DOCSLIB.ORG

Functional Roles of the E3 Ubiquitin Ligase UBR5 in Cancer Robert F

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Functional Roles of the E3 Ubiquitin Ligase UBR5 in Cancer Robert F Published OnlineFirst October 13, 2015; DOI: 10.1158/1541-7786.MCR-15-0383 Review Molecular Cancer Research Functional Roles of the E3 Ubiquitin Ligase UBR5 in Cancer Robert F. Shearer1,2, Mary Iconomou1,2, Colin K.W. Watts1, and Darren N. Saunders1,3 Abstract The Ubiquitin-Proteasome System (UPS) is an important tion of DNA damage response, metabolism, transcription, and regulator of cell signaling and proteostasis, which are essential apoptosis. Hence, UBR5 is a key regulator of cell signaling to a variety of cellular processes. The UPS is disrupted in many relevant to broad areas of cancer biology. However, the mech- diseases including cancer, and targeting the UPS for cancer anism by which UBR5 may contribute to tumor initiation and therapy is gaining wide interest. E3 ubiquitin ligases occupy progression remains poorly defined. This review synthesizes a key position in the hierarchical UPS enzymatic cascade, emerging insights from genetics, biochemistry, and cell biology largely responsible for determining substrate specificity and to inform our understanding of UBR5 in cancer. These molec- ubiquitin (Ub) chain topology. The E3 ligase UBR5 (aka ular insights indicate a role for UBR5 in integrating/coordinat- EDD1) is emerging as a key regulator of the UPS in cancer ing various cellular signaling pathways. Finally, we discuss and development. UBR5 expression is deregulated in many outstanding questions in UBR5 biology and highlight the need cancer types and UBR5 is frequently mutated in mantle cell to systematically characterize substrates, and address limita- lymphoma. UBR5 is highly conserved in metazoans, has tions in current animal models, to better define the role of unique structural features, and has been implicated in regula- UBR5 in cancer. Mol Cancer Res; 13(12); 1523–32. Ó2015 AACR. Ubiquitination and the Role of E3 Ubiquitin provides tissue specificity and fine-scale regulation of signaling Ligases outputs (6). Correct functioning of the UPS is essential for many cellular Ubiquitination is one of the most widespread and frequent processes such as cell-cycle progression and apoptosis. Conse- cellular posttranslational modifications (PTM) and is essential for quently, the UPS is the subject of intense interest for its therapeutic normal cellular functions. Ubiquitination can regulate protein potential in many diseases including cancer [reviewed elsewhere levels via degradation by the proteasome (1, 2), regulate protein– (8)]. Currently, only broad-acting proteasome inhibitors are in protein interactions, and modulating protein function and local- clinical use. Proteasome inhibitors bortezomib (Velcade) and ization (3, 4). The small protein modifier Ubiquitin (Ub) forms carfilzomib (Kyprolis) have reached phase II clinical trials for use an isopeptide bond with substrate proteins via acceptor lysine in mantle cell lymphoma (MCL) and multiple myeloma (9–12), residues in a hierarchical enzymatic reaction catalyzed by an E3 although use is associated with peripheral neuropathy (12, 13). Ub ligase (5). Much variety in Ub modification of substrate The E3 ligase modulator Lenalidomide (Revlimid, an analogue of proteins arises from the ability of Ub to form either single Thalidomide), is also used in treatment of multiple myeloma but conjugates (mono-ubiquitination) or chains (poly-ubiquitina- has associated resistance and toxicity (14). tion) after repeated rounds of Ub attachment (6). Further com- The UPS targets a large range of proteins with important roles in plexity and diversity in Ub PTMs is generated by variation in Ub cancer biology. Therapeutic benefit with reduced toxicity might be chain topology, depending on which Ub lysine residue is further