Phylogeny of the Altingiaceae Based on Cpdna Matk, PY-IGS and Nrdna ITS Sequences
Total Page：16
File Type：pdf, Size：1020Kb
_______________________________________________________________________________www.paper.edu.cn Plant Syst. Evol. 230: 13±24 12001) Phylogeny of the Altingiaceae based on cpDNA matK, PY-IGS and nrDNA ITS sequences S.Shi 1, Y.Huang 1, Y.Zhong 2,Y.Du1, Q.Zhang 1, H.Chang 1, and D.E.Bouord 3 1The Key Laboratory of Gene Engineering of Ministry of Education, School of Life Sciences, Zhongshan University, Guangzhou, China 2Ministry of Education Key Laboratory of Biodiversity Science and Ecological Engineering, School of Life Sciences, Fudan University, Shanghai, China 3Harvard University Herbaria, Cambridge, MA, USA Received December 20, 2000 Accepted June 25, 2001 Abstract. Phylogenetic relationships of the three Although the monophyly of the Hamameli- genera of the family Altingiaceae, i.e., Altingia, daceas s.l. remains unclear, it appears to be Liquidambar and Semiliquidambar, based on matK generally accepted that the Altingiaceae, pre- sequences and the intergenic spacer between the viously included in the Hamamelidaceae, is a psaA and ycf3 genes 1PY-IGS) of cpDNA, and on natural group that includes three genera the internal transcribed spacer 1ITS) of nrDNA Liquidambar, Altingia and Semiliquidambar. were studied. Phylogenetic trees based on the three These genera were treated as the subfamily data sets 1matK, PY-IGS and ITS) were generated using Hamamelis japonica and Mytilaria laosensis Altingioideae in Hamamelidaceae 1Reinsch 1Hamamelidaceae), Cercidiphyllum japonicum 1890, Cronquist 1981, Endress 1989, Chang 1Cercidiphyllaceae), and Daphniphyllum calycinum 1979, Bogle 1986), or as the Liquidambaroi- 1Daphniphyllaceae) as outgroups. The partition- deae 1Harms 1930), or as a distinct family, the homogeneity tests indicated that the three data sets Altingiaceae 1Blume 1828, Wilson 1905, Chang and the combined data are homogeneous. A 1964, Melikian 1973, Li et al. 1988, Zhou and combined analysis also generated a strongly Jiang 1990, Wang 1992, Qiu et al. 1998, supported phylogeny. The phylogenetic trees show Angiosperm Phylogeny Group 1998). The that the North American and western Asian APG's system is followed in this study. The species, L. styraci¯ua and L. orientalis, respectively, phylogenetic relationships between the three form a monophyletic group which is sister to the genera have at times been controversial due to clade including all Asian species in the family. The overlap in primitive and advanced morpholog- genus Liquidambar is paraphyletic with Altingia and Semiliquidambar nested within. Phylogenetic ical and anatomical features. The three genera analyses of the molecular data indicate that are remarkably similar in the morphology of taxonomic reexamination of the generic delimita- their leaves, stipules, in¯orescences, ¯owers, tion in the Altingiaceae is needed. pollen grains, fruits, and seeds, but dier mainly in some vegetative and morphological Key words: Altingiaceae, phylogeny, evolution, characteristics. Species of Altingia are ever- Altingia, Liquidambar, Semiliquidambar. green with entire, unlobed leaves; those of _______________________________________________________________________________中国科技论文在线 www.paper.edu.cn 14 S. Shi et al.: Phylogeny of the Altingiaceae Liquidambar are deciduous with 3- to 5-, or Material and methods even 7-lobed leaves; and Semiliquidambar is Leaves of 14 samples representing the three genera deciduous or evergreen with leaves trilobed, of the Altingiaceae and four outgroups were simple or lobed on one side. Unlike Liquidam- collected from natural or cultivated populations bar, which has a disjunct distribution charac- 1Table 1). Hamamelis japonica and Mytilaria laos- teristic of a number of ancient plants 1eastern ensis 1Hamamelidaceae), Cercidiphyllum japonicum North America, Mexico, eastern Asia, and 1Cercidiphyllaceae), and Daphniphyllum calycinum southwestern Asia), Altingia and Semiliqui- 1Daphniphyllaceae) were selected as outgroups dambar are restricted to southeastern Asia. based on the results of Qiu et al. 11998) and APG Recent phylogenetic analyses of the ITS and 11998). Total DNAs were isolated from fresh and matK sequences have suggested that the silica-dried material using the CTAB method Altingiaceae are monophyletic 1Shi et al. 1Doyle and Doyle 1987). Double stranded copies 1998; Li et al. 1999a, b). Further studies on of the matK and ITS regions were ampli®ed from total DNA using the polymerase chain reaction phylogeny, evolution, and biogeography with- 1PCR). Only one band of PCR product was in Altingiaceae are needed, especially of the detected in agarose gel, which was then puri®ed intercontinental disjunct genus Liquidambar using the QIAquick PCR Puri®cation Kit 1CN 1Wen 1999). Shi