A Gene Encoding a Putative Gtpase Regulator Is Mutated in Familial Amyotrophic Lateral Sclerosis 2

Shinji Hadano1,2, Collette K. Hand3, Hitoshi Osuga1,2, Yoshiko Yanagisawa1, Asako Otomo1, Rebecca S. Devon4, Natsuki Miyamoto1, Junko Showguchi-Miyata2, Yoshinori Okada2, Roshni Singaraja4, Denise A. Figlewicz5, Thomas Kwiatkowski6, Betsy A. Hosler6, Tally Sagie7, Jennifer Skaug8, Jamal Nasir4,9, Robert H. Brown, Jr6, Stephen W. Scherer8, Guy A. Rouleau3, Michael R. Hayden4 & Joh-E Ikeda1,2,10

Amyotrophic lateral sclerosis 2 (ALS2) is an autosomal recessive form of juvenile ALS and has been mapped to human chromosome 2q33. Here we report the identiﬁcation of two independent deletion mutations linked to ALS2 in the coding exons of the new gene ALS2. These deletion mutations result in frameshifts that generate premature stop codons. ALS2 is expressed in various tissues and cells, including neurons throughout the brain and spinal cord, and encodes a protein containing multiple domains that have homology to RanGEF as well as RhoGEF. Deletion mutations are predicted to cause a loss of protein function, providing strong evidence that ALS2 is the causative gene underlying this form of ALS.

Introduction The disorder ALS2 (OMIM 205100), also known as type 3 Amyotrophic lateral sclerosis (ALS) is a heterogeneous group of autosomal recessive ALS (RFALS type 3), was originally reported inexorable neurodegenerative disorders characterized by a selec- in a large consanguineous Tunisian kindred and was character- tive loss of upper and lower motor neurons in the brain and ized by a loss of upper motor neurons and spasticity of limb and spinal cord1. Although most cases reported are sporadic (SALS), facial muscles accompanying distal amyotrophy of hands and 5–10% are familial (FALS). Five types of FALS have been assigned feet10. The ALS2 locus has been mapped by linkage and haplo-

© http://genetics.nature.com Group 2001 Nature Publishing to the distinct loci of the human genome. The gene for an autoso- type analyses to the 1.7-cM interval flanked by D2S116 and mal dominant form with late onset (ALS1) maps to chromosome D2S2237 (refs. 6,7). YAC-, BAC- and PAC-based physical cloning 21q22.1–q22.2 (ref. 2) and is associated with missense mutations and mapping have shown that this interval spans approximately in the copper–zinc superoxide dismutase gene (SOD1)3. A domi- 3 Mb of genomic DNA7,11,12 and have allowed the generation of a nant form of juvenile ALS (ALS4) has been mapped to chromo- transcript map of the ALS2 critical region. Within this interval, some 9q34 (refs. 4,5). Two types of autosomal recessive forms for several candidate genes for ALS2 have been assigned7,11,12. A juvenile ALS, ALS2 and ALS5, have been mapped to chromo- recent study showed that no sequence alterations associated with somes 2q33 (refs. 6,7) and 15q15–q22 (ref. 8), respectively. In ALS2 have been found in four exons encoding CD28 and three addition, an autosomal dominant form of ALS with frontotem- exons encoding CTLA4, indicating that CD28 and CTLA4 are not poral dementia (ALS-FTD) has recently been assigned to chro- causative genes for ALS2 (ref. 7). Despite such substantial studies, mosome 9q21–q22 (ref. 9). Pedigrees with adult-onset, the genetic cause underlying ALS2 has yet to be identified. autosomal-dominant ALS that is neither linked to chromosome We have identified 42 nonoverlapping transcripts within the 21 nor associated with SOD1 mutations suggest an additional ALS2 candidate interval11,12 and searched the disease-associated locus for FALS, which is currently called ALS3 (ref. 2). These data DNA sequence for alterations in 395 exons and their flanking indicate the genetic heterogeneity of FALS, for which all genetic regions derived from these genes. We found two independent causes except ALS1 are still unknown. To delineate the molecular deletion mutations in the coding exons of a new gene, ALS2 (ini- pathogenesis of ALS and other motor-neuron diseases, identifi- tially identified as ALS2CR6), in the Tunisian and Kuwaiti ALS2 cation of additional genes and their mutations that link to FALS families. These deletion mutations result in frameshifts that gen- is essential. erate premature stop codons. We have also isolated the mouse

1NeuroGenes, International Cooperative Research Project, Japan Science and Technology Corporation, Tokai University School of Medicine, Isehara, Kanagawa 259-1193, Japan. 2Department of Molecular Neuroscience, The Institute of Medical Sciences, Tokai University, Isehara, Kanagawa, Japan. 3Centre for Research in Neuroscience, McGill University, and Montreal General Hospital Research Institute, Montreal, Quebec, Canada. 4Department of Medical Genetics, and Centre for Molecular Medicine and Therapeutics, University of British Columbia and Children’s and Women’s Hospital, Vancouver, British Columbia, Canada. 5Departments of Neurology and Neurobiology & Anatomy, University of Rochester Medical Center, Rochester, New York, USA. 6Day Neuromuscular Research Laboratory, Navy Yard, Charlestown, Massachusetts, USA. 7Pediatric Neurology and Metabolic Neurogenetic Clinic, E. Wolfson Medical Center, Holon, Israel Sackler School of Medicine, Tel Aviv University, Tel Aviv, Israel. 8Department of Genetics, The Hospital for Sick Children, Toronto, Ontario, Canada. 9Division of Genomic Medicine, University of Shefﬁeld, Royal Hallamshire Hospital, Shefﬁeld, UK. 10Department of Paediatrics, Faculty of Medicine, University of Ottawa, Ottawa, Ontario, Canada. Correspondence should be addressed to J.-E.I. (e-mail: [email protected]) or M.R.H. (e-mail: [email protected]).

19E07

WI-6694 WI-10756 D2S307 WI-10029 D2S116 D2S309 IB1518 WI-4092 D2S2309 D2S2214 D2S346 D2S2289 D2S72 D2S105 WI-5293 D2S2189 D2S1384 D2S2237

WI-3292

500895) EST (BE086567) EST 2 LOC57404 (D31306) EST

I002114) R19 R W

8 0005

2C A SP S

IA A L TLA4 EST (AI754862) EST

KIAA0058 pseudo

EST (A EST (A PMSA2 pseudo PMSA2 K ALS2CR1 NDUFB3 CFLAR CASP10 C A ALS2CR7 FZD7 BMPR2 ALS2CR13 EST (AA379434) ALS2CR16 ALS2CR8 AIP-1 CD28 C ICOS ALS2C

(CEN) (TER)

10 12 15

R R R

2L 1 2C 2C 2C

C S S

LK R L LS L

C PPIL3 O A A ALS2CR3 ALS2CR11 ALS2CR4 MPP4/ALS2CR5 ALS2CR6 UBL1 NOP5/NOP58 A ALS2CR14 FLJ10881 ALS2CR17 ALS2CR9

500 kb

Fig. 1 A transcript map of the 3-Mb region of human chromosome 2q33 containing the ALS2 candidate region. An open box spans the region between D2S116 and D2S2237, which represents a critical region for the candidate interval for ALS2 (ref. 7). Locations of 7 STS markers, 13 polymorphic DNA markers and 42 nonoverlapping transcriptional units are shown based on the previously reported physical map11,12. Polarities of 38 transcriptional units are drawn as indicated as arrows.

ortholog for ALS2 (Als2). Both transcripts are expressed in vari- for large deletions or rearrangements in the critical region in the ous tissues and cells, including neurons throughout the brain and Tunisian individuals with ALS2 by PCR-based STS/EST content spinal cord, and encode proteins containing several guanine- mapping and Southern blot analysis. We did not detect any evi- nucleotide exchange factor for Ran (RanGEF)13 and the guanine- dence for such deletions or rearrangements (data not shown). We nucleotide exchange factor for Rho (RhoGEF)14. Deletion next screened for small deletions or base substitutions in exons or mutations are predicted to abolish protein function, providing intron-exon boundaries. To identify these mutations, we ana- strong evidence that ALS2 is the causative gene underlying ALS2. lyzed the genomic organization of each transcript and deﬁned the intron-exon boundaries for the candidate genes. We identi- Results ﬁed 395 exons derived from 42 candidate transcripts. Although A transcript map and the ALS2 candidate genes not all the exons in the putative ALS2 candidate interval are rep- We previously generated a YAC-, BAC-, and PAC-based physical resented by these exons, the results of our extensive saturation