obtained by targeting more specific aspects of the UPS. For ubiquitinated on the growing poly-Ub chain. Various poly-Ub example, Ub-specific proteases, an extensive class of de-ubiqui- chain topologies are known to effect different signaling outcomes tinating enzymes, have promise as therapeutic targets (15). Of via binding to specific adaptor proteins [reviewed elsewhere (4)]. comparable interest and specificity are the E3 Ub ligases, espe- Specificity of the Ubiquitin-Proteasome System (UPS) is largely cially as key proteins commonly associated with proliferation and determined by the approximately 617 (human) E3 Ub ligases (7), cell-cycle arrest (such as p53, p27, Cyclins, and NF-kB) are but significant pleiotropy and redundancy among E3 Ub ligases specifically regulated by these enzymes (16). One of the more intriguing members of the E3 ligase family is 1 UBR5 [Ubiquitin protein ligase E3 component n-recognin 5, also Kinghorn Cancer Centre, Garvan Institute of Medical Research, Dar- fi linghurst, Australia. 2St.Vincent's Clinical School, Faculty of Medicine, known as EDD (E3 identi ed by Differential Display), EDD1, University of New South Wales, Sydney, Australia. 3School of Medical HHYD, KIAA0896, or DD5]. UBR5 is highly conserved (17) and is Sciences, Faculty of Medicine, University of New South Wales, Sydney, essential for mammalian development (18). UBR5 is rarely Australia. mutated in healthy somatic tissues, but is mutated and/or over- Corresponding Author: Darren N. Saunders, School of Medical Sciences, Uni- expressed in cancer (19, 20). UBR5 is known to modulate the versity of New South Wales, Sydney, NSW 2052, Australia. Phone: 61-2- DNA damage response (DDR) and transcription (see below for 93852494; Fax: 61-2-92958100; E-mail: [email protected] detailed discussion), and emerging roles for UBR5 in a number of doi: 10.1158/1541-7786.MCR-15-0383 biologic contexts have been identified using high-throughput, Ó2015 American Association for Cancer Research. functional genomics screens. This review will summarize the www.aacrjournals.org 1523 Downloaded from mcr.aacrjournals.org on September 24, 2021. © 2015 American Association for Cancer Research. Published OnlineFirst October 13, 2015; DOI: 10.1158/1541-7786.MCR-15-0383 Shearer et al. characterized and emerging biologic roles of UBR5, its role in UBR5 is highly overexpressed in breast cancer at the mRNA level tumorigenesis, and its potential as a therapeutic target. with increases in UBR5 protein also evident in many samples (19). This indicates that regulation of UBR5 is likely at the Unique Genomic and Protein Structure of transcriptional level, though regulation of activity may also occur UBR5 through PTM. Many phosphorylation sites have been identified in UBR5 (see Fig. 1; refs. 34–41), and UBR5 is known to be a UBR5 is a homologue of hyperplastic discs (HYD), a Drosophila phosphorylation target of ATM (42), CHK (43), and ERK kinases melanogaster tumor suppressor (21). Mammalian UBR5 is a HECT (44). However, this phosphorylation has not as yet been directly (homologous to E6-associated protein at the carboxy-terminus) linked to UBR5 activity. E3 Ub ligase recognizing n-degrons (see Fig. 1; refs. 17, 22). The human UBR5 gene has 59 exons, encoding an approximately 10 UBR5 in Cancer kb mRNA and >300 kDa protein with widespread expression in various cell types. One splice variant (loss of nucleotides 884– A number of studies have implicated UBR5 in various aspects 901, removing amino-acid sequence VLLLPL) has been identified of cancer biology and many of the molecular functions of UBR5 in 26/26 cancer cell lines investigated (19), although numerous (e.g., DDR) are consistent with a role in cancer. Indeed, the fi other splice variants are predicted in genome databases. The Drosophila homologue Hyd was originally identi ed as a tumor fi structural/functional consequences of these variants are not suppressor