The Role of CCL5/CCR5 Signal Transduction in the Immune

The Role of CCL5/CCR5 Signal Transduction in T cell Function and Breast Cancer

Thomas Tsutomu Murooka

A thesis submitted in conformity with the requirements for the

degree of Doctor of Philosophy

Graduate Department of Immunology

University of Toronto

The Role of CCL5/CCR5 Signal Transduction in T cell Function and Breast Cancer

Degree of Doctor of Philosophy, 2009

Thomas Tsutomu Murooka

Graduate Department of Immunology

University of Toronto

Chemokines are responsible for directing leukocyte migration and triggering firm

arrest by activating integrins on leukocytes. It is now apparent that chemokines have

critical biological roles beyond chemo-attraction. Throughout this thesis, I describe the

importance of the CCL5/CCR5 axis in the context of the immune response and cancer

biology. Specifically, CCL5 invokes dose-dependent distinct signalling events

downstream of CCR5 activation in T cells. I show that nM concentrations of CCL5 mediate CD4+ T cell migration that is partially dependent on mTOR activation. CCL5

induces phosphorylation and de-activation of the repressor 4E-BP1, resulting in its

dissociation from the eukaryotic initiation factor-4E to initiate protein translation. I

provide evidence that CCL5 initiates rapid translation of cyclin D1 and MMP-9, known

mediators of cell migration. The data demonstrated that up-regulation of chemotaxis-

related proteins may “prime” T cells for efficient migration. During an immune response,

recently recruited T cells are exposed to high CCL5 concentrations. The propensity of

CCL5 to form higher-order aggregates at high, µM concentrations, prompted studies to investigate their effects on T cell function. I show that at these high doses, CCL5 induces

apoptosis in PM1.CCR5 and MOLT4.CCR5 T cell lines. CCL5-induced cell death

involves the cytosolic release of cytochrome c and caspase-9/-3 activation. Furthermore,

I identified Tyrosine-339 as a critical residue within CCR5, suggesting that tyrosine

phosphorylation signalling events are important in CCL5-mediated apoptosis. Our data suggest that CCL5-induced cell death, in addition to Fas/FasL mediated events, may contribute to clonal deletion of T cells during an immunological response. I subsequently examined the possible pathological consequence of aberrant CCL5/CCR5 signalling in breast cancer. Exogenous CCL5 enhances MCF-7.CCR5 proliferation, which is abolished by anti-CCR5 antibody and rapamycin. CCL5 induces the formation of the eIF4F translation initiation complex, and mediates a rapid up-regulation of cyclin D1, c-

Myc and Dad-1 protein expression. Thus, our data demonstrate the potential for breast cancer cells to exploit downstream CCL5/CCR5 signalling pathways for their proliferative and survival advantage. Taken altogether, each of these studies reinforces the notion that chemokines are not only potent chemotactic mediators, but are key effectors in diverse developmental, immunological and pathological processes.

iii

ACKNOWLEDGEMENTS

This thesis is dedicated to everyone who supported me throughout my doctorate studies. Such a feat is never a work of one individual, and could not have been achieved without the support of everyone through the years. I have not only grown as a scientist, but also as an individual throughout this journey, and I now leave here with the confidence to tackle a new set of challenges.

Thank you, Eleanor, for being so supportive of me through the years. You always guided me in the right direction, and gave me words of encouragement through the lean times. Thank you for always being accessible, and taking the time to discuss my research plans. I am especially thankful for taking me to multiple international meetings, more than any laboratory in the department. You encouraged me to give oral presentations, and by doing so, I now have the confidence and experience to speak in front of an audience. Your continued commitment to your family and the scientific community is contagious, and look forward to working with you in the near future.

To all past and present Fish Pond members, thank you for all your scientific and emotional support through the years. Beata, you were there for me from the very beginning, and took this skinny (well, skinnier) and bewildered student from Vancouver under your wing. Thank you for teaching me everything I know and for being such a great friend. Jiabing, thank you for teaching me the art of molecular biology, and for being such a calm influence in the lab. Jyothi, Raj, Anna, Joanna, Celeste and Melissa, it was such a privilege to work with all of you, and I enjoyed being the only guy in the lab (at the time). Thanks for making me feel like a part of the team and giving me a crash course on female psychology (I listened attentively but forgot most of it). Sham, I enjoyed working with you and I wish you luck with your medical career. Ramtin, I’m glad you decided to join the Fish lab, and I knew we would get along from the moment we shook hands. Friends usually encourage you, but only true friends challenge you and point out your flaws, and that’s exactly what you did. I wouldn’t have been as successful without your support, and I leave here, but never leave behind, my true friend, confidant, and scientific partner. Carole, I’m going to miss all your unanswerable questions, but I’m always a phone call away! Thank you for being such a great mentor and friend, and will definitely miss Kaycee and Kip. Behnam, I enjoyed working with you, but more so our time outside the lab. I wish you all the luck with your studies and your backhand. Danlin, thank you for all your input and help throughout my studies, and I look forward to working with you in the future. Just make sure you don’t develop a drinking habit. Daniel, I really enjoyed working with you also, and our many discussions on protein translation. I think you’re well on your way towards obtaining your Ph.D., as long as Tim Horton’s doesn’t file for Chapter 11. Cole, thank you for all your help in the lab, but telling me you’re CCR5Δ32 homozygous AFTER leaving the lab didn’t help. Erin, it’s been a short time, but a blast! I hear the CBS ghosts don’t bother you if you keep smiling. Joanne, you’re like a rainbow on a rainy day, and I wish you luck with your future studies. Olivia, I enjoyed our short time working together, and am confident that you will take this project to new heights.

To my mom, dad and Arnold, thank you for all your emotional and financial support over the years. Knowing that I could fly back to Vancouver and get some TLC (tender love and care) from my family was all the motivation I needed during my studies. Mom, you are an incredibly courageous woman, and even with all the pain you continue to suffer, you always manage to give me encouragement and comfort. Dad, you always put a smile on my face and I thank you for all your support. Your stock tips, however, is at best 50/50, equivalent to a coin toss. Arnold, thank you for taking care of the family back home, and I see tremendous growth in you while I was away. Yes, I will practice my golf game more, but I rather cheat to beat you.

Ada, you held my hand through the tougher stretches of my studies, and for that I will be eternally grateful. Knowing that I can count on your at any time means the world to me, and we have a lifetime of pillow talks to look forward to. I do hope your carpal tunnel on your left wrist can handle some more extra weight on your finger. Mr. and Mrs. Man, I am truly grateful for feeding me and supporting me over the course of my studies. I look forward for more discussions and meals with you, but I’ll treat this time.

I want to thank the “1002” boys, Jeff and Cliff for their friendship during our Toronto days, and I wish you two nothing but the best. See you guys at the top! I also thank “turtle” and my late cat, Tama, for many good times.

Finally, I would like to thank the chair, all faculty members, graduate coordinators and fellow students in the Immunology department for all their support and friendship, and look forward to working with all of you again in the future. Playing left field for the Immunology softball team was truly a blast!

TABLE OF CONTENTS

Title Page ……………………………………………………………………………...…..i Abstract …………………………………………………………………………………..ii Acknowledgements …………………………………………………………...………….iv Table of Contents …………………………………………………………………….….vi List of Figures ……………………………………………………………………...…….x List of Tables ……………………………………………………………………..……..xii List of Abbreviations ………………………………………………………….……...xiii

CHAPTER 1: Introduction ……………………………………………..………..…1-69

1.1. Chemokine Superfamily ……………………………………………….…….2 1.1.1. Classification …………………………………………………..….2 1.1.2. Chemokine Structure ……………………………………………..7 1.1.3. Glycosaminoglycan (GAG) Binding …………………….……….9 1.1.4. Chemokine-mediated Signal Transduction ………………...……11 1.1.4.1.Jak-Stat Pathway ……………………………….………..12

1.2. Chemokine Receptors ………………………………………………...…….14 1.2.1. Classification ……………………………………………….……14 1.2.2. Atypical Chemokine Receptor Family ……………………..……17 1.2.3. Receptor Structure ……………………………………..………..20 1.2.4. Chemokine Ligand Binding Domains …………………………..21 1.2.5. Receptor Internalization …………………………..……………..22 1.2.6. Receptor Homo- and Hetero- Dimerization …………….……….24

1.3. Chemokine/Chemokine Receptor Function and the Immune Response …....27 1.3.1. Chemotaxis …………………………………………………...…27 1.3.1.1. Cell Proliferation ……………………………………..…27 1.3.1.2. Activation of the PI-3’K Pathway ………………………28 1.3.1.3. Recruitment of Rho Family GTPases ………………..…31 1.3.1.4. MAPK Signalling and Cytoskeletal Dynamics …………33

1.3.2. Role in Cell Death and Survival ……………………………...…36 1.3.3. T cell Co-stimulation …………………………………………....39 1.3.4. The mTOR/4E-BP1 Pathway and Chemotaxis ………………….41

1.4. Chemokine/Chemokine Receptors and Disease …………………………....52 1.4.1. Rheumatoid Arthritis ……………………………………………52 1.4.2. Cancer …………………………………………………………...55 1.4.2.1. Chemokines Influence Leukocyte Tumour Infiltration…55 1.4.2.2. Chemokines and Tumour Growth …………….………...59 1.4.2.3. Chemokines in Angiogenesis/Angiostasis ………..…….61 1.4.2.4. Chemokines in Metastasis ………………………………63

1.4.3. Human Immunodeficiency Virus (HIV) Infection …………..….66

1.5. Hypothesis and Objectives …………………………………………….……69

CHAPTER 2: CCL5-CCR5 Mediated Apoptosis in T cells: Requirement for Glycosaminoglycan Binding and CCL5 Aggregation …………70-154

2.1. Abstract ………………………………………………………………..……71 2.2. Introduction …………………………………………………………………72 2.3. Materials and Methods 2.3.1. Cells and Reagents ………………………………………………75 2.3.2. Preparation of primary T cells ……………………….………….76 2.3.3. Chondroitinase ABC treatment …………………………………76 2.3.4. MTT, Annexin V/7-ADD staining ………………………...…….76 2.3.5. JC-1 staining for mitochondrial membrane potential ……..…….77 2.3.6. Subcellular Fractionation …………………………………..……77 2.3.7. Western Blot Analysis ……………………………………..……77 2.3.8. Flow Cytometric Analysis …………………………………..…..78 2.3.9. CCR5 site-directed mutagenesis and PM1 transfection ………....78 2.3.10. Statistical Analysis …………………………………………..….79

2.4. Results 2.4.1. µM concentrations of CCL5 induce apoptosis in CCR5 expressing T cells ………………………………………………………………80 2.4.2. CCL5 induced cell death is mediated by the mitochondrial and apoptosome pathway ………………………………………...…..80 2.4.3. µM concentrations of CCL5 induce apoptosis in CCR5 expressing primary T cells ……………………………………………..……92 2.4.4. Expression of intact CCR5, but not CCR5Y339F, renders PM1 cells susceptible to CCL5-inducible apoptosis …………………..……92 2.4.5. CCL5-induced cell death is dependent on GAG interactions ….…95 2.4.6. Aggregation of CCL5 is required for CCL5-induced cell death .104

2.5. Discussion …………………………………………………………………107

CHAPTER 3: CCL5-mediated T cell Chemotaxis Involves the Initiation of mRNA Translation through mTOR/4E-BP1 ………………………….113-154

3.1. Abstract ……………………………………………………………………114 3.2. Introduction …………………………………………………………..……115 3.3. Materials and Methods 3.3.1. Cells and Reagents ………………………………………..……119 3.3.2. Immunoblotting and Immunoprecipitation ………………….…120 3.3.3. Flow Cytometric Analysis ………………………………..……121

vii

3.3.4. Chemotaxis Assay …………………………………………...…121 3.3.5. Semi-quantitative RT-PCR ………………………………….…122 3.3.6. Polysome gradients ………………………………………….…122 3.3.7. Statistical Analysis …………………………………………..…123

3.4. Results 3.4.1. CCL5-mediated chemotaxis of activated CD4+ T cells is mTOR dependent ……………………………………………………….124 3.4.2. CCL5 induces phosphorylation of mTOR, p70 S6 kinase and S6 ribosomal protein …………………………………………….…129 3.4.3. CCL5-mediated 4E-BP1 phosphorylation is PI-3’K-, PLD- and mTOR- dependent …………………………………………...…134 3.4.4. CCL5 initiates protein translation through formation of the eIF4F complex ……………………………………………………...…134 3.4.5. CCL5-inducible protein translation of cyclin D1 and MMP-9 is mTOR-dependent ……………………………………………....144

3.5. Discussion ……………………………………………………………...….147

CHAPTER 4: CCL5 Promotes Breast Cancer Progression through mTOR/4E-BP1 dependent mRNA Translation.…………………..………..…155-181

4.1. Abstract ……………………………………………………………………156 4.2. Introduction …………………………………………………………..……157 4.3. Materials and Methods 4.3.1. Cells and Reagents ……………………………………..………160 4.3.2. Plasmid Constructs ……………………………………….……160 4.3.3. Proliferation Assay …………………………………………..…161 4.3.4. Immunoblotting and Immunoprecipitation ……………….……161 4.3.5. Flow Cytometric Analysis ………………………………..……162 4.3.6. Polysome gradients ……………………………………….……163 4.3.7. RT-PCR ……………………………………………………..…164 4.3.8. Statistical Analysis ………………………………………..……164

4.4. Results 4.4.1. CCL5-CCR5 inducible MCF-7 proliferation is dependent on mTOR ……………………………………………………….…165 4.4.2. CCL5 activation of CCR5 leads to the formation of the eIF4F complex through mTOR …………………………………….…168 4.4.3. CCL5 induces protein translation of proliferation and survival proteins …………………………………………………………171 4.4.4. CCL5 facilitates recruitment of a subset of mRNAs to polysomes .………………………………………………..……174

