Cd73 Is a Critical Regulator of Hepatocytes in Homeostasis and Disease

CD73 IS A CRITICAL REGULATOR OF HEPATOCYTES IN HOMEOSTASIS AND DISEASE

Karel Pastor Alcedo

A dissertation submitted to the faculty at the University of North Carolina at Chapel Hill in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Department of Cell Biology and Physiology in the School of Medicine.

Chapel Hill 2021

Approved by:

Natasha T. Snider

Patrick Brennwald

Jay Brenman

Hong Jin Kim

Yuliya Pylayeva-Gupta

ABSTRACT

Karel Pastor Alcedo: CD73 Is a Critical Regulator of Hepatocytes in Homeostasis and Disease (Under the direction of Natasha T. Snider)

The enzymatic dephosphorylation of 5´-nucleotides like adenosine 5´-monophosphate

(AMP) is a key step in purine salvage and purinergic signaling. This reaction occurs inside the cell or in the extracellular space. Ecto-5´-nucleotidase (CD73) is the major enzyme catalyzing the formation of extracellular adenosine from AMP. CD73-generated adenosine controls tissue homeostasis and responses related to inflammation, ischemia, fibrosis, and cancer. However, the specific functions of CD73 in liver homeostasis and diseases have not been fully elucidated. The objectives of the study were to 1) define the cell-specific role of

CD73 in the liver, 2) determine how hepatocyte CD73 regulates alcohol-induced liver injury, and 3) examine CD73 regulation in human hepatocellular carcinoma.

We generated and characterized a hepatocyte-specific CD73 knockout mouse (CD73-

LKO) model using serological, biochemical, and histological assays. We found that CD73-

LKO mice developed spontaneous liver injury in a sex- and age-dependent manner, which was associated with hypoactivation of AMPK, the key regulator of cellular energy metabolism. Furthermore, CD73-generated extracellular adenosine mediated AMPK activity upon cellular uptake through nucleoside transporters. Given that hepatocyte CD73 and adenosine exerts basal hepatoprotection, we then determined its role in alcohol-induced liver injury, a leading risk factor for chronic liver diseases. The loss of hepatocyte CD73 predisposed mice to more severe liver injury. In contrast, alcohol exposure in WT mice

iii resulted in mild injury, concomitant with CD73 induction and enhanced enzymatic activity.

In vitro assays revealed a non-enzymatic CD73 binding protein function for bioactive lipids, which are generated upon alcohol exposure. These data suggest CD73-mediated dual protection in alcoholic liver.

In humans, chronic alcohol-induced liver injury leads to hepatocellular carcinoma

(HCC), the fourth leading cause of cancer-related deaths worldwide. Because hepatocyte

CD73 is critical in normal and injured liver, we examined its regulation in HCC. CD73 was expressed in tumor and non-tumor liver tissues. However, tumor-specific CD73 altered N- linked glycosylation led to its cytoplasmic redistribution and a reduction in the enzymatic activity, suggesting a potential impairment in CD73-mediated liver protection. In conclusion, these studies provide further understanding of CD73 biology in the liver and has implications for the potential therapeutic use of CD73 in chronic liver diseases.

I dedicate this to Jerry and Nerie.

Napuno nak ti pinag-agyaman ko para kinya yo nga dua – diyay kinaado ti pinagsakripisyo yo para kinyami nga agkakabsat, tapno laeng mumayat diyay biyag mi. Detoy ti maisublik kinya yo nga dua – pinagpayso ti pinagadal ko.

ACKNOWLEDGMENTS

I want to acknowledge my mentor, Natasha Snider, for her exemplary commitment to my scientific and personal growth, for the opportunities and experiences that she has afforded me, for her guidance and encouragement in my endeavors beyond my scientific training, and for the support and endorsement in my career decisions. I attribute a huge part of my success to her while in graduate school. I also want to acknowledge all members of the Snider Lab for their guidance and assistance, most specially to Morgan Rouse, Gloria Jung, and Dr.

Dong Fu. I want to thank the members of my thesis committee – Drs. Patrick Brennwald,

Yuliya Pylayeva-Gupta, Hong Jin Kim, and Jay Brenman for their invaluable guidance and support throughout my time in the Cell Biology and Physiology program. Thank you to all of the collaborators who have significantly contributed to the completion of this project. I am also very thankful to the Cancer Cell Biology Training Program – to Drs. Adrienne Cox, Ben

Major, William Kim, and to all the trainees – for providing a community that was vital in my development as a scientist for cancer research.

I want to acknowledge my solid support group of family and friends for their endless love and encouragement, and their continued support as I navigated graduate school. Lastly, I am thankful to Kenneth Alarcon Negy for being my pillar.

This dissertation was funded by pre-doctoral fellowships from the Cancer Cell

Biology Training Program and UNC Graduate School.

TABLE OF CONTENTS

LIST OF TABLES…………………………………………………………………………...x

LIST OF FIGURES…………………………………………………………………………xi

LIST OF ABBREVIATIONS…………………………………………………….………..xiii

CHAPTER 1: CHRONIC LIVER DISEASE………………………………………………..1

Overview……………………………………………………………………………..1

Liver as a Metabolic Hub…………………………………………………………….2

Pathophysiology and Treatment of Chronic Liver Diseases…………………………4

HCC Development and The Role of Alcohol………………………………………..6

Tight Regulation of Cellular Energy Metabolism Maintains Liver Homeostasis……7

5’NT and Extracellular Adenosine in Physiological Adaptation and Disease Development………………………………………………………………...8

5’NT/CD73 in Chronic Liver Disease……………………………………………….9

Rationale and Objectives……………………………………………………………10

REFERENCES……………………………………………………………………...11

CHAPTER 2: THE ELEGANT COMPLEXITY OF 5’-NUCLEOTIDASE (CD73)……...19

Overview……….…………………...……………………………………………....19

From 5’-NT to CD73: Changing Nomenclature and Shifting Research Directions………………………………………………………………...20

Genetic Deficiency of CD73 and Cross-Talk Between Purinergic Signaling and Gene Regulation…...………………………………………………...22

The Emerging Importance of Age and Sex in the Physiological Functions of CD73 and Adenosine…………………………………………………23

vii Cellular Uptake-Mediated versus Receptor-Mediated Effects of CD73-Derived Adenosine………………………………………………………..24

The Importance of Location: Zonal Distribution of CD73 in Digestive Epithelia………………………………………………………………….25

CD73 and Intestinal Epithelial Homeostasis………………………………………..26

CD73 and Liver Homeostasis…………………………………………………….....28

Complex Regulation of CD73 mRNA, Protein, and Enzymatic Activity…………..29

Development of CD73 Inhibitors and Other Tools to Support Further Research…..31

REFERENCES……………………………………………………………………...33

CHAPTER 3: CD73 MAINTAINS HEPATOCYTE METABOLIC INTEGRITY AND MOUSE LIVER HOMEOSTASIS IN A SEX-DEPENDENT MANNER………………...43

Introduction…………………………………………………………………………43

Materials and Methods……………………………………………………………...45

Results………………………………………………………………………………54

Discussion…………………………………………………………………………..66

REFERENCES……………………………………………………………………...73

CHAPTER 4: HEPATOCYTE CD73 IS A TARGET OF ETHANOL AND PROTECTS DURING ALCOHOL-INDUCED LIVER INJURY…………………………80

Introduction…………………………………………………………………………80

Materials and Methods……………………………………………………………...81

Results………………………………………………………………………………86

Discussion…………………………………………………………………………..94

REFERENCES……………………………………………………………………...99

CHAPTER 5: TUMOR-SELECTIVE ALTERED GLYCOSYLATION AND FUNCTIONAL ATTENUATION OF CD73 IN HUMAN HEPATOCELLULAR CARCINOMA……………………………………………………104

viii Introduction………………………………………………………………………..104

Materials and Methods…………………………………………………………….106

Results……………………………………………………………………………..110

Discussion……………….………………………………………………………...123

REFERENCES…………………………………………………………………….128

CHAPTER 6: CD73 AS A THERAPEUTIC TARGET OF HEPATIC AND EXTRAHEPATIC DISEASES……………………………………………………..133

Overview…………………………………………………………………………..133

CD73 as a Metabolic Gatekeeper in the Liver…………………………………….134

CD73 as a Novel Lipid Binding Protein…………………………………………..135

CD73 as a Marker of Hepatocyte Stress…………………………………………..135

Sex-Dependent Differences in HCC and a Potential Role of CD73………………136

Conclusions and Future Perspectives……………………………………………...137

REFERENCES…………………………………………………………………….141

ix LIST OF TABLES

Table 3.1 – Primers for Genotyping and Quantitative Polymerase Chain Reaction…….….51

Table 6.1 – Outstanding Questions on CD73 Function and Expression……………….….140

LIST OF FIGURES

Figure 1.1 – Metabolic Zonation in the Liver………………………………………………..3

Figure 1.2 – Sequential Progression of Chronic Liver Disease……………………………...5

Figure 2.1 – CD73 is an Essential Component of Purinergic Signaling and a Novel Disease Target..……………………………………………………. 21

Figure 2.2 – Zonal Expression of CD73 Supports Tissue-Specific Homeostasis…………..27

Figure 2.3 – Molecular Regulation of CD73………………………………………………. 30

Figure 3.1 – CD73 is Expressed Primarily on Hepatocytes in Normal Mouse Liver…..…..55

Figure 3.2 – Generation of Liver-Specific CD73-LKO Mice………………………………56

Figure 3.3 – CD73-LKO Mice Develop Normally and Do Not Show Major Liver Abnormalities Up to 21 Weeks of Age……………………………………………….58

Figure 3.4 – CD73-LKO Mice Develop Spontaneous Liver Injury After 21 Weeks of Age in a Sex-Dependent Manner……………….………………………………...60

Figure 3.5 – Metabolic Imbalance and Increased Steatosis in Male CD73-LKO Mouse Hepatocytes and Livers………………………………………………...62

Figure 3.6 – Inhibition of CD73 Enzymatic Activity Promotes Lipid Accumulation in Hepatocytes…………………………………………………………….....64

Figure 3.7 – CD73-Generated Extracellular Adenosine Activates AMPK in Hepatocytes and Livers from CD73-LKO Mice and Show Impaired AMK Signaling…….……………..65

Figure 3.8 – Loss of Hepatocyte CD73 Results in Spontaneous Liver Inflammation……....67

Figure 4.1 – CD73/NT5E is Upregulated in Response to Alcohol in Humans and Mice……………………………………………………………………….…...87

Figure 4.2 – Leukotriene B3 (LTB3) is a Non-Competitive Substrate for CD73…………....89

Figure 4.3 – Nt5e Induction Attenuates Acute-On-Chronic Liver Injury in Mice…………..91

Figure 4.4 – Increased CD73 Expression and AMPase Function Upon Alcohol Exposure…………………………………………………………………………....93

Figure 4.5 – Loss of Hepatocyte CD73 Predisposes Male Mice to Alcohol-Induced Liver Injury…………………………………………………………………………………………95

Figure 5.1 – CD73 is Highly Expressed in Malignant Hepatocytes in Human HCC……..111

Figure 5.2 – CD73 is Endogenously Expressed in Human HCC Cell Lines and Exhibits Membrane and Cytoplasmic Expression…………..………………………...113

Figure 5.3 – HCC Tumor-Specific CD73 Biochemical Alterations Correlate with Decreased 5’-Nucleotidase Activity…….…………………………………………....115

Figure 5.4 – Correlation Analysis Between Biochemical Changes of Tumor- Associated CD73 with Disease Presence/Recurrence and Patient Survival…………….....116

Figure 5.5 – Site-Specific Glycan Distribution on CD73 in Normal Human Liver…….….117

Figure 5.6 – Site-Specific Increase in High Mannose Glycans Promotes CD73 Intracellular Retention and Decreased Enzymatic Activity………………………………...119

Figure 5.7 – Golgi Protein GM130 Induction in HCC Tumors Correlates with Global Expression Changes in N-Linked Glycoprotein-Encoding Genes………………....121

Figure 6.1 – New Tools to Study CD73 Regulation and Function………………………...139

xii

LIST OF ABBREVIATIONS

5’NT 5’-Nucleotidase

A1R Adenosine 1 Receptor

A2AR Adenosine 2A Receptor

A2BR Adenosine 2B Receptor

A3R Adenosine 3 Receptor

ACDC Arterial Calcification due to Deficiency of CD73

ADARB2 Adenosine Deaminase RNA Specific B2

AdoR Adenosine Receptor

ADP Adenosine Diphosphate

AKT RAC-Alpha Serine/Threonine-Protein Kinase

ALD Alcoholic Liver Disease

ALT Alanine Aminotransferase

AMP Adenosine Monophosphate

AMPase AMP-Nucleotidase

AMPK AMP-Activated Protein Kinase

ANOVA Analysis of variance

APCP Adenosine 5'-(α,β-methylene)diphosphate

ASH Alcoholic Steatohepatitis

ATP Adenosine Triphosphate

BAC Bacterial Artificial Chromosome bp Base Pair

BSA Bovine Serum Albumin

xiii

BUN Blood Urea Nitrogen

CALJA Calcification of Joint and Arteries

CBS Cystathionine Beta Synthase

CD31 Cluster of Differentiation 31

CD39 Cluster of Differentiation 39

CD73 Cluster of Differentiation 73

CD73-LKO CD73 Liver-Specific Knockout

CD73S Cluster of Differentiation 73 Short

CF102 2‐Chloro‐N(6)‐(3‐Iodobenzyl)Adenosine‐5′‐N‐Methyluronamide

CircNT5E Circular Ecto-5’-Nucleotidase

CLD Chronic Liver Disease

CNT1/2 Concentrative Nucleoside Transporter 1/2

COVID-19 Coronavirus Disease 2019

CT Cycle Threshold

DAB 3,3’-diaminobenzidine

DAPI 4′,6-diamidino-2-phenylindole

DMSO Dimethyl Sulfoxide

DNA Deoxyribonucleic Acid

ECM Extracellular Matrix

EGTA Ethylene Glycol-Bis(-Aminoethyl Ether)-N,N,N′,N′-Tetraacetic Acid

EIF2 Eukaryotic Initiation Factor 2 eN Ecto-5’-Nucleotidase

EndoH Endoglycosidase H

xiv

eNPP2 Ectonucleotide Pyrophosphatase/Phosphodiesterase 2 eNT Ecto-5’-Nucleotidase

ENT1/2 Equilibrative Nucleoside Transporter 1/2 eNTPD8 Ectonucleoside Triphosphate Diphosphohydrolase 8

ER Endoplasmic Reticulum

ES Embryonic Stem [Cells]

FACS Fluorescence-Activated Cell Sorting

FL Floxed

FOXO1 Forkhead Box O1 Protein

FPKM Fragments per Kilobase

GFAP Glial Fibrillary Acidic Protein

GPI Glycosylphosphatidylinositol

GPI-AP Glycosylphosphatidylinositol-Anchored Protein

H2O2 Hydrogen Peroxide

H&E Hematoxylin and Eosin

HCC Hepatocellular Carcinoma

HDL High Density Lipoprotein

HIF Hypoxia-Inducible Factor

HFD High Fat Diet

HSC Hepatic Stellate Cells

IL1 Interleukin 1

IMP 5’-Inosine Monophosphate iPSC Induced Pluripotent Stem Cell

K(8/18) Keratin

LC-MS/MS Liquid Chromatography with Tandem Mass Spectrometry

LSEC Liver Sinusoidal Endothelial Cells

LTB3 Leukotriene B3

MAFLD Metabolic-Associated Fatty Liver Disease miR MicroRNA mRNA Messenger Ribonucleic Acid

MSC Mesenchymal Stromal Cells mTOR Mechanistic Target of Rapamycin

NADH Nicotinamide Adenine Dinucleotide Hydrogen

NAFLD Non-Alcoholic Fatty Liver Disease

NASH Non-Alcoholic Steatohepatitis

NBTI Nitrobenzylthioinosine

NER Nucleotide Excision Repair

NIAAA National Institute of Alcohol Abuse and Alcoholism

NK Natural Killer [cells]

NT5E Ecto-5’-Nucleotidase, gene

NTPDase Ecto-Nucleoside Triphosphate Diphosphohydrolase

OCT Optimal Cutting Temperature

OG n‐Octylglucoside p70S6K 70-kDa Ribosomal Protein S6 Kinase

PBS Phosphate Buffered Saline

PCR Polymerase Chain Reaction

xvi

PLC Phospholipase C

PNGase F Peptide:N-Glycosidase F

PPAR Peroxisome Proliferator-Activated Receptor 

PTM Post-translational Modification

PTS Protein Thermal Shift qPCR Quantitative Polymerase Chain Reaction rCD73 Recombinant CD73

RNA Ribonucleic Acid

RNASeq RNA Sequencing

RT Room Temperature

RXR Retinoid X Receptor  s.d. Standard Deviation

SDS-PAGE Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis

SLC28A2 Solute Carrier Family 28 Member 2

SREBP-1 Sterol Regulatory Element-Binding Protein 1

TAZ PDZ-Binding Motif

TBST Tris-Buffered Saline with 0.1% Tween-20

TBX2 11-dehydro-2,3-dinor thromboxane B2

TNAP Tissue Non-Specific Alkaline Phosphatase tRNA Transfer RNA tSNE t-Distributed Stochastic Neighbor Embedding

WB Western Blot

WT Wild Type

xvii

YAP Yes-Associated Protein

ZO1 Zonula Occludens 1

xviii

CHAPTER 1: CHRONIC LIVER DISEASE

Overview

Chronic liver disease (CLD) is a substantial global health burden that results from a progressive dysfunction of the liver1. In a longitudinal study conducted between 2000-2015, the World Health Organization ranked CLD as the 11th most common cause of mortality worldwide, accounting for an estimated 2 million deaths per year1,2. The highest absolute numbers of deaths were from Asia and sub-Saharan Africa at 642,000 and 179,000, respectively1. Although the total numbers are lower in Latin America, the Caribbean islands, and the Middle East, these regions had proportionately the highest mortality rate due to CLD.

Notably, the incidence and prevalence rates of CLD are rising in European countries and in

North America, which have paralleled the increasing trend in co-morbidities like obesity and diabetes. These new diagnoses in the United States alone have resulted in increased CLD- related inpatient hospitalizations from 3.06% to 3.76% and an upsurge in healthcare costs from

$14.9 billion to $18.8 billion between 2012 to 20163. Despite these alarming statistical data, the health burden of CLD remains an approximation because of the lack of sensitive and specific diagnostic markers, especially at early stages of the disease when it is amenable for treatment. Normally, patients are at advanced stages of CLD upon diagnosis when they are at the highest risk for liver failure. At this stage, liver transplantation remains the standard treatment; however, this is still limited by the shortage of liver donors, as well as patient eligibility due to CLD status4. Thus, the objective of this dissertation is to unravel diagnostic

and potential therapeutic targets for CLD, with an overarching goal of conveying research discoveries from the bench to the clinic.

Liver as a Metabolic Hub

An understanding of the normal anatomical and physiological functions of the liver can help illuminate CLD regulators (Figure 1.1). Hepatocytes, which comprise approximately 80% of the total liver, are arranged in hepatic plates that are one-cell layer thick and are stacked together in the hepatic lobule5. The “periportal” hepatocytes are located next to the portal triad on one side (encompassing the hepatic artery, vein, and bile duct), and the “pericentral” hepatocytes are adjacent to the central vein on the opposite side. This arrangement follows the oxygen gradient: highly oxygenated blood enters the liver via the hepatic artery from the portal triad, mixes with deoxygenated blood through the sinusoids between the hepatic plates and is returned to the circulation in the central vein. The level of oxygen exposure of hepatocytes determines the distribution of key metabolic enzymes in the liver6. Enzymes involved in pathways requiring high oxygen (such as protein secretion, cholesterol synthesis, fatty acid oxidation, and ureagenesis) have periportal predominance, where oxygen tension is high. In contrast, pericentral hepatocytes experience a physiologically hypoxic microenvironment with lower oxygen tension, which upregulates the enzymes involved in glycolysis, lipogenesis, and bile acid synthesis6-8. This compartmentalized yet unified structural design enables the liver to perform many metabolic functions that are crucial in maintaining homeostasis at the tissue level and in the whole body. However, both anatomical and physiological functions of the liver in CLD become dysregulated as a culmination of cellular, genomic, and metabolic changes, which can eventually lead to liver failure.

Figure 1.1. Metabolic Zonation in the Liver. Hepatocytes, the major parenchymal cells in the liver, are aligned in a one-cell thick hepatic plate that is situated in between hepatic sinusoids. Oxygenated blood from the hepatic artery in the portal triad flows within the sinusoids, mixes with the deoxygenated blood, and drains to the central vein. The oxygen gradient that is generated by this blood flow influences the metabolic functions of hepatocytes. Oxygen requiring enzymes such as those needed for protein secretion, cholesterol synthesis, fatty acid oxidation, and ureagenesis are expressed in hepatocytes surrounding the portal triad. In contrast, hepatocytes around the central vein express enzymes that require minimal to no oxygen, such as those for glycolysis, lipogenesis, and bile acid synthesis.

Pathophysiology and Treatment of Chronic Liver Diseases

CLD is caused by a variety of etiological factors that include viral infections, alcohol and drug abuse, autoimmune disorders, genetic disorders, and metabolic syndrome (i.e., obesity, diabetes). Regardless of the causative agent, the initial stage of CLD is hepatocellular injury (Figure 1.2), which is manifested histologically as hepatocyte ballooning9, swelling, fatty liver or steatosis10,11, the presence of inclusion bodies (in some cases)12, and cell death13.

These cellular changes trigger the immune system and promote inflammation, as well as tissue repair14-16. The liver initially undergoes structural changes ensuing from the deposition of extracellular matrix (ECM) components that promote cell proliferation and tissue regeneration17. Subsequently, ECM is degraded by metalloproteinases, resulting in cessation of wound healing responses. However, the persistence of causative agents can lead to an iterative process of injury and repair, thus, excessive wound healing often leads to the second stage of CLD called fibrosis.

In a fibrotic liver, Kupffer cells secrete cytokines that activate the major fibrogenic cell type called hepatic stellate cells (HSCs)18,19. In turn, activated HSCs differentiate into myofibroblasts that generate ECM, which form networks of fibrillary collagen that fill the gaps wherein hepatocytes fail to regenerate. Excessive amounts of ECM, in addition to their altered degradation, increases liver stiffness and portal hypertension20. Without any treatment, unremitting fibrogenesis results in end-stage CLD called cirrhosis. The stiff fibrotic septa in a cirrhotic liver form bridges linking the portal triad and the central vein and encases hepatocytes in nodules. This encasement separates the blood supply from the hepatic plate, which compromises oxygen flow to the hepatocytes and impairs hepatocyte function21. At this end stage of CLD, nodules of hepatocytes undergo oncogenic transformations that promote an

Figure 1.2. Sequential Progression of Chronic Liver Disease. A spectrum of causative agents cause hepatocellular injury in the normal liver, leading to steatosis. Over a period of time and with the presence of co-morbidities and risk factors, liver steatosis progresses to fibrosis. At this stage, fibrosis can be resolved upon the removal of the underlying cause or with the use of anti-fibrotic drugs. However, untreated fibrosis can further progress to cirrhosis, a major risk factor for liver failure or the development of HCC. This is an adapted schematic from Pelicoro, et al. (Nat Rev Immunol 2014), Gao & Bataller (Gastroenterol 2011), Alhadad, et al. (Annals of Clin & Lab Res 2017), and The Internet Pathology Laboratory from the University of Utah.

abnormal proliferative and metabolic phenotype18,21. Thus, the presence of cirrhosis is a major risk factor for liver failure and the development of hepatocellular carcinoma (HCC).

HCC Development and the Role of Alcohol

HCC accounts for more than 90% of primary liver cancer cases with over 850,000 new diagnoses per year22 and a 5-year survival rate of 18%23,24. HCC is the fourth leading cause of cancer deaths worldwide, and it affects men 2-4 times more than women25. Decades of research on the pathophysiology of HCC have shown that it develops in the context of cirrhosis.

However, more recent studies have reported that approximately 20% of the total HCC cases arise from a non-cirrhotic liver26-28. Comparative studies have shown that in the absence of cirrhosis, non-alcoholic alcoholic fatty liver disease (NAFLD) and alcoholic liver disease

(ALD) are increasingly associated with HCC26,29,30. These diseases result in metabolic syndrome and insulin resistance, which eventually promote carcinogenesis by inducing recurring inflammation and perturbing cellular metabolism31,32.

Excessive alcohol consumption is a major risk factor for HCC in the United States (only second to viral hepatitis infections). Although the mechanistic association between non- cirrhotic ALD and HCC is less studied than NAFLD, it follows a similar oncogenic trajectory that involves insulin resistance and affects virtually most aspects of cellular metabolism33-36.

Acetaldehyde, which is the byproduct of ethanol oxidation, directly promotes insulin resistance by inhibiting the transcriptional activity of peroxisome proliferator–activated receptor α

(PPARα)37. Furthermore, acetaldehyde also elevates cellular energy state by virtue of NADH and ATP generation38. This leads to a decrease in the concentrations of AMP and hypoactivation of AMP-activated protein kinase (AMPK), the main regulator of cellular energy metabolism38. In both cases of AMPK inhibition and insulin resistance, hepatic glucose

production39, lipid synthesis39-41, and cell proliferation42 are induced. Additionally, the anti- inflammatory effects of both AMPK and insulin are suppressed, thereby supporting chronic inflammation43,44. Apart from these impaired functions, ethanol oxidation is associated with epigenetic changes, such as DNA methylation and histone acetylation that affect gene transcription45. Taken together, the direct and indirect consequences of excessive alcohol consumption may exert pro-tumorigenic actions that have some similarities with events occurring in alcohol-mediated cirrhosis. These studies highlight the possibility of a converging mechanism that governs the shift from reversible hepatic injury to HCC.

Tight Regulation of Cellular Energy Metabolism Maintains Liver Homeostasis

Extracellular nucleotides and nucleosides modulate various physiological functions in all tissues, including in the liver, and their regulation is critical in maintaining a balanced state.

Walter B. Cannon, elaborating on the newly formed concept of physiological homeostasis, offered the following assessment in 1929: “The highly developed living being is an open system having many relations to its surroundings – in the respiratory and alimentary tracts and through surface receptors, neuromuscular organs and bony levers. Changes in the surroundings excite reactions in this system, or affect it directly, so that internal disturbances of the system are produced”46. That same year, Karl Lohmann discovered adenosine triphosphate (ATP)47, which was later coined as the cellular energy currency at the center of all living systems48. Another major discovery in 1929 by Alan Drury and Albert Scent-Gyorgyi was the ability of adenosine to control major activities within the mammalian cardiovascular, nervous, digestive, and renal systems49, which ultimately paved the way for adenosine to be clinically approved for use in treating cardiovascular diseases50. Four decades following the initial breakthroughs in ATP and adenosine, Geoffrey Burnstock demonstrated that ATP is

released outside the cell as part of the purinergic system and exerts autocrine or paracrine activities51-53. This biochemical and functional understanding of ATP and adenosine provided mechanistic insights into how cells integrate internal and external cues to maintain homeostasis.

Burnstock’s seminal discovery of the purinergic pathway highlights the importance of cellular energy regulation and function. In a normal (non-diseased) state, cells produce and consume ATP in a tightly regulated manner, thereby ensuring “internal disturbances” are kept within a narrow range54. This provides optimal organismal function despite constant external fluctuations. In addition to its use as fuel to power essential activities within the cell, ATP is also released outside the cell55. In the liver, extracellular release of ATP stimulates important physiological functions such as bile acid secretion and glycogen metabolism56. However, released ATP may also serve as a “danger” molecule that can trigger the infiltration of immune cells56. Thus, ATP signaling outside the cell is controlled by the sequential removal of its phosphate groups to form the nucleoside adenosine. Endogenous extracellular adenosine is the enzymatic product of adenosine monophosphate (AMP) hydrolysis by 5’-nucleotidase (5’-

NT), which is the primary focus of this thesis.

5-NT and Extracellular Adenosine in Physiological Adaptation and Disease Development

5’-NT is classified as an ectonucleotidase based on its function57. Ectonucleotidases are enzymes that metabolize extracellular nucleotides as part of the purinergic system52,58.

Purinergic signaling is a universal mechanism by which cells control their own activities and interact with other cells, or with the extracellular matrix57,58. The purinergic system is highly adaptable to changing environmental conditions59. While this adaptability is crucial for maintaining homeostasis, long lasting changes in the set points within the system can promote

the development of diseases that are driven by metabolic perturbations and chronic inflammation, such as cancer60. In many cancer types, 5’-NT upregulation and increased adenosine production within the tumor microenvironment have been linked to the suppression of anti-tumor immune responses and more aggressive tumor behavior61. Because of this, the inhibition of 5’-NT is currently regarded as an important therapeutic avenue for cancer therapy and is being tested in clinical trials62-64. However, given the important functions of adenosine across cells and tissues65 and the direct link between genetic 5’-NT deficiency and human vascular disease66, the long-term safety of systemic interventions blocking 5’-NT activity to reduce adenosine production must be further examined. Thus, a more comprehensive molecular understanding of the initiation, propagation, and termination of endogenous adenosine and 5’NT signaling will reveal their therapeutic potential in diseases such as HCC.

5’NT/CD73 in Chronic Liver Disease

5’NT, more commonly known as CD73, is the protein product of the NT5E gene. In the normal liver, CD73 is a glycosylphosphatidyl-inositol anchored glycoprotein that is expressed on the apical membrane of hepatocytes and endothelial cells, albeit at lower levels in the latter67. CD73 is also expressed in activated hepatic stellate cells that differentiate in to myofibroblasts during hepatic fibrosis68. Although there are other phosphatases present in the normal liver, CD73 is considered the key enzyme that dephosphorylates AMP to generate the majority of extracellular adenosine69. Subsequently, adenosine activates four types of adenosine receptors (A1R, A2AR, A2BR, A3R), or is transported into the cytoplasm through equilibrative or concentrative nucleoside transporters (ENT1/2, CNT1/2)70.

Early studies in the 1960s implicated CD73 as a potential diagnostic marker for liver diseases71-74. However, the results were inconclusive and were shrouded by the presence of

other phosphatases. It was not until the creation of the global CD73 knockout mice that showed

CD73 as a critical component in CLD67. These studies demonstrated that the loss of CD73 conferred protection against hepatic fibrosis75, steatosis76,77, and the formation of pathologic hepatocyte inclusions called Mallory-Denk bodies77,78. In contrast, CD73 is transcriptionally downregulated in human liver fibrosis, regardless of the etiology or severity79. Moreover,

CD73 is post-transcriptionally regulated via alternative splicing to generate the variant isoform

(CD73S)79. In human HCC, CD73S targets the canonical CD73 isoform for degradation, potentially leading to a loss of CD73-geneated adenosine79. These studies highlight the complexity of CD73 in chronic liver diseases and warrants further investigation. Furthermore, the significance of CD73 and CD73-generated adenosine in different cell types of the liver, particularly in parenchymal cells have yet to be established.

Rationale and Objectives

Given that hepatocyte injury is a central event in CLD and in non-cirrhotic HCC, my central hypothesis is that CD73 has distinct homeostatic and disease-related functions in the liver. To test this hypothesis, we set out with the following specific aims:

1. Define the cell-specific role of CD73 in the liver. (Chapter 3)

2. Determine if hepatocyte CD73 regulates alcohol-induced liver injury. (Chapter 4)

3. Examine CD73 regulation in human hepatocellular carcinoma. (Chapter 5)

In light of these proposed aims, this dissertation hopes to fill the gap in knowledge of potential converging mechanisms between cirrhotic- and non-cirrhotic HCC that may be exploited for diagnostic and therapeutic purposes. Using multiple models of CLD in humans and mice, this dissertation aspires to define gatekeepers of hepatic resilience to toxins and stress and examine the switch to CLD progression.

