, whereas high dietary tryptophan exacerbates disease in TC mice. Further, microbiota transfers from TC mice fed high dietary tryptophan induced more immune activation in GF B6 recipients compared to microbiota transfers from TC mice fed low dietary tryptophan, supporting the importance of metabolites from microbial origin.

We found that high levels of dietary tryptophan compromised regulatory T cell functionality and increased mTORC1 activation in TC effector memory T cells in vivo, which may imply that skewed tryptophan metabolites have the potential to increase effector T cell pathogenicity through prototypical metabolic pathways that are relevant in lupus. Thus, the interplay of gut microbial dysbiosis, tryptophan metabolism and host genetic susceptibility suggests that aberrant tryptophan metabolism in lupus-susceptible mice could be a mechanism contributing to autoimmune activation in this disease, and that reducing dietary tryptophan may improve disease severity.

CHAPTER 1 INTRODUCTION

Overview of Systemic Lupus Erythematosus

Systemic Lupus Erythematosus (SLE) is a chronic autoimmune disease of complex etiology characterized by multi-organ damage and heterogenous clinical manifestations(1-3) (Figure 1-1). Loss of tolerance to nuclear antigens is a fundamental feature in SLE. Autoreactive B cells are responsible for producing high affinity, class- switched autoantibodies against numerous cellular antigens (Figure 1-1). These antibody-antigen complexes, together with complement proteins, form large circulating immune complexes that are deposited throughout a multitude of organs leading to widespread, chronic inflammation and tissue damage (1; 2) (Figure 1-1). Additionally, internalization of immune complexes by plasmacytoid dendritic cells (pDCs) leads to type 1 interferon (T1 IFN) production, and an evident interferon gene signature in patients(4; 5).

Globally, studies combined have illustrated that SLE prevalence ranges from 45 to 123 per 100,000 depending on the geographical region and ethnicity(6). There is a much higher frequency of disease in women of childbearing age, with an average female to male ratio of 9:1(6). Additionally, a significant number of SLE patients are of

African American, Hispanic, and Asian descent(1; 2; 6). Given the diversity of SLE manifestations, numerous clinical criteria have been developed to aid in assessment of disease severity, including the American College of Rheumatology (ACR) criteria,

Systemic lupus international collaborating clinics (SLICC) criteria (derived from the original ACR criteria), and the SLE disease activity index (SLEDAI)(7). Diagnosis is based on the presence of a combination of clinical manifestations from the above

criteria in addition to serological features(7). Further, adding to the difficulty of clinical diagnosis are comorbidities associated with SLE(8), including cardiovascular complications among others(3). Treatment options for patients primarily involve immunosuppression(7). Some immunosuppressants used in the clinic are highly toxic, chemotherapeutic agents that leave patients at increased risk for infection and other adverse side effects(7). Therefore, an ideal treatment for SLE would decrease autoreactive immune responses, while simultaneously preserving the ability to respond to pathogenic challenges.

Both genetic and environmental constituents are known to underlie the development of SLE as reflected by twin concordance studies(9). Genetic variants involved in both innate and adaptive immunity have been linked to SLE(10-12).

Persistence of autoreactive B cells and defective clearance of cellular waste and immune complexes are prominent pathways in which genetic deficiencies have been noted(13-15). Collectively, SLE susceptibility genes cluster within fundamental immunological pathways including TLR and T1 IFN, immune complex processing, and immune cell signaling(11; 12). Additionally, numerous environmental components have been highlighted for their potential contributions to SLE(16). Exposure to UV radiation, cigarette smoke, demethylating drugs, DNA viruses, and the gut microbiota have all been associated with disease in genetically susceptible individuals.

The gut microbiota is an important environmental constituent that can heavily influence both local and systemic host immune reactivity through distinct mechanisms.

As a result, the microbiota has been a topic of immense interest in the field of autoimmunity. In fact, intestinal dysbiosis has been documented in human and murine

autoimmunity(17-32). Further, specific classes of microbes that may be associated with disease have also been identified(23; 24; 26; 33), but causal links between specific bacterial species and autoimmune manifestations are still rare. Nonetheless, it is easy to conceive how pathogenic alterations to gut microbial communities or intestinal dysbiosis may compromise the capacity of the microbiota to control inflammation, especially in genetically susceptible hosts.

Overview of The TC Murine Model

The B6.Sle1.Sle2.Sle3 triple congenic (TC) murine model contains three susceptibility loci derived from the NZM2410 lupus-prone mouse, originally identified via linkage analysis(34). The primary disease phenotype of each susceptibility interval was identified using single congenic strains containing either Sle1, Sle2, or Sle3 on a non- autoimmune B6 background(35). Sle1 mediates loss of tolerance to nuclear antigens,

Sle2 lowers the activation threshold of B cells, and Sle3 facilitates dysregulation in the

CD4+ T cell compartment(35). Together, the co-expression of these loci on a nonautoimmune C57BL6 (B6) background is necessary and sufficient to induce disease phenotypes that resemble phenotypes observed in SLE patients, including high titers of serum autoantibodies against dsDNA, splenomegaly, CD4+ T cell hyperactivation, increased interferon activity, and glomerulonephritis(36). Immune activation precedes seroconversion, a transition period in which TC mice begin to test positive for serum autoantibodies. Seroconversion in this model occurs within a window of 4 to 6 months of age after which inflammatory tissue damage ensues, ultimately resulting in fatal glomerulonephritis (Figure 1-2). Female TC mice have earlier disease onset and more severe disease compared to males, which reflects the gender skewing in SLE patients.

A unique advantage of the TC model is the 95% genetic similarity between TC and non-

autoimmune B6 mice, thus allowing B6 to serve as true, non-autoimmune genetic controls.

Endogenous Tryptophan Metabolism

The essential amino acid tryptophan is a precursor for the endogenous synthesis of kynurenine and serotonin by host enzymes (Figure 1-3). Indoleamine-2,3- dioxygenases (IDO1, IDO2), and tryptophan-2,3-dioxygenase (TDO) are the mammalian enzymes responsible for catalyzing the synthesis of kynurenine from tryptophan. TDO expression is mostly restricted to the liver, whereas IDO1 is expressed in numerous tissues, most notably in immune cells and the intestinal epithelium. IDO2 also participates in kynurenine synthesis, though with a lower activity compared to

IDO1(37). Overall, little is known about how IDO2 participates in host physiology.

Kynurenine can be metabolized by several downstream enzymes to give rise to additional metabolites, collectively referred to as “kynurenines” (Figure1-3). It has been estimated that about 90% of dietary tryptophan is metabolized through the kynurenine pathway (KP), largely by liver TDO(38). Additionally, hepatocytes express all enzymes within the KP and represent a significant source for downstream kynurenines. Some kynurenines, such as quinolinic acid and kynurenic acid, exhibit neuromodulatory properties and have thus been implicated in numerous peripheral and CNS diseases(39; 40). De novo synthesis of nicotinamide adenine dinucleotide (NAD), an essential co-factor in energy metabolism, represents the last step of the KP in some cells, such as hepatocytes and macrophages(38; 41). The serotonin pathway begins with the rate limiting synthesis of 5-hydroxytryptophan (5-HTP) by the enzymes tryptophan hydroxylase 1 and 2 (TPH1, TPH2). 5-HTP is then converted to 5-HT via aromatic amino acid decarboxylase (AAAD). The majority of serotonin synthesis occurs

within the intestine and the CNS. Melatonin represents the end product of the 5-HT pathway, the synthesis of which occurs in 2 steps within the pineal gland and periphery.

Microbial Tryptophan Metabolism

Bacteria also catabolize tryptophan to produce a plethora of bioactive metabolites(42-44). Some bacteria synthesize indole from tryptophan via the tryptophanase enzyme (TnaA), while others synthesize additional indoles such as indole lactic acid (ILA), indole propionic acid (IPA), and indole aldehyde (IAld) through separate pathways(43; 44). Furthermore, some bacteria use the tryptophan decarboxylase enzyme to generate tryptamine(45), which structurally resembles serotonin and binds to intestinal serotonin receptors to regulate intestinal transit(46).

Indoles and tryptamine are known AhR ligands(47; 48) and thus they function as immune modulatory compounds. Moreover, indoles reinforce host intestinal barrier integrity(49), through pathways such as IL-22 production(50), or the pregnane X receptor(51), both of which are imperative for maintaining homeostasis. Some bacteria have also been shown to synthesize kynurenine from tryptophan via the expression of

IDO homologs(52-55). Alternatively, phosphoenolpyruvate and erythrose-4-phosphate are precursors for the shikimate pathway, by which microbes can synthesize aromatic amino acids, including tryptophan(56). Therefore, the microbiota has an immense potential to produce tryptophan metabolites, including potentially kynurenine, all of which have the capacity to modulate the host immune system(42; 43). Given the contribution of dysbiosis to autoimmunity, it is crucial to consider the microbiota as a source of skewed tryptophan metabolite distribution and to evaluate the mechanisms by which they may contribute to autoimmune pathogenesis.

Tryptophan Metabolites in Immunity

Proinflammatory cytokines, such as type 1 and type 2 interferons, upregulate

IDO1 expression in dendritic cells (DCs)(57; 58). The resulting accumulation of kynurenine increases Treg cell differentiation(59; 60) via the aryl hydrocarbon receptor

(AhR) pathway(59). AhR is a transcription factor activated by environmental pollutants in addition to a plethora of tryptophan metabolites, either derived from the microbiota or the endogenous KP(61). AhR activation by some of these ligands has been linked to the differentiation and function of both innate and adaptive immune cells(61), highlighting the importance of the tryptophan - AhR axis in immune homeostasis. The outcome of

AhR activation depends on the specific ligand encountered (cite), for example in the case of T cells, the tryptophan metabolite formyl-indolocarbazole (FICZ) has been shown to promote Th17 skewing(62), whereas kynurenine and TCDD promote Treg differentiation(59; 62). Tryptophan depletion activates the stress kinase general control non-derepressible 2 (GCN2) due to the accumulation of uncharged tRNAs, which then induce cell cycle arrest and a state of anergy in effector T cells(63), leading to impaired proliferation and pro-inflammatory responses. Therefore, the KP elicits immunosuppression by simultaneously inducing Treg cells and attenuating effector T cell responses. On the other hand, persistent documentation of accumulated KP metabolites in autoimmune disorders(40; 64-74) may highlight a pro-inflammatory role for this pathway. In addition, metabolites downstream of kynurenine play a role in neurotoxicity, some of which are biomarkers for neuroinflammation(39). Therefore, the

KP may have different consequences depending on the disease context, which highlights the need for a better understanding of this pathway in multiple immune- related diseases.

Intestinal Dysbiosis in Human and Murine SLE

Several features emerge from studies that have compared the distribution of fecal bacterial 16S rDNA between SLE patients and healthy controls (HCs). A lower

Firmicutes/Bacteroidetes (F/B) ratio has been found in two independent cohorts of SLE patients(17; 18), but this has not been confirmed in other cohorts(19; 75). A reduction in microbial diversity, commonly associated with dysbiosis and disease state, has been reported in the latter two studies with an inverse correlation between diversity and disease activity(75). SLE subjects also presented an expansion of specific phyla, such as Prevotella(17; 18), which has also been reported in Rheumatoid Arthritis (RA) patients(23-25), Proteobacteria(17; 19) and Actinobacteria(17). In a more detailed study, Ruminococcus gnavus and Veillonella spp. were highly enriched in SLE feces and the abundance of R. gnavus positively correlated with disease activity(75).

Importantly, SLE patients with renal involvement had a greater abundance of R. gnavus(75). Taken together, these data demonstrate a state of intestinal dysbiosis in

SLE patients that may be associated with disease activity.

Lupus-prone NZB/W F1 mice present with intestinal dysbiosis at disease onset and exhibit an increased relative abundance of Lactobacillus in established disease compared to the pre-disease state(19). Administration of dexamethasone, a common treatment in SLE patients, which also attenuates disease in NZB/W F1 mice(76), decreased the relative abundance of Lactobacillus and increased microbial diversity(19), suggesting that some Lactobacillus spp. are associated with disease in this model. However, colonization of NZB/W F1 mice with L. paracasei reduced disease-associated cardiac complications(77), although the effects on autoimmune manifestations were not examined. Moreover, treatment of NZB/W F1 mice with the

probiotic strain L. fermentum changed their microbiota and reduced the F/B ratio(78), improved gut barrier and endothelial integrity, as well as decreased serum anti-dsDNA

IgG(78). Collectively, these studies may suggest that an outgrowth of Lactobacillus is associated with disease in the NZB/W F1 model. However, specific Lactobacillus probiotic strains improve disease manifestations. It is therefore possible that specific strains of Lactobacillus are therapeutic, while others exacerbate autoimmune complications in NZB/W F1 mice via unknown mechanisms. In addition to NZB/W F1 mice, intestinal dysbiosis has been identified in the related (NZW x BXSB) F1 model(31), and in lupus-prone B6.TLR7 mice (79)

MRL/lpr lupus-prone mice also present an intestinal dysbiosis, but it is characterized by a higher microbial diversity, decreased Lactobacillaceae, and increased Lachnospiraceae, Rikenellaceae, and Ruminococcaceae(29) compared to non-autoimmune controls. However, specific pathogen free (SPF) and germ free (GF)

MRL/lpr mice presented similar disease manifestations(80), indicating that the microbiota is not required for disease initiation and development. Disease was attenuated in this strain by a broad-spectrum antibiotic cocktail or by vancomycin alone, which decreased the abundance of Bacteroidales and Clostridiales as well as increased the abundance of Lactobacillus(81). This suggests that dysbiosis amplifies established disease and that Lactobacillus spp. are protective in this model. Additionally, MRL/lpr mice have a compromised intestinal barrier leading to gut leakage, and colonization with

Lactobacillus spp. improved intestinal barrier integrity, and improved disease outcomes(19). In summary, these data suggest that a low abundance of Lactobacillus may be associated with autoimmune manifestations in MRL/lpr mice.

Potential Mechanisms for Microbiota Contributions to Autoimmunity

There are three main mechanisms by which the microbiota could play a role in autoimmunity: molecular mimicry(75; 82; 83), an impaired intestinal barrier that may promote bacterial translocation(31; 84), and an altered abundance of microbial metabolites with immunoregulatory functions(32). Each of these mechanisms has the potential to promote inflammation and consequent tissue damage, especially when combined with genetic susceptibility to autoimmune diseases. Molecular mimicry has long been considered to be a major mechanism leading to autoimmunity(85). In this process, microbial antigens possess high homology to host antigens, leading to cross- reactive immune responses and chronic inflammation. There is evidence for pathogen- induced molecular mimicry in autoimmunity(85). For example, Streptococcus pyogenes is a trigger of rheumatic fever(86). Similarly, several studies have shown evidence for gut commensals eliciting cross-reactive immune responses with self-antigens(75; 82;

83).

The intestinal barrier simultaneously prevents immune responses against commensals and excludes pathogens(87). Any compromise to this barrier has the potential to elicit inflammatory responses against overabundant leaked microbial antigens. Additionally, bacteria could translocate across a compromised barrier and disseminate to distal organs to promote inflammatory responses(31; 84). Therefore, bacterial translocation may trigger or amplify inflammation.

In the past decade, it has become increasingly evident that microbial metabolites play an indispensable role in immune modulation and intestinal homeostasis(88-93).

The short chain fatty acids (SCFAs), acetate, butyrate, and propionate, are derived from commensal fermentation of dietary fiber. Collectively, SCFAs promote intestinal

homeostasis via their tolerogenic properties and their ability to reinforce intestinal barrier integrity(94). Furthermore, bile acids are metabolized by the microbiota into secondary bile acids that also have immune modulatory activity(95). An altered distribution of tryptophan metabolites has been identified in numerous autoimmune diseases(64; 65;

67-74; 96; 97). Independently of endogenous host tryptophan metabolism, enzymes in the intestinal microbiota catabolize tryptophan to produce various metabolites(Figure 1-

3) that play an important role in immune modulation and microbiota-host communication(38; 42-44). The contribution of these metabolites to autoimmune diseases has, however, not been fully appreciated.

Evidence for Microbiota Contributions to SLE

Exact mechanisms by which immune reactivity occurs against specific autoantigens in lupus remain elusive, but evidence suggests that molecular mimicry with commensals could be one of them. Autoantibodies against the RNA binding protein

Ro60 are produced by a majority of lupus patients(98). Bacteria such as Bacteroides thetaiotaomicron that express orthologs of Ro60 have been identified in the intestinal microbiota of SLE patients and HCs with a similar abundance(82). However, a microbial origin of Ro60 autoreactivity was suggested when T cells isolated from anti-Ro60 positive SLE patients proliferated in response to microbial Ro60, and the sera from these patients bound microbial Ro60 orthologs(82). This hypothesis was verified when

GF mice monocolonized with B. thetaiotaomicron produced anti-Ro60 antibodies(82).

Further evidence for molecular mimicry was demonstrated by the observation that SLE patients possess serum reactivity with a R. gnavus lipoglycan, in which there was a positive correlation between the serum levels of anti-lipoglycan antibodies and anti- dsDNA autoantibodies(75). Furthermore, patient anti-dsDNA IgG cross-reacted with R.

gnavus antigens(75). These findings were confirmed in a separate cohort of SLE patients(75), suggesting that the association of R. gnavus expansion with disease activity and the cross-reactivity of R. gnavus antigens with mammalian DNA may be general to SLE. Overall, these studies emphasize the presence of microbial antigens to which SLE patients display immune reactivity, suggesting that certain bacteria and their products may play a role in pathogenesis through molecular mimicry.

SLE patients present signs of leaky gut, such as increased fecal IgM and

IgG(75), in addition to fecal calprotectin(75; 84), fecal albumin(84), and serum soluble

CD14(75). Enterococcus gallinarum DNA was detected in liver biopsies from SLE and autoimmune hepatitis patients(84). E. gallinarum increased the expression of autoimmune promoting factors such as beta-2 glycoprotein 1 (GPI) and type I interferon when cultured with primary human hepatocytes(84). Further, antibodies against E. gallinarum-specific RNA were detected in both groups of autoimmune subjects(84). This same study showed that a compromised intestinal barrier in (NZW x BXSB)F1 lupus- prone mice allows E. gallinarum to translocate to the mesenteric lymph node (mLN) and liver, where it activates the AhR pathway and promotes autoantibody production(84).

This highlights the promiscuity of AhR as illustrated by the ability of this receptor to promote or suppress inflammation depending on the ligand encountered(62; 99).

Bacterial translocation was also demonstrated in the TLR7 transgenic model of lupus(31), in which Lactobacilllus reuteri translocates across the intestinal barrier to stimulate type I interferon production, and therefore exacerbate disease activity(31).

The abundance of L reuteri and its translocation were reduced by a high fiber diet that alleviated autoimmune manifestations(31). Together, these data indicate that an

impaired intestinal barrier may allow bacteria to gain entry to circulation and distal organs in SLE patients and mouse models of the disease.

Dysregulated Tryptophan Metabolism in SLE

Although kynurenine is primarily considered an immunosuppressive metabolite, its exact role in autoimmunity is poorly understood. RA(64-67; 100) and SLE patients(69-74; 101) show a skewed distribution of tryptophan metabolites, characterized by an elevated kynurenine/tryptophan ratio in the serum, urine, and

PBMCs. Disease activity and clinical manifestations have been positively correlated with depleted tryptophan and increased kynurenine(69; 70; 72; 74; 101) in SLE and RA(66).

In addition, kynurenine was one of the most increased metabolites in the PBMCs of SLE patients, and it was the best metabolite to discriminate between responders and non- responders to N-acetylcysteine treatment(74). The prevailing interpretation is that elevated levels of T1 IFN or other pro-inflammatory cytokines upregulate IDO1 expression(101). An alternative non-exclusive hypothesis is that the SLE microbiota may also have an enhanced capacity to metabolize tryptophan into kynurenine or other metabolites.

Interestingly, kynurenine activated mTOR in human PBMCs and the Jurkat T cell line(74). SLE CD4+ T cells possess a hyperactivated phenotype as well as signaling defects(102; 103). Cellular metabolism regulates T cell activation, proliferation, and differentiation(104-106), and SLE patient CD4+ T cells are characterized by increased mTORC1 activation and mitochondrial production of reactive oxygen species(107; 108).