gene (21). Human UBR5 was originally identi ed in a known. UBR5 is highly conserved, but appears to be restricted screen for progestin-regulated genes in breast cancer cells (17). fi to the metazoan lineage, and based on phylogenetic analysis is Ampli cation of UBR5 has been reported in breast and ovarian grouped in a distinct class of HECT ligases (Class IV; ref. 23). Class cancer, mostly in the form of allelic imbalance resulting in IV likely evolved from a common ancestral gene duplication and increased UBR5 mRNA levels (19). UBR5 is located at genomic includes UBR5/EDD and three other families that are highly locus 8q22.3 (17), just downstream from MYC (8q22.4) but fi divergent at the sequence level. UBR5 ampli cation is independent of microsatellites examined HECT E3 Ub ligases have a well characterized mechanism, in the more distal regions of the 8q arm (19). Provisional data forming a thio-ester linkage between Ub and the substrate pro- from The Cancer Genome Atlas (TCGA) clearly show UBR5 fi tein, a reaction highly dependent on a conserved cysteine within ampli cation to be a common alteration in many cancer types the HECT domain (24, 25). The catalytically active HECT domain (see Fig. 2A). UBR5 has been shown to mediate therapeutic of UBR5 is made up of N- and C-lobes separated by a linker resistance in ovarian cancer (20), likely through modulation of fi sequence as determined by high-resolution crystallography (26). the DDR (see below). UBR5 was also identi ed in a transposon However, the HECT domain of UBR5 has some unique structural mutagenesis screen for cooperating mutations and pathways in features compared with other HECT ligases. The C-lobe of the pancreatic adenocarcinoma (45). UBR5 HECT domain does not have a surface for noncovalent Perhaps the most convincing evidence yet for an integral role binding of Ub, and it is unclear if this exists in the N-lobe (a feature for UBR5 in cancer comes from a recent
Load more

Recommended publications
  • The Cross-Talk Between Methylation and Phosphorylation in Lymphoid-Specific Helicase Drives Cancer Stem-Like Properties
    Signal Transduction and Targeted Therapy www.nature.com/sigtrans ARTICLE OPEN The cross-talk between methylation and phosphorylation in lymphoid-specific helicase drives cancer stem-like properties Na Liu1,2,3, Rui Yang1,2, Ying Shi1,2, Ling Chen1,2, Yating Liu1,2, Zuli Wang1,2, Shouping Liu1,2, Lianlian Ouyang4, Haiyan Wang1,2, Weiwei Lai1,2, Chao Mao1,2, Min Wang1,2, Yan Cheng5, Shuang Liu4, Xiang Wang6, Hu Zhou7, Ya Cao1,2, Desheng Xiao1 and Yongguang Tao1,2,6 Posttranslational modifications (PTMs) of proteins, including chromatin modifiers, play crucial roles in the dynamic alteration of various protein properties and functions including stem-cell properties. However, the roles of Lymphoid-specific helicase (LSH), a DNA methylation modifier, in modulating stem-like properties in cancer are still not clearly clarified. Therefore, exploring PTMs modulation of LSH activity will be of great significance to further understand the function and activity of LSH. Here, we demonstrate that LSH is capable to undergo PTMs, including methylation and phosphorylation. The arginine methyltransferase PRMT5 can methylate LSH at R309 residue, meanwhile, LSH could as well be phosphorylated by MAPK1 kinase at S503 residue. We further show that the accumulation of phosphorylation of LSH at S503 site exhibits downregulation of LSH methylation at R309 residue, which eventually promoting stem-like properties in lung cancer. Whereas, phosphorylation-deficient LSH S503A mutant promotes the accumulation of LSH methylation at R309 residue and attenuates stem-like properties, indicating the critical roles of LSH PTMs in modulating stem-like properties. Thus, our study highlights the importance of the crosstalk between LSH PTMs in determining its activity and function in lung cancer stem-cell maintenance.