REFERENCES

1 Asrani, S. K., Devarbhavi, H., Eaton, J. & Kamath, P. S. Burden of liver diseases in the world. J Hepatol 70, 151-171, doi:10.1016/j.jhep.2018.09.014 (2019).

2 Tapper, E. B. & Parikh, N. D. Mortality due to cirrhosis and liver cancer in the United States, 1999-2016: observational study. BMJ 362, k2817, doi:10.1136/bmj.k2817 (2018).

3 Hirode, G., Saab, S. & Wong, R. J. Trends in the Burden of Chronic Liver Disease Among Hospitalized US Adults. JAMA Netw Open 3, e201997, doi:10.1001/jamanetworkopen.2020.1997 (2020).

4 Neuberger, J. An update on liver transplantation: A critical review. J Autoimmun 66, 51-59, doi:10.1016/j.jaut.2015.08.021 (2016).

5 Lee, S. Y., Kim, H. J. & Choi, D. Cell sources, liver support systems and liver tissue engineering: alternatives to liver transplantation. Int J Stem Cells 8, 36-47, doi:10.15283/ijsc.2015.8.1.36 (2015).

6 Kietzmann, T. Metabolic zonation of the liver: The oxygen gradient revisited. Redox biology 11, 622-630, doi:10.1016/j.redox.2017.01.012 (2017).

7 Mylonis, I., Simos, G. & Paraskeva, E. Hypoxia-Inducible Factors and the Regulation of Lipid Metabolism. Cells 8, doi:10.3390/cells8030214 (2019).

8 Del Rey, M. J. et al. Hif-1α Knockdown Reduces Glycolytic Metabolism and Induces Cell Death of Human Synovial Fibroblasts Under Normoxic Conditions. Sci Rep 7, 3644, doi:10.1038/s41598-017-03921-4 (2017).

9 Lackner, C. et al. Ballooned hepatocytes in steatohepatitis: the value of keratin immunohistochemistry for diagnosis. J Hepatol 48, 821-828, doi:10.1016/j.jhep.2008.01.026 (2008).

10 El-Zayadi, A. R. Hepatic steatosis: a benign disease or a silent killer. World J Gastroenterol 14, 4120-4126, doi:10.3748/wjg.14.4120 (2008).

11 Gao, B. & Bataller, R. Alcoholic liver disease: pathogenesis and new therapeutic targets. Gastroenterology 141, 1572-1585, doi:10.1053/j.gastro.2011.09.002 (2011).

12 Strnad, P. et al. Broad spectrum of hepatocyte inclusions in humans, animals, and experimental models. Compr Physiol 3, 1393-1436, doi:10.1002/cphy.c120032 (2013).

13 Malhi, H., Guicciardi, M. E. & Gores, G. J. Hepatocyte death: a clear and present danger. Physiol Rev 90, 1165-1194, doi:10.1152/physrev.00061.2009 (2010).

14 Gilgenkrantz, H. & Collin de l'Hortet, A. New insights into liver regeneration. Clin Res Hepatol Gastroenterol 35, 623-629, doi:10.1016/j.clinre.2011.04.002 (2011).

15 Diehl, A. M. & Rai, R. Review: regulation of liver regeneration by pro-inflammatory cytokines. J Gastroenterol Hepatol 11, 466-470, doi:10.1111/j.1440- 1746.1996.tb00292.x (1996).

16 Valizadeh, A., Majidinia, M., Samadi-Kafil, H., Yousefi, M. & Yousefi, B. The roles of signaling pathways in liver repair and regeneration. J Cell Physiol, doi:10.1002/jcp.28336 (2019).

17 Klaas, M. et al. The alterations in the extracellular matrix composition guide the repair of damaged liver tissue. Sci Rep 6, 27398, doi:10.1038/srep27398 (2016).

18 Okuda, H. Hepatocellular carcinoma development in cirrhosis. Best Pract Res Clin Gastroenterol 21, 161-173, doi:10.1016/j.bpg.2006.07.002 (2007).

19 Pellicoro, A., Ramachandran, P., Iredale, J. P. & Fallowfield, J. A. Liver fibrosis and repair: immune regulation of wound healing in a solid organ. Nat Rev Immunol 14, 181- 194, doi:10.1038/nri3623 (2014).

20 Bataller, R. & Brenner, D. A. Liver fibrosis. J Clin Invest 115, 209-218, doi:10.1172/JCI24282 (2005).

21 Schuppan, D. & Afdhal, N. H. Liver cirrhosis. Lancet 371, 838-851, doi:10.1016/S0140-6736(08)60383-9 (2008).

22 Villanueva, A. Hepatocellular Carcinoma. N Engl J Med 380, 1450-1462, doi:10.1056/NEJMra1713263 (2019).

23 Jemal, A. et al. Annual Report to the Nation on the Status of Cancer, 1975-2014, Featuring Survival. J Natl Cancer Inst 109, doi:10.1093/jnci/djx030 (2017).

24 Llovet, J. M. et al. Hepatocellular carcinoma. Nat Rev Dis Primers 2, 16018, doi:10.1038/nrdp.2016.18 (2016).

25 McGlynn, K. A., Petrick, J. L. & El-Serag, H. B. Epidemiology of Hepatocellular Carcinoma. Hepatology, doi:10.1002/hep.31288 (2020).

26 Desai, A., Sandhu, S., Lai, J. P. & Sandhu, D. S. Hepatocellular carcinoma in non- cirrhotic liver: A comprehensive review. World J Hepatol 11, 1-18, doi:10.4254/wjh.v11.i1.1 (2019).

27 Lee, D. H. & Lee, J. M. Primary malignant tumours in the non-cirrhotic liver. Eur J Radiol 95, 349-361, doi:10.1016/j.ejrad.2017.08.030 (2017).

28 Liu, S., Chan, K. W., Wang, B. & Qiao, L. Fibrolamellar hepatocellular carcinoma. Am J Gastroenterol 104, 2617-2624; quiz 2625, doi:10.1038/ajg.2009.440 (2009).

29 Paradis, V. et al. Hepatocellular carcinomas in patients with metabolic syndrome often develop without significant liver fibrosis: a pathological analysis. Hepatology 49, 851- 859, doi:10.1002/hep.22734 (2009).

30 Yasui, K. et al. Characteristics of patients with nonalcoholic steatohepatitis who develop hepatocellular carcinoma. Clin Gastroenterol Hepatol 9, 428-433; quiz e450, doi:10.1016/j.cgh.2011.01.023 (2011).

31 Starley, B. Q., Calcagno, C. J. & Harrison, S. A. Nonalcoholic fatty liver disease and hepatocellular carcinoma: a weighty connection. Hepatology 51, 1820-1832, doi:10.1002/hep.23594 (2010).

32 Perumpail, R. B., Liu, A., Wong, R. J., Ahmed, A. & Harrison, S. A. Pathogenesis of hepatocarcinogenesis in non-cirrhotic nonalcoholic fatty liver disease: Potential mechanistic pathways. World J Hepatol 7, 2384-2388, doi:10.4254/wjh.v7.i22.2384 (2015).

33 You, M. & Arteel, G. E. Effect of ethanol on lipid metabolism. J Hepatol 70, 237-248, doi:10.1016/j.jhep.2018.10.037 (2019).

34 Bhavani, K. et al. Effect of ethanol on p36 protein kinase substrate and insulin receptor substrate 1 expression and tyrosyl phosphorylation in human hepatocellular carcinoma

cells. Alcohol Clin Exp Res 19, 441-446, doi:10.1111/j.1530-0277.1995.tb01528.x (1995).

35 Onishi, Y. et al. Ethanol feeding induces insulin resistance with enhanced PI 3-kinase activation. Biochem Biophys Res Commun 303, 788-794, doi:10.1016/s0006- 291x(03)00407-8 (2003).

36 Shelmet, J. J. et al. Ethanol causes acute inhibition of carbohydrate, fat, and protein oxidation and insulin resistance. J Clin Invest 81, 1137-1145, doi:10.1172/JCI113428 (1988).

37 Galli, A., Pinaire, J., Fischer, M., Dorris, R. & Crabb, D. W. The transcriptional and DNA binding activity of peroxisome proliferator-activated receptor alpha is inhibited by ethanol metabolism. A novel mechanism for the development of ethanol-induced fatty liver. J Biol Chem 276, 68-75, doi:10.1074/jbc.M008791200 (2001).

38 Wilson, D. F. & Matschinsky, F. M. Ethanol metabolism: The good, the bad, and the ugly. Med Hypotheses 140, 109638, doi:10.1016/j.mehy.2020.109638 (2020).

39 Santoleri, D. & Titchenell, P. M. Resolving the Paradox of Hepatic Insulin Resistance. Cell Mol Gastroenterol Hepatol 7, 447-456, doi:10.1016/j.jcmgh.2018.10.016 (2019).

40 Aoyama, T. et al. Altered constitutive expression of fatty acid-metabolizing enzymes in mice lacking the peroxisome proliferator-activated receptor alpha (PPARalpha). J Biol Chem 273, 5678-5684, doi:10.1074/jbc.273.10.5678 (1998).

41 You, M., Matsumoto, M., Pacold, C. M., Cho, W. K. & Crabb, D. W. The role of AMP- activated protein kinase in the action of ethanol in the liver. Gastroenterology 127, 1798-1808, doi:10.1053/j.gastro.2004.09.049 (2004).

42 Leclercq, I. A., Da Silva Morais, A., Schroyen, B., Van Hul, N. & Geerts, A. Insulin resistance in hepatocytes and sinusoidal liver cells: mechanisms and consequences. J Hepatol 47, 142-156, doi:10.1016/j.jhep.2007.04.002 (2007).

43 Zhang, N. et al. Peroxisome proliferator activated receptor alpha inhibits hepatocarcinogenesis through mediating NF-kappaB signaling pathway. Oncotarget 5, 8330-8340, doi:10.18632/oncotarget.2212 (2014).

44 Peng, X., Li, J., Wang, M., Qu, K. & Zhu, H. A novel AMPK activator improves hepatic lipid metabolism and leukocyte trafficking in experimental hepatic steatosis. J Pharmacol Sci 140, 153-161, doi:10.1016/j.jphs.2019.05.008 (2019).

45 French, S. W. Epigenetic events in liver cancer resulting from alcoholic liver disease. Alcohol Res 35, 57-67 (2013).

46 Cannon, W. B. Organization for physiological homeostasis. Physiological reviews 9, 399-431 (1929).

47 Langen, P. & Hucho, F. Karl Lohmann and the discovery of ATP. Angew Chem Int Ed Engl 47, 1824-1827, doi:10.1002/anie.200702929 (2008).

48 Lipmann, F. Metabolic generation and utilization of phosphate bond energy. Advances in enzymology and related areas of molecular biology 1, 99-162 (1941).

49 Drury, A. N. & Szent-Gyorgyi, A. The physiological activity of adenine compounds with especial reference to their action upon the mammalian heart. J Physiol 68, 213- 237, doi:10.1113/jphysiol.1929.sp002608 (1929).

50 Camm, A. J. & Garratt, C. J. Adenosine and supraventricular tachycardia. N Engl J Med 325, 1621-1629, doi:10.1056/NEJM199112053252306 (1991).

51 Burnstock, G. Introduction to Purinergic Signaling. Methods Mol Biol 2041, 1-15, doi:10.1007/978-1-4939-9717-6_1 (2020).

52 Burnstock, G. Purinergic nerves. Pharmacol Rev 24, 509-581 (1972).

53 Burnstock, G. Pathophysiology and therapeutic potential of purinergic signaling. Pharmacol Rev 58, 58-86, doi:10.1124/pr.58.1.5 (2006).

54 Wilson, D. F. Oxidative phosphorylation: regulation and role in cellular and tissue metabolism. J Physiol 595, 7023-7038, doi:10.1113/JP273839 (2017).

55 Khakh, B. S. & Burnstock, G. The double life of ATP. Sci Am 301, 84-90, 92, doi:10.1038/scientificamerican1209-84 (2009).

56 Burnstock, G., Vaughn, B. & Robson, S. C. Purinergic signalling in the liver in health and disease. Purinergic Signal 10, 51-70, doi:10.1007/s11302-013-9398-8 (2014).

57 Zimmermann, H. History of ectonucleotidases and their role in purinergic signaling. Biochem Pharmacol, 114322, doi:10.1016/j.bcp.2020.114322 (2020).

58 Zimmermann, H. Ectonucleoside triphosphate diphosphohydrolases and ecto-5′- nucleotidase in purinergic signaling: how the field developed and where we are now. Purinergic Signalling, 1-9 (2020).

59 Burnstock, G. Pathophysiology and therapeutic potential of purinergic signaling. Pharmacological reviews 58, 58-86 (2006).

60 Kotas, M. E. & Medzhitov, R. Homeostasis, inflammation, and disease susceptibility. Cell 160, 816-827 (2015).

61 Allard, B., Allard, D., Buisseret, L. & Stagg, J. The adenosine pathway in immuno- oncology. Nature Reviews Clinical Oncology 17, 611-629 (2020).

62 Roh, M., Wainwright, D. A., Wu, J. D., Wan, Y. & Zhang, B. Targeting CD73 to augment cancer immunotherapy. Current Opinion in Pharmacology 53, 66-76 (2020).

63 Antonioli, L., Yegutkin, G. G., Pacher, P., Blandizzi, C. & Haskó, G. Anti-CD73 in cancer immunotherapy: awakening new opportunities. Trends in cancer 2, 95-109 (2016).

64 Boison, D. & Yegutkin, G. G. Adenosine metabolism: emerging concepts for cancer therapy. Cancer Cell 36, 582-596 (2019).

65 Layland, J., Carrick, D., Lee, M., Oldroyd, K. & Berry, C. Adenosine: physiology, pharmacology, and clinical applications. JACC: Cardiovascular Interventions 7, 581- 591 (2014).

66 St. Hilaire, C. et al. NT5E mutations and arterial calcifications. New England Journal of Medicine 364, 432-442 (2011).

67 Minor, M., Alcedo, K. P., Battaglia, R. A. & Snider, N. T. Cell type- and tissue-specific functions of ecto-5'-nucleotidase (CD73). Am J Physiol Cell Physiol 317, C1079- C1092, doi:10.1152/ajpcell.00285.2019 (2019).

68 Fausther, M., Sheung, N., Saiman, Y., Bansal, M. B. & Dranoff, J. A. Activated hepatic stellate cells upregulate transcription of ecto-5'-nucleotidase/CD73 via specific SP1 and SMAD promoter elements. Am J Physiol Gastrointest Liver Physiol 303, G904- 914, doi:10.1152/ajpgi.00015.2012 (2012).

69 Fausther, M. et al. Coexpression of ecto-5'-nucleotidase/CD73 with specific NTPDases differentially regulates adenosine formation in the rat liver. Am J Physiol Gastrointest Liver Physiol 302, G447-459, doi:10.1152/ajpgi.00165.2011.

70 Pastor-Anglada, M. & Perez-Torras, S. Emerging Roles of Nucleoside Transporters. Front Pharmacol 9, 606, doi:10.3389/fphar.2018.00606 (2018).

71 Young, II. Serum 5-nucleotidase; characterization and evaluation in disease states. Ann N Y Acad Sci 75, 357-362, doi:10.1111/j.1749-6632.1958.tb36883.x (1958).

72 Kowlessar, O. D., Haeffner, L. J., Riley, E. M. & Sleisenger, M. H. Comparative study of serum leucine aminopeptidase, 5-nucleotidase and non-specific alkaline phosphatase in diseases affecting the pancreas, hepatobiliary tree and bone. Am J Med 31, 231-237, doi:10.1016/0002-9343(61)90111-5 (1961).

73 Schwartz, M. K. & Bodansky, O. Serum 5'-Nucleotidase in Patients with Cancer. Cancer 18, 886-892, doi:10.1002/1097-0142(196507)18:7<886::aid- cncr2820180717>3.0.co;2-b (1965).

74 Smith, K. et al. Serum 5'-nucleotidase in patients with tumor in the liver. Cancer 19, 1281-1285, doi:10.1002/1097-0142(196609)19:9<1281::aid- cncr2820190914>3.0.co;2-0 (1966).

75 Peng, Z. et al. Ecto-5'-nucleotidase (CD73) -mediated extracellular adenosine production plays a critical role in hepatic fibrosis. FASEB J 22, 2263-2272, doi:10.1096/fj.07-100685 (2008).

76 Peng, Z. et al. Adenosine signaling contributes to ethanol-induced fatty liver in mice. J Clin Invest 119, 582-594, doi:10.1172/JCI37409 (2009).

77 Kucukoglu, O. et al. High-fat diet triggers Mallory-Denk body formation through misfolding and crosslinking of excess keratin 8. Hepatology 60, 169-178, doi:10.1002/hep.27068 (2014).

78 Snider, N. T. et al. CD73 (ecto-5'-nucleotidase) hepatocyte levels differ across mouse strains and contribute to mallory-denk body formation. Hepatology 58, 1790-1800, doi:10.1002/hep.26525 (2013).

79 Snider, N. T. et al. Alternative splicing of human NT5E in cirrhosis and hepatocellular carcinoma produces a negative regulator of ecto-5'-nucleotidase (CD73). Mol Biol Cell 25, 4024-4033, doi:10.1091/mbc.E14-06-1167 (2014).

CHAPTER 2: THE ELEGANT COMPLEXITY OF 5’-NUCLEOTIDASE (CD73)

Overview

Cells produce and consume ATP in a tightly regulated manner to ensure optimal organismal function in the presence of continuous external fluctuations. In addition to being used as fuel to power essential activities within the cell, ATP can also be released outside of the cell, where the sequential removal of its phosphate groups results in the formation of the nucleoside adenosine1. Adenosine and its associated synthetic and catabolic enzymes, receptors, and transporters are part of the evolutionarily conserved purinergic system, which controls fundamental cellular activities and physiological responses across different tissues2.

Adaptability in purinergic signaling is crucial for maintaining baseline homeostasis and regaining homeostasis after stress. However, long lasting changes in the setpoints within the system can promote the development of diseases that are driven by metabolic perturbations and chronic inflammation, such as cancer3.

Endogenous extracellular adenosine is the enzymatic product of adenosine monosphosphate (AMP) hydrolysis by the enzyme 5'-nucleotidase (CD73). Over the last 10 years, CD73 upregulation and increased adenosine production within the tumor microenvironment have been linked to the suppression of anti-tumor immune responses and more aggressive tumor behavior4. Because of this, blocking the enzymatic activity of CD73 is currently regarded as an important avenue for cancer therapy5. This has led to a rapid movement into clinical development and testing of multiple CD73-targeting antibodies and small molecule inhibitors within the past few years (Figure 2.1). The long-term safety of these

types of systemic interventions blocking CD73 activity to reduce adenosine production is an important consideration, because adenosine is critical for normal physiology, and loss-of- function mutations in the CD73-encoding gene (NT5E) cause a vascular disease in humans6.

Studies from the last 2-4 years have addressed many important questions surrounding the biology of CD73, including mechanisms of transcriptional regulation and dysregulation of the encoding gene (NT5E), unique functions of the mRNA, alternative isoforms, post-translational modifications, intracellular signaling mechanisms, and zonal expression pattern correlating with specialized metabolic activities in epithelial tissues.

The purpose of this overview is to render the latest discoveries on CD73 biology in a historical context and highlight functions that are important for normal cell biology and physiological homeostasis. Understanding the biological complexity of CD73 regulation and homeostatic functions will be critical for guiding translational and clinical efforts to target the

CD73-adenosine axis.

From 5’-NT to CD73: Changing Nomenclature and Shifting Research Directions

CD73 is an ectonucleotidase discovered more than 80 years ago, as 5′-nucleotidase (5′-

NT)7-9. It received the designation ‘cluster of differentiation 73 (CD73)’ prior the cloning of its cDNA in 199010,11. Ectonucleotidases are enzymes that metabolize extracellular nucleotides as part of the purinergic system8. To distinguish it from functionally similar cytoplasmic enzymes12, it is also called ecto-5′-nucleotidase (abbreviated eN or eNT).

Currently, 5′-NT, eN, eNT and CD73 are all used to refer to the protein product

(P21589; NP_002517) of the same gene, which is NT5E (Gene ID: 4907). The name CD73 is most commonly used in the recent literature (last 10-15 years) and this coincides with a major

Figure 2.1. CD73 is an Essential Component of Purinergic Signaling and a Novel Disease Target. CD73 is a ubiquitously expressed rate-limiting ectonucleotidase of the extracellular purine metabolism pathway. As a glycosylphosphatidylinositol (GPI) -anchored glycoprotein on the plasma membrane, CD73 works in tandem with ectonucleoside triphosphate diphosphohydrolase- 1 (CD39), which breaks down adenosine triphosphate (ATP) to adenosine 5’-monophosphate (AMP). Subsequently, CD73 dephosphorylates AMP to generate extracellular adenosine (Ado). CD73-generated adenosine directly exerts tissue-specific functions by binding to four different types of G-coupled adenosine receptors (AdoR). Additionally, extracellular adenosine is transported into the cytoplasm through equilibrative and concentrative nucleoside transporters (ENTs and CNTs). Due to its role in inflammatory responses and tumor growth and metastasis, small molecule inhibitors and monoclonal antibodies against CD73 are currently being tested in clinical trials for cancer immunotherapy and COVID-19 therapy.

focus on the functions of CD73 on immune and cancer cells. However, based on numerous studies to date, CD73 is expressed and functional across many cell types13, as has also been confirmed by recent large scale single cell profiling experiments done on mouse14 and human tissues15. Furthermore, CD73 is involved in virtually every aspect of normal physiology13,16, including the preservation of tissue barrier function17,18. With respect to immune regulation, recent studies show that non-immune cells, including fibroblasts, epithelial, and endothelial cells, which express high levels of CD73, are epigenetically primed to elicit tissue-specific immune responses19. Moreover, the purinergic system links cellular metabolism to a myriad of other processes including proliferation, differentiation, and cell death20. Therefore, the functional significance of CD73 is far from being limited to cells of the immune system, although it certainly is important in that context, particularly in the biology of regulatory T cells21.

Genetic Deficiency of CD73 and Cross-talk Between Purinergic Signaling and Gene Regulation

The AMP substrate that is used by CD73 to generate adenosine is supplied by the ectonucleoside triphosphate diphosphohydrolase (NTPDase) enzymes (Figure 2.1)7. NTPDase-

1 (CD39) is commonly implicated together with CD73 in controlling tissue inflammation22.

Recently, bifunctional proteins were engineered by fusing the extracellular domains of CD39 and CD7323. The fusion proteins exhibited high phosphohydrolysis activity towards extracellular ATP and anti- platelet activity in vitro, suggesting they could potentially be developed to treat inflammatory diseases by augmenting the conversion of pro-inflammatory

ATP to anti-inflammatory adenosine23. A similar approach may also be used as a strategy for patients with loss-of-function mutations in NT5E, which cause the rare disease ‘calcification of joint and arteries’ (CALJA; OMIM: 211800), also known as ‘arterial calcification due

to deficiency of CD73’ (ACDC)24. The calcifications affect the lower and upper extremities6,25,26 and the tissue-specific presentation is in line with recent quantitative profiling studies that reveal the highest NT5E/CD73 expression in human arteries in a comparison of 32 normal tissues27. The mechanisms linking NT5E mutations and clinical presentations are not fully understood, partly because genetic mouse models of CD73 deficiency do not reflect the human phenotype24. However, cellular models of ACDC utilizing patient fibroblasts and induced pluripotent stem cell (iPSC)-derived mesenchymal stromal cells (MSCs) are illuminating signaling mechanisms altered in the absence of CD7328,29. For example, ACDC patient fibroblasts exhibit dysregulated signaling via the transcription factor Forkhead Box O1

Protein (FOXO1)29. In addition, ACDC patient-derived MSCs display increased activation of

AKT kinase, mechanistic target of rapamycin (mTOR), and the 70-kDa ribosomal protein S6 kinase (p70S6K) in the presence of osteogenic stimuli28. It will be interesting to assess additional stress response mechanisms in ACDC model systems, as it was also shown recently that CD73 is important during stress recovery of bone marrow stromal cells30. Moreover, decreased levels of intracellular adenosine due to elevated activity of adenosine kinase, which phosphorylates intracellular adenosine to form AMP, exacerbate vascular inflammation via epigenetic reprogramming of histone methylation31. This mechanism was shown to be dependent on the uptake of extracellular adenosine. These new studies support the hypothesis that CD73 links extracellular purinergic signaling with gene regulation.

The Emerging Importance of Age and Sex in the Physiological Functions of CD73 and Adenosine

Adenosine has fascinated biologists for decades because it controls virtually every system in the body. It has been named a “retaliatory metabolite” because it enables target cells to adjust their energy supply and therefore retaliate against external stimuli that would

otherwise promote the excessive breakdown of ATP32. More recently, adenosine has been called a “multi-signaling guardian angel” because it restores the oxygen supply-and-demand balance and exerts potent anti- inflammatory effects to guard against cellular damage33. Along the same lines, CD73 exerts numerous protective functions13, including cardiac healing34 and early immune responses35,36. An emerging concept in the field is that there are critical hormonal influences, particularly estrogen-derived, in how males and females metabolize extracellular adenosine and cope with deficiency of CD7337-40. How biological sex will impact the safety and effectiveness of CD73-targeted therapeutics is not clear, but it is an important question moving forward. Age and aging-related stress responses are other important considerations, given recent findings that CD73 expression levels change throughout the human lifespan41 and that

CD73 activity can be either beneficial or disease-promoting in atherosclerosis models, depending on age42.

Cellular Uptake-Mediated versus Receptor-Mediated Effects of CD73-Derived Adenosine

Adenosine is taken up into the cell and re-phosphorylated to replenish intracellular

ATP stores, which represents an important mechanism for purine salvage8. In addition, the uptake of adenosine via adenosine transporters, followed by phosphorylation by adenosine kinase leads to increased levels of AMP and activation of the master metabolic regulator AMP- activated protein kinase (AMPK)43. This was shown to be important for mammalian liver homeostasis because re-activation of AMPK in mice protected against metabolic disorders including diet-induced non-alcoholic fatty liver disease44-46.

Extracellular adenosine also signals via cell surface receptors. There are four ubiquitously expressed metabotropic adenosine receptors (A1, A2A, A2B, and A3) and their G- protein coupled activities regulate cardiovascular and respiratory functions, metabolism,

neurological activity, gastrointestinal and liver biology47. Recently, mice that lack all four adenosine receptors were generated and reported to have significantly shorter lifespan48. The decline in survival began at 15 weeks of age and reached 50% by the time the mice were 30 weeks old48. Based on this mouse model, baseline adenosine signaling via adenosine receptors appears to be critical for long- term organismal viability. Still, the mechanisms leading to shortened life span in mice lacking all four adenosine receptors are unknown. Going forward, this mouse model will be a useful tool to address the role of adenosine signaling not only in homeostasis, but also in allostasis - the process by which regulatory systems adapt under stress in order to regain homeostasis49.

Direct activation of adenosine receptors by small molecules with selective affinity for each receptor type represents an important avenue for drug development for cardiovascular diseases, pain, cancer, diabetes, liver disease and other disorders50. Recent advances in the structural biology of adenosine receptors51-54, including allosteric regulation by membrane cholesterol55,56 and cations, such as calcium and magnesium57 should support future efforts in this area.

The Importance of Location: Zonal Distribution of CD73 in Digestive Epithelia

Adaptability of the purinergic system is especially important in gastrointestinal and liver biology due to the constant exposure of the cells within these tissues to environmental factors. Division of labor among epithelial cells that make up the bulk of digestive tissues, particularly enterocytes in the small intestine and hepatocytes in the liver, enable functional efficiency in homeostasis while minimizing systemic perturbations during chronic stress conditions. The importance of CD73 distribution and activity in the intestinal epithelium was shown nearly 25 years ago through work demonstrating that its distribution and apical

localization in the intestine is critical for the ability of adenosine to promote electrogenic chloride secretion58. The apical membrane localization and activity of CD73 in hepatocytes was described in the 1950s59 and CD73 was initially used to study protein trafficking mechanisms in hepatocytes60.

Single cell technologies are advancing our understanding of how functional specialization among the same cell types in digestive tissues is achieved and maintained. A common mechanism in the intestine and the liver is the existence of an oxygen gradient, which patterns zonal expression of CD73 in low oxygen areas, including the villus tip enterocytes of the small intestine61 and the pericentral hepatocytes in the liver62 (Figure 2.2).

CD73 and Intestinal Epithelial Homeostasis

The hypoxic environment of the intestinal lumen is controlled by anaerobic bacteria that form the gut microbiome, which is physically and chemically separated from the host immune system by a mucosal barrier63. Intestinal epithelial cells adapt to oxygen availability by modulating the expression of hypoxia-inducible factors (HIFs), which are degraded under high oxygen conditions and stabilized under low oxygen conditions63. HIFs support energy- demanding cellular metabolic activities under physiologically low oxygen conditions, and hypoxia is known to trigger alternative pathways of adenosine metabolism64,65. The regulated cell surface expression of CD73 in intestinal epithelia under conditions of limited oxygen availability was demonstrated in work published nearly 20 years ago66. Elevation of CD73 expression and activity under these conditions is dependent on hypoxia response element -

1 (HIF-1) in the NT5E promoter66.

Follow-up studies showed that the function of CD73 and adenosine is to protect the intestinal epithelial barrier under these conditions, and most of this work has been reviewed

Figure 2.2. Zonal Expression of CD73 Supports Tissue-Specific Homeostasis. A hypoxic environment induces CD73 expression in the apical membrane of different tissues. In the intestinal epithelia, for example, CD73 is present at the villus tips of enterocytes, which are subjected to low oxygen conditions. The villus tips face the intestinal lumen where anaerobic bacteria normally reside. Similarly, CD73 is zonally expressed in hepatocytes in the liver. In the hepatic lobule, periportal hepatocytes are located next to the portal triad on one side (encompassing the hepatic artery, vein, and bile duct), and the pericentral hepatocytes are adjacent to the central vein on the opposite side. This arrangement follows the oxygen gradient: highly oxygenated blood enters the liver via the hepatic artery from the portal triad, mixes with deoxygenated blood through the sinusoids between hepatocytes and is returned to the circulation via the central vein.

previously67. Recently it was demonstrated that Nt5e/CD73 expression in the mouse small intestine is restricted to enterocytes at the very tip of the villus, whereas most other purine catabolism genes were expressed across multiple zones of the villus61. Nt5e expression and detection of CD73 on the luminal side of the villus tip was strongly correlated with the expression of Slc28a2, which encodes a high-affinity adenosine transporter61. One potential reason for the preferential localization of CD73 at the villus tip is to counteract the ATP released by bacteria in the intestinal lumen and thereby control inappropriate immune activation by the host microbiome. Other functions of apically localized CD73 in the intestine are coming into focus, including the metabolism of cyclic dinucleotides to regulate host defense mechanisms at mucosal surfaces68 and serve as a source of antimicrobial adenosine to protect against bacterial colonization and infection68.

CD73 and Liver Homeostasis

Similar to the intestinal epithelium, oxygen tension across the hepatic lobule is a key determinant of hepatocyte metabolic zonation. Metabolic zonation in the liver pertains to the heterogeneous distribution pattern of enzymes, resulting in periportal enrichment of protein secretion, cholesterol synthesis, and fatty acid oxidation functions, and pericentral enrichment of glycolytic, lipogenic, and bile acid synthesizing functions69. The zoning of hepatocytes controls normal liver metabolism and is significantly disrupted in chronic liver diseases that have a strong metabolic and inflammatory component70. Recent single cell sequencing studies found that Nt5e is zonally distributed across the liver lobule and concentrated on the apical membrane of hepatocytes surrounding the central vein, but not around the portal triad62. The significance of Nt5e zonation in the liver may be to endow hepatocytes to calibrate their metabolic activities under physiologically low oxygen conditions in the pericentral region. An

important new direction for the field will be to address the mechanisms by which CD73 and its associated signaling pathways control physiological adaptation in digestive tissues and in other epithelia, such as the kidney. To that end, it was also reported recently that CD73 exhibits hypoxia- driven zonal distribution and enrichment on erythropoietin-producing renal interstitial cells71.