Rapamycin treatment normalizes T cell activation and decreases disease activity in SLE patients(109), demonstrating that enhanced mTOR activation contributes to disease. As a regulator of cellular metabolism, mTOR integrates cues from the environment such as

nutrient and oxygen availability. Its activation allows for metabolic changes following T cell receptor stimulation to support proliferation and differentiation into effector T cell subsets(104-106; 110). Contrary to the established role of kynurenine in immunosuppression, its accumulation in autoimmune patients as well as its activation of the mTOR pathway suggests that kynurenine may be pro-inflammatory in lupus.

While multiple studies have implicated tryptophan metabolism in autoimmune diseases, few have addressed the potential contribution of tryptophan metabolites of microbial origin. A synergy between type 1 IFNs and microbial tryptophan metabolites modulate astrocyte function to suppress inflammation in experimental autoimmune encephalomyelitis (EAE)(111). This corresponded to reduced levels of indoles in the serum of MS patients(111). These microbial metabolites act as ligands for AhR through which they modulate the microglia-astrocyte crosstalk to reduce inflammation in

MS(112). The contribution of microbial-mediated tryptophan catabolism in EAE was demonstrated in an independent study in which a tryptophan-restricted diet limited the expansion and function of autoreactive T cells(113), implicating a pro-inflammatory contribution of microbially-derived tryptophan metabolites. Together, these studies highlight a role for microbiota tryptophan metabolites in autoimmune pathogenesis in both promoting and attenuating autoimmune activation. Therefore, additional studies are necessary to identify these metabolites as well as the mechanisms by which they promote autoimmunity in other diseases.

Mammalian Target of Rapamycin (mTOR) and Relevance in SLE

mTOR is a ubiquitously expressed serine/threonine kinase that integrates intracellular and extracellular cues and is a central regulator of cellular metabolism, growth, proliferation, and survival(114; 115). There are two distinct mTOR complexes,

mTOR complex 1 (mTORC1), which contains the “regulatory associated protein of

TOR” (Raptor), and mTOR complex 2 (mTORC2), which contains the “rapamycin- insensitive companion of mammalian target of rapamycin” (Rictor)(114). mTORC1 senses growth factors, oxygen levels, energy status, and amino acid availability to promote cellular metabolism and proliferation in favorable conditions while preventing autophagy(114). mTORC2 is mostly responsible for promoting cell survival and cytoskeleton organization(114). In the case of T cells, T cell receptor (TCR) ligation activates PI3K, which results in the phosphorylation of AKT. pAKT then phosphorylates mTORC1 (Figure1-4) (116). mTORC1 specifically promotes protein synthesis through phosphosrylation of the downstream proteins 4E (eIF4E)-binding protein 1 (4E-BP1) and the p70 ribosomal S6 kinase (S6K), the latter of which phosphorylates ribosomal protein S6 (Figure1-4) (114). All of these downstream phosphorylation events lead to an increase in protein translation and elongation(114), and importantly, serve as measurements of mTORC1 activation (Figure1-4).

One important change regulated through the PI3K-Akt-mTOR axis in T cells is upregulation of GLUT1 and an increase in glycolytic capacity for the rapid production of

ATP (53-55, 58). Mouse and human SLE CD4+ T cells are characterized by increased mTORC1 activation(108). SLE CD4+ T cells also have increased rates of glycolysis and oxidative phosphorylation (OXPHOS), and these metabolic defects contribute to the

SLE T cell phenotype by regulating IFNγ and IL-2 production (31, 37) and follicular helper T cell expansion (59). Blocking these pathways using metformin and 2- deoxyglucose decreased IFNγ and increased IL-2 production by mouse and human

SLE CD4+ T cells (37), and autoimmunity in TC mice was reversed following treatment.

Therefore, these findings illustrate the importance of mTORC1 activation and cellular metabolism in autoimmune T cells.

Figure 1-1. Pathogenesis of SLE. Recognition of self-antigens as foreign by T cells and B cells leads to germinal center formation and autoantibody production. Autoantibodies and complement proteins form circulating immune complexes that are deposited throughout multiple organs leading to widespread inflammation. Chronic inflammation ultimately leads to multi-organ damage and heterogenous clinical manifestations. Common manifestations associated with SLE include cutaneous complications and photosensitivity, cardiovascular complications, arthritis and musculoskeletal complications, neurological complications, and kidney complications.

Figure 1-2. Overview of disease pathogenesis in the B6.Sle1.Sle2.Sle3 (TC) murine model. Seroconversion in the TC mouse occurs over a period of 4 to 6 months of age, after which anti-dsDNA IgG antibodies continue to increase. As immune complexes are formed and deposited in the kidney, chronic inflammatory conditions result in kidney damage. Fatal loss of kidney function due to immune-mediated damage typically occurs around 12 months of age.

Figure 1-3. Overview of endogenous and microbial tryptophan catabolism pathways emphasizing kynurenine synthesis. Dietary tryptophan in the host is a precursor for the synthesis of kynurenine and serotonin. The kynurenine pathway gives rise to downstream metabolites collectively referred to as “kynurenines”, in addition to NAD+. Bacteria contain enzymes for the synthesis of indoles, tryptamine, and kynurenine. Therefore, kynurenine can be derived from host and bacterial tryptophan catabolism.

Figure 1-4. Overview of signaling events upstream and downstream of mTORC1 in T cells. TCR ligation and sensing of nutrient and energy availability results in phosphorylation of PI3K and subsequent phosphorylation of AKT (Thr residue 308). AKT phosphorylates mTORC1, resulting in activation, which can be measured by phosphorylation events downstream of mTORC1. Important downstream events specifically involved in protein synthesis include phosphorylation of 4EBP1 (Thr residues 37/46) and P70S6K. P70S6K then phosphorylates the ribosomal protein S6 (Ser residues 235/236).

CHAPTER 2 MICROBIOTA-ASSOCIATED TRYPTOPHAN CATABOLISM INDUCES AUTOIMMUNE ACTIVATION IN THE TC MURINE MODEL

Background

Pathogenic alterations to the intestinal microbiota, also known as dysbiosis, may play a significant role in autoimmune diseases via bacterial-mediated immune regulation. Intestinal dysbiosis is evident in SLE patients(17-19; 75; 84; 117) and lupus murine models(29-31; 84) and in some cases, it has been associated with disease phenotypes(31; 75; 84; 117). Fecal microbiota transplants from the (NZW x BSXB)F1 and B6.TLR7 transgenic mouse models of lupus induce autoimmune phenotypes in non-autoimmune germ free (GF) recipients(31; 84). Additionally, impaired intestinal barrier and bacterial translocation have been shown to promote disease in these murine models(31; 84). SLE patients show signs of leaky gut(75; 84) and molecular mimicry, in which similarity between commensal antigens and self-antigens results in cross reactive immune responses(75; 117). Cross-reactivity with commensal orthologues of the human lupus-associated autoantigen Ro60 contribute to autoimmunity and the induction of anti-

RNA autoantibodies(117) and patient anti-dsDNA IgG autoantibodies cross-react with a

Ruminococcus gnavus antigen, the abundance of which is increased in the feces of

SLE patients(75). Altogether, these findings suggest that leaky gut and molecular mimicry may be mechanisms of microbiota contributions to autoimmune activation and emphasize potential involvement of multiple pathways in lupus pathogenesis. Although a disrupted inflammatory microbiota has been confirmed in the TC model(30), the mechanism by which this microbiota influences lupus-like disease remains elusive.

Given the presence and potential importance of intestinal dysbiosis in human and murine lupus, we performed a comprehensive evaluation of the TC microbiota to

characterize disrupted bacterial communities and to determine how dysbiosis influences autoimmune activation. The results of this study have been published in a paper in which I served as first co-author(32)1. A summary of these findings is presented in this chapter, focusing on my specific contribution to the study.

 The premise of this study is that altered gut bacterial communities contribute to autoimmune pathogenesis in lupus-prone TC mice.

 The goal of the study is to understand the mechanisms by which the TC microbiota contributes to immune activation.

Methods

Mice and Treatments

The TC strain has been previously described(118). C57BL/6J (B6) mice were originally purchased from the Jackson Laboratory and maintained at the University of

Florida. Germ free (GF) B6 mice were produced by the University of Florida Animal

Care Services. Only female mice were used in this study, which were housed with mice from the same strain unless indicated otherwise, in the same SPF room. “Aged” or late disease stage mice are defined as 6 to 9-month-old, when TC mice present a full autoimmune activation with high levels of autoantibodies. All age-matched groups within an experiment were tested simultaneously. In the fecal transfer experiments, 2 to 3- month old GF mice were acclimated in SPF static cages for 3 d before the transfers in separate cages according to the strain of origin of the fecal donor. Pooled donor fresh fecal pellets were diluted in PBS (1 pellet / 150 ul) and 200 ul of fecal slurry was

1Reprinted with permission from Seung-Chul Choi, Josephine Brown, Minghao Gong, Yong Ge, Mojgan Zadeh, Wei Li, Byron Croker, George Michailidis, Timothy Garrett, Mansour Mohamadzadeh, and Laurence Morel. Gut microbiota dysbiosis and altered tryptophan catabolism contribute to autoimmunity in lupus-susceptible mice, Science Translational Medicine, 2020 Jul 8;12(551):eaax2220, doi: 10.1126/scitranslmed.aax2220. Copyright 2020 by the American Association for the Advancement of Science

gavaged in each GF recipients. GF controls received PBS only. Phenotypes were evaluated one month after transfer. Mice were provided with autoclaved reversed osmosis drinking water, and unless indicated, fed with irradiated Envigo 7912 standard chow ad lib that contains 0.3% tryptophan. Tryptophan-modified synthetic chows that differ only by their tryptophan content (0, 0.19, 0.3, or 1.19% Tryptophan, A11022501-

04, Research Diets, Inc.) were fed to mice for the indicated periods of time. To replenish

Tryptophan levels, Tryptophan-deficient (0%) chow was switched to Tryptophan 0.19% chow on Friday afternoons and switched back to 0% chow on Monday mornings, corresponding to an approximate distribution of 60% Tryptophan (0): 40% Tryptophan

(0.19), or an overall 0.08% dietary Tryptophan. Some mice were treated with a cocktail of antibiotics (AMNV: ampicillin 0.5g/L, metronidazole 0.5g/L, neomycin 0.5g/L and vancomycin 0.25 g/L) from 6 weeks to 6 months of age. All experiments were conducted on at least 2 independent cohorts per group to avoid cage effects. All experiments were conducted according to protocols approved by the University of

Florida IACUC.

Assessment of Gut Leakage

Fecal blood was detected with Hemoccult slides (Beckman Coulter). To assess gut leakage, aged mice in the late stage of disease were fasted overnight and gavaged with 44 mg/100 g body weight of fluorescein isothiocyanate conjugated dextran (FITC- dextran). Serum was collected 4 h later, and the amount of FITC-dextran was quantified with a spectrophotometer against a standard curve. The presence of bacterial endotoxin was analyzed in serum collected from 5-month-old B6 and TC mice using Pierce LAL

Chromogenic Endotoxin Quantification Kit (ThermoFisher). Bacterial translocation outside the gut was analyzed in the liver and MLN collected from 9 to 12-month-old TC

and B6 mice in a sterile manner. Two hundred microliters of tissue homogenate (0.1 g tissue / ml PBS) was spread onto tryptic soy agar with 5% sheep blood plates (Carolina

Biological) and incubated at 37°C for 24 h under aerobic or anaerobic conditions. The numbers of colony forming units (CFUs) were normalized to tissue weight. Tissues from a GF B6 mouse were collected as a negative control and colon contents from conventional mice were used as positive controls. Single colonies were inoculated into nutrient broth and incubated at 370C for 24 h. Sanger sequencing of the full-length 16S rDNA gene was performed with universal primers (F: AGAGTTTGATCCTGGCTCAG,

R: GGTTACCTTGTTACGACTT) to identify bacterial species using NCBI Basic Local

Alignment Search Tool (BLAST). Tight junction gene expression was analyzed by qRT-

PCR on duodenum and colon RNAs obtained from 5-month-old B6 and TC mice using

SYBR green (Bio-Rad) incorporation. The primer sequences for Jam, Zo-1, Cldn2 and

Ocln are listed in Table S2. Results were first normalized to Gapdh expression then B6 mean values for each gene.

Gut Microbiota Analysis

Fecal samples from B6 and TC mice (N=10 per strain), and from TC mice fed tryptophan high and tryptophan low diets (N=10 per diet) were collected and stored at -

80°C. Part of the collected fecal samples were processed for microbiota analysis.

Briefly, fecal DNA was isolated using ZymoBIOMICS DNA Mini Kit (Zymo Research,

Irvine, CA). Fecal DNA samples were amplified by pairs of Miseq compatible primers, targeting the 16S rDNA V4-V5 regions as reported previously(119; 120). Amplicons were purified, normalized, pooled and sequenced on an Illumina Miseq with 2 x 250 bp pair-end reads. Sequence analyses were performed using QIIME (v1.9.1), as described previously(119; 120). Filtered operational taxonomic units (OTUs) were rarefied to a

depth of 21,234 sequences per sample, 16,451 sequences per sample, and 23,624 sequences per sample in the experiments comparing aged B6 to TC mice, Tryptophan- supplemented compared to tryptophan-deficient mice, and 1-2 month old B6 to TC mice, respectively. Principle coordinate analysis (PCoA) was performed in QIIME and the data was plotted using Python (V2.7.14). Alpha diversity analyses, including Chao's richness were also performed in QIIME. To identify significantly enriched microbial species, linear discriminant analysis effect size (LEfSe) analyses were performed. To avoid batch effects, we set the batches as the subclass and the genotype or diet as the main class in the LEfSe analyses with the all-against-all strategy, which is stricter.

Significant taxa were selected with default criteria (P < 0.05 by Kruskal-Wallis test; linear discriminant analysis (LDA) score > 2) and plotted in a cladogram based on their phylogenetic relationship.

Metabolomic Analysis

Feces were homogenized in 5 mM ammonium acetate at 20 mg/ml. After homogenization, the sample was centrifuged at 20,000 rcf and 100 ul of supernatant was transferred to a new tube. A 20-ul aliquot of isotopic standards was added for both calibration and profiling experiments. The internal standard solution consisted of tryptophan-13C11 (5 ug/ml), creatine-D3 (4 ug/ml), leucine-D10 (4 ug/ml), citric acid-

13C6 (8 ug/ml), tyrosine-13C6 (4 ug/ml), phenyalanine-13C6 (4 ug/ml), serotonin-D4

(5 ug/ml), kynurenine-D5 (5 ug/ml), kynurenic acid-D5 (0.5 ug/ml), anthranilic acid-

acid in water for metabolomic analysis. Global metabolomic analysis was performed on a Thermo Fisher Q Exactive HRMS with a Dionex UHPLC and autosampler running in both positive and negative ionization as separate injections. Mass resolution is 35,000 at m/z 200 with a mass accuracy of less than 5 ppm in positive mode and less than 10 ppm in negative mode. Separation was achieved on an Ace C18-PFP column (100 ×

2.1 mm, 2 um) with 0.1% formic acid in water as mobile phase A and acetonitrile as mobile phase B with a column temperature of 25°C. Flow rate was 350 ul/min with a total run time of 20 min (68, 69). Chromatography and additional method details can be found at www.metabolomicsworkbench.org. Metabolite identification of 234 named metabolites retained for subsequent analysis was performed through reference to metabolite library of 1000 compounds, curated by running each standard at the

Southeast Center for Integrated Metabolomics (www.secim.ufl.edu). Feature alignment and curation were performed by MZmine (70) through an automated routine developed in-house. From the same type of global metabolite profiling from serum and fecal samples, we quantified six tryptophan metabolites (tryptophan, serotonin, kynurenine, kynurenic acid, xanthurenic acid, and anthranilic acid) which were referenced to an external calibration curve covering the expected concentration range. The metabolomics data (including 234 named metabolites retained for subsequent analysis) were first log2-transformed and then centered. They were further examined to ensure that the normality assumption was satisfied. The two groups (B6/TC strains) were first analyzed using principal components analysis, to obtain a global viewpoint of the data and the groups. Subsequently, for each of the 234 named metabolites, an analysis of variance model was fitted with the strain factor. Adjusted P values for multiple

comparisons, based on the Benjamini-Hochberg procedure, are given in table S1.

Subsequently, the named metabolites were mapped to 114 KEGG pathways that were then tested for enrichment across the B6 and TC strains. P values were adjusted for multiple comparisons based on the Benjamini-Hochberg procedure.

Serum kynurenine and tryptophan were also quantified by a high-performance liquid chromatography (HPLC) system (Agilent 1220 Infinity II, Agilent Technologies) equipped with an automated sampler, a gradient pump and a VWD detector. Briefly, 50 ul of serum was mixed with 6.5 ul of 40% periodic acid, followed by vortex-mixing for 1 min and centrifugation at 17,000 g for 10 min. Subsequently, the supernatants were passed through a 0.22 um filter (Millex), and 20 ul of the samples was injected into the

HPLC system. Separations were carried out using a mobile phase consisting of 15 mM aqueous zinc acetate (pH 4.0) and acetonitrile (96:4, v/v) in a ZORBAX Eclipse AAA column (3.5 μm, 3 × 150 mm), with a flow rate of 1.0 ml/min. The eluates were monitored by the programmed wavelength detection setting at 365 nm (kynurenine) and

404 nm (tryptophan, excitation at 254 nm). The data were acquired and processed using Agilent ChemStation software. Concentrations of serum kynurenine and tryptophan were calculated based on the standard curves using serial dilutions of kynurenine and tryptophan standards (Sigma).

Renal Pathology

Kidneys were processed as previously described(121) and PAS-stained sections were ranked or scored on a 0-4 scale in a blinded fashion by a pathologist (BPC).

Anti-dsDNA IgG Autoantibody ELISA

Serum quantification of anti-dsDNA IgG has previously been described(122).

Briefly, sera diluted 1:100 were incubated on dsDNA (Sigma) coated plates. Bound

antibodies were detected with alkaline phosphatase-conjugated goat anti-mouse IgG and p-nitrophenyl phosphate (PNPP) substrate (ThermoFisher). Serial dilutions of

NZM2410 sera were included on each plate to construct a standard curve.

Statistical Analysis

Statistical analyses were performed using the GraphPad Prism 6.0 software.

Unless indicated, data were normally distributed, and graphs show means and standard deviations of the mean (SEM) for each group. Unless indicated, results were compared with 2-tailed tests with a minimal level of significance set at P < 0.05. Bonferroni corrections were applied for multiple comparisons.

Results

Autoimmune TC mice Present Altered Gut Microbial Communities

To elucidate the status of gut commensals in autoantibody positive TC mice compared to age-matched control B6 mice, 16S rDNA sequencing was performed using mouse fecal samples. We found that TC gut microbial communities were significantly modified compared to B6 controls(30; 32)(Figure 2-1 A-C). While there were no obvious changes in alpha diversity indexes, such as the Chao1 richness and Shannon diversity

(Figure 2-1 D), several taxa were enriched in autoantibody positive TC mice, including

Paraprevotellaceae, Paraprevotella, Lactobacillales, Lactobacillaceae, and

Lactobacillus(32) (Figure 2-1 A). Such differences were not observed in young TC mice before they produce autoantibodies(32), suggesting that gut dysbiosis develops as a result of lupus-like disease. We found that fecal microbiota transfers (FMT) from autoantibody positive TC mice induced the production of autoantibodies in non- autoimmune GF B6 recipients, and increased the frequency of germinal center B cells

(GC B cells), plasma cells, and follicular helper T cells (Tfh)(30; 32), all of which are

phenotypes strongly associated with lupus. Interestingly, FMTs from either young TC mice or from TC.Rag1-/- mice did not induce autoimmune phenotypes in GF B6 recipients(32), further indicating that the pro-inflammatory functions of the TC microbiota occur after the development of autoimmunity and that they require the presence of lymphocytes. Furthermore, autoimmune phenotypes can be transferred horizontally between TC and B6 mice by co-housing(32). All together, these data demonstrate that microbial dysbiosis in the TC model amplifies autoimmune activation rather than driving disease initiation.

Intestinal Dysbiosis Contributes to Autoimmune Activation via a Mechanism other than Bacterial Translocation

Assessment of colon histology and analysis of fecal blood (Figure 2-2 A) indicated the presence of intestinal inflammation in aged TC mice. It is possible that the

TC microbiota induces inflammatory phenotypes through impaired intestinal barrier and bacterial translocation, as this has been shown in other murine models of lupus(31; 84).