    [Show full text]
  • KIAA0556 Is a Novel Ciliary Basal Body Component Mutated in Joubert Syndrome Anna A
    Sanders et al. Genome Biology (2015) 16:293 DOI 10.1186/s13059-015-0858-z RESEARCH Open Access KIAA0556 is a novel ciliary basal body component mutated in Joubert syndrome Anna A. W. M. Sanders1†, Erik de Vrieze2,3†, Anas M. Alazami4†, Fatema Alzahrani4, Erik B. Malarkey5, Nasrin Sorusch6, Lars Tebbe6, Stefanie Kuhns1, Teunis J. P. van Dam7, Amal Alhashem8, Brahim Tabarki8, Qianhao Lu9,10, Nils J. Lambacher1, Julie E. Kennedy1, Rachel V. Bowie1, Lisette Hetterschijt2,3, Sylvia van Beersum3,11, Jeroen van Reeuwijk3,11, Karsten Boldt12, Hannie Kremer2,3,11, Robert A. Kesterson13, Dorota Monies4, Mohamed Abouelhoda4, Ronald Roepman3,11, Martijn H. Huynen7, Marius Ueffing12, Rob B. Russell9,10, Uwe Wolfrum6, Bradley K. Yoder5, Erwin van Wijk2,3*, Fowzan S. Alkuraya4,14* and Oliver E. Blacque1* Abstract Background: Joubert syndrome (JBTS) and related disorders are defined by cerebellar malformation (molar tooth sign), together with neurological symptoms of variable expressivity. The ciliary basis of Joubert syndrome related disorders frequently extends the phenotype to tissues such as the eye, kidney, skeleton and craniofacial structures. Results: Using autozygome and exome analyses, we identified a null mutation in KIAA0556 in a multiplex consanguineous family with hallmark features of mild Joubert syndrome. Patient-derived fibroblasts displayed reduced ciliogenesis potential and abnormally elongated cilia. Investigation of disease pathophysiology revealed that Kiaa0556-/- null mice possess a Joubert syndrome-associated brain-restricted phenotype. Functional studies in Caenorhabditis elegans nematodes and cultured human cells support a conserved ciliary role for KIAA0556 linked to microtubule regulation. First, nematode KIAA0556 is expressed almost exclusively in ciliated cells, and the worm and human KIAA0556 proteins are enriched at the ciliary base.
    [Show full text]
  • A Family of Mammalian E3 Ubiquitin Ligases That Contain the UBR Box Motif and Recognize N-Degrons Takafumi Tasaki,1 Lubbertus C
    MOLECULAR AND CELLULAR BIOLOGY, Aug. 2005, p. 7120–7136 Vol. 25, No. 16 0270-7306/05/$08.00ϩ0 doi:10.1128/MCB.25.16.7120–7136.2005 Copyright © 2005, American Society for Microbiology. All Rights Reserved. A Family of Mammalian E3 Ubiquitin Ligases That Contain the UBR Box Motif and Recognize N-Degrons Takafumi Tasaki,1 Lubbertus C. F. Mulder,2 Akihiro Iwamatsu,3 Min Jae Lee,1 Ilia V. Davydov,4† Alexander Varshavsky,4 Mark Muesing,2 and Yong Tae Kwon1* Center for Pharmacogenetics and Department of Pharmaceutical Sciences, School of Pharmacy, University of Pittsburgh, Pittsburgh, Pennsylvania 152611; Aaron Diamond AIDS Research Center, The Rockefeller University, New York, New York 100162; Protein Research Network, Inc., Yokohama, Kanagawa 236-0004, Japan3; and Division of Biology, California Institute of Technology, Pasadena, California 911254 Received 15 March 2005/Returned for modification 27 April 2005/Accepted 13 May 2005 A subset of proteins targeted by the N-end rule pathway bear degradation signals called N-degrons, whose determinants include destabilizing N-terminal residues. Our previous work identified mouse UBR1 and UBR2 as E3 ubiquitin ligases that recognize N-degrons. Such E3s are called N-recognins. We report here that while double-mutant UBR1؊/؊ UBR2؊/؊ mice die as early embryos, the rescued UBR1؊/؊ UBR2؊/؊ fibroblasts still retain the N-end rule pathway, albeit of lower activity than that of wild-type fibroblasts. An affinity assay for proteins that bind to destabilizing N-terminal residues has identified, in addition to UBR1 and UBR2, a huge (570 kDa) mouse protein, termed UBR4, and also the 300-kDa UBR5, a previously characterized mammalian E3 known as EDD/hHYD.