Complex Regulation of CD73 mRNA, Protein, and Enzymatic Activity

In addition to hypoxia, an emerging concept is that NT5E is a direct transcriptional target of yes-associated protein (YAP) and the transcriptional coactivator with PDZ-binding motif (TAZ)72, which integrate metabolic signals and cellular growth to regulate organ size73.

The interaction between YAP/TAZ and CD73 could especially be relevant in cancer cells.

However, it is important to note that while many studies report that CD73 is upregulated in cancer, very few address the level at which the upregulation occurs, such as mRNA expression, protein expression, or enzymatic activity (Figure 2.3). The specific mechanism is an important consideration because upregulation at the mRNA level does not necessarily result in increased protein expression, while increased protein expression does not always correlate with increased enzymatic activity74. Moreover, the possibility that NT5E mRNA upregulation in cancer could act independently of CD73 enzymatic activity has not been fully explored. Indeed, a novel tumor-promoting non-coding circular RNA with oncogenic activity called circNT5E was recently discovered in glioblastoma75 (Figure 3.3). The circNT5E mRNA arose from exon

3-9 region of NT5E through the activity of the double-stranded RNA-specific editase B2

(ADARB2). The pro-tumorigenic activity of circNT5E was linked to its ability to act as a sponge, or sink, for tumor suppressor micro RNAs, including miR-422a75. Similar tumor- promoting roles of circNT5E were recently reported in non-small cell lung cancer76. This

Figure 2.3. Molecular Regulation of CD73. The important functions of CD73 across cell- and tissue- types warrant different levels of molecular regulation. 1) At the transcriptional level, the expression of the CD73-encoding gene NT5E is upregulated under hypoxic conditions via the transcription factor, hypoxia-inducible factor 1 (HIF-1). Similarly, NT5E expression is increased in response to metabolic signals and cellular growth through the activation of the yes-associated protein (YAP) and the transcriptional coactivator with PDZ-binding motif (TAZ). In the context of cancer, NT5E mRNA undergoes 2) post-transcriptional splicing to generate a shorter NT5E-2 transcript or circularNT5E. Subsequently, NT5E mRNA is translated into CD73 and NT5E-2 mRNA into CD73S, which is an enzymatically-inactive isoform that targets CD73 for proteasomal degradation. 3) At the posttranslational level, CD73 protein is modified by the addition of a glycosylphosphatidylinositol (GPI)- anchor and by N-glycosylation. The mature CD73 protein dimerizes and is transported to the plasma membrane facing the exterior. At high levels in the membrane, CD73 is cleaved at the GPI-anchor by phospholipase C (PLC).

exciting discovery opens new possibilities for selectivity in targeting the pro-tumorigenic effects of NT5E without interfering with the normal enzymatic functions of CD73.

Other ways in which NT5E is dysregulated in cancer is via alternative splicing of exon 7 to produce a shorter enzymatically-inactive intracellular protein isoform (CD73S), which acts as a dominant negative to the canonical form77. This alternative spliced variant was upregulated in liver cirrhosis and liver cancer. Importantly, CD73S appears to be human-specific but its exact functions remain to be determined. As a glycosylphosphatidylinositol (GPI)-anchored glycoprotein that functions as a dimer, canonical CD73 undergoes a number of posttranslational modifications (PTMs) that can significantly impact its localization and activity, including cleavage from the membrane to form soluble enzyme78,79. This is a key consideration in studies that involve tissue digestion, since that process removes the membrane-bound form of CD73, as previously shown to occur immediately following hepatocyte isolation74. Another important consideration is that CD73 is N-glycosylated at four different asparagine residues

(N53, N311, N333 and N403). This PTM may be of relevance since changes in protein glycosylation have been linked to liver fibrosis, cirrhosis, and liver cancer80,81. Presently, little is known on how alternative splicing and post-translational modifications impact CD73 expression, localization, and activity in chronic diseases and in different cancers.

Development of CD73 Inhibitors and Other Tools to Support Further Research

Active efforts to block the adenosine-producing CD73 activity for therapeutic purposes of limiting cancer growth and metastasis include monoclonal antibodies and small molecule inhibitors82. The initial proof-of-concept pre-clinical study using an inhibitory antibody against

CD73 was done 11 years ago83, and there are now five different anti-CD73 antibodies (BMS-

986179, CPI-006, MEDI9447, NZV930 and TJ004309) and two small molecule inhibitors

(AB122 and LY3475070) undergoing Phase I/II clinical trials82. In addition, there are many similar agents in early-stage discovery and pre-clinical development84-89. Surprisingly, some anti-CD73 antibodies are already being repurposed for COVID-19 therapy90,91, despite existing evidence of clinical benefit of adenosine in this disease92,93 with supportive mechanistic rationale94. Radiolabeled antibodies95 and fluorescent probes96 are among the latest tools that were developed to monitor CD73 distribution and regulation in various settings. An Nt5e reporter mouse was also generated, and it appears to be a useful tool for studying CD73 on multipotent stromal cells and sinusoidal endothelial cells97. The availability of multiple approaches to target, manipulate and track CD73 will undoubtedly open new opportunities to understand its biology and regulation during physiological adaptation.

REFERENCES

1 Khakh, B. S. & Burnstock, G. The double life of ATP. Sci Am 301, 84-90, 92, doi:10.1038/scientificamerican1209-84 (2009).

2 Burnstock, G. Introduction to Purinergic Signaling. Methods Mol Biol 2041, 1-15, doi:10.1007/978-1-4939-9717-6_1 (2020).

3 Kotas, M. E. & Medzhitov, R. Homeostasis, inflammation, and disease susceptibility. Cell 160, 816-827, doi:10.1016/j.cell.2015.02.010 (2015).

4 Antonioli, L., Yegutkin, G. G., Pacher, P., Blandizzi, C. & Haskó, G. Anti-CD73 in cancer immunotherapy: awakening new opportunities. Trends Cancer 2, 95-109, doi:10.1016/j.trecan.2016.01.003 (2016).

5 Allard, B., Allard, D., Buisseret, L. & Stagg, J. The adenosine pathway in immuno- oncology. Nat Rev Clin Oncol 17, 611-629, doi:10.1038/s41571-020-0382-2 (2020).

6 St Hilaire, C. et al. NT5E mutations and arterial calcifications. N Engl J Med 364, 432- 442, doi:10.1056/NEJMoa0912923 (2011).

7 Zimmermann, H. Ectonucleoside triphosphate diphosphohydrolases and ecto-5'- nucleotidase in purinergic signaling: how the field developed and where we are now. Purinergic Signal, doi:10.1007/s11302-020-09755-6 (2020).

8 Burnstock, G. Purinergic nerves. Pharmacol Rev 24, 509-581 (1972).

9 Reis, M. Nucleotidase and its relation to the deamination of nucleotides in the heart and the muscles. Bull Soc Chim Biol 16, 385-399 (1934).

10 Misumi, Y., Ogata, S., Ohkubo, K., Hirose, S. & Ikehara, Y. Primary structure of human placental 5'-nucleotidase and identification of the glycolipid anchor in the mature form. Eur J Biochem 191, 563-569, doi:10.1111/j.1432-1033.1990.tb19158.x (1990).

11 Thompson, L. F., Ruedi, J. M., Glass, A., Low, M. G. & Lucas, A. H. Antibodies to 5'- nucleotidase (CD73), a glycosyl-phosphatidylinositol-anchored protein, cause human peripheral blood T cells to proliferate. J Immunol 143, 1815-1821 (1989).

12 Bianchi, V. & Spychala, J. Mammalian 5'-nucleotidases. J Biol Chem 278, 46195- 46198, doi:10.1074/jbc.R300032200 (2003).

13 Minor, M., Alcedo, K. P., Battaglia, R. A. & Snider, N. T. Cell type- and tissue-specific functions of ecto-5'-nucleotidase (CD73). Am J Physiol Cell Physiol 317, C1079- C1092, doi:10.1152/ajpcell.00285.2019 (2019).

14 Consortium, T. M. et al. Single-cell transcriptomics of 20 mouse organs creates a Tabula Muris. Nature 562, 367-372, doi:10.1038/s41586-018-0590-4 (2018).

15 Han, X. et al. Construction of a human cell landscape at single-cell level. Nature 581, 303-309, doi:10.1038/s41586-020-2157-4 (2020).

16 Colgan, S. P., Eltzschig, H. K., Eckle, T. & Thompson, L. F. Physiological roles for ecto-5'-nucleotidase (CD73). Purinergic Signal 2, 351-360, doi:10.1007/s11302-005- 5302-5 (2006).

17 Thompson, L. F. et al. Crucial role for ecto-5'-nucleotidase (CD73) in vascular leakage during hypoxia. J Exp Med 200, 1395-1405, doi:10.1084/jem.20040915 (2004).

18 Bowser, J. L. & Broaddus, R. R. CD73s protection of epithelial integrity: Thinking beyond the barrier. Tissue Barriers 4, e1224963, doi:10.1080/21688370.2016.1224963 (2016).

19 Krausgruber, T. et al. Structural cells are key regulators of organ-specific immune responses. Nature 583, 296-302, doi:10.1038/s41586-020-2424-4 (2020).

20 Burnstock, G. Pathophysiology and therapeutic potential of purinergic signaling. Pharmacol Rev 58, 58-86, doi:10.1124/pr.58.1.5 (2006).

21 Deaglio, S. et al. Adenosine generation catalyzed by CD39 and CD73 expressed on regulatory T cells mediates immune suppression. J Exp Med 204, 1257-1265, doi:10.1084/jem.20062512 (2007).

22 Antonioli, L., Pacher, P., Vizi, E. S. & Haskó, G. CD39 and CD73 in immunity and inflammation. Trends Mol Med 19, 355-367, doi:10.1016/j.molmed.2013.03.005 (2013).

23 Zhong, E. H. et al. Structural and functional characterization of engineered bifunctional fusion proteins of CD39 and CD73 ectonucleotidases. Am J Physiol Cell Physiol 320, C15-C29, doi:10.1152/ajpcell.00430.2020 (2021).

24 Joolharzadeh, P. & St Hilaire, C. CD73 (Cluster of Differentiation 73) and the Differences Between Mice and Humans. Arterioscler Thromb Vasc Biol 39, 339-348, doi:10.1161/ATVBAHA.118.311579 (2019).

25 Yoshioka, K. et al. Calcification of joints and arteries with novel NT5E mutations with involvement of upper extremity arteries. Vasc Med 22, 541-543, doi:10.1177/1358863X17724263 (2017).

26 Zhang, Z., He, J. W., Fu, W. Z., Zhang, C. Q. & Zhang, Z. L. Calcification of joints and arteries: second report with novel NT5E mutations and expansion of the phenotype. J Hum Genet 60, 561-564, doi:10.1038/jhg.2015.85 (2015).

27 Jiang, L. et al. A Quantitative Proteome Map of the Human Body. Cell 183, 269- 283.e219, doi:10.1016/j.cell.2020.08.036 (2020).

28 Jin, H. et al. Increased activity of TNAP compensates for reduced adenosine production and promotes ectopic calcification in the genetic disease ACDC. Sci Signal 9, ra121, doi:10.1126/scisignal.aaf9109 (2016).

29 Moorhead, W. J. et al. Dysregulation of FOXO1 (Forkhead Box O1 Protein) Drives Calcification in Arterial Calcification due to Deficiency of CD73 and Is Present in Peripheral Artery Disease. Arterioscler Thromb Vasc Biol 40, 1680-1694, doi:10.1161/ATVBAHA.119.313765 (2020).

30 Severe, N. et al. Stress-Induced Changes in Bone Marrow Stromal Cell Populations Revealed through Single-Cell Protein Expression Mapping. Cell Stem Cell 25, 570- 583.e577, doi:10.1016/j.stem.2019.06.003 (2019).

31 Xu, Y. et al. Regulation of endothelial intracellular adenosine via adenosine kinase epigenetically modulates vascular inflammation. Nat Commun 8, 943, doi:10.1038/s41467-017-00986-7 (2017).

32 Kusek, J. et al. Chaperoning of the A1-adenosine receptor by endogenous adenosine - an extension of the retaliatory metabolite concept. Mol Pharmacol 87, 39-51, doi:10.1124/mol.114.094045 (2015).

33 Borea, P. A., Gessi, S., Merighi, S. & Varani, K. Adenosine as a Multi-Signalling Guardian Angel in Human Diseases: When, Where and How Does it Exert its Protective Effects? Trends Pharmacol Sci 37, 419-434, doi:10.1016/j.tips.2016.02.006 (2016).

34 Borg, N. et al. CD73 on T Cells Orchestrates Cardiac Wound Healing After Myocardial Infarction by Purinergic Metabolic Reprogramming. Circulation 136, 297-313, doi:10.1161/CIRCULATIONAHA.116.023365 (2017).

35 Morianos, I. et al. Activin-A limits Th17 pathogenicity and autoimmune neuroinflammation via CD39 and CD73 ectonucleotidases and Hif1-α-dependent pathways. Proc Natl Acad Sci U S A 117, 12269-12280, doi:10.1073/pnas.1918196117 (2020).

36 Murphy, P. S. et al. CD73 regulates anti-inflammatory signaling between apoptotic cells and endotoxin-conditioned tissue macrophages. Cell Death Differ 24, 559-570, doi:10.1038/cdd.2016.159 (2017).

37 Wang, Y., Copeland, J., Shin, M., Chang, Y. & Venton, B. J. CD73 or CD39 Deletion Reveals Different Mechanisms of Formation for Spontaneous and Mechanically Stimulated Adenosine and Sex Specific Compensations in ATP Degradation. ACS Chem Neurosci 11, 919-928, doi:10.1021/acschemneuro.9b00620 (2020).

38 Mitrović, N. et al. Estrogen receptors modulate ectonucleotidases activity in hippocampal synaptosomes of male rats. Neurosci Lett 712, 134474, doi:10.1016/j.neulet.2019.134474 (2019).

39 Hebanowska, A., Mierzejewska, P. & Braczko, A. Effect of estradiol on enzymes of vascular extracellular nucleotide metabolism. Hormones (Athens) 20, 111-117, doi:10.1007/s42000-020-00242-6 (2021).

40 Goodman, W. A. et al. Impaired estrogen signaling underlies regulatory T cell loss-of- function in the chronically inflamed intestine. Proc Natl Acad Sci U S A 117, 17166- 17176, doi:10.1073/pnas.2002266117 (2020).

41 Crooke, A. et al. Low expression of CD39 and CD73 genes in centenarians compared with octogenarians. Immun Ageing 14, 11, doi:10.1186/s12979-017-0094-3 (2017).

42 Sutton, N. R. et al. CD73 Promotes Age-Dependent Accretion of Atherosclerosis. Arterioscler Thromb Vasc Biol 40, 61-71, doi:10.1161/ATVBAHA.119.313002

(2020).

43 Aymerich, I., Foufelle, F., Ferré, P., Casado, F. J. & Pastor-Anglada, M. Extracellular adenosine activates AMP-dependent protein kinase (AMPK). J Cell Sci 119, 1612- 1621, doi:10.1242/jcs.02865 (2006).

44 Garcia, D. et al. Genetic Liver-Specific AMPK Activation Protects against Diet- Induced Obesity and NAFLD. Cell Rep 26, 192-208.e196, doi:10.1016/j.celrep.2018.12.036 (2019).

45 Woods, A. et al. Liver-Specific Activation of AMPK Prevents Steatosis on a High- Fructose Diet. Cell Rep 18, 3043-3051, doi:10.1016/j.celrep.2017.03.011 (2017).

46 Viollet, B. et al. Activation of AMP-activated protein kinase in the liver: a new strategy for the management of metabolic hepatic disorders. J Physiol 574, 41-53, doi:10.1113/jphysiol.2006.108506 (2006).

47 Borea, P. A., Gessi, S., Merighi, S., Vincenzi, F. & Varani, K. Pharmacology of Adenosine Receptors: The State of the Art. Physiol Rev 98, 1591-1625, doi:10.1152/physrev.00049.2017 (2018).

48 Xiao, C., Liu, N., Jacobson, K. A., Gavrilova, O. & Reitman, M. L. Physiology and effects of nucleosides in mice lacking all four adenosine receptors. PLoS Biol 17, e3000161, doi:10.1371/journal.pbio.3000161 (2019).

49 McEwen, B. S. & Wingfield, J. C. The concept of allostasis in biology and biomedicine. Horm Behav 43, 2-15, doi:10.1016/s0018-506x(02)00024-7 (2003).

50 Jacobson, K. A., Tosh, D. K., Jain, S. & Gao, Z. G. Historical and Current Adenosine Receptor Agonists in Preclinical and Clinical Development. Front Cell Neurosci 13, 124, doi:10.3389/fncel.2019.00124 (2019).

51 Eddy, M. T. et al. Allosteric Coupling of Drug Binding and Intracellular Signaling in the A. Cell 172, 68-80.e12, doi:10.1016/j.cell.2017.12.004 (2018).

52 Glukhova, A. et al. Structure of the Adenosine A. Cell 168, 867-877.e813, doi:10.1016/j.cell.2017.01.042 (2017).

53 Draper-Joyce, C. J. et al. Structure of the adenosine-bound human adenosine A. Nature 558, 559-563, doi:10.1038/s41586-018-0236-6 (2018).

54 García-Nafría, J., Lee, Y., Bai, X., Carpenter, B. & Tate, C. G. Cryo-EM structure of the adenosine A. Elife 7, doi:10.7554/eLife.35946 (2018).

55 Rouviere, E., Arnarez, C., Yang, L. & Lyman, E. Identification of Two New Cholesterol Interaction Sites on the A. Biophys J 113, 2415-2424, doi:10.1016/j.bpj.2017.09.027 (2017).

56 Guixà-González, R. et al. Membrane cholesterol access into a G-protein-coupled receptor. Nat Commun 8, 14505, doi:10.1038/ncomms14505 (2017).

57 Ye, L. et al. Mechanistic insights into allosteric regulation of the A. Nat Commun 9, 1372, doi:10.1038/s41467-018-03314-9 (2018).

58 Strohmeier, G. R. et al. Surface expression, polarization, and functional significance of CD73 in human intestinal epithelia. J Clin Invest 99, 2588-2601, doi:10.1172/JCI119447 (1997).

59 ESSNER, E., NOVIKOFF, A. B. & MASEK, B. Adenosinetriphosphatase and 5- nucleotidase activities in the plasma membrane of liver cells as revealed by electron microscopy. J Biophys Biochem Cytol 4, 711-716, doi:10.1083/jcb.4.6.711 (1958).

60 Schell, M. J., Maurice, M., Stieger, B. & Hubbard, A. L. 5'nucleotidase is sorted to the apical domain of hepatocytes via an indirect route. J Cell Biol 119, 1173-1182, doi:10.1083/jcb.119.5.1173 (1992).

61 Moor, A. E. et al. Spatial Reconstruction of Single Enterocytes Uncovers Broad Zonation along the Intestinal Villus Axis. Cell 175, 1156-1167.e1115, doi:10.1016/j.cell.2018.08.063 (2018).

62 Ben-Moshe, S. et al. Spatial sorting enables comprehensive characterization of liver zonation. Nat Metab 1, 899-911, doi:10.1038/s42255-019-0109-9 (2019).

63 Singhal, R. & Shah, Y. M. Oxygen battle in the gut: Hypoxia and hypoxia-inducible factors in metabolic and inflammatory responses in the intestine. J Biol Chem 295, 10493-10505, doi:10.1074/jbc.REV120.011188 (2020).

64 Losenkova, K. et al. Compartmentalization of adenosine metabolism in cancer cells and its modulation during acute hypoxia. J Cell Sci 133, doi:10.1242/jcs.241463 (2020).

65 Glover, L. E., Lee, J. S. & Colgan, S. P. Oxygen metabolism and barrier regulation in the intestinal mucosa. J Clin Invest 126, 3680-3688, doi:10.1172/JCI84429 (2016).

66 Synnestvedt, K. et al. Ecto-5'-nucleotidase (CD73) regulation by hypoxia-inducible factor-1 mediates permeability changes in intestinal epithelia. J Clin Invest 110, 993- 1002, doi:10.1172/JCI15337 (2002).

67 Bowser, J. L., Phan, L. H. & Eltzschig, H. K. The Hypoxia-Adenosine Link during Intestinal Inflammation. J Immunol 200, 897-907, doi:10.4049/jimmunol.1701414 (2018).

68 Chang, D. et al. Extracellular cyclic dinucleotides induce polarized responses in barrier epithelial cells by adenosine signaling. Proc Natl Acad Sci U S A 117, 27502-27508, doi:10.1073/pnas.2015919117 (2020).

69 Kietzmann, T. Metabolic zonation of the liver: The oxygen gradient revisited. Redox Biol 11, 622-630, doi:10.1016/j.redox.2017.01.012 (2017).

70 Hall, Z. et al. Lipid zonation and phospholipid remodeling in nonalcoholic fatty liver disease. Hepatology 65, 1165-1180, doi:10.1002/hep.28953 (2017).

71 Broeker, K. A. E. et al. Different subpopulations of kidney interstitial cells produce erythropoietin and factors supporting tissue oxygenation in response to hypoxia in vivo. Kidney Int, doi:10.1016/j.kint.2020.04.040 (2020).

72 Wang, Y. et al. Comprehensive Molecular Characterization of the Hippo Signaling Pathway in Cancer. Cell Rep 25, 1304-1317.e1305, doi:10.1016/j.celrep.2018.10.001 (2018).

73 Koo, J. H. & Guan, K. L. Interplay between YAP/TAZ and Metabolism. Cell Metab 28, 196-206, doi:10.1016/j.cmet.2018.07.010 (2018).

74 Snider, N. T. et al. CD73 (ecto-5'-nucleotidase) hepatocyte levels differ across mouse strains and contribute to mallory-denk body formation. Hepatology 58, 1790-1800, doi:10.1002/hep.26525 (2013).

75 Wang, R. et al. CircNT5E Acts as a Sponge of miR-422a to Promote Glioblastoma Tumorigenesis. Cancer Res 78, 4812-4825, doi:10.1158/0008-5472.CAN-18-0532 (2018).

76 Dong, L. et al. The circular RNA NT5E promotes non-small cell lung cancer cell growth via sponging microRNA-134. Aging (Albany NY) 12, 3936-3949, doi:10.18632/aging.102861 (2020).

77 Snider, N. T. et al. Alternative splicing of human NT5E in cirrhosis and hepatocellular carcinoma produces a negative regulator of ecto-5'-nucleotidase (CD73). Mol Biol Cell 25, 4024-4033, doi:10.1091/mbc.E14-06-1167 (2014).

78 Schneider, E. et al. Generation and Function of Non-cell-bound CD73 in Inflammation. Front Immunol 10, 1729, doi:10.3389/fimmu.2019.01729 (2019).

79 Zhang, W. et al. Multiple steps determine CD73 shedding from RPE: lipid raft localization, ARA1 interaction, and MMP-9 up-regulation. Purinergic Signal 14, 443- 457, doi:10.1007/s11302-018-9628-1 (2018).

80 Blomme, B., Van Steenkiste, C., Callewaert, N. & Van Vlierberghe, H. Alteration of protein glycosylation in liver diseases. J Hepatol 50, 592-603, doi:10.1016/j.jhep.2008.12.010 (2009).

81 Stowell, S. R., Ju, T. & Cummings, R. D. Protein glycosylation in cancer. Annu Rev Pathol 10, 473-510, doi:10.1146/annurev-pathol-012414-040438 (2015).

82 Boison, D. & Yegutkin, G. G. Adenosine Metabolism: Emerging Concepts for Cancer Therapy. Cancer Cell 36, 582-596, doi:10.1016/j.ccell.2019.10.007 (2019).

83 Stagg, J. et al. Anti-CD73 antibody therapy inhibits breast tumor growth and metastasis. Proc Natl Acad Sci U S A 107, 1547-1552, doi:10.1073/pnas.0908801107 (2010).

84 Du, X. et al. Orally Bioavailable Small-Molecule CD73 Inhibitor (OP-5244) Reverses Immunosuppression through Blockade of Adenosine Production. J Med Chem 63, 10433-10459, doi:10.1021/acs.jmedchem.0c01086 (2020).

85 Jin, R. et al. Dual Mechanisms of Novel CD73-Targeted Antibody and Antibody-Drug Conjugate in Inhibiting Lung Tumor Growth and Promoting Antitumor Immune-

Effector Function. Mol Cancer Ther, doi:10.1158/1535-7163.MCT-20-0076 (2020).

86 Stefano, J. E. et al. A highly potent CD73 biparatopic antibody blocks organization of the enzyme active site through dual mechanisms. J Biol Chem 295, 18379-18389, doi:10.1074/jbc.RA120.012395 (2020).

87 Lawson, K. V. et al. Discovery of AB680: A Potent and Selective Inhibitor of CD73. J Med Chem 63, 11448-11468, doi:10.1021/acs.jmedchem.0c00525 (2020).

88 Beatty, J. W. et al. Discovery of Potent and Selective Non-Nucleotide Small Molecule Inhibitors of CD73. J Med Chem 63, 3935-3955, doi:10.1021/acs.jmedchem.9b01713 (2020).

89 Bhattarai, S. et al. 2-Substituted α,β-Methylene-ADP Derivatives: Potent Competitive Ecto-5'-nucleotidase (CD73) Inhibitors with Variable Binding Modes. J Med Chem 63, 2941-2957, doi:10.1021/acs.jmedchem.9b01611 (2020).

90 Willingham, S. B. et al. Characterization and Phase 1 Trial of a B Cell Activating Anti- CD73 Antibody for the Immunotherapy of COVID-19. medRxiv, 2020.2009.2010.20191486, doi:10.1101/2020.09.10.20191486 (2020).

91 Zhong, T. et al. 476 AK119, a humanized anti-CD73 monoclonal antibody, as Immunotherapy for COVID-19. Journal for ImmunoTherapy of Cancer 8, A292-A293, doi:10.1136/jitc-2020-SITC2020.0476 (2020).

92 Falcone, C. et al. Can Adenosine Fight COVID-19 Acute Respiratory Distress Syndrome? J Clin Med 9, doi:10.3390/jcm9093045 (2020).

93 Correale, P. et al. Therapeutic effects of adenosine in high flow 21% oxygen aereosol in patients with Covid19-pneumonia. PLoS One 15, e0239692, doi:10.1371/journal.pone.0239692 (2020).

94 Geiger, J. D., Khan, N., Murugan, M. & Boison, D. Possible Role of Adenosine in COVID-19 Pathogenesis and Therapeutic Opportunities. Front Pharmacol 11, 594487, doi:10.3389/fphar.2020.594487 (2020).

95 Sudo, H. et al. Radiolabeled Human Monoclonal Antibody 067-213 has the Potential for Noninvasive Quantification of CD73 Expression. Int J Mol Sci 21, doi:10.3390/ijms21072304 (2020).

96 Schmies, C. C. et al. Fluorescent Probes for Ecto-5'-nucleotidase (CD73). ACS Med Chem Lett 11, 2253-2260, doi:10.1021/acsmedchemlett.0c00391 (2020).

97 Breitbach, M. et al. In Vivo Labeling by CD73 Marks Multipotent Stromal Cells and Highlights Endothelial Heterogeneity in the Bone Marrow Niche. Cell Stem Cell 22, 262-276.e267, doi:10.1016/j.stem.2018.01.008 (2018).

CHAPTER 3: CD73 MAINTAINS HEPATOCYTE METABOLIC INTEGRITY AND MOUSE LIVER HOMEOSTASIS IN A SEX-DEPENDENT MANNER1

Introduction

The highly integrated metabolic activities of hepatocytes control physiological homeostasis and are perturbed in chronic liver diseases. Non-alcoholic fatty liver disease

(NAFLD) is the most prevalent chronic liver disease in children and adults, and a major risk factor for the development of cirrhosis and hepatocellular carcinoma (HCC)1,2. Lack of approved therapies renders NAFLD a major health problem, estimated to affect 25% of the global population, including 80 million people in the United States3. In recognition that

NAFLD is principally a metabolic disease, a new nomenclature was proposed: Metabolic-

Associated Fatty Liver Disease (MAFLD)4. From that standpoint, understanding how hepatocytes maintain long-term energy homeostasis will be critical for addressing the key mechanisms behind this complex and heterogeneous disorder.

It was shown over 50 years ago that ATP injections increase hepatic ATP content and can prevent the development of fatty liver in rodents5. Moreover, patients with non-alcoholic steatohepatitis (NASH), the most severe form of NAFLD, have significantly impaired capacity for replenishing hepatic ATP stores after transient depletion6. Numerous biochemical reactions control ATP metabolism and utilization by hepatocytes, including the enzymatic hydrolysis of extracellular ATP to form AMP, which is further metabolized to

1 This chapter contains published material authored by: Alcedo KP, Rouse MA, Jung GS, Fu D, Minor M, Willcockson HH, Greene KG, Snider NT. CD73 Maintains Hepatocyte Metabolic Integrity and Mouse Liver Homeostasis in a Sex-Dependent Manner. Cell Mol Gastroenterol Hepatol. 2021 Jan 29:S2352-345X(21)00022-9.

43 adenosine by ecto-5′-nucleotidase (CD73)7. Adenosine regulates many physiological responses via activation of adenosine receptors8, and it can also be taken up inside the cell via specific transporters9 and phosphorylated back to AMP by adenosine kinase10. A major function of adenosine is to reduce metabolic demand and conserve energy, but it is not known what role CD73 plays in this process, despite being the major extracellular adenosine regulator across different tissues and cell types11,12. Insights into CD73 mechanisms have particular relevance to liver biology and disease because the messenger RNA (mRNA) expression and enzymatic activity of CD73 are significantly downregulated in human

NAFLD, cirrhosis and HCC via transcriptional13, post-transcriptional14, and post- translational15 mechanisms. The latter two mechanisms involve production of a catalytically- deficient splice variant (CD73S) and catalytically-impaired high-mannose glycosylation variant12.

Although CD73 has ubiquitous expression12, recent single cell profiling experiments show that its mRNA is zonally distributed in epithelial tissues, including the liver16, intestine17, and kidney18. CD73 is transcriptionally induced by hypoxia19 and CD73- generated adenosine directly protects multiple epithelial tissues, including the liver, against hypoxic injury20-22. Previous studies have shown an allostatic function for CD73 in response to severe oxygen deprivation, but presently it is not known if CD73 functions in the long- term maintenance of liver homeostasis. Addressing this question is important because oxygen tension across the hepatic lobule is a key determinant of physiological metabolic zonation23.

Metabolic zonation refers to the heterogeneous distribution of enzyme activities, resulting in periportal predominance of protein secretion, cholesterol synthesis, fatty acid oxidation, and ureagenesis, and pericentral predominance of glycolysis, lipogenesis, and bile acid synthesis.

44 This structured division of labor among healthy hepatocytes is disrupted in chronic liver diseases, such as NAFLD24.

Given the earlier-described observations, and the known functions of adenosine in regulating hepatic glucose and lipid metabolism25, we hypothesized that CD73 has non- redundant homeostatic functions in the liver. To test the hypothesis, we generated mice with a targeted deletion of the CD73-encoding gene Nt5e in hepatocytes and characterized their liver phenotypes using multiple approaches. Our findings reveal unanticipated age- and sex- dependent functions of CD73 in the long-term maintenance of hepatocyte metabolism and liver homeostasis. As such, these results add cellular-level understanding of this key enzyme, in particular its relatively underappreciated functions in epithelial tissues. Importantly, these findings have translational implications for human liver diseases, as well as anti-CD73 antibodies and inhibitors, which are currently undergoing clinical development for cancer26 and COVID-19 immunotherapy27.