4.5. Discussion ……………………………………………………………..…..177

viii

CHAPTER 5: Discussion and Future Directions …………………………...…182-202

Chemokines and the Immune Response ……………………………………………….183 5.1. mTOR and the Adaptive Immune Response ………………………...……188 5.1.1. mTOR-mediated Nutrient Sensing and Chemotaxis ………….…193

5.2. CCL5 determines T cell fate through AICD ………………………………196 5.3. CCL5 promotes breast cancer proliferation …………………………….…199 5.3.1. CCL5-mediated mTOR Activation and Cellular Metabolism …..200

5.4. Conclusions ………………………………………………………………..203

CHAPTER 6: Dissemination of Work Arising from this Thesis …………………..204

CHAPTER 7: References ………………………………………………………206-267

LIST OF FIGURES

CHAPTER 1

Figure 1.1. Chemokines share similar structural elements …………………….…4 Figure 1.2. Two-dimensional diagram of CCR5 depict residues critical for ligand binding, receptor integrity, internalization and signal transduction ...15 Figure 1.3. The MAPK Signaling Cascade ……………………………………..34 Figure 1.4. Regulation of cap-dependent mRNA translation ………………...….44 Figure 1.5. eIF4F formation and ribosome recruitment ……………………....…48 Figure 1.6. Chemokines and Cancer …………………………………………….56

CHAPTER 2

Figure 2.1. µM concentrations of CCL5 induce apoptosis in PM1.CCR5 T cells …………………………………………………………………..…81 Figure 2.2. CCL5 does not affect Fas/FasL expression in T cells ………………85 Figure 2.3. FasL neutralizing monoclonal antibody NOK1 does not block CCL5 mediated apoptosis in PM1.CCR5 cells ……………………….……87 Figure 2.4. µM concentrations of CCL5 induce cytochrome c release, caspase-9 and caspase-3 activation and PARP cleavage ………………………89 Figure 2.5. µM concentrations of CCL5 induce apoptosis in human primary T cells …………………………………………………………………93 Figure 2.6. CCL5 binding and receptor internalization of PM1.CCR5 and PM1.CCR5Y339F cells ……………………………………….……96 Figure 2.7. Introduction of CCR5 but not CCR5Y339F into PM1 T cells renders them susceptible to CCL5-inducible apoptosis …………………….98 Figure 2.8. CCL5-GAG interactions are important for apoptosis …………..…101 Figure 2.9. The CCL5 aggregation mutant E66S does not induce PM1.CCR5 cell death …………………………………………………………….…105

CHAPTER 3

Figure 3.1. CCL5-mediated chemotaxis of activated CD4+ T cells is dependent on PI-3’K and mTOR ………………………………………………....125 Figure 3.2. CCL3/MIP1α-dependent T cell chemotaxis is not dependent on mTOR ……………………………………………………….……..127 Figure 3.3. Effect of various inhibitors on T cell viability and adhesion ……...130 Figure 3.4. CCL5-dependent phosphorlyation of mTOR, p70 S6K1 and ribosomal protein S6 in T cells …………………………………………….....132 Figure 3.5. CCL5 phosphorylates the 4E-BP1 repressor of mRNA translation through PI-3’ kinase and mTOR ………………………..…………135 Figure 3.6. CCL5-mediated PLD activation regulates T cell migration …….…137 Figure 3.7. CCL5 induces formation of the eIF4F initiation complex ……...…140 Figure 3.8. CCL5-inducible protein translation enhances mRNA association with polyribosomes …………………………………………………..…142

Figure 3.9. CCL5-inducible upregulation of cyclin D1 and MMP-9 protein levels is dependent on mTOR-mediated mRNA translation …………..…145 Figure 3.10. Possible model for CCL5-mediated mRNA translation in CD4+ Tcells ……………………………………………………………....152

CHAPTER 4

Figure 4.1. CCL5-mediated MCF-7 proliferation is dependent on mTOR ……166 Figure 4.2. CCL5 induces formation of the eIF4F initiation complex and enhances mRNA association with polyribosomes …………………………...169 Figure 4.3. CCL5 mediates upregulation of proliferative and survival proteins through a mTOR dependent mechanism …………………………..172 Figure 4.4. CCL5 faciliates recruitment of a subset of mRNAs to polysomes ..175

CHAPTER 5

Figure 5.1. Chemokines mediates leukocyte migration from blood to extravascular tissue ……………………………………………...... 184 Figure 5.2. Illustration of the role of mTOR activity in T cell migration in vivo ………………………………………………………………….…..190

LIST OF TABLES

CHAPTER 1

Table 1.1. The Chemokine Superfamily and Nomenclature ……………………...3

xii

LIST OF ABBREVIATIONS

Ab Antibody ADP Adenosine diphosphate AICD Activation induced cell death AOP-CCL5 Aminooxypentane-CC chemokine ligand 5 APC Antigen presenting cell Arp2/3 Actin-related proteins 2/3 Bcl-2 B cell lymphoma-2 bp Base pair BRET Bioluminescence resonance energy transfer CCL5 CC chemokine ligand 5 CCR5 CC chemokine receptor 5 CCX-CKR ChemoCentryx chemokine receptor Cdc42 Cell division cycle 42 c-Myc Cellular-myelocytomatosis virus oncogene CS Chondroitin sulphate C-terminus Carboxy-terminus CTL Cytotoxic T lymphocyte CXCL CXC chemokine ligand CXCR CXC chemokine receptor CX3CL CX3C chemokine ligand CX3CR CX3C chemokine receptor DAD Defender against cell death DAG Diaceylglyerol DARC Duffy antigen receptor for chemokines DC Dendritic cell DNA Deoxyribonucleic acid DPG Diphosphoglycerate DRY Aspartate-Arginine-Tyrosine DS Dermatan sulphate DTT Dithiothreitol ECL Extra-cellular loop EDTA Ethylenediamine tetra-acetic acid EGTA Ethylene glycol-bis (2-aminoethylether)-N’N’N’N’-tetra-acetic acid EGF Epidermal growth factor eIF Eukaryotic translation initiation factor ELR Glutamate-Leucine-Arginine ERK Extracellular signal-related kinase F-actin Filamentous actin FACS Flourescence activated cell sorter FAK Focal adhesion kinase FasL Fas antigen ligand FCS Fetal calf serum

xiii

FITC Flourescein isothiocynate FKBP12 FK506-binding protein of 12kDa FLF Fulminant liver failure FRAP/mTOR FKBP 12-rapamycin-associated protein/mammalian target of rapamycin FRET Fluorescence resonance energy transfer GABA γ-aminobutyric acid GAG Glycosaminoglycan GAP GTPase activating protein GAPDH Glyceraldehyde 3-phosphate dehydrogenase GDP Guanosine diphosphate GEF Guanidine nucleotide exchange factor GFP Green fluorescent protein GM-CSF Granulocyte-macrophage colony-stimulating factor gp120 Glycoprotein of 120kDa GPCR G-protein coupled receptor GRK G-protein receptor kinase GTP Guanosine triphosphate HA Hyaluronic acid HEK Human embryonic kidney HEV High endothelial venule HIV Human immunodeficiency virus HLA Human leukocyte antigen HRP Horseradish peroxidase HS Heparin sulphate IP3 Inositol 1,4,5-phosphate Jnk c-Jun N-terminal kinase kDa Kilodalton KS Keratin sulphate KSHV Karposi’s sarcoma-associated herpes virus ICAM Intracellular adhesion molecule IFN Interferon IL Interleukin IP Immunoprecipitation IRES Internal ribosomal entry segment Jak Janus kinase LFA Lymphocyte function-associated antigen LPS Lipopolysaccharide MAPK Mitogen-activated protein kinase MCP Macrophage chemo-attractant protein MEF Murine embryonic fibroblast Met-CCL5 Methionine-CC chemokine ligand 5 Met-tRNA Methionine-transfer ribonucleic acid MHC Major histocompatibility complex MIP Macrophage inflammatory protein MLCK Myosin light chain kinase

xiv

µM Micromolar MMP Matrix metalloproteinase mRNA Messenger RNA mTOR Mammalian target of rapamycin mTORC1 Mammalian target of rapamycin complex 1 NF-κB Nuclear factor-kappa B NK Natural killer NMR Nuclear magnetic resonance nM Nanomolar NP-40 Nonidet-40 N-terminus Amino-terminus OD Optical density OX-PHOS Oxidative phosphorylation p38 38kDa stress-activated kinase PA Phosphatidic acid PARP Poly ADP ribose polymerase PBS Phosphate buffered saline PCR Polymerase chain reaction PDK Phosphoinositide-dependent kinase PGE2 Prostaglandin E2 PH Pleckstrin homology PHA Phytohaemagglutinin PHAS Phosphorylated heat and acid soluble protein PI Propidium iodide PI-3’K Phosphatidylinositol 3-kinase PIKK Phosphoinositide kinase-related kinase PIP3 Phosphatidylinositol 3,4,5-phosphate PKB Protein kinase B PKC Protein kinase C PKR Protein kinase R PLCβ Phospholipase Cβ PLD Phospholipase D PMA Phorbol-12-miristate-13-acetate PMSF Phenylmethylsulfonylflouride PRR Pattern-recognition receptors PTEN Phosphatase and tensin homolog deleted in chromosome ten pTx Pertussis toxin RA Rheumatoid arthritis Rac Ras-related C3 botulinum toxin substrate RANTES Regulated on activation normal T cell expressed and secreted Raptor Regulatory associated protein of mTOR Rheb Ras-homolog enriched in brain Rho Ras homolog gene family Rictor Rapamycin-insensitive companion of mammalian target of rapamycin RNA Ribonucleic acid

ROCK Rho kinase ROS Reactive oxygen species rpS6 Ribosomal protein S6 RT-PCR Reverse transcription-polymerase chain reaction SDF Stromal derived factor SDS Sodium dodecyl sulphate SDS-PAGE Sodium dodecyl sulphate-polyacrylamide gel electrophoresis SH2 Src-homology 2 SHIP Src-homology 2 domain-containing inositol phosphatase S6K S6 kinase Stat Signal transducer and activator of transcription TAM Tumor associated macrophages TBS Tris buffered saline TCR T cell receptor Th T helper TIL Tumor infiltrating T lymphocytes TLR Toll-like receptor TM Trans-membrane TNFα Tumor necrosis factor α TNFR Tumor necrosis factor receptor α TOP Tract of oligopyrimidines TRAIL TNF-related apoptosis-inducing ligand TSC Tuberous sclerosis complex TXP Threonine-X-Proline UTR Untranslated region VCAM Vascular cell adhesion molecule VEGF Vascular endothelial growth factor VLA Very late antigen WASp Wiskott-Aldrich syndrome protein WAVE/Scar Wiskott-Aldrich syndrome protein family verprolin-homologous protein/suppressor of cyclic adenosine monophosphate receptor XCL XC chemokine ligand XCR XC chemokine receptor ZAP-70 Zeta-associated protein tyrosine kinase of 70kDa 4E-BP 4E-binding protein 7-AAD 7-amino actinomycin D

xvi

Chapter 1

Introduction

Portion of this chapter was published as:

Murooka, T.T., Ward, S.E., and Fish, E.N. (2005). Chemokines and cancer. Cancer Treat Res 126, 15-44.

Galligan C.L., Murooka, T.T., Rahbar, R., Baig, E., Majchrzak-Kita, B., and Fish, E.N. (2006). Interferons and viruses: signalling for supremacy. Immunol Res 35, 27-40.

1.1. Chemokine Superfamily

1.1.1. Classification

The chemokines are soluble, small molecular weight (8-14 kDa) and basic cytokines that bind to their cognate seven trans-membrane G-protein coupled receptors

(GPCRs) to elicit directed cell migration. Since their initial discovery almost 30 years ago, approximately 47 human chemokines have been identified to date (Table 1.1). They are separated into four sub-families based on the relative positioning and presence of the first two cysteine residues at the N-terminus (Zlotnik and Yoshie, 2000). The cysteine residues in CXC chemokines are separated by one non-conserved amino acid, whereas in

CC chemokines, the first two cysteine residues are adjacent. The XC chemokines lack the first consensus cysteine, whereas the CX3C chemokine CX3CL1 is characterized by three non-conserved amino acids between the first two cysteine residues. In 2000, a system of nomenclature was introduced in which each ligand and receptor is identified by its sub-family and given an identifying number (Bacon et al., 2002; Murphy et al., 2000).

For example, the CXC chemokine SDF-1α (stromal-derived factor 1α) is now known as

CXCL12 for CXC chemokine ligand 12, and the CC chemokine RANTES (regulated on activation normal T cell expressed and secreted) is now known as CCL5 for CC chemokine ligand 5. Throughout this thesis, chemokine ligands and receptors will be referred to by the new nomenclature, with their corresponding original names found in

Table 1.1. This thesis will review our general understanding of chemokine/chemokine receptor structure and function, with a major emphasis on the CC chemokine CCL5 and its receptor, CCR5.