© http://genetics.nature.com Group 2001 Nature Publishing map of the 3-Mb genomic region covering the complete candi- mapping of transcripts suggests that the majority of exons are date region for ALS2 (refs. 11,12). Using this physical map, com- indeed included in this sample. We designed 411 pairs of primers bined with extensive analyses of EST sequences and DNA to use in amplifying exons and their flanking sequences, includ- sequencing of cDNA clones, we mapped 42 nonoverlapping tran- ing splicing donor and acceptor consensus sequences (Web Table scriptional units, including 18 previously characterized genes B). We amplified exons and their flanking sequences from 14 (KIAA0005, CLK1, PPIL3, ORC2L, NDUFB3, CFLAR, CASP10, Tunisian family members with ALS2 (Fig. 2a) and 10 unrelated CASP8, FZD7, UBL1, NOP5/NOP58, BMPR2, FLJ10881, normal controls. By determining the DNA sequence for each LOC57404, AIP1, CD28, CTLA4 and ICOS) and 10 new full- PCR product, we identified a total of 77 sequence variations in length transcripts (ALS2CR1, ALS2CR2, ALS2CR3, ALS2CR4, either introns or exons (data not shown). Of these 77 variations, ALS2CR5/MPP4, ALS2CR6, ALS2CR7, ALS2CR8, ALS2CR9 and 6 intronic sequence variations and 2 exonic sequence changes are ALS2CR12; Fig. 1 and Web Table A). associated with the disease phenotype (Table 1) and haplotypes for adjacent DNA markers (data not shown). Mutation detection in Tunisian family with ALS2 Among these sequence changes, we observed a single- Juvenile ALS2 is rare, and is heralded by symptoms in the first or nucleotide deletion (261delA) in exon 3 of ALS2CR6 that dis- second decade of life that include progressive spasticity of the rupts the reading frame and would be expected to have a limbs and the facial and pharyngeal muscles10. The recessive deleterious effect on the encoded protein. All the suspected het- inheritance of ALS2 led us to predict that the disease probably erozygote carriers show a superimposed sequence pattern start- results from a loss-of-function mutation. We initially searched ing at the first nucleotide after the deletion (Fig. 2b). As this

Table 1 • Summary of sequence polymorphisms seen in Tunisian ALS2 patients Gene Region Normal ALS2 → NOP5/NOP58 intron 2 tatctc(T)9aattct (T)6 → NOP5/NOP58 intron 6 gttttg(TTG)2ttttta (TTG)3 ALS2CR6 intron 2 ggtaaaAtcattt → G ALS2CR6 exon 3 gcaggcAgccctc → 261Adel* ALS2CR8 intron 6 gtcagtAttataa → G ALS2CR9 exon 4 ctccagCatggac → T (3rd codon) ALS2CR9 intron 7 ttgggaTtttttt → A ALS2CR9 intron 8 aaaataCggatat → T ALS2-associated sequence variations are underscored. *denotes the mutation for the Tunisian ALS2.

261delA mutation generates a new NarI cutting site, we next car- mal controls. We did not detect aberrant mRNA sequences (data ried out a mutation analysis using NarI to digest the exon 3 PCR not shown). Thus, it is likely that the single-base deletion products. The mutant allele produces two fragments of 225 bp (261delA) in ALS2CR6 is the mutation underlying the Tunisian and 113 bp in place of the 339-bp fragment representing the nor- ALS2 phenotype. mal allele. We found that all the affected individuals studied carry a homozygous 261delA mutation, whereas all the predicted carri- Mutation detection in Kuwaiti family with ALS2 ers show a heterozygous pattern (Fig. 2d); thus, the deletion co- We also found a second truncating mutation in an unrelated segregates perfectly with the ALS2 phenotype. In addition, the family with ALS2 in Kuwait15 (Fig. 2a). Affected members of this 261delA mutation was not seen in 533 unrelated normal control family show early development of progressive spasticity with a individuals (61 North African individuals, whose racial back- a ground is the same as that of Tunisian ALS2 family Kuwaiti ALS2 family the family with ALS2; 94 Lebanese, whose ethnic origin I I overlaps with that of Tunisians; 310 Caucasians; and 68 Asians; II II data not shown). Other sequence changes (Table 1) III III 10799 include a C→T single-base

substitution in exon 4 of IV IV 10785 10780 10773* 18281 18276 ALS2CR9 (C873T). This corre-

sponds to the third codon and V z V * 10782 10789* 10797 10792 10787 10772 10786 10795 10784 10793 10791 10788 18275 18279 18277 18278 18280 thus does not change the cod-

ing amino acid residue. To genotype unknown detect possible cryptic splicing ALS2 or splicing errors resulting heterozygote carrier * * non-carrier from other sequence varia- b tions, we carried out RT–PCR A261del using total RNA samples 1548delAG extracted from lymphocytes of c both affected patients and nor- normal forward reverse A C G TA C G T A C G T reverse forward C E 473 GAA T T C GAA E 473 C T E 474 GAA T T T C GAA E 474 T T ALS2 (10797) T 475 ACA G T Fig. 2 Mutation detection in ALS2. a, A T T ACA T 475 C G E 476 GAG T T C C GGG G 476 pedigree of the Tunisian and Kuwaiti C C G 477GGA C C © http://genetics.nature.com Group 2001 Nature Publishing T T AGG R 477 families with ALS2. Genotypes of the C C C G 478GGC C G G T CAG Q 478 family members were drawn based on carrier (10784) C 6,7 reported and unpublished (Brown et forward primer normal carrier ALS2 al.) results. b, Sequence of the muta- (18279)(18281) (18275) tion (261delA) in the genomic DNA in the Tunisian ALS2 family. Patient 10797 carrier (10784) is homozygous for 261delA, and carrier reverse primer 10784 is heterozygous for the deletion. We carried out DNA sequencing of the products using both forward and Tunisian ALS2 Kuwaiti ALS2 reverse primers. c, Sequence of the mutation (1548delAG) in the genomic DNA in the Kuwaiti family with ALS2. Sequences of the reverse strand of d exon 5 in the region of interest are shown. Individual 18279 is a normal sibling who is unaffected by ALS2 and marker 1 control 2 control 10785 10782 10789 10797 10792 10787 10772 10786 10795 10780 3 control 4 control 10784 10793 10791 10773 5 control 6 control brain 10799 10788 marker carries two normal haplotypes. A box in this sequence indicates the position of the bases deleted (red letters) in affected members. Individual 18281 is 339 bp 302 bp an unaffected parent who carries one 225 bp 195 bp disease haplotype. The overlapping 113 bp 106 bp normal and mutated sequences can be ALS2CR6 exon 3 - PCR RT-PCR clearly seen. Individual 18275 is affected; this sequence shows the Na rI Na rI homozygous CT deletion in the reverse strand of exon 5. The position of the deleted bases is indicated by the arrow. exon 3 exon 2exon 3 exon 4 The corresponding forward sequence 339 bp 302 bp and coded normal amino acids (black) normal normal and novel amino acids produced by 225 bp 113 bp 195 bp 106 bp mu tant mu tant frameshifting (red) are indicated. d, Segregation of the 261delA mutation in the Tunisian family with ALS2. ALS2CR6 exon 3 - PCR RT-PCR We assayed the presence of the deletion by digestion with NarI, which cuts only the mutant allele. On exon-PCR, the normal allele gives rise to a 339-bp fragment whereas the mutant allele gives rise to two fragments of 225 bp and 113 bp. On RT–PCR, the normal allele gives rise to a 302-bp product, whereas the mutant allele gives rise to two fragments of 195 bp and 106 bp.

a b lymph. lymph. normal brain normal lymph. normal brain normal lymph. ALS2 ALS2 brain heart skeletal muscle colon thymus spleen kidney liver small intestine placenta lung leukocytes cerebellum cerebral cortex medulla spinal cord occipital lobe lobe frontal temporal lobe putamen amygdala caudate nucleus corpus callosum hippocampus whole brain substantia nigra thalamus