To maintain an intact intestinal epithelium, tight junction proteins adhere adjacent epithelial cells to prevent paracellular entry of microbes into the underlying lamina propria. Oral gavage of FITC-dextran and subsequent detection of fluorescence from this molecule in the serum is one method of testing for a compromised intestinal barrier.

Compared to B6 controls, less fluorescence was detected in TC sera, suggesting that the TC intestinal barrier is not compromised (Figure 2-2 B). Further, TC sera did not contain significantly higher levels of endotoxin compared to B6 controls (Figure 2-2 C), yet another indicator of compromised intestinal barrier integrity. Expression of tight junction genes (Table 2-1) was assessed by quantitative reverse transcription PCR

(qRT-PCR) in TC and non-autoimmune B6 controls. No differences in the expression of

tight junction genes were observed between strains (Figure 2-2 D), suggesting that paracellular entry of bacteria is unlikely in TC mice. Finally, because it is also possible for bacteria to breach the intestinal barrier through mechanisms other than passive paracellular entry, we assessed bacterial growth from liver and mesenteric lymph node

(mLN) tissue homogenates under both aerobic and anaerobic conditions. No colony growth was observed in any of the samples under anaerobic conditions(32), however, in a fraction of aged TC mice, bacterial colonies were detected on liver and mLN blood agar plates under aerobic conditions (Figure 2-3 A). These colonies were not observed in any B6 samples. To identify bacteria from TC organs, the 16S gene was amplified and sequenced. All of the colonies from TC organs had >95% similarity to

Staphylococcus xylosus (Figure 2-3 A-C), suggesting that this species translocates across the intestinal epithelium via a mechanism other than passive paracellular entry.

Additionally, S. xylosus operational taxanomic units (OTUs) were higher in B6 feces compared to TC mice (Figure 2-3 D), potentially suggesting more translocation of this particular bacterium in TC mice. Importantly, the presence of S. xylosus in extraintestinal organs did not correlate with prototypical lupus phenotypes such as Tfh cell expansion (Figure 2-3 E), suggesting that this bacterium does not contribute to autoimmune pathogenesis. Taken together, these data strongly suggest that TC mice do not have leaky gut, despite the presence of S. xylosus in the liver and mLN, which did not correlate with lupus-associated immune cell phenotypes. Therefore, the mechanism by which the TC microbiota induces inflammation may be via the production of specific microbial metabolites.

Tryptophan Metabolites are Dysregulated in TC Mice

An untargeted analysis of fecal metabolites identified tryptophan metabolism as one of the most differentially regulated pathways between TC and B6 mice(32).

Interestingly, tryptophan metabolism was also one of the pathways differentially represented in the feces of SLE patients(123). Dysregulated serum tryptophan metabolites have been well documented in SLE patients(69-74; 101; 124) and in some cases have been associated with disease activity(69; 74; 101). Therefore, to determine if TC mice also present skewed metabolites within the tryptophan pathway, B6 and TC sera and feces were analyzed by high performance liquid chromatography (HPLC).

Indeed, TC mice show the same pattern of tryptophan metabolite alterations observed in SLE patients, consisting of depleted serum tryptophan and serotonin in addition to increased kynurenine (Figure 2-4 A-C). Interestingly, kynurenine was increased in TC feces compared to B6 mice (Figure 2-4 B), potentially highlighting an enhanced capacity of TC intestinal microbes to produce kynurenine. Thus, dysregulated tryptophan catabolism is a significant feature of both human and TC autoimmunity, which can be characterized by skewing towards the kynurenine pathway.

Autoimmune Phenotype Severity is Dependent on the Amount of Dietary Tryptophan

To further understand the role of dysregulated tryptophan metabolism in the TC model, mice were fed synthetic chows that differed only in the percentage of dietary tryptophan for 4 months beginning at 2 months of age preceding disease onset. Sera from TC and B6 mice consuming each tryptophan diet were analyzed via Mass

Spectrometry. Regardless of the percentage of dietary tryptophan, TC mice had less tryptophan and serotonin and more kynurenine in the serum compared to B6 controls

(Figure 2-4 D-F), further confirming an intrinsically skewed tryptophan metabolism toward the kynurenine pathway. Additionally, TC mice receiving low dietary tryptophan

(0.08%) displayed attenuated anti-dsDNA IgG production over the duration of consumption compared to those receiving high dietary tryptophan (1%), in which anti- dsDNA IgG production was exacerbated (Figure 2-5 A-B). Further, glomerulonephritis

(GN) severity increased with the amount of dietary tryptophan (Figure 2-5 C). Immune cell phenotypes were also altered by dietary tryptophan percentage. High dietary tryptophan increased the frequency and proliferation of activated CD69+ CD4+ T cells in both strains, as well as the frequency of CD44+CD62L- CD4+ effector memory T cells

(Tem) in TC mice(32). In addition, high dietary tryptophan increased the proliferation of

TC naïve CD4+ T cells, which are more metabolically active compared to their B6 counterparts(125; 126). High dietary tryptophan enhanced the frequency of Tfh cells in both TC and B6 mice, which corresponded to an increased TC Tfh cell proliferation(32).

Conversely, low dietary tryptophan increased the Tfr/Tfh ratio in TC mice in addition to increasing CD25 expression on TC and B6 Treg cells(32) (data not shown), suggesting that tryptophan metabolism may contribute to functional impairment of Treg cells.

Overall, these data illustrate that low dietary tryptophan is protective, while high levels of tryptophan exacerbate autoimmune phenotypes in TC mice.

Increased Dietary Tryptophan Percentage Further Disrupts Gut Microbial Communities in TC Mice

A metabolic pathway analysis of 16S rDNA sequences suggested increased microbial tryptophan degradation via a kynurenine pathway in TC feces(32).

Interestingly, the TC fecal microbiota is enriched in Lactobacillus and Paraprevotella

(Figure 2-1), which have the ability to catabolize tryptophan. Therefore, the effects of

dietary tryptophan on autoimmune activation may be at least partially mediated by the

TC gut microbiota. To understand the effects of dietary tryptophan consumption on gut microbial communities, fecal content was collected from TC and B6 mice consuming low (0.08%) or high (1.19%) dietary tryptophan and 16S rDNA sequencing was performed. TC mice consuming high dietary tryptophan (1.19%) had an exaggerated expansion of Lactobacillus and Paraprevotella (Figure 2-6 B), along with higher concentrations of kynurenine relative to B6 (Figure 2-4 E), suggesting that this expansion may play a role in skewed tryptophan metabolites. These exaggerated bacterial expansions were not present in B6 mice consuming high dietary tryptophan

(Figure 2-6 A), suggesting a unique sensitivity of the TC microbiota to dietary tryptophan consumption. It is therefore likely that microbial tryptophan metabolites contribute to the inflammatory capacity of the TC microbiota, as there is no evidence for bacterial translocation as a direct result of leaky gut in this model (Figure 2-2). In addition, the maintenance of intestinal barrier in TC mice may be due to the expansion of

Lactobacillus supporting barrier integrity through production of tryptophan metabolites(47). Together, these studies suggest a role for microbiota-derived tryptophan metabolites in autoimmune pathogenesis.

Long-Term Antibiotic Treatment Restores Tryptophan Metabolites in TC Mice

To further address the role of the gut microbiota in dysregulated tryptophan catabolism in TC mice, TC and B6 controls were treated with a broad-spectrum antibiotic cocktail for 5 months followed by serum and fecal metabolite analysis.

Antibiotic treatment increased fecal tryptophan concentrations in both B6 and TC mice

(Figure 2-7 A). Further, antibiotic treatment reduced serum kynurenine levels in TC mice to levels comparable to B6 controls whereas antibiotic treatment had no effect on serum

kynurenine levels in B6 mice (Figure 2-7 B), suggesting a microbial involvement in the skewing of tryptophan metabolites in the TC model. Finally, antibiotic treatment decreased the serum kynurenine/serotonin ratio in TC mice, but not in B6 controls

(Figure 2-7 C). Collectively, these data strongly suggest a microbiota contribution to dysregulated tryptophan metabolites in TC mice.

The TC Microbiota Mediates the Effects of Variations in Dietary Tryptophan on Autoimmune Activation

To assess if the TC microbiota is responsible for mediating the effects of dietary tryptophan on disease pathogenesis, we performed FMTs from TC mice consuming either low (0.08%) or high (1.19%) dietary tryptophan into non-autoimmune GF recipients. Three weeks after transfer, the microbiota from TC mice fed with high tryptophan expanded the number of mLN cells as well as the production of anti-dsDNA

IgM in GF recipients(32). This microbiota also expanded the number of Tfh and Th17 cells, as well as GC B cells and PCs(32). On the other hand, microbiota from TC mice fed with low tryptophan increased CD25 expression on recipient mLN Treg cells(32), suggesting that the immunoregulation conferred by dietary tryptophan can be transferred in part by TC fecal microbiome.

Discussion

The potential immunomodulatory effects of an altered gut microbiota have been documented, however, the causative effects of either gut bacterial dysbiosis or the presence of specific bacteria on autoimmunity remain largely elusive. The absence of commensal bacteria in the gut does not prevent the development of autoimmune pathology in mouse models of spontaneous lupus(127). However, antibiotic treatment prevents or delays disease manifestations in lupus-prone mice with different genetic

backgrounds(31; 81; 84; 128). Furthermore, alterations in the composition of the gut microbiota have been reported in independent cohorts of patients with SLE(17-19; 75) and in multiple mouse models of lupus(29-31; 84; 129-131). We confirmed this finding in

TC relative to B6 mice, and because these two mouse strains are congenic for most of their genome, the differential distribution of bacterial communities in this model is therefore tightly associated with SLE susceptibility genes. We observed no evidence for reduced gut bacterial diversity in TC mice, but did observe a differential distribution of bacterial taxa, with a marked abundance of Prevotella, Paraprevotella or Lactobacillus genera. Importantly, these bacterial taxa are expanded in the gut microbiota of individuals with rheumatoid arthritis(132), in the oral microbiota of individuals with

SLE(133), and in lupus-prone B6.TLR7 transgenic mice(31). Further, our data show that alterations in the TC mouse gut microbiota may have functional consequences. Transfer of the fecal microbiota from TC mice into GF B6 recipients induced anti-dsDNA IgG antibodies, and other lupus-relevant disease phenotypes. These phenotypes were only induced by the microbiota from aged, autoantibody positive TC mice, suggesting that intestinal dysbiosis is established after disease onset. Overall, these results suggest a model in which lupus susceptibility genes trigger autoimmune activation in TC mice that potentially promotes gut dysbiosis, which then amplifies autoimmune activation.

Several mechanisms may account for the ability of bacteria to induce immune phenotypes associated with lupus. Commensal bacteria expressing orthologues of human Ro60 autoantigens are commonly found in patients with SLE, and Ro60-specific

T cells can be activated and trigger anti-Ro60 antibodies in GF mice(117), supporting molecular mimicry as a potential mechanism of autoimmunity. Further, impaired gut

barrier integrity is also documented in several murine models of lupus (79; 84; 129) and in some patients with SLE(75; 84; 129), and the translocation of Enterococcus gallinarium(84) or Lactobacillus reuteri(31) from the gut to the periphery results in systemic immune activation. In the present investigation, evaluation of the intestine of

TC mice found colonic inflammation, but no clear evidence of deteriorated gut barrier integrity in TC mice, although some aged TC mice did exhibit a Staphylococcus species in peripheral organs. However, there was no correlation between the presence of these translocated bacteria and any autoimmune manifestations in these TC mice.

Additionally, no bacterial translocation was observed in TC mice before they produced autoantibodies. Overall, these results do not demonstrate any tangible bacterial translocation in the periphery that may have critically contributed to autoimmune activation leading to the emergence of lupus in the TC model.

Microbiota-associated metabolites serve as a major source of immunomodulation(134). Individuals with SLE present a distinct gut microbiota-derived metabolite signature(135; 136), but the consequences of these findings have not been investigated. Here, we assessed whether metabolites could account for the autoimmune activation that may be induced by gut microbial dysbiosis in TC mice. Among the metabolites observed in TC feces compared to control feces, the tryptophan pathway was of particular interest because an altered distribution of tryptophan-associated metabolites has been consistently observed by other groups in the serum and immune cells from patients with SLE often in correlation with disease activity(69-74; 101; 124) and in the feces of patients with SLE(136; 137). Moreover, some bacterial and host metabolites synthesized from dietary tryptophan are known to contribute to immune

modulation and microbiota-host communication(43; 44; 138). We showed increased kynurenine and reduced serotonin in the sera and feces of TC mice. Our results support an intestinal microbiota contribution to skewed tryptophan metabolism as antibiotic treatment decreased kynurenine only in TC mice. TC mice also responded with acute weight loss to tryptophan deficiency, suggesting that these mice may process this essential amino acid differently, possibly because they specifically harbor a higher abundance of gut microbes that catabolize tryptophan. In support of this notion, some species of Prevotella, Paraprevotella, or Lactobacillus, were expanded in the TC gut microbiota, and these bacteria have been shown to catabolize tryptophan(44; 47; 139).

Therefore, expansion of these taxa could potentially result in the accumulation of microbial tryptophan metabolites that may negatively impact TC immune cells.

We showed that reduced dietary tryptophan exerted a protective effect on lupus development in TC mice. Further, variations in dietary tryptophan affected the microbiota of B6 and TC mice differently. Notably, tryptophan supplementation was associated with the expansion of Prevotella, Paraprevotella, or Lactobacillus species in

TC mouse feces compared to B6 mice fed standard chow. Furthermore, fecal transfers from TC mice exposed to high dietary tryptophan enhanced inflammatory phenotypes in

GF B6 recipients compared to fecal transfers from TC mice fed low dietary tryptophan.

An alteration of the gut microbiota by tryptophan supplementation has been reported in piglets, with, as in TC mice, an expansion of Prevotella species(140). Interestingly, tryptophan supplementation in these animals increased the expression of genes involved in gut epithelial integrity, which may be related, at least in part, to the absence of a “leaky gut” phenotype in TC mice. Overall, these results suggest a functional link

between tryptophan metabolism, gut microbial dysbiosis and autoimmune activation in

TC mice.

Mechanistically, we have not identified the bacterial species directly responsible for the differential processing of dietary tryptophan or the tryptophan metabolites that may have induced autoimmune activation in TC mice. We have documented phenotypic changes in the lymphocytes of TC mice in response to variations in tryptophan availability, but we have not yet identified the molecular machinery by which this occurs.

It is unknown which of the altered tryptophan metabolites generated by the TC mouse gut microbiota may mitigate the development of autoimmune pathogenesis. In addition to microbial enzymes, it is also entirely possible that endogenous enzymes, such as

IDO1, are contributing to the overall tryptophan metabolite imbalances, which together play a role in immune activation in this model.

AhR ligands such as kynurenine have been associated with immunosuppression(134), however, kynurenine activates mTORC1 in human T cells in vitro(74). As mTORC1 activation is a critical pathway in lupus pathogenesis, including in

TC mice(125; 126), and its targeting with rapamycin demonstrates beneficial therapeutic effects in patients with SLE(141), mTOR activation may be one of the mechanisms through which elevated kynurenine enhances immune activation in TC mice. Although not as well documented as the production by IDO1, bacterial synthesis of kynurenine has been documented in Pseudomonas aeruginosa(54). Additionally, bacterial- associated tryptophan metabolites other than kynurenine may also trigger autoimmune activation in TC mice. Collectively, our investigation here demonstrates that modifying tryptophan metabolism through the gut microbiota may alter autoimmune pathogenesis.

A recent study has reported that a restriction of dietary tryptophan impaired encephalitogenic T cell responses in a mouse model of multiple sclerosis, most likely through an altered gut microbiota(142). Thus, tryptophan availability may regulate autoreactive pathogenic CD4+ T cells in a variety of autoimmune settings.

Although the increased kynurenine/tryptophan ratio correlates with increased disease severity in SLE patients(69; 70; 101), the mechanism by which skewed tryptophan metabolites contribute to immune activation is unknown. Additionally, the identity of specific tryptophan metabolites that may exert these effects remain elusive.

Figure 2-1. Autoimmune TC mice present altered gut microbial communities. (A) Bacterial 16S rDNA sequences in B6 and TC mouse feces are depicted. On the left, the taxonomic cladogram shows the phylogenetic distribution of differentially enriched taxa between the two mouse strains. Fecal mouse B6- enriched taxa are shown in blue and fecal mouse TC-enriched taxa are shown in red. On the right, a bubble plot of linear discriminant analysis (LDA) scores reveals the most differentially abundant taxa between the two mouse strains. Only taxa meeting the criteria (LDA score > 2 and p < 0.05) are shown. Fecal B6-enriched taxa are represented with positive LDA scores and fecal TC-enriched taxa with negative LDA scores. Data analyzed were from 2 independent experiments. Mice were 6 - 12-months old. (B) Three- dimensional plot of principal coordinate analysis (PCoA). Fainter colors correspond to points that are further back from the plane of the page along the PC1 axis. (C) Relative abundance of phyla. (D) Plots of Chao1 richness, observed OTUs, Shannon Index observed between the two strains.

Figure 2-2. TC mice do not display signs of a compromised intestinal barrier. (A) Shown is the frequency of fecal blood in B6 and TC feces (N # in center). (B) Shown is serum FITC-dextran in B6 and TC mice after gavage of animals with FITC-dextran to detect gut barrier integrity. (C) Serum endotoxin concentrations in TC and B6 mice. (D) Expression of tight junction genes (Cldn2, Zo-1, Ocln, Jam) in the duodenum and colon of TC and B6 mice. Mice were 6 - 12 months old. Statistical analysis for A-C: Each symbol represents a mouse; bars show means and standard error of the mean (SEM). Mann-Whitney tests in (B), (C), and t test in (D). * P < 0.05, ** P < 0.01, *** P < 0.001.

Figure 2-3. TC mice have minimal bacterial translocation that does not contribute to autoimmune activation. (A) The frequency of TC and B6 mouse liver and MLN cultures that were positive for bacteria are presented. The sample size for each column is indicated. (B) CFU counts in liver and MLN cultures from B6 and TC mice, either at 2-5 months (young, Y) or 6-8 (older, O) months of age are shown. The sample size for each column is indicated. (C) CFU numbers in TC liver and MLN cultures that were negative or positive for Staphylococcus xylosus (Sx – or Sx +, respectively) are shown. (D) S. xylosus OTU counts in 16S rDNA sequences in B6 and TC mouse feces. (E) Shown is a Pearson’s correlation between the frequency of splenic Tfh cells and the sum of liver and MLN CFUs (Pearson’s correlation R2 = 0.02, p = 0.58). * P < 0.05, ** P < 0.01, *** P < 0.001.

Figure 2-4. TC mice have intrinsically skewed tryptophan metabolism toward the kynurenine pathway. (A-C) Concentrations of tryptophan, kynurenine and serotonin in feces and serum of 6-month-old B6 and TC mice are shown. (D- F) Serum concentrations of tryptophan, kynurenine, and serotonin in B6 and TC mice consuming diets with different percentages of tryptophan. Data are presented as means and SEM and are compared with t tests. * P < 0.05, ** P < 0.01 (n= 5 -10/group).

Figure 2-5. Dietary tryptophan percentage modifies autoimmune activation. Shown are terminal (A) and time-course (B) serum anti-dsDNA IgG concentrations in TC mice fed chow with the indicated amount of tryptophan (%). (C) Renal pathology (glomerulonephritis rank) in TC mice fed with variable amounts of Tryptophan in their chow is shown. Data are presented as means and SEM and are compared with Dunnett's multiple comparison tests (panels A and C), 2-way ANOVA (B), or Fisher Exact test (C). In panel A, medians are compared with the Mann-Whitney Test. * P < 0.05, ** P < 0.01, *** P < 0.001.

Figure 2-6. Increased dietary tryptophan alters microbial communities, allowing for further expansions of Lactobacillus and Paraprevotella in TC mice. Fecal samples of B6 (A) and TC (B) mice fed tryptophan high (plus) or low (minus) chows were collected to isolate bacteria DNA for 16S rDNA sequence analysis. Taxonomic cladograms and bubble plots of significantly enriched taxa in fecal samples of Tryptophan-low as compared to Tryptophan-high B6 (A) and Tryptophan-high as compared to Tryptophan-low TC mice (B). Only taxa meeting the criteria (LDA score > 2 and p < 0.05) are shown. Data are analyzed from three independent experiments with N = 5 per group. * P < 0.05, ** P < 0.01, *** P < 0.001.