    [Show full text]
  • Dual Proteome-Scale Networks Reveal Cell-Specific Remodeling of the Human Interactome
    bioRxiv preprint doi: https://doi.org/10.1101/2020.01.19.905109; this version posted January 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Dual Proteome-scale Networks Reveal Cell-specific Remodeling of the Human Interactome Edward L. Huttlin1*, Raphael J. Bruckner1,3, Jose Navarrete-Perea1, Joe R. Cannon1,4, Kurt Baltier1,5, Fana Gebreab1, Melanie P. Gygi1, Alexandra Thornock1, Gabriela Zarraga1,6, Stanley Tam1,7, John Szpyt1, Alexandra Panov1, Hannah Parzen1,8, Sipei Fu1, Arvene Golbazi1, Eila Maenpaa1, Keegan Stricker1, Sanjukta Guha Thakurta1, Ramin Rad1, Joshua Pan2, David P. Nusinow1, Joao A. Paulo1, Devin K. Schweppe1, Laura Pontano Vaites1, J. Wade Harper1*, Steven P. Gygi1*# 1Department of Cell Biology, Harvard Medical School, Boston, MA, 02115, USA. 2Broad Institute, Cambridge, MA, 02142, USA. 3Present address: ICCB-Longwood Screening Facility, Harvard Medical School, Boston, MA, 02115, USA. 4Present address: Merck, West Point, PA, 19486, USA. 5Present address: IQ Proteomics, Cambridge, MA, 02139, USA. 6Present address: Vor Biopharma, Cambridge, MA, 02142, USA. 7Present address: Rubius Therapeutics, Cambridge, MA, 02139, USA. 8Present address: RPS North America, South Kingstown, RI, 02879, USA. *Correspondence: [email protected] (E.L.H.), [email protected] (J.W.H.), [email protected] (S.P.G.) #Lead Contact: [email protected] bioRxiv preprint doi: https://doi.org/10.1101/2020.01.19.905109; this version posted January 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • 4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation
    Methods Mice: 4-6 weeks old female C57BL/6 mice obtained from Jackson labs were used for cell isolation. Female Foxp3-IRES-GFP reporter mice (1), backcrossed to B6/C57 background for 10 generations, were used for the isolation of naïve CD4 and naïve CD8 cells for the RNAseq experiments. The mice were housed in pathogen-free animal facility in the La Jolla Institute for Allergy and Immunology and were used according to protocols approved by the Institutional Animal Care and use Committee. Preparation of cells: Subsets of thymocytes were isolated by cell sorting as previously described (2), after cell surface staining using CD4 (GK1.5), CD8 (53-6.7), CD3ε (145- 2C11), CD24 (M1/69) (all from Biolegend). DP cells: CD4+CD8 int/hi; CD4 SP cells: CD4CD3 hi, CD24 int/lo; CD8 SP cells: CD8 int/hi CD4 CD3 hi, CD24 int/lo (Fig S2). Peripheral subsets were isolated after pooling spleen and lymph nodes. T cells were enriched by negative isolation using Dynabeads (Dynabeads untouched mouse T cells, 11413D, Invitrogen). After surface staining for CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61) and CD44 (IM7), naïve CD4+CD62L hiCD25-CD44lo and naïve CD8+CD62L hiCD25-CD44lo were obtained by sorting (BD FACS Aria). Additionally, for the RNAseq experiments, CD4 and CD8 naïve cells were isolated by sorting T cells from the Foxp3- IRES-GFP mice: CD4+CD62LhiCD25–CD44lo GFP(FOXP3)– and CD8+CD62LhiCD25– CD44lo GFP(FOXP3)– (antibodies were from Biolegend). In some cases, naïve CD4 cells were cultured in vitro under Th1 or Th2 polarizing conditions (3, 4).