Table 1.1. The Chemokine Superfamily and Nomenclature

Alternate Names Mouse Ligand Receptor(s)

CXC Chemokines CXCL1 Groα/MGSAα Gro/KC CXCR2, CXCR1 CXCL2 Groβ/MGSAβ MIP-2 CXCR2 CXCL3 Groγ Dcip CXCR2 CXCL4 PF4 PF4 CXCR3b CXCL5 ENA-78 LIX CXCR2 CXCL6 GCP-2 CXCR1, CXCR2 CXCL7 NAP-2 Ppbp CXCR2 CXCL8 IL-8 CXCR1, CXCR2 CXCL9 MIG MIG CXCR3, CXCR3b CXCL10 IP-10 IP-10 CXCR3, CXCR3b CXCL11 I-TAC I-TAC CXCR3, CXCR3b, CXCR7 CXCL12 SDF-1α/β SDF-1α/β CXCR4, CXCR7 CXCL13 BLC, BCA-1 BLC, BCA-1 CXCR5 CXCL14 BRAK, Bolekine BRAK, Boleine Unknown CXCL15 none Lungkine Unknown CXCL16 none CXCL16 CXCR6 CXCL17 DMC DMC Unknown

CC Chemokines CCL1 I-309 TCA-3 CCR8 CCL2 MCP-1 JE CCR2 CCL3 MIP-1α/LD78α MIP-1α CCR1, CCR5 CCL4 MIP-1β MIP-1β CCR5 CCL5 RANTES RANTES CCR1, CCR3, CCR5 CCL7 MCP-3 MARC CCR1, CCR2, CCR3 CCL8 MCP-2 MCP-2, MCP-5 CCR1, CCR2, CCR3, CCR5 CCL11 Eotaxin Eotaxin CCR3 CCL13 MCP-4 CCR1, CCR2, CCR3 CCL14 HCC-1 CCR1 CCL15 HCC-2/LKN1/MIP-1γ CCL9, MIP-1γ CCR1, CCR3 CCL16 HCC-4/LEC/LCC-1 CCR1, CCR2, CCR5 CCL17 TARC TARC CCR4 CCL18 DC-CK1/PARC/AMAC-1 Unknown CCL19 MIP-3β/ELC MIP-13β CCR7 CCL20 MIP-3β/LARC MIP-α/LARC CCR6 CCL21 SLC/6Ckinase CCL21a, b, c/SLC CCR7 CCL22 MDC/STCP-1 ABCD-1 CCR4 CCL23 MPIF/CKβ8 CCL6/C10 CCR1 CCL24 Eotaxin-2/MPIF-2 Eotaxin-2 CCR3 CCL25 TECK TECK CCR9 CCL26 Eotaxin-3 CCL26l CCR3 CCL27 CTACK/ILC CTACK/ILC CCR10 CCL28 MEC MEC CCR3, CCR10

C Chemokines XCL1 Lymphotactin/SCM-1α Lymphotactin XCR1 XCL2 SCM-1β XCR1

CX3C Chemokine CX3CL1 Fractalkine Fractalkine CX3CR1

Figure 1.1 Chemokines share similar structural elements

Overlayed monomeric minimized mean structure of CCL2 (yellow), CCL5 (blue) and CCL11 (red) shows similar structural elements despite a low level of sequence homology.

C-terminal α-helix 30s loop

β1

N-loop

N-terminus

β2 β3

310 helix

40s loop

Adapted from M. Crump et al J. Biol. Chem. 273 (1998)

Chemokines are also functionally classified as homeostasis or inflammation.

Inflammatory chemokines control the recruitment of leukocytes during immunological insult, whereas homeostatic chemokines are involved in normal leukocyte development and the migration of cells to and within secondary lymphoid organs (Moser et al., 2004).

Most chemokines are secreted from the cell, with the exception of CX3CL1 and CXCL16, which are tethered to the extracellular surface through a trans-membrane stalk (Zlotnik and Yoshie, 2000). These chemokines can also be released in soluble form after proteolytic cleavage. Interestingly, there are 47 chemokines that bind to 18 receptors, suggestive of considerable redundancy within the chemokine system of ligand/receptor interactions. This redundancy is thought to aid in fine-tuning specific chemokine- mediated biological responses. For instance, CCR5-deficient mice develop normally, suggesting that other chemokine receptors may compensate for the lack of CCR5 (Zhou et al., 1998).

The CXC chemokines can be further subdivided into ELR+ and ELR- chemokines based on the presence or absence of the Glutamate-Leucine-Arginine (ELR) motif preceding the CXC sequence. ELR+ chemokines are potent promoters of angiogenesis, exemplified by their ability to mediate the chemotaxis of endothelial cells in corneal neo-vascularization experiments (Strieter et al., 1995). CXCL1, CXCL2,

CXCL3, CXCL5, CXCL6, CXCL7 and CXCL8 are all ELR+ chemokines, with CXCL12 the only ELR- chemokine with angiogenic properties (Luker and Luker, 2006; Moser et al., 2004; Orimo et al., 2005). The role of chemokines in angiogenesis is discussed in more detail in Section 1.4.2.3.

1.1.2. Chemokine Structure

The structures of several chemokines have been solved by nuclear magnetic resonance (NMR) and/or X-ray crystallography. Studies have revealed that the three dimensional structure of CCL5 is similar to that of CCL2, CCL3, CCL4 and CXCL8, despite a relatively low level of sequence homology (Baldwin et al., 1991; Czaplewski et al., 1999; Handel and Domaille, 1996; Lodi et al., 1994) (Figure 1.1). This “chemokine fold” structure consists of three anti-parallel β-strands (β(1), β(2) and β(3)) overlaid by a C- terminal α-helix. Upstream of the β-sheets is the flexible N-terminal region, followed by a long N-loop and a short 310 helix. Two characteristic disulphide bridges between the first and third, and the second and fourth cysteine residues stabilize the three dimensional conformation. The flexible N-terminal region is believed to be important in receptor activation, since modifications in this region have been shown to affect function (Gong and Clark-Lewis, 1995; Jarnagin et al., 1999; Mizoue et al., 2001). In some instances, N- terminal modifications have been shown to modify chemokine function, effectively creating a variant potent antagonist. Retention of the N-terminal methionine in CCL5

(Met-CCL5) and CCL2 (Met-CCL2) both produced antagonists for CCR5 and CCR2, respectively, as does the addition of amino-oxypentane to CCL5 (AOP-CCL5) (Signoret et al., 2000; Simmons et al., 1997). In addition to the N-terminus, the N-loop between the first two cysteines and the 310 helix contains residues involved in receptor binding

(Crump et al., 1997; Pakianathan et al., 1997). Taken together, in a hypothesized two-site model of chemokine receptor activation, the core domain of chemokines (which differs

for each chemokine) binds to the extracellular loops of the receptor to help position the

N-terminal signalling domain of the ligand within the helical bundle of the receptor.

Chemokines are subject to proteolytic cleavage by specific proteases found at inflammatory sites. As a result, a number of natural variants of inflammatory chemokines with N-terminal modifications have been identified (Proost et al., 2006). The resulting chemokine variants can either have increased or decreased chemokine bioactivity. For example, the serine protease CD26 (also known as dipeptidyl peptidase

IV) is capable of mediating N-teriminal CCL5 cleavage, resulting in a CCL5 variant (3-

68) that exhibited reduced chemotactic and intracellular calcium mobilization ability

(Proost et al., 1998; Struyf et al., 1998). Thus, by altering the N-terminus, proteases can alter chemokine function by directly affecting receptor binding. The data demonstrate the potential for proteases to regulate chemokine activity during an inflammatory response.

It has been known for some time that chemokines form oligomers in solution, but whether they were relevant physiologically was unknown. Subsequent mutational analyses of different classes of chemokines revealed that CC chemokines form dimers through residues near their N-terminus surrounding the first two cysteine residues, while

CXC chemokines predominantly dimerize through residues in the first strand of β(1)

(Proudfoot, 2006). Intriguingly, CCL5 not only forms dimers, but has a tendency to extensively aggregate into higher-order oligomeric structures (Appay et al., 1999).

Extensive mutational studies have produced mutant CCL5 molecules that display unique aggregation properties. A CCL5 mutant where Thr-7 is N-methylated on the amide

nitrogen ([Nme-7T]-CCL5), is monomeric and does not oligomerize on immobilized glycosaminoglycans (GAGs), yet retains its ability to mediate chemotaxis in vitro

(Proudfoot et al., 2003). However, when tested in vivo using a peritoneal recruitment assay, [Nme-7T]-CCL5 failed to recruit cells. In the same study, the dimeric [E66S]-

CCL5 mutant, but not the tetrameric [E26A]-CCL5 mutant, failed to recruit cells in vivo, although both retained chemotactic ability in vitro. The data suggest that not only is

CCL5 aggregation required for biological activity in vivo, but a minimal quaternary structure must be reached. Similarly, a Pro-8 to Ala substitution in CCL2 ([P8A]-CCL2) resulted in a mutant chemokine that induced calcium mobilization and mediated chemotaxis with wildtype potency and efficacy in vitro, while failing to do so in vivo

(Paavola et al., 1998; Proudfoot et al., 2003). Taken altogether, chemokine oligomerization is physiologically relevant, and critical for chemokine function in vivo.

1.1.3. Glycosaminoglycan (GAG) Binding

Secreted chemokines bind to heparin-like glycosaminoglycans (GAGs), which immobilize and concentrate chemokines at tissue sites. GAGs are normally attached to proteins on the cell surface and/or the extracellular matrix to form proteoglycans

(Proudfoot, 2006). GAGs are widely diverse, and consist of repeating disaccharide units with variations in basic composition of the saccharide in acetylation and N- and O- sulphation patterns. A common feature of GAGs is their overall negative charge due to the density of sulphate and carboxylate groups on the GAG chains. This suggests an electrostatic interaction with the basic, positively charged chemokines (Kuschert et al.,

1999). There are several classes of GAGs, the most ubiquitous being heparin sulphate

(HS), a polysaccharide that is expressed on virtually every cell in the body. Others include heparin, produced almost exclusively by mast cells; chondroitin sulphate (CS) and dermatan sulphate (DS), found on cell surfaces and the extracellular matrix; keratin sulphate (KS), found as part of the cornea and cartilage; and hyaluronic acid (HA).

Interestingly, chemokines have been shown to have a hierarchical preference for GAGs.

For example, CCL5 binding affinity for different GAGs was determined as heparin > DS

> HS > CS through competition studies, suggesting that specificity of chemokine-GAG interactions may have important implications in vivo (Kuschert et al., 1999). The GAG binding residues on various chemokines have been identified, described as XBBXBX and

XBBBXXBX (where B is a basic amino acid and X is any amino acid). In some cases, the GAG binding epitopes can overlap with the receptor binding domains (Hileman et al.,

1998). Specific residues critical for GAG binding of chemokines CCL2, CCL3 and

CCL4 have now been identified (Chakravarty et al., 1998; Koopmann et al., 1999;

Koopmann and Krangel, 1997; Lau et al., 2004; Laurence et al., 2001; Martin et al.,

2001; Sadir et al., 2001; Vita et al., 2002). Proudfoot and colleagues identified the heparin-binding BBXB motif found within the 40s loop for CCL5. An alanine mutant,

[44AANA47]-CCL5, exhibits an 80% reduction in heparin binding capacity and no recruitment activity in vivo, although in vitro activity was retained (Proudfoot et al.,

2003; Shaw et al., 2004). Intriguingly, mixing both [44AANA47]-CCL5 and intact CCL5 resulted in heterodimers that were unable to recruit cells into the peritoneal cavity in vivo

(Johnson et al., 2004). Indeed, [44AANA47]-CCL5 functioned as a dominant negative inhibitor in a number of inflammatory models by limiting leukocyte recruitment (Johnson et al., 2004). Taken altogether, chemokine-GAG interactions are critical in promoting

chemokine aggregation, local retention and the establishment of a chemokine concentration gradient, allowing immune cells to migrate via a haptotactic mechanism

(Amara et al., 1999; Cinamon et al., 2001; Kuschert et al., 1999; Netelenbos et al., 2002;

Pablos et al., 2003; Proudfoot et al., 2003). These immobilized chemokines allow leukocytes to stop rolling, promote extravasation and direct chemotaxis.

1.1.4. Chemokine-mediated Signal Transduction

Chemokine ligands bind to and activate seven trans-membrane, G-protein coupled chemokine receptors (GPCRs). In most cases, ligand binding causes the dissociation of

Gαi from the Gβγ subunit of the heterotrimeric G-proteins, leading to the activation of a multitude of signalling cascades. These include activation of adenylyl cyclase and phospholipase Cβ (PLCβ), resulting in intracellular calcium mobilization (Frederick and

Clayman, 2001; Richmond, 2002; Rossi and Zlotnik, 2000). Specifically, PLCβ activation results in the generation of diacylglcerol (DAG) and inositol-1,4,5-triphosphate

(IP3) to subsequently activate protein kinase C (PKC), which in turn phosphorylates

CCR5 on the C-terminus. The majority of chemokine-mediated responses are inhibited by pertussis toxin (PTx), a bacterial toxin that catalyzes the ADP-ribosylation of the Gαi subunit, preventing all G-protein coupled signalling. However, chemokine receptors have been reported to associate with other PTx-insensitive G-proteins, including Gq/11 or

G16, (Mellado et al., 2001b). Furthermore, CCR2 and CCR5 have been demonstrated to induce a PTx-insensitive, tyrosine phosphorylation signalling cascade after ligand binding, adding an additional layer of complexity to signalling pathways mediated by chemokines (Bacon et al., 1995).

1.1.4.1. Jak-Stat Pathway

The Jak-Stat pathway is the principle signalling mechanism for many cytokines and growth factors. It is clear through numerous studies that chemokines can activate the

Janus kinase (Jak)–Signal transducers and activators of transcription (Stat) signalling pathway (Mellado et al., 1998; Rodriguez-Frade et al., 1999; Shahrara et al., 2003; Vila-

Coro et al., 1999a; Wong and Fish, 1998; Wong et al., 2001). Generally, activation of

Jaks occurs upon ligand-mediated receptor dimerization, when two Jaks are brought into close proximity to facilitate trans-phosphorylation (Rawlings et al., 2004). Active Jaks then directly phosphorylate a single tyrosine residue within the carboxy terminus of Stats

(Fu, 1992). Phosphorylated Stats then dimerize through their SH2 domains, translocate to the nucleus and bind specific DNA sequences to regulate gene transcription (Darnell,

1998). CCL5 induced rapid tyrosine phosphorylation of CCR5, Jak2 and Jak3 in a PTx- insensitive manner in PM1 T cells, suggesting that these events were independent of G- protein signalling (Wong et al., 2001). Subsequent studies have shown that both CCL3 and CCL5 mediated Stat1:Stat1 and Stat1:Stat3 homo- and hetero-dimer formation in

Molt-4 and Jurkat T cells (Wong and Fish, 1998). Other studies have demonstrated that

CCL5 induced phosphorylation of Jak1 and Stat5 in a CCR5-dependent manner in HEK

293 cells (Mellado et al., 2001b). Similarly, CXCL12 has been shown to induce Jak2 and

Jak3 activation in T cells, although subsequent studies have not been able to reproduce these finding (Moriguchi et al., 2005; Soriano et al., 2003; Vila-Coro et al., 1999b).