Figure 2-7. Broad-spectrum antibiotic treatment restores tryptophan metabolite alterations in TC mice. Shown is the quantitation of (A) fecal tryptophan (B) serum kynurenine and (C) the serum kynurenine/serotonin ratio in B6 and TC mice treated with the antibiotic combination Ampicillin, Metronidazole, Neomycin, Vancomycin (AMNV) for 5 months or untreated. * P < 0.05, ** P < 0.01, *** P < 0.001.

Table 2-1. Mouse primer sequences used for qRT-PCR analysis of tight junction genes

Gene Forward primer sequence Reverse primer sequence Jam ACCCTCCCTCCTTTCCTTAC CTAGGACTCTTGCCCAATCC Zo-1 AGGACACCAAAGCATGTGAG GGCATTCCTGCTGGTTACA Cldn2 GGCTGTTAGGCACATCCAT TGGCACCAACATAGGAACTC Ocln TTGGGACAGAGGCTATGGGA AAAGCGATGAAGCAGAAGCT Gapdh AGTCCATGCCATCACTGCCACC CCAGTGAGCTTCCCGTTCAGC

CHAPTER 3 THE MICROBIOTA IS LARGELY RESPONSIBLE FOR SKEWED TRYPTOPHAN METABOLISM IN THE LUPUS-PRONE TC MODEL

Background

SLE patients show a skewed distribution of tryptophan metabolites, characterized by an elevated kynurenine/tryptophan ratio in the serum(69-73), PBMCs(74) and feces(123). These skewed metabolites, first described two decades ago(71), have since been associated with disease manifestations(69; 70) as well as clinical disease activity(70). Further, kynurenine was a top discriminator of SLE patient responders and non-responders to N-acetylcysteine treatment(74). Although kynurenine is generally considered to be an immunosuppressive metabolite, its exact role in autoimmunity remains elusive. Considering that elevated kynurenine levels have been associated with

SLE disease severity suggests that this metabolite may play a different role in the context of autoimmunity. Type 1 interferon represents a major pathway in lupus pathogenesis. SLE patients display elevated levels of type 1 and type 2 interferons(143), that results in a characteristic interferon gene signature(4; 5). Like SLE patients, the TC mouse model also has elevated levels of type 1 and type 2 interferons and an interferon gene signature(144). Importantly, type 1 and type 2 interferons are known to upregulate IDO1 gene expression(57; 58; 145). Thus, the prevailing hypothesis for the elevated kynurenine/tryptophan ratio in this autoimmune setting is that increased interferon levels upregulate IDO1 expression(70). An alternative hypothesis for which our lab has provided evidence(32), is that in addition to endogenous interferon-driven metabolite skewing, the SLE microbiota also plays a significant role. Indeed, a recent study has demonstrated an altered fecal tryptophan metabolome in SLE patients compared to healthy controls(123). Whether or not

microbial enzymes are the primary mechanism or are instead participating in combination with upregulated endogenous enzymes, including IDO1, is currently unknown. In addition to possessing elevated levels of interferons and a gene signature, our lab has shown the same profile of skewed serum tryptophan metabolites in TC mice(32), therefore making this an ideal model for delineating the relative contributions of microbial and endogenous enzymes to perturbed tryptophan catabolism. Additionally, we have shown a positive correlation between kynurenine concentrations and anti- dsDNA IgG levels in TC mice(32). Taken together, existing evidence suggests a role for altered tryptophan metabolism in SLE pathogenesis. Thus, the objective of this study was to determine the mechanism by which skewed tryptophan metabolism is established in the TC model.

 The premise of the study is that tryptophan metabolite skewing contributes to lupus pathogenesis in the TC mouse model.

 The purpose of this study is to test the origin of tryptophan metabolite skewing by delineating the contribution of endogenous and microbial enzymes to tryptophan metabolite alterations in TC mice

Methods

Mice and Treatments

The TC strain has been previously described(118). C57BL/6J (B6), B6.SJL-Ptprc

Pepc /BoyJ (B6.SJL), and B6.Rag1−/− mice were originally purchased from the Jackson

Laboratory (Bar Harbor, ME) and maintained at the University of Florida. TC.Rag1−/− mice were produced by breeding the Rag1−/− allele to the Sle1, Sle2, and Sle3 loci, as previously described for other alleles(34). GF B6 mice were produced by the University of Florida Animal Care Services. Only female mice were used in this study, which were housed with mice from the same strain unless indicated otherwise, in the same SPF

room. All age-matched groups within an experiment were tested simultaneously. All experiments were conducted on at least two independent cohorts per group to avoid cage effects. All experiments were conducted according to protocols approved by the

University of Florida IACUC. Samples used for untargeted metabolomics analyses were obtained from conventionally raised TC and B6 mice in addition to GF TC mice housed and produced at the University of Chicago.

Analysis of Kynurenine and Tryptophan by HPLC

Serum and fecal kynurenine and tryptophan were quantified by a high- performance liquid chromatography (HPLC) system (Agilent 1220 Infinity II, Agilent

Technologies) equipped with an automated sampler, a gradient pump and a VWD detector. Briefly, 50 ul of serum was mixed with 6.5 ul 40% periodic acid, followed by vortex-mixing for 1 min and centrifugation at 17,000 g for 10 min. Subsequently, the supernatants were passed through a 0.22 um filter (Millex), and 20 ul of the samples was injected into the HPLC system. Separations were carried out using a mobile phase consisting of 15 mM aqueous zinc acetate (pH 4.0) and acetonitrile (96:4, v/v) in a

ZORBAX Eclipse AAA column (3.5 μm, 3 × 150 mm), with a flow rate of 1.0 ml/min.

The eluates were monitored by the programmed wavelength detection setting at 365 nm

(kynurenine) and 404 nm (tryptophan, excitation at 254 nm). The data were acquired and processed using Agilent ChemStation software. Concentrations of serum kynurenine and tryptophan were calculated based on the standard curves using serial dilutions of kynurenine and tryptophan standards (Sigma).

Metabolomic Analysis

Feces were homogenized in 5 mM ammonium acetate at 20 mg/ml. After homogenization, the sample was centrifuged at 20,000 rcf and 100 ul of supernatant

was transferred to a new tube. A 20-ul aliquot of isotopic standards was added for both calibration and profiling experiments. The internal standard solution consisted of tryptophan-13C11 (5 ug/ml), creatine-D3 (4 ug/ml), leucine-D10 (4 ug/ml), citric acid-

13C6 (8 ug/ml), tyrosine-13C6 (4 ug/ml), phenyalanine-13C6 (4 ug/ml), serotonin-D4

(5 ug/ml), kynurenine-D5 (5 ug/ml), kynurenic acid-D5 (0.5 ug/ml), anthranilic acid-

13C6 (0.8 ug/ml), and xanthurenic acid-D4 (0.8 ug/ml). Next, 800 ul of a mixture of acetonitrile, methanol, and acetone (8:1:1) was added followed by centrifugation to precipitate and pellet the proteins. The supernatant was transferred to a clean tube and dried under a gentle stream of nitrogen before reconstitution in 100 ul of 0.1% formic acid in water for metabolomic analysis. Global metabolomic analysis was performed on a Thermo Fisher Q Exactive HRMS with a Dionex UHPLC and autosampler running in both positive and negative ionization as separate injections. Mass resolution is 35,000 at m/z 200 with a mass accuracy of less than 5 ppm in positive mode and less than 10 ppm in negative mode. Separation was achieved on an Ace C18-PFP column (100 ×

samples, we quantified six tryptophan metabolites (tryptophan, serotonin, kynurenine, kynurenic acid, xanthurenic acid, and anthranilic acid) which were referenced to an external calibration curve covering the expected concentration range. The metabolomics data (including 234 named metabolites retained for subsequent analysis) were first log2-transformed and then centered. They were further examined to ensure that the normality assumption was satisfied. The two groups (B6/TC strains) were first analyzed using principal components analysis, to obtain a global viewpoint of the data and the groups. Subsequently, for each of the 234 named metabolites, an analysis of variance model was fitted with the strain factor. Adjusted P values for multiple comparisons, based on the Benjamini-Hochberg procedure, are given in table S1.

Gene Expression Analysis

Total CD4+ T cells and CD11c+ DCs were purified from mouse spleen with CD4+ and CD11c+ microbeads (Miltenyi Biotec) using negative and positive selection, respectively. Total proximal colon and duodenum cells were collected and homogenized. RNA was isolated with RNeasy Mini Kit (Qiagen) and cDNA was synthesized via reverse transcription using ImProm II Reverse Transcriptase

(Promega). Gene expression was quantified using SYBR Green Dye (Bio-Rad) on the

BioRad CFX Connect, using listed qRT-PCR primers (Table 3-1). The thermo-cycling protocol consisted of 30 s at 95°C, 30 s at 60°C, and 30 s at 72°C repeated for 40 cycles. Expression was calculated using the ΔΔCq method with difference in Cq values taken between the housekeeping gene Ppia against the gene of interest.

Flow Cytometry

Single cell suspensions were prepared from mouse spleen using standard procedures. Lysis of red blood cells was performed followed by fluorochrome- conjugated antibody staining in FACs buffer (2.5% FBS, 0.05% sodium azide in PBS).

Antibodies were used for the detection of IDO1 (mIDO-48, eBiosciences), CD4

(GK1.5, Biolegend), CD8 (53-6.7, Biolegend), B220 (RA3-6B2, BD Biosciences),

CD11c (N418, eBiosciences), CD11b (M1/70, BD Biosciences), PDCA-1 (eBio927, eBiosciences), and CD45.2 (104, Biolegend). Dead cells were excluded with fixable viability dye (eFluor 780; eBiosciences). Data were collected on an LSRFortessa (BD

Biosciences) and analyzed with FlowJo (TreeStar, Ashland, OR).

Bone Marrow Chimeras

Bone marrow (BM) cells were purified from 2-month-old TC (CD45.2) or B6.SJL

(CD45.1) donor mice. After depletion of T cells with anti-CD5 microbeads (Miltenyi

Biotec), 107 BM cells from either donor were injected (i.v.) into 3-month-old B6.Rag-/- or

TC.Rag-/- recipient mice that were previously irradiated with 2 doses of 4.25–4.50 Gy, 4 hours apart. After BM transfer, recipient mice were treated with antibiotics (1:100;

Baytril, Bayer) for 10 days. After 7 weeks of reconstitution, sera were collected from all recipients and tryptophan metabolite concentrations were assessed via HPLC. Anti- dsDNA IgG was quantified using an ELISA. Flow cytometry was performed to validate recipient immune cell reconstitution.

Anti-dsDNA IgG Autoantibody ELISA

Serum quantification of anti-dsDNA IgG has previously been described(122).

Briefly, sera diluted 1:100 were incubated on dsDNA (Sigma) coated plates. Bound antibodies were detected with alkaline phosphatase-conjugated goat anti-mouse IgG

and p-nitrophenyl phosphate (PNPP) substrate (ThermoFisher). Serial dilutions of

NZM2410 sera were included on each plate to construct a standard curve.

Statistical Analysis

Statistical analyses were performed using the GraphPad Prism 6.0 software.

Results

IDO1 and TDO do not Contribute to Kynurenine Accumulation in TC Mice

It is possible that the genomic intervals responsible for lupus-like disease in the

TC model could indirectly promote differences in endogenous enzyme expression in the tryptophan catabolism pathway, as this has never been assessed to our knowledge. To delineate the relative contributions of endogenous and microbial enzymes to skewed tryptophan metabolites in TC mice, we first assessed expression of selected host enzymes within the tryptophan catabolism pathway (Table 3-1). Endogenous (non- microbial) tryptophan catabolism is convoluted, as many enzymes are involved, some of which are ubiquitously expressed. IDO1 is primarily expressed in immune cell subsets, most notably dendritic cells (DCs)(145), in addition to the gut epithelium in which tryptophan is used as a substrate for kynurenine synthesis. Therefore, IDO1, in addition to other enzymes in this catabolic pathway are expressed in both immune and non- immune (stromal) cells. We found no significant differences in the expression of Ido1 in the small or large intestine of TC and B6 controls (Figure 3-1 B). On the other hand, we found a substantial decrease in Ido1 at the transcript level in TC DCs compared to B6

DCs (Figure 3-1 C). The other major kynurenine synthesizing enzyme, TDO (encoded

by the Tdo2 gene) is almost exclusively expressed in hepatocytes and it is thought to account for greater than 90% of tryptophan catabolism through the KP (38).

Hepatocytes express all enzymes within the KP, therefore also representing a significant source of downstream KP metabolites (Figure 3-1 A). There were no differences observed in any hepatic enzymes of the KP of tryptophan catabolism between TC and B6 controls (Figure 3-1 D). Therefore, these data do not show any obvious increase in expression of endogenous tryptophan catabolism enzymes in TC mice that could account for increased kynurenine. We confirmed by flow cytometry

(Figure 3-2 A) that TC IDO1 protein levels were decreased in plasmacytoid DCs

(pDCs), classical DCs (cDCs) and in eosinophils (Figure 3-2 B) relative to B6 controls.

Eosinophils are known to constitutively express IDO1, and exposure of eosinophils to

IFNγ in vitro results in a substantial increase of Ido1 mRNA(146). The observation that

TC IDO1 message and protein levels were decreased in immune cell subsets is surprising considering other reports of interferon-mediated IDO1 upregulation and metabolite skewing in lupus patients(70). These data therefore indicate that neither

IDO1 in TC immune cells nor TDO in hepatocytes are sources of elevated kynurenine levels observed in TC serum. On the other hand, while there were no significant differences in hepatic expression of enzymes within the kynurenine pathway, we did observe a trend for decreased kynurenine monooxygenase (Kmo) expression in TC hepatocytes (Figure 3-1 D). Since KMO is directly downstream of kynurenine, it is also possible that decreased expression of this enzyme may allow for kynurenine buildup.

Although we have examined this in the liver of B6 and TC mice, expression of KMO at the protein level, as well as the expression of other KP enzymes should be evaluated in

immune cells such as macrophages, which like hepatocytes, are known to express all enzymes within the KP(41).

TC Hematopoietic and Non-hematopoietic Compartments Play a Role in Tryptophan Metabolite Alterations

We next assessed in vivo whether or not TC cells intrinsically had any capacity to produce the observed differences in tryptophan metabolites. First, T cell-depleted bone marrow cells from 2 month old B6.SJL (CD45.1) and TC (CD45.2) mice were purified and adoptively transferred to B6.Rag-/- and TC.Rag-/- recipients to avoid retention of immune cells that were resistant to radiation (Figure 3-3 A). Following reconstitution, sera were collected, and anti-dsDNA IgG concentrations were determined via ELISA.

As expected, autoantibody production occurs only the recipients of TC immune cells

(Figure 3-3 B). More importantly, this experiment allowed us to test the capacity of both donor immune cells and radio-resistant non-immune host cells to change tryptophan and kynurenine concentrations in the serum, which was assessed via HPLC. Compared to B6.Rag-/- controls reconstituted with B6 bone marrow cells, B6.Rag-/- mice reconstituted with TC bone marrow cells had significantly less serum tryptophan, and a trend for increased kynurenine, indicating a TC immune cell contribution to the increased kynurenine/tryptophan ratio (Figure 3-3 C). Additionally, TC.Rag-/- recipients reconstituted with B6 bone marrow cells also had depleted tryptophan compared to

B6.Rag-/- control recipients, but no difference in kynurenine levels (Figure 3-3 C), suggesting a stromal cell contribution to reduced tryptophan. Collectively, these data show that both TC immune cells and stromal cells contribute to depleting tryptophan in vivo, whereas TC immune cells are mostly responsible for kynurenine synthesis, and an elevated kynurenine/tryptophan ratio as a result. Finally, it is possible that donor

immune cells could change the composition of the recipient microbiota, which may then contribute indirectly to metabolite skewing in this experiment.

Next, we assessed the role of adaptive immune cells in serum tryptophan metabolite skewing by comparing serum tryptophan and kynurenine concentrations in

TC and TC.Rag-/- mice, the latter of which lack B and T cells (Figure 3-3 D). We found that TC.Rag-/- mice displayed no changes in serum tryptophan concentrations but had increased kynurenine and an increased overall kynurenine/tryptophan ratio relative to

TC mice at 4 months of age (Figure 3-3 D). These data may suggest that innate immune cells or stromal cells contribute to kynurenine accumulation, that TC B and/or T cells import kynurenine. Indeed, CD4+ T cells have been shown to import kynurenine via expression of the SLC7A5 transporter(147). It is also possible for the TC.Rag-/- microbiota to have a greater capacity to metabolize tryptophan compared to the TC microbiota. These data together suggest that both TC immune cells and stromal cells contribute to an elevated kynurenine/tryptophan ratio.

The Microbiota Skews Tryptophan Metabolism in TC Mice

Our previous data suggests TC microbiota involvement in altered tryptophan metabolism(32) (Figure 2-4). To further understand the contribution of the TC microbiota to skewed tryptophan metabolites, we compared serum and fecal tryptophan metabolites from TC mice raised under GF conditions to those raised in standard SPF conditions, both from the same institution. SPF B6 were used as a control. Overall, tryptophan metabolites were significantly altered in the serum and feces between groups (Figure 3-5 A-B). We found increased serum and fecal kynurenine concentrations in GF relative to SPF TC mice (Figure 3-5 C), suggesting that the microbiota is not directly responsible for elevated kynurenine found in the TC model.

The absence of the TC microbiota dramatically increased fecal tryptophan to levels comparable to B6 tryptophan concentrations (Figure 3-5 D), further demonstrating that the TC microbiota has an enhanced capacity to catabolize tryptophan relative to the B6 microbiota. This may explain why TC mice have lower levels of tryptophan compared to

B6 mice no matter the percentage of dietary tryptophan consumed (Figure 2-4 D).

Additionally, this observation may explain the acute weight loss observed in TC mice consuming low dietary tryptophan relative to B6 controls on low dietary tryptophan(32).

Overall, endogenous KP metabolites were elevated in the serum and feces of GF TC mice (Figure 3-5 E), suggesting that in the absence of the microbiota, more tryptophan is available for utilization by the endogenous pathway. The microbial metabolite tryptamine was elevated in SPF TC relative to GF TC mice as expected (Figure 3-5 F), but more interestingly, was drastically increased relative to SPF B6 mice in the serum and feces. Further, serum indole-3-acetate was also elevated in SPF TC mice relative to both GF TC and SPF B6 mice (Figure 3-5 F). These data support the notion that the

TC microbiota utilizes more dietary tryptophan for the synthesis of microbial metabolites compared to the B6 microbiota. Therefore, the TC microbiota drastically reduces tryptophan levels and produces more microbial tryptophan metabolites compared to the

B6 microbiota.

Discussion

The premise of these experiments was to identify to origin of tryptophan metabolite skewing in TC mice. Here, we have provided evidence to suggest that the

TC microbiota plays a role in skewed tryptophan catabolism in TC mice compared to non-autoimmune B6 controls. There are numerous enzymes involved in microbial tryptophan catabolism, some of which are responsible for indole synthesis, tryptamine

synthesis, or even the production of kynurenine. Our previous metagenomic analysis of the TC microbiota did not show any direct evidence for differences in microbial tryptophan enzymes(32), however, this method resulted in a coverage of only 47%, which will allow for future re-analysis as better annotation of the murine microbiota becomes available. Serum kynurenine levels were restored to B6 levels in TC mice treated with broad-spectrum antibiotics (Figure 2-7 B), highlighting a potential microbiota contribution to elevated kynurenine in this model. Although we found no direct evidence for TC microbiota production of kynurenine from our analysis of GF and

SPF TC mice, we did find evidence to bolster microbiota involvement in the skewing of other tryptophan metabolites. The reduction of kynurenine levels in antibiotic-treated TC sera may have been an effect of increased serotonin synthesis as a result of elevated tryptophan levels in the presumed absence of the microbiota. Fecal tryptophan concentrations in GF TC mice are comparable to SPF B6 mice, which are drastically elevated compared to SPF TC mice, suggesting that the TC microbiota plays an important role in elevating the kynurenine/tryptophan ratio by dramatically reducing tryptophan levels. More importantly, these data show that the TC microbiota has a greater capacity to catabolize tryptophan compared to the B6 microbiota, as reflected by elevated microbial tryptophan metabolites in SPF TC mice relative to B6 controls. In previous experiments, we found that when TC and B6 mice were fed the same low tryptophan diet, TC mice experienced acute weight loss compared to B6 controls, which highlights that TC mice process tryptophan differently. Indeed, we observed depleted tryptophan in TC mice relative to B6 controls regardless of the percentage of dietary tryptophan they were fed, highlighting an intrinsic difference in the way TC mice

catabolize tryptophan. The data presented here support the notion that the TC microbiota consumes more tryptophan for the production of microbial tryptophan metabolites, while reducing tryptophan availability for endogenous processing, which may ultimately explain our previous observations of weight loss in TC mice consuming low dietary tryptophan.