    [Show full text]
  • CIB1 Antibody Purified Mouse Monoclonal Antibody Catalog # Ao1068a
    10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 CIB1 Antibody Purified Mouse Monoclonal Antibody Catalog # AO1068a Specification CIB1 Antibody - Product Information Application WB, IHC Primary Accession Q99828 Reactivity Human Host Mouse Clonality Monoclonal Description CIB1(also designated calcium and integrin binding 1 or calmyrin),with 191-amino acid protein(about 21kDa), belongs to the calcium-binding protein family.CIB1 is known to interact with DNA-dependent protein kinase and may play a role in kinase-phosphatase regulation of DNA end Figure 1: Western blot analysis using CIB1 joining.CIB1 is an EF-hand-containing mouse mAb against truncated CIB1 protein that binds multiple effector proteins, recombinant protein (1) and A431 cell lysate including the platelet alpha(IIb)beta(3) (2). integrin and several serine/threonine kinases and potentially modulates their function.CIB1 regulates platelet aggregation in hemostasis through a specific interaction with the alpha(IIb) cytoplasmic domain of platelet integrin alpha(IIb)beta(3). CIB1 is also ubiquitously expressed activating and inhibiting protein ligand of the InsP3R. Figure 2: Immunohistochemical analysis of paraffin-embedded human thalamus (left) Immunogen and glioma (right) tissue, showing membrane Purified recombinant fragment of CIB1 localization using CIB1 mouse mAb with DAB expressed in E. Coli. staining. Formulation Ascitic fluid containing 0.03% sodium azide. CIB1 Antibody - References 1. Holly R. Gentry,Alex U. Singer, Laurie Betts. CIB1 Antibody - Additional Information J. Biol. Chem., Mar 2005; 280: 8407 - 8415. 2. Carl White, Jun Yang, Mervyn J. Monteiro. J. Gene ID 10519 Biol. Chem., Jul 2006; 281: 20825 – 20833.
    [Show full text]
  • Microtubule-Severing Enzymes at the Cutting Edge
    Commentary 2561 Microtubule-severing enzymes at the cutting edge David J. Sharp1,* and Jennifer L. Ross2 1Department of Physiology and Biophysics, Albert Einstein College of Medicine, 1300 Morris Park Avenue, Bronx, NY 10461, USA 2Department of Physics, University of Massachusetts-Amherst, 302 Hasbrouck Laboratory, Amherst, MA 01003, USA *Author for correspondence ([email protected]) Journal of Cell Science 125, 2561–2569 ß 2012. Published by The Company of Biologists Ltd doi: 10.1242/jcs.101139 Summary ATP-dependent severing of microtubules was first reported in Xenopus laevis egg extracts in 1991. Two years later this observation led to the purification of the first known microtubule-severing enzyme, katanin. Katanin homologs have now been identified throughout the animal kingdom and in plants. Moreover, members of two closely related enzyme subfamilies, spastin and fidgetin, have been found to sever microtubules and might act alongside katanins in some contexts (Roll-Mecak and McNally, 2010; Yu et al., 2008; Zhang et al., 2007). Over the past few years, it has become clear that microtubule-severing enzymes contribute to a wide range of cellular activities including mitosis and meiosis, morphogenesis, cilia biogenesis and disassembly, and migration. Thus, this group of enzymes is revealing itself to be among the most important of the microtubule regulators. This Commentary focuses on our growing understanding of how microtubule-severing enzymes contribute to the organization and dynamics of diverse microtubule arrays, as well as the structural and biophysical characteristics that afford them the unique capacity to catalyze the removal of tubulin from the interior microtubule lattice. Our goal is to provide a broader perspective, focusing on a limited number of particularly informative, representative and/or timely findings.