6.5 kb

6.5 kb ALS2CR6 2.6 kb 2.6 kb

ALS2CR6

β-actin

Fig. 3 Northern blot analysis of ALS2 mRNA. a, We hybridized northern blots containing 2 µg of poly(A)+ mRNA from various adult human tissues with exon 4 of the ALS2 cDNA clone. The lower panel represents the same blots hybridized with the human β-actin cDNA to conﬁrm RNA quality and relative loading. Sizes of the ALS2 transcripts are shown on the left. b, Northern blots containing 10 µg of total RNA from normal whole brain and 20 µg of total RNA from lymphocytes derived from unaffected and affected (Tunisian; 10788) individuals were hybridized with exon 4 of the ALS2 cDNA clone. The right panel represents the agarose gel electrophoresis of RNA samples.

time course and severity that resemble the clinical features as two transcripts of approximately 6.5 kb and 2.6 kb in various seen in the Tunisian family. However, in the Kuwaiti family, there adult human tissues (Fig. 3a). Both transcripts show similar was no evidence of denervation, at least in the first two decades of expression patterns, except in liver, where the shorter transcript is life. Haplotype analysis in this family confirms that the ALS2 predominantly expressed. The 6.5-kb transcript is expressed at phenotype segregates perfectly with DNA markers for the 2q33 slightly higher levels than the 2.6-kb transcript and shows highest ALS2 locus between D2S116 and D2S72. The disease-associated expression in the cerebellum. We also detected expression in lym- haplotype in this ALS2 kindred differs from that in the Tunisian phocyte RNA derived from the Tunisian individual with ALS2 family with ALS2, consistent with independent origins for the (Fig. 3b). NarI-based mutation analysis indicates that the mutation (data not shown). We searched for DNA sequence vari- expressed ALS2 transcripts from affected individuals carry a ations in exons of ALS2CR6 in five members of the Kuwaiti fam- homozygous 261delA mutation, which generates a novel NarI

© http://genetics.nature.com Group 2001 Nature Publishing ily (samples 18281, 18275, 18279, 18277 and 18278), and found a cutting site (Fig. 2d). homozygous 2-bp deletion (1548delAG) in exon 5 of ALS2CR6 in 2 affected individuals (18275 and 18278). Individuals carrying Deduced protein sequence of ALS2 one disease haplotype are heterozygous for the deletion (18281 Database searches show a number of interesting domains and and 18277), whereas an unaffected individual carrying two nor- motifs in the protein sequence deduced for human ALS2. A mal haplotypes (18279) shows no deletion (Fig. 2c). The region in the amino-terminal half of ALS2 is highly homologous 1548delAG variation thus segregates perfectly with both disease to the regulator of chromosome condensation (RCC1)13 and the phenotype and haplotypes for adjacent DNA markers. This dele- retinitis pigmentosa GTPase regulator (RPGR)17, including its tion was not observed in a control group of 95 DNA samples of functional structural motif, a seven-bladed propeller (Fig. 4b)18. Arab descent, in 14 members of the Tunisian family with ALS2 or RCC1 is a GEF for the nuclear GTP-binding protein Ran (Ras- in 10 normal Caucasian control DNA samples (data not shown). related nuclear)13. A middle portion of ALS2 contains a tandem These findings suggest that the 1548AGdel is the causative muta- organization of diffuse B-cell lymphoma (Dbl) homology19 and tion underlying the disease in this Kuwaiti family with ALS2. pleckstrin homology domains19 (Fig. 4a,c) that is a hallmark of GEFs for Rho (Ras-homologous member) GTPases19. In addi- Structure and expression of ALS2 tion, a vacuolar protein sorting 9 (VPS9) domain, which is seen The gene ALS2CR6, now officially designated ALS2, comprises 33 in a number of GEFs, including Vps9 (ref. 20), Rabex-5 (ref. 21) introns and 34 exons and resides within 80.3 kb of genomic DNA and RIN1 (ref. 22), is also found in the carboxy-terminal region close to the polymorphic DNA marker D2S2309 (Fig. 1; Web (Fig. 4a; Web Fig. A).Two membrane occupation and recognition Table C). The transcriptional polarity of ALS2 is in a telomere-to- nexus (MORN) motifs23 consisting of 23 amino acids and impli- centromere direction. The sequence of the ALS2 transcript cated in binding to plasma membranes are also noted in the encompasses 6,394 nt with a single open reading frame (ORF; region between the Dbl and pleckstrin homology domains and 4,974-nt long, nt 124–5,097), and is predicted to encode a 184- the VPS9 domain (Fig. 4a; Web Fig. A). kD protein consisting of 1,657 amino acids. Putative polyadeny- lation signals (AATAAA; 6,375–6,380 nt) and a poly(A) tail are The mouse ortholog evident. Part of the ALS2 sequence overlaps with that of the We isolated the mouse ortholog of ALS2, designated Als2. KIAA1563 cDNA clone16. We also identified a shorter transcript Sequence analysis of Als2 shows that it encompasses 6,349 for ALS2 that encompasses 2,651 nt with a single 1,191-nt ORF nucleotides, with a single ORF that is 4,956 nucleotides long encoding 396 amino acids. This short variant was produced by (124–5,079 nt) and is predicted to encode a 183-kD protein con- alternate splicing at the 5′ donor site after exon 4, resulting in a sisting of 1,651 amino acids. The entire ORF is well conserved premature stop codon after 25 amino acid residues in intron 4. between human and mouse (87% identity at DNA level; data not Consistent with these results, we identified by northern blotting shown). Two transcripts with sizes similar to those in humans

were detected by northern blot analy- a RCC1 MORN motifs sis (data not shown). Deduced protein DH PH I II VPS9 sequences for mouse Als2 and human normal (long form) 1 55263339 457 507 651 695 879 929 1007 1100 1554 1657 1049 1121 1646 ALS2 are conserved (91% identity, unique 25 residues 1071 94% similarity; Web Fig. B). To study normal (short form)