Our data also suggest that IDO1 is not directly involved in tryptophan metabolism skewing in the TC model. We found a substantial decrease in IDO1 mRNA in TC total

CD11c+ DCs relative to B6 controls in addition to decreased IDO1 protein levels in DC subsets and eosinophils compared to B6 controls, which is surprising considering the high interferon levels in the TC model. Further experiments are ongoing to test the functionality of IDO1 in DCs between strains by quantifying kynurenine production from these cells in vitro. It is possible that decreased expression of downstream enzymes such as KMO may account for kynurenine buildup in TC mice. Although we found no differences in the expression of this enzyme between strains in hepatocytes, KMO and other enzymes should be examined in additional cell types such as macrophages, which are also known to express all enzymes within the KP(41). Additionally, tracer studies using C13-labelled tryptophan would allow a more extensive understanding of the metabolic fate of tryptophan in the TC mouse, since it is difficult to simultaneously assess all relevant catabolic pathways using our current methodologies.

Although data from bone marrow chimeras showed a contribution of both immune cells and stromal cells to metabolite skewing in vivo, the identity of both cell types involved remains elusive. It is also possible that the metabolite skewing in this experiment is due to indirect effects on the recipient microiota, either by immune cells or

stromal cells. An elevated kynurenine/tryptophan ratio in TC.Rag-/- mice may further suggest an innate immune cell contribution, either direct or indirect through the microbiota, but it is also possible that B and or T cells are responsible for kynurenine uptake. The role of the TC.Rag-/- microbiota in metabolite skewing is unknown, however, this microbiota fails to induce autoimmune activation in GF B6 recipients, which may suggest that any potential tryptophan metabolite changes in the presence of this microbiota do not specifically play a role in disease pathogenesis. Therefore, these data collectively show that elevated kynurenine in the TC model is a result of the innate compartment, but that it is not directly due to IDO1.

Although these data provide some insight on the origin of skewed tryptophan metabolites in a murine model of lupus, it is unknown whether a similar contribution may account for skewing of tryptophan metabolism in SLE patients and other murine models of the disease. Additionally, the specific mechanisms by which altered tryptophan metabolism contributes to disease pathogenesis are not well understood and therefore represent a significant point of interest.

Figure 3-1 Endogenous enzyme expression in the tryptophan catabolism pathway in TC and B6 mice. (A) Mammalian enzymes comprising the extrahepatic (IDO1) and hepatic kynurenine pathway including TDO (Tdo2), KAT2, KMO, and 3HAO. (B) Ido1 expression in B6 and TC proximal colon and duodenum (SI). (C) Ido1 expression in B6 and TC purified splenic CD11c+ DCs. (D) Hepatic expression of enzymes within the kynurenine pathway in B6 and TC mice.

Figure 3-2 Assessment of IDO1 protein levels in immune cell subsets in TC and B6 mice. (A) Gating strategy. (B) IDO1 protein levels in pDCs, cDCs, and in eosinophils. All mice used for this experiment were 2.5 months of age.

Figure 3-3 Tryptophan metabolite concentrations from bone marrow chimeras (A) Schematic showing experimental design for adoptive cell transfers and generation of bone marrow chimeras. Recipient symbols are shown for identification of groups within data set. (B) Quantified serum anti-dsDNA IgG in chimera mice after 7 weeks after reconstitution. (C) Serum tryptophan and kynurenine concentrations from chimeras 7 weeks after reconstitution.

Figure 3-4 Tryptophan metabolite concentrations from TC and TC.Rag-/- mice (A) Serum tryptophan concentrations and (B) kynurenine concentrations from age- matched TC and TC.Rag-/- mice at 4 months of age. (C) Kynurenine/tryptophan ratio comparison between strains.

Figure 3-5 Serum and fecal tryptophan metabolites from GF and SPF TC mice. (A) Principle coordinate analysis (PCA) of global metabolites in the serum and (B) feces of GF (red) and SPF TC (green) mice. (C) Serum and fecal kynurenine concentrations (D) Serum and fecal tryptophan concentrations. (E) Endogenous serum and fecal tryptophan metabolites. (F) Microbial serum and fecal tryptophan metabolites.

Table 3-1. Mouse primer sequences used for qRT-PCR analysis of endogenous tryptophan catabolism genes

Gene Forward primer sequence Reverse primer sequence Ido1 CCCACACTGAGCACGGACGG TTGCGGGGCAGCACCTTTCG Tdo2 CATGGCTGGAAAGAACAC GGAGTGCACGGTATGAC Ppia GCTGTTTGCAGACAAAGTTCCA CGTGTAAAGTCACCACCCTGG Kmo ATGGCATCGTCTGATACTCAGG CCCTAGCTTCGTACACATCAACT Kat2 ATGAATTACTCACGGTTCCTCAC AACATGCTCGGGTTTGGAGAT 3Hao GAACGCCGTGTGAGAGTGAA CCAACGAACATGATTTTGAGCTG

CHAPTER 4 SKEWED TRYPTOPHAN METABOLISM IN THE LUPUS-PRONE TC MOUSE PROMOTES PRO-INFLAMMATORY T CELL PHENOTYPES

Background

Numerous studies have consistently reported skewed tryptophan metabolites favoring the kynurenine pathway in SLE patients(69-72; 74; 101), which correlate with disease severity(70) in addition to specific disease manifestations(69). Interestingly, kynurenine has been shown to activate mTORC1 in human T cells(74), both in the

Jurkat T cell line, and in peripheral blood lymphocytes from healthy volunteers. mTORC1 activation is increased in lupus CD4+ T cells(108), in addition to glycolysis and mitochondrial oxidative phosphorylation (OXPHOS)(125). The relevance of mTORC1 activation in lupus pathogenesis is illustrated by the therapeutic effects of mTOR blockade in SLE patients, including reduced disease activity and normalized T cell activation(109; 141). mTOR plays a central role in T cell metabolic pathways by supporting transcription of genes involved in glycolysis and mitochondrial respiration(148). Increased rates of glycolysis and OXPHOS in lupus T cells(125), along with cell signaling defects(102; 103), play a significant role in autoimmune activation.

This is supported by previous studies from the Morel lab demonstrating that dual blockade of glycolysis and OXPHOS using the inhibitors 2-deoxyglucose (2DG) and metformin, respectively, results in disease reversal in TC mice in addition to other murine models of lupus(125; 126; 149). Also, treatments with 2DG or metformin alone prevented or delayed disease in several murine lupus models(149), further illustrating the importance of cellular metabolism in the pathogenicity of lupus CD4+ T cells.

We have demonstrated that high levels of dietary tryptophan exacerbate autoimmunity in the TC model, whereas low dietary tryptophan confers protection

(Figure 2-5)(32). Intriguingly, we found that CD25 expression on Treg cells, which is associated with the suppressive function of these cells, increases with reduced dietary tryptophan consumption(32), potentially indicating impaired Treg suppressive capacity with higher levels of dietary tryptophan. It is also possible that consumption of higher levels of dietary tryptophan impacts effector T cell phenotypes, either through mTOR activation or other pathways which may lead to enhanced pathogenicity in the TC model.

Therefore, to understand the consequences of high dietary tryptophan, and the impact of tryptophan metabolites on autoimmune phenotypes in the TC model(32), we further evaluated the impact of tryptophan metabolites on T cell phenotypes, including potential effects on mTORC1 activation. We hypothesized that the elevated kynurenine in lupus may activate mTORC1 in T cells and skew their polarization to effector functions, thus promoting exacerbated autoimmune activation.

 The premise of the study is that tryptophan metabolites directly modulate immune activation

 The goal of this study is to identify mechanisms by which the relative tryptophan metabolites modify T cell activation and function in TC mice

Methods

Mice and Treatments

The TC strain has been previously described(118). C57BL/6J (B6) and

B6.Rag1−/− mice were originally purchased from the Jackson Laboratory and maintained at the University of Florida. Only female mice were used in this study, and they were housed with mice from the same strain unless indicated otherwise, in the same SPF room. All age-matched groups within an experiment were tested simultaneously. Mice were provided with autoclaved reversed osmosis drinking water

and fed with Tryptophan-modified synthetic chows that differ only by their Tryptophan content (0 or 1.19% Tryptophan, A11022501-04, Research Diets, Inc.) for the indicated amount of time. To replenish Tryptophan levels, Tryptophan-deficient (0%) chow was switched to Tryptophan 0.19% chow on Friday afternoons and switched back to 0% chow on Monday mornings, corresponding to an approximate distribution of 60%

Tryptophan (0): 40% Tryptophan (0.19), or an overall 0.08% dietary Tryptophan. All experiments were conducted on at least 2 independent cohorts per group to avoid cage effects. All experiments were conducted according to protocols approved by the

University of Florida IACUC.

Flow Cytometry

For the suppression assay, purified CD4+ T cells were washed and stained in

FACS buffer (2.5% FBS, 0.05% sodium azide in PBS) for 1 h with antibodies against mouse CD4 (PE; GK1.5; eBioscience), CD45.1 (FITC; A20; BD Biosciences). For cell proliferation quantification, cells were pre-labelled with cell trace violet (CTV; BV421).

For the polarization experiments, purified CD4+ T cells were collected after a 4 d incubation under the respective polarizing conditions, washed, and stained in FACS buffer for 1 h with antibodies against CD4 (RM4-5, Biolegend). For assessment of mTOR activation in CD4+ T cells, total splenocytes were washed and stained in FACS buffer for 1 h with antibodies against CD4 (GK1.5; Biolegend), CD44 (IM7; BD

Biosciences), and CD62L (MEL-14; Biolegend). Dead cells were excluded with fixable viability dye (eFluor780; Thermo Fisher) for all experiments.

For intracellular staining, cells were fixed and permeabilized overnight using the

FOXP3/Transcription Factor Staining Buffer Set (Thermo Fisher Scientific) according to manufacturer instructions. Cells were then stained for 1 h with antibodies against Foxp3

(FJK-16S; eBioscience), p4EBP1 (236B4; Cell Signaling), pS6 (D57.2.2E; Cell

Signaling), and IFNγ (XMG1.2, Biolegend). Data were acquired on an LSRFortessa (BD

Biosciences) and analyzed with FlowJo V10 (FlowJo).

Cellular Assays

For the Treg suppression assays, CD45.1+CD4+CD25- Teff cells were isolated with magnetic beads from B6.SJL mice and labeled with Cell Trace Violet (CTV) (Life

Technologies). DCs were isolated from B6 spleens with CD11c+ microbeads (Miltenyi) and served as antigen-presenting cells. CD4+CD25+ Treg cells were purified from either

B6 and TC mice consuming high and low dietary tryptophan, and immediately incubated with Teff cells. DCs (104) and Teff cells (6.6 x 104) were incubated with Treg cells at a

1:1 to 1:8 Teff:Treg ratio in the presence of soluble anti-CD3 antibody (1 mg/ml) for 3 d.

The proliferation of CD45.1+ Teff cells was determined by CTV and analyzed using

FlowJo software. Results are shown as a proliferation index, representing total Teff proliferation for each ratio of Treg:Teff.

For T cell polarization assays, total splenic CD4+ T cells were incubated in the presence of anti-CD3/CD28 antibodies under Th1 (IL-12 (10 ng/mL) and anti-IL-4 (10 ug/mL)) or Treg (TGF-β (3 ng/mL), IL-2 (50 ng/mL), anti-IFNγ (300 nM), and anti-IL-4

(10 ug/mL)) polarizing conditions with L-tryptophan (15 uM and 50 uM) or L-kynurenine

(50 uM) (both from Sigma) in complete McCoy’s 5A media (15 uM tryptophan) for 96 h.

IFNγ production and Foxp3 expression were assessed by flow cytometry.

Immunofluorescence Staining

Immunofluorescence staining of frozen spleen sections was performed with an mTOR polyclonal antibody (Invitrogen PA5-34663, 1:1000 dilution) followed by an Alexa

Fluor 594-conjugated donkey anti-rabbit IgG (ThermoFisher A-2107, 1:200 dilution).

GCs were stained with anti-GL7-FITC (LY-77; 1:25), B cells with anti-IgDb-PE (217-170,

1:50) and CD4+ T cells with anti-CD4-APC (RM4-5, 1:100), all from BD Bioscience.

Western Blots

For preparation of protein lysates, sorted effector memory T cells (CD4+ CD25-

CD45RB+) and Treg cells (CD4+ CD25+) from TC mice fed tryptophan high or tryptophan low diets for 2 months were pelleted, resuspended in 50 ul cell lysis buffer

(EMD Millipore) and protease inhibitor cocktail (1:100, Sigma-Aldrich), and incubated on ice for 20 min. Samples were sonicated for 30 seconds and centrifuged for cell debris removal. Total protein was quantified in supernatants using the Bradford Coomassie assay against a standard curve. Lysates were normalized to 30-40 ug/ul using a cocktail of DTT/dye solution (both from Cell Signaling) at a ratio of 1:10 before heating the samples at 95oC for 5 min. Protein content from all lysates (30 ul) in addition to a protein standard (15 ul) were loaded into a polyacrylamide gel and separated based on size using SDS-PAGE at 90 V for 1 h. Transfer onto a PVDF membrane was performed using the BioRad transblot mini-gel system. Immediately after transfer, the membrane was incubated in 5% milk proteins (Cell Signaling) in 1X TBS-T (Cell Signaling) for 1 h at room temperature. The membrane was washed thoroughly 3 times in TBS-T for 5 min with gentle rocking before incubating overnight with primary antibodies (1:1000; Cell

Signaling) against p4E-BP1 (2855S), p70S6K (9204S), and beta-Actin (3700S) at 4oC.

Goat anti-rabbit IgG conjugated to HRP was used as the secondary antibody (1:2000 in

TBS-T with 5% milk proteins) for 1 h at room temperature. Following incubation and washing, signal was detected using signal fire elite luminol reagent (Cell Signaling). For repeat measurements of different proteins on the same membrane, PVDF stripping buffer was applied for 15 min (ThermoFisher), and the membrane was re-blocked with

5% milk proteins in TBS-T before re-probing. Band intensities were quantified using

ImageJ software (National Institutes of Health, Bethesda, MD).

Statistical Analysis

Statistical analyses were performed using the GraphPad Prism 6.0 software.

Results

High Dietary Tryptophan Impairs Treg Suppressive Function in vitro

Since elevated dietary tryptophan results in decreased CD25 expression in Treg cells in vivo(32), we sought to further investigate the functional impact of dietary tryptophan levels on Treg cells ex vivo. To do this, total Treg cells (CD4+ CD25+) were purified from the spleens of TC mice fed either low or high dietary tryptophan for 4 months. Treg cells were incubated at various ratios with CTV labeled CD4+ effector T cells from B6.SJL mice (expressing the congenic marker CD45.1) and DCs from B6 mice in the presence of anti-CD3 for 3 d. Following this incubation, flow cytometry was performed to quantify effector T cell proliferation by gating on CD4+ CD45.1+ CTV labeled cells (Figure 4-1 A). We found that Treg cells from TC mice consuming high dietary tryptophan were less suppressive than Treg cells from TC mice consuming low dietary tryptophan (Figure 4-1 B), further suggesting that higher levels of dietary tryptophan impair Treg functional capacity. However, when Treg cells are incubated with either tryptophan or kynurenine alone for 4 h before the suppression assay is performed, it does not result in any difference in the functional capacity of these cells

(data not shown). Therefore, high levels of dietary tryptophan impair Treg cell function in

TC mice in vivo, however, this impairment may not be due to tryptophan or kynurenine themselves, but rather another metabolite that has yet to be identified.

High Dietary Tryptophan Activates mTOR in TC CD4+ T Cells in vivo

Considering the importance of the mTORC1 pathway in lupus and previous reports of kynurenine activating mTOR in human CD4+ T cells, we assessed mTOR activation in sorted effector memory T cells (CD4+ CD25- CD44+) from TC mice consuming high or low dietary tryptophan for 2 months by specifically quantifying phosphorylated proteins downstream of mTORC1, including p4E-BP1 and p70S6K by

Western blot analysis and flow cytometry. We found that effector memory T cells from

TC mice consuming high dietary tryptophan had increased mTOR activation, as shown by the significant increase in phosphorylated 4E-BP1 (Figure 4-2 A-B). We also found an increase in phosphorylated 4E-BP1 by flow cytometry in effector memory CD4+ T cells from TC mice fed high tryptophan compared to TC mice fed low dietary tryptophan

(Figure 4-2 C-D). In addition, we performed immunofluorescence staining on frozen spleen sections from TC mice fed either tryptophan high or tryptophan low and found increased total mTOR protein in the spleens of TC mice fed high dietary tryptophan compared to mice fed low tryptophan (Figure 4-3). Therefore, we show by various methods that consumption of an elevated percentage of dietary tryptophan has an effect on mTOR in CD4+ cells in TC mice. Immunofluorescence staining shows that total mTOR protein levels are increased and colocalize with CD4+ cells in spleen sections from TC mice fed high dietary tryptophan, whereas western blot and flow cytometry analyses demonstrate increased mTOR activation in CD4+ T cells from TC mice fed high dietary. The significant increase in p4EBP1, along with no differences in pS6 in

tryptophan high TC T cells suggests that high dietary tryptophan may have a greater effect on mTORC1 activation.

Tryptophan Metabolites Impact CD4+ T Cell Polarization in vitro

Previously, we have modulated tryptophan metabolites by feeding mice high or low percentages of dietary tryptophan. To understand if individual exogenous tryptophan metabolites had an effect on T cell polarization in vitro, we incubated purified total CD4+ T cells from the spleens of B6 and TC mice under Th1 and Treg polarizing conditions in the presence of anti-CD3/CD28 with low (15 uM) or high (50 uM) tryptophan, and with or without exogenous kynurenine. After 4 d, polarization was evaluated by flow cytometry (Figure 4-4 A). We found that a high concentration of tryptophan promoted TC CD4+ T cell skewing toward a Th1 phenotype but not B6 CD4+

T cells (Figure 4-4 B). Conversely, tryptophan promoted B6 but not TC Treg polarization from CD4+ T cells (Figure 4-4 D). Similarly, the addition of high levels of kynurenine promoted B6 and TC CD4+ T cell polarization to a Th1 phenotype (Figure 4-4 C), and increased Treg polarization in B6 mice only (Figure 4-4 E). Interestingly, kynurenine promoted CD4+ T cell IFNγ production from both strains even in the absence of polarizing conditions (Figure 4-4 F). Thus, these data suggest that tryptophan and kynurenine alone can encourage the skewing of CD4+ T cells toward a Th1 phenotype, which is pathogenic in the setting of lupus.

Discussion

Despite consistent reports of skewed tryptophan metabolism and associations with disease in lupus patients, its functional consequences on lupus disease phenotypes remain elusive. We previously observed that an increased abundance of tryptophan in the diet results in more immune activation in TC mice. Therefore, the goal

of this study was to determine the mechanism by which dietary tryptophan modifies autoimmune activation in the TC model. Although kynurenine was reported to activate mTOR in healthy human donor T cells and the Jurkat T cell line, it is unknown if this metabolite alone, or other tryptophan metabolites may lead to mTOR activation in lupus

T cells in vivo. Additionally, pathways other than mTOR may be affected.

Here, we have shown that feeding TC mice high dietary tryptophan levels results in increased mTOR expression and mTOR activation in CD4+ T cells, which may play a role in enhancing the pathogenicity of these cells, presumably through increased rates of glycolysis and oxidative phosphorylation. We have also demonstrated that high dietary tryptophan impairs Treg cell suppressive function ex vivo, which may permit elevated immune activation, especially in combination with enhanced effector T cell pathogenicity. In addition, tryptophan and kynurenine had specific effects on T cell polarization in vitro. The addition of tryptophan to CD4+ T cells resulted in increased

IFNγ CD4+ T cells under Th1 polarizing conditions in TC T cells only, and increased

FoxP3+ CD4+ T cells under Treg polarizing conditions in both strains. On the other hand, kynurenine increased IFNγ+ CD4+ T cells under Th1 polarizing conditions and in

Th0 conditions (anti-CD3/CD28 alone) in both B6 and TC T cells. Interestingly, kynurenine increased FoxP3+ CD4+ T cells under Treg polarizing conditions in B6 T cells only, while in TC T cells, there is a trend for reduced FoxP3+ CD4+ T cells.