Materials and Methods

Chemicals and Reagents

The following chemicals and reagents were purchased from Sigma-Aldrich (St.

Louis, MO): bovine serum albumin (A2153), Adenosine 5′-(,-methylene)diphosphate

(M3763), insulin (I0516), glucagon (G2044), hydrocortisone (H0888), levamisole (196142), calcium chloride dihydrate (223506), glucose (G8270), Percoll (P1644), and EGTA (E3889).

4X Laemmli Sample buffer (1610747) was purchased from BioRad Laboratories (Hercules,

CA).

45 Generation of Hepatocyte-Specific CD73 KO Mice

CD73 floxed (CD73fl/fl) mice were generated by Cyagen Bioscience, Inc. (Santa

Clara, CA). Briefly, exon 2 of the CD73-encoding gene, Nt5e (GenBank accession number:

NM_011851.4, Ensembl: ENSMUSG00000032420), was targeted to generate a frameshift mutation from downstream exons. Bacterial artificial chromosome (BAC) clone RP23-

137M4 from the C57BL/6J library was the template for the targeting vector that contains a

Neo cassette flanked by Frt sites, and Nt5e exon 2 region flanked by loxP sites. Linearized targeting vector was electroporated into embryonic stem (ES) cells, followed by Neomycin selection of resistant clones. Targeted ES clones were injected into blastocysts and transferred into surrogate mothers to obtain chimera lines. The conditional knockout allele was obtained after flippase-mediated recombination. Heterozygote (flox/wt) mice were bred with each other to obtain flox/flox. For this study, CD73fl/fl mice were backcrossed to

C57BL/6J WT mice four times. To generate the CD73 hepatocyte-specific knockout mice

(CD73-LKO), CD73fl/fl mice were bred with Cre mice driven by the albumin promoter (Stock

003574, The Jackson Laboratory)28. Genotyping was performed at 7-10 days of age and the mice were weaned at 21 days. WT and CD73-LKO littermates were maintained on normal chow diet or 14-week high fat diet (Bio-Serv 60% calories from fat; as noted in the Figure

3.6 legend in the pathogen-free animal facility at the University of North Carolina at Chapel

Hill. All experiments were approved by the Institutional Animal Care and Use Committee and in accordance with the National Institutes of Health guidelines.

Genotyping

Polymerase chain reaction (PCR) analysis using DNA extracted from toe clips and

DreamTaq Green PCR Master Mix 2X (K1081, Thermo Fisher, Waltham, MA) was

46 performed to identify WT and CD73-LKO mice. Floxed PCR analysis used primers listed on

Table 1. Amplicons were analyzed using 2% agarose gel electrophoresis. The presence of a

426-bp and 286-bp bands indicate floxed CD73 and WT allele, respectively. A 300-bp and

200-bp band is positive for Cre recombinase.

Serum Analysis

Blood was collected by cardiac puncture from male and female WT and CD73-LKO mice between 5-9 months of age. Serum was analyzed for alanine aminotransferase (ALT), albumin, and blood urea nitrogen (BUN) using the VetScan VS2 Analyzer and VetScan mammalian liver profile reagent rotor (Abaxis, Union City, CA).

Immunoblot

Total liver protein lysates were extracted from 25 mg of liver tissue from the left lobe or from cultured primary WT hepatocytes using ice-cold lysis buffer (50 mM n-octyl--D- glucopyranoside, 1X protease inhibitors (05892970001; Roche, Basel, Switzerland), and 1X phosphatase inhibitors (04906837001; Roche, Basel, Switzerland) in 1X PBS). Protein lysates were resolved in 10% sodium dodecyl sulfate-polyacrylamide electrophoresis gels and transferred to a nitrocellulose membrane. After blocking in 5% milk in Tris-buffered saline with 0.1% Tween20 (TBST) for 1 hour at room temperature (RT), the membranes were incubated with anti-CD73 (clone D7F9A, #13160), phospho-AMPK (T172, clone

40H9, #2535), total AMPK (clone D5A2, #5831), phospho-AMPK substrate motif

(LXRXX(pS/pT), #5759S) (Cell Signaling, Beverly, MA); pan actin (ACTN05, MA5-11869;

Thermo Fisher, Waltham, MA), and anti-vinculin (clone hVIN-1, V9131; Sigma-Aldrich, St.

Louis, MO) in 5% BSA/TBST overnight at 4°C. Secondary antibodies (A4416, A6154,

47 1:5,000-10,000; Sigma-Aldrich, St. Louis, MO) were incubated for 1 hour at RT in 5% milk/TBST. Gels were stained with Coomassie Blue, and membranes with Ponceau S stain.

Primary Hepatocyte Isolation and Treatment

Hepatocyte isolation was performed on 5-month-old CD73fl/fl mice weighing 20–35 g.

Mice were anesthetized with Nembutal Avertin (250–300 mg/kg, intraperitoneally) (T48402;

Sigma-Aldrich, St. Louis, MO) to achieve deep anesthesia. The portal vein was cannulated and the liver was perfused with 50 mL of 37°C sterile buffer I solution (0.50 mmol/L ethylene glycol-bis[β-aminoethyl ether]-N,N,N′,N′-tetraacetic acid, 5.5 mmol/L glucose, 1% penicillin/streptomycin in calcium- and magnesium-free Hank’s balanced salt solution) at a rate of 7 mL/min. Liver digestion was performed with 40 mL of 37°C sterile buffer II solution (1.5 mmol/L CaCl2, 5.5 mmol/L glucose, 1% penicillin/streptomycin, and 3600 U of collagenase IV in calcium- and magnesium-free Hank’s balanced salt solution) at a rate of 7 mL/min. Livers were surgically removed and hepatocytes were isolated in cold 1×

Dulbecco’s modified Eagle medium/penicillin/streptomycin media by size exclusion using

100-μm and 70-μm filters, respectively. Isolated hepatocytes were treated 24 hours after isolation with soluble human recombinant CD73 protein, AMP substrate, and a selective equilibrative nucleoside transporter 1 inhibitor, as specified in the figure legends. For intracellular lipid accumulation experiments, isolated WT C57BL/6 male hepatocytes were treated for 24 hours with 1 μmol/L oleic acid in the presence or absence of the CD73 inhibitor, APCP (10 μmol/L). Lipid accumulation was visualized using LipidTOX neutral lipid stain (H34477; Thermo Fisher, Waltham, MA). Fluorescence intensities were quantified in individual hepatocytes using Adobe Photoshop (San Jose, CA) software to measure the

48 signal within individual hepatocytes after selecting equal areas of 20,000 pixels and plotted for each treatment group.

RNA and Quantitative Polymerase Chain Reaction (PCR)

Total RNA was isolated from the left lobe of the liver and was extracted according to the manufacturer’s protocol (RNeasy Mini Kit, 74104; Qiagen, Hilden, Germany). A total of

2 μg RNA was converted to complementary DNA using the high-capacity complementary

DNA reverse-transcription kit (4368813; Applied Biosystems, Foster City, CA). PCR was performed using SYBR Green PCR master mix (A25742; Applied Biosystems), and performed in a Quantstudio 6 Flex System (Applied Biosystems, Foster City, CA). The change in cycle threshold (delta CT) was normalized to 18S and was expressed in fold change. The primer sequences are listed on Table 1.

Liver Tissue Staining and CD73 Enzyme Histochemistry

Liver tissues from the left lobe were fixed with paraformaldehyde and paraffin- embedded, or flash frozen using optimal cutting temperature (OCT) embedding medium.

Paraffin-embedded tissues were cut in 10 m sections and stained with hematoxylin and eosin (H&E). For immunohistochemistry, tissue sections were de-paraffinized and rehydrated. Antigen was retrieved using HIER buffer pH 6.0 (TA-135-HBL; Thermo Fisher,

Waltham, MA), and endogenous peroxidase was inhibited by 3% hydrogen peroxide. Tissues were blocked with 10% normal goat serum, and primary antibody for the neutrophil marker

Ly6G (2557; Abcam, Cambridge, United Kingdom) was incubated overnight at 4°C in blocking buffer. Secondary biotinylated anti-rat IgG was incubated for 1 hour at room temperature, followed by incubation with tertiary antibody (ABC Elite, PK-6100; Vector,

Burlington, Ontario, Canada). Tissue sections were developed using 3,3’-diaminobenzidine

49 (DAB) substrate (TA-125-QHDX; Thermo Fisher, Waltham, MA), and counterstained with

Harris hematoxylin. Images were analyzed at 20X objective using EVOSTM FL auto imaging system (Thermo Fisher, Waltham, MA). The average number of positive signal was quantified using ImageJ software and plotted for each animal group. Frozen tissues were cut in 10 m sections and stained by immunofluorescence. Briefly, frozen tissue sections were fixed in cold 10% normal buffered formalin (032-059; Fisher Scientific, Ottawa, Ontario,

Canada), followed by cold acetone (A19-1; Fisher Scientific, Ottawa, Ontario, Canada) for

10 minutes each. Tissues were blocked in 2% normal goat serum/2.5%BSA/1X PBS for 1 hour at RT. Primary antibodies CD73 (clone TY/23, 550738; BD Pharmingen, San Jose,

CA), K19-AF647 (ab192980; Abcam, Cambridge, United Kingdom), K8/18 (clone 8592), zonula occludens 1 (ZO1) (clone D6L1E, 13663; Cell Signaling, Beverly, MA) in blocking solution were incubated overnight at 4°C. Tissues were washed in 1X PBS, before adding secondary antibodies anti-rat 488 (a11006; Thermo Fisher, Waltham, MA) and anti-rabbit

568 (a11079; Thermo Fisher, Waltham, MA) for 1 hour at RT. The nuclei were stained using

4′,6-diamidino-2-phenylindole (D1306; Invitrogen, Carlsbad, CA). Images were analyzed at

40X oil objective using Zeiss LSM 880 confocal microscope (Zeiss, Concord, NC). Frozen liver tissues sections of 10 m thickness were fixed in 10% neutral buffered formalin for 5 min at 4°C. Enzyme histochemistry was performed using our published protocol13. Images were analyzed at 20X objective using EVOS-FL auto imaging system (Thermo Fisher,

Waltham, MA).

50 Table 3.1: Primers for Genotyping and Quantitative Polymerase Chain Reaction

Genotyping

Gene Sequence (5’ → 3’)

Nt5e Floxed Forward AGCACATTTAGTTTGAAATCCC

Nt5e Floxed Reverse AAACAGACTTCTTGATTGGCAT

Fabpi-200 Forward TGGACAGGACTGGACCTCTGCTTTCCTAGA

Fabpi-200 Reverse TAGAGCTTTGCCACATCACAGGTCATTCAG

Cre-281 Forward CCATCTGCCACCAGCCAG

Cre-281 Reverse TCGCCATCTTCCAGCAGG

Adora1 Forward TGTGACCACCACCCAGAGTA

Adora1 Reverse GCAGAGACTGGGACAAGGAG

Adora2a Reverse GAGAGGATGATGGCCAGGTA

Adora2b Forward CCTTTGGCATTGGATTGACT

Adora2b Reverse AAAATGCCCACGATCATAGC

Adora3 Forward TCATACCGGAAGGAATGAGC

Adora3 Reverse AGCTTGACCACCCAGATGAC

Entpd1 Forward TACCACCCCATCTGGTCATT

Entpd1 Reverse GGACGTTTTGTTTGGTTGGT

IL1β Forward TCGCTCAGGGTCACAAGAAA

IL1β Reverse CATCAGAGGCAAGGAGGAAAAC

TNFα Forward AGGCTGCCCCGACTACGT

TNFα Reverse GACTTTCTCCTGGTATGAGATAGCAAA

Acaca Forward AGCCAGAAGGGACAGTAGAA

51 Genotyping

Gene Sequence (5’ → 3’)

Acaca Reverse CTCAGCCAAGCGGATGTAAA

Hmgcr Forward CTTGTGGAATGCCTTGTGATTG

Hmgcr Reverse AGCCGAAGCAGCACATGAT

Hmgcs1 Forward GCCGTGAACTGGGTCGAA

Hmgcs1 Reverse GCATATATAGCAATGTCTCCTGCAA

Srebp1a Forward GGCCGAGATGTGCGAACT

Srebp1a Reverse TTGTTGATGAGCTGGAGCATGT

Srebp1c Forward GGAGCCATGGATTGCACATT

Srebp1c Reverse GGCCCGGGAAGTCACTGT

18S Forward ACCTGGTTGATCCTGCCAGTAG

18S Reverse TTAATGAGCCATTCGCAGTTTC

52 Proteomic Analysis by Liquid Chromatography with Tandem Mass Spectrometry (LC- MS/MS)

Freshly isolated primary hepatocytes from 3 WT and 3 CD73-LKO mice were lysed using 8M urea. Protein lysates were digested with LysC-protease and trypsin. Peptides samples were cleaned using PierceTM C18 spin columns (Thermo Fisher, Waltham, MA), then peptide quantitation was conducted. A total of 350 mg per sample were dried and labeled using TMT 6-plexTM Isobaric Label Reagent Set (90061; Thermo Fisher, Waltham,

MA). Label efficiency was evaluated and found to be >99% for all TMT channels. Samples were mixed, then subjected to fractionation into 96 fractions by high-pH reversed-phase LC.

Samples were concatenated into 24 samples. Each sample (~1mg) was analyzed by LC-

MS/MS using the QExactive HF (Thermo Fisher, Waltham, MA) for a total of 25 analyses.

Proteins were identified and quantified using MaxQuant utilizing both a reviewed (~18,000 proteins) mouse database appended with a common contaminants database. Core analysis of

LC-MS/MS data set were analyzed using Ingenuity Pathway Analysis (Qiagen, Hilden,

Germany) and filtered based on a log (P value of 1E-10) and an absolute z-score of 1.

Statistical Analysis

Data were analyzed using unpaired t-test or two-way ANOVA built in GraphPad

Prism (San Diego, CA). Data are presented relative to WT or untreated controls. Error bars from all graphs indicate standard deviation (s.d.) for n≥3 samples or independent experiments. P values are denoted within each respective figure panel. Outliers were tested based on Grubb’s test (α=0.05). Number of samples or independent experiments is indicated in the figure legends.

53 Results

Pericentral Hepatocytes Account for the Bulk of CD73 Expressed in the Normal Mouse Liver

Using single cell RNA transcriptomic data from the Tabula Muris project29, we compared Nt5e expression across different cell types in the mouse liver. Both FACS-sorted and microfluidic droplet-captured cells showed that hepatocytes are the primary cell types expressing Nt5e (Figure 3.1A-D). Approximately 30% of hepatocytes, 7% of leukocytes and natural killer (NK) cells, and <2% of Kupffer cells and liver sinusoidal endothelial cells

(LSECs) express Nt5e, while cholangiocytes and B cells lack Nt5e expression (Figure 3.1A-

D). To determine if Nt5e presence correlates with CD73 protein, we performed co- immunofluorescence staining for CD73 and markers of hepatocytes, cholangiocytes, endothelial cells, and Kupffer cells (Figure 3.1E). In agreement with the transcriptomic data,

CD73 is present on hepatocytes, but absent from cholangiocytes, which are marked by keratin (K) K8/K18 and K19 staining, respectively (Figure 3.1E). In addition, subsets of endothelial cells, expressing CD31, and Kupffer cells, expressing F4/80, co-stained for CD73

(Figure 3.1E). However, the most abundant expression of CD73 was detected on the bile canalicular membranes of hepatocytes, as shown by co-staining with the tight junction marker protein zonula occludens 1 (Figure 3.1F).

Liver-Specific CD73 Knockout Mice Develop Normally and Do Not Show Major Liver Abnormalities at A Young Age

To address the function of CD73 in the mammalian liver, we generated mice with a targeted deletion of the Nt5e gene in hepatocytes. The critical exon 2 of Nt5e was flanked by loxP sites and deleted in the presence of Cre recombinase driven by the albumin (Alb) promoter. As expected, Nt5e was selectively targeted in the liver (Figure 3.2A) and CD73 protein was absent from primary hepatocytes isolated from the CD73-LKO mice (Figure

Figure 3.1. CD73 is Expressed Primarily On Hepatocytes in Normal Mouse Liver. t- distributed stochastic neighbor embedding (tSNE) and violin plots showing RNA sequencing analysis of the mouse liver from (A and B) fluorescence-activated cell sorter (FACS)-sorted and (C and D) microfluidic droplet captured cells showing the highest expression of the mouse CD73-encoding gene Nt5e in hepatocytes. Data were obtained from Tabula Muris. (E) Fresh-frozen liver sections were stained with antibodies against CD73 (green), and the cell- specific markers keratins K8/18 (hepatocyte), K19 (cholangiocyte), CD31 (endothelium), and F4/80 (Kupffer cells) in red. Bottom row: Magnified views of the boxed areas in the top row. Blue, 4′,6-diamidino-2-phenylindole (DAPI)-stained nuclei (DNA). (F) Immunofluorescence staining for CD73 (green) in frozen liver sections showing co-localization with the bile- canalicular marker zonula occludens 1 (ZO1) (red). Right: 4× magnified view of the boxed area in the merged panel. DAPI-stained nuclei. Blue, DAPI-stained nuclei (DNA). Scale bars: 20 μm. NK, natural killer; LSEC, liver sinusoidal endothelial cell.

Figure 3.2. Generation of Liver-Specific CD73-LKO Mice. (A) PCR analysis of Nt5e generated a 349-bp fragment from the Cre-targeted allele in the CD73-LKO mouse liver. Nt5e(wt/wt), Nt5e(fl/wt), and Nt5e(fl/fl) mice are controls. Representative immunoblots of CD73 in (B) primary hepatocytes, and (C) in total liver lysates from male and female WT and CD73-LKO mice. Actin and tissue nonspecific alkaline phosphatase (TNAP) immunoblots serve as controls. (D) Semiquantitative analysis of CD73 protein expression based on immunoblot band intensities in panel C. ∗∗P < .01, ∗∗∗P < .001, 2-way analysis of variance. Error bars represent SD. (E) Immunofluorescence staining for CD73 (green), tight junction protein zonula occludens 1 (ZO1) (red), and 4′,6-diamidino-2-phenylindole (DAPI)- stained DNA (blue) on frozen liver tissue sections from WT (top) and CD73-LKO (bottom) mice. Scale bar: 20 μm. (F) AMPase activity in WT and CD73-LKO mice using formalin- fixed liver tissue sections. The brown deposits indicate ecto-AMPase activity in the presence of AMP. Stars indicate the central vein. Scale bar: 400 μm.

56 3.2B). Immunoblotting of total liver lysates revealed that CD73 levels were reduced by 75% and 67% in male and female CD73-LKO mice, respectively, compared to age-matched wild- type (WT) mice (Figure 3.2C-D). The expression of a functionally related GPI-anchored protein, tissue non-specific alkaline phosphatase (TNAP), was unaffected (Figure 3.2C).

Immunofluorescence analysis of liver tissues showed absence of CD73 from the apical membrane of hepatocytes in CD73-LKO mice (Figure 3.2E) and this corresponded to significantly diminished ecto-AMPase activity in the pericentral region of CD73-LKO livers

(Figure 3.2F). Therefore, the CD73-LKO mice lack hepatocyte CD73 expression and are deficient in CD73-associated ecto-AMPase function.

To determine how this genetic manipulation affected liver function, we analyzed mice at different ages. Histological examination of liver tissues from 7-week-old WT and CD73-

LKO male mice did not reveal major differences (Figure 3.3A). In agreement with previous observations using constitutive Nt5e-knockout mice22, the CD73-LKO mice did not show major defects in viability, growth, and development up to the mature adult stage at 21 weeks

(Figure 3.3B). Both male and female CD73-LKO mice gained weight at the same rate

(Figure 3.3B) and had similar liver weight-to-body weight ratios compared to their WT counterparts (Figure 3.3C). Taken together, these data show that hepatocyte CD73 is not required for normal mouse liver development and maturation.

CD73-LKO Mice Develop Spontaneous Hepatocyte Degeneration in A Sex- and Age- Dependent Manner

The zonal expression pattern of CD73 on pericentral hepatocytes prompted us to investigate the long-term consequences of CD73 deficiency because pericentral hepatocytes are important for the homeostatic renewal in the mouse liver30,31. Therefore, we studied the liver phenotypes of standard chow-fed WT and CD73-LKO mice between 22 and 42 weeks

Figure 3.3. CD73-LKO Mice Develop Normally and Do Not Show Major Liver Abnormalities Up To 21 Weeks of Age. (A) Formalin-fixed liver sections of 7-week-old male mice stained with H&E. Scale bar: 200 μm. (B) Comparison of body weight from WT and CD73-LKO mice at 6–21 weeks of age. n = 15–21 mice/group. (C) Analysis of liver-to- body weight ratios of 21-week-old mice. Males: n = 18 WT, n = 21 CD73-LKO. Females: n = 9 WT, n = 15 CD73-LKO. Error bars represent SD.

58 (5–10 mo) of age, which represents the period between the mature adult and middle-aged stages. Serum analysis showed a trend (P < .08) toward increased alanine aminotransferase levels in male mice, but not in female mice (P< .3) at 21–22 weeks of age (Figure 3.4A).

Histologically, we observed significant pericentral hepatocyte injury in 22-week-old male

CD73-LKO mice, which was not present in the female mice, or the corresponding age- and sex-matched WT controls (Figure 3.4B). The hepatocyte injury and tissue damage were more extensive in the older (age, 42 wk) compared with the younger (age, 22 wk) male mice

(Figure 3.4C), pointing to a progressive and age-dependent liver injury. Blinded quantitative histologic analysis further unmasked male-predominant hepatocellular damage (P < .05), which was defined by swelling and ballooning hepatocyte degeneration (Figure 3.4D).

Another notable sex difference was that hepatocytes in female CD73-LKO appeared smaller

(Figure 4B), which corresponded with decreased serum albumin levels (Figure 3.4E), whereas serum albumin was unaffected in the male CD73-LKO mice (Figure 3.4E).

Furthermore, we observed a significant increase in serum blood urea nitrogen levels in the male, but not female, CD73-LKO mice (Figure 3.4F).

Deficiency of Hepatocyte CD73 Leads To AMP-Activated Protein Kinase (AMPK) Hypo- Activation and Perturbs Metabolic Homeostasis

To understand the cellular basis for the male-predominant histopathologic changes, we performed proteomic profiling on freshly isolated hepatocytes from 5-month-old male

WT and CD73-LKO mice (Figure 3.5A). This analysis showed up-regulation in protein synthesis pathways associated with the transcriptional regulator eukaryotic initiation factor 2

(EIF2), apoptosis, and nucleotide excision repair. Pathways involved in fatty acid oxidation

(peroxisome proliferator-activated receptor α/retinoid X receptor α, PPARα/RXRα), cholesterol, and stearate biosynthesis also were up-regulated (Figure 3.5A). On the other

Figure 3.4. CD73-LKO Mice Develop Spontaneous Liver Injury After 21 Weeks of Age in a Sex-Dependent Manner. (A) Serum analysis of alanine aminotransferase (ALT) in 21- to 22-week-old male (blue) and female (red) WT (filled circles) and CD73-LKO mice (open circles). Males: n = 8 WT; n = 8 CD73-LKO; P = .08 (unpaired t test); females: n = 7 WT; n = 7 CD73-LKO. P = .3 (unpaired t test). (B) Representative H&E images of formalin-fixed liver sections from 22-week-old male and female WT and CD73-LKO mice. Scale bars: 200 μm. (C) Representative H&E images of formalin-fixed liver sections from 36- to 42-week- old male WT and CD73-LKO mice. Scale bars: 200 μm. (D) Quantification of blinded histologic scoring of hepatocyte degeneration (defined as swelling and ballooning) in 21- to 42-week-old mice. Scoring: 0, none; 4, mild swelling/focal ballooning; 8, severe swelling/extensive ballooning (scores were averaged for animals with ballooning + swelling). ∗P < .05; 1-way analysis of variance. Box-and-whisker plots of (E) albumin and (F) blood urea nitrogen (BUN) in male (blue) and female (red) WT (filled circles) and CD73-LKO mice (open circles). Same animals as in panel D. Males: n = 13 WT; n = 12 CD73-LKO; females: n = 14 WT; n = 18 CD73-LKO mice. ∗P < .05, ∗∗∗∗P < .0001; unpaired t test .

60 hand, hormone signaling (estrogen and aldosterone), amino acid metabolism (transfer RNA charging), nutrient sensing (mechanistic target of rapamycin, mTOR; p70S6K), and overall cellular energy homeostasis (oxidative phosphorylation and AMP-activated protein kinase

[AMPK]) pathways were down-regulated in the CD73-null hepatocytes (Figure 3.5A).

Consistent with abnormal lipid metabolism, as suggested by the proteomic analysis, male

CD73-LKO mice developed significantly more microvesicular and macrovesicular steatosis, compared with female mice (Figure 3.5B and C). We profiled a set of lipid metabolism genes to determine if transcriptional compensation may account for the sex differences we observed. Although most genes remained unchanged, the gene Hmgcs1, which encodes hydroxymethylglutaryl-coenzyme A synthase, was significantly higher in female WT mice and further induced in the CD73-LKO mice (Figure 3.5D). Hydroxymethylglutaryl-CoA synthase converts acetyl-CoA to hydroxymethylglutaryl-CoA, which is used in the mevalonate pathway.

To further examine the link between CD73 activity and hepatic lipid accumulation, we treated WT hepatocytes with the CD73 inhibitor, adenosine 5'-(α,β- methylene)diphosphate (APCP) in the absence and presence of oleic acid (OA) and monitored neutral lipid accumulation using a fluorescence imaging method. Treatment with

APCP alone led to significant accumulation of lipid droplets in hepatocytes (Figure 3.6A and

B). Co-treatment of hepatocytes with OA and APCP together led to significantly more accumulation of lipid droplets than either treatment alone (Figure 3.6A), suggesting that

CD73 enzymatic activity regulates hepatocyte lipid metabolism. To determine if CD73 enzymatic activity is altered during hepatic steatosis, we fed mice a high fat diet (HFD) for

14 weeks and assessed CD73 ecto-AMPase activity using enzyme histochemistry. As shown

Figure 3.5. Metabolic Imbalance and Increased Steatosis in Male CD73-LKO Mouse Hepatocytes and Livers. (A) Ingenuity pathway analysis of proteomic results showing activated (orange) and inhibited (blue) pathways in freshly isolated hepatocytes from male CD73-LKO mice relative to WT controls. (B) H&E staining of formalin-fixed liver sections. Magnified view of boxed areas in the left panel comparing the presence of steatosis in male and female CD73-LKO mice. Scale bar: 200 μm. (C) Quantification of blinded histologic scoring of microvesicular and macrovesicular steatosis. Scoring: 0, none; 1, mild; 2, moderate; 3, severe (scores were averaged for animals with microsteatosis and macrosteatosis). Males: n = 13 WT; n = 12 CD73-LKO; females: n = 14 WT; n = 18 CD73- LKO. ∗∗∗P < .001, 1-way analysis of variance. (D) Gene expression analysis of lipid metabolism genes Acaca, Hmgcr, Hmgcs1, Srebp1a, and Srebp1c using total liver messenger RNA in male and female WT and CD73-LKO mice. n = 13 WT male, n = 12 LKO male, n = 14 WT female, n = 18 LKO female. ∗P < .05, ∗∗∗P < .001, ∗∗∗∗P < .0001, 2-way analysis of variance. Error bars represent SD. EIF2, eukaryotic initiation factor 2; NER, nucleotide excision repair; PPARα/RXRα, peroxisome proliferator-activated receptor α/retinoid X receptor α; tRNA, transfer RNA.

62 in Figure 3.6C, hepatic steatosis leads to a dramatic decrease in CD73 activity in vivo.

Together with the results in isolated hepatocytes, this suggests that CD73 enzymatic activity and hepatic lipid metabolism are closely linked.

The proteomic profiling revealed that AMPK, which is an ATP sensor and master metabolic regulator of lipid and glucose homeostasis was downregulated in CD73-LKO hepatocytes. To determine if the metabolic dysregulation in the absence of CD73 was linked to altered AMPK signaling, we probed for AMPK substrate phosphorylation using a specific phospho-motif antibody (targeting LXRXX [pS/pT])32. Despite equal expression of total

AMPKα, male CD73-LKO mice had dramatic reduction in the phosphorylation of AMPK substrates (Figure 3.7A and B). On the other hand, baseline AMPK substrate phosphorylation was lower in WT female mice and not changed significantly by CD73 deletion. The downregulation of AMPK substrate phosphorylation was not related to major changes in the abundance or subcellular distribution of the kinase (Figure 3.7C), leading us to hypothesize that adenosine generated by CD73 promotes AMPK activity. In support of this hypothesis, extracellular addition of AMP significantly, and dose-dependently, induced AMPK activation (phosphorylation at Thr-172) in primary hepatocytes co-treated with soluble, enzymatically-active CD73 (Figure 3.7D and E). To determine if this effect was dependent on the uptake of extracellular adenosine, we tested AMPK activation in the absence and presence of nitrobenzylthioinosine (NBTI), an inhibitor of the ENT1 adenosine re-uptake transporter33. Although AMPK phosphorylation appeared blunted in the presence of (NBTI), this was not statistically-significant (Figure 3.7F-G), suggesting multiple potential mechanisms. Combined, these data show that CD73, in the presence of extracellular AMP,

Figure 3.6. Inhibition of CD73 Enzymatic Activity Promotes Lipid Accumulation in Hepatocytes. (A) Isolated WT C57BL/6 male hepatocytes were treated for 24 hours with 1 μmol/L oleic acid in the presence or absence of the CD73 inhibitor, APCP (10 μmol/L). Intracellular lipid accumulation was analyzed using LipidTOX neutral lipid stain (red). (B) Quantification of lipid accumulation in panel A. ∗∗P < .01, ∗∗∗∗P < .0001; 1-way analysis of variance. Error bars represent SD. (C) WT mice were fed normal chow (Control) or a HFD for 14 weeks. Top panels: Representative H&E images of Control- and HFD-fed mice, showing the development of steatosis in the HFD condition. Bottom panels: Representative enzyme histochemistry images showing a decrease in CD73 AMPase activity in the HFD condition. Scale bars: 200 μm.

Figure 3.7. CD73-Generated Extracellular Adenosine Activates AMPK in Hepatocytes and Livers from CD73-LKO Mice and Show Impaired AMPK Signaling. (A) Representative immunoblots of AMPK substrate phosphorylation in liver lysates from male and female mice. (B) Semiquantitative analysis of AMPK substrate phosphorylation relative to total protein based on immunoblots in panel A. ∗∗∗P < .0001, 2-way analysis of variance. Error bars represent SD. (C) Fresh-frozen liver sections were stained with antibodies against AMPK (red) and zonula occludens 1 (ZO1) (green) show similar AMPK distribution in WT and CD73-LKO mice. Bottom panels: Magnified view of the boxed areas. Scale bar: 50 μm. (D) Isolated WT hepatocytes were treated with AMP and recombinant soluble CD73 (rCD73) at the indicated concentrations. Representative immunoblots of total and phospho- AMPKα. (E) Quantification of phosphorylated/total AMPK. n = 4 replicates. ∗∗P < .001; 2- way analysis of variance. (F) Representative immunoblot analysis showing AMPK phosphorylation in WT hepatocytes treated with AMP, rCD73, and the adenosine transport inhibitor nitrobenzylthioinosine (NBTI). (G) Quantification of phosphorylated/total AMPK in rCD73-treated hepatocytes, in the absence/presence of AMP and NBTI. n = 3 replicates. 2- way analysis of variance. Error bars represent SD. DAPI, 4′,6-diamidino-2-phenylindole.

65 activates AMPK in hepatocytes potentially via transport-dependent and -independent mechanisms.