the regional expression of the Als2 1 396 transcript in mouse brain and spinal unique 3 residues cord, we used in situ hybridization ALS2 (Tunisia) with riboprobes directed against a 149 portion of the Als2 cDNA. The Als2 unique 70 residues transcript is expressed to a variable ALS2 (Kuwait) 1 545 degree in neuronal cells throughout the brain and spinal cord, particulary in hippocampus and dentate gyrus b hALS2 CR6_ RCC1 1 M D S K K R S S T E A E G S K E R G L V H I W Q A G S F P I T P E R L P G W G G K T V L Q A A L G V K H G V L L T E D G E V Y S F G T L P W R S G P V E I C P S mAl s 2 c r 6_ RCC1 1 M D S K K K S S T E A E G S K E R G L V H V W Q A G S F S L T P E R L P G W G G K T V L Q A A L G V R H G V L L T E D G E V Y S F G T L P W K S E S A E I C P S neurons, cerebellar Purkinje cells, hRCC1 1 ------M S P K R I A K R ------R S P P A D A I P K hRPGR 1 ------M R E P E E L M P D S G A V F T F G - - - - K S K F A E N N P G cerebral cortex neurons and spinal mRPGR 1 ------M P R G S R W G S Q G V G Q H L R L N R V A P A I F P K Q A Q I P F A G F G M A E S E S L V P D T G A V F T F G - - - - K T K F A E N I P S blade 1 hALS2 CR6_ RCC1 8 1 S P I L E N A L V G Q Y V I T V A T G S F H S G A V T D N G V A Y M W G E N S A G Q C A V A N Q Q Y V P E P N P V S I A D S E A S P L L A V R I L Q L A C G E E gray matter, including anterior horn mAl s 2 c r 6_ RCC1 8 1 S P L L E S A L V G H H V I T V A T G S F H S G A V T E S G V V Y M W G E N A A G Q C A V A N Q Q Y V P E P S P V S I S D S E T S P S L A V R I L Q L A C G E E hRCC1 20 S K K V K ------V S H R S H S T E P G L V L T L G Q G D V G Q L G L G - E N V M E R K K P A L V S I P E D ------V V Q A E A G G M hRPGR 29 K F W F K N D V P - - - - V H L S C G D E H S A V V T G N N K L Y M F G S N N W G Q L G L G S K S A I S K P T C V K A L K P E K ------V K L A A C G R N cells (Fig. 5). Prominent expression is mRPGR 67 K F W F K N D I P - - - - I C L S C G D E H T A I V T G N N K L Y M F G S N N W G Q L G L G S K A A I I K P T C I K A L K P E K ------V K L A A C G R N also seen in neurons in the olfactory blade 2 hALS2 CR6_ RCC1 1 6 1 H T L A L S I S R E I W A W G T G C Q L G L I T T A F P V T K P Q K V E H L A G R V V L Q V A C G A F H S L A L V Q C L P S Q D L K P V P E R C N Q C S Q L L I mAl s 2 c r 6_ RCC1 1 6 1 H T L A L S L S R E I W A W G T G C Q L G L I T T T F P V T K P Q K V E H L A G R V V L Q V A C G A F H S L A L V Q C L P P Q D L K P V P E R C N Q C S Q L L I bulb, basal ganglia and cranial nuclei hRCC1 78 H T V C L S K S G Q V Y S F G C N D E G - - - - A L G R D T S V E G S E M V P G K V E L Q E K V V Q V S A G D S H T A A L T D D G R V F L W G S F R D N N G V I hRPGR 98 H T L V S T E G G N V Y A T G G N N E G - - - Q L G L G D T E E R N T F H V I S F F T S E H K I K Q L S A G S N T S A A L T E D G R L F M W G D N S E G Q I G L (data not shown). mRPGR 136 H T L V S T D T G G V Y A A G G N N E G - - - Q L G L G D T D D R D T F H Q I V F F T P A D T I K Q L S A G A N T S A A L T E D G K L F M W G D N S E G Q I G L blade 3 hALS2 CR6_ RCC1 2 4 1 T M T D K E D H V I I S D S H C C P L G V T L T E S Q A E N H A S T A L S P S T E T L D R Q E E V F E N T L V A N D Q S V A T E L N A V S A Q I T S S D A M S S mAl s 2 c r 6_ RCC1 2 4 1 T M T D K E D H V I I S D S H C C P L G V T L S E S Q A E K H A S P A P S P H P E A L D E Q G E V F E N ------T V V E A E L N M G S S Q T T S G S A I S T hRCC1 154 G L L E P ------M K K S M V P V Q V Q L D ------hRPGR 175 K N V S N ------V C V P Q Q V T I G ------Discussion mRPGR 213 E D K S N ------V C I P H E V T V G ------blade 4 ALS2 is a recessive form of juvenile hALS2 CR6_ RCC1 3 2 1 Q Q N V M G T T E I S S A R N I P S Y P D T Q A V N E Y L R K L S D H S V R E D S E H G E K P M P S Q P L L E E A I P N L H S P P - T T S T S A L N S L V V S C 6,10 mAl s 2 c r 6_ RCC1 3 1 5 Q Q N I V G T A E V S S A R T A P S Y P D T H A V T A Y L Q K L S E H S M R E N H E P G E K P P Q V Q P L V E E A V P D L H S P P - T T S T S A L N S L V V S C ALS and is heralded by symptoms hRCC1 172 ------V P V V K V A S G N D H L V M L T A D G D L Y T L G C G E Q G Q L G R V P E L F A N R G G R Q G L E R L L V P K C V M L K S hRPGR 190 ------K P V S W I S C G Y Y H S A F V T T D G E L Y V F G E P E N G K L G L P N Q L L G N H R T P Q - L V S E I P E K V I Q V A C in the ﬁrst or second decade of life mRPGR 228 ------K P I S W I S C G Y Y H S A F V T M D G E L Y T F G E P E N G K L G L P N E L L M N H R S P Q - R V L G I P E R V I Q V A C blade 5 hALS2 CR6_ RCC1 4 0 0 A S A V G V R V A A T Y E A G A L S L K K V M N F Y S T T P C E T G A Q A G S S A I G P E G L K D S R E E Q V K Q E S M Q G K K S S S L V D I R E E E T E G G S with progressive spasticity of the mAl s 2 c r 6_ RCC1 3 9 4 A S A V G V R V A A T Y E A G A L S L K K V M N F Y S T A P C E T A A Q S G S A S T G P E S L K D L R E E Q V K Q E S L Q G K K S S S L M D I R E E E S E G G S hRCC1 234 R G S R G H V R F Q D A F C G A Y F T F A I S H E G H V Y G F G L S N Y H Q L G T P G T E S C F I P Q N L T S F K N ------hRPGR 251 G ------G E H T V V L T E N A V Y T F G L G Q F G Q L G L G T F L F E T S E P K V I E N I R D Q ------limbs and of the facial and pharyngeal mRPGR 289 G ------G G H T V V L T E K V V Y A F G L G Q F G Q L G L G T F L F E T S E P K I I E R I K D Q ------10,15 blade 6 muscles . Here we report the iden- hALS2 CR6_ RCC1 4 8 0 R R L S L P G L L S Q V S P R L L R K A A R V K T R T V V L T P T Y S G E A D A L L P S L R T E V W T W G K G K E G Q L G H G - - D V L P R L Q P L C V K C L D mAl s 2 c r 6_ RCC1 4 7 4 R R L S L P G L L S Q V S P R L L R K A A R V K T R T V V L T P T Y S G E A D A L L P S L R T E V W T W G K G K E G Q L G H G - - D V L P R L Q P L C V K C L D hRCC1 292 ------S T K S W V G F S G G Q H H T V C M D S E G K A Y S L G R A E Y G R L G L G - E G A E E K S I P T L I S R L P tiﬁcation of two independent muta- hRPGR 296 ------T I S Y I S C G E N H T A L I T D I G L M Y T F G D G R H G K L G L G L E N F T N H F I P T L C S N F L mRPGR 334 ------K I C H I S C G E N H T A L M T E L G L L Y T F G D G R H G K L G L G M E N F T N Q F F P T L C S N F L tions in the same gene, ALS2, in blade 7 hALS2 CR6_ RCC1 5 5 8 G K E V I H L E A G G Y H S L A L T A K S Q V Y S W G S N T F G Q L G H S D F P T T V P R L A K I S S E N G V W S I A A G R D Y S L F L V D T E D F Q P G L Y Y mAl s 2 c r 6_ RCC1 5 5 2 G K E V I H L E A G G S H S L A L T A K S Q V Y S W G S N T F G Q L G H S E F P T T V P R L S K V S S E N G V W S V A A G Q D Y S L F L V D T E D F Q P G L Y Y hRCC1 346 - - A V S S V A C G A S V G Y A V T K D G R V F A W G M G T N Y Q L G T G Q D E D A W S P V E M M G K Q L E N R V V L S V S S G G Q H T V L L V K D K E Q S - - hRPGR 348 R F I V K L V A C G G C H M V V F A A P H R G V A K E I E F D E I N D T C L S V A T F L P Y S S L T S G N V L Q R T L S A R M R R R E R E R S P D S F S M R R T mRPGR 386 R F A V Q L I A C G G C H M L V F A T P R L G T I D E P K F E D V Y E P Y I S T G - S F S I N D L S P R S S L N R S L S A R L R R R E R E R P P C S A S M V G T Fig. 4 Amino-acid sequence analysis. hALS2 CR6_ RCC1 6 3 8 S G R Q D P T E G D N L P E N H S G S - a, Schematic representation of the domains mAl s 2 c r 6_ RCC1 6 3 2 S G R Q D R A E G D T L P E N P S G T - hRCC1 ------