These data support a role for skewed tryptophan metabolites, either endogenously derived from high levels of dietary tryptophan, or exogenous, in promoting pathogenic T cell phenotypes in the lupus-prone TC model. Although the specific tryptophan metabolite(s) responsible for elevated mTOR activation and

impaired Treg cell function are unknown, exogenous application of tryptophan or kynurenine to T cells in vitro promote skewing of T cell phenotypes toward pro- inflammatory Th1 cells. On the other hand, TC Tregs incubated in the presence of these exogenous metabolites showed no differences in their suppressive function in vitro

(data not shown), potentially suggesting that another metabolite is responsible for the effects of high dietary tryptophan on Treg cell function in vivo. Collectively, these data suggest that higher levels of dietary tryptophan promote autoimmunity via simultaneous skewing of effector T cells toward a Th1 phenotype, mTOR activation in effector T cells, and impairment to Treg suppressive capacity. Whether or not high dietary tryptophan levels would have the same impact on T cells from lupus patients is unknown. Also, the extent to which tryptophan and kynurenine are imported into B6 and TC CD4+ T cells in vivo and in vitro is unknown, although mouse CD4+ T cells have been shown to import kynurenine through the system L transporter SLC7A5 in vitro(147). Therefore, intracellular concentrations of tryptophan and kynurenine should be assessed in CD4+ T cells in vitro and in vivo.

Figure 4-1 Dietary tryptophan modifies Treg suppressive capacity. A. Gating strategy for quantification of CD45.1 effector T cell proliferation. B. In vitro proliferation of effector T cells in the presence of Treg cells purified from TC mice fed tryptophan low or tryptophan high diets (N = 6). * P < 0.05, ** P < 0.01, *** P < 0.001.

Figure 4-2 High dietary tryptophan promotes mTOR activation in TC effector T cells in vivo. A. Representative western blot of TC effector T cell lysates for p4E-BP1, p70S6K, and beta-actin. B. Quantification of western blot results for p4E-BP1, p70S6K, and beta-actin intensity. C. Flow cytometry gating strategy for assessment of mTOR activation in CD4+ CD44+ CD62L- T cells. D. Mean fluorescence intensity of p4EBP1 and pS6 in splenic effector memory CD4+ T cells from TC mice fed tryptophan low or high diets for two months. * P < 0.05, ** P < 0.01, *** P < 0.001.

Figure 4-3 High dietary tryptophan increases mTOR expression in TC CD4+ T cells. Representative immunofluorescence staining for IgD, CD4, and total mTOR protein in spleen sections from TC mice fed high or low dietary tryptophan for 2 months. Images shown were captured at 20x magnification. Arrows show colocalization of mTOR and CD4 imunofluorescence.

Figure 4-4 Exogenous tryptophan and kynurenine promote CD4+ T cell Th1 and impair Treg polarization in vitro. (A) Gating strategy for evaluation of T cell polarization. Frequencies of CD4+ T cells producing IFNγ after 4 d incubation under Th1 polarizing conditions with either tryptophan (B) or kynurenine (D). Frequencies of CD4+ T cells expressing FoxP3 after 4 d incubation under Treg polarizing conditions with either tryptophan (C) or kynurenine (E). (F) Frequencies of CD4+ T cells producing IFNγ after 4 d incubation under Th0 conditions with the addition of kynurenine. * P < 0.05, ** P < 0.01, *** P < 0.001.

CHAPTER 5 CONCLUSIONS

There is a strong body of evidence from human and murine studies associating microbial dysbiosis with autoimmune diseases(17-25; 27-31; 75). Previous reports highlight altered gut microbial communities in SLE patients relative to healthy controls(17-19; 29), however, the exact mechanism by which microbial dysbiosis may contribute to human autoimmunity, and more specifically, lupus-like disease in the TC model, remains elusive. Here we report a differential distribution of bacterial taxa in TC mice compared to age matched B6 controls, characterized by a marked abundance of

Prevotella, Paraprevotella, and Lactobacillus genera. Interestingly, these expansions have been documented in the gut microbiota of individuals with rheumatoid arthritis(23-

25), in the oral microbiota of individuals with SLE(150) and in lupus prone B6.TLR7 transgenic mice(150). Importantly, we have shown that perturbed microbial communities in TC mice have functional consequences by amplifying disease(32).

Multiple mechanisms may account for the ability of intestinal bacteria to induce autoimmunity associated with lupus(75; 82; 83). Commensal bacteria expressing orthologs of human Ro60 autoantigens are commonly found in patients with SLE, and

Ro60-specific T cells can be activated and trigger anti-Ro60 antibodies in GF mice(82), supporting molecular mimicry as a potential mechanism of autoimmunity. Further, impaired gut barrier integrity is also documented in several murine models of lupus(31;

84) and in some patients with SLE(75; 84), and the translocation of Enterococcus gallinarium(84) or L. reuteri(31) from the gut to the periphery results in systemic immune activation in GF B6 mice. Overall, these findings suggest that multiple mechanisms of microbiota-mediated immune regulation may be at play in the context of lupus. We have

shown no evidence for an impaired intestinal barrier in the TC model that would allow for bacterial translocation and subsequent induction of inflammation, which has been reported in other lupus murine models(31; 84), and in SLE patients(75; 84). Despite an intact barrier in TC mice, aerobic bacterial growth was still observed in mLN and liver homogenates, all of which were positive for Staph. xylosus. These findings suggest that this specific bacterium, the presence of which does not correlate with prototypical autoimmune phenotypes, gains entry through a mechanism other than translocation and likely is not playing a role in disease pathogenesis. We found no bacterial growth from any of these tissues under anaerobic conditions. Therefore, bacterial translocation and dissemination are not likely to be mechanisms by which the TC microbiota plays a role in pathogenesis.

Fecal tryptophan metabolites were significantly altered between strains and normalized in cohoused B6 and TC mice(32), suggesting that the TC microbiota has an altered capacity for tryptophan catabolism. This pathway was is of interest due to the well-known role of tryptophan metabolites as bioactive immunomodulatory compounds(38; 42-44), and because of consistent reporting of tryptophan catabolism skewing in the serum and immune cells of independent SLE patient cohorts(69-72; 74;

101), in addition to SLE patient feces(123). Many of these studies have also demonstrated positive correlations between skewed tryptophan metabolism and disease activity, suggesting that the catabolism of this essential amino acid may play an active role in disease pathogenesis, or that skewed metabolites in this pathway could be relevant biomarkers. Despite known perturbations to tryptophan metabolism in the

context of lupus and associations with disease severity, the exact origin of this skewing and associated mechanisms of immune activation are unknown.

Interestingly, six-month-old autoantibody-positive TC mice displayed an elevated serum kynurenine/tryptophan ratio, the same metabolite profile observed in SLE patients(69-72). Although the prevailing hypothesis for skewing toward the kynurenine pathway in lupus is that elevated interferon levels upregulate endogenous IDO1 expression(101), our alternative, non-exclusive hypothesis is that the TC microbiota, in addition to endogenous enzymes, act simultaneously to skew tryptophan catabolites.

In support of this hypothesis, TC mice raised under GF conditions have drastically elevated fecal tryptophan concentrations relative to TC mice raised under normal SPF conditions, and importantly, SPF TC mice have significantly depleted fecal tryptophan concentrations compared to SPF B6 control mice, strongly suggesting that the TC microbiota has an enhanced capacity for metabolizing tryptophan. We found that

TC mice responded with acute weight loss to tryptophan deficiency compared to B6 controls, further suggesting that TC mice process this essential amino acid differently, likely due to the higher abundance of gut microbes that catabolize tryptophan. Indeed, some species of Prevotella, Paraprevotella, and Lactobacillus were expanded in the TC gut microbiota, which have the ability to catabolize tryptophan(44; 47; 139). In addition to the elevated levels of tryptophan in the feces, GF TC mice have increased levels of endogenous KP metabolites in the serum and feces, suggesting that in the absence of the microbiota, more tryptophan is used to fuel the KP. Elevated concentrations of microbial tryptophan metabolites including tryptamine and indole-3-acetate were found in SPF TC mice relative to both GF TC and SPF B6 controls. It is possible that these

microbial-derived tryptophan metabolites promote inflammatory TC immune cell phenotypes. Together, these data show that the TC microbiota plays a role in skewing tryptophan metabolites, by dramatically depleting fecal tryptophan concentrations to produce specific microbial tryptophan metabolites, thereby limiting the amount of tryptophan available to the host for endogenous catabolism. (Figure 5-1).

Our assessment of endogenous expression of tryptophan metabolism enzymes did not indicate a significant increase in Ido1 in the intestinal epithelium or dendritic cells, Tdo2 (which encodes the enzyme TDO), or any other hepatic enzymes within the

KP in TC mice. We observed a decrease in Ido1 transcripts in TC total CD11c+ DCs.

Similarly, IDO1 was decreased at the protein level in TC dendritic cell subsets and eosinophils compared to B6 mice. These findings are surprising given that increased type 1 and type 2 interferons are increased in TC mice and a type 1 interferon signature is apparent before disease onset in this model(144), which we hypothesized would upregulate Ido1. Therefore, IDO1 in these immune cell subsets, in addition to hepatic

TDO are not responsible for elevated kynurenine concentrations in TC serum (Figure 5-

1). It is possible that the accumulation kynurenine is due to reduced catabolism by downsteam enzymes.

We did not observe any differences in disease phenotypes in TC mice treated with the IDO inhibitor 1-MT, potentially suggesting that the kynurenine pathway is dispensable for promoting immune activation in this model. Interestingly, an increased kynurenine/tryptophan ratio has also been reported in the spontaneous MRL/lpr lupus model(151). Although the origin of tryptophan metabolism skewing has not been investigated in this model, 1-MT treatment is therapeutic(152) in contrast to TC mice,

suggesting that the endogenous KP plays a major role in disease pathogenesis in

MRL/lpr mice. This highlights the need for further investigation of tryptophan metabolism in additional lupus-prone mouse models and SLE patient cohorts to better understand the origin of this skewing and contributions to disease phenotypes.

We found that feeding low levels of dietary tryptophan conferred protection in TC mice, whereas TC mice fed high dietary tryptophan levels displayed exacerbated disease phenotypes. In addition, we have demonstrated that the inflammatory capacity of the TC microbiota is at least partially mediated by dietary tryptophan levels, as FMTs from TC mice fed high dietary tryptophan induced more mLN immune activation in GF

B6 recipients compared to FMTs from TC mice fed low tryptophan. Further, variations in dietary tryptophan affected B6 and TC mouse gut microbiotas differently. Tryptophan supplementation was associated with the expansion of Prevotella, Paraprevotella, or

Lactobacillus species in TC mouse feces. An alteration of the gut microbiota by tryptophan supplementation has been reported in piglets, with, as in TC mice, an expansion of Prevotella species(153). Notably, tryptophan supplementation in these animals increased the expression of genes involved in gut epithelial integrity(153), which may be related, at least in part, to the absence of a leaky gut phenotype in TC mice. Overall, these results suggest a functional link between tryptophan metabolism, gut microbial dysbiosis, and autoimmune activation in TC mice.

We have also demonstrated functional consequences associated with high dietary tryptophan levels in TC mice. An early observation of increased CD25 expression on Treg cells from TC mice consuming low dietary tryptophan(32) led us to hypothesize that dietary tryptophan levels may compromise Treg cell functionality,

100

which is important for preventing and controlling inflammation. Indeed, we found that

Treg cells purified from TC mice fed high dietary tryptophan had impaired functional capacity compared to Treg cells from TC mice fed low dietary tryptophan.

Previously, kynurenine was shown to activate mTORC1 in healthy donor PBLs and the Jurkat T cell line(74). mTORC1 activity is increased in CD4+ T cells from SLE patients(154) and lupus mouse models(125; 149). Further, mTOR blockade by rapamycin reduces disease activity and normalizes hyperactive CD4+ T cells in SLE patients(109). mTORC1 plays a major role in cellular metabolism following T cell activation by promoting transcription of genes involved in glycolysis and mitochondrial respiration. Lupus T cells exhibit higher rates of glycolysis and oxidative phosphorylation(125; 149), which directly contribute to the pathogenicity of these cells as illustrated by dual blockade of these metabolic pathways using the inhibitors 2- deoxy-D-glucose (2DG) and metformin resulting in disease reversal in the TC model(125). Considering the importance of the mTOR pathway in lupus, we sought to understand if high dietary tryptophan may exacerbate disease through mTOR activation in CD4+ T cells. Here we show that mTOR activation, more specifically that phosphorylated 4E-BP1, is increased in splenic effector T cells from TC mice fed high dietary tryptophan compared to effector T cells from TC mice consuming low dietary tryptophan. However, whether the exact metabolite responsible for mTOR activation in

T cells is of endogenous or microbial origin is unknown. It is also possible that activation of this pathway is a secondary effect of tryptophan catabolism. However, in vitro studies suggest that tryptophan and kynurenine may directly alter T cell phenotypes.

Exogenous tryptophan and kynurenine both promoted Th1 polarization in vitro.

101

Importantly, the addition of kynurenine to CD4+ T cells in the absence of polarizing conditions promoted skewing toward a Th1-like phenotype characterized by increased

IFNγ production, which is pathogenic in the setting of lupus. However, the extent to which these individual metabolites affect T cell skewing in vivo is unknown. Therefore, more studies should be performed on mouse and human CD4+ T cells to identify specific metabolites that are responsible for these observed effects.

We have clearly linked gut microbial dysbiosis to altered tryptophan metabolism in the lupus-prone TC mouse, as demonstrated by tryptophan metabolite differences between GF and conventionally raised TC mice. The TC microbiota has a greater capacity for tryptophan catabolism, reflected by dramatically depleted fecal tryptophan levels and increased microbial metabolites in SPF TC mice compared to SPF B6 controls and GF TC mice. Although we found increased relative abundances of

Prevotella and Lactobacillus in TC mice, we have not yet identified the bacterial species responsible for the differential processing of dietary tryptophan nor have we identified specific microbial tryptophan metabolites that may contribute to autoimmune activation in TC mice.

It is not certain whether altered tryptophan metabolism and gut microbial dysbiosis are also linked in patients with SLE. Further, it is not clear whether altering dietary tryptophan would be beneficial in SLE patients. More studies in larger patient cohorts and across mouse models are necessary to define more precisely the changes in bacterial communities that are associated with disease, and how these changes occur relative to disease development. Only a small number of bacterial species have been identified to be responsible for specific autoimmune phenotypes(75; 82; 84). Some

102

of these intestinal bacteria promote autoimmune disease by expressing genes with a high homology to genes in the mammalian host(75; 82), further bolstering that molecular mimicry is a major mechanism of autoimmune activation. A major gap in the field has been lack of a mechanistic understanding of the bidirectional relationships between the development of dysbiosis and autoimmune pathogenesis. Although investigations have and are continuing to reveal mechanisms by which gut resident microbes may contribute to autoimmune activation, special attention should be given to the ability of an altered microbiota to modify metabolites, such as those within the tryptophan pathway, since many have immune regulatory capabilities. There is clearly a relationship of altered tryptophan metabolism to autoimmunity, and here we show evidence for some of the mechanisms by which this may occur. A more comprehensive evaluation of tryptophan metabolism is needed in larger lupus patient cohorts and in additional murine models of the disease to better understand how the vast number of metabolites generated from this essential amino acid are skewed relative to healthy controls. Previous studies have largely focused on the kynurenine/tryptophan ratio, and while this may provide information on kynurenine pathway skewing, it is not representative of other catabolic pathways that our data suggests may be relevant to immune activation. Additionally, future studies should investigate the effects of tryptophan metabolites on human T cells, including those from SLE patients.

In summary, our investigation here demonstrates that modifying tryptophan metabolism alters autoimmune pathogenesis in TC mice and that the long-reported skewing of tryptophan metabolites in the lupus setting is a result of microbial dysbiosis

(Figure 5-1). Further, we demonstrate consequences of enhanced tryptophan

103

catabolism on immune cell phenotypes in TC mice (Figure 5-1), which to our knowledge, has never been investigated. Increased dietary tryptophan consumption impairs Treg cell function and enhances mTOR activation in effector T cells, the latter of which may increase the pathogenicity of these cells and potentially worsen disease.

Although we have not yet identified the individual metabolites responsible for these phenotypes, our data strongly suggests a microbial origin. The failure of 1-MT treatment to improve disease phenotypes demonstrates that endogenous tryptophan metabolism toward the KP does not play a major role in autoimmune activation. Microbial tryptophan metabolites may therefore be more relevant to disease phenotypes in TC mice.

Interestingly, a recent study has reported that restriction of dietary tryptophan impairs encephalitogenic T cell responses in a mouse model of multiple sclerosis, most likely through an altered gut microbiota(113). Thus, tryptophan availability may regulate autoreactive pathogenic CD4+ T cells in a variety of autoimmune settings.

104

Figure 5-1 Working model depicting the mechanism of skewed tryptophan metabolism and related contributions to immune phenotypes in murine lupus. Tryptophan metabolism skewing toward the kynurenine pathway in the TC mouse is a result of microbial dysbiosis and endogenous tryptophan catabolism. The exact cell type(s) and mechanism responsible for accumulated kynurenine is unknown. Dietary tryptophan processed through the TC microbiota impairs Treg function and increases mTOR activation in effector memory T cells, both of which likely contribute to exacerbated disease phenotypes in TC mice. In vitro application of tryptophan or kynurenine promotes skewing toward a Th1- like phenotype characterized by elevated IFNγ production, another relevant phenotype that is observed in SLE patients.