Mature Adult CD73-LKO Mice Develop Liver Inflammation, With Male Predominance in Severity

Because CD73 and adenosine plays a major role in immune suppression, we next asked whether CD73-LKO mice develop hepatic inflammation. Blinded histological analysis showed presence of portal and lobular inflammation in both male and female CD73-LKO mice, but the male mice were more severely affected (Figure 3.8A and B). Consistent with the known roles of adenosine34 and AMPK35 as anti-inflammatory mediators, we observed induction in the pro-inflammatory cytokines IL-1 and TNFα in the CD73-LKO livers, with the latter reaching statistical significance only in the female mice (Figure 3.8C). Despite the similar transcriptional changes of pro-inflammatory genes, male mice showed significantly more neutrophil infiltration, as assessed by lymphocyte antigen 6 complex locus G6D

(Ly6G) staining (Figure 3.8D and E). Profiling of CD73-associated adenosine pathway components, including the AMP substrate-generating enzyme CD39 (Entpd1) and adenosine receptors A1, A2A, A2B, and A3 (Adora 1, 2A, 2B, and 3), showed female-specific compensatory induction of these targets in the absence of hepatocyte CD73 (Figure 3.8F).

These results demonstrate that loss of hepatocyte CD73 leads to spontaneous liver inflammation, and that in female mice this may be partly opposed by compensatory upregulation of anti-inflammatory adenosine signaling mediators to limit tissue damage.

Discussion

Physiological Hepatoprotection of CD73 and Adenosine

Our study demonstrates the importance of CD73, a major extracellular AMPase, for the long-term metabolic integrity of the mammalian liver. Previous seminal work utilizing

Figure 3.8 Loss of Hepatocyte CD73 Results in Spontaneous Liver Inflammation. (A) Representative H&E images of inflammatory lesions in livers from 22-week-old CD73-LKO mice. Boxed areas in the top panels are magnified in the bottom panels. (B) Quantification of blinded histologic analysis of portal and lobular inflammation (scores were averaged for animals with portal + lobular inflammation). Scoring: 0, none; 2, minimal; 4, mild; 6, moderate; 8, severe. (C) Total liver messenger RNA analysis of proinflammatory markers interleukin 1β and tumor necrosis factor α in male (blue) and female (red) mice aged 21–42 weeks. (D) Representative images of immunohistochemical-stained paraffin-embedded liver tissues for neutrophil marker Ly6G (brown). Harris hematoxylin-stained nuclei (blue). Inset: magnified view of the boxed area showing signal distribution. Scale bar: 200 μm. (E) Quantification of Ly6G+ cells per view field in panel D. (F) Gene expression analysis of ectonucleotidase CD39 (Entpd1) and adenosine receptors A1R, 2AR, 2BR, and 3R (Adora1, 2a, 2b, 3) using total liver messenger RNA in male and female WT and LKO mice. n = 13 WT male, n = 12 LKO male, n = 14 WT female, n = 18 LKO female. ∗P < .05, ∗∗P < .01, ∗∗∗∗P < .0001, unpaired t test. Error bars represent SD.

67 constitutive CD73 knockout mice established CD73 as a key factor in maintaining epithelial integrity via adenosine-mediated protection of the tissue barrier function, especially during hypoxia19,22,36,37, while our present findings provide new insights into the homeostatic mechanisms that are specifically attributed to CD73 on hepatocytes.

The male-predominant, spontaneous development of liver disease that we observed in

CD73-LKO mice points to a physiological protective mechanism of CD73 that exhibits a sexual dimorphism. We conclude that AMPK hypo-activation, likely secondary to extracellular adenosine deficiency, contributes to the hepatocellular injury, metabolic stress, and inflammation in the male CD73-LKO mice. CD73 is significantly downregulated under conditions of severe and persistent chronic stress in the mouse liver 13, and in chronic human liver diseases of different etiologies 14,15. Future studies addressing the detailed mechanisms of how CD73 supports metabolic homeostasis in hepatocytes throughout the lifespan, and in a sex-dependent manner, will have important implications for understanding mammalian liver biology as well as disease development and progression. To that end, the Nt5efl/fl and

CD73-LKO mice represent tools for studying the cell-specific mechanisms of human liver diseases that are driven by perturbed metabolism and inflammation, such as NAFLD38.

Sex Differences and Hormonal Regulation of the CD73-Adenosine Axis Across the Lifespan

At present, we do not fully understand the genetic and metabolic factors contributing to the sex differences. Our findings here highlight the importance for future work to consider both biological sex and age when examining the role of CD73-adenosine in hepatocyte biology and liver disease. Previous reports using whole-body knockout mice to address the role of CD73 and adenosine in hepatic steatosis39 and fibrosis40 examined only young (6-8 weeks) male mice. We found that 7-week-old CD73-LKO mice are indistinguishable from

68 their WT littermates, regardless of sex, whereas CD73 loss is detrimental at older age, but that female mice are relatively protected. While our study is the first demonstration of sex- dependent liver injury due to CD73 deficiency, the CD73-adenosine axis has been linked recently to the protective action of female sex hormones in other organ systems and diseases.

For example, estrogen receptor signaling maintains CD73 expression and adenosine production by osteoprogenitors, while the loss of CD73-generated adenosine promotes postmenopausal bone loss in mice41. In addition, several studies reveal complex and region- specific modulation of spontaneous adenosine production by CD73 in the central nervous system that is mediated by both estrogen receptors  and 42-44, accounting for sex differences underlying adenosine-dependent neuromodulation. Although the exact significance of increased Hmgcs1 in the female mice is not presently clear, it is possible that it serves a protective mechanism against lipid accumulation because deficiency of the closely related mitochondrial Hmgcs2 gene promotes mouse fatty liver pathology via ketogenic insufficiency45. Moreover, it was shown recently that, in regulatory T cells, perturbation of the mevalonate pathway leads to metabolic stress and a dramatic reduction in cell surface

CD73 expression46, showing a link between these 2 pathways.

Biological sex and reproductive hormones exert a significant effect over individual variability to human disease development and progression47. This is especially evident in chronic liver disease, which currently ranks among the top ten causes of death in men, but not in women 48. Both male sex and older age are associated with worse survival and greater incidence of HCC among patients with biopsy-confirmed NAFLD49. However, the basic biological mechanisms of how age and biological sex affect patient susceptibility to disease development and progression have been difficult to understand, especially in the case of

69 NAFLD50. Recent studies in mice reveal that the genetic background, body fat distribution, plasma high density lipoprotein (HDL), ceramides, and metabolic genes (e.g. Pklr, Lcn2) levels underlie sex differences in hepatic steatosis51-55. The most extensive analysis to date, examining 50 metabolic and cardiovascular traits in 100 inbred mouse strains revealed significant sex differences in at the molecular and physiological levels55. In general, sex hormones partially accounted for the metabolic traits, but the major conclusion from this study was that sex differences cannot be reconciled by examining single molecules or even pathways, given the multitude of variables that exert effects upon the organism (e.g., environment, age, genetic background) and their interactions. Therefore, the CD73-adenosine axis is one of many pathways that can influence sex differences in liver biology and disease.

Cross-Talk Between CD73 and AMPK in Hepatocytes

CD73 is strongly induced in epithelial tissues under hypoxic conditions via hypoxia- inducible factor-1 (HIF-1)19. Rapid and sustained CD73 upregulation during hepatic ischemia confers adenosine-dependent hepatoprotection21. The latter is very similar to the reported hepatoprotective effect of AMPK during ischemic preconditioning56, although a functional link between these pathways has not been established. At 5 months of age, AMPK activity in mouse liver is significantly augmented by hypoxia, but this regulation is lost at older age57.

The age-dependent activation of AMPK by hypoxia in the liver coincides with the age of onset of spontaneous liver injury in the CD73-LKO mice, which became apparent at 5 months in our study animals. Based on this, we propose that the detrimental effects stemming from CD73 deficiency in hepatocytes may be associated with impaired capacity of the mature liver to calibrate oxygen responses properly via AMPK. In vitro work in cell lines, and in vivo studies using lower organisms, have linked AMPK and HIF-1 cross-talk with

70 cellular homeostasis and organismal longevity through their roles in balancing intracellular reactive oxygen species (ROS)58,59. The purinergic signaling pathway also plays important roles in oxidative stress responses in the liver and is disrupted in liver disease60. As a key regulator of purinergic signaling, and the major extracellular enzymatic source of the immuno-suppressive and anti-inflammatory mediator adenosine, CD73 represents a promising target for metabolic inflammation, which is considered a major driver of chronic human diseases and associated comorbidities38,61.

Anti-Inflammatory Effects of Adenosine in the Liver

In various liver injury models, adenosine exerts protective anti-inflammatory effects through the activation of the Gs-protein coupled adenosine receptor 2A (A2AR) on hepatocytes and immune cells34,62,63. For example, genetic deletion or pharmacological inhibition of the A2AR causes severe inflammation and liver damage following concanavalin

A (Con A)-induced liver injury in a mixed cohort of male and female mice62. Whole-body hypoxia treatment provided protection against Con A-induced liver inflammation63. Although the detailed mechanism behind the hepatoprotective effects of hypoxia in liver inflammation are not clear, it is plausible that hypoxia-mediated CD73 induction, followed by increased extracellular adenosine production, may be important during immune-mediated liver damage, which remains to be examined in detail in future studies. CD73 protein was shown to be upregulated in a high fat diet (HFD) model of liver injury performed in male mice, where the

34 hepatic protein expression of CD39 and A2AR were also increased . The upregulation of these purinergic factors was likely a protective mechanism because the absence of A2AR led to more severe inflammation, steatosis, and impaired insulin sensitivity after HFD feeding34.

71 The hypo-activation of AMPK and liver injury in the CD73-LKO mice that we observed are similar to the findings from another study employing a mixed cohort of older

(12-16 months) male and female mice, which found that the absence of the A2AR receptor leads to hypo-activation of AMPK and metabolic dysregulation, specifically obesity, hyperglycemia and glucose intolerance64. The relative protection that we observed in the female CD73-LKO mice in our study could be attributed to compensatory induction of adenosine receptors, in particular A2AR and A2BR. Our proteomic analysis revealed a paradoxical finding that the mTOR pathway is decreased in the CD73-LKO mice. It is plausible that the decrease in mTOR activity as predicted by the proteomic analysis is secondary to nucleotide imbalance since it was shown recently that mTOR is inhibited by purine depletion (adenylate and its derivatives) irrespective of AMPK activation65.

Specifically, genetic, and pharmacological blockade of de novo purine biosynthesis or purine salvage significantly decreased the activation of key mTOR downstream targets, S6K and

4EBP1. This inhibitory effect was rescued by exogenous purines and their intracellular conversion to adenylate nucleotides.

Taken together, our study provides broad insight into potential novel and sex- dependent functions of CD73 in promoting hepatocyte metabolic homeostasis under physiological conditions. Future studies will illuminate deeper understanding of the mechanistic networks by which CD73 plays a role in the liver. Ultimately, our findings can improve target identification for drug discovery in chronic liver diseases.

72 REFERENCES

1 Younossi, Z. et al. Global burden of NAFLD and NASH: trends, predictions, risk factors and prevention. Nat Rev Gastroenterol Hepatol 15, 11-20, doi:10.1038/nrgastro.2017.109 (2018).

2 Anstee, Q. M., Reeves, H. L., Kotsiliti, E., Govaere, O. & Heikenwalder, M. From NASH to HCC: current concepts and future challenges. Nat Rev Gastroenterol Hepatol 16, 411-428, doi:10.1038/s41575-019-0145-7 (2019).

3 Cotter, T. G. & Rinella, M. Nonalcoholic Fatty Liver Disease 2020: The State of the Disease. Gastroenterology 158, 1851-1864, doi:10.1053/j.gastro.2020.01.052 (2020).

4 Eslam, M., Sanyal, A. J., George, J. & International Consensus, P. MAFLD: A Consensus-Driven Proposed Nomenclature for Metabolic Associated Fatty Liver Disease. Gastroenterology 158, 1999-2014 e1991, doi:10.1053/j.gastro.2019.11.312 (2020).

5 Hyams, D. E. & Isselbacher, K. J. Prevention of Fatty Liver by Administration of Adenosine Triphosphate. Nature 204, 1196-1197, doi:10.1038/2041196a0 (1964).

6 Cortez-Pinto, H. et al. Alterations in liver ATP homeostasis in human nonalcoholic steatohepatitis: a pilot study. JAMA 282, 1659-1664, doi:10.1001/jama.282.17.1659 (1999).

7 Zimmermann, H. 5'-Nucleotidase: molecular structure and functional aspects. Biochem J 285 ( Pt 2), 345-365, doi:10.1042/bj2850345 (1992).

8 Borea, P. A., Gessi, S., Merighi, S., Vincenzi, F. & Varani, K. Pharmacology of Adenosine Receptors: The State of the Art. Physiol Rev 98, 1591-1625, doi:10.1152/physrev.00049.2017 (2018).

9 Griffiths, M. et al. Cloning of a human nucleoside transporter implicated in the cellular uptake of adenosine and chemotherapeutic drugs. Nat Med 3, 89-93, doi:10.1038/nm0197-89 (1997).

10 Spychala, J. et al. Cloning of human adenosine kinase cDNA: sequence similarity to microbial ribokinases and fructokinases. Proc Natl Acad Sci U S A 93, 1232-1237, doi:10.1073/pnas.93.3.1232 (1996).

73 11 Colgan, S. P., Eltzschig, H. K., Eckle, T. & Thompson, L. F. Physiological roles for ecto-5'-nucleotidase (CD73). Purinergic Signal 2, 351-360, doi:10.1007/s11302-005- 5302-5 (2006).

12 Minor, M., Alcedo, K. P., Battaglia, R. A. & Snider, N. T. Cell type- and tissue- specific functions of ecto-5'-nucleotidase (CD73). Am J Physiol Cell Physiol 317, C1079-C1092, doi:10.1152/ajpcell.00285.2019 (2019).

13 Snider, N. T. et al. CD73 (ecto-5'-nucleotidase) hepatocyte levels differ across mouse strains and contribute to mallory-denk body formation. Hepatology 58, 1790-1800, doi:10.1002/hep.26525 (2013).

14 Snider, N. T. et al. Alternative splicing of human NT5E in cirrhosis and hepatocellular carcinoma produces a negative regulator of ecto-5'-nucleotidase (CD73). Mol Biol Cell 25, 4024-4033, doi:10.1091/mbc.E14-06-1167 (2014).

15 Alcedo, K. P. et al. Tumor-Selective Altered Glycosylation and Functional Attenuation of CD73 in Human Hepatocellular Carcinoma. Hepatol Commun 3, 1400-1414, doi:10.1002/hep4.1410 (2019).

16 Ben-Moshe, S. et al. Spatial sorting enables comprehensive characterization of liver zonation. Nat Metab 1, 899-911, doi:10.1038/s42255-019-0109-9 (2019).

17 Moor, A. E. et al. Spatial Reconstruction of Single Enterocytes Uncovers Broad Zonation along the Intestinal Villus Axis. Cell 175, 1156-1167 e1115, doi:10.1016/j.cell.2018.08.063 (2018).

18 Broeker, K. A. E. et al. Different subpopulations of kidney interstitial cells produce erythropoietin and factors supporting tissue oxygenation in response to hypoxia in vivo. Kidney Int 98, 918-931, doi:10.1016/j.kint.2020.04.040 (2020).

19 Synnestvedt, K. et al. Ecto-5'-nucleotidase (CD73) regulation by hypoxia-inducible factor-1 mediates permeability changes in intestinal epithelia. J Clin Invest 110, 993- 1002, doi:10.1172/JCI15337 (2002).

20 Tak, E. et al. Protective role of hypoxia-inducible factor-1alpha-dependent CD39 and CD73 in fulminant acute liver failure. Toxicol Appl Pharmacol 314, 72-81, doi:10.1016/j.taap.2016.11.016 (2017).

74 21 Hart, M. L. et al. Extracellular adenosine production by ecto-5'-nucleotidase protects during murine hepatic ischemic preconditioning. Gastroenterology 135, 1739-1750 e1733, doi:10.1053/j.gastro.2008.07.064 (2008).

22 Thompson, L. F. et al. Crucial role for ecto-5'-nucleotidase (CD73) in vascular leakage during hypoxia. J Exp Med 200, 1395-1405, doi:10.1084/jem.20040915 (2004).

23 Gebhardt, R. Metabolic zonation of the liver: regulation and implications for liver function. Pharmacol Ther 53, 275-354, doi:10.1016/0163-7258(92)90055-5 (1992).

24 Hall, Z. et al. Lipid zonation and phospholipid remodeling in nonalcoholic fatty liver disease. Hepatology 65, 1165-1180, doi:10.1002/hep.28953 (2017).

25 Koupenova, M. & Ravid, K. Adenosine, adenosine receptors and their role in glucose homeostasis and lipid metabolism. J Cell Physiol, doi:10.1002/jcp.24352 (2013).

26 Allard, B., Allard, D., Buisseret, L. & Stagg, J. The adenosine pathway in immuno- oncology. Nat Rev Clin Oncol, doi:10.1038/s41571-020-0382-2 (2020).

27 Willingham, S. B. et al. Characterization and Phase 1 Trial of a B Cell Activating Anti-CD73 Antibody for the Immunotherapy of COVID-19. medRxiv, 2020.2009.2010.20191486, doi:10.1101/2020.09.10.20191486 (2020).

28 Postic, C. et al. Dual roles for glucokinase in glucose homeostasis as determined by liver and pancreatic beta cell-specific gene knock-outs using Cre recombinase. The Journal of biological chemistry 274, 305-315, doi:10.1074/jbc.274.1.305 (1999).

29 Tabula Muris, C. et al. Single-cell transcriptomics of 20 mouse organs creates a Tabula Muris. Nature 562, 367-372, doi:10.1038/s41586-018-0590-4 (2018).

30 Ang, C. H. et al. Lgr5(+) pericentral hepatocytes are self-maintained in normal liver regeneration and susceptible to hepatocarcinogenesis. Proc Natl Acad Sci U S A 116, 19530-19540, doi:10.1073/pnas.1908099116 (2019).

31 Wang, B., Zhao, L., Fish, M., Logan, C. Y. & Nusse, R. Self-renewing diploid Axin2(+) cells fuel homeostatic renewal of the liver. Nature 524, 180-185, doi:10.1038/nature14863 (2015).

75 32 Gwinn, D. M. et al. AMPK phosphorylation of raptor mediates a metabolic checkpoint. Mol Cell 30, 214-226, doi:10.1016/j.molcel.2008.03.003 (2008).

33 Pastor-Anglada, M. & Perez-Torras, S. Who Is Who in Adenosine Transport. Front Pharmacol 9, 627, doi:10.3389/fphar.2018.00627 (2018).

34 Cai, Y. et al. Disruption of adenosine 2A receptor exacerbates NAFLD through increasing inflammatory responses and SREBP1c activity. Hepatology 68, 48-61, doi:10.1002/hep.29777 (2018).

35 Garcia, D. et al. Genetic Liver-Specific AMPK Activation Protects against Diet- Induced Obesity and NAFLD. Cell Rep 26, 192-208 e196, doi:10.1016/j.celrep.2018.12.036 (2019).

36 Volmer, J. B., Thompson, L. F. & Blackburn, M. R. Ecto-5'-nucleotidase (CD73)- mediated adenosine production is tissue protective in a model of bleomycin-induced lung injury. J Immunol 176, 4449-4458, doi:10.4049/jimmunol.176.7.4449 (2006).

37 Grenz, A. et al. Protective role of ecto-5'-nucleotidase (CD73) in renal ischemia. J Am Soc Nephrol 18, 833-845, doi:10.1681/ASN.2006101141 (2007).

38 Gehrke, N. & Schattenberg, J. M. Metabolic Inflammation-A Role for Hepatic Inflammatory Pathways as Drivers of Comorbidities in Nonalcoholic Fatty Liver Disease? Gastroenterology 158, 1929-1947 e1926, doi:10.1053/j.gastro.2020.02.020 (2020).

39 Peng, Z. et al. Adenosine signaling contributes to ethanol-induced fatty liver in mice. J Clin Invest 119, 582-594, doi:10.1172/JCI37409 (2009).

40 Peng, Z. et al. Ecto-5'-nucleotidase (CD73) -mediated extracellular adenosine production plays a critical role in hepatic fibrosis. FASEB J 22, 2263-2272, doi:10.1096/fj.07-100685 (2008).

41 Shih, Y. V. et al. Dysregulation of ectonucleotidase-mediated extracellular adenosine during postmenopausal bone loss. Sci Adv 5, eaax1387, doi:10.1126/sciadv.aax1387 (2019).

76 42 Borgus, J. R., Puthongkham, P. & Venton, B. J. Complex sex and estrous cycle differences in spontaneous transient adenosine. J Neurochem 153, 216-229, doi:10.1111/jnc.14981 (2020).

43 Mitrović, N. et al. 17β-Estradiol upregulates ecto-5'-nucleotidase (CD73) in hippocampal synaptosomes of female rats through action mediated by estrogen receptor-α and -β. Neuroscience 324, 286-296, doi:10.1016/j.neuroscience.2016.03.022 (2016).

44 Wang, Y., Copeland, J., Shin, M., Chang, Y. & Venton, B. J. CD73 or CD39 Deletion Reveals Different Mechanisms of Formation for Spontaneous and Mechanically Stimulated Adenosine and Sex Specific Compensations in ATP Degradation. ACS Chem Neurosci 11, 919-928, doi:10.1021/acschemneuro.9b00620 (2020).

45 Cotter, D. G. et al. Ketogenesis prevents diet-induced fatty liver injury and hyperglycemia. J Clin Invest 124, 5175-5190, doi:10.1172/JCI76388 (2014).

46 Timilshina, M. et al. Activation of Mevalonate Pathway via LKB1 Is Essential for Stability of Treg Cells. Cell Rep 27, 2948-2961 e2947, doi:10.1016/j.celrep.2019.05.020 (2019).

47 Mauvais-Jarvis, F. et al. Sex and gender: modifiers of health, disease, and medicine. Lancet 396, 565-582, doi:10.1016/S0140-6736(20)31561-0 (2020).

48 Heron, M. Deaths: Leading Causes for 2017. Natl Vital Stat Rep 68, 1-77 (2019).

49 Vilar-Gomez, E. et al. Fibrosis Severity as a Determinant of Cause-Specific Mortality in Patients With Advanced Nonalcoholic Fatty Liver Disease: A Multi-National Cohort Study. Gastroenterology 155, 443-457 e417, doi:10.1053/j.gastro.2018.04.034 (2018).

50 Lonardo, A. et al. Sex Differences in Nonalcoholic Fatty Liver Disease: State of the Art and Identification of Research Gaps. Hepatology 70, 1457-1469, doi:10.1002/hep.30626 (2019).

51 Norheim, F. et al. Genetic and hormonal control of hepatic steatosis in female and male mice. J Lipid Res 58, 178-187, doi:10.1194/jlr.M071522 (2017).

77 52 Norheim, F. et al. Genetic, dietary, and sex-specific regulation of hepatic ceramides and the relationship between hepatic ceramides and IR. J Lipid Res 59, 1164-1174, doi:10.1194/jlr.M081398 (2018).

53 Chella Krishnan, K. et al. Sex-specific metabolic functions of adipose Lipocalin-2. Mol Metab 30, 30-47, doi:10.1016/j.molmet.2019.09.009 (2019).

54 Kurt, Z. et al. Tissue-specific pathways and networks underlying sexual dimorphism in non-alcoholic fatty liver disease. Biol Sex Differ 9, 46, doi:10.1186/s13293-018- 0205-7 (2018).

55 Norheim, F. et al. Gene-by-Sex Interactions in Mitochondrial Functions and Cardio- Metabolic Traits. Cell Metab 29, 932-949 e934, doi:10.1016/j.cmet.2018.12.013 (2019).

56 Peralta, C. et al. Adenosine monophosphate-activated protein kinase mediates the protective effects of ischemic preconditioning on hepatic ischemia-reperfusion injury in the rat. Hepatology 34, 1164-1173, doi:10.1053/jhep.2001.29197 (2001).

57 Mulligan, J. D., Gonzalez, A. A., Kumar, R., Davis, A. J. & Saupe, K. W. Aging elevates basal adenosine monophosphate-activated protein kinase (AMPK) activity and eliminates hypoxic activation of AMPK in mouse liver. J Gerontol A Biol Sci Med Sci 60, 21-27, doi:10.1093/gerona/60.1.21 (2005).

58 Hwang, A. B. et al. Feedback regulation via AMPK and HIF-1 mediates ROS- dependent longevity in Caenorhabditis elegans. Proc Natl Acad Sci U S A 111, E4458-4467, doi:10.1073/pnas.1411199111 (2014).

59 Rabinovitch, R. C. et al. AMPK Maintains Cellular Metabolic Homeostasis through Regulation of Mitochondrial Reactive Oxygen Species. Cell Rep 21, 1-9, doi:10.1016/j.celrep.2017.09.026 (2017).

60 Burnstock, G., Vaughn, B. & Robson, S. C. Purinergic signalling in the liver in health and disease. Purinergic Signal 10, 51-70, doi:10.1007/s11302-013-9398-8 (2014).

61 Hotamisligil, G. S. Inflammation, metaflammation and immunometabolic disorders. Nature 542, 177-185, doi:10.1038/nature21363 (2017).

78 62 Ohta, A. & Sitkovsky, M. Role of G-protein-coupled adenosine receptors in downregulation of inflammation and protection from tissue damage. Nature 414, 916- 920, doi:10.1038/414916a (2001).

63 Chouker, A. et al. Critical role of hypoxia and A2A adenosine receptors in liver tissue-protecting physiological anti-inflammatory pathway. Mol Med 14, 116-123, doi:10.2119/2007-00075.Chouker (2008).

64 Cordero-Herrera, I. et al. AMP-activated protein kinase activation and NADPH oxidase inhibition by inorganic nitrate and nitrite prevent liver steatosis. Proc Natl Acad Sci U S A 116, 217-226, doi:10.1073/pnas.1809406115 (2019).

65 Hoxhaj, G. et al. The mTORC1 Signaling Network Senses Changes in Cellular Purine Nucleotide Levels. Cell Rep 21, 1331-1346, doi:10.1016/j.celrep.2017.10.029 (2017).

CHAPTER 4: HEPATOCYTE CD73 IS A TARGET OF ETHANOL AND PROTECTS DURING ALCOHOL-INDUCED LIVER INJURY

Introduction

Alcohol consumption continues to be a leading global health burden, yet there is stagnation in the clinical translation of basic research findings on novel targeted therapies for alcohol-related liver disease (ALD). According to the 2018 World Health Organization Report, alcohol consumption accounts for 3.1 million deaths and 132.6 million individuals suffering from alcohol-related disabilities in a given year1. Among the estimated 2.3 billion current drinkers, almost half of them participate in heavy episodic drinking, consuming more than 60 grams of pure alcohol (roughly equal to 4-5 beers) at least once per session1. As a result, the liver undergoes a spectrum of pathological changes that include fatty liver or steatosis, hepatocellular damage and cell death, and inflammation2. These changes are significant risk factors for the development of advanced liver diseases such as fibrosis, cirrhosis, and hepatocellular carcinoma2. While alcohol abstinence is still the most critical therapeutic strategy, many patients present with advanced ALD upon diagnosis and thus, require effective treatment. In light of this, current therapies focus on regulating the persistent ethanol-induced inflammation that drives ALD progression. However, clinical trials have yet to show efficacy of these treatments3.

Strategies with the greatest potential for treatment are those that can block the early stages of ALD progression. One potential novel regulator in this process that has emerged is ecto-5’-nucleotidase (commonly known as CD73). CD73 is the product of the NT5E gene, and it functions as an AMP-ectonucleotiadse (AMPase) that generates the majority of extracellular

adenosine. Previous studies using the global CD73 knockout mice demonstrated that the loss of CD73 attenuated ethanol-induced steatosis4 and fibrosis5, while others showed that it exacerbated hepatic ischemia and reperfusion injury6. The discrepancy in these findings can be attributed to the ubiquitous expression of CD73 in the liver; thus, a more mechanistic examination of the cell-specific CD73 contributions in liver diseases is warranted. More recently, we showed that hepatocytes generate the majority of extracellular adenosine in the liver, and that CD73 deletion in hepatocytes resulted in spontaneous liver inflammation under basal conditions in vivo7. Furthermore, we demonstrated that the inhibition of hepatocyte CD73

AMPase activity resulted in unstimulated lipid accumulation in primary hepatocytes, which was recapitulated in vivo7. Therefore, we hypothesize that hepatocyte CD73 may exert hepatoprotective functions against alcohol-induced injury via its AMPase activity.

In this study, we tested our hypothesis using the acute-on-chronic ethanol and binge diet to induce ALD8 in liver-specific CD73 knockout (CD73-LKO) mice. Our findings point to hepatocyte CD73 expression and function as an adaptive response to ethanol exposure, potentially due to adenosine-mediated tissue barrier protection and immunosuppression.

Furthermore, we uncovered a novel, non-enzymatic CD73 function as a bioactive lipid-binding protein, suggesting a non-redundant role of CD73 in regulating ethanol-induced inflammation.

These data implicate hepatocyte CD73 as a critical gatekeeper protein between homeostasis and tissue injury in ALD.

Materials and Methods

Antibodies and Reagents

The following antibodies were used for immunoblotting: anti-CD73 (13160; Cell

Signaling Technology, Danvers, MA) and anti-vinculin (V9131; Sigma-Aldrich, St. Louis,

MO). For immunofluorescence analysis, we used: anti-CD73 IE9 (sc-32299; Santa Cruz

Biotechnology, Dallas, TX), K8/18 (clone 8592), and GFAP (G3893; Sigma-Aldrich, St.

Louis, MO). The following chemicals and reagents used in this study is the same as was used in our previously published paper7.

Animal Studies

Wild-type and CD73 liver-specific knockout male mice (CD73-LKO) between 2-10 months of age were used in this study. Specifically, 8-10 months-old WT and CD73-LKO mice were administered the National Institute on Alcohol Abuse and Alcoholism chronic and binge ethanol diet (the NIAAA model)8. Briefly, mice were acclimated to a Lieber-DeCarli liquid diet (F1259SP; BioServ, Flemington, NJ) for 5 days at the initial stage of the study. Mice were subsequently divided into two groups: Group 1 was fed 5% volume/volume (v/v) ethanol- liquid containing Lieber-DeCarli diet (F1679SP; Bioserv, Flemington, NJ), and Group 2 was fed an isocaloric maltose dextran liquid diet. After 10 days of ad libitum feeding, mice were given oral gavage: Group 1 received 36% v/v ethanol gavage, and Group 2 received an isocaloric maltose dextran gavage. This procedure was done 9 hours prior to euthanasia and tissue collection. All mice were housed in the pathogen-free animal facility at the University of North Carolina at Chapel Hill and were fed a normal chow diet prior to the study. All experiments and procedures were approved by the Institutional Animal Care and Use

Committee and in accordance with the National Institutes of Health guidelines.

Serum Analysis

Blood was collected by cardiac puncture from male mice under deep anesthesia. Serum was analyzed for alanine aminotransferase levels using the VetScan VS2 Analyzer and

VetScan mammalian liver profile reagent rotor (Abaxis; Union City, CA).

Primary Hepatocytes

Human primary hepatocytes were purchased from __. Mouse primary hepatocytes were isolated from 2-months-old male wild-type (WT) mice using our published protocol7. Both mouse and human hepatocytes were cultured in a collagen sandwich culture as previously shown9. For the time- and dose-dependent ethanol studies, primary mouse hepatocytes were cultured for 3 days and media was changed daily before ethanol treatment. They were incubated in 0, 50, or 100 millimoles/liter (mM) concentrations of ethanol for 24, 48, or 72 hours. Parafilm was wrapped in each dish to prevent ethanol evaporation. Control cells were taken at the initiation of ethanol treatment. For the acute ethanol treatment, primary mouse hepatocytes purchased from Lonza were cultured in a 96-well plate. Cells were incubated with

50 mM ethanol and was analyzed using enzyme histochemistry. For leukotriene B3 (LTB3) studies, human primary hepatocytes were cultured for 6 days prior to treatment. Cells were incubated with 100 nanomoles/L (nM) LTB3 for 1 and 6 hours before immunofluorescence analysis. Control cells received no treatment.