et al. 11998) have shown that 28104, QIAGEN). Sequencing was done using the Liquidambar is probably paraphyletic. Hoey Automated Sequencer 377 1Applied Biosystems, and Parks 11994) studied Liquidambar using CA) at China Agricultural University in Beijing. isozyme data and concluded that L. styraci¯ua DNA strands of partial samples were sequenced of the New World was more closely related to manually using the Sequenase Version 2.0 DNA the Mediterranean L. orientalis than to the sequencing kit 1US70770, Amersham) and alpha 35 eastern Asian species. Two more papers on S-dATP as a radioactive tracer and compared for interspeci®c relationships of Liquidambar by Li all taxa to ensure accuracy. The primers for et al. 11997, 1999b) supported Hoey and amplifying the ITS regions were ITS4 and ITS5 and for sequencing were C5.8S, ITS4, N5.8S and Parks' conclusions. To test these conclusions N18L18 1Wen and Zimmer 1996). The primers for by including samples of Semiliquidambar and the matK gene were MG15 and MG1 for PCR additional species of Altingia, therefore, was ampli®cation 1Hilu and Liang 1997), and MS4R one of the major objectives of this study. 15¢TATCTGACATAATGCATGAA3¢), MS5R Sequences of the internal transcribed spac- 15¢TTGAATGAATAGATCGTRA3¢) 1this study), er 1ITS) regions of nrDNA and the matK gene MS2F 15¢CTATATAATTCTCATGTAT3¢) 1Shi of cpDNA have been widely used for phylo- et al. 2000), matK-1470R 1Johnson and Soltis, genetic studies at the inter- and intra-generic 1994), matK5 1Hilu and Liang 1997) and matKF6 levels in many angiosperm families 1Baldwin 1Sang et al. 1997) for sequencing. The primers for et al. 1995, Steele and Vilgalys 1994, Johnson amplifying and sequencing the PY-IGS region were and Soltis 1994, Hilu and Liang 1997). The PG1 15¢CATTCCTCGAACGAAGTTTTTACG- intergenic spacer between the psaA and ycf3 GGATCC3¢) and PG2 15¢CAATTATGCGCTTC- AATATAATTACCGGGA3¢). genes 1PY-IGS) is located from 43410 to 44297 The DNA sequences obtained were assembled in the chloroplast DNA of tobacco 1Nicotiana and the boundaries of the matK gene and PY-IGS tabacum) 1Shimada and Sugiura 1991), and region were determined by comparison with the has begun to be applied in studies of the DNA sequences of tobacco 1Nicotiana tabacum) molecular systematics of plants, such as in 1Shinozaki et al. 1986, Shimada and Sugiura 1991). the family Oleaceae 1K.-J. Kim, personal The DNA sequences of the ITS regions were communication). In this paper, the phylo- compared with that of carrot 1Daucus carota) genetic analyses of Altingiaceae based on 1Yokota et al. 1989). The assembled sequences sequences of the cpDNA matK gene, the were aligned using the Clustal-X program 1Thomp- PY-IGS region, and the nrDNA ITS regions son et al. 1997). Sequences were then deposited in were carried out. GenBank 1see Table 1 for accession numbers). _______________________________________________________________________________中国科技论文在线 www.paper.edu.cn Table 1. Accessions of Altingiaceae and outgroups used in this study. SYS = Zhongshan 1Sunyatsen) University, CS = Colorado State Uni- S. Shi et al.: Phylogeny of the Altingiaceae 15 versity. Classi®cation follows APG 11998) Taxon Source and voucher GenBank Accession Number matK PY-IGS ITS Altingia chinensis 1Champion) Cult. South-China Bot. Gard. China, AF133225 AF304542 AF133232 Oliver ex Hance Y. Chen 105%SYS) Altingia excelsa Hemsley var. Cult. Kunming Bot. Gar. China, AF304520 AF304533 AF304525 serrulata Tutch X. Gong 726%SYS) Altingia gracilipe Hemsley Dawushan, Hong Kong, China, AF133223 AF304535 AF133233 F. Xing 106%SYS) Altingia abovata Merrill et Chun 11) Cult. Guangdong Inst. Forest., China, AF133224 AF304541 AF133234 T. Chen 118%SYS) Altingia obovata Merrill et Chun 12) Jianfengling, Hainan, China, Shi 695%SYS) AF304523 AF304540 AF304528 Altingia takhtajanensis Thai Van Cult. Xishuanbanna Bot. Gard. China, AF304521 AF304534 AF304526 Trung et Lie Viet Lok Y. Huang 355 %SYS) Semiliquidambar cathayenensis Chang Jianfehgling, Hainan, China, H. Chen 158%SYS) AF133226 AF304536 AF133235 Semiliquidambar chingii 1Metcalfe) Chang Cult. Hangzhou Bot. Gar. China, AF304522 AF304537 AF304527 C. Fu 743%SYS) Liquidambar acalycina Chang Huangshan, China X. Li 223%SYS) AF133222 AF304538 AF133231 Liquidambar formosana Hance Dadongshan, Guangdong, China, AF133221 AF304539 AF133230 W. Liao 128 %SYS) Liquidambar styraci¯ua Linn 11) Arnold Arboretum, USA, J. Wen 581 %CS) AF133218 AF304532 AF133227 Liquidambar styraci¯ua Linn 12) Cult. South-China Bot. Gard. China AF133219 AF304531 AF133228 T. Chen 121%SYS) Liquidambar orientalis Miller 11) Cult. South-China Bot. Gard. China AF133220 AF304530 AF133229 S. Shi 484%SYS) Liquidambar orientalis Miller 12) Cult. Yeungnam Univ. Korea, Shi-K01%SYS) AF304519 AF304529 AF304524 Hamamelis japonica Tokyo, Japan, J. Wen 2463%CS) AF198091 AF304543