105

LIST OF REFERENCES

1. Kaul A, Gordon C, Crow MK, Touma Z, Urowitz MB, van Vollenhoven R, Ruiz- Irastorza G, Hughes G: Systemic lupus erythematosus. Nat Rev Dis Primers 2016;2:16039

2. Tsokos GC: Systemic lupus erythematosus. N Engl J Med 2011;365:2110-2121

3. Tsokos GC: Autoimmunity and organ damage in systemic lupus erythematosus. Nat Immunol 2020;21:605-614

4. Baechler EC, Batliwalla FM, Karypis G, Gaffney PM, Ortmann WA, Espe KJ, Shark KB, Grande WJ, Hughes KM, Kapur V, Gregersen PK, Behrens TW: Interferon- inducible gene expression signature in peripheral blood cells of patients with severe lupus. Proc Natl Acad Sci U S A 2003;100:2610-2615

5. Bennett L, Palucka AK, Arce E, Cantrell V, Borvak J, Banchereau J, Pascual V: Interferon and granulopoiesis signatures in systemic lupus erythematosus blood. J Exp Med 2003;197:711-723

6. Gergianaki I, Bortoluzzi A, Bertsias G: Update on the epidemiology, risk factors, and disease outcomes of systemic lupus erythematosus. Best Pract Res Clin Rheumatol 2018;32:188-205

7. Fava A, Petri M: Systemic lupus erythematosus: Diagnosis and clinical management. J Autoimmun 2019;96:1-13

8. Rees F, Doherty M, Grainge M, Lanyon P, Davenport G, Zhang W: Burden of Comorbidity in Systemic Lupus Erythematosus in the UK, 1999-2012. Arthritis Care Res (Hoboken) 2016;68:819-827

9. Ulff-Møller CJ, Svendsen AJ, Viemose LN, Jacobsen S: Concordance of autoimmune disease in a nationwide Danish systemic lupus erythematosus twin cohort. Semin Arthritis Rheum 2018;47:538-544

10. Bentham J, Morris DL, Graham DSC, Pinder CL, Tombleson P, Behrens TW, Martín J, Fairfax BP, Knight JC, Chen L, Replogle J, Syvänen AC, Rönnblom L, Graham RR, Wither JE, Rioux JD, Alarcón-Riquelme ME, Vyse TJ: Genetic association analyses implicate aberrant regulation of innate and adaptive immunity genes in the pathogenesis of systemic lupus erythematosus. Nat Genet 2015;47:1457-1464

11. Vaughn SE, Kottyan LC, Munroe ME, Harley JB: Genetic susceptibility to lupus: the biological basis of genetic risk found in B cell signaling pathways. J Leukoc Biol 2012;92:577-591

12. Harley IT, Kaufman KM, Langefeld CD, Harley JB, Kelly JA: Genetic susceptibility to SLE: new insights from fine mapping and genome-wide association studies. Nat Rev Genet 2009;10:285-290

106

13. Li X, Ptacek TS, Brown EE, Edberg JC: Fcgamma receptors: structure, function and role as genetic risk factors in SLE. Genes Immun 2009;10:380-389

14. Hom G, Graham RR, Modrek B, Taylor KE, Ortmann W, Garnier S, Lee AT, Chung SA, Ferreira RC, Pant PV, Ballinger DG, Kosoy R, Demirci FY, Kamboh MI, Kao AH, Tian C, Gunnarsson I, Bengtsson AA, Rantapää-Dahlqvist S, Petri M, Manzi S, Seldin MF, Rönnblom L, Syvänen AC, Criswell LA, Gregersen PK, Behrens TW: Association of systemic lupus erythematosus with C8orf13-BLK and ITGAM-ITGAX. N Engl J Med 2008;358:900-909

15. Manderson AP, Botto M, Walport MJ: The role of complement in the development of systemic lupus erythematosus. Annu Rev Immunol 2004;22:431-456

16. Gulati G, Brunner HI: Environmental triggers in systemic lupus erythematosus. Semin Arthritis Rheum 2018;47:710-717

17. He Z, Shao T, Li H, Xie Z, Wen C: Alterations of the gut microbiome in Chinese patients with systemic lupus erythematosus. Gut Pathog 2016;8:64

18. Hevia A, Milani C, López P, Cuervo A, Arboleya S, Duranti S, Turroni F, González S, Suárez A, Gueimonde M, Ventura M, Sánchez B, Margolles A: Intestinal dysbiosis associated with systemic lupus erythematosus. MBio 2014;5:e01548-01514

19. Luo XM, Edwards MR, Mu Q, Yu Y, Vieson MD, Reilly CM, Ahmed SA, Bankole AA: Gut Microbiota in Human Systemic Lupus Erythematosus and a Mouse Model of Lupus. Appl Environ Microbiol 2018;84

20. Zhang X, Zhang D, Jia H, Feng Q, Wang D, Liang D, Wu X, Li J, Tang L, Li Y, Lan Z, Chen B, Zhong H, Xie H, Jie Z, Chen W, Tang S, Xu X, Wang X, Cai X, Liu S, Xia Y, Qiao X, Al-Aama JY, Chen H, Wang L, Wu QJ, Zhang F, Zheng W, Zhang M, Luo G, Xue W, Xiao L, Yin Y, Yang H, Wang J, Kristiansen K, Liu L, Li T, Huang Q: The oral and gut microbiomes are perturbed in rheumatoid arthritis and partly normalized after treatment. Nat Med 2015;21:895-905

21. Chen J, Wright K, Davis JM, Jeraldo P, Marietta EV, Murray J, Nelson H, Matteson EL, Taneja V: An expansion of rare lineage intestinal microbes characterizes rheumatoid arthritis. Genome Med 2016;8:43

22. Sun Y, Chen Q, Lin P, Xu R, He D, Ji W, Bian Y, Shen Y, Li Q, Liu C, Dong K, Tang YW, Pei Z, Yang L, Lu H, Guo X, Xiao L: Characteristics of Gut Microbiota in Patients With Rheumatoid Arthritis in Shanghai, China. Front Cell Infect Microbiol 2019;9:369

23. Scher JU, Sczesnak A, Longman RS, Segata N, Ubeda C, Bielski C, Rostron T, Cerundolo V, Pamer EG, Abramson SB, Huttenhower C, Littman DR: Expansion of intestinal Prevotella copri correlates with enhanced susceptibility to arthritis. Elife 2013;2:e01202

107

24. Alpizar-Rodriguez D, Lesker TR, Gronow A, Gilbert B, Raemy E, Lamacchia C, Gabay C, Finckh A, Strowig T: in individuals at risk for rheumatoid arthritis. Ann Rheum Dis 2019;78:590-593

25. Maeda Y, Kurakawa T, Umemoto E, Motooka D, Ito Y, Gotoh K, Hirota K, Matsushita M, Furuta Y, Narazaki M, Sakaguchi N, Kayama H, Nakamura S, Iida T, Saeki Y, Kumanogoh A, Sakaguchi S, Takeda K: Dysbiosis Contributes to Arthritis Development via Activation of Autoreactive T Cells in the Intestine. Arthritis Rheumatol 2016;68:2646-2661

26. Miyake S, Kim S, Suda W, Oshima K, Nakamura M, Matsuoka T, Chihara N, Tomita A, Sato W, Kim SW, Morita H, Hattori M, Yamamura T: Dysbiosis in the Gut Microbiota of Patients with Multiple Sclerosis, with a Striking Depletion of Species Belonging to Clostridia XIVa and IV Clusters. PLoS One 2015;10:e0137429

27. Jangi S, Gandhi R, Cox LM, Li N, von Glehn F, Yan R, Patel B, Mazzola MA, Liu S, Glanz BL, Cook S, Tankou S, Stuart F, Melo K, Nejad P, Smith K, Topçuolu BD, Holden J, Kivisäkk P, Chitnis T, De Jager PL, Quintana FJ, Gerber GK, Bry L, Weiner HL: Alterations of the human gut microbiome in multiple sclerosis. Nat Commun 2016;7:12015

28. Chen J, Chia N, Kalari KR, Yao JZ, Novotna M, Paz Soldan MM, Luckey DH, Marietta EV, Jeraldo PR, Chen X, Weinshenker BG, Rodriguez M, Kantarci OH, Nelson H, Murray JA, Mangalam AK: Multiple sclerosis patients have a distinct gut microbiota compared to healthy controls. Sci Rep 2016;6:28484

29. Zhang H, Liao X, Sparks JB, Luo XM: Dynamics of gut microbiota in autoimmune lupus. Appl Environ Microbiol 2014;80:7551-7560

30. Ma Y, Xu X, Li M, Cai J, Wei Q, Niu H: Gut microbiota promote the inflammatory response in the pathogenesis of systemic lupus erythematosus. Mol Med 2019;25:35

31. Zegarra-Ruiz DF, El Beidaq A, Iñiguez AJ, Lubrano Di Ricco M, Manfredo Vieira S, Ruff WE, Mubiru D, Fine RL, Sterpka J, Greiling TM, Dehner C, Kriegel MA: A Diet- Sensitive Commensal Lactobacillus Strain Mediates TLR7-Dependent Systemic Autoimmunity. Cell Host Microbe 2019;25:113-127.e116

32. Choi S, Brown J, Gong M, Ge Y, Zadeh M, Li W, Croker B, Michailidis G, Garrett T, Mohamadzadeh M, Morel L: Gut microbiota dysbiosis and altered tryptophan catabolism contribute to autoimmunity in lupus-susceptible mice. Sci Transl Med 12 , eaax2220 2020;

33. Wu HJ, Ivanov II, Darce J, Hattori K, Shima T, Umesaki Y, Littman DR, Benoist C, Mathis D: Gut-residing segmented filamentous bacteria drive autoimmune arthritis via T helper 17 cells. Immunity 2010;32:815-827

108

34. Sang A, Niu H, Cullen J, Choi SC, Zheng YY, Wang H, Shlomchik MJ, Morel L: Activation of rheumatoid factor-specific B cells is antigen dependent and occurs preferentially outside of germinal centers in the lupus-prone NZM2410 mouse model. J Immunol 2014;193:1609-1621

35. Morel L, Mohan C, Yu Y, Croker BP, Tian N, Deng A, Wakeland EK: Functional dissection of systemic lupus erythematosus using congenic mouse strains. J Immunol 1997;158:6019-6028

36. Morel L, Croker BP, Blenman KR, Mohan C, Huang G, Gilkeson G, Wakeland EK: Genetic reconstitution of systemic lupus erythematosus immunopathology with polycongenic murine strains. Proc Natl Acad Sci U S A 2000;97:6670-6675

37. Metz R, Duhadaway JB, Kamasani U, Laury-Kleintop L, Muller AJ, Prendergast GC: Novel tryptophan catabolic enzyme IDO2 is the preferred biochemical target of the antitumor indoleamine 2,3-dioxygenase inhibitory compound D-1-methyl-tryptophan. Cancer Res 2007;67:7082-7087

38. Cervenka I, Agudelo LZ, Ruas JL: Kynurenines: Tryptophan's metabolites in exercise, inflammation, and mental health. Science 2017;357

39. Huang YS, Ogbechi J, Clanchy FI, Williams RO, Stone TW: IDO and Kynurenine Metabolites in Peripheral and CNS Disorders. Front Immunol 2020;11:388

40. Lovelace MD, Varney B, Sundaram G, Franco NF, Ng ML, Pai S, Lim CK, Guillemin GJ, Brew BJ: Current Evidence for a Role of the Kynurenine Pathway of Tryptophan Metabolism in Multiple Sclerosis. Front Immunol 2016;7:246

41. Minhas PS, Liu L, Moon PK, Joshi AU, Dove C, Mhatre S, Contrepois K, Wang Q, Lee BA, Coronado M, Bernstein D, Snyder MP, Migaud M, Majeti R, Mochly-Rosen D, Rabinowitz JD, Andreasson KI: Macrophage de novo NAD. Nat Immunol 2019;20:50-63

42. Gao J, Xu K, Liu H, Liu G, Bai M, Peng C, Li T, Yin Y: Impact of the Gut Microbiota on Intestinal Immunity Mediated by Tryptophan Metabolism. Front Cell Infect Microbiol 2018;8:13

43. Agus A, Planchais J, Sokol H: Gut Microbiota Regulation of Tryptophan Metabolism in Health and Disease. Cell Host Microbe 2018;23:716-724

44. Roager HM, Licht TR: Microbial tryptophan catabolites in health and disease. Nat Commun 2018;9:3294

45. Williams BB, Van Benschoten AH, Cimermancic P, Donia MS, Zimmermann M, Taketani M, Ishihara A, Kashyap PC, Fraser JS, Fischbach MA: Discovery and characterization of gut microbiota decarboxylases that can produce the neurotransmitter tryptamine. Cell Host Microbe 2014;16:495-503

109

46. Bhattarai Y, Williams BB, Battaglioli EJ, Whitaker WR, Till L, Grover M, Linden DR, Akiba Y, Kandimalla KK, Zachos NC, Kaunitz JD, Sonnenburg JL, Fischbach MA, Farrugia G, Kashyap PC: Gut Microbiota-Produced Tryptamine Activates an Epithelial G-Protein-Coupled Receptor to Increase Colonic Secretion. Cell Host Microbe 2018;23:775-785.e775

47. Zelante T, Iannitti RG, Cunha C, De Luca A, Giovannini G, Pieraccini G, Zecchi R, D'Angelo C, Massi-Benedetti C, Fallarino F, Carvalho A, Puccetti P, Romani L: Tryptophan catabolites from microbiota engage aryl hydrocarbon receptor and balance mucosal reactivity via interleukin-22. Immunity 2013;39:372-385

48. Cheng Y, Jin UH, Allred CD, Jayaraman A, Chapkin RS, Safe S: Aryl Hydrocarbon Receptor Activity of Tryptophan Metabolites in Young Adult Mouse Colonocytes. Drug Metab Dispos 2015;43:1536-1543

49. Bansal T, Alaniz RC, Wood TK, Jayaraman A: The bacterial signal indole increases epithelial-cell tight-junction resistance and attenuates indicators of inflammation. Proc Natl Acad Sci U S A 2010;107:228-233

50. Fatkhullina AR, Peshkova IO, Dzutsev A, Aghayev T, McCulloch JA, Thovarai V, Badger JH, Vats R, Sundd P, Tang HY, Kossenkov AV, Hazen SL, Trinchieri G, Grivennikov SI, Koltsova EK: An Interleukin-23-Interleukin-22 Axis Regulates Intestinal Microbial Homeostasis to Protect from Diet-Induced Atherosclerosis. Immunity 2018;49:943-957.e949

51. Venkatesh M, Mukherjee S, Wang H, Li H, Sun K, Benechet AP, Qiu Z, Maher L, Redinbo MR, Phillips RS, Fleet JC, Kortagere S, Mukherjee P, Fasano A, Le Ven J, Nicholson JK, Dumas ME, Khanna KM, Mani S: Symbiotic bacterial metabolites regulate gastrointestinal barrier function via the xenobiotic sensor PXR and Toll-like receptor 4. Immunity 2014;41:296-310

52. Kurnasov O, Jablonski L, Polanuyer B, Dorrestein P, Begley T, Osterman A: Aerobic tryptophan degradation pathway in bacteria: novel kynurenine formamidase. FEMS Microbiol Lett 2003;227:219-227

53. Colabroy KL, Begley TP: Tryptophan catabolism: identification and characterization of a new degradative pathway. J Bacteriol 2005;187:7866-7869

54. Bortolotti P, Hennart B, Thieffry C, Jausions G, Faure E, Grandjean T, Thepaut M, Dessein R, Allorge D, Guery BP, Faure K, Kipnis E, Toussaint B, Le Gouellec A: Tryptophan catabolism in Pseudomonas aeruginosa and potential for inter-kingdom relationship. BMC Microbiol 2016;16:137

55. Vujkovic-Cvijin I, Dunham RM, Iwai S, Maher MC, Albright RG, Broadhurst MJ, Hernandez RD, Lederman MM, Huang Y, Somsouk M, Deeks SG, Hunt PW, Lynch SV, McCune JM: Dysbiosis of the gut microbiota is associated with HIV disease progression and tryptophan catabolism. Sci Transl Med 2013;5:193ra191

110

56. Mir R, Jallu S, Singh TP: The shikimate pathway: review of amino acid sequence, function and three-dimensional structures of the enzymes. Crit Rev Microbiol 2015;41:172-189

57. Hissong BD, Byrne GI, Padilla ML, Carlin JM: Upregulation of interferon-induced indoleamine 2,3-dioxygenase in human macrophage cultures by lipopolysaccharide, muramyl tripeptide, and interleukin-1. Cell Immunol 1995;160:264-269

58. Chalise JP, Pallotta MT, Narendra SC, Carlsson B, Iacono A, Namale J, Boon L, Grohmann U, Magnusson M: IDO1 and TGF-β Mediate Protective Effects of IFN-α in Antigen-Induced Arthritis. J Immunol 2016;197:3142-3151

59. Mezrich JD, Fechner JH, Zhang X, Johnson BP, Burlingham WJ, Bradfield CA: An interaction between kynurenine and the aryl hydrocarbon receptor can generate regulatory T cells. J Immunol 2010;185:3190-3198

60. Chen W, Liang X, Peterson AJ, Munn DH, Blazar BR: The indoleamine 2,3- dioxygenase pathway is essential for human plasmacytoid dendritic cell-induced adaptive T regulatory cell generation. J Immunol 2008;181:5396-5404

61. Shinde R, McGaha TL: The Aryl Hydrocarbon Receptor: Connecting Immunity to the Microenvironment. Trends Immunol 2018;39:1005-1020

62. Quintana FJ, Basso AS, Iglesias AH, Korn T, Farez MF, Bettelli E, Caccamo M, Oukka M, Weiner HL: Control of T(reg) and T(H)17 cell differentiation by the aryl hydrocarbon receptor. Nature 2008;453:65-71

63. Munn DH, Sharma MD, Baban B, Harding HP, Zhang Y, Ron D, Mellor AL: GCN2 kinase in T cells mediates proliferative arrest and anergy induction in response to indoleamine 2,3-dioxygenase. Immunity 2005;22:633-642

64. Labadarios D, McKenzie DY, Dickerson JW, Parke DV: Metabolic abnormalities of tryptophan and nicotinic acid in patients with rheumatoid arthritis. Rheumatol Rehabil 1978;17:227-232

65. Schroecksnadel K, Kaser S, Ledochowski M, Neurauter G, Mur E, Herold M, Fuchs D: Increased degradation of tryptophan in blood of patients with rheumatoid arthritis. J Rheumatol 2003;30:1935-1939

66. Schroecksnadel K, Winkler C, Duftner C, Wirleitner B, Schirmer M, Fuchs D: Tryptophan degradation increases with stage in patients with rheumatoid arthritis. Clin Rheumatol 2006;25:334-337

67. Igari T, Tsuchizawa M, Shimamura T: Alteration of tryptophan metabolism in the synovial fluid of patients with rheumatoid arthritis and osteoarthritis. Tohoku J Exp Med 1987;153:79-86

111

68. Lim CK, Bilgin A, Lovejoy DB, Tan V, Bustamante S, Taylor BV, Bessede A, Brew BJ, Guillemin GJ: Kynurenine pathway metabolomics predicts and provides mechanistic insight into multiple sclerosis progression. Sci Rep 2017;7:41473

69. Åkesson K, Pettersson S, Ståhl S, Surowiec I, Hedenström M, Eketjäll S, Trygg J, Jakobsson PJ, Gunnarsson I, Svenungsson E, Idborg H: Kynurenine pathway is altered in patients with SLE and associated with severe fatigue. Lupus Sci Med 2018;5:e000254

70. Pertovaara M, Hasan T, Raitala A, Oja SS, Yli-Kerttula U, Korpela M, Hurme M: Indoleamine 2,3-dioxygenase activity is increased in patients with systemic lupus erythematosus and predicts disease activation in the sunny season. Clin Exp Immunol 2007;150:274-278

71. Widner B, Sepp N, Kowald E, Kind S, Schmuth M, Fuchs D: Degradation of tryptophan in patients with systemic lupus erythematosus. Adv Exp Med Biol 1999;467:571-577

72. Widner B, Sepp N, Kowald E, Ortner U, Wirleitner B, Fritsch P, Baier-Bitterlich G, Fuchs D: Enhanced tryptophan degradation in systemic lupus erythematosus. Immunobiology 2000;201:621-630

73. Mandel EH, Appleton HD: Tryptophan metabolism. Results of studies in discoid lupus erythematosus. Arch Dermatol 1966;94:358-360

74. Perl A, Hanczko R, Lai ZW, Oaks Z, Kelly R, Borsuk R, Asara JM, Phillips PE: Comprehensive metabolome analyses reveal. Metabolomics 2015;11:1157-1174

75. Azzouz D, Omarbekova A, Heguy A, Schwudke D, Gisch N, Rovin BH, Caricchio R, Buyon JP, Alekseyenko AV, Silverman GJ: Lupus nephritis is linked to disease-activity associated expansions and immunity to a gut commensal. Ann Rheum Dis 2019;78:947-956

76. Macanovic M, Sinicropi D, Shak S, Baughman S, Thiru S, Lachmann PJ: The treatment of systemic lupus erythematosus (SLE) in NZB/W F1 hybrid mice; studies with recombinant murine DNase and with dexamethasone. Clin Exp Immunol 1996;106:243-252

77. Hu WS, Rajendran P, Tzang BS, Yeh YL, Shen CY, Chen RJ, Ho TJ, Vijaya Padma V, Chen YH, Huang CY: Lactobacillus paracasei GMNL-32 exerts a therapeutic effect on cardiac abnormalities in NZB/W F1 mice. PLoS One 2017;12:e0185098

78. Toral M, Robles-Vera I, Romero M, de la Visitación N, Sánchez M, O'Valle F, Rodriguez-Nogales A, Gálvez J, Duarte J, Jiménez R: CECT5716: a novel alternative for the prevention of vascular disorders in a mouse model of systemic lupus erythematosus. FASEB J 2019;33:10005-10018

112

79. Zegarra-Ruiz DF, El Beidaq A, Iniguez AJ, Lubrano Di Ricco M, Manfredo Vieira S, Ruff WE, Mubiru D, Fine RL, Sterpka J, Greiling TM, Dehner C, Kriegel MA: A diet- sensitive commensal lactobacillus strain mediates TLR7-dependent systemic autoimmunity. Cell Host Microbe 2019;25:113-127 e116

80. Maldonado MA, Kakkanaiah V, MacDonald GC, Chen F, Reap EA, Balish E, Farkas WR, Jennette JC, Madaio MP, Kotzin BL, Cohen PL, Eisenberg RA: The role of environmental antigens in the spontaneous development of autoimmunity in MRL-lpr mice. J Immunol 1999;162:6322-6330

81. Mu Q, Tavella VJ, Kirby JL, Cecere TE, Chung M, Lee J, Li S, Ahmed SA, Eden K, Allen IC, Reilly CM, Luo XM: Antibiotics ameliorate lupus-like symptoms in mice. Scientific reports 2017;7:13675