Human Samples

Liver biopsies from alcoholic steatohepatitis (ASH) patients (n=16) and non-ASH individuals (n=11) were obtained in collaboration with Dr. Ramon Bataller at the University of North Carolina at Chapel Hill. Messenger RNA (mRNA) was extracted in Dr. Bataller’s lab. Gene expression was analyzed by quantitative polymerase chain reaction (qPCR) using the following primers: human NT5E-Forward: 5’; human NT5E-Reverse: 5’; 18S-Forward:

5’-; 18S-Reverse: 5’.

Protein Thermal Shift Assay (PTS)

The PTS assay was performed used a commercial kit (Thermo Fisher 4461146). Each

10µL reaction contained 1.25µL protein dye, 2.5µL PTS Buffer, 1µL DMSO (vehicle) or bioactive lipid from a screening library (Cayman Chemical 10507), and 5.25µL of purified

CD73 diluted in water (for a total of 1µg protein per reaction). The optimal CD73 protein amount in each reaction of the screen was empirically determined by testing the melting profile of CD73 in a concentration range from 0.125-2µg per 10uL reaction.

In Vitro CD73 Specific Activity

Custom-purified active human CD73 was purchased from R&D Systems and the specific activity was assessed using the Malachite Green Phosphate Detection kit (DY996) following manufacturer guidelines. The effect of LTB3 on CD73 activity was assessed by pre- incubating the purified protein with different concentrations of the lipid (as specified in the figure legends) for 5 min. APCP was used as a positive control for CD73 inhibition.

Immunoblot

Total liver lysates were extracted from 25 milligrams of tissue obtained from the left lobe using ice-cold lysis buffer as detailed previously7. Primary hepatocytes cultured in collagen sandwich culture were lysed using the same protocol. Protein lysates were quantified using bicinchoninic acid (BCA) protein assay and resolved in 10% sodium dodecyl sulfate- polyacrylamide electrophoresis gels. Proteins were transferred to a nitrocellulose membrane, blocked in 5% milk/TBST for 1 hour, and incubated in primary antibodies overnight at 4°C.

Secondary antibodies were incubated for 1 hour prior to imaging using the Odyssey CLx infrared imaging system (Licor Biosciences, Lincoln, NE).

RNA and Quantitative PCR

Liver tissues from the left lobe or mouse primary hepatocytes were snap frozen immediately after collection. Total RNA was extracted according to the RNeasy Mini Kit manufacturer’s protocol (74104; Qiagen, Hilden, Germany). RNA was converted to complementary DNA using the high-capacity complementary DNA reverse-transcription kit

(4368813; Applied Biosystems, Foster City, CA). Gene expression analysis was performed using the SYBR Green PCR master mix (A25742; Applied Biosystems, Foster City, CA) and

Quantstudio 6 Flex System (Applied Biosystems, Foster City, CA). The following primers were used:

Liver Tissue Staining

Liver tissues from the left lobe were fixed with 10% neutral buffered formalin or flash frozen using OCT media as previously reported7. Hematoxylin and eosin (H&E) staining was performed by the Center for Gastrointestinal Biology and Disease histology core at the

University of North Carolina at Chapel Hill. Enzyme histochemistry was performed with our published protocol10. We followed the detailed guidelines for immunofluorescence staining as shown in other studies7.

Statistical Analysis

Data were analyzed using one-way ANOVA, two-way ANOVA, or unpaired student t test, and outliers were identified by Grubb’s test (α=0.05) built in GraphPad Prism. Data are presented relative to WT or untreated controls. Error bars from all graphs indicate standard deviation (s.d.) for n≥3 samples or independent experiments. P values are denoted within each respective figure panel. Number of samples or independent experiments is indicated in the figure legends.

Results

Ethanol Augments the Expression and Promotes Redistribution of CD73 on Hepatocytes

Given the known involvement of adenosine in ethanol-induced liver injury, we asked if the CD73-encoding gene, NT5E, is altered in patients diagnosed with alcoholic steatohepatitis (ASH). ASH is the most severe form of alcoholic liver disease and is associated with significant mortality11. Using liver biopsy specimens, we observed a 3.4-fold (p<0.0001) upregulation of NT5E in ASH patients compared to non-ASH controls (Figure 4.1A).

Because severe hepatocyte damage is the initiating factor in the development of ASH, we next sought to determine how CD73/NT5E is regulated in hepatocytes in response to ethanol. Primary hepatocytes isolated from male wild-type (WT) C57/BL6 mice were exposed to two different concentrations of ethanol for 48 hours, and Nt5e mRNA expression was analyzed by qPCR. As shown in Figure 4.1B, Nt5e was upregulated in a dose-dependent manner following ethanol treatment. In agreement with the Nt5e transcript, hepatocyte CD73 protein levels increased as early as 24 hours up to 72 hours in response to ethanol (Figure

4.1C). While untreated hepatocytes exhibited the expected plasma membrane-associated

AMPase activity, ethanol-treated hepatocytes showed significant redistribution of AMPase activity outside of the membrane space (Figure 4.1D), suggesting that hepatocyte CD73 mRNA expression, protein levels, and enzymatic activity are regulated in a dynamic time- and concentration-dependent manner in response to ethanol. Of note, there was no significant cell death at these time points and ethanol concentrations (not shown).

The Bioactive Lipid LTB3 Binds CD73 and Promotes its Redistribution on Hepatocytes

The striking redistribution of CD73 activity in hepatocytes is consistent with the known ability of ethanol to remodel the membrane lipid bilayer12,13. Moreover, alcohol exposure

Figure 4.1. CD73/NT5E is Upregulated in Response to Alcohol in Humans and Mice. A) CD73-encoding gene NT5E expression analysis in healthy controls (n=11) and alcoholic steatohepatitis patients (n=16). *p value <0.05, unpaired student t test. Mouse primary hepatocytes were treated with 50- and 100-mM ethanol at 24, 48, or 72 hours. CD73 expression was analyzed at the B) mRNA and C) protein level. *p value <0.05, one-way ANOVA. n=3- 4. D) CD73 AMPase activity was analyzed by enzyme histochemistry. Brown spots indicate enzyme activity. Phase contrast was added to demarcate cellular outline. Yellow boxes (right panels) are magnified in the middle panels. Scale bar = 200 m.

significantly alters the metabolism of neutral as well as bioactive lipids in vivo14,15. Bioactive lipids are a diverse set of molecules that include fatty acids and their metabolites, and they are important in metabolic homeostasis and regulation of inflammatory processes15. Therefore, we hypothesized that the redistribution of CD73 on the hepatocyte membrane is caused by its interactions with bioactive lipids generated upon ethanol exposure. Using differential scanning fluorimetry, we screened a set of 200 bioactive lipids that included fatty acids, prostaglandins, isoprostanes, thromboxanes, leukotrienes, and lipoxins for their ability to alter the thermal stability of purified human CD73. Two eicosanoids, leukotriene B3 (LTB3) and 11-dehydro-

2,3-dinor thromboxane B2 emerged as hits from this screen (Figure 4.2A). Both of these molecules are metabolites of arachidonic acid and their ability to alter the thermal stability of

CD73 was not shared by closely related structural analogs (Figure 4.2A, top panels #1-5).

LTB3 is an understudied and equipotent analog of LTB4, a known pro-inflammatory molecule that is associated with leukocyte infiltration16, hepatic insulin resistance17, and alcoholic liver disease severity18. Using an in vitro enzymatic assay, we determined that the

CD73 AMPase activity was modestly inhibited in the presence of 10µm LTB3, but not at lower concentrations that are more physiologically relevant (Figure 4.2B). Using a low, non- inhibitory concentration (100nM), we observed that LTB3 causes a redistribution of CD73 on the plasma membrane of hepatocytes within 1 to 6 hours of treatment. Combined, these results show that LTB3 is a direct ligand of CD73 and that promotes plasma membrane redistribution of its target (Figure 4.2C).

Deficiency of Hepatocyte CD73 Predisposes Mice to Alcohol-Induced Liver Injury

Because hepatocyte CD73 is responsive to ethanol in vitro and may exert a dual function against ethanol-induced inflammation, we examined its significance in vivo using the

Figure 4.2. Leukotriene B3 (LTB3) is a Non-Competitive Substrate for CD73. A) Top, Chemical structures of arachidonic acids that are similar to 11-dehydro-2,3-dinor thromboxane B2 (TBX2) and LTB3. Bottom, Differential scanning fluorimetry showing thermal stability of CD73 upon binding of ligands in (A). Note an increase in thermal stability of CD73 upon TBX2 and LTB3 binding. B) CD73 AMPase activity was measured in vitro in the presence of the CD73 substrate, AMP, LTB3, and CD73-inhibitor APCP. Concentrations are indicated in the panel. P value *p value <0.05, ****<0.0001; one-way ANOVA. n=3. C) Representative immunofluorescence analysis of CD73 (green) and 4′,6-diamidino-2-phenylindole (DAPI)- stained DNA (blue) on human primary hepatocytes were incubated with 100 nM LTB3 for 1 and 6 hours. Insets are magnified images of the area demarcated by white dotted box. Note the increased numbers of CD73 puncta in the presence of LTB3. n=3. Scale bar = 50 m.

hepatocyte-specific CD73 knockout (CD73-LKO) mice7. We adapted the National Institute of

Alcohol Abuse and Alcoholism chronic and binge ethanol diet (the NIAAA model, Figure

4.3A) to recapitulate acute-on-chronic alcoholic liver injury observed in ASH patients8. We administered the NIAAA diet on 8-10 month old WT and CD73-LKO mice based on our previous finding that showed CD73-LKO mice developed spontaneous liver injury during physiological aging7.

Initial characterization of mice fed the NIAAA diet showed that hepatocyte CD73 deficiency predisposes mice to alcohol-induced liver injury. Ethanol-fed CD73-LKO mice exhibited higher serum alanine aminotransferase (ALT) levels at 143.7 ±115.93 U/L compared to 96 ±19.98 U/L in WT mice (Figure 4.3B). In contrast, serum ALT levels of control-fed WT and CD73-LKO mice were comparable at 50.86 ±9.30 U/L and 58.63 ±26.40 U/L, respectively. Consistent with the in vitro data on primary hepatocytes, Nt5e was significantly upregulated by 2.5-fold (P<0.001) in the total liver of male WT mice fed the ethanol diet, compared to the control group (Figure 4.3C). There was no significant change in Nt5e expression in the CD73-LKO mice, suggesting that induction of CD73 in response to ethanol is primarily from hepatocytes and that this may exert hepatoprotection during acute-on-chronic ethanol-induced injury.

CD73 Expression and Function are Spatially Regulated in Response to Ethanol In Vivo

To determine if Nt5e induction correlates with CD73 protein, we performed immunoblot analysis of the total liver. CD73 was significantly increased in ethanol-fed male

WT mice than the control-fed WT group (Figure 4.4A). CD73-LKO mice showed a modest increase in CD73 protein from the ethanol group compared to the control. The observed protein levels corresponded with CD73 enzymatic activity on liver tissues (Figure 4.4B). In contrast

Figure 4.3. Nt5e Induction Attenuates Acute-on-Chronic Liver Injury in Mice. A) A schematic model of the acute-on-chronic ethanol diet that was established by the National Institute of Alcohol Abuse and Alcoholism (the NIAAA diet). Ethanol-fed mice received an ethanol oral gavage at the end of the study. Control group were fed an isocaloric maltose dextran diet and received a maltose dextran oral gavage. Male wild type (WT) and liver- specific CD73 knockout (CD73-LKO) mice aged 8-10 months were used in this study. n=7- 10 mice per group per diet. B) Serum alanine aminotransferase levels from WT (filled circles) and CD73-LKO (open circles) mice fed a control or ethanol diet. C) Nt5e gene expression analysis of mice in (B). **p value <0.01, ***<0.001; two-way ANOVA.

to the control group (Figure 4.4B, left panels), liver tissues of WT mice exposed to ethanol exhibited more prominent brown staining, an indication of AMPase activity, surrounding the central veins (Figure 4.4B, middle and right top panels). The lobular area had observable punctate or chicken-wire staining that resembles the bile canaliculi. Interestingly, male CD73-

LKO mice on the ethanol diet showed mild staining between hepatic plates (Figure 4B, middle and right bottom panels), suggesting that AMPase activity may be localized in the sinusoidal compartment and is potentially attributed to endothelial or non-parenchymal cells.

Specifically, hepatic stellate cells are known to be activated in alcoholic liver disease19.

Immunofluorescence analysis of glial fibrillary acidic protein (GFAP), an early marker of hepatic stellate cell activation, was significantly increased in between keratin 8/18-expressing hepatocytes only in ethanol-fed male CD73-LKO mice (Figure 4.4C). Thus, CD73 expression and AMPase activity are regulated spatially, suggesting a functional significance in pericentral hepatocytes upon ethanol treatment.

CD73 Attenuates Ethanol-Induced Hepatocellular Damage

We recently demonstrated that hepatocyte CD73 and adenosine are regulators of steatosis (fatty liver) and inflammation7; both of which are known disorders in alcoholic liver disease pathogenesis3. Specifically, pharmacological inhibition of CD73 led to lipid accumulation in hepatocytes. Moreover, CD73-LKO male mice exhibited portal and lobular inflammation with a significant infiltration of Ly6G+ neutrophils7. Therefore, we investigated whether CD73 exerts in vivo protection against steatosis and inflammation resulting from ethanol treatment. To investigate this, hematoxylin and eosin-stained liver tissues were analyzed by a blinded expert pathologist for alcohol-induced pathology. WT and CD73-LKO mice that were given a control diet did not show any significant alterations in the liver tissue

Figure 4.4. Increased CD73 Expression and AMPase Function Upon Alcohol Exposure. A) Representative immunoblot analysis of CD73 protein expression from the total livers of WT and CD73-LKO (LKO in short) mice that were fed the NIAAA diet. Vinculin was used as a loading control. n=7-10 mice per group per diet. B) Representative enzyme histochemistry of flash-frozen liver tissues from WT and CD73-LKO control- and ethanol-fed mice. Brown staining is indicative of AMPase activity. Note the greater intensity of brown staining surrounding central veins marked with an asterisk (*). Scale bar = 200 m. C) Representative immunofluorescence staining of liver tissues to analyze CD73 (green) expression in keratin (K) 8/18+ hepatocytes (red) or glial fibrillary acidic protein (GFAP)+ hepatic stellate cells (gray). DNA was stained using DAPI. Scale bar = 50 m.

(Figure 4.5, left panels). In contrast, ethanol-fed WT and CD73-LKO mice displayed variable signs of steatosis, inflammation, and cell death (Figure 4.5, right 3 panels). Histologic examination revealed minimal steatosis (3/8 mice), and mild steatosis (5/8 mice) in WT mice.

Liver tissues of CD73-LKO mice had minimal steatosis (2/9 mice) and observable micro- and macrovesicular steatosis (7/9 mice). Moreover, mice lacking CD73 exhibited lobular and portal inflammation, which is consistent with the immunosuppressive function of adenosine. While there were no identifiable foci of cell death in the livers of WT mice, there were apoptotic and necrotic areas in 7 out of 9 CD73-LKO mice. Combined, these data suggest that the presence and induction of hepatocyte CD73 may reduce the severity of hepatocellular damage and inflammation, thus limiting ethanol-induced tissue injury.

Discussion

Our study demonstrated that hepatocyte CD73 induction is an adaptive response to acute-on-chronic ethanol exposure to attenuate liver injury. Furthermore, we showed that hepatocyte CD73 AMPase activity is strongly localized in the pericentral hepatocytes, suggesting that it may exert tissue barrier protection6,20 against ethanol-induced pericentral hypoxia21. Previously, global CD73-/- mice fed a liquid ethanol-containing diet for 6 weeks were reported to develop less severe steatosis and have lower liver and serum triglycerides compared to WT mice4. The AMPase activity of CD73 was implicated in the protection against ethanol-induced steatosis on the basis that these effects were phenocopied in adenosine receptor A1 and A2A knockout mice, and in absence of any characterization of CD73 protein expression or AMPase activity in this model. Since ethanol is well-known to increase extracellular adenosine by means of inhibiting its reuptake via ENTs22, the mechanism in the adenosine receptor knockouts may be quite different from the CD73-/- mice. Here we show that

Figure 4.5. Loss of Hepatocyte CD73 Predisposes Male Mice to Alcohol-Induced Liver Injury. Representative hematoxylin and eosin-stained liver tissues from WT and CD73-LKO male mice fed a control- or ethanol-diet using the NIAAA model. Steatosis or fatty liver (small or large white circular droplets) was visible in both WT- and CD73-LKO ethanol-fed mice but was more prominent in the latter group. Inflammation (white-filled black arrows) was present in 1 WT and in all CD73-LKO ethanol-fed mice. There were observable foci of cell death or necrosis (yellow arrow heads) in CD73-LKO mice but not in WT mice. n=7-10 mice per group. Scale bar = 200 m.

the loss of hepatocyte CD73 led to exacerbated steatosis and an increase in activated hepatic stellate cells upon ethanol treatment. The discrepancy between our findings in the hepatocyte- specific knockout and previous findings in the global CD73 knockout mice, highlights the differences in the model systems and ubiquitous nature of CD73 expression, warranting more in-depth investigation of cell- and tissue-specific CD73.

Metabolic Stress Promotes Progression of Ethanol-Induced Liver Injury

We showed that hepatocyte CD73 deficiency exacerbated inflammation and steatosis mediated by ethanol. Surprisingly, activated GFAP+ hepatic stellate cells (HSC) were increased in the liver tissues of CD73-LKO mice after ethanol treatment, suggesting an early pre-fibrotic response. Activation of HSC is preceded by a deposition of extracellular matrix in the liver in response to cellular damage23. Independent of this study, we previously demonstrated that male mice lacking hepatocyte CD73 developed the same pathological conditions in normal physiological aging, in part due to the hypoactivation of AMP-activated protein kinase (AMPK) signaling, which likely resulted from a deficiency of extracellular adenosine7. AMPK, a key regulator of metabolic homeostasis, has been shown to mediate the inflammatory response24,25 and regulate lipid metabolism26. AMPK activation occurs in low cellular energy conditions (low ATP, high ADP) and is promoted and maintained by the binding of AMP to the CBS nucleotide-binding domain27. Thus, the activity of AMPK is particularly sensitive to the levels of available AMP nucleotides in the cytoplasm.

Upon chronic alcohol consumption, cellular energy and the redox state are increased as a result of ethanol oxidation28. Consequently, AMP levels are significantly reduced, and

AMPK activity is inhibited. In turn, ethanol inhibition of AMPK activity exacerbates NFB- mediated inflammation28 and lipid accumulation via the activation of SREBP-1 and acetyl-

CoA carboxylase29. However, it is important to note that AMPK inhibition is not completely due to the increased cellular energy resulting from ethanol oxidation. A study on chronic ethanol fed-rats demonstrated that pharmacological treatment with an AMPK-activator promoted AMPK phosphorylation and protection from ethanol-induced steatosis30. Given that extracellular adenosine uptake and conversion to AMP promotes AMPK phosphorylation7,31, we hypothesized that CD73 induction upon ethanol exposure is a compensatory mechanism to alleviate inhibition of AMPK activity. A caveat is that extracellular adenosine uptake is inhibited, particularly upon acute ethanol exposure22. Thus, temporal regulation of hepatocyte

CD73 enzymatic activity in response to acute or chronic ethanol needs further investigation.

CD73 as a Bioactive Lipid Scavenger Molecule

CD73 is well known for its enzymatic activity to generate the immunosuppressive adenosine molecule32,33. In response to injury, adenosine prevents excessive inflammation34,35 and promotes tissue repair and regeneration36,37. However, adenosine signaling is complex and tightly controlled, which might limit the protective effects of CD73-adenosine. In part, the complexity of adenosine can be attributed to the regulation of its receptors via internalization and desensitization38, as well as the contradicting effects on cyclic AMP production39 and downstream genetic alterations40. In light of this, we posit that CD73 induction after injury may have an additional non-redundant role in suppressing inflammatory responses to promote tissue protection and repair. In this study, we uncovered a novel non-enzymatic function of

CD73 as a binding protein for bioactive lipids, specifically pro-inflammatory molecules leukotriene B3 (LTB3) and 11-dehydro-2,3-dinor thromboxane B2 (TBX2). LTB3 has been previously shown to mediate inflammation by binding to receptors of leukotriene B4, an

18 equipotent analog of LTB3 that correlates with the severity of alcoholic liver disease , on

41 polymorphonuclear cells in humans and rats . This binding of LTB3 enhances complement receptors and lysozyme release, as well as chemokinesis in leukocytes16,42. Similarly, TBX2 has also been associated with alcoholic liver disease18. Pharmacological inhibition of TBX2 attenuated ethanol-mediated inflammation and necrosis43. Consistent with these previous studies, we observed attenuated inflammation and absence of necrosis in WT mice compared to CD73-LKO mice that were fed an ethanol-containing diet. Thus, our study unravels a potentially important non-enzymatic role of CD73 in alcoholic liver injury. Additional studies will be important in delineating the mechanism and identifying the biological relevance of this alternative CD73 function in liver homeostasis and liver diseases. Importantly, the targeting of adenosine-independent functions of CD73 may be a mechanism to overcome challenges associated with direct pharmacological manipulation of adenosine signaling44.

In conclusion, we have identified a crucial role of hepatocyte CD73 in the attenuation and potential protection against the damaging effects of alcohol consumption. It illuminated novel insights into hepatocyte resilience from alcohol via CD73 induction. Future mechanistic studies will promote better understanding of the temporal and spatial progression of alcoholic liver disease, and the identification of potential diagnostic or therapeutic targets.

REFERENCES

1 Global status report on alcohol and health 2018. (World Health Organization, 2018).

2 Seitz, H. K. et al. Alcoholic liver disease. Nat Rev Dis Primers 4, 16, doi:10.1038/s41572-018-0014-7 (2018).

3 Gao, B. & Bataller, R. Alcoholic liver disease: pathogenesis and new therapeutic targets. Gastroenterology 141, 1572-1585, doi:10.1053/j.gastro.2011.09.002 (2011).

4 Peng, Z. et al. Adenosine signaling contributes to ethanol-induced fatty liver in mice. J Clin Invest 119, 582-594, doi:10.1172/JCI37409 (2009).

5 Peng, Z. et al. Ecto-5'-nucleotidase (CD73) -mediated extracellular adenosine production plays a critical role in hepatic fibrosis. FASEB J 22, 2263-2272, doi:10.1096/fj.07-100685 (2008).

6 Hart, M. L. et al. Extracellular adenosine production by ecto-5'-nucleotidase protects during murine hepatic ischemic preconditioning. Gastroenterology 135, 1739- 1750.e1733, doi:10.1053/j.gastro.2008.07.064 (2008).

7 Alcedo, K. P. et al. CD73 Maintains Hepatocyte Metabolic Integrity and Mouse Liver Homeostasis in a Sex-Dependent Manner. Cell Mol Gastroenterol Hepatol, doi:10.1016/j.jcmgh.2021.01.016 (2021).

8 Bertola, A., Mathews, S., Ki, S. H., Wang, H. & Gao, B. Mouse model of chronic and binge ethanol feeding (the NIAAA model). Nat Protoc 8, 627-637, doi:10.1038/nprot.2013.032 (2013).

9 Fu, D. & Lippincott-Schwartz, J. Monitoring the Effects of Pharmacological Reagents on Mitochondrial Morphology. Curr Protoc Cell Biol 79, e45, doi:10.1002/cpcb.45 (2018).

10 Snider, N. T. et al. CD73 (ecto-5'-nucleotidase) hepatocyte levels differ across mouse strains and contribute to mallory-denk body formation. Hepatology 58, 1790-1800, doi:10.1002/hep.26525 (2013).

11 Hosseini, N., Shor, J. & Szabo, G. Alcoholic Hepatitis: A Review. Alcohol Alcohol 54, 408-416, doi:10.1093/alcalc/agz036 (2019).

12 Gurtovenko, A. A. & Anwar, J. Interaction of ethanol with biological membranes: the formation of non-bilayer structures within the membrane interior and their significance. The journal of physical chemistry B 113, 1983-1992 (2009).

13 Goldstein, D. & Chin, J. in Federation proceedings. 2073-2076.

14 Jeon, S. & Carr, R. Alcohol effects on hepatic lipid metabolism. Journal of lipid research 61, 470-479 (2020).

15 Clugston, R. D. et al. Altered hepatic lipid metabolism in C57BL/6 mice fed alcohol: a targeted lipidomic and gene expression study. Journal of lipid research 52, 2021- 2031 (2011).

16 Lee, T. H. et al. Characterization of leukotriene B3: comparison of its biological activities with leukotriene B4 and leukotriene B5 in complement receptor enhancement, lysozyme release and chemotaxis of human neutrophils. Clin Sci (Lond) 74, 467-475, doi:10.1042/cs0740467 (1988).

17 Li, P. et al. LTB4 promotes insulin resistance in obese mice by acting on macrophages, hepatocytes and myocytes. Nature medicine 21, 239-247 (2015).

18 Nanji, A. A., Khettry, U., Sadrzadeh, S. M. & Yamanaka, T. Severity of liver injury in experimental alcoholic liver disease. Correlation with plasma endotoxin, prostaglandin E2, leukotriene B4, and thromboxane B2. Am J Pathol 142, 367-373 (1993).

19 Jia, W. Q. et al. CD73 regulates hepatic stellate cells activation and proliferation through Wnt/beta-catenin signaling pathway. Eur J Pharmacol 890, 173667, doi:10.1016/j.ejphar.2020.173667 (2021).

20 Bowser, J. L. & Broaddus, R. R. CD73s protection of epithelial integrity: Thinking beyond the barrier. Tissue Barriers 4, e1224963, doi:10.1080/21688370.2016.1224963 (2016).

21 Thurman, R. G., Ji, S. & Lemasters, J. J. Alcohol-induced liver injury. The role of oxygen. Recent Dev Alcohol 2, 103-117 (1984).

22 Nagy, L. E., Diamond, I., Casso, D. J., Franklin, C. & Gordon, A. S. Ethanol increases extracellular adenosine by inhibiting adenosine uptake via the nucleoside transporter. J Biol Chem 265, 1946-1951 (1990).

100

23 Gillis, S. E. & Nagy, L. E. Deposition of cellular fibronectin increases before stellate cell activation in rat liver during ethanol feeding. Alcohol Clin Exp Res 21, 857-861 (1997).

24 Salminen, A., Hyttinen, J. M. & Kaarniranta, K. AMP-activated protein kinase inhibits NF-kappaB signaling and inflammation: impact on healthspan and lifespan. J Mol Med (Berl) 89, 667-676, doi:10.1007/s00109-011-0748-0 (2011).

25 O'Neill, L. A. & Hardie, D. G. Metabolism of inflammation limited by AMPK and pseudo-starvation. Nature 493, 346-355, doi:10.1038/nature11862 (2013).

26 Fullerton, M. D. et al. Single phosphorylation sites in Acc1 and Acc2 regulate lipid homeostasis and the insulin-sensitizing effects of metformin. Nature medicine 19, 1649-1654, doi:10.1038/nm.3372 (2013).

27 Davies, S. P., Helps, N. R., Cohen, P. T. & Hardie, D. G. 5'-AMP inhibits dephosphorylation, as well as promoting phosphorylation, of the AMP-activated protein kinase. Studies using bacterially expressed human protein phosphatase-2C alpha and native bovine protein phosphatase-2AC. FEBS Lett 377, 421-425, doi:10.1016/0014-5793(95)01368-7 (1995).

28 Wilson, D. F. & Matschinsky, F. M. Ethanol metabolism: The good, the bad, and the ugly. Med Hypotheses 140, 109638, doi:10.1016/j.mehy.2020.109638 (2020).

29 You, M., Matsumoto, M., Pacold, C. M., Cho, W. K. & Crabb, D. W. The role of AMP- activated protein kinase in the action of ethanol in the liver. Gastroenterology 127, 1798-1808, doi:10.1053/j.gastro.2004.09.049 (2004).

30 Tomita, K. et al. AICAR, an AMPK activator, has protective effects on alcohol-induced fatty liver in rats. Alcohol Clin Exp Res 29, 240S-245S, doi:10.1097/01.alc.0000191126.11479.69 (2005).

31 Aymerich, I., Foufelle, F., Ferré, P., Casado, F. J. & Pastor-Anglada, M. Extracellular adenosine activates AMP-dependent protein kinase (AMPK). J Cell Sci 119, 1612- 1621, doi:10.1242/jcs.02865 (2006).

32 Longhi, M. S., Feng, L. & Robson, S. C. Targeting ectonucleotidases to treat inflammation and halt cancer development in the gut. Biochem Pharmacol, 114417, doi:10.1016/j.bcp.2021.114417 (2021).

101

33 Wang, S. et al. The role of the CD39-CD73-adenosine pathway in liver disease. J Cell Physiol, doi:10.1002/jcp.29932 (2020).

34 Hasko, G. et al. Ecto-5'-nucleotidase (CD73) decreases mortality and organ injury in sepsis. J Immunol 187, 4256-4267, doi:10.4049/jimmunol.1003379 (2011).

35 Murphy, P. S. et al. CD73 regulates anti-inflammatory signaling between apoptotic cells and endotoxin-conditioned tissue macrophages. Cell Death Differ 24, 559-570, doi:10.1038/cdd.2016.159 (2017).

36 Minor, M., Alcedo, K. P., Battaglia, R. A. & Snider, N. T. Cell type- and tissue-specific functions of ecto-5'-nucleotidase (CD73). Am J Physiol Cell Physiol 317, C1079- C1092, doi:10.1152/ajpcell.00285.2019 (2019).

37 Borg, N. et al. CD73 on T Cells Orchestrates Cardiac Wound Healing After Myocardial Infarction by Purinergic Metabolic Reprogramming. Circulation 136, 297-313, doi:10.1161/CIRCULATIONAHA.116.023365 (2017).

38 Klaasse, E. C., Ijzerman, A. P., de Grip, W. J. & Beukers, M. W. Internalization and desensitization of adenosine receptors. Purinergic Signal 4, 21-37, doi:10.1007/s11302-007-9086-7 (2008).

39 Nagy, L. E. & DeSilva, S. E. Adenosine A1 receptors mediate chronic ethanol-induced increases in receptor-stimulated cyclic AMP in cultured hepatocytes. Biochem J 304 ( Pt 1), 205-210, doi:10.1042/bj3040205 (1994).

40 Gordon, A. S., Nagy, L., Mochly-Rosen, D. & Diamond, I. Chronic ethanol-induced heterologous desensitization is mediated by changes in adenosine transport. Biochem Soc Symp 56, 117-136 (1990).

41 Shimazaki, T., Kawajiri, K., Kobayashi, Y. & Sato, F. 12(R)-methyl-leukotriene B3: a stable leukotriene B analogue toward the reductase metabolism. Prostaglandins 45, 335-345, doi:10.1016/0090-6980(93)90111-j (1993).

42 Charleson, S. et al. Leukotriene B3, leukotriene B4 and leukotriene B5; binding to leukotriene B4 receptors on rat and human leukocyte membranes. Prostaglandins 32, 503-516, doi:10.1016/0090-6980(86)90033-x (1986).

102

43 Nanji, A. A. et al. Thromboxane inhibitors attenuate pathological changes in alcoholic liver disease in the rat. Gastroenterology 112, 200-207, doi:10.1016/s0016- 5085(97)70236-1 (1997).

44 Chen, J. F., Eltzschig, H. K. & Fredholm, B. B. Adenosine receptors as drug targets-- what are the challenges? Nat Rev Drug Discov 12, 265-286, doi:10.1038/nrd3955 (2013).