© http://genetics.nature.com Group 2001 Nature Publishing and motifs identified in the predicted nor- hRPGR 428 L P P I E G T L G L S A C F L P N S V - mRPGR 465 L P P L E G T S A S T S A Y F Y P S S P mal and mutated ALS2 proteins. Positions of unique 25 amino acid residues found in the short form of ALS2 (starting from residue c 372), 3 amino acid residues predicted from hALS2 CR6_ DH/ PH 695 ...... L H E L A T T E R R F Y S K L S D I K S Q I L R P L L S L E N L G T T T T V Q L L Q E V A S R F S K L C Y L I G Q H G A S L S S F L H G V K E A R the Tunisian mutation (starting from residue mA l s 2 c r 6 _ D H / PH 689 ...... L H E L A S T E R R F Y S K L S E I K S Q I L R P L L S L E N L G T V T T V Q L L Q E V A S R F S K L C Y L I G Q H G A S L S S Y L Q G M K E A S hTrioI 1237 ...... I M A E L I Q T E K A Y V R D L R E C M D T Y L W E M T S G . . . V E E I P P G I V N K E L I I F G N M Q E I Y E F H N N I F L K E L E K Y E Q L P 47) and 70 amino acid residues predicted rKalirin 1278 ...... I M A E L L Q T E K A Y V R D L H E C L E T Y L W E M T S G . . . V E E I P P G I L N K E H I I F G N I Q E I Y D F H N N I F L K E L E K Y E Q L P hDbl 499 ...... V L N E L I Q T E R V Y V R E L Y T V L L G Y R A E M D N P E . M F D L M P P L L R N K K D I L F G N M A E I Y E F H N D I F L S S L E N C A H A P hTrioII 1914 ...... V L Q E L V E T E R D Y V R D L G Y V V E G Y M A L M K E D . . . . . G V P D D M K G K D K I V F G N I H Q I Y D W H R D F F L G E L E K C L E D P from the Kuwaiti mutation (starting from hFgd1 377 ...... I A N E L L Q T E K A Y V S R L H L L D Q V F C A R L L E E A R N R S S F P A D V V H G . . . I F S N I C S I Y C F H Q Q F L L P E L E K R M E E W hVav 198 ...... C L R E I Q Q T E E K Y T D T L G S I Q Q H F L K P L Q R F ...... L K P Q D I E I I F I N I E D L L R V H T H F L K E M K E A L G T P G residue 476) are shown. RCC1, regulator of hSH3P17 1242 ...... I H E L I V T E E N Y V N D L Q L V T E I F Q K P L M E S ...... E L L T E K E V A M I F V N W K E L I M C N I K L L K A L R V R K K M S G mTiam1 1044 ...... V I C E L L E T E R T Y V K D L N C L M E R Y L K P L Q K E T ...... F L T Q D E L D V L F G N L T E M V E F Q V E F L K T L E D G V R L V P chromosome condensation; DH, Dbl homol- hSos1 198 E Q T Y Y D L V K A F X A E I R Q Y I R E L N L I I K V F R E P F V S N S ...... K L F S A N D V E N I F S R I V D I H E L S V K L L G H I E D T V E X T D ogy domain; PH, pleckstrin homology hALS2 CR6_ DH/ PH 768 S ...... L V I L K H S S . . L F L D S Y . . . . T E Y C T S I T N F L V M G G F Q L L A K P A I D F L N K N Q E . . . . . L L Q D L S E domain; MORN, membrane occupation and mA l s 2 c r 6 _ D H / PH 762 S ...... L V I M K H S S . . L F L D S Y . . . . T E Y C T S V S N F L V M G G F Q L L A K P A I D F L N K N Q E . . . . . L L Q D L S E h T r i o I 1308 E ...... D V G H C F V T W A D K F Q M Y . . . . V T Y C K N K P . D S T Q L I L E H A G . S Y F D E I Q Q R H G . . . . . L A N S I S S recognition nexus; VPS9, vacuolar protein r K a l i r i n 1349 E ...... D V G H C F V T W A D K F Q M Y . . . . V T Y C K N K P . D S N Q L I L E H A G . T F F D E I Q Q R H G . . . . . L A N S I S S hDbl 572 E ...... R V G P C F L E R K D D F Q M Y . . . . A K Y C Q N K P . R S E T I W R K Y S E C A F F Q E C Q R K L K . . . . . H R L R L D S sorting 9 domain. b, Multiple amino h T r i o I I 1983 E ...... K L G S L F V K H E R R L H M Y . . . . I A Y C Q N K P . K S E H I V S E Y I D . T F F E D L K Q R L G . . . . . H R L Q L T D hFgd1 448 D R Y . . P ...... R I G D I L Q K L A P F L K M Y . . . . G E Y V K N F D R A V E L V N T W T E R S T Q F K V I I H E V Q K E E A C G N L T L Q H acid–sequence alignment of the RCC1-repeat hVav 263 A A N ...... L Y Q V F I K Y K E R F L V Y . . . . G R Y C S Q V E S A S K H L D R V A A A R E D V Q M K L E E C S Q R A N N G R F T L R D h S H3 P 1 7 1308 E K M P V K ...... M I G D I L S A Q L P H M Q P Y . . . . I R F C S R Q L N G A A L I Q Q K T D E A P D F K E F V K R L E M D P R C K G M P L S S containing regions of human ALS2, mT i a m1 1111 D L E K L E K V D Q F K K V L F S L G G S F L Y Y A D R F K L Y . . . . S A F C A S H T K V P K V L V K A K T D T A F K A F L D A Q N P R Q Q . . H S S T L E S hSos1 272 E G S P H P ...... L V G S C F E D L A E E L A F D P Y E S Y A R D I L R P G F H D R F L S Q L S K P G A A L Y L Q S I G E G F K E A V Q Y V L P R hALS2_RCC1; mouse Als2, mAls2_RCC1; human RCC1, hRCC1, ref;NP_001260; human hALS2 CR6_ DH/ PH 822 V N D E N T Q L M E I L N T L F F L P I R R L H N Y A K V L L K L A T C F E V A S P E Y Q K L Q D S S S C Y E C L . . . A L H L G R K R K E A E Y T L G F W K T mA l s 2 c r 6 _ D H / PH 816 V N D E N T Q L M E I L N M L F F L P I R R L H N Y A K V L L K L A T C F E V T S P E Y Q K L Q D S S S C Y E S L . . . A L H L G K K R K E A E Y T L S F W K T RPGR, hRPGR, ref;NP_03415; and mouse h T r i o I 1362 Y L I K P V Q R I T K Y Q L L L K E L L T C C E . . . E G K G E I K D G L E V M L S V P K R A N D A M H L S M L E . . . G F D E N I E S Q G E L I L Q E S F Q V r K a l i r i n 1403 Y L I K P V Q R V T K Y Q L L L K E L L T C C E . . . E G K G E L K D G L E V M L S V P K K A N D A M H V S M L E . . . G F D E N L D V Q G E L I L Q D A F Q V hDbl 627 Y L L K P V Q R I T K Y Q L L L K E L L K Y S K D C . E G S A L L K K A L D A M L D L L K S V N D S M H Q I A I N . . . G Y I G N L N E L G K M I M Q G G F S V Rpgr, mRPGR, ref;NP_000319. The alignment h T r i o I I 2037 L L I K P V Q R I M K Y Q L L L K D F L K Y S K K A S L D T S E L E R A V E V M C I V P R R C N D M M N V G R L Q . . . G F D G K I V A Q G K L L L Q D T F L V hFgd1 512 H M L E P V Q R I P R Y E L L L K D Y L L K L P H G S P D S K D A Q K S L E L I A T A A E H S N A A I R K M E R M . . . H K L L K V Y E L L G G E E D I V S P T is shown with the black and gray shadings hVav 325 L L M V P M Q R V L K Y H L L L Q E L V K H T Q E A M E K E N . L R L A L D A M R D L A Q C V N E V K R D N E T L . . . R Q I T N F Q L S I E N L D Q S L A H Y h S H3 P 1 7 1374 F I L K P M Q R V T R Y P L I I K N I L E N T P E N H P D H S H L K H A L E K A E E L C S Q V N E G V R E K E N S . . . D R L E W I Q A H V Q C E G L S E Q L V representing identical and conserved amino mT i a m1 1185 Y L I K P I Q R V L K Y P L L L R E L F A L T D A E S E E H Y H L D V A I K T M N K V A S H I N E M Q K I H E E F G A V F D Q L I A E Q T G E K K E V A D L S M acids, respectively. Position of each blade in hSos1 342 L L L A P V Y H C L H Y F E L L K Q L E E K S E D Q E D K E C L K Q A I T A L L N V Q S G X E K I C S K S L A K R R L S E S A C R F Y S Q Q X K G K Q L A I K K