82. Greiling TM, Dehner C, Chen X, Hughes K, Iñiguez AJ, Boccitto M, Ruiz DZ, Renfroe SC, Vieira SM, Ruff WE, Sim S, Kriegel C, Glanternik J, Girardi M, Degnan P, Costenbader KH, Goodman AL, Wolin SL, Kriegel MA: Commensal orthologs of the human autoantigen Ro60 as triggers of autoimmunity in lupus. Sci Transl Med 2018;10

83. Pianta A, Arvikar SL, Strle K, Drouin EE, Wang Q, Costello CE, Steere AC: Two rheumatoid arthritis-specific autoantigens correlate microbial immunity with autoimmune responses in joints. J Clin Invest 2017;127:2946-2956

84. Manfredo Vieira S, Hiltensperger M, Kumar V, Zegarra-Ruiz D, Dehner C, Khan N, Costa FRC, Tiniakou E, Greiling T, Ruff W, Barbieri A, Kriegel C, Mehta SS, Knight JR, Jain D, Goodman AL, Kriegel MA: Translocation of a gut pathobiont drives autoimmunity in mice and humans. Science 2018;359:1156-1161

85. Rojas M, Restrepo-Jiménez P, Monsalve DM, Pacheco Y, Acosta-Ampudia Y, Ramírez-Santana C, Leung PSC, Ansari AA, Gershwin ME, Anaya JM: Molecular mimicry and autoimmunity. J Autoimmun 2018;95:100-123

86. Carapetis JR, Beaton A, Cunningham MW, Guilherme L, Karthikeyan G, Mayosi BM, Sable C, Steer A, Wilson N, Wyber R, Zühlke L: Acute rheumatic fever and rheumatic heart disease. Nat Rev Dis Primers 2016;2:15084

87. Martens EC, Neumann M, Desai MS: Interactions of commensal and pathogenic microorganisms with the intestinal mucosal barrier. Nat Rev Microbiol 2018;16:457-470

88. Levy M, Thaiss CA, Elinav E: Metabolites: messengers between the microbiota and the immune system. Genes Dev 2016;30:1589-1597

89. Lin L, Zhang J: Role of intestinal microbiota and metabolites on gut homeostasis and human diseases. BMC Immunol 2017;18:2

90. Perrigoue J, Das A, Mora JR: Interplay of nutrients and microbial metabolites in intestinal immune homeostasis: distinct and common mechanisms of immune regulation in the small bowel and colon. Nestle Nutr Inst Workshop Ser 2014;79:57-71

113

91. Alexeev EE, Lanis JM, Kao DJ, Campbell EL, Kelly CJ, Battista KD, Gerich ME, Jenkins BR, Walk ST, Kominsky DJ, Colgan SP: Microbiota-Derived Indole Metabolites Promote Human and Murine Intestinal Homeostasis through Regulation of Interleukin- 10 Receptor. Am J Pathol 2018;188:1183-1194

92. Opazo MC, Ortega-Rocha EM, Coronado-Arrázola I, Bonifaz LC, Boudin H, Neunlist M, Bueno SM, Kalergis AM, Riedel CA: Intestinal Microbiota Influences Non-intestinal Related Autoimmune Diseases. Front Microbiol 2018;9:432

93. Ostrov BE, Amsterdam D: Immunomodulatory interplay of the microbiome and therapy of rheumatic diseases. Immunol Invest 2017;46:769-792

94. Xiao S, Jiang S, Qian D, Duan J: Modulation of microbially derived short-chain fatty acids on intestinal homeostasis, metabolism, and neuropsychiatric disorder. Appl Microbiol Biotechnol 2020;104:589-601

95. Jia W, Xie G: Bile acid-microbiota crosstalk in gastrointestinal inflammation and carcinogenesis. Nat Rev Gastroenterol Hepatol 2018;15:111-128

96. Gaetani L, Boscaro F, Pieraccini G, Calabresi P, Romani L, Di Filippo M, Zelante T: Host and Microbial Tryptophan Metabolic Profiling in Multiple Sclerosis. Front Immunol 2020;11:157

97. Aeinehband S, Brenner P, Ståhl S, Bhat M, Fidock MD, Khademi M, Olsson T, Engberg G, Jokinen J, Erhardt S, Piehl F: Cerebrospinal fluid kynurenines in multiple sclerosis; relation to disease course and neurocognitive symptoms. Brain Behav Immun 2016;51:47-55

98. Sontheimer RD, McCauliffe DP, Zappi E, Targoff I: Antinuclear antibodies: clinical correlations and biologic significance. Adv Dermatol 1992;7:3-52; discussion 53

99. Martey CA, Baglole CJ, Gasiewicz TA, Sime PJ, Phipps RP: The aryl hydrocarbon receptor is a regulator of cigarette smoke induction of the cyclooxygenase and prostaglandin pathways in human lung fibroblasts. Am J Physiol Lung Cell Mol Physiol 2005;289:L391-399

100. Forrest CM, Kennedy A, Stone TW, Stoy N, Darlington LG: Kynurenine and neopterin levels in patients with rheumatoid arthritis and osteoporosis during drug treatment. Adv Exp Med Biol 2003;527:287-295

101. Lood C, Tydén H, Gullstrand B, Klint C, Wenglén C, Nielsen CT, Heegaard NH, Jönsen A, Kahn R, Bengtsson AA: Type I interferon-mediated skewing of the serotonin synthesis is associated with severe disease in systemic lupus erythematosus. PLoS One 2015;10:e0125109

114

102. Enyedy EJ, Nambiar MP, Liossis SN, Dennis G, Kammer GM, Tsokos GC: Fc epsilon receptor type I gamma chain replaces the deficient T cell receptor zeta chain in T cells of patients with systemic lupus erythematosus. Arthritis Rheum 2001;44:1114- 1121

103. Liossis SN, Ding XZ, Dennis GJ, Tsokos GC: Altered pattern of TCR/CD3- mediated protein-tyrosyl phosphorylation in T cells from patients with systemic lupus erythematosus. Deficient expression of the T cell receptor zeta chain. J Clin Invest 1998;101:1448-1457

104. Pearce EL, Poffenberger MC, Chang CH, Jones RG: Fueling immunity: insights into metabolism and lymphocyte function. Science 2013;342:1242454

105. Pearce EL: Metabolism in T cell activation and differentiation. Curr Opin Immunol 2010;22:314-320

106. Buck MD, O'Sullivan D, Pearce EL: T cell metabolism drives immunity. J Exp Med 2015;212:1345-1360

107. Gergely P, Grossman C, Niland B, Puskas F, Neupane H, Allam F, Banki K, Phillips PE, Perl A: Mitochondrial hyperpolarization and ATP depletion in patients with systemic lupus erythematosus. Arthritis Rheum 2002;46:175-190

108. Perl A: Activation of mTOR (mechanistic target of rapamycin) in rheumatic diseases. Nat Rev Rheumatol 2016;12:169-182

109. Fernandez D, Bonilla E, Mirza N, Niland B, Perl A: Rapamycin reduces disease activity and normalizes T cell activation-induced calcium fluxing in patients with systemic lupus erythematosus. Arthritis Rheum 2006;54:2983-2988

110. Waickman AT, Powell JD: mTOR, metabolism, and the regulation of T-cell differentiation and function. Immunol Rev 2012;249:43-58

111. Rothhammer V, Mascanfroni ID, Bunse L, Takenaka MC, Kenison JE, Mayo L, Chao CC, Patel B, Yan R, Blain M, Alvarez JI, Kébir H, Anandasabapathy N, Izquierdo G, Jung S, Obholzer N, Pochet N, Clish CB, Prinz M, Prat A, Antel J, Quintana FJ: Type I interferons and microbial metabolites of tryptophan modulate astrocyte activity and central nervous system inflammation via the aryl hydrocarbon receptor. Nat Med 2016;22:586-597

112. Rothhammer V, Borucki DM, Tjon EC, Takenaka MC, Chao CC, Ardura-Fabregat A, de Lima KA, Gutiérrez-Vázquez C, Hewson P, Staszewski O, Blain M, Healy L, Neziraj T, Borio M, Wheeler M, Dragin LL, Laplaud DA, Antel J, Alvarez JI, Prinz M, Quintana FJ: Microglial control of astrocytes in response to microbial metabolites. Nature 2018;557:724-728

115

113. Sonner JK, Keil M, Falk-Paulsen M, Mishra N, Rehman A, Kramer M, Deumelandt K, Röwe J, Sanghvi K, Wolf L, von Landenberg A, Wolff H, Bharti R, Oezen I, Lanz TV, Wanke F, Tang Y, Brandao I, Mohapatra SR, Epping L, Grill A, Röth R, Niesler B, Meuth SG, Opitz CA, Okun JG, Reinhardt C, Kurschus FC, Wick W, Bode HB, Rosenstiel P, Platten M: Dietary tryptophan links encephalogenicity of autoreactive T cells with gut microbial ecology. Nat Commun 2019;10:4877

114. Laplante M, Sabatini DM: mTOR signaling at a glance. J Cell Sci 2009;122:3589- 3594

115. Condon KJ, Sabatini DM: Nutrient regulation of mTORC1 at a glance. J Cell Sci 2019;132

116. Sharabi A, Tsokos GC: T cell metabolism: new insights in systemic lupus erythematosus pathogenesis and therapy. Nat Rev Rheumatol 2020;16:100-112

117. Greiling TM, Dehner C, Chen X, Hughes K, Iniguez AJ, Boccitto M, Ruiz DZ, Renfroe SC, Vieira SM, Ruff WE, Sim S, Kriegel C, Glanternik J, Chen X, Girardi M, Degnan P, Costenbader KH, Goodman AL, Wolin SL, Kriegel MA: Commensal orthologs of the human autoantigen Ro60 as triggers of autoimmunity in lupus. Sci Transl Med 2018;10:pii: eaan2306

118. Morel L, Croker BP, Blenman KR, Mohan C, Huang G, Gilkeson G, Wakeland EK: Genetic reconstitution of systemic lupus erythematosus immunopathology with polycongenic murine strains. Proc Natl Acad Sci USA 2000;97:6670-6675

119. Colliou N, Ge Y, Sahay B, Gong M, Zadeh M, Owen JL, Neu J, Farmerie WG, Alonzo F, Liu K, Jones DP, Li S, Mohamadzadeh M: Commensal Propionibacterium strain UF1 mitigates intestinal inflammation via Th17 cell regulation. J Clin Invest 2017;127:3970-3986

120. Ge Y, Gong M, Colliou N, Zadeh M, Li J, Jones DP, Li S, Mohamadzadeh M: Neonatal intestinal immune regulation by the commensal bacterium, P. UF1. Mucosal Immunol 2019;12:434-444

121. Cuda CM, Zeumer L, Sobel ES, Croker BP, Morel L: Murine lupus susceptibility locus Sle1a requires the expression of two sub-loci to induce inflammatory T cells. Genes Immun 2010;11:542-553

122. Mohan C, Alas E, Morel L, Yang P, Wakeland EK: Genetic dissection of SLE pathogenesis. Sle1 on murine chromosome 1 leads to a selective loss of tolerance to H2A/H2B/DNA subnucleosomes. J Clin Invest 1998;101:1362-1372

123. Zhang Q, Yin X, Wang H, Wu X, Li X, Li Y, Zhang X, Fu C, Li H, Qiu Y: Fecal Metabolomics and Potential Biomarkers for Systemic Lupus Erythematosus. Front Immunol 2019;10:976

116

124. Bengtsson AA, Trygg J, Wuttge DM, Sturfelt G, Theander E, Donten M, Moritz T, Sennbro CJ, Torell F, Lood C, Surowiec I, Rännar S, Lundstedt T: Metabolic Profiling of Systemic Lupus Erythematosus and Comparison with Primary Sjögren's Syndrome and Systemic Sclerosis. PLoS One 2016;11:e0159384

125. Yin Y, Choi SC, Xu Z, Perry DJ, Seay H, Croker BP, Sobel ES, Brusko TM, Morel L: Normalization of CD4+ T cell metabolism reverses lupus. Sci Transl Med 2015;7:274ra218

126. Choi SC, Titov AA, Abboud G, Seay HR, Brusko TM, Roopenian DC, Salek- Ardakani S, Morel L: Inhibition of glucose metabolism selectively targets autoreactive follicular helper T cells. Nat Commun 2018;9:4369

127. Vieira SM, Pagovich OE, Kriegel MA: Diet, microbiota and autoimmune diseases. Lupus 2014;23:518-526

128. Jain S, Ward JM, Shin DM, Wang H, Naghashfar Z, Kovalchuk AL, Morse HC, 3rd: Associations of autoimmunity, immunodeficiency, lymphomagenesis, and gut microbiota in mice with knockins for a pathogenic autoantibody. The American journal of pathology 2017;187:2020-2033

129. Luo XM, Edwards MR, Mu Q, Yu Y, Vieson MD, Reilly CM, Ahmed SA, Bankole AA: Gut microbiota in human systemic lupus erythematosus and a mouse model of lupus. Appl Environ Microbiol 2018;84:e02288-02217

130. Mu Q, Zhang H, Liao X, Lin K, Liu H, Edwards MR, Ahmed SA, Yuan R, Li L, Cecere TE, Branson DB, Kirby JL, Goswami P, Leeth CM, Read KA, Oestreich KJ, Vieson MD, Reilly CM, Luo XM: Control of lupus nephritis by changes of gut microbiota. Microbiome 2017;5:73

131. Gaudreau MC, Johnson BM, Gudi R, Al-Gadban MM, Vasu C: Gender bias in lupus: does immune response initiated in the gut mucosa have a role? Clin Exp Immunol 2015;180:393-407

132. Scher JU, Sczesnak A, Longman RS, Segata N, Ubeda C, Bielski C: Expansion of intestinal Prevotella copri correlates with enhanced susceptibility to arthritis. eLife 2013;2

133. Correa JD, Calderaro DC, Ferreira GA, Mendonca SM, Fernandes GR, Xiao E, Teixeira AL, Leys EJ, Graves DT, Silva TA: Subgingival microbiota dysbiosis in systemic lupus erythematosus: association with periodontal status. Microbiome 2017;5:34

134. Ost KS, Round JL: Communication between the microbiota and mammalian immunity. Annu Rev Microbiol 2018;72:399-422

117

135. Rojo D, Hevia A, Bargiela R, Lopez P, Cuervo A, Gonzalez S, Suarez A, Sanchez B, Martinez-Martinez M, Milani C, Ventura M, Barbas C, Moya A, Suarez A, Margolles A, Ferrer M: Ranking the impact of human health disorders on gut metabolism: systemic lupus erythematosus and obesity as study cases. Scientific reports 2015;5:8310

136. Zhang Q, Yin X, Wang H, Wu X, Li X, Li Y, Zhang X, Fu C, Li H, Qiu Y: Fecal Metabolomics and Potential Biomarkers for Systemic Lupus Erythematosus. Frontiers in immunology 2019;10:976

137. Yan R, Jiang H, Gu S, Feng N, Zhang N, Lv L, Liu F: Fecal Metabolites Were Altered, Identified as Biomarkers and Correlated With Disease Activity in Patients With Systemic Lupus Erythematosus in a GC-MS-Based Metabolomics Study. Front Immunol 2020;11:2138

138. Cervenka I, Agudelo LZ, Ruas JL: Kynurenines: Tryptophan's metabolites in exercise, inflammation, and mental health. Science 2017;357:pii: eaaf9794

139. Sasaki-Imamura T, Yoshida Y, Suwabe K, Yoshimura F, Kato H: Molecular basis of indole production catalyzed by tryptophanase in the genus Prevotella. FEMS Microbiol Lett 2011;322:51-59

140. Liang H, Dai Z, Liu N, Ji Y, Chen J, Zhang Y, Yang Y, Li J, Wu Z, Wu G: Dietary L- tryptophan modulates the structural and functional composition of the intestinal microbiome in weaned piglets. Front Microbiol 2018;9:1736

141. Lai ZW, Kelly R, Winans T, Marchena I, Shadakshari A, Yu J, Dawood M, Garcia R, Tily H, Francis L, Faraone SV, Phillips PE, Perl A: Sirolimus in patients with clinically active systemic lupus erythematosus resistant to, or intolerant of, conventional medications: a single-arm, open-label, phase 1/2 trial. Lancet 2018;391:1186-1196

142. Sonner JK, Keil M, Falk-Paulsen M, Mishra N, Rehman A, Kramer M, Deumelandt K, Rowe J, Sanghvi K, Wolf L, von Landenberg A, Wolff H, Bharti R, Oezen I, Lanz TV, Wanke F, Tang Y, Brandao I, Mohapatra SR, Epping L, Grill A, Roth R, Niesler B, Meuth SG, Opitz CA, Okun JG, Reinhardt C, Kurschus FC, Wick W, Bode HB, Rosenstiel P, Platten M: Dietary tryptophan links encephalogenicity of autoreactive T cells with gut microbial ecology. Nat Commun 2019;10:4877

143. Kim T, Kanayama Y, Negoro N, Okamura M, Takeda T, Inoue T: Serum levels of interferons in patients with systemic lupus erythematosus. Clin Exp Immunol 1987;70:562-569

144. Sriram U, Varghese L, Bennett HL, Jog NR, Shivers DK, Ning Y, Behrens EM, Caricchio R, Gallucci S: Myeloid dendritic cells from B6.NZM Sle1/Sle2/Sle3 lupus- prone mice express an IFN signature that precedes disease onset. J Immunol 2012;189:80-91

118

145. Fallarino F, Vacca C, Orabona C, Belladonna ML, Bianchi R, Marshall B, Keskin DB, Mellor AL, Fioretti MC, Grohmann U, Puccetti P: Functional expression of indoleamine 2,3-dioxygenase by murine CD8 alpha(+) dendritic cells. Int Immunol 2002;14:65-68

146. Odemuyiwa SO, Ghahary A, Li Y, Puttagunta L, Lee JE, Musat-Marcu S, Moqbel R: Cutting edge: human eosinophils regulate T cell subset selection through indoleamine 2,3-dioxygenase. J Immunol 2004;173:5909-5913

147. Sinclair LV, Neyens D, Ramsay G, Taylor PM, Cantrell DA: Single cell analysis of kynurenine and System L amino acid transport in T cells. Nat Commun 2018;9:1981

148. Linke M, Fritsch SD, Sukhbaatar N, Hengstschläger M, Weichhart T: mTORC1 and mTORC2 as regulators of cell metabolism in immunity. FEBS Lett 2017;591:3089-3103

149. Yin Y, Choi SC, Xu Z, Zeumer L, Kanda N, Croker BP, Morel L: Glucose Oxidation Is Critical for CD4+ T Cell Activation in a Mouse Model of Systemic Lupus Erythematosus. J Immunol 2016;196:80-90

150. Corrêa JD, Calderaro DC, Ferreira GA, Mendonça SM, Fernandes GR, Xiao E, Teixeira AL, Leys EJ, Graves DT, Silva TA: Subgingival microbiota dysbiosis in systemic lupus erythematosus: association with periodontal status. Microbiome 2017;5:34

151. Li Y, Eskelund AR, Zhou H, Budac DP, Sánchez C, Gulinello M: Behavioral Deficits Are Accompanied by Immunological and Neurochemical Changes in a Mouse Model for Neuropsychiatric Lupus (NP-SLE). Int J Mol Sci 2015;16:15150-15171

152. Merlo LM, Mandik-Nayak L: IDO2: A Pathogenic Mediator of Inflammatory Autoimmunity. Clin Med Insights Pathol 2016;9:21-28

153. Liang H, Dai Z, Liu N, Ji Y, Chen J, Zhang Y, Yang Y, Li J, Wu Z, Wu G: Dietary L- Tryptophan Modulates the Structural and Functional Composition of the Intestinal Microbiome in Weaned Piglets. Front Microbiol 2018;9:1736

154. Fernandez D, Perl A: mTOR signaling: a central pathway to pathogenesis in systemic lupus erythematosus? Discov Med 2010;9:173-178

119

BIOGRAPHICAL SKETCH

Josephine Brown was born and raised in Saint Augustine, Florida. In May 2014,

Josephine graduated with a Bachelor of Science in biology from the University of North

Florida. Josephine also graduated with a Master of Science degree in molecular biology from the University of North Florida in 2016. It was through these experiences and others that Josephine found her interests were application of basic science knowledge toward improving human health. She subsequently enrolled in the University of Florida’s

Graduate Program in Biomedical Sciences in Fall 2016 and joined the Immunology and

Microbiology concentration. Josephine joined the laboratory of Dr. Laurence Morel in

March 2017 and began work to identify the origin and consequences of skewed tryptophan metabolism in the context of systemic autoimmunity.

120