    [Show full text]
  • Chromosome Substitution Strain Assessment of a Huntington's
    Mamm Genome DOI 10.1007/s00335-014-9552-9 Chromosome substitution strain assessment of a Huntington’s disease modifier locus Eliana Marisa Ramos • Marina Kovalenko • Jolene R. Guide • Jason St. Claire • Tammy Gillis • Jayalakshmi S. Mysore • Jorge Sequeiros • Vanessa C. Wheeler • Isabel Alonso • Marcy E. MacDonald Received: 26 August 2014 / Accepted: 3 December 2014 Ó The Author(s) 2015. This article is published with open access at Springerlink.com Abstract Huntington’s disease (HD) is a dominant neu- with the human 6q23–24 region, is derived from the A/J rodegenerative disorder that is due to expansion of an (AJ) strain. Crosses were performed to assess the possi- unstable HTT CAG repeat for which genome-wide genetic bility of dominantly acting chr10 AJ-B6J variants of strong scans are now revealing chromosome regions that contain effect that may modulate CAG-dependent HdhQ111/? phe- disease-modifying genes. We have explored a novel notypes. Testing of F1 progeny confirmed that a single AJ human–mouse cross-species functional prioritisation chromosome had a significant effect on the rate of body approach, by evaluating the HD modifier 6q23–24 linkage weight gain and in HdhQ111 mice the AJ chromosome was interval. This unbiased strategy employs C57BL/6J (B6J) associated subtle alterations in somatic CAG instability in HdhQ111 knock-in mice, replicates of the HD mutation, and the liver and the formation of intra-nuclear inclusions, as the C57BL/6J-chr10A/J/NaJ chromosome substitution strain well as DARPP-32 levels, in the striatum. These findings in (CSS10), in which only chromosome 10 (chr10), in synteny relatively small cohorts are suggestive of dominant chr10 AJ-B6 variants that may modify effects of the CAG expansion, and encourage a larger study with CSS10 and sub-strains.
    [Show full text]
  • Functional Diversification of the Nleg Effector Family in Enterohemorrhagic Escherichia Coli
    Functional diversification of the NleG effector family in enterohemorrhagic Escherichia coli Dylan Valleaua, Dustin J. Littleb, Dominika Borekc,d, Tatiana Skarinaa, Andrew T. Quailea, Rosa Di Leoa, Scott Houlistone,f, Alexander Lemake,f, Cheryl H. Arrowsmithe,f, Brian K. Coombesb, and Alexei Savchenkoa,g,1 aDepartment of Chemical Engineering and Applied Chemistry, University of Toronto, Toronto, ON M5S 3E5, Canada; bDepartment of Biochemistry and Biomedical Sciences, Michael G. DeGroote Institute for Infectious Disease Research, McMaster University, Hamilton, ON L8S 4K1, Canada; cDepartment of Biophysics, University of Texas Southwestern Medical Center, Dallas, TX 75390; dDepartment of Biochemistry, University of Texas Southwestern Medical Center, Dallas, TX 75390; ePrincess Margaret Cancer Centre, University of Toronto, Toronto, ON M5G 2M9, Canada; fDepartment of Medical Biophysics, University of Toronto, Toronto, ON M5G 1L7, Canada; and gDepartment of Microbiology, Immunology and Infectious Diseases, University of Calgary, Calgary, AB T2N 4N1, Canada Edited by Ralph R. Isberg, Howard Hughes Medical Institute and Tufts University School of Medicine, Boston, MA, and approved August 15, 2018 (receivedfor review November 6, 2017) The pathogenic strategy of Escherichia coli and many other gram- chains. Depending on the length and nature of the polyubiquitin negative pathogens relies on the translocation of a specific set of chain, it posttranslationally regulates the target protein’s locali- proteins, called effectors, into the eukaryotic host cell during in- zation, activation, or degradation. Ubiquitination is a multistep fection. These effectors act in concert to modulate host cell pro- process which begins with the ubiquitin-activating enzyme (E1) cesses in favor of the invading pathogen. Injected by the type III using ATP to “charge” ubiquitin, covalently binding the ubiquitin secretion system (T3SS), the effector arsenal of enterohemorrhagic C terminus by a thioester linkage.