Nevertheless, CXCL12 stimulation of CD34+ hematopoietic progenitor cells induced

Jak2 phosphorylation and its association with PI-3’K to possibly modulate cell migration

(Zhang et al., 2001). Taken altogether, chemokines activate the Jak-Stat pathway to invoke various biological responses, where specific usage of various Jak and Stat molecules seems to be largely ligand and cell type specific (Wong and Fish, 2003).

1.2. Chemokine receptors

1.2.1. Classification

Currently, 18 chemokine receptors have been described (Table 1.1). All chemokines exert their biological functions by binding to G-protein coupled receptors

(GPCR). Chemokine receptors are classified according to the sub-family of chemokine ligands they are receptors for: CC chemokines bind to CC chemokine receptors (CCRs),

CXC chemokines bind to CXC chemokine receptors (CXCRs) , XC chemokines bind to

XC chemokine receptors (XCRs) , and CX3CL1 is the ligand for the CX3CR1 receptor

(Bacon et al., 2002; Murphy et al., 2000). The CC chemokine receptor 5, CCR5, contains

352 amino acids and has a calculated molecular mass of 40.6 kDa. CCR5 shares 71% sequence identitiy with CCR2, and is the receptor for CCL3, CCL4 and CCL5 (Figure

1.2) (Combadiere et al., 1996; Raport et al., 1996; Samson et al., 1996). A number of non-functional CCR5 variants have been identified, the most important being the truncated CCR5Δ32 variant that is non-functional and not expressed on the cell surface

(Samson et al., 1996).

Several virus-encoded chemokine receptor-like molecules have also been characterized. One of particular importance is the G-protein coupled receptor encoded by the Kaposi’s sarcoma-associated herpresvirus KSHV (also know as HHV8), designated

KHSV-GPCR. This receptor shares a high degree of homology with human CXCR2

(Arvanitakis et al., 1997).

Figure 1.2 Two-dimensional diagram of CCR5 depicting residues critical for ligand binding, receptor integrity, internalization and signal transduction

Tyrosine sulfation sites

Extracellular Domain

Palmitoylatio nsites

Trans-membrane Domain

Y12

G-protein Intracellular binding Y307 Domain

Y339

Serine phosphorylation

Adapted from M. Oppermann Cellular Signaling 16 (2004)

Once expressed in endothelial cells, KSHV-GPCR can trigger a constitutive signal sufficient to induce Kaposi-like sarcomas in mice (Bais et al., 1998; Sodhi et al., 2006).

Altered chemokine expression has also been reported in Kaposi’s sarcoma herpes virus- infected cells. The virus has acquired genes encoding three chemokines, viral macrophage inflammatory proteins (vMIP)-I, -II and –III (Nakano et al., 2003).

Recombinant vMIP-I and –II induced calcium mobilization and are chemotactic for leukemic cells in a CCR5-dependent manner, suggesting a possible mechanism for the propagation of Kaposi’s sarcoma. Taken together, viruses encode chemokine/chemokine receptors to potentially interfere with or take advantage of host chemokines to favour viral replication and dissemination.

1.2.2. Atypical Chemokine Receptor Family

Three ‘atypical’ chemokine receptors, also known as interceptors (internalizing receptors) have been described, namely DARC (Duffy Antigen Receptor for

Chemokines), D6 and CCX-CKR (ChemoCentryx Chemokine Receptor). These receptors, despite considerable structural similarity to chemokine receptors, do not signal in response to chemokine binding. They either lack completely or exhibit an altered

DRY (Asp-Arg-Tyr) motif in the second intracellular loop and therefore cannot couple with G-proteins to initiate signalling cascades (Comerford et al., 2007).

DARC is expressed on venular endothelial cells, cerebellar neurons and erythrocytes, acting as a receptor for a variety of CC and CXC pro-inflammatory chemokines (Pogo and Chaudhuri, 2000). The four extracellular domains of DARC are

essential for chemokine binding, but how they are able to bind multiple chemokines is unclear (de Brevern et al., 2005). The role of DARC during an immune response differs according to where it is expressed. DARC expression on erythrocytes acts as a chemokine sink, both neutralizing excess chemokine in the bloodstream and preventing chemokine diffusion into distant tissues or organs. This was demonstrated in DARC- deficient mice, where intraperitoneal injection of lipopolysaccharide (LPS) induced increased numbers of neutrophils in the lungs and livers in DARC-null compared to wildtype mice (Dawson et al., 2000). The data suggest that in the absence of DARC, excess inflammatory chemokines are allowed to reach distal sites. In contrast, DARC expression on venule endothelial cells seems to play an important role in chemokine transcytosis from the basolateral to the apical side of endothelial cells, as well as their subsequent presentation to leukocytes (Middleton et al., 1997). Localized chemokine injections in DARC-deficient mice resulted in diminished neutrophil recruitment compared to wildtype mice, suggesting that DARC may be important in presenting inflammatory chemokines to circulating leukocytes (Lee et al., 2003). Taken together,

DARC seems to have two distinct functions in vivo: (1) DARC expressed on erythrocytes acts as a chemokine sink to limit chemokine circulation to distant tissues and (2) DARC expression on endothelial cells aid in the transcytosis and presentation of chemokines for circulating leukocytes, in a similar fashion to GAGs (Pruenster and Rot, 2006).

The D6 receptor binds almost all inflammatory CC chemokines (CCL2, CCL3,

CCL3L1, CCL4, CCL4L1, CCL5, CCL7, CCL8, CCL11, CCL13, CCL14, CCL17 and

CCL22), yet does not mediate chemotaxis or signalling (Hansell et al., 2006). Once

bound, the ligand-D6 complex is rapidly internalized and targeted for degradation. Like other signalling chemokine receptors, D6 is recycled back to the cell surface for additional ligand binding. In several inflammatory models using D6-deficient mice, it is clear that D6 is anti-inflammatory, functioning to sequester and eliminate inflammatory chemokines. In a mouse model of psoriasis, repeated application of phorbol ester to the skin manifested a prolonged and exaggerated T cell-dependent cutaneous inflammation.

While inflammation was transient in wildtype mice, D6-deficient mice exhibited exacerbated inflammation with an over-abundance of cutaneous pro-inflammatory CC chemokines (Jamieson et al., 2005). How D6 is able to internalize bound ligand without initiating signal transduction is not clear. In fact, D6 seems to be constitutively phosphorylated on its C-terminal serine residues, but does not require β-arrestin 2 recruitment for internalization and degradation of CCL3 (Weber et al., 2004). Thus, D6 is responsible for the resolution of an inflammatory response by binding in a non-specific manner to and degrading inflammatory chemokines.

The recently described CCX-CKR binds CCL19, CCL21 and CCL25, yet mediates neither chemotaxis nor signal transduction (Comerford et al., 2006). CCX-CKR internalization seems to occur independently of β-arrestin and clathrin-coated pits.

CCL19, CCL21 and CCL25 are critical mediators of lymph node organogenesis, thymocyte localization during T cell development, and recruitment of mature dendritic cells, naïve T cells and some memory T cell subsets into T-cell compartments within secondary lymphoid organs (Campbell et al., 2003; Cyster, 2005; Misslitz et al., 2004;

Muller et al., 2003; Uehara et al., 2002; Ueno et al., 2004). CCX-CKR may actively

regulate migratory events within secondary lymphoid tissues to modulate immune responses.

1.2.3. Receptor Structure

The inherent difficulty in crystallization of chemokine receptors has left the bovine rhodopsin as the only experimental 3D structure available for any GPCRs

(Palczewski et al., 2000). All chemokine receptors are seven trans-membrane receptors, with their N-terminus outside the cell, three extracellular and intracellular loops and a C- terminus that contains multiple serine/threonine and tyrosine phosphorylation residues.

Chemokine receptors have disulphide bridges in their extracellular domains that provide structure to the overall receptor. Generally, one disulfide bridge connects the N-terminus to the third extracellular loop (ECL), while the second links the first and second ECL.

Several post-translational modifications are critical for proper chemokine receptor function. For example, CCR5 is palmitoylated in its C-terminal domain on three cysteine residues which are critical for intracellular trafficking. CCR5 mutants lacking these palmitoylation residues are not expressed on the cell surface and remain sequestered in intracellular biosynthetic compartments (Blanpain et al., 2001). CCR5 is also glycosylated and tyrosine phosphorylated on its N-terminus. Tyrosine sulfation increases receptor affinity for the ligand, as well as enhancing the usage of CCR5 by HIV-1 virus as a cofactor for viral infection. With the exception of decoy receptors, most chemokine receptors are coupled to the heterotrimeric G-proteins through the conserved DRY motif in the second intracellular loop (Lagane et al., 2005).

1.2.4. Chemokine Ligand Binding Domains

The ligand binding regions of chemokine receptors have been defined through various mutagenesis studies. The N-terminal domain of several receptors, namely CCR2,

CCR3, CCR5 and CXCR1 is crucial for ligand binding. CCR5 mutants with N-terminal domain truncations exhibit a progressive decrease in chemokine binding affinity and functional responsiveness (Blanpain et al., 1999a). Specifically, CCR5 mutants lacking residues 2-13 exhibited weak responses to CCL4 and CCL5. Charged and aromatic residues in this region, namely Asp-2, Tyr-3, Tyr-10, Asp-11, and Glu-18, are critical for ligand binding (Blanpain et al., 1999a). In addition to the N-terminus, extensive mutagenesis studies by Blanpain and colleagues have identified the extracellular loop

(ECL) 2 as another important ligand binding domain. As mentioned, two disulphide bonds in the extracellular domains maintain the structure of the receptor helical bundle.

In CCR5, alanine substitution of any of the four extracellular domain cysteine residues, namely Cys-20, Cys-101, Cys-178 and Cys-269, dramatically reduced receptor cell surface expression and resulted in mutant receptors unable to bind CCL4 (Blanpain et al.,

1999b). Mutations to Cys-101 or Cys-178, predicted to link ECL1 and ECL2 of CCR5, abolished recognition by anti-CCR5 antibodies. The epitope for the monoclonal antibody

2D7 that completely blocks CCR5 ligand binding and chemotaxis was mapped to the second ECL of CCR5 (Wu et al., 1997). Furthermore, ECL2 specific monoclonal antibodies are more efficient than antibodies against the N-terminus in blocking CCL4 and CCL5 binding (Lee et al., 1999). Taken altogether, disulfide bonds linking the ECLs are required for maintaining structural integrity necessary for ligand binding and receptor activation. Thus, two hypothetical interactions are believed to play a role in CCR5

activation: the globular body of the chemokine ligand contacts the N-terminus and the extracellular loops of the receptor to orient the ligand N-terminus among the trans- membrane helices. Indeed, the core domains of CCL3 and CCL5 bind distinct residues in

CCR5, whereas the N-terminus of these chemokines mediates receptor activation by interacting with the trans-membrane helix bundle (Blanpain et al., 2003).

The trans-membrane region of CCR5 has also been shown to be important for ligand binding and/or receptor activation. Mutagenesis of the Thr-X-Pro (TXP) motif in the second trans-membrane helix of CCR5 resulted in a receptor with abolished chemokine binding and functional responses (Govaerts et al., 2001). More recently, an interaction between the arginine of the DRY motif and the cytosolic ends of TM6 was shown to play a role in the transition from an inactive to active state (Springael et al.,

2007). The data reinforce the notion that trans-membrane regions contain important structural elements for proper CCR5 ligand binding and subsequent receptor activation.

1.2.5. Receptor Internalization

Ligand-activated chemokine receptors are internalized through clathrin-coated pits after serine phosphorylation by PKC and G-protein receptor kinases (GRKs) of their C- terminal domains. CCR5 is phosphorylated on conserved serine residues Ser-336, Ser-

337, Ser-342 and Ser-349 (Oppermann et al., 1999). Specifically, Ser-337 is exclusively phosphorylated by PKC, whereas Ser-349 represents a GRK phosphorylation site

(Pollok-Kopp et al., 2003). Mutation to any two serine residues abrogated ligand induced receptor internalization and desensitization (Huttenrauch et al., 2002b). T cells from

GRK2+/- mice displayed enhanced CCR5-mediated calcium mobilization and chemotaxis, indicating that GRKs play an important role in chemokine receptor desensitization

(Vroon et al., 2004). Phosphorylation of the C-terminus leads to the recruitment of β- arrestins, which are large, multi-functional proteins that block further G-protein coupling and attenuate additional signalling (Oppermann et al., 1999; Shenoy and Lefkowitz,

2003). Receptor internalization is initiated through β-arrestin binding to the clathrin heavy chain and the β2-adaptin subunit of the heterotrimeric AP-2 adaptor complex

(Oppermann, 2004). Once internalized, receptors accumulate in peri-nuclear recycling endosomes and are recycled back to the cell surface in their dephosphorylated form

(Blanpain et al., 1999c; Mueller and Strange, 2004; Pollok-Kopp et al., 2003).

Chemokine-mediated internalization is abolished in mouse embryonic fibroblasts lacking

β-arrestin 1/2, demonstrating that these molecules are critical for receptor internalization

(Fraile-Ramos et al., 2003). Notably, G-protein mediated signalling seems to be dispensible for CCR5 internalization, as the CCR5 mutant R126N (where Arg-126 of the

DRY motif is replaced by Asn) abolished G-protein activation but there was no effect on endocytosis in response to ligand (Lagane et al., 2005). Monovalent anti-CCR5 antibodies bound efficiently to CCR5 but did not induce internalization, suggesting that

CCR5 must exist, at a minimum, as a dimer for the internalization process to occur

(discussed in more detail in Section 1.2.6.) (Blanpain et al., 2002). Interestingly, β- arrestins not only function to prevent further G-protein signalling, but also recruit and initiate new signals themselves, such as Erk1/2 (Perry and Lefkowitz, 2002).