103

CHAPTER 5: TUMOR‐SELECTIVE ALTERED GLYCOSYLATION AND FUNCTIONAL ATTENUATION OF CD73 IN HUMAN HEPATOCELLULAR CARCINOMA1

Introduction

Ecto‐5′‐nucleotidase (CD73) is the major enzyme that dephosphorylates extracellular adenosine 5′‐monophosphate (AMP) to produce adenosine. CD73 activity is ubiquitous in mammalian systems and regulates purine salvage and purinergic signaling in tissue homeostasis, inflammation, fibrosis, and cancer1,2. CD73‐generated adenosine can suppress antitumor T‐cell responses, thereby promoting the progression of breast, skin, ovarian, and prostate cancer in animal models3. Several anti‐CD73 inhibitory antibodies (MEDI9447,

CPI‐006, TJ004309, NZV930) are currently undergoing clinical testing for advanced solid tumors4,5. However, the role of CD73 in cancer is complex because CD73 activity is crucial for protecting endothelial and epithelial barrier functions6, particularly during hypoxic conditions7,8, and CD73 protects the epithelial integrity in well‐differentiated early stage endometrial carcinoma, which is associated with better overall patient survival9. This clearly demonstrates that the role of CD73 in cancer is not uniform and warrants a critical mechanistic evaluation of CD73 regulation and function at multiple levels and in different cancer types6.

1 This chapter contains published material authored by: Alcedo KP, Guerrero A, Basrur V, Fu D, Richardson ML, McLane JS, Tsou CC, Nesvizhskii AI, Welling TH, Lebrilla CB, Otey CA, Kim HJ, Omary MB, Snider NT. Tumor-Selective Altered Glycosylation and Functional Attenuation of CD73 in Human Hepatocellular Carcinoma. Hepatol Commun. 2019 Aug 9;3(10):1400-1414.

104 CD73 is a known regulator of hepatocyte injury10,11 and fibrogenic responses in the liver12,13 but its functional regulation in liver cancer has not been investigated to date. Given the importance of CD73 as a novel target for cancer therapy and the significant disease burden of liver cancer14, the aim of the present study was to investigate the regulation and activity of CD73 protein in human hepatocellular carcinoma (HCC). CD73 is widely expressed in hepatobiliary malignancies, and aberrant intense cytoplasmic CD73 staining is a marker of invasive lesions in HCC15. The mechanisms behind the aberrant CD73 localization and whether it is enzymatically active are not known. Novel interventions for HCC are critically needed, and modulation of adenosine signaling represents one potential strategy.

Specifically, the adenosine A3 receptor (A3AR) is highly expressed in HCC, and its activation by a selective agonist (2‐chloro‐N(6)‐(3‐iodobenzyl)adenosine‐5′‐N‐ methyluronamide [CF102 or Namodenoson]) has antitumor effects in a rat model of

HCC16. CF102 recently completed phase II clinical testing and showed a favorable clinical safety profile and a positive signal of efficacy in patients with advanced HCC and severe liver dysfunction, justifying further testing in phase III trials17,18. In light of the important role of adenosine signaling as a clinical target in HCC, it is critical to understand how the activity of the major extracellular AMPase CD73 is regulated in HCC tumors.

As a glycosylphosphatidylinositol‐anchored protein (GPI‐AP), CD73 undergoes complex processing by the secretory pathway19. Proteins destined for this pathway undergo initial maturation in the endoplasmic reticulum (ER) followed by vesicular transport through the Golgi apparatus before being targeted to their ultimate destinations through the trans‐

Golgi network. A key regulatory step in the proper execution of this process is the sequential covalent modification of proteins with oligosaccharides linked by asparagine residues,

105 termed N‐linked glycosylation20. Alterations in the N‐linked glycoproteome are hallmarks of many cancers, including HCC21. In this study, we reveal a novel glycosylation mechanism leading to the mis-localization and functional suppression of CD73 in HCC tumors. Our results illuminate specific regulatory mechanisms that may be exploited for targeted treatment to improve outcomes in patients with HCC.

Materials and Methods

Antibodies and Reagents

Mouse anti‐Flag M2 clone (Sigma‐Aldrich) and rabbit anti‐CD73 clone HPA017357

(Atlas Antibodies) were used to detect tagged and untagged (endogenous) CD73, respectively. Mouse anti‐CD73 clone AD2 (BD Biosciences) was used for immunoprecipitation of CD73. Mouse anti‐CD73 clone IE9 (Santa Cruz Biotechnology) was used to co-stain with tight junction markers ZO1 (rabbit; Cell Signaling) and claudin‐1

(rabbit; Thermo Fisher Scientific). Other antibodies used were rat anti‐keratin (K)19 (Troma‐

III; Developmental Studies Hybridoma Bank); rabbit anti‐tissue nonspecific alkaline phosphatase (TNAP; Abcam); and mouse monoclonal antibodies for Golgi marker proteins

GM130, Vti1, STx6, and GS27 (BD Biosciences). Complementary DNA encoding human ecto‐5′‐nucleotidase (NT5E)‐1 and NT5E‐2 in pCMV6‐Entry and control empty vector were purchased from Origene. Endoglycosidase H (EndoH) and peptide:N‐glycosidase F (PNGase

F) glycosidases were used with liver lysates as recommended by the manufacturer (New

England Biolabs).

Human Specimens

Surgical specimens were collected under approved human subject protocols at the

University of Michigan (UM) and the University of North Carolina at Chapel Hill (UNC).

106 HCC surgical specimens that were collected at UM have been described22. Normal human liver specimens were from surgical resections of unaffected liver tissue collected during removal of colorectal cancer metastasis to the liver. An additional 27 liver–tumor pairs of

HCC surgical specimens (23 of which were CD73 positive) were collected at UNC under an approved human subject protocol.

Cell Culture, Transfections, Imaging, Immunoblotting, and Quantitative Polymerase Chain Reaction

Huh7 cells were obtained from the Japanese Collection of Research Bioresources and cultured in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum and 100 U/mL penicillin/streptomycin. PLC/PRF5 cells were from the American Type

Culture Collection (ATCC; Manassas, VA) and cultured according to ATCC recommendations. Site‐directed mutagenesis was performed using the QuikChange kit

(Agilent Technologies). For immunofluorescence analysis, human tissues or cells were fixed in methanol at −20°C for 10 minutes, washed 3 times in phosphate‐buffered saline (PBS) and incubated in blocking solution (2.5% bovine serum albumin, 2% normal goat serum in PBS) for 1 hour at room temperature. Primary antibodies were diluted in blocking buffer and incubated overnight at 4°C. Following three PBS washes, the cells/tissues were incubated with Alexa Fluor‐conjugated secondary antibodies diluted in blocking solution for 1 hour at room temperature followed by 4′,6‐diamidino‐2‐phenylindole (DAPI) incubation for

5 minutes and mounted in Fluoromount‐G (SouthernBiotech, Birmingham, AL) overnight.

Secondary antibodies alone served as negative controls. A Zeiss 880 confocal laser scanning microscope using a 63× (1.4 numerical aperture) oil immersion objective (Zeiss, Jena,

Germany) was used for imaging.

107 Biochemical Assay of CD73 Expression and Activity

CD73 was extracted from cells or liver tissue in 50 mM n‐octylglucoside (Sigma) in

PBS (OG lysis buffer) with freshly added complete protease inhibitor cocktail (Roche) and shaking for 2 hours at 4°C, followed by centrifugation at 20,000g for 20 minutes.

Immunoprecipitation of CD73 from OG lysates was performed using Dynabeads protein G

(Thermo Fisher Scientific) following the manufacturer’s instructions. Measurement of 5′‐ nucleotidase activity was performed using a commercial kit (Diazyme) with OG liver lysates that were first normalized to 1 mg/mL total protein concentration. This assay is based on a four‐reaction sequence beginning with the enzymatic hydrolysis of 5′‐inosine monophosphate (5′‐IMP) to form inosine, which is subsequently converted to hypoxanthine by purine nucleoside phosphorylase. Xanthine oxidase converts hypoxanthine to uric acid and hydrogen peroxide (H2O2). H2O2 is then reacted with N‐ethyl‐N‐(2‐hydroxy‐3‐ sulfopropyl)‐3‐methylaniline and 4‐ aminoantipyrine in the presence of peroxidase to generate a quinone dye, which is monitored in a kinetic manner. The specificity of the 5′‐

IMP‐based assay for CD73 activity was originally described in multiple tissues8 and specifically in the liver, using CD73−/− liver lysates11.

Mass Spectrometry Analysis of Site‐Specific CD73 Glycosylation and Determination of Glycan Structures

CD73 was immunodepleted from liver and tumor OG lysates and subjected to mass spectrometry (MS) analysis to determine site‐specific glycosylation and glycan structures.

The band corresponding to CD73 protein was excised and de-stained with 30% methanol for

4 hours. Following reduction (10 mM dithiothreitol) and alklylation (65 mM 2‐ chloroacetamide) of the cysteines, proteins were digested overnight with sequencing‐grade modified trypsin (Promega). Resulting peptides were resolved on a nanocapillary reverse

108 phase column (Acclaim PepMap C18, 2 μm, 15 cm; Thermo Scientific, San Jose CA) using a

1% acetic acid/acetonitrile gradient at 300 nL/minute and were directly introduced into an

Orbitrap Fusion tribrid MS (Thermo Scientific). MS1 scans were acquired at 60K resolution.

Data‐dependent high‐energy C‐trap dissociation MS/MS spectra were acquired with top‐ speed option (3 seconds) following each MS1 scan (relative capillary electrophoresis ~35%).

Fragment (daughter) ion masses were measured in orbitrap (resolution of 15K). XX peptide identification and site‐specific glycan structures were determined using the program GP

Finder, as described23. To determine glycopeptide abundance, we used the summation of elution apex intensities of all MS1 isotope peaks. MS1 precursor features of glycopeptides were extracted by the feature detection algorithm described in DIA‐Umpire24. Feature detection was restricted to +3, +4, and +5 charge states and 3‐5 isotope peaks. For each liquid chromatography (LC)/MS run, the detected features with close precursor mass‐to‐charge ratio (±20 ppm) and charge state identical to the identified glycopeptides were considered as the candidate features for quantification. For the identified glycopeptides, the feature closest to the identified retention time was extracted. If a glycopeptide was only identified in other

LC/MS runs, the most intense candidate feature within a 2‐minute retention time range of the identified retention times from other LC/MS runs was extracted.

RNA Sequencing Analysis of Differentially Expressed Genes in Adjacent Nontumor Liver Tissue and HCC Tumor Tissue Surgical tissues from two adjacent liver–tumor pairs were preserved in RNAlater.

Tumor CD73 displayed shift in migration on sodium dodecyl sulfate‐polyacrylamide gel electrophoresis (SDS‐PAGE) in both specimens. RNA was extracted using the RNeasy kit

(Qiagen) and used for sequencing analysis (all RNA integrity number values were >9). For the published dataset (GSE 33294), sequence read archive data files were obtained from the

109 National Center for Biotechnology Information (NCBI) Gene Expression Omnibus repository and converted into fastq files. The quality of the raw reads data was determined using FastQC. The software package Tuxedo Suite was used for alignment, differential expression analysis, and post-analysis diagnostics. FastQC was used for a second round of quality control (post-alignment) to ensure that only high-quality data would be input to expression quantitation and differential expression analysis. We used Cufflinks/CuffDiff

(version 2.1.1) for expression quantitation and differential expression analysis, using

University of California Santa Cruz (UCSC) hg19.fa as the reference genome sequence and

UCSC hg19.gtf as the reference transcriptome annotation. We identified genes and transcripts as being differentially expressed based on three criteria: test status, “OK”; false discovery rate, <0.05; and fold change, ≥1.5. We annotated genes and isoforms with NCBI

Entrez GeneIDs and text descriptions. We further annotated differentially expressed genes with gene ontology terms using NCBI annotation. We used DAVID (version 6.7) for enrichment analysis of the set of differentially expressed genes to identify significantly enriched functional categories.

Results

CD73 is Expressed in Malignant Hepatocytes and Exhibits Cytoplasmic Distribution in HCC Tumors

Using data from the PanCancer Atlas Consortium25, we determined that the CD73‐ encoding gene (NT5E) did not correlate with a specific tumor immune subtype in HCC

(Figure 5.1A). However, aside from its functions in the immune system, CD73 is also a well‐ known regulator of epithelial cells6, including hepatocytes11. Therefore, we investigated

CD73 protein expression and localization in non-diseased (normal) liver and HCC tumor and adjacent nontumor tissues. Immunofluorescence imaging revealed abundant CD73

110

Figure 5.1. CD73 is Highly Expressed in Malignant Hepatocytes in Human HCC. (A) NT5E gene expression across tumors classified into the four major HCC immune subtypes: wound healing (C1), IFNγ‐dominant (C2), inflammatory (C3), and lymphocyte depleted (C4). Data were obtained from the PanCancer Atlas (one‐way ANOVA; Tukey’s multiple comparisons test). (B) Immunofluorescence analysis of CD73 (green) and DAPI‐ stained DNA (blue) in normal human liver tissue (left), HCC adjacent liver tissue (middle), and tumor tissue (right). Scale bars, 50 μm. (C) Immunofluorescence analysis of CD73 (magenta), ZO1 (green), and DAPI‐stained DNA (blue). Bottom panels represent boxed areas of the merged images, revealing cytoplasmic (asterisk) and punctate perinuclear (arrowhead) clustering of CD73 in HCC tumor and adjacent tissue. In adjacent liver tissue, CD73 was also localized in the lumen of the bile canaliculus (arrows). Scale bars, 20 μm. (D) Immunofluorescence analysis of DAPI‐stained DNA (blue), CD73 (green), and K8 and K19 (red), which mark hepatocytes and cholangiocytes, respectively. Scale bars, 50 μm. Abbreviations: FPKM, fragments per kilobase of exon model per million reads mapped; IFN, interferon; ns, no statistical significance in expression between groups.

111 expression in normal liver and in HCC (Figure 5.1B). CD73 in HCC adjacent liver tissue and tumor tissue appeared largely intracellular (Figure 5.1B). Co-staining with the tight junction marker ZO1 revealed CD73 presence in the cytoplasm as well as the lumen of bile canaliculi in adjacent liver tissue and primarily cytoplasmic and perinuclear distribution in the tumor tissue (Figure 5.1C). To determine which epithelial cell types express CD73 in HCC tumors, we co-stained for the epithelial markers K8 and K19. CD73 is abundant in K8‐positive but not K19‐positive cells (Figure 5.1D), suggesting that it is expressed primarily on malignant hepatocytes and absent from tumor cholangiocytes. By immunoblot analysis, we detected

CD73 protein in all HCC cell lines we tested (Hep3B, Huh7, MHCC97, SNU‐423, and SNU‐

449), while PLC/PRF/5 hepatoma cells were CD73 negative (Figure 5.2A).

Immunofluorescence analysis confirmed the lack of CD73 in the PLC/PRF5 cells (Figure

5.2B) and revealed cytoplasmic and membranous distribution of CD73 in the Huh7 cells

(Figure 5.2B-C). Specifically, co-staining with the tight junction markers ZO1 and claudin‐1 showed CD73 localization within the lumen of small bile canaliculi‐like structures (Figure

5.2C, arrows) that Huh7 cells are known to form in culture26 as well as the presence of CD73 in perinuclear puncta (Figure 5.2C, arrowheads), similar to its distribution in the primary

HCC tissues.

Tumor‐Specific Biochemical Changes on CD73 Correlate with Decreased 5′‐Nucleotidase Activity

HCC typically develops in the context of cirrhosis, so we asked whether CD73 protein expression is different in the tumor versus the adjacent nontumor tissue. Immunoblot analysis (Figure 5.3A) and quantification of band intensities from 23 CD73‐positive HCC liver–tumor pairs (Figure 5.3B) revealed heterogeneous expression of CD73. Of the 23 tumors, CD73 was increased in 11, unchanged in six, and decreased in six tumors, relative to

112

Figure 5.2. CD73 Is Endogenously Expressed in Human HCC Cell Lines and Exhibits Membrane and Cytoplasmic Expression. (A) CD73 immunoblot and Coomassie stain (loading control) in HCC cell lines. (B) Immunofluorescence staining of CD73 (green) and DNA (blue) in Huh7 (CD73‐positive) and PLC/PRF5 (CD73‐negative) cell lines. Scale bars, 20 μm. (C) Immunofluorescence analysis of CD73 (magenta), ZO1 or claudin‐1 (green; as labeled in panels), and DAPI‐stained DNA (blue) in Huh7 cells. Bottom panels represent boxed areas of the merged images, revealing membrane (arrows) and punctate cytoplasmic (arrowheads) localization. Scale bars, 40 μm.

113 adjacent liver. However, we also noted that in 13/23 (57%) of the CD73‐positive liver–tumor pairs, CD73 from the tumor tissue migrated faster on SDS‐PAGE gels compared to CD73 from adjacent nontumor liver, as shown by the representative immunoblot in Figure 5.3C.

Tumor‐associated biochemical changes in CD73 were independent of HCC etiology, tumor stage, and presence of fibrosis (Figure 5.3D‐F). However, altered biochemical processing of

CD73 in the HCC tumors was associated with significantly decreased enzymatic activity

(Figure 5.3G). Although there was a negative correlation trend between CD73 shift with disease‐free status (P = 0.20) and patient survival (P = 0.28), it was not statistically significant (Figure 4A‐C). Similarly, total tumor CD73 expression did not correlate with clinical outcomes based on the samples tested here (Figure 5.4D‐F).

CD73 Undergoes Differential Glycosylation in HCC Tumors Relative to Adjacent Nontumor Tissue

CD73 has four consensus N‐glycosylation motifs: 53NAS, 311NSS, 333NYS, and 403NGT (Figure 5.5A). Changes in glycosylation at one or more of these sites may alter

CD73 activity because three (N311/N333/N403) are located in the C‐terminal catalytic domain of the molecule19. Therefore, we tested the hypothesis that tumor CD73 undergoes altered glycosylation. To that end, we de-glycosylated CD73 in vitro using EndoH (typically removes immature high mannose glycans introduced in the ER) and PNGase F (removes more mature complex glycans introduced post‐ER exit). The differential migration on the gel was not present after PNGase F treatment but was still present in the EndoH‐resistant fraction

(Figure 5.5B). This suggested that glycosylation differences on tumor CD73 are introduced after exit from the ER. MS glycomics analysis revealed that the majority of CD73 glycans are conjugated to N311 and N333, followed by N403 and N53 (Figure 5.5C). While N333 was conjugated primarily to complex glycans, N311 displayed a mix of high mannose,

114

Figure 5.3. HCC Tumor‐Specific CD73 Biochemical Alterations Correlate with Decreased 5′‐Nucleotidase Activity. (A) Representative WB (top) of CD73 in adjacent liver (L) and tumor (T) OG lysates from surgical HCC specimens collected at UNC. Coomassie‐ stained gel as a loading control. The numbers represent individual patients. (B) Densitometric quantification of CD73 WB of 23 paired HCC samples. (C) Representative CD73 WB of paired L-T HCC tissue showing tumor CD73 migration shift. (D‐F) Distribution of (D) HCC etiology, (E) tumor stage, and (F) fibrosis status across tumor samples without CD73 shift (n = 10) and with CD73 shift (n = 12‐13). (G) Measurement of 5′‐nucleotidase activity in paired HCC tissues in which tumor CD73 did not exhibit a shift in migration and in HCC cases where there was a significant shift. ****P < 0.0001; paired t test. Abbreviations: NAFLD, nonalcoholic fatty liver disease; NASH, nonalcoholic steatohepatitis; WB, western blot.

115

Figure 5.4. Correlation Analysis Between Biochemical Changes of Tumor-Associated CD73 with Disease Presence/Recurrence and Patient Survival. (A-C) Correlation between CD73 tumor shift and patients’ disease/vital status. Left bars; no shift in tumor CD73 (N=10). Right bars; shift in CD73 (N=13). (D-F) Correlation between CD73 expression level and patients’ disease/vital status. Left bars; tumor CD73 decreased (low) relative to adjacent liver (N=13). Right bars; tumor CD73 increased (high) relative to adjacent liver (N=6). Panels A and D represent distribution of patients who were never disease-free (black), patients who had successful tumor removal, but had disease recurrence (red), and patients who had successful tumor removal and did not have recurrence (blue). Panels B and E represent distribution of patients presenting with disease (red) or patients who had no evidence of disease (blue) at date of last contact. Panels C and F represent distribution of patients’ vital status at date of last contact: deceased (dark blue); alive (light blue). P- values are noted below each comparison; Chi-square (panels A,D) and Fisher’s exact test (panels B,C,D,E).

116

Figure 5.5. Site‐Specific Glycan Distribution on CD73 in Normal Human Liver. (A) Model of CD73 dimer structure (magenta) showing the four asparagine residues (yellow) that are targets of glycosylation. Structure of CD73 dimer was generated using Pymol (PDB: 4H1S). (B) Effect of in vitro CD73 deglycosylation using PNGase F or EndoH. (C) Relative abundance of glycans across the four CD73 N‐linked glycosylation sites, demonstrating that N311 and N333 account for >70% of all glycans. Bars represent mean ± SD. *P < 0.05; **P < 0.01; ***P < 0.001; one‐way ANOVA Tukey’s multiple comparisons test. (D) Types of glycans present on the four CD73 glycosylation sites. GlcNAc ( ), mannose ( ), fucose ( ), galactose ( ), Neu5Ac ( ).

117 hybrid, and complex glycans (Figure 5.5D). Globally, the major glycosylation differences on

CD73 from HCC tumors were in specific glycan structures, with a significant increase in high mannose glycans and a decrease in hybrid glycans (Figure 5.6A). The greatest glycosylation changes were observed at site N311 (Figure 5.6B), where under normal conditions high mannose glycans accounted for <20% of all glycans; in tumor CD73, this residue was highly mannosylated (>60% of total glycans). In addition, incorporation of complex glycans was significantly reduced at both the N311 and N333 sites (Figure 5.6B-C).

Site‐Specific Glycosylation Regulates CD73 Enzymatic Activity and Subcellular Distribution To assess the functional significance of site‐specific CD73 N‐glycosylation, we generated non-glycosylatable mutants (N311Q and N333Q) and compared their enzymatic activity to wild‐type (WT) CD73 (Figure 5.6D). The glycosylation‐deficient N311Q and

N333Q mutants had 30% and 50% lower enzyme activity, respectively, compared to WT

CD73. Furthermore, the subcellular distribution of both mutants appeared predominantly perinuclear compared to WT CD73 (Figure 5.6E). To assess whether the intracellular CD73 puncta colocalize with the Golgi organelle, where most of the hybrid and complex glycans are conjugated to proteins, we co-stained with the Golgi marker GM130. The glycosylation‐ deficient and catalytically‐impaired N333Q mutant partially colocalized with GM130 (Figure

5.6F), suggesting that it is partly retained in the Golgi compartment. Combined, these data demonstrate that N‐glycosylation of CD73 at N311 and N333, the two sites that are aberrantly glycosylated on CD73 in primary HCC tumors, is important for CD73 function.

118

Figure 5.6. Site‐Specific Increase in High Mannose Glycans Promotes CD73 Intracellular Retention and Decreased Enzymatic Activity. (A) Percent of high mannose (top), hybrid (middle), and complex (bottom) glycans on CD73 extracted from non-HCC liver tissue (n = 4), HCC adjacent liver tissue (n = 5), and HCC tumor tissue (n = 5). (B-C) Changes in glycan composition on the two major CD73 glycosylation sites, N311 and N333. **P < 0.01; ***P < 0.001; ****P < 0.0001. Bars represent mean ± SD. (D) Representative CD73 immunoblot (top) of PLC/PRF/5 cells transfected with empty vector, WT CD73, and glycosylation mutants N311Q and N333Q. Measurement of 5′‐nucleotidase activity (bottom) in lysates of control vector‐transfected (−) or CD73‐transfected PLC/PRF/5 cells (n = 3). (E) Subcellular distribution of WT and glycosylation point mutant CD73 transfected in PLC/PRF/5 cells. Green, CD73; blue, DNA. Scale bars, 10 μm. (F) Colocalization between CD73‐N333Q (green) and the Golgi marker protein GM130 (red). Scale bar, 20 μm. Abbreviation: HM, high mannose. All data are representative of at least n=3. Bars represent mean ± SD. *P < 0.05; **P < 0.01; ***P < 0.001; one‐way ANOVA.

119 Up‐Regulation of Golgi Protein GM130 and Global Differences in the Expression of Genes Encoding N‐Linked Glycoproteins in HCC Tumors We analyzed major proteins that regulate the transit of GPI‐APs through the Golgi organelle, including GM130, which is important for glycosylation and maintenance of Golgi structure; the v‐SNARE (Vti1) and t‐SNARE (syntaxin‐6) proteins involved in vesicle transport through the Golgi, and a SNAP receptor that regulates protein transport in the Golgi

(GS27). GM130 exhibited the most profound differences between tumor and adjacent nontumor tissue and was up‐regulated more than 8‐fold in HCC tumors (Figure 5.7A-B).

While in adjacent nontumor human liver tissue, GM130 staining appeared as perinuclear puncta; in HCC tumors, the puncta appeared enlarged and merged, forming larger structures

(Figure 5.7C). RNA sequencing (RNAseq) analysis was performed on two pairs of HCC specimens (adjacent tissue and tumor tissue) that displayed differences in CD73 migration on gel, as shown in insets to Figure 5.7E. We additionally analyzed gene expression data on two

HCC liver–tumor pairs from a published RNAseq data set (GSE 33294). These results revealed that N‐linked glycoprotein‐encoding genes were among the most represented category of differentially expressed genes (Figure 5.7D). Because ecto‐nucleotidases that act upstream of CD73 in the liver (e.g., ectonucleotide pyrophosphatase/phosphodiesterase 2

[eNPP2] and ectonucleoside triphosphate diphosphohydrolase 8 [eNTPD8])27, as well as the

A3AR are also N‐glycosylated, we compared their gene expression levels in nontumor versus tumor tissue from the RNAseq sets. This comparison revealed a general decrease in expression (11%‐95%) in the tumors compared to adjacent liver tissue (Figure 5.7E). Taking into account the RNAseq results and the molecular and biochemical studies, we propose a model for a tumor‐selective mechanism to limit extracellular adenosine signaling in HCC tumors by (i) disruption of CD73 glycosylation leading to decreased activity and (ii)

120

Figure 5.7. Golgi Protein GM130 Induction in HCC Tumors Correlates with Global Expression Changes in N‐Linked Glycoprotein‐Encoding Genes. (A) Immunoblot of Golgi‐resident proteins GM130, Vti1, syntaxin 6, and GS27 in HCC adjacent liver and tumor lysates. (B) Quantification of the immunoblots in panel A. Bars represent mean ± SD. *P < 0.05 compared to GS27; one‐way ANOVA; Tukey’s multiple comparisons test. (C) Double immunofluorescence staining of GM130 (green) and DNA (blue) in adjacent liver and tumor tissue (representative images are from HCC case #752). Scale bars, 50 μm. Right panels show the respective magnified areas (represented by the yellow boxes). (D) RNAseq analysis on four pairs of HCC adjacent liver–tumor pairs revealing the percentage (36%‐

121 48%) of significantly differentially expressed genes that encode N‐linked glycoproteins. (E) RNA expression levels of select N‐linked glycoprotein genes (eNPP2, eNTPD8, and ADORA3) in paired HCC adjacent liver (black bars) and tumor tissues (gray bars). Each bar represents a single readout from the RNAseq data set. (F) Summary of findings and working hypothesis model of HCC tumor‐specific changes in N‐glycosylation. HCC tumors exhibit altered Golgi structure, as exemplified by significant overexpression of the structural protein GM130. Changes in Golgi structure lead to altered localization and decreased function of N‐linked glycoproteins, including ecto‐nucleotidase CD73, and are associated with decreased expression of eNPP2 and eNTPD8, leading to overall decreased levels in the production of extracellular adenosine. Decreased adenosine production by the highly mannosylated tumor CD73 blunts adenosine‐dependent HCC cell death by the A3 adenosine receptor, promoting HCC progression. Abbreviations: A3AR, A3 adenosine receptor; ADO, adenosine; ADORA3, adenosine A3 receptor gene; ADP, adenosine diphosphate; ATP, adenosine triphosphate; eNPP2, ectonucleotide pyrophosphatase/phosphodiesterase 2 gene; FPKM, fragments per kilobase of exon model per million reads mapped; L, adjacent liver tissue; T, tumor tissue.

122 transcriptional down‐regulation of ecto‐nucleotidases supplying the AMP substrate of CD73, such as eNTPD8 (Figure 5.7F).

Discussion

CD73 as a Potential Target in HCC

HCC accounts for the vast majority of primary liver cancer cases, and there are

~850,000 new cases diagnosed worldwide each year28. While death rates continue to decline for most cancer types, recent trends in the United States reveal that liver cancer mortality has continued to increase at a rate of 2.5%‐3% per year and 5‐year survival remains below

20%29. At the onset of symptoms, HCC is typically advanced and not amenable to current treatment approaches, which are very limited. Direct modulation of adenosine receptor activity represents a promising therapeutic strategy for patients with HCC17. In addition to direct‐acting agonists, such as the clinical candidate A3AR agonist CF102, an alternative approach is to augment the generation of the endogenous ligand adenosine. Here, we demonstrate that the adenosine‐generating function of CD73 is compromised in human HCC tumors due to aberrant N‐linked glycosylation. Aside from revealing a novel mechanism in

HCC tumor biology, our results may potentially help to identify patients who are more likely to benefit from A3AR agonists based on their tumor CD73 glycosylation status, localization, and activity. While our primary focus here was on tumor hepatocytes and HCC cells, the regulation and function of CD73 on other cell types, such as endothelial cells and lymphocytes, will need to be considered in future studies to determine if CD73 augmentation or blockade could be of potential benefit to patients with HCC.

123 Differences in CD73 Regulation and Function Across Cancer Types

Tumor‐selective transcriptional up‐regulation of NT5E can be pro-tumorigenic as high expression of epithelial CD73 is associated with low levels of tumor‐infiltrating leukocytes and reduced disease‐free and overall survival in triple‐negative breast cancer30. However, in contrast to breast cancer, CD73 is significantly down‐regulated in advanced endometrial tumors compared to normal endometrium and less aggressive tumors6,9, similar to invasive bladder cancer31,32; in both cases high expression predicts more favorable patient outcome. In the case of endometrial cancer, down‐regulation of CD73 is detrimental as it leads to compromised integrity of the epithelial barrier. Specifically, CD73‐ generated adenosine is necessary for A1AR receptor‐dependent cortical actin polymerization and cell–cell adhesion9. Our results herein reveal that posttranslational modulation of the

CD73 nucleotidase function by N‐linked glycosylation is yet another important but underappreciated mechanism for modulating CD73 function. Given our findings, assessment of CD73 expression by tissue staining alone does not necessarily reflect presence of the active enzyme as more detailed biochemical studies are needed to probe that function.

Resolving which mode of CD73 regulation is most relevant for the specific tumor type will aid in understanding which patients are likely to benefit from CD73 blocking antibodies.

The Need for Robust Preclinical in Vivo Studies on the Role of CD73 in HCC

Studies examining how CD73 loss impacts HCC development in rodent models have not been performed, with the exception of a limited analysis reporting that subcutaneous inoculation of MHCC97‐derived tumors showed decreased growth in CD73−/− compared to

WT mice33. Use of global and tissue‐specific CD73 knockout models in combination with standard HCC induction models, such as chemical carcinogenesis, fatty liver disease, and

124 alcohol‐induced liver disease34, will help address this question in a rigorous manner in future studies. One major caveat is that CD73 regulation in humans is different from rodents, as we have shown to be the case with the posttranscriptional processing of the NT5E gene, which is uniquely spliced in humans compared to all other species22. Therefore, the use of humanized mice and patient‐derived xenograft mouse models will likely be warranted.