    [Show full text]
  • (Calcium and Integrin Binding Protein 2) Mutation Associated with Non- Syndromic Hearing Loss in a Hispanic Family Kunjan Patel Albert Einstein College of Medicine
    University of Kentucky UKnowledge Physiology Faculty Publications Physiology 10-1-2015 A Novel C-Terminal CIB2 (Calcium and Integrin Binding Protein 2) Mutation Associated with Non- Syndromic Hearing Loss in a Hispanic Family Kunjan Patel Albert Einstein College of Medicine Arnaud P. Giese University of Maryland J. M. Grossheim University of Kentucky, [email protected] Rashima S. Hegde Cincinnati Children’s Hospital Medical Centre Maria Delio Mount Sinai School of Medicine See next page for additional authors Right click to open a feedback form in a new tab to let us know how this document benefits oy u. Follow this and additional works at: https://uknowledge.uky.edu/physiology_facpub Part of the Physiology Commons Repository Citation Patel, Kunjan; Giese, Arnaud P.; Grossheim, J. M.; Hegde, Rashima S.; Delio, Maria; Samanich, Joy; Riazuddin, Saima; Frolenkov, Gregory I.; Cai, Jinlu; Ahmed, Zubair M.; and Morrow, Bernice E., "A Novel C-Terminal CIB2 (Calcium and Integrin Binding Protein 2) Mutation Associated with Non-Syndromic Hearing Loss in a Hispanic Family" (2015). Physiology Faculty Publications. 72. https://uknowledge.uky.edu/physiology_facpub/72 This Article is brought to you for free and open access by the Physiology at UKnowledge. It has been accepted for inclusion in Physiology Faculty Publications by an authorized administrator of UKnowledge. For more information, please contact [email protected]. Authors Kunjan Patel, Arnaud P. Giese, J. M. Grossheim, Rashima S. Hegde, Maria Delio, Joy Samanich, Saima Riazuddin, Gregory I. Frolenkov, Jinlu Cai, Zubair M. Ahmed, and Bernice E. Morrow A Novel C-Terminal CIB2 (Calcium and Integrin Binding Protein 2) Mutation Associated with Non-Syndromic Hearing Loss in a Hispanic Family Notes/Citation Information Published in PLOS One, vol.
    [Show full text]
  • Aspm (NM 009791) Mouse Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MR219160 Aspm (NM_009791) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Aspm (NM_009791) Mouse Tagged ORF Clone Tag: Myc-DDK Symbol: Aspm Synonyms: Calmbp1; D330028K02Rik; MCPH5; Sha1 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >MR219160 representing NM_009791 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGACGATGCAGGCAGCCTCCTGCCCAGAGGAGAGGGGGCGGCGGGCGCGACCAGATCCTGAGGCCG GGGACCCGTCTCCGCCGGTGCTGTTGCTCAGCCACTTCTGCGGCGTTCCCTTCCTCTGCTTCGGGGATGT CCGCGTGGGCACGTCGCGGACGCGGTCTCTGGTCCTGCACAACCCGCACGAGGAACCTCTGCAGGTGGAG CTGTCGCTGCTGCGCGCCGCAGGCCAGGGCTTCAGCGTGGCGCCGAACCGCTGCGAGCTGAAGCCTAAAG AAAAACTTACCATTTCCGTTACCTGGACGCCACTGCGAGAAGGGGGAGTGAGGGAGATTGTCACATTTCT TGTAAATGATTTCCTGAAGCACCAGGCTATATTACTAGGAAATGCAGAAGAGCCTAAGAAGAAAAAGAGA AGTCTTTGGAATACCAGTAAGAAGATTCCAGCCTCTTCAAAACATACAAAAAGGACTTCCAAAAACCAAC ATTTTAATGAATCATTTACTATTTCACAAAAAGACAGAATTAGGAGCCCACTGCAGCCTTGTGAAAATCT GGCTATGAGTGAATGCTCTTCCCCAACAGAAAACAAAGTCCCCACCCCATCCATTAGTCCTATTAGAGAA TGCCAGAGTGAAACTTGCTTGCCACTGTTTTTACGCGAGTCCACTGCCTATTCATCTCTTCATGAATCTG AAAATACACAAAATTTAAAAGTACAAGATGCCAGCATTTCACAAACTTTTGATTTTAATGAGGAAGTCGC AAATGAAACTTTTATTAATCCCATTAGTGTCTGTCACCAGAGTGAAGGGGATAGGAAACTCACGCTTGCC CCAAACTGTTCTTCACCTTTGAATAGTACACAGACCCAAATACACTTTCTAAGTCCAGATTCTTTTGTAA
    [Show full text]