Additionally, β-arrestin ½ act as scaffolds that connect activated GPCRs with tyrosine kinases c-Src, PI-3’K and NF-κB pathways (Lefkowitz and Shenoy, 2005).

1.2.6. Receptor Homo- and Hetero-Dimerization

Originally thought to function as monomers, it is now widely accepted that chemokine receptors form functional dimers or even higher order oligomers (Hereld and

Jin, 2008). The emergence of new biophysical techniques, such as BRET

(Bioluminescence Resonance Energy Transfer) and FRET (Fluorescence Resonance

Energy Transfer) have allowed for the monitoring of chemokine receptor interactions in live cells. These techniques are based on the non-radiative transfer of energy between an energy donor and an energy acceptor that occurs only when the two are in close proximity, typically within 100Å (Kroeger and Eidne, 2004). Numerous studies have demonstrated that chemokine receptors CXCR2, CXCR4, CCR2 and CCR5 homo- dimerize on the cell surface. CCR5 has been shown to homo-dimerize shortly after synthesis in the endoplasmic reticulum (Issafras et al., 2002). Consistant with this, CCR5 dimers on the cell surface were observed in the absence of ligand, suggesting that ligand binding is not a pre-requisite for CCR5 dimerization (El-Asmar et al., 2005; Issafras et al.,

2002). Similarly, CXCR4 dimerization was also found to be independent of ligand binding (Babcock et al., 2003). Interestingly, co-expression of CCR2b with a mutant

CCR2b, where Tyr-139 in the DRY motif was mutated to phenylalanine (CCR2bY139F), resulted in a non-functional chemokine receptor in response to CCL2 (Mellado et al.,

1998). The data suggest that CCR2 dimerization is a pre-requisite for its function, and that CCR2bY139F may act as a dominant negative by associating with intact CCR2 to form non-functional dimers.

Chemokine receptors also form hetero-dimers with other chemokine receptors.

FRET analysis showed that CCR2b and CCR5 were able to form functional hetero- dimers when co-expressed in cells (El-Asmar et al., 2005; Hernanz-Falcon et al., 2004;

Issafras et al., 2002; Mellado et al., 2001c). Such hetero-dimers are as abundant as homo-dimers, and are only able to bind a single chemokine ligand of either cognate receptor at any one time (El-Asmar et al., 2005). In fact, CCL5 efficiently inhibits CCL2 binding only when both CCR5 and CCR2 are co-expressed, again suggesting that the

CCR2b/CCR5 hetero-dimer is responsive to one ligand. Similarly, CXCR4 will hetero- dimerize with CCR2, but not CCR5 when co-expressed in cells (Babcock et al., 2003;

Percherancier et al., 2005). What remains to be demonstrated is a clear functional relevance for chemokine receptor dimerization. For example, hetero-dimerization of the metabotropic receptor GABAB1 with GABAB2 is absolutely required for their cell surface expression and proper function (Pin et al., 2003). The functional consequence of

CCR2b/CCR5 heterodimers is controversial. Mellado and colleagues first demonstrated that CCR2b and CCR5 homo- and hetero-dimers activate distinct signal transduction pathways. Specifically, they showed that both CCR2b and CCR5 homo-dimers triggered the Jak-Stat pathway and Gαi-mediated activation of PI-3’K in response to their respective ligands. In the presence of both CCL2 and CCL5, they had a synergistic affect on the CCR2b/CCR5 hetero-dimers, activating PI-3’K through Gq/11 and lowering the threshold for calcium mobilization. However, subsequent studies have not been able to reproduce these findings (El-Asmar et al., 2005; Springael et al., 2005). Additionally, these results are incompatible with more current data showing that hetero-dimers respond to only one ligand. Taken altogether, initial excitement over the possibility that different

combinations of chemokine receptor hetero-dimers may lead to distinct biological function is purely speculative, and requires further investigation.

More recently, chemokine receptors have been reported to form hetero-dimers with receptors belonging to other families. For example, CCR5 and CXCR4 were reported to interact with opioid receptors, although the physiological relevance remains unclear

(Chen et al., 2004; Pello et al., 2008; Suzuki et al., 2002). Recent studies have demonstrated that the CXCR4/δ-opioid receptor hetero-dimer completely inhibited signalling in response to ligands for both receptor (Pello et al., 2008). It is intriguing to speculate that such dimerization “locks” each receptor in an inactive conformation to negatively regulate signalling.

1.3. Chemokine/Chemokine Receptor Function and the

Immune Response

1.3.1. Chemotaxis

Chemotaxis, or directed cell migration, is a tightly regulated process, critical for numerous biological processes including proper tissue development, wound healing and protection against invading pathogens. Chemotaxis requires the activation and redistribution of a number of signalling, adhesion and cytoskeletal molecules at the cell surface. Numerous external stimuli that engage various cell surface receptors and signalling cascades, can promote cell migration.

1.3.1.1. Cell Polarization

In general, cell migration can be viewed as a cyclical process. First, plasma membrane receptors for a chemo-attractant bind their cognate ligand(s) and cluster at the leading edge of the cell, known as the lamellipodium. This leads to the accumulation of intracellular signalling and lipid molecules at this leading edge, causing the cell to polarize. Second, there is formation of adhesions that attach the protrusion to the substratum on which the cell is rolling. These act as traction points for migration, integrating adhesion molecule signals to control dynamics and protrusion activities. To complete the cycle, adhesion molecules detach at the back of the cell (termed the uropodium) coupled with contractions to move the cell body forward (Giannone and

Sheetz, 2006; Hynes, 2002; Nelson and Nusse, 2004). F-actin polymerization is localized at the lamellipodium, critical for the assembly of cellular protrusions (Cory et al., 2003;

Pollard and Borisy, 2003). Not surprisingly, lamellipodia contain numerous actin- modifying enzymes, namely the Arp2/3 complex, WAVE/Scar and WASp (Myers et al.,

2005; Nozumi et al., 2003; Sukumvanich et al., 2004). In contrast, myosin-II is assembled at the uropodium and lateral sides of the cell, where it provides rigidity to the polarized cell through cortical tension. Assembly and contraction of actin:myosin filaments at the uropodium provides the mechanical force needed to move the cell forward. Therefore, re-distributing signalling and structural molecules to establish cell polarity is a crucial initial step during chemotaxis.

1.3.1.2. Activation of the PI-3’K Pathway

PI-3’Kinase and its lipid product phosphatidylinositol-3,4,5 triphosphate

(PI(3,4,5)P3) have been widely implicated in controlling cell migration and polarity. The

PI-3’K family of proteins are defined as lipid kinases that phosphorylate the 3’-OH position of the inositol ring of phosphoinositides and its derivatives (Vanhaesebroeck et al., 2001). Members of the family are grouped into four classes (IA, IB, II and III) on the basis of their structure and substrate specificity. Class IA and IB PI-3’K members are the best characterized and are primarily responsible for the production of PI(3,4,5)P3 in response to extracellular stimulation. Class IA PI-3’K generally functions downstream of receptor tyrosine kinases and exist as a stable hetero-dimer, consisting of one of three catalytic isoforms (p110α, p110β or p110δ) that associate with any one of the five regulatory isoforms (p85α, p55β, p50α, p85β or p55γ). Class IB PI-3’K is activated by the G protein βγ subunit, and consists of a p101/p87 regulatory subunit and a p110γ catalytic subunit. Class II PI-3’K poorly phosphorylates PI(4,5)P2 and its biological

function is not well understood (Falasca and Maffucci, 2007). Class III PI-3K is homologous to the yeast protein Vps34p and regulates intracellular vesicle trafficking

(Odorizzi et al., 2000). Once activated at the lamellipodium, PI-3’K is largely responsible for the generation and accumulation of PI(3,4,5)P3 at the leading edge of the cell. These phospholipids then act as secondary messengers to exclusively recruit proteins with pleckstrin homology (PH) domains to localize a number of integrated signalling pathways at the lamellipodium of the migrating cell. Of particular importance is the PH domain containing Protein Kinase B (PKB, also known as Akt), which is recruited to the membrane and phosphorylated on Thr-308 by Phosphoinositide-

Dependent Kinase 1 (PDK1). Full PKB activation requires additional phosphorylation on

Ser-473 within the hydrophobic motif, either by mTORC2 or DNA-PKCS (Feng et al.,

2004; Manning and Cantley, 2007). PKB is largely responsible for activation of a wide range of signalling cascades, many intimately involved in cell cycle progression, cell survival, metabolism, translation and cell motility (Brazil et al., 2002).

Constitutive PI-3’K activation is associated with tumorigenesis, thus negative regulation by phosphatases determine critical tumour suppressor proteins. The SH2 domain-containing Inositol Phosphatase (SHIP) has a 5’-phosphoinositide phosphatase activity which converts PI(3,4,5)P3 to PI(3,4)P2 (Kalesnikoff et al., 2003; Rohrschneider et al., 2000). Another important phosphatase, the Phosphatase and Tensin Homolog

Deleted in Chromosome Ten (PTEN), hydrolyzes PI(3,4,5)P3 to PI(4,5,)P2 (Stambolic et al., 1998). These phosphatases are critical suppressors of constitutive PI-3’K activity,

also associated with maintaining localized PI-3’K activation at the leading edge of the migrating cell (discussed below).

The role of PI-3’K in chemokine-mediated cell migration has been well documented through the use of pharmacological inhibitors such as wortmannin and

Ly294002. Turner and colleagues first demonstrated that CCL5-mediated T cell chemotaxis and polarization were dependent on PI-3’K activation (Turner et al., 1995b).

Subsequent studies have shown that other chemokines, namely CCL2 and CXCL12, stimulate wortmannin-sensitive chemotaxis of various cell types (Sotsios et al., 1999;

Turner et al., 1998). It is now clear that localized PI-3’K activation at the lamellipodium is crucial to establish polarity and maintain chemotactic signalling gradients. Indeed,

GFP-tagged PH domains that selectively bind PI(3,4,5)P3 accumulate at the leading edge of polarized cells undergoing chemotaxis (Rickert et al., 2000; Servant et al., 2000).

Coincidently, studies have shown that PTEN is largely excluded from the leading edge of the migrating cell and accumulates at the trailing edge. The net effect is a transient increase in the level of PIP3 at the lamellipodium. The crucial role of PTEN is underscored by studies where overexpression or deficiency of PTEN were reported to reduce or enhance leukocyte motility, respectively (Fox et al., 2002). Presumably, the lack of PTEN leads to a loss or impairment in directionality, as PIP3 accumulation is less localized.

In recent years, much of the focus has been on elucidating the role of different PI-

3’K isoforms on chemotaxis, using gene-specific knockout mice and isoform-specific

pharmacological inhibitors. The PI-3’Kγ isoform is undoubtedly a key regulator of chemotaxis, activated downstream of chemokine receptors by the G-protein βγ subunit.

This seems to be the case for neutrophils and macrophages, where p110γ-deficiency leads to defective chemotaxis towards several chemokines (Hirsch et al., 2000; Li et al., 2000;

Sasaki et al., 2000). However, B cells do not utilize p110γ, but rather use p110δ for

CXCL13-mediated chemotaxis and homing to Peyer’s patches (Reif et al., 2004).

Furthermore, the chemotactic responses of PI3Kγ-deficient T cells towards CXCL12,

CCL19 and CCL21 was not completely abrogated, suggesting that other PI-3’K isoforms and/or PI-3’K-independent events are required for efficient migration (Reif et al., 2004).

Certainly, studies have shown that the Class IA p85/p110 hetero-dimer contributes to the signals that determine optimal chemotactic migration towards CCL5 and CXCL12 in T cells (Curnock et al., 2003; Turner et al., 1995b). In fact, the regulatory subunit p85 co- immunoprecipitates with CXCR4 after CXCL12 stimulation, although a similar association with CCR5 has not been shown (Vicente-Manzanares et al., 1999). The p85/p110 hetero-dimer is known to interact with phosphotyrosine-containing proteins, while CCL5 has been shown to mediate tyrosine phosphorylation/activation of a number of effector molecules, including p56 lck, focal adhesion kinase (FAK) and zeta-associated protein (ZAP-70) (Bacon et al., 1996; Vanhaesebroeck et al., 2001; Wong et al., 2001).

Although speculative, these proteins may be able to couple the p85/p110 hetero-dimer with activated CCR5.

1.3.1.3. Recruitment of Rho family GTPases

The Rho family of small GTPases are key regulators of the actin/myosin cytoskeleton during chemotaxis, the most well-known members being Rho, Rac and

Cdc42 (Raftopoulou and Hall, 2004). They act as molecular switches by cycling between

GDP-bound, inactive and GTP-bound, active forms. Rho GTPases are intimately regulated by guanidine nucleotide exchange factors (GEFs) that catalyze the exchange of

GDP for GTP. Many RhoGEFs contain a PH domain, allowing them to accumulate at the leading edge of the migrating cell in response to phospholipids. Indeed, GFP reporter studies have demonstrated that both Rac1 and Cdc42 are exclusively recruited to and activated at the lamellipodium (Itoh et al., 2002; Kraynov et al., 2000; Srinivasan et al.,

2003). Interestingly, Rac1 can stimulate PI-3’K activity, possibly establishing a positive feedback loop for sustained asymmetrical accumulation of PI(3,4,5)P3 at the leading edge

(Wang et al., 2002). It is now clear that Rac1 and Cdc42 are crucial regulators of F-actin polymerization directing peripheral lamellipodial and filopodial protrusions, respectively

(Raftopoulou and Hall, 2004). A family of WAVE/Scar and WASp proteins bridge Rac1 and Cdc42 to the Arp2/3 complex, that functions to nucleate actin polymerization and facilitate branching of actin filaments (Pollard and Borisy, 2003). Specifically, Rac1, through its binding to IRSp53, regulates WAVE dependent Arp2/3 complex activation

(Miki et al., 2000). Cdc42 directly binds to N-WASP, exposing the domains that activate the Arp2/3 complex (Suetsugu et al., 1998). These dynamic actin structures at the leading edge enable cells to form protrusion on the substratum in preparation for migration. Migrational studies with Rac1 and Rac2 double-deficient hematopoietic cells and neutrophils revealed that the cells were unable to respond to chemokines because of defective F-actin polymerization (Gu et al., 2003). In contrast to Rac and Cdc42, Rho

seems to accumulate at the rear of the cell, where it regulates the assembly of contractile, actin:myosin filaments through its effectors Rho kinase (ROCK) and myosin light chain kinase (MLCK) (Amano et al., 1997; Amano et al., 1996; Ohashi et al., 2000; Sumi et al.,

2001). Therefore, Rho is an important regulator of cell contractions at the uropodium of the migrating cell. Notably, CCL5 was shown to induce RhoA activation in Jurkat T cells, although its role in chemotaxis was not investigated (Bacon et al., 1998). A pharmacological inhibitor of ROCK blocked adhesion and migration of monocytes across endothelial cells (Honing et al., 2004). There is also evidence that RhoA, acting through mDia, has a direct positive effect on microtubule stability at the leading edge (Palazzo et al., 2001). Recent studies have shown that mDia1-deficient T cells exhibit reduced chemotaxis, negligible actin filament formation and impaired polarity in response to

CXCL12 and CCL21 (Sakata et al., 2007).