Posttranscriptional and Posttranslational Regulation Mechanisms Alter CD73 Functions

Our prior and current results demonstrate that the major mechanism of CD73 regulation in HCC is not transcriptional but posttranscriptional22 and posttranslational

(current study). Previously, we demonstrated that alternative splicing generates a novel human‐specific CD73 isoform in cirrhosis and HCC (CD73S) that is present in both adjacent nontumor tissue and tumor tissue and acts in a dominant‐negative fashion22. Our current results provide additional evidence that the activity of the major canonical CD73 protein is selectively altered by N‐linked glycosylation to produce a highly mannosylated and enzymatically impaired glycoform in HCC tumors. Understanding the pathways that lead to these changes may reveal additional molecular targets to elevate CD73 activity selectively in

HCC tumors. For example, restoration of Golgi morphology and glycosylation has been shown to enhance the susceptibility of prostate cancer cells to apoptosis35, and similar approaches may be explored in HCC. Our results may also help explain several previously reported functions of CD73 in multiple cell types that are independent of its activity as an

AMPase, such as T‐cell activation by protein–protein interactions to deliver a costimulatory signal36, promoting adhesion of lymphocytes to the endothelium37, conferring resistance to apoptosis of leukemia cells38, and inducing phosphorylation of intracellular proteins in response to antibody ligation39,40. Therefore, it is plausible that N‐linked glycosylation is a

125 mechanism to tune adenosine‐independent CD73 functions in different cell types under physiological and disease states.

CD73 as a Marker of Golgi Organelle Dysfunction in HCC Tumors

The significant and selective up‐regulation of GM130 in HCC tumors implicates the

Golgi organelle in HCC tumor biology. The Golgi apparatus is the central compartment of the secretory pathway where proteins and lipids are extensively modified as they traverse the organelle en route to their intended destination to cellular membranes or to being secreted outside the cell. Proper architecture of the Golgi, which is composed of stacks of cisternae, ensures that the various enzymes involved in the modification of proteins and lipids are localized to their proper compartment. The Golgi structural protein GM130 is critical for the lateral linking of Golgi elements, which in turn ensures the proper localization of glycosylation enzymes41. It was shown that down‐regulation of GM130 had antitumor effects in a mouse model of lung cancer42. Presently, it is not clear what causes the Golgi alterations in cancer, but it is known that many genes, in particular kinases, exert control of this important organelle43. Therefore, the mechanism behind up‐regulated GM130 expression in

HCC tumors remains to be investigated and may involve kinome‐level changes.

N‐Linked Glycosylation as a Mechanism for HCC Progression

Previous studies aimed at identifying serum biomarkers reported major HCC‐ associated alterations in the types and abundance of glycans on specific serum proteins, such as α‐fetoprotein and Golgi protein 7344-47. Aside from being a biomarker of HCC, altered N‐ glycosylation can also serve a functional role to promote HCC tumor metastasis. For example, altered N‐glycan branching of CD147 enhances its binding to β1‐integrin to promote HCC tumor metastasis48. While the functional significance of elevated high‐

126 mannose glycans that we identified on HCC tumor CD73 is not clear, global high mannose glycosylation negatively affects multiple essential functions of the intestinal epithelium, such as permeability, host–microbe interactions, and the activities of membrane‐associated proteins49. Therefore, it is plausible that the highly mannosylated CD73 tumor glycoform blocks the tissue barrier function of CD736. This will be a key question for future studies.

127 REFERENCES

1 Zimmermann, H., Zebisch, M. & Strater, N. Cellular function and molecular structure of ecto-nucleotidases. Purinergic Signal 8, 437-502, doi:10.1007/s11302-012-9309-4 (2012).

2 Ipata, P. L. & Balestri, F. The functional logic of cytosolic 5'-nucleotidases. Curr Med Chem 20, 4205-4216, doi:10.2174/0929867311320340002 (2013).

3 Antonioli, L., Yegutkin, G. G., Pacher, P., Blandizzi, C. & Haskó, G. Anti-CD73 in cancer immunotherapy: awakening new opportunities. Trends Cancer 2, 95-109, doi:10.1016/j.trecan.2016.01.003 (2016).

4 Hay, C. M. et al. Targeting CD73 in the tumor microenvironment with MEDI9447. Oncoimmunology 5, e1208875, doi:10.1080/2162402X.2016.1208875 (2016).

5 Perrot, I. et al. Blocking Antibodies Targeting the CD39/CD73 Immunosuppressive Pathway Unleash Immune Responses in Combination Cancer Therapies. Cell Rep 27, 2411-2425.e2419, doi:10.1016/j.celrep.2019.04.091 (2019).

6 Bowser, J. L. & Broaddus, R. R. CD73s protection of epithelial integrity: Thinking beyond the barrier. Tissue Barriers 4, e1224963, doi:10.1080/21688370.2016.1224963 (2016).

7 Synnestvedt, K. et al. Ecto-5'-nucleotidase (CD73) regulation by hypoxia-inducible factor-1 mediates permeability changes in intestinal epithelia. J Clin Invest 110, 993- 1002, doi:10.1172/JCI15337 (2002).

8 Thompson, L. F. et al. Crucial role for ecto-5'-nucleotidase (CD73) in vascular leakage during hypoxia. J Exp Med 200, 1395-1405, doi:10.1084/jem.20040915 (2004).

9 Bowser, J. L. et al. Loss of CD73-mediated actin polymerization promotes endometrial tumor progression. J Clin Invest 126, 220-238, doi:10.1172/JCI79380 (2016).

10 Hart, M. L. et al. Extracellular adenosine production by ecto-5'-nucleotidase protects during murine hepatic ischemic preconditioning. Gastroenterology 135, 1739- 1750.e1733, doi:10.1053/j.gastro.2008.07.064 (2008).

128 11 Snider, N. T. et al. CD73 (ecto-5'-nucleotidase) hepatocyte levels differ across mouse strains and contribute to mallory-denk body formation. Hepatology 58, 1790-1800, doi:10.1002/hep.26525 (2013).

12 Peng, Z. et al. Ecto-5'-nucleotidase (CD73) -mediated extracellular adenosine production plays a critical role in hepatic fibrosis. FASEB J 22, 2263-2272, doi:10.1096/fj.07-100685 (2008).

13 Fausther, M., Sheung, N., Saiman, Y., Bansal, M. B. & Dranoff, J. A. Activated hepatic stellate cells upregulate transcription of ecto-5'-nucleotidase/CD73 via specific SP1 and SMAD promoter elements. Am J Physiol Gastrointest Liver Physiol 303, G904-914, doi:10.1152/ajpgi.00015.2012 (2012).

14 Global Burden of Disease Liver Cancer, C. et al. The Burden of Primary Liver Cancer and Underlying Etiologies From 1990 to 2015 at the Global, Regional, and National Level: Results From the Global Burden of Disease Study 2015. JAMA Oncol 3, 1683-1691, doi:10.1001/jamaoncol.2017.3055 (2017).

15 Sciarra, A. et al. CD73 expression in normal and pathological human hepatobiliopancreatic tissues. Cancer Immunol Immunother 68, 467-478, doi:10.1007/s00262-018-2290-1 (2019).

16 Cohen, S. et al. CF102 an A3 adenosine receptor agonist mediates anti-tumor and anti-inflammatory effects in the liver. J Cell Physiol 226, 2438-2447, doi:10.1002/jcp.22593 (2011).

17 Stemmer, S. M. et al. CF102 for the treatment of hepatocellular carcinoma: a phase I/II, open-label, dose-escalation study. Oncologist 18, 25-26, doi:10.1634/theoncologist.2012-0211 (2013).

18 Stemmer, S. M. et al. (American Society of Clinical Oncology, 2019).

19 Knapp, K. et al. Crystal structure of the human ecto-5'-nucleotidase (CD73): insights into the regulation of purinergic signaling. Structure 20, 2161-2173, doi:10.1016/j.str.2012.10.001 (2012).

20 Moremen, K. W., Tiemeyer, M. & Nairn, A. V. Vertebrate protein glycosylation: diversity, synthesis and function. Nat Rev Mol Cell Biol 13, 448-462, doi:10.1038/nrm3383 (2012).

129 21 Stowell, S. R., Ju, T. & Cummings, R. D. Protein glycosylation in cancer. Annu Rev Pathol 10, 473-510, doi:10.1146/annurev-pathol-012414-040438 (2015).

22 Snider, N. T. et al. Alternative splicing of human NT5E in cirrhosis and hepatocellular carcinoma produces a negative regulator of ecto-5'-nucleotidase (CD73). Mol Biol Cell 25, 4024-4033, doi:10.1091/mbc.E14-06-1167 (2014).

23 Strum, J. S. et al. Automated assignments of N- and O-site specific glycosylation with extensive glycan heterogeneity of glycoprotein mixtures. Anal Chem 85, 5666- 5675, doi:10.1021/ac4006556 (2013).

24 Tsou, C. C. et al. DIA-Umpire: comprehensive computational framework for data- independent acquisition proteomics. Nat Methods 12, 258-264, 257 p following 264, doi:10.1038/nmeth.3255 (2015).

25 Thorsson, V. et al. The Immune Landscape of Cancer. Immunity 48, 812-830 e814, doi:10.1016/j.immuni.2018.03.023 (2018).

26 Chiu, J. H., Hu, C. P., Lui, W. Y., Lo, S. C. & Chang, C. M. The formation of bile canaliculi in human hepatoma cell lines. Hepatology 11, 834-842, doi:10.1002/hep.1840110519 (1990).

27 Fausther, M. et al. Coexpression of ecto-5'-nucleotidase/CD73 with specific NTPDases differentially regulates adenosine formation in the rat liver. Am J Physiol Gastrointest Liver Physiol 302, G447-459, doi:10.1152/ajpgi.00165.2011.

28 Llovet, J. M. et al. Hepatocellular carcinoma. Nat Rev Dis Primers 2, 16018, doi:10.1038/nrdp.2016.18 (2016).

29 Jemal, A. et al. Annual Report to the Nation on the Status of Cancer, 1975-2014, Featuring Survival. J Natl Cancer Inst 109, doi:10.1093/jnci/djx030 (2017).

30 Buisseret, L. et al. Clinical significance of CD73 in triple-negative breast cancer: multiplex analysis of a phase III clinical trial. Ann Oncol 29, 1056-1062, doi:10.1093/annonc/mdx730 (2018).

31 Wettstein, M. S. et al. CD73 Predicts Favorable Prognosis in Patients with Nonmuscle-Invasive Urothelial Bladder Cancer. Dis Markers 2015, 785461, doi:10.1155/2015/785461 (2015).

130 32 Koivisto, M. K. et al. Cell-type-specific CD73 expression is an independent prognostic factor in bladder cancer. Carcinogenesis 40, 84-92, doi:10.1093/carcin/bgy154 (2019).

33 Shali, S. et al. Ecto-5'-nucleotidase (CD73) is a potential target of hepatocellular carcinoma. J Cell Physiol 234, 10248-10259, doi:10.1002/jcp.27694 (2019).

34 Brown, Z. J., Heinrich, B. & Greten, T. F. Mouse models of hepatocellular carcinoma: an overview and highlights for immunotherapy research. Nat Rev Gastroenterol Hepatol 15, 536-554, doi:10.1038/s41575-018-0033-6 (2018).

35 Petrosyan, A., Holzapfel, M. S., Muirhead, D. E. & Cheng, P. W. Restoration of compact Golgi morphology in advanced prostate cancer enhances susceptibility to galectin-1-induced apoptosis by modifying mucin O-glycan synthesis. Mol Cancer Res 12, 1704-1716, doi:10.1158/1541-7786.MCR-14-0291-T (2014).

36 Resta, R. & Thompson, L. F. T cell signalling through CD73. Cell Signal 9, 131-139, doi:10.1016/s0898-6568(96)00132-5 (1997).

37 Airas, L. et al. CD73 is involved in lymphocyte binding to the endothelium: characterization of lymphocyte-vascular adhesion protein 2 identifies it as CD73. J Exp Med 182, 1603-1608, doi:10.1084/jem.182.5.1603 (1995).

38 Mikhailov, A. et al. CD73 participates in cellular multiresistance program and protects against TRAIL-induced apoptosis. J Immunol 181, 464-475, doi:10.4049/jimmunol.181.1.464 (2008).

39 Airas, L. et al. Differential regulation and function of CD73, a glycosylphosphatidylinositol-linked 70-kD adhesion molecule, on lymphocytes and endothelial cells. J Cell Biol 136, 421-431, doi:10.1083/jcb.136.2.421 (1997).

40 Dianzani, U. et al. Co-stimulatory signal delivered by CD73 molecule to human CD45RAhiCD45ROlo (naive) CD8+ T lymphocytes. J Immunol 151, 3961-3970 (1993).

41 Puthenveedu, M. A., Bachert, C., Puri, S., Lanni, F. & Linstedt, A. D. GM130 and GRASP65-dependent lateral cisternal fusion allows uniform Golgi-enzyme distribution. Nature cell biology 8, 238-248, doi:10.1038/ncb1366 (2006).

131 42 Chang, S. H. et al. GOLGA2/GM130, cis-Golgi matrix protein, is a novel target of anticancer gene therapy. Mol Ther 20, 2052-2063, doi:10.1038/mt.2012.125 (2012).

43 Chia, J. et al. RNAi screening reveals a large signaling network controlling the Golgi apparatus in human cells. Mol Syst Biol 8, 629, doi:10.1038/msb.2012.59 (2012).

44 Mehta, A., Herrera, H. & Block, T. Glycosylation and liver cancer. Adv Cancer Res 126, 257-279, doi:10.1016/bs.acr.2014.11.005 (2015).

45 Kim, H. et al. Measurement of glycosylated alpha-fetoprotein improves diagnostic power over the native form in hepatocellular carcinoma. PLoS One 9, e110366, doi:10.1371/journal.pone.0110366 (2014).

46 Jiang, K. et al. GP73 N-glycosylation at Asn144 reduces hepatocellular carcinoma cell motility and invasiveness. Oncotarget 7, 23530-23541, doi:10.18632/oncotarget.8120 (2016).

47 Norton, P. A. et al. N-linked glycosylation of the liver cancer biomarker GP73. J Cell Biochem 104, 136-149, doi:10.1002/jcb.21610 (2008).

48 Cui, J. et al. N-glycosylation by N-acetylglucosaminyltransferase V enhances the interaction of CD147/basigin with integrin beta1 and promotes HCC metastasis. J Pathol 245, 41-52, doi:10.1002/path.5054 (2018).

49 Park, D. et al. Enterocyte glycosylation is responsive to changes in extracellular conditions: implications for membrane functions. Glycobiology 27, 847-860, doi:10.1093/glycob/cwx041 (2017).

132

CHAPTER 6: CD73 AS A THERAPEUTIC TARGET OF HEPATIC AND EXTRAHEPATIC DISEASES

Overview

Since the discovery of CD73 (initially called 5’-nucleotidase) in the 1930s, the bulk of research studies have focused primarily on characterizing its role in the immune system. In particular, CD73-generated adenosine is a potent immunosuppressor that dampens inflammation in acute settings but can exert pro-tumorigenic activity in chronic conditions like cancer. While these preceding studies on the immune function of CD73 continue to be significant in the clinic, this dissertation offers another perspective by centering on the non- redundant roles of CD73 in epithelial cells.

As highlighted in Chapter 1, CD73 has been shown to regulate chronic liver diseases

(CLD) of multiple etiologies; therefore, targeting this protein in CLD may be a promising therapeutic strategy. The majority of CD73 that is expressed in the normal liver are on hepatocytes1. These cells are the main functional units in the liver that have high metabolic activity. Additionally, hepatocytes are uniquely situated in between sinusoids, thus they are directly exposed to toxins or pathogens from the external environment. Because of these properties, hepatocytes undergo continuous stress, yet they are able to withstand these changes and maintain homeostasis. Previous studies have shown that CD73-generated adenosine promotes a protective epithelial barrier2. Many others have established the role of adenosine in limiting tissue damage by suppressing the immune system. In addition to these protective mechanisms in the epithelium, key findings from this dissertation have demonstrated that CD73 1) maintains metabolic homeostasis via AMPK, the main energy

133

metabolism regulator1; and 2) exhibits a non-enzymatic role as a binding protein for pro- inflammatory bioactive lipids. Based on these findings and others afforded by this dissertation, I hypothesize that CD73 is a gatekeeper in maintaining liver homeostasis and that its altered regulation and loss of function in CLD promotes a shift towards disease progression. Results in this study can be used as a model for understanding the role of CD73 in other epithelial cells.

CD73 as a Metabolic Gatekeeper in the Liver

One of the key findings in this research is that CD73 controls liver metabolism in normal physiologic aging (Chapter 3)1. The absence of CD73 in mouse hepatocytes led to lipid droplet accumulation, swelling, and ballooning, suggesting perturbation of cellular metabolism. Congruent to metabolic stress is the presence of inflammation3 and cell death4, which were exhibited by mice lacking hepatocyte-CD73. This observational finding links

CD73 as a potential gatekeeper of metabolic signaling under basal conditions. One possible mechanism to which these effects could be attributed to is the loss of CD73 AMPase function and a potential, significant reduction in adenosine levels. Previous studies have shown that the intracellular transport and phosphorylation of extracellular adenosine to AMP activates

AMPK5. To that end, we demonstrated that CD73-generated extracellular adenosine must be transported intracellularly to potentiate AMPK activity. In the absence of hepatocyte CD73,

CD73-LKO mice had reduced phosphorylation of AMPK targets as evidenced by our analysis using an AMPK phospho-motif antibody. Notably, we cannot rule out the possibility of adenosine receptor signaling in mediating AMPK activity. Therefore, additional studies are required to determine the potency of adenosine receptor-mediated versus transport- mediated effects on AMPK and hepatocyte metabolism. In combination, CD73 promotes the

134

activation and function of AMPK via its enzymatic activity to maintain metabolic homeostasis.

CD73 as a Novel Lipid Binding Protein

In contrast to its known enzymatic activity, CD73 non-enzymatic functions remain understudied. As shown in Chapter 4, we have uncovered a novel function of CD73 as a binding protein to two eicosanoid molecules. Given that CD73 is expressed in different cell types, this novel function may have a broader implication beyond alcoholic liver disease. For example, circulating TBX2 is vasoconstrictive, and it promotes platelet aggregation in diabetes and cardiovascular disease6, renal disease7, CLD8,9, and cancer8,10. Thrombolytic agents such as aspirin are used in the clinic to inhibit thromboxane synthesis in platelets; however, an increasing number of patients have shown resistance to aspirin therapy11. One potential alternative strategy is through CD73. Interestingly, the enzymatic activity of CD73 has been shown to inhibit aggregation through the sequential dephosphorylation of adenosine diphosphate molecules secreted from activated platelets. Indeed, the presence of soluble

CD73 protein inhibited platelet aggregation in a whole blood in vitro assay and in vivo12.

Given that LTB3 binding did not inhibit CD73 enzymatic activity, additional mechanistic studies on TBX2 and CD73 interactions are needed to understand the feasibility of this approach.

CD73 as a Marker of Hepatocyte Stress

Although the underlying basis of this dissertation examines CD73 as a potential therapeutic target, it may also be used as a diagnostic marker for CLD. A recurring theme throughout the study is that CD73 is regulated at different stages of CLD, such as in hepatocellular carcinoma (HCC)13, non-alcoholic fatty liver disease (NAFLD)1, and alcoholic

135

liver disease (ALD). Previous studies demonstrated that CD73 in human HCC is post- transcriptionally regulated through alternative splicing14. Furthermore, the CD73-encoding gene NT5E was decreased in human fibrosis regardless of the etiology14,15. Herein, we showed that CD73 mRNA transcript is increased in response to alcohol-induced liver injury

(Chapter 4). This discrepancy in CD73 expression at the transcript level may be explained by early versus advanced stages of CLD. Therefore, a molecular understanding of transcription factors or stimuli that promote NT5E expression may delineate key regulatory mechanisms at these different stages.

Another set point in regulation is after CD73 protein translation. We discovered that tumor-specific CD73 is modified at four N-glycosylation sites in human HCC (Chapter 5)13.

These modifications render CD73 enzymatically inactive and mislocalized to the perinuclear area. Further examination of CD73 glycosylation mutants revealed accumulation in the Golgi apparatus, which is the main site of protein glycosylation. Interestingly, analysis of HCC tissues showed the following: 1) an enrichment of other N-glycosylation proteins by RNA sequencing, and 2) enhanced biogenesis of the Golgi apparatus by histology. These data suggests that aberrant protein glycosylation may be a common neoplastic transformation in

HCC. Specifically, N-linked glycans have been examined in the context of HCC16, but its application in the clinic is still undetermined. Further biochemical and molecular studies will help identify specific glycosyltransferases that are involved in HCC. In addition, the global modification of glycosylated proteins may be exploited as a diagnostic tool in establishing disease stage and severity.

Sex-Dependent Differences in HCC and a Potential Role of CD73

The last significant finding is the sexual dimorphic function of CD73 in the liver

136

(Chapter 3). Although our study is mostly observational, it is worth noting that further investigation of hepatocyte CD73 biology in metabolism and sex differences may illuminate converging pathways in CLD and non-CLD progression to HCC. This is important because

HCC affects men 2-4 times more than women17. However, HCC in women normally increases after menopause, when estrogen sharply decreases, which strongly suggests that decreased estrogen levels lead to higher rates of HCC. Yet despite the accumulating evidence of estrogen-based sex differences, overall results from clinical trials testing estrogen-related therapies for HCC have been inconclusive18. It is therefore possible that other factors (like

CD73) may contribute to the overall protective effect of estrogen. A future direction for this project is to mechanistically interrogate how CD73 interacts with sex hormone signaling to mediate the gender disparity in HCC and CLD, thereby providing a foundation for alternate, more effective treatments.

Conclusions and Future Perspectives

Decades of research breakthroughs on the release and metabolism of ATP to adenosine outside of the cell have revealed critical functions that are independent of the essential metabolic activities occurring within the cell19. Adenosine controls numerous homeostatic processes and stress adaptation mechanisms, which would be rendered ineffective in the setting of chronic CD73 inhibition, an effort currently being undertaken in clinical research20. In order to move forward in advancing effective therapies around CD73, now is the time to take a step back and understand the fundamental biology behind this fascinating molecule (see Table 6.1 for Outstanding Questions). Priorities for future work include the generation of additional human-specific tools to study CD73 regulation – such as iPSC-derived cells and tissue organoids21. These tools can help resolve species-specific

137

mechanisms, such as alternative splicing14, and help streamline the process of translating preclinical discoveries to the clinic. It will be important for future studies to carefully consider the mechanisms by which CD73 expression and activity are altered in diseases, such as mRNA expression and processing, protein expression and localization, and enzymatic activity, as these are often discordant under pathological conditions. The current anti-CD73 targeting strategies rely on the presence of cell surface - expressed, enzymatically active form of CD73 but do not address alternative splice isoforms and PTM variants that can affect localization and activity. CD73 targeting should ideally be tailored to the specific disease and cancer type to avoid untoward effects. The whole-body CD73 knockout mouse model has been instrumental in understanding CD73 function and for disease modeling22. However, given the ubiquitous expression and complex interplay between CD73 on different cell types23, it is critical to move forward using tissue-specific knockout models, as has been done in intestinal24, kidney25, and our newly-generated liver models1, in order to decode some of the cellular complexity. All of these questions are addressable with the availability of new iPSC technologies, genetic mouse models, highly selective and potent inhibitors, and imaging probes, which are creating new opportunities to monitor, target, and manipulate CD73

(Figure 6.1).

138

Figure 6.1. New Tools to Study CD73 Regulation and Function. The ubiquitous nature of CD73 and the purinergic signaling complexity conceal important tissue-specific mechanisms, which warrants development of new tools to study this ecto-enzyme. (Top Row) Recently synthesized fluorescent probes and small molecule inhibitors were designed based on the lead structure of the most common CD73 inhibitor, adenosine 5'-(α,β-methylene)diphosphate or APCP. These newer probes exhibit higher potency while also enabling visualization and monitoring of CD73. Additionally, studies demonstrating pro-tumorigenic functions of CD73 led to the advent of new monoclonal antibodies tested in clinical trials. In contrast, promoting CD73 activity may alleviate inflammation and platelet aggregation. A CD39-CD73 fusion protein was shown to sequentially hydrolyze pro-inflammatory ATP to anti-inflammatory adenosine. (Middle Row) To interrogate relevant disease mechanisms, patient-derived induced pluripotent stem cells (iPSCs) have become an ideal model system. For example, fibroblasts derived from patients with a rare genetic mutation of CD73 can be reprogrammed to generate iPSCs. These, in turn, can be differentiated into osteoblasts and osteoclasts to study pathological mechanisms the rare disease Arterial Calcification Due to Deficiency of CD73 (ACDC). (Bottom Row) To elucidate tissue-specific functions of proteins, reporter mouse lines and targeted gene deletion have been instrumental. A new reporter mouse line called CD73-EGFP enables tracking cell lineage and identification of CD73+ cells. This reporter line could help characterize stem cell populations that have been recently shown to express CD73. Another useful model is the floxed CD73 mouse line, which enables targeted deletion of CD73 in specific tissues when mated with Cre recombinase mice. Specifically, deletion of CD73 in the liver, intestines, and kidney demonstrated tissue-specific protection under physiological and pathological conditions.

139

Table 6.1. Outstanding Questions on CD73 Function and Expression Outstanding Questions • Which aspects of CD73 regulation and function are conserved across species and which ones are unique to humans? • What are the influences of age and biological sex, including hormones, on CD73 function, regulation, and roles in disease? • What is the significance of CD73 metabolic zonation, and how does CD73 mediate physiological adaptation in epithelial tissues? • How are the transcriptional, post-transcriptional, and post-translational mechanisms integrated to control CD73 express and activity in normal cells? How are these mechanisms altered during stress and in disease conditions? • What are the functions of the circNT5E mRNA in malignant neoplastic cells? What are the drivers of this alternative splicing process? • Which RNA-binding proteins control NT5E expression and splicing in homeostasis and stress? • How are kinase signaling pathways (e.g. AKT, mOR, AMPK) altered in the absence of functional CD73? • Does CD73 have adenosine-independent functions and, if so, how are they altered by CD73-targeting antibodies and small molecule inhibitors?

140

REFERENCES

1 Alcedo, K. P. et al. CD73 Maintains Hepatocyte Metabolic Integrity and Mouse Liver Homeostasis in a Sex-Dependent Manner. Cell Mol Gastroenterol Hepatol, doi:10.1016/j.jcmgh.2021.01.016 (2021).

2 Bowser, J. L. & Broaddus, R. R. CD73s protection of epithelial integrity: Thinking beyond the barrier. Tissue Barriers 4, e1224963, doi:10.1080/21688370.2016.1224963 (2016).

3 Gehrke, N. & Schattenberg, J. M. Metabolic Inflammation-A Role for Hepatic Inflammatory Pathways as Drivers of Comorbidities in Nonalcoholic Fatty Liver Disease? Gastroenterology 158, 1929-1947 e1926, doi:10.1053/j.gastro.2020.02.020 (2020).

4 Altman, B. J. & Rathmell, J. C. Metabolic stress in autophagy and cell death pathways. Cold Spring Harb Perspect Biol 4, a008763, doi:10.1101/cshperspect.a008763 (2012).

5 Aymerich, I., Foufelle, F., Ferré, P., Casado, F. J. & Pastor-Anglada, M. Extracellular adenosine activates AMP-dependent protein kinase (AMPK). J Cell Sci 119, 1612- 1621, doi:10.1242/jcs.02865 (2006).

6 Lopez, L. R. et al. Platelet thromboxane (11-dehydro-Thromboxane B2) and aspirin response in patients with diabetes and coronary artery disease. World J Diabetes 5, 115-127, doi:10.4239/wjd.v5.i2.115 (2014).

7 Simeone, P., Boccatonda, A., Liani, R. & Santilli, F. Significance of urinary 11- dehydro-thromboxane B2 in age-related diseases: Focus on atherothrombosis. Ageing Res Rev 48, 51-78, doi:10.1016/j.arr.2018.09.004 (2018).

8 Sciulli, M. G. et al. Platelet activation in patients with colorectal cancer. Prostaglandins Leukot Essent Fatty Acids 72, 79-83, doi:10.1016/j.plefa.2004.10.006 (2005).

9 Nanji, A. A., Khettry, U., Sadrzadeh, S. M. & Yamanaka, T. Severity of liver injury in experimental alcoholic liver disease. Correlation with plasma endotoxin, prostaglandin E2, leukotriene B4, and thromboxane B2. Am J Pathol 142, 367-373 (1993).

141

10 Yokoyama, I. et al. Prevention of experimental hepatic metastasis with thromboxane synthase inhibitor. Res Exp Med (Berl) 195, 209-215, doi:10.1007/BF02576790 (1995).

11 Hankey, G. J. & Eikelboom, J. W. Aspirin resistance. Lancet 367, 606-617, doi:10.1016/S0140-6736(06)68040-9 (2006).

12 Hart, M. L. et al. Direct treatment of mouse or human blood with soluble 5'- nucleotidase inhibits platelet aggregation. Arterioscler Thromb Vasc Biol 28, 1477- 1483, doi:10.1161/ATVBAHA.108.169219 (2008).

13 Alcedo, K. P. et al. Tumor-Selective Altered Glycosylation and Functional Attenuation of CD73 in Human Hepatocellular Carcinoma. Hepatology communications 3, 1400-1414, doi:10.1002/hep4.1410 (2019).

15 Snider, N. T. et al. CD73 (ecto-5'-nucleotidase) hepatocyte levels differ across mouse strains and contribute to mallory-denk body formation. Hepatology 58, 1790-1800, doi:10.1002/hep.26525 (2013).

16 Mehta, A., Herrera, H. & Block, T. Glycosylation and liver cancer. Adv Cancer Res 126, 257-279, doi:10.1016/bs.acr.2014.11.005 (2015).

17 McGlynn, K. A., Petrick, J. L. & El-Serag, H. B. Epidemiology of Hepatocellular Carcinoma. Hepatology, doi:10.1002/hep.31288 (2020).

18 Di Maio, M. et al. Is human hepatocellular carcinoma a hormone-responsive tumor? World J Gastroenterol 14, 1682-1689, doi:10.3748/wjg.14.1682 (2008).

19 Khakh, B. S. & Burnstock, G. The double life of ATP. Sci Am 301, 84-90, 92, doi:10.1038/scientificamerican1209-84 (2009).

20 Allard, B., Allard, D., Buisseret, L. & Stagg, J. The adenosine pathway in immuno- oncology. Nat Rev Clin Oncol 17, 611-629, doi:10.1038/s41571-020-0382-2 (2020).

142

21 Joolharzadeh, P. & St Hilaire, C. CD73 (Cluster of Differentiation 73) and the Differences Between Mice and Humans. Arterioscler Thromb Vasc Biol 39, 339-348, doi:10.1161/ATVBAHA.118.311579 (2019).

22 Thompson, L. F. et al. Crucial role for ecto-5'-nucleotidase (CD73) in vascular leakage during hypoxia. J Exp Med 200, 1395-1405, doi:10.1084/jem.20040915 (2004).

23 Minor, M., Alcedo, K. P., Battaglia, R. A. & Snider, N. T. Cell type- and tissue- specific functions of ecto-5'-nucleotidase (CD73). Am J Physiol Cell Physiol 317, C1079-C1092, doi:10.1152/ajpcell.00285.2019 (2019).

24 Kao, D. J. et al. Intestinal Epithelial Ecto-5'-Nucleotidase (CD73) Regulates Intestinal Colonization and Infection by Nontyphoidal Salmonella. Infect Immun 85, doi:10.1128/IAI.01022-16 (2017).

25 Sung, S. J. et al. Proximal Tubule CD73 Is Critical in Renal Ischemia-Reperfusion Injury Protection. J Am Soc Nephrol 28, 888-902, doi:10.1681/ASN.2016020229 (2017).

143