a seven-bladed propeller for RCC1 was hALS2 CR6_ DH/ PH 899 F P G K M ...... T D S L R K P E R R L L C E S S N R A L S L Q H A G R F S V N W F I L F N D A L V H A Q ...... F S T H H mA l s 2 c r 6 _ D H / PH 893 F P G K M ...... T D S L R K P E R R L L C E S S N R A L S L Q H A G R F S V N W F I L F N D A L V H A Q ...... F S T H H drawn on top of the alignment according to h T r i o I 1436 W D ...... P K T L I R K G R E R H L F L F E M S L V F S K E V K D S S G R S K ...... Y L Y K S 18 r K a l i r i n 1477 W D ...... P K S L I R K G R E R H L F L F E I S L V F S K E I K D S S G H T K ...... Y V Y K N previous data . Sequences are numbered hDbl 703 W I G H K ...... K G A T K M K D L A R F K P M Q R H L F L Y E K A I V F C K R R V E S G E G S D R Y P S ...... Y S F K H h T r i o I I 2114 T D ...... Q D A G L L P R C R E R R I F L F E Q I V I F S E P L D K K K G F S M P G ...... F L F K N with the initiation codon (M) of each protein hFgd1 589 K E L I K ...... E G H I L K L S A K N G T T Q D R Y L I L F N D R L L Y C V P R L R L L G Q K F S ...... V R A hVav 401 G R P K I ...... D G E L K I T S V E R R S K M D R Y A F L L D K A L L I C K R R G D S Y D L K D ...... F V N L H as no. 1. c, Multiple amino acid–sequence h S H3 P 1 7 1451 F N S V T N C L G ...... P R K F L H S G K L Y K A K N N K E L Y G F L F N D F L L L T Q I T K P L G S S G T D K V ...... F S P K S mT i a m1 1265 G D L L L H T S V ...... I W L N P P A S L G K W K K E P E L A A F V F K T A V V L V Y K D G S K Q K K K L V G S H R L S I Y E E W D P F R F R H alignment of DH-PH domains for: human hSos1 422 X N E I Q K N I D G W E G K D I G Q C C N E F I X E G T L T R V G A K H E R H I F L F D G L X I C C K S N H G Q P R L P G A S N ...... A E Y R L K E ALS2, hALS2CR6_DH/PH; mouse Als2cr6, hALS2 CR6_ DH/ PH 953 V F P L A T L W A E P L S E E A G G V N G L K I T T P ...... E E Q F T L I S S T P Q E K T K W L R A I S Q A V D Q A . . . mAls2cr6_DH/PH; the first DH-PH domain of mA l s 2 c r 6 _ D H / PH 947 V F P L A T L W A E P L S E E A G S V N G L K I T T P ...... E E Q F T L I S S T P Q E K T K W L R A I S Q A V D Q A . . . h T r i o I 1477 K L F T S E L G V T E H V E G D P C K F A L W V G R T P ...... T S D N K I V L K A S S I E N K Q D W I K H I R E V I Q E . . . . r K a l i r i n 1518 K L L T S E L G V T E H V E G D P C K F A L W S G R T P ...... S S D N K T V L K A S N I E T K Q E W I K N I R E V I Q E . . . . human Trio, TrioI, sp;O75962; Rat kalirin, hDbl 757 C W K M D E V G I T E Y V K G D N R K F E I W Y G E K ...... E E V Y I V Q A S N V D V K M T W L K E I R N I L L K Q . . . h T r i o I I 2158 S I K V S C L C L E E N V E N D P C K F A L T . S R T G ...... D V V E T F I L H S S S P S V R Q T W I H E I N Q I ...... rKalirin, sp;P97924; human Dbl, hDbl, hFgd1 638 R I D V D G M E L K E S S N L N L P R T F L V S G K Q ...... R S L E L Q A R T E E E K K D W V Q A I N S ...... hVav 451 S F Q V R D D S S G D R D N K K W S H M F L L I E D Q G ...... A Q G Y E L F F K T R E L K K K W M E Q F E M A I S . . . . . sp;P10911; the second DH-PH domain of h S H3 P 1 7 1510 N L Q Y K M Y K T P I F L N E V L V K L P T D P S G D E P I F H I S H I D R V Y T L R A E S I N E R T A W V Q K I K A A S ...... mT i a m1 1334 M I P T E A L Q V R A L P S A D A E A N A V C E I V H V K S E S E G R P E R V F H L C C S S P E S R K D F L K S V H S I L R D . . . . human Trio, hTrioII, sp;O75962; human hSos1 493 K F F X R K V Q I N D K D D T N E Y K H A F E I I L K D ...... E N S V I F S A K S A E E K N N W X A A L I S L Q Y R S T L E FGD1, hFgd1, sp;P98174; human Vav, hVav, sp;P15498; human SH3P17, hSH3P17, ref;NP_003015; mouse Tiam1, mTiam1, sp;Q60610; and human Sos1, hSos1, pdb;1DBH. Red and blue bars on top of the alignment represent regions corresponding to DH and PH domains, respectively. The alignment is shown with the black and gray shadings representing identical and conserved amino acids, respectively. Sequences are numbered with the initiation codon of each protein as no. 1.

Fig. 5 Expression of Als2 mRNA in adult mouse brain and spinal cord. a,b, Sagittal a antisenseb sense macro images of RNA/RNA in situ hybridization with antisense Als2 riboprobe (a) and with sense-strand probe as a control (b). A deﬁnite signal in the brain is demonstrated including olfactory bulb, cerebral cortex, basal ganglia, cranial-nerve nuclei and cerebellum. c,g, Neurons in hippocampus and dentate gyrus. d,h, Purkinje cells in cerebellum. e,i, Neurons in cerebral cortex. f,j, Neurons in spinal gray matter including c d e f anterior horn cells are represented in a marked expression. Each scale bar repre- µ sents 10 m in length. antisense

unrelated families with ALS2. These g h i j deletion mutations result in frameshifts that generate premature sense stop codons. ALS2 is expressed in various tissues and cells, including neurons throughout the brain and spinal cord, and encodes a protein hippocampus cerebellum cortex spinal cord containing multiple domains that have homology to RanGEF as well as RhoGEF. Deletion mutations are predicted to cause a loss of termination codons and code for nonfunctional or even harmful protein function, providing strong evidence that ALS2 is the proteins are subject to nonsense-mediated mRNA decay (NMD), causative gene underlying ALS2. a conserved surveillance mechanism allowing the identiﬁcation The protein sequence deduced for human ALS2 shows a num- and elimination of imperfect mRNAs30. It is therefore possible ber of interesting features relating to GEFs (Fig. 4a,c; Web Fig. A). that the mutated ALS2 mRNA could be degraded by NMD and First, the amino-terminal half of ALS2 contains a region that is does not serve as mRNA templates for protein translation. Based highly homologous to RCC1 (ref. 13) and RPGR (ref. 17), on our RT–PCR and northern blot analyses, however, the including its functional structural motif, a seven-bladed pro- mutated ALS2 transcript is indeed present in lymphocytes from peller (Fig. 4b)18. RCC1 acts as a GEF for Ran, an abundant small an affected member of the Tunisian family (Figs. 2d,3b), suggest- GTPase, and is implicated in nuclear transfer as well as chro- ing that truncated ALS2 can be produced from mutated tran- matin condensation through the regulation of microtuble assem- scripts (Fig. 4a). Given that these truncated proteins do not 24

© http://genetics.nature.com Group 2001 Nature Publishing bly . Although the RCC1 homologous domain in ALS2 is contain any of the putative functional domains of ALS2 in com- interrupted by two intervening sequences, the blade sequences plete form, the mutations are likely to be deleterious and cause a are not disrupted (Fig. 4b). Thus, ALS2 could function as a GEF loss of function. Further, the predicted protein (58.3 kD) from for Ran or Ran-related GTPases. Second, ALS2 contains Db1 and the Kuwaiti ALS2 family, which is longer than that of a short form pleckstrin homology domains (Fig. 4c)19. A tandem organization of the normal ALS2 protein, encodes only an incomplete RCC1 of Db1–pleckstrin homology domains is a hallmark of Rho motif (Fig. 4a), indicating that the loss of function for the full- GEFs19, which play important roles in various signaling cas- length ALS2CR6 might be associated with the ALS2 phenotype. cades25, neuronal morphogenesis26, membrane transport or traf- These findings also suggest that a short form of ALS2 encoding ficking27,28 and organization of the actin cytoskeleton14,29. In nearly half of the RCC1 motif could be inactive or a functional addition, a VPS9 domain is found in the carboxy-terminal modifier for the full-length ALS2. region. The VPS9 domain is seen in a number of GEFs, including Recent findings that ALS is associated with defects in axonal Vps9 (ref. 20), Rabex-5 (ref. 21) and RIN1 (ref. 22), and is known transport and cytoskeletal organization31,32 support the hypoth- to mediate vacuolar protein sorting and endocytic trafficking. esis that ALS2 causes ALS2, with defects in microtubule assembly, Two MORN motifs23 consisting of 23 amino acids are also noted membrane organization and trafficking possibly resulting from in the ALS2 protein (Web Fig. A). A recent study on junctophilins the loss of modulatory function in Ran/Rho-related GTPases. that contain MORN motifs shows that this motif contributes to Determination of the function of this new protein in vitro and in the binding to plasma membranes23. GEFs are known to associ- vivo is required to elucidate both the molecular pathogenesis of ate with GDP-bound forms of GTPases and accelerate GDP dis- ALS2 and the reason for the selective degeneration of motor neu- sociation and GTP binding, thereby activating the GTPases. rons. Identification of a mouse ortholog of ALS2 in this study is Taking this information together, it is possible that ALS2 acts as a the first step towards the creation of in vivo model of ALS2. In regulator/activator of particular GTPases and modulates the addition, isolation of specific upstream regulators and down- microtuble assembly, membrane organization and trafficking in stream effectors for ALS2 will help unravel both the normal mol- cells, including neurons. ecular cascades and the defective one that causes ALS2. The 261delA mutation (Tunisian ALS2) in codon 46 causes To our knowledge, ALS2 is only the second FALS gene identi- disruption of the reading frame and is predicted to generate a fied, the first being the copper-zinc superoxide dismutase truncated protein (5.4 kD), which consists of 49 amino acid (SOD1) gene in ALS. SOD1 mutations are responsible for an residues with 3 new residues at the carboxy terminus (Fig. 4a; autosomal dominant form with late onset (ALS1)3. The identifi- Web Fig. B). The 1548delAG mutation (Kuwaiti ALS2) in codon cation of ALS2 has both clinical and biochemical implications. 475 also results in a frameshift that generates 70 new amino acids The characterization of a putative GTPase regulator in ALS will before a premature stop codon (Fig. 4a; Web Fig. B). Recent stud- provide new avenues to explore the molecular pathogenesis not ies suggest that transcripts that contain premature translation only of ALS2 but also of other FALS3–5,8,9 and of SALS.