1.3.1.4. MAPK Signalling and Cytoskeletal Dynamics

The Mitogen-Activated Protein Kinase (MAPK) pathways that activate Erk, Jnk and p38 kinases elicit wide-ranging cellular outcomes, including regulating gene expression, cell proliferation and cell motility (Pullikuth and Catling, 2007). MAPK signalling cascades comprise a core hierarchy of three kinases, each of which is activated through phosphorylation by the kinase positioned upstream of it. Thus, the MAPKs are phosphorylated and activated by the MAPK kinases (MAPKKs), which are themselves activated by the MAPKK kinases (MAPKKK) (Figure 1.3). Numerous growth factors and cytokines signal through MAPKs to induce cellular proliferation and the transcriptional activation of cytokine genes (Pullikuth and Catling, 2007). Given that

Figure 1.3 The MAPK Signalling Cascade

Mekk1-4, Tak1-3, Tao1-3,

MAPKKK Raf Mekk1Ask1-2, Tpl2, Mlk3Tak

MAPKK Mek1/2 Mek4/7 Mek3/6

MAPK Erk1/2 Jnk1/2 p38

Biological Response

chemokines are potent inducers of cytokines and proliferation, it is not surprising that chemokines can activate multiple MAPK signalling cascades. For example, ligands for

CCR5 have been demonstrated to activate Erk, Jnk and p38 signalling pathways (Brill et al., 2001; Ganju et al., 1998; Kraft et al., 2001; Misse et al., 2001; Wong et al., 2001)

Similarly, CXCL12 has been shown to induce Erk1/2 phosphorylation, leading to increased astrocyte proliferation (Bajetto et al., 2001). Several studies have demonstrated a specific contribution of MAPKs to cellular motility through the regulation of expression of focal adhesions. Active Erk localizes to adhesions at the uropodium and facilitates their disassembly to promote motility (Suetsugu et al., 2006; Webb et al., 2004).

Although a specific mechanism has not been described, sustained Erk phosphorylation appears important in the down-regulation of Rho-dependent stress fibre formation (Sahai et al., 2001). Disassembly of adhesions by MAPKs at the rear of the cell allows for the migrating cell to push forward. Thus, MAPKs may play an unexpected role in chemotaxis by regulating cytoskeletal dynamics in addition to their well described functions as regulators of cell proliferation and cytokine production.

1.3.2. Role in Cell Death and Survival

Accumulating evidence has shown that chemokines invoke both apoptotic and anti-apoptotic events in a wide range of cell types. Whether a chemokine protects from or induces cell death depends on the chemokine, its concentration and/or the target cell.

One possible role for chemokine-mediated apoptosis is the resolution of an immune response. Activation induced cell death (AICD) of T cells is an important mechanism of clonal deletion after an immune response. Death receptors, especially Fas/FasL

(CD95/CD95L) interactions have been described as important inducers of AICD in T cells, although different effectors, including c-Myc and TRAIL, have also been described

(Green et al., 2003; Ju et al., 1995). Several reports have demonstrated that chemokines can potentiate T cell death. CXCL12 induces apoptosis of Jurkat T cells through a

Fas/FasL dependent mechanism after 3 days in culture (Colamussi et al., 2001).

Similarly, XCL1 can co-stimulate the apoptosis of CD4+ T cells triggered through the

CD3/TCR. This apoptosis is also dependent on Fas/FasL signalling, leading to caspase-9, caspase-7 and PARP cleavage (Cerdan et al., 2001). These studies indicate that chemokines may determine T cell fate during an immunological response, in addition to

AICD. Mellado and colleagues reported that melanoma tumour cell-derived CCL5 induced apoptosis of tumour infiltrating T lymphocytes (TILs) as a potential immune escape mechanism in melanoma progression. T cell apoptosis was CCR5-dependent, and mediated by cytochrome c release, caspase-9 and caspase-3 activation (Mellado et al.,

2001a). CCL5-CCR5 mediated caspase-3 activation and cell death were also reported in neuroblastoma cells, and there is also evidence that the HIV-1 envelope-mediated apoptosis of bystander uninfected CD4+ T cells, which leads to T cell depletion in infected individuals, is CCR5-dependent (Algeciras-Schimnich et al., 2002; Yao et al.,

2001). CCR5 deficiency may predispose individuals to the development of fulminant liver failure (FLF), by preventing hepatic NKT cell apoptosis (Ajuebor et al., 2005).

Work from our laboratory has demonstrated that CCL5-CCR5 interactions induce T cell death (Murooka et al., 2006) (Chapter 2). Specifically, we showed that CCL5 aggregation at high ligand concentrations induces apoptosis in PM1, MOLT-4 and activated peripheral blood T cells in a CCR5-dependent manner. When T cells are

subjected to µM concentration of CCL5, cells undergo apoptosis through cytosolic release of the mitochondrial pro-apoptotic factors cytochrome c, caspase-9 and caspase-3, followed by poly ADP ribose polymerase (PARP) cleavage. We showed that CCL5- mediated cell death is independent of G-proteins, but rather dependent on tyrosine kinases initiated through the Tyr-339 residue found on the C-teriminus of CCR5. Finally, we showed that CCL5-GAG interactions and CCL5 oligomerization are important pre- requisites to initiate a cascade of events resulting in T cell death. Taken together, our data suggest that CCL5-induced cell death, in addition to CD95/CD95L mediated events, may contribute to clonal deletion of T cells during an immunological response.

By contrast, there is evidence that chemokines have anti-apoptotic properties.

CCL3, CCL4 and CCL5, either individually or in combination, will reduce anti-CD3- induced apoptosis of T cell blasts. These chemokines do not affect CD3 or Fas cell surface expression levels, suggesting that they reduce AICD downstream of Fas (Pinto et al., 2000). Interestingly, Tyner and colleagues have reported that virus-inducible CCL5 is required to prevent apoptosis of virus-infected mouse macrophages in vivo. The protective effects of CCL5 are dependent on CCR5 and activation of the PI-3’K/Akt and

Mek/Erk signalling pathways (Tyner et al., 2005). Although apparently contradicting our data (Murooka et al, 2006), the cell lineage studied (macrophages vs T cells) and the lower dose of CCL5 employed may explain these different observations. CCL1 activation of CCR8 protected murine thymic lymphomas against corticoid- and dexamethasone- induced apoptosis, possibly through Erk1/2 phosphorylation (Louahed et al., 2003;

Spinetti et al., 2003). Viewed altogether, conflicting data in regard to the pro- or anti-

apoptotic properties of several chemokines reflect the need for further studies. The ability of chemokines to determine cell fate is a consequence of a number of important factors, such as the nature of the chemokine, whether it exhibits aggregation and GAG- binding, the chemokine dose effect, the nature of the specific cognate receptor, and the lineage of the target cell. These factors are particularly important when considering chemokine antagonists as possible therapeutics. The anti-apoptotic and survival effects of chemokines are further discussed in Section 1.4.2.2.

1.3.3. T cell Co-stimulation

Distinct from their chemotactic properties, a number of chemokines have been shown to co-stimulate T cell activation. For example, CXCL12 can co-stimulate anti-

CD3 stimulation of CD4+ T cells in the context of proliferation and IL-2, IFNγ, IL-4 and

IL-10 production. CXCL12 treatment alone did not have the same effect, suggesting that the chemokine functions as a co-stimulator for T cells (Nanki and Lipsky, 2000). Such co-stimulation was PTx-sensitive, but not altered by anti-CD25 antibodies, indicating the dependence on G-protein, but not IL-2, mediated signalling (Nanki and Lipsky, 2001).

Furthermore, CXCL12 stimulated the physical association between CXCR4 and the TCR to initiate signalling through ZAP-70 (Kumar et al., 2006). CCL5 is also a T cell costimulatory molecule in the context of CD3 stimulation (Makino et al., 2002; Taub et al.,

1996). Studies in CCL5 deficient mice showed impaired T cell proliferation and cytokine production in response to antigen or anti-CD3 stimulation (Makino et al., 2002). Anti-

CD3 stimulation of T cells, together with nM concentrations of CCL5, result in increased proliferation and cytokine production, dependent on IL-2 and extracellular calcium (Taub

et al., 1996). In the same study, CCL3, CCL4 and CCL5 all induced expression of B7.1 in antigen presenting cells (APCs), suggesting an additional mechanism to modulate T cell activation. In Jurkat T cells, Dairaghi and colleagues showed that T cell responses to

CCL5 are dependent on the level of CD3 cell surface expression (Dairaghi et al., 1998).

Interestingly, CCR5 constitutively co-localizes with CD4 on the cell surface (Xiao et al.,

1999). Furthermore, at higher, µM concentrations, CCL5 stimulated antigen-independent activation of T cells in the context of increased proliferation, CD25 expression and cytokine production. This unexpected property of CCL5 demonstrated that high doses of

CCL5 can bypass T cell receptor recognition of antigen to activate T cells (Bacon et al.,

1995; Dairaghi et al., 1998). Since these initial observations, it is now apparent that at these µM concentrations, CCL5 forms large oligomers with a mass greater than 100 kDa

(Appay et al., 1999; Appay et al., 2000). CCL5 variants with a Glu-26 to alanine mutation (E26A-CCL5), or a Glu-66 to serine mutation (E66S-CCL5) were unable to form higher order aggregates at µM concentrations (Appay et al., 1999; Czaplewski et al.,

1999). These mutants are unable to activate T cells, demonstrating that the aggregating properties of CCL5 are important for T cell activation (Appay et al., 1999; Appay et al.,

2000). Notably, the non-aggregating mutants retain their ability to signal via classical G- protein dependent pathways in vitro. Whether high CCL5 concentrations are attainable in vivo is unclear. Certainly, unusually high CCL5 concentrations may be realizable at site of acute infection or inflammation through the sequestration of CCL5 by cell surface and/or extracellular matrix GAGs. In addition, the unique ability of CCL5 to form higher order aggregates, facilitated through GAG-binding, may also lead to an increase in local

CCL5 concentration (Appay et al., 1999; Appay et al., 2000; Czaplewski et al., 1999;

Hoogewerf et al., 1997; Kuschert et al., 1999; Martin et al., 2001; Proudfoot et al., 2001;

Proudfoot et al., 2003).

1.3.4. The mTOR/4E-BP1 Pathway and Chemotaxis

Regulation of protein synthesis in eukaryotes plays a critical in development, differentiation, cell cycle progression, cell growth and apoptosis. Not surprisingly, protein synthesis is regulated by both transcriptional and translational processes. One highly regulated process is mRNA translation, (Proud, 2007). Once mRNAs are transcribed, processed and exported into the cytoplasm, they are available for translation through two principle pathways. The first involves the binding of translation initiation factors (eIFs) to the 7-methyl guanosine residue (m7GpppN, where m is a methyl group and N is any nucleotide) that caps the 5’ end of all nuclear-encoded eukaryotic mRNAs, termed cap-dependent translation. Specifically, the interaction of the cap structure with eIF4E, via the ribosomal-subunit-associated eIF4G, directs the translational machinery to the 5’end of the mRNA (Richter and Sonenberg, 2005). A second pathway uses complex secondary structure elements in the mRNA, called Internal Ribosomal Entry Segments

(IRES), to recruit small ribosomal subunits, independently of the cap structure, referred to as cap-independent translation (Jackson, 2005). Because the vast majority of eukaryotic mRNAs are translated in a cap-dependent manner, eIF4E represents the rate-limiting step for translation, and is subject to exquisite regulation.

The embryonic lethality of mTOR-deficient mice demonstrates the importance of mTOR during development (Gangloff et al., 2004; Martin and Sutherland, 2001). mTOR

possesses a carboxy-terminal region sharing significant homology with lipid kinases, especially with PI-3’K, and has been assigned to a larger protein family termed the

PIKKs (Phosphoinositide Kinase-related Kinase) (Gingras et al., 2004). The anti-fungal macrolide, rapamycin, is a potent immuno-suppressive agent with additionl potent anti- proliferative properties. In the early 1990s, rapamycin was shown to bind to a small protein receptor called FKBP12 (FK506-binding protein 12kDa), and the complex specifically interacted with mTOR to inhibit its function (Sabatini et al., 1994; Sabers et al., 1995). However, there is controversy whether rapamycin directly inhibits the intrinsic kinase activity of mTOR by blocking autophosphorylation or whether it prevents mTOR from interacting with its substrates (Edinger et al., 2003b; Peterson et al., 2000). mTOR exists in two complexes: mTOR Complex1 (mTORC1), which is sensitive to rapamycin and phosphorylates p70 S6K1 and initiation factor 4E binding proteins (4E-BPs), and mTOR Complex2 (mTORC2), which is rapamycin-resistant and phosphorylates PKB

(Dann et al., 2007; Gingras et al., 1998; Hay and Sonenberg, 2004). mTORC1 is a complex containing mTOR, Raptor (Regulatory Associated Protein of mTOR) and mLST8, while the mTORC2 complex consists of mTOR, Rictor (Rapamycin-Insensitive

Companion of mTOR), Sin1 and mLST8 (Jacinto et al., 2004; Kim et al., 2002). Given the importance of mTOR in development and protein translation, its activation is under exquisite control by several molecules. The major upstream positive regulator is the small GTPase, Rheb (Ras-Homolog Enriched in Brain) (Saucedo et al., 2003). Similar to other GTPases, GTP-bound Rheb, but not GDP-bound, is active and stimulates mTOR kinase activity (Long et al., 2005). Rheb activity is negatively regulated by the mammalian TSC1/2 (Tuberous Sclerosis Complex 1/2), by increasing the intrinsic GTP

hydrolysis of Rheb (Inoki et al., 2003). Thus, TSC1/2 is a potent negative regulator of mTOR by inactivating Rheb activity. It is now clear that TSC1/2 represent tumour suppressor proteins, where mutation to either one is sufficient to cause TSC tumor formation in a number of target organs (Yang and Guan, 2007). TSC1 and TSC2 form a physical and functional complex, where TSC1 stabilizes the complex and TSC2 exerts

GTPase activating protein (GAP) activity. Thus, mutations in the TSC1/2 complex lead to a hyperactive mTOR, leading to uncontrolled tumour formation (Gao et al., 2002).

Upstream of TSC1/2 is PKB, an important survival kinase with a wide array of effector molecules. PKB has been shown to phosphorylate TSC2 directly on multiple sites to inhibit its function (Inoki et al., 2002). Given that PI-3’K is largely responsible for the recruitment and activation of PKB, as described earlier, it is now well established that PI-

3’K is responsible for indirectly activating mTOR activity (Figure 1.4). Another important modulator of mTOR activity is phospholipase D (PLD)-dependent generation of phosphatidic acid (PA). Several studies reported that PA was required for mTOR- dependent S6K activation and 4E-BP1 phosphorylation in several cell types (Fang et al.,

2001; Foster, 2007; Hornberger et al., 2006). Interestingly, PA seems to compete for mTOR binding with the rapamycin/FKBP12 complex, thereby modulating mTOR activity (Fang et al., 2001).

A wide range of factors, including hormones, growth factors, mitogens and amino acids, can initiate protein translation. eIF4E availability represents the rate-limiting step for cap-dependent translation and thus act as the node of convergence for a number of upstream signalling events. Three eIF4E inhibitory proteins, the 4E-BPs (4E-BP1-3, also

Figure 1.4 Regulation of cap-dependent mRNA translation

The PI-3’K/PKB/mTOR pathway is activated by growth factors, hormones, mitogens, cytokines and chemokines. Nutrients (amino acids, glucose) also activate mTOR. The AMP-activated protein kinase (AMPK) also phosphorylates and enhances the activity of TSC2 under energy starvation. Activation of Ras/Raf/Mek/Erk pathways leads to Mnk activation. Mnk phosphorylates eIF4E within the eIF4F complex to regulate its binding affinity for the 5’-cap structure of mRNAs.

Growth factors, hormones, mitogens, cytokines, chemokines

PI-3’K Energy PIP2 PIP3 starvation Ras PTEN PDK1

Raf AMPK PKB

Mek TSC1/2 * Erk Rheb-GTP 5’-TOP mRNA translation mTOR (e.g., ribosomal proteins) Mnk

4E-BP1 S6K1

eIF4E eIF4B

Cap-dependent translation (e.g., cyclin D1, VEGF, c-Myc)

* Positive feedback loop by rapamycin-resistant mTORC2

known as PHAS-1-3 for Phosphorylated Heat and Acid Soluble protein stimulated by

Insulin), regulate mRNA translation by sequestering eIF4E. They constitute a family of proteins that compete with eIF4G for an overlapping binding site on eIF4E. Indeed, through X-ray crystallographic analysis, peptides derived from the regions of eIF4G and

4E-BP1 form nearly identical α-helical structures that lie along the same convex region of eIF4E (Marcotrigiano et al., 1997; Matsuo et al., 1997). Notably, the eIF4G and 4E-BP1 binding sites on eIF4E do not overlap the cap binding sites. By sequestering eIF4E, 4E-

BPs are negative regulators of mRNA translation that requires high levels of available eIF4E. Binding of the 4E-BPs to eIF4E is regulated by phosphorylation (Pause et al.,

1994). Hypo-phosphorylated 4E-BPs efficiently bind eIF4E, but once hyper- phosphorylated on specific serine and threonine residues, this interaction is abrogated.

The number of phosphorylation sites is controversial, but the most critical sites for eIF4E release are located on Thr-37, Thr-46, Ser-65, and Thr-70 (Hay and Sonenberg, 2004). In fact, phosphorylation seems to proceed in a hierarchical manner. The Thr-37/46 residues represent the priming sites, and are phosphorylated by mTOR in vitro (Brunn et al., 1997;

Burnett et al., 1998). Phosphorylation at these priming sites is critical for subsequent phosphorylation on Thr-70, followed by Thr-65, ultimately leading to the release of 4E-

BP1 from eIF4E (Hay and Sonenberg, 2004). X-ray crystallography studies have revealed that these residues on 4E-BP1 are all in close proximity to acidic amino acid residues in eIF4E when in a complex. Therefore, accumulation of negatively charged phosphate groups would likely lead to electrostatic repulsion of the acidic residues, to mediate release of 4E-BP1 from eIF4E (Gross et al., 2003). Additionally, mTOR controls the translation of 5’-TOP (tract of oligopyrimidines) mRNAs which often encode

for cytoplasmic ribosomal proteins (Meyuhas, 2000; Ruvinsky and Meyuhas, 2006).

Although 5’-TOP mRNA translation is sensitive to rapamycin, the mechanism of action is unclear and studies have shown that S6K1 and its effector molecule rpS6 are dispensable for their translation (Ruvinsky et al., 2005). Taken together, mTOR is a critical regulator of the translational machinery by: (1) directly influencing eIF4E availability for 5’-capped mRNA translation initiation and (2) up-regulating ribosomal protein levels through modulation of 5’-TOP mRNA translation.

By regulating eIF4E availability, the assembly of the mRNA translation machinery is greatly affected, thereby resulting in changes in the rate of protein translation. The mRNA 5’-cap structure is bound by eIF4F, a hetero-trimeric protein complex comprised of a large, scaffold protein eIF4G, the RNA helicase eIF4A and the cap-binding eIF4E (Figure 1.5). eIF4G also associates with eIF3, a multi-subunit, ribosome-associated initiation factor, to bridge the mRNA to the 40S ribosomal subunit.

The 40S ribosomal subunit is bound to eIF2, GTP and the initiator methionine-transfer

RNA (Met-tRNA), and the entire complex is termed the 43S pre-initiation complex

(Proud, 2007). In addition, the N-terminus of eIF4G binds the poly(A) binding protein

(PABP), leading to the circularization of the mRNA via the cap-eIF4F-poly(A) tail bridge, which enhances mRNA translation. Optimal binding and passage along the 5’-UTR towards the initiation codon by the translation initiation complex is often hindered by long, complex secondary structures that are found in the 5’-UTR of some mRNAs

(Richter and Sonenberg, 2005). The helicase function of eIF4A is enhanced by eIF4B, and is critical for unwinding the inhibitory secondary structures present in the 5’UTR.

Figure 1.5 eIF4F formation and ribosome recruitment

Hypo-phosphorylated 4E-BP1 binds to and sequesters eIF4E. (B) Once phosphorylated, 4E-BP1 dissociates from eIF4E, allowing eIF4E to be incorporated into the eIF4F complex. (C) Through eIF4E, eIF4F binds to the mRNA 5’-cap structure. (D) The helicase activity of eIF4E (along with eIF4B) unwinds secondary structure within the 5’- UTR of the mRNA. (E) The resulting single stranded mRNA is further bound by the 43S pre-initiation complex via eIF3 that bridges the 40S ribosomal subunit with eIF4G. The complex scans the 5’-UTR towards the start codon. eIF4G also interacts with PABP1 to circularize the mRNA.

eIF4A A eIF4G B

eIF4E cap AUG 4E-BP1 mRNA eIF4F complex ATP Pi

ADP P cap

AUG C

eIF4B

AUG

ATP

mRNA unwinding

ADP + Pi

AUG D

eIF2 eIF1A + GTP 40S + + Met-tRNA eIF3

43S pre-initiation complex AUG E

PABP (A)n

Once the 43S pre-initiation complex is bound to mRNA, it is thought to scan the mRNA in the 5’ to 3’ direction (Proud, 2007). When it encounters an AUG start codon in the proper sequence context, other factors, including the 60S ribosomal subunit, are recruited in order for protein synthesis to begin.

Two mRNA transcripts may be translated at very different rates, depending on the length and structure of their 5’-UTRs. As mentioned earlier, the helicase activity of the eIF4F translation initiation complex is crucial for unwinding inhibitory structures within the 5’-UTR. Those mRNAs that are well translated when eIF4E availability is low are termed “strong” mRNAs, and have relatively short, unstructured 5’-UTRs (e.g. β-actin,

GAPDH). Translation of “weak” mRNAs are most sensitive to alterations in eIF4F levels, and typically encode for proliferative and survival proteins (e.g. c-Myc, vascular endothelial growth factor (VEGF), bcl-2) (Armengol et al., 2007; Graff and Zimmer,

2003). This ensures that proliferation and survival proteins are preferentially synthesized only during optimal growth conditions.

Several published reports suggest a role for both mTOR and p70 S6K1 in cellular migration. GM-CSF-mediated neutrophil chemotaxis is inhibited by rapamycin, and the extent of S6K1 phosphorylation correlates with migration (Gomez-Cambronero, 2003;

Lehman and Gomez-Cambronero, 2002). Fibronectin-induced migration of human arterial E47 smooth muscle cells is sensitive to rapamycin (Sakakibara et al., 2005).

Several chemokines have been reported to activate S6K1, but this activation was studied in the context of cell survival and proliferation, not migration (Hwang et al., 2003; Joo et

al., 2004; Lee et al., 2002; Loberg et al., 2006). As mentioned previously, a G protein- coupled receptor encoded by KSHV exhibits constitutive activation of the TSC2/mTOR pathway to promote Kaposi’s sarcomagenesis (Montaner, 2007; Sodhi et al., 2006).

However, the specific role for mTOR-dependent protein translation in T cell chemotaxis is unclear. Recently, we demonstrated that rapamycin significantly reduced CCL5- mediated T cell chemotaxis in vitro (Murooka et al., 2008). CCL5 induced rapid phosphorylation/activation of mTOR, p70 S6K1 and ribosomal protein S6. Additionally,

CCL5 induced PI-3’K-, phospholipase D and mTOR-dependent phosphorylation/deactivation of the transcriptional repressor 4E-BP1, which resulted in its dissociation from eIF4E. Subsequently, eIF4E associated with the scaffold protein eIF4G, forming the eIF4F translation initiation complex. Indeed, CCL5 initiated active translation of mRNA, shown by the increased presence of high-molecular-weight polysomes which were significantly reduced by rapamycin treatment. Notably, CCL5 induced protein translation of cyclin D1 and MMP-9, known mediators of migration. Our data describe a mechanism by which CCL5 directly regulates translation of chemokine- related mRNAs to “prime” CD4+ T cells for efficient chemotaxis.

1.4. Chemokine/Chemokine Receptors and Disease

1.4.1. Rheumatoid Arthritis

The influx of IFNγ-secreting CD4+, CD8+ effector T cells and activated macrophages into tissues is characteristic of Th1-type inflammatory diseases, including rheumatoid arthritis (Loetscher et al., 1998; Qin et al., 1998). RA is a chronic inflammatory disease that affects synovial tissue in multiple joints. Such chronic inflammation leads to severe morbidity and progressive structural damage to the joints.

While genetic associations between RA and variants of the human leukocyte antigens

(HLA) are well established, other genes also play important roles in RA susceptibility, including chemokine/chemokine receptors (Jawaheer et al., 2002). RA is characterized by extensive infiltration of activated T cells, B cells and macrophages into affected joints, leading to the expansion of the synovial tissue. Inflammatory chemokines are critical for actively recruiting leukocytes into inflamed synovial joints. Indeed, analysis of synovial tissue and synovial fluid from patients with RA, revealed abundant expression of a wide range of inflammatory chemokines and their receptors (Haringman et al., 2004; Hosaka et al., 1994; Wong et al., 2003). RA synovial fibroblasts produce chemokines CCL2, CCL3,

CCL4 and CCL5 in response to TNFα, IL-1α and IL1β (Hosaka et al., 1994; Luster,

1998). In turn, these inflammatory chemokines promote leukocyte recruitment to the joints and stimulate cells to release additional inflammatory mediators. For example, stimulation of fibroblast-like synoviocytes from RA patients with CCL2, CCL5 or

CXCL12 resulted in enhanced IL-6 and IL-8 production (Nanki and Lipsky, 2001). Thus, accumulating evidence implicates inflammatory chemokines in RA disease progression,

both through recruitment of activated leukocyte and direct modulation of cytokine production in the affected joints.

Animal models for RA have been used extensively to examine the role of chemokine/chemokine receptors in disease pathogenesis. Such models of disease are also critical to evaluate the therapeutic potential of chemokine antagonists. Chemokine expression profiles in affected tissues are comparable between human and rodent models of RA. High levels of CCL3 and CCL5 in synovial fluid are present early and in later stages of disease in both human patients and murine collagen-induced arthritic mice

(Rathanaswami et al., 1993; Robinson et al., 1995; Thornton et al., 1999).