Methods In situ hybridization of RNA. We prepared antisense and sense cRNA Families with ALS2. We analyzed 16 members of the Tunisian consan- probes from two mouse cDNA clones, m2-as and m2-s, that carried the guineous family with ALS210 and 7 members of the Kuwaiti family with portion of mouse Als2cr6 cDNA (1,732–2,685 nt; 954 bp) in pCR2.1 vector ALS215 (originally diagnosed as having primary lateral sclerosis)15. ALS2 is (Invitrogen) with opposite orientations, in an in vitro transcription reac- characterized by a progressive spasticity of limb and facial muscles accom- tion incorporating digoxigenin-labeled UTP with T7 RNA polymerase panying distal amyotrophy of hands and feet. The age of onset of symp- according to the manufacturer’s protocol (Roche). Methods for sample toms is 3–10 y10. Analysis of the genotypes in the polymorphic DNA mark- preparations and in situ hybridization are described elsewhere34. ers in conjunction with the clinical data clearly indicates that ALS2 is an autosomal recessive disease, and its genetic locus has been mapped to chro- Database searches. We compared DNA and amino acid sequences with mosome 2q33 (refs. 6,7). non-redundant nucleotide and protein sequence databases using BLASTN and BLASTP, respectively33. We identified protein motifs and domains Transcript map. To identify the transcribed DNA sequences mapped with- using the MOTIF server at GenomeNet Japan (http://www.genome.ad.jp), in the candidate region, we searched the public databases in Genome Data BCM search launcher (http://searchlauncher.bcm.tmc.edu) and CD- Base (http://gdbwww.gdb.org) and UniGene at The National Center for Search at NCBI (http://www.ncbi.nlm.nih.gov). We carried out the multi- Biotechnology Information (http://www.ncbi.nlm.nih.gov). Genomic ple protein sequence alignment using ClustalW 1.80 DNA sequences overlapping the ALS2 candidate interval were retrieved (http://www.genome.ad.jp) and displayed it using BOXSHADE from the ‘nr’ or ‘htgs’ database at GenBank, and were used as queries for (http://www.ch.embnet.org/software/BOX_form.html). BLAST search33 against the dbEST. We also used RT–PCR, 5′-RACE and cDNA library screening to isolate the full-length transcripts. We sequenced Genbank/EMBL/DDBJ accession numbers. ALS2CR4, AB053301; purchased EST clones (Research Genetics) to determine their entire insert ALS2CR5/MPP4 variant (long), AB053302; ALS2CR5/MPP4 variant sequences. We sequenced double-stranded DNA by dideoxy sequencing (short), AB053303; ALS2CR5/MPP4 alternative form, AB053304; ALS2 using the BigDyeTerminator Cycle Sequencing kit (ABI) and the ABI377 (ALS2CR6; long form), AB053305; ALS2 (ALS2CR6; short form), DNA sequencer. We aligned DNA sequences obtained from EST data, PCR AB053306; Als2cr6 (mouse ortholog), AB053307; ALS2CR7, AB053308; products and cDNA clones, and established putative nonoverlapping tran- ALS2CR8 (long form), AB053309; ALS2CR8 (short form), AB053310; scriptional units. We then mapped each unit onto the physical map using a ALS2CR9, AB053311; ALS2CR10, AB053312; ALS2CR11, AB053313; PCR-based method. ALS2CR12, AB053314; ALS2CR13, AB053315; ALS2CR14, AB053316; ALS2CR15, AB053317; ALS2CR16, AB053318; ALS2CR17, AB053319; Exon identification. To define the intron/exon organizations of the tran- ALS2CR18, AB053320; ALS2CR19, AB053321. scribed sequences, we compared the cDNA sequences with the genomic DNA sequence data published in the GenBank database using BLAST33 and Sequencher Version 3.0 (Gene Codes) as previously described11,12. Note: supplementary information is available on the Nature Genetics web site (http://genetics.nature.com/supplementary_info/). PCR. We carried out PCR amplification of the region containing both exons and intron-exon boundaries (exon-PCR) in candidate genes. Acknowledgments Genomic DNA (50 ng) was subjected to PCR amplification using ExTaq We thank the patients and other members of the ALS2 families for participating polymerase (Takara) and 35 cycles of 15 s at 95 °C, 30 s at 60 °C and 30 s at in this study; A.E. MacKenzie, R.G. Korneluk, I. Kanazawa, J.-C. Barbot and 72 °C. To detect the aberrant forms of transcripts, we carried out RT–PCR J.-C. Kaplan for providing control DNA samples; D. Rochefort for technical on total RNA from lymphocytes of four affected invididuals and two carri-

© http://genetics.nature.com Group 2001 Nature Publishing support; and all the members of our laboratories for helpful discussion and ers in the family with ALS2 using the SuperScript preamplification system suggestions. This work was funded by the Japan Science and Technology (Invitrogen) according to the supplier’s recommendations. We purchased Corporation, the Canadian Genetic Diseases Network, the Centre for total RNA extracted from normal human brain from Clontech for control Molecular Medicine and Therapeutics, the Nakabayashi Trust For ALS RT–PCR. We designed oligonucleotide primers for these PCR reactions Research, the Japan Brain Foundation, the Grant-in-Aid for Scientific Research using Primer 3.0 (http://www-genome.wi.mit.edu). Priority Areas for the Ministry of Education, Science, Sports, and Culture (Japan), the Canadian Institute for Health Research, the Muscular Dystrophy Mutational analysis. To detect DNA sequence variations in exons or at Association (USA), the Amyotrophic Lateral Sclerosis Association, the National intron-exon boundaries, we carried out DNA sequencing of the exon-PCR Institute for Neurological Disease (USA), National Institute for Aging (USA), products. We compared DNA sequences obtained from affected patients, Angel Fund for ALS Research (Boston, USA), Project ALS (New York, USA), carriers and normal individuals in conjunction with the sequence data in Pierre L. DeBourgknecht ALS Research Foundation and Al-Athel ALS public databases, and identified the nucleotide variations. Foundation. M.R.H. is a holder of a Canada Research Chair. G.A.R. is We carried out genotyping for the 261delA variant that creates a new supported by the Canadian Institute of Health Research. S.W.S. is a Scholar of NarI site in ALS2 by PCR amplification of exon 3 or RT–PCR amplification the Medical Research Council of Canada. J.-E.I. is a scientific director of of exons 2–4, followed by restriction digestion with NarI. Forward and NeuroGenes/International Cooperative Research Project/Japan Science and reverse primers for exon 3 PCR are 5´–CCTAGTCATCCATGTGCTGG–3´ Technology Corporation. and 5´–TCCCATACCTGACCTTCCAC–3´, respectively. Forward and reverse primers for exon 2–4 RT–PCR are 5´–CTTGATAGACTTTCTG Received 5 June; accepted 9 July 2001. TAAAGAAG–3´ and 5´–GGCTACTTGGACAAATCTCCACTG–3´, respectively. We separated the NarI-digested products on 1.5% agarose gels. 1. Siddique, T., Nijhawan, D.& Hentati, A. Molecular genetic basis of familial ALS. Neurology 47, S27–S35 (1996). We carried out genotyping for the 1548delAG variant using a DHPLC 2. Siddique, T. et al. Linkage of a gene causing familial amyotrophic lateral sclerosis WAVE system (Transgenomics). We sequenced samples that displayed abnor- to chromosome 21 and evidence of genetic-locus heterogeneity. N. Engl. J. Med. mal retention times in both directions using a Thermosequenase 33P cycle 324, 1381–1384 (1991). 3. Rosen, D.R. et al. Mutations in Cu/Zn superoxide dismutase gene are associated sequencing kit (United States Biochemical). We resolved sequences on 6% with familial amyotrophic lateral sclerosis. Nature 362, 59–62 (1993). polyacrylamide gels and read them after exposure to autoradiography film. 4. Chance, P.F. et al. Linkage of the gene for an autosomal dominant form of juvenile amyotrophic lateral sclerosis to chromosome 9q34. Am. J. Hum. Genet. 62, 633–640 (1998). Northern blot analysis. We separated 10 µg of total RNA extracted from 5. Blair, I.P. et al. A gene for autosomal dominant juvenile amyotrophic lateral normal brain and 20 µg of those from lymphocytes of affected and unaf- sclerosis (ALS4) localizes to a 500-kb interval on chromosome 9q34. Neurogenetics 3, 1–6 (2000). fected individuals and blotted it onto the nylon membrane. We then 6. Hentati, A. et al. Linkage of recessive familial amyotrophic lateral sclerosis to hybridized several human adult tissue northern blots (Clontech) and the chromosome 2q33–q35. Nature Genet. 7, 425–428 (1994). total RNA blot with [32P]dCTP-labeled exon 4 of ALS2CR6 or human β- 7. Hosler, B.A. et al. Refined mapping and characterization of the recessive familial amyotrophic lateral sclerosis locus (ALS2) on chromosome 2q33. Neurogenetics 2, actin cDNA in PerfectHyb hybridization solution (Toyobo) at 68 °C. We 34–42 (1998). washed membranes with 0.1×SSC containing 1% SDS at 65 °C and exposed 8. Hentati, A. et al. Linkage of a commoner form of recessive amyotrophic lateral them to X-ray film (Bio-MAX, Kodak). sclerosis to chromosome 15q15-q22 markers. Neurogenetics 2, 55–60 (1998).

9. Hosler, B.A. et al. Linkage of familial amyotrophic lateral sclerosis with 5 links nucleotide exchange to effector recruitment and function. Cell 90, frontotemporal dementia to chromosome 9q21-q22. JAMA 284, 1664–1669 1149–1159 (1997). (2000). 22. Tall, G.G., Barbieri, M.A., Stahl, P.D. & Horazdovsky, B.F. Ras-activated endocytosis 10. Ben Hamida, M., Hentati, F. & Ben Hamida, C. Hereditary motor system diseases is mediated by the Rab5 guanine nucleotide exchange activity of RIN1. Dev. Cell 1, (chronic juvenile amyotrophic lateral sclerosis). Brain 113, 347–363 (1990). 73–82 (2001). 11. Hadano, S. et al. A yeast artificial chromosome-based physical map of the juvenile 23. Takeshima, H., Kamazaki, S., Nishi, M., Iino, M. & Kangawa, K. Junctophilins: a amyotrophic lateral sclerosis (ALS2) critical region on human chromosome 2q33- novel family of junctional membrane complex proteins. Mol. Cell 6, 11–22 (2000). q34. Genomics 55, 106–112 (1999). 24. Carazo-Salas, R.E. et al. Generation of GTP-bound Ran by RCC1 is required for 12. Hadano, S. et al. Cloning and characterization of three novel genes, ALS2CR1, chromatin mitotic spindle formation. Nature 400, 178–181 (1999). ALS2CR2, and ALS2CR3, in the juvenile amyotrophic lateral sclerosis (ALS2) critical 25. Barrett, K., Leptin, M. & Settleman, J. The Rho GTPase and a putative RhoGEF region at chromosome 2q33-q34: candidate genes for ALS2. Genomics 71, mediate a signaling pathway for the cell shape changes in Drosophila 200–213 (2001). gastrulation. Cell 91, 905–915 (1997). 13. Ohtsubo, M. et al. Isolation and characterization of the active cDNA of the human 26. Martijn, F.B.G. et al. Identification of a novel, putative Rho-specific GDP/GTP cell cycle gene (RCC1) involved in the regulation of onset of chromosome exchange factor and a RhoA-binding protein: control of neuronal morphology. J. condensation. Genes Dev. 1, 585–593 (1987). Cell Biol. 137, 1603–1613 (1997). 14. Luo, L. Rho GTPases in neuronal morphogenesis. Nature Rev. Neurosci. 1, 173–180 27. Roepman, R. et al. The retinitis pigmentosa GTPase regulator (RPGR) interacts (2000). with novel transport-like proteins in the outer segments of rod photoreceptors. 15. Lerman-Sagie, T., Filiano, J., Smith, D.W. & Korson, M. Infantile onset of Hum. Mol. Genet. 9, 2095–2105 (2000). hereditary ascending spastic paralysis with bulbar involvement. J. Child Neurol. 28. Alam, M.R. et al. Kalirin, a cytosolic protein with spectrin-like and GDP/GTP 11, 54–57 (1996). exchange factor-like domains that interacts with peptidylglycine alpha- 16. Nagase, T., Kikuno, R., Nakayama, M., Hirosawa, M. & Ohara, O. Prediction of the amidating monooxygenase, an integral membrane peptide-processing enzyme. J. coding sequences of unidentified human genes. XVIII. The complete sequences of Biol. Chem. 272, 12667–12675 (1997). 100 new cDNA clones from brain which code for large protein in vitro. DNA Res. 29. Hall, A. Rho GTPases and the actin cytoskeleton. Science 279, 509–514 (1998). 7, 273–281 (2000). 30. Culbertson, M.R. RNA surveillance. Unforeseen consequences for gene 17. Meindl, A. et al. A gene (RPGR) with homology to the RCC1 guanine nucleotide expression, inherited genetic disorders and cancer. Trends Genet. 15, 74–80 exchange factor is mutated in X-linked retinitis pigmentosa (RP3). Nature Genet. (1999). 13, 35–42 (1996). 31. Collard, J.-F., Côté, F. & Julien, J.-P. Defective axonal transport in a transgenic 18. Renault, L. et al. The 1.7 Å crystal structure of the regulator of chromosome mouse model of amyotrophic lateral sclerosis. Nature 375, 61–64 (1995). condensation (RCC1) reveals a seven-bladed propeller. Nature 392, 97–101 (1998). 32. Williamson, T.L. & Cleveland, D.W. Slowing of axonal transport is a very early 19. Soisson, S.M., Nimnual, A.S., Uy, M., Bar-Sagi, D. & Kuriyan, J. Crystal structure of event in the toxicity of ALS-linked SOD1 mutants to motor neurons. Nature the Dbl and pleckstrin homology domains from the human Son of sevenless Neurosci. 2, 50–56 (1999). protein. Cell 95, 259–268 (1998). 33. Altschul, S.F. et al. Gapped BLAST and PSI-BLAST: a new generation of protein 20. Hama, H., Tall, G. G. & Horazdovsky, B.F. Vps9p is a guanine nucleotide exchange database search programs. Nucleic Acids Res. 25, 3389–3402 (1997). factor involved in vesicle-mediated vacuolar protein transport. J. Biol. Chem. 274, 34. Matsumoto, K. et al. Neuronal apoptosis inhibitory protein (NAIP) may enhance 15284–15291 (1999). the survival of granulosa cells thus indirectly affecting oocyte survival. Mol. 21. Horiuchi, H. et al. A novel Rab5 GDP/GTP exchange factor complexed to Rabaptin- Repod. Dev. 54, 103–111 (1999). © http://genetics.nature.com Group 2001 Nature Publishing

nature genetics • volume 29 • october 2001 173