Correspondingly, there is a selective accumulation of CCR5 and CXCR3 positive T cells in the synovial joints (Suzuki et al., 1999). Indeed, upregulation of CCR1, CCR2 and

CCR5 mRNA levels coincide with peak inflammation in the joints of rat adjuvant- induced arthritic mice (Shahrara et al., 2003). The data suggest that CCR5 is one of several critical chemokine receptors that influence RA disease pathogenesis. The implications are that individuals with altered/reduced CCR5 expression exhibit less severe and/or slower progression of RA. To this end, several studies have focused on cohorts of RA patients that are homozygous for the CCR5Δ32 allele, a non-functional

CCR5 receptor. Indeed, meta-analysis of five published case-control association studies confirmed the negative association between CCR5Δ32 and RA, indicating that CCR5Δ32 is protective against the development of RA (Prahalad, 2006). Furthermore, the analysis showed that CCR5Δ32 homozygosity conferred a much greater protective effect than

CCR5Δ32 heterozygosity, suggesting a gene dosage effect. It is important to note that

this analysis took into account published studies conducted in populations of European ancestry, where the CCR5Δ32 allelic frequency is approximately 5-10% (Cooke et al.,

1998; Garred et al., 1998; Gomez-Reino et al., 1999; Pokorny et al., 2005; Samson et al.,

1996; Zapico et al., 2000). Whether these results are relevant for different ethnic groups is unclear (John et al., 2003; Zuniga et al., 2003). Nevertheless, the data suggest the possibility that CCR5 blockade may have therapeutic potential in selected cohorts of RA patients.

The strategy to block chemokine/chemokine receptors as a therapy for RA is not new, yet there are no clinical applications of this approach approved or in the clinic to date. There is accumulating evidence in rodents that targeting the chemokine system can dampen arthritic inflammation. Notably, targeting CCL2 or its receptor CCR2 in mice significantly reduced joint destruction by limiting macrophage infiltration (Gong et al.,

1997; Ogata et al., 1997). In a rat adjuvant model of arthritis, administration of CCL5 neutralizing antibodies resulted in clinical improvement and reduced cellular infiltration and subsequent reductions in joint damage (Barnes et al., 1998). Similarly, a non-peptide

CCR5 antagonist TAK-779 significantly reduced both incidence and severity of collagen- induced arthritis in mice by reducing T cell migration (Yang et al., 2002). The chemotaxis of monocytes towards patient synovial fluid was significantly reduced with anti-CCL5 antibodies (Volin et al., 1998). Finally, a non-competitive allosteric inhibitor of CXCR1 and CXCR2 significantly ameliorated adjuvant-induced arthritis in rats

(Barsante et al., 2008). Taken altogether, antagonists for various chemokine receptors, that reduce leukocyte migration to affected tissues and dampen cytokine production in the

joints, may prove to be effective in RA. Currently, a fully humanized monoclonal antibody against CCR2 is in Phase II clinical trial for RA by Millennium Pharmaceuticals

Inc.

1.4.2. Cancer

Many cancers can be characterized by abnormal chemokine production or aberrant expression of and signalling by chemokine receptors. Through their interaction with chemokine receptors on target cells, tumor-associated chemokines can promote tumor growth directly, by mediating the influx of leukocytes to the tumor microenvironment and stimulating the release of growth factors, or indirectly, by initiating angiogenesis. To date, chemokines and their receptors have been implicated in all steps of tumorigenesis, including the control of leukocyte infiltration into tumors, initiation of primary tumor growth and survival, regulation of angiogenesis, and the control of tumor cell adhesion, invasion and migration (Figure 1.6) (Murooka et al.,

2005). Understanding the complex role chemokines play at each stage of tumorigenesis will assist with defining potential therapeutic strategies.

1.4.2.1. Chemokines influence Leukocyte Tumour Infiltration

Infiltrating leukocytes are found in most solid tumors, comprising monocytes/macrophages, T cells, dendritic cells, and mast cells. The influx of immune cells into solid tumors was initially believed to reflect an anti-tumor immune response.

However, there is increasing evidence that tumor-derived chemokines attract leukocytes to the tumor microenvironment, thereby promoting tumor growth, angiogenesis and

Figure 1.6 Chemokines and Cancer

The roles of chemokines and their receptors in various steps of tumorgenesis, namely leukocyte infiltration into tumors, initiation of primary tumor growth and survival, regulation of angiogenesis, and the control of tumor cell adhesion, invasion and migration, are shown.

1 – Neoplastic Transformation 4 - Angiogenesis Abnormal chemokine Tumor-produced and chemokine receptor chemokines stimulate expression in angiogenesis, causing transformed cells up- neighbouring blood regulate growth and vessels to grow into the survival factor tumor

2 – Leukocyte Infiltration 5 - Metastasis

Aberrant chemokine Tumor-derived chemokines attract receptor expression causes active circulating leukocytes, migration of tumor infiltrating the tumor cells out into the mass vasculature

3 – Tumor Cell Growth 6 – Organ Homing Tumor-associated Expression of chemokines function chemokine receptors as growth and on tumor cells allows survival factors for for specific organ tumor cells through a homing autocrine and/or paracrine loop

Murooka, TT, Ward, SE and Fish, EN. Cancer Treat Res 126 (2005)

metastasis. Tumor associated macrophages (TAMs) have pro-tumor functions by virtue of their release of growth factors, such as epidermal growth factor (EGF), and their production of angiogenic mediators, including VEGF and basic fibroblast growth factor

(bFGF) (Mantovani et al., 1992). TAMs are also a source of IL-10 and prostaglandin E2

(PGE2), two potent immuno-modulating agents contributing to the general immunosuppression of the host (Chouaib et al., 1997).

Over two decades ago, Bottazzi and colleagues showed that CCL2 is expressed and secreted by most tumor cell lines (Bottazzi et al., 1990; Bottazzi et al., 1983).

Specific monocyte/macrophage recruitment has been linked to local production of CCL2 by tumors and stromal cells, and is implicated in breast, ovarian, bladder, and lung cancer

(Bottazzi et al., 1990; Bottazzi et al., 1983; Frederick and Clayman, 2001; Silzle et al.,

2003). CCL2 production was also detected in tumor-infiltrating macrophages, indicating the existence of an amplification loop for their recruitment. Correlative studies in breast cancer patients showed that CCL2 expression levels are directly proportional to TAM accumulation (Saji et al., 2001; Ueno et al., 2000). These studies also identified a significant correlation between CCL2 levels and several potent angiogenic factors, namely VEGF, thymidine phosphorylase (TP) and CXCL-8. Other studies have demonstrated a pivotal role for tumor-derived CCL5 in leukocyte infiltration. CCL5 was highly expressed in high grade breast tumors, while breast tumor cell lines express functional CCL5 in culture that induces monocyte migration in vitro (Adler et al., 2003;

Azenshtein et al., 2002; Luboshits et al., 1999; Robinson et al., 2003; Saji et al., 2001).

Subsequent studies by Robinson and colleagues demonstrated the pro-neoplastic role of

CCL5 using a murine model of breast cancer. Administration of the CCR1/CCR5 antagonist, Met-CCL5, significantly reduced the extent of macrophage infiltration within tumors, which correlated with reduced tumor burden (Robinson et al., 2003). Similar conclusions can be drawn from studies where mammary carcinoma cells expressing lower levels of CCL5 exhibit a decrease in tumor growth in vivo (Adler et al., 2003).

Following the recruitment of TAMs, both CCL2 and CCL5 also stimulate the release of tumor-promoting factors by TAMs, namely MMP-9 and TNF-α (Azenshtein et al., 2002;

Robinson et al., 2002; Saji et al., 2001). Viewed altogether, chemokines are important for the recruitment of tumor-promoting inflammatory cells into the tumor site, considered critical in the initial stages of tumorgenesis.

1.4.2.2. Chemokines and Tumour Growth

Chemokines act as growth and survival factors for various tumors, generally in an autocrine manner. CXCL12/CXCR4 signalling is the most well-studied chemokine signalling axis that has direct pro-tumor growth effects on tumor cells. Upregulation of

CXCR4 is prevalent in various cancers, including colon carcinoma, lymphoma, breast cancer, glioblastoma, leukemia, multiple myeloma, prostate cancer, oral squamous cell carcinoma and pancreatic cancer (Chan et al., 2003; Floridi et al., 2003; Koshiba et al.,

2000; Moller et al., 2003; Sehgal et al., 1998a; Sehgal et al., 1998b; Sun et al., 2003;

Uchida et al., 2003; Zeelenberg et al., 2003). CXCL12 increases DNA synthesis and proliferation of primary pre-B ALL, meningioma and adenoma cells, in an Erk1/2- dependent manner (Barbieri et al., 2006; Florio et al., 2006; Mowafi et al., 2008).

Similarly, increased CXCL12/CXCR4 mediated proliferation in both human glioblastoma

and neuroepithelioma cell lines correlated with Erk1/2 and PKB activation (Barbero et al.,

2003; Barretina et al., 2003). Interestingly, a C-terminal domain-truncated CXCR4 exhibited a gain-of-function phenotype, leading to increased proliferation, motility and loss of cell-to-cell contact (Ueda et al., 2006). The contributions of CCL5 and CCR5 in the pathogenesis of breast cancer have been investigated by several groups. CCL5 is reported to be highly expressed in high grade breast tumors (Azenshtein et al., 2002;

Luboshits et al., 1999; Niwa et al., 2001; Yaal-Hahoshen et al., 2006). Serum CCL5 levels were elevated in patients with high grade tumors compared to low grade tumors

(Niwa et al., 2001). Indeed, several breast cancer cell lines migrate towards CCL5

(Azenshtein et al., 2002; Luboshits et al., 1999; Robinson et al., 2003; Youngs et al.,

1997). This suggests the possibility that local production of CCL5 by tumor cells, or other cells within the tumor microenvironment, results in CCL5 exerting effects directly on breast tumor cells. Certainly, there is conflicting reports for the direct pro-growth effects of CCL5 in breast cancer (Adler et al., 2003; Jayasinghe et al., 2008). Our data support a pro-proliferative role for CCL5 in breast cancer. Specifically, CCL5 actively promoted translation of proliferative and survival proteins, namely cyclin D1, c-Myc and defender against cell death-1 (Dad-1) in CCR5-expressing breast cancer cells, in a rapamycin-dependent manner (Murooka et. al., unpublished data). Thus, our data demonstrate the potential for breast cancer cells to exploit downstream chemokine signalling pathways for their proliferative and survival advantage through expression of appropriate chemokine receptors. This is in contrast to studies showing that tumor- derived CCL5 did not contribute to breast tumor formation in vivo (Jayasinghe et al.,

2008). One explanation for these contradictory results is the concentration differences in

CCL5 in these two studies. While we observed significant CCL5-mediated proliferative effects at 10 nM, CCL5 expression levels by 4T1 breast cancer cells reported by

Jayasinghe and colleagues was approximately 100 fold less (Jayasinghe et al., 2008).

The data suggest that a threshold level of CCL5 is required in order for CCL5 to invoke a proliferative response in breast cancer cells. Such a hypothesis is supported by several studies showing that CCL5 content within tumor lesions is markedly higher in more aggressive forms of breast cancer (Bieche et al., 2004; Niwa et al., 2001). Such a threshold level may be attainable through the propensity of CCL5 to bind, oligomerize and accumulate on GAGs at their secretion site (Proudfoot et al., 2003). Others have reported chemokine activation of mTOR signalling leading to increased proliferation and motility in cancer. The CXCR4/mTOR signalling pathway increased the proliferative and migratory potential of gastric carcinoma cells (Hashimoto et al., 2008). CXCL8 has been shown to up-regulate cyclin D1 at the level of translation in prostate cancer cells

(MacManus et al., 2007). Sodhi and colleagues show that endothelial-specific expression of the Karposi’s sarcoma-associated herpesvirus (KSHV)-encoded gene, v-GPCR, is sufficient to induce Kaposi-like sarcomas in mice, and is dependent on the

Akt/TSC2/mTOR signalling pathway (Sodhi et al., 2006). Recently, CCL5 was implicated in mediating pro-growth and anti-apoptotic effects of gastric cancer cells

(Sugasawa et al., 2008). Notably, TILs rather than tumor cells, were the source of CCL5.

1.4.2.3. Chemokines in Angiogenesis/Angiostasis

Angiogenesis involves the formation of new vessels from pre-existing ones and is regulated by a delicate balance between pro- and anti-angiogenic factors. There is

accumulating evidence that CXC chemokines regulate angiogenesis thereby promoting tumor formation and metastasis. As described by Strieter et al., CXC chemokines containing the ELR motif at their NH2 terminus (ELR+) are potent promoters of angiogenesis. These chemokines were directly chemotactic for endothelial cells and promoted angiogenesis in corneal neovascularization experiments (Koch et al., 1992;

Strieter et al., 1992). In contrast, CXC chemokines lacking this motif (ELR-) were potent angiostatic factors (Strieter et al., 1995). These molecules were able to inhibit new vessel formation induced by ELR+ chemokines and other pro-angiogenic mediators (Angiolillo et al., 1995; Belperio et al., 2000; Sgadari et al., 1996). ELR+ chemokines that promote angiogenesis include CXCL1, CXCL2, CXCL3, CXCL5, CXCL6, CXCL7, and CXCL8.

Generally, the ELR- chemokines are IFN-γ inducible and inhibit angiogenesis (Belperio et al., 2000). CXCL4, CXCL9, and CXCL10 are ELR- chemokines that inhibit angiogenesis. Interestingly CXCL12, which is ELR-, is angiogenic (Gupta et al., 1998;

Salcedo et al., 1999). Additionally, CCL2 is a CC family chemokine stimulated angiogenesis directly (Salcedo et al., 2000).

CXCL8 was the first chemokine to display potent angiogenic activity when implanted into rat cornea and to induce proliferation and chemotaxis of human umbilical vein endothelial (HUVEC) cells (Koch et al., 1992). A CXCL8 anti-sense oligonucleotide specifically blocked the production of monocyte-induced angiogenic activity, suggesting a role for CXCL8 in angiogenesis-dependent disorders. The involvement of CXCL8 in tumor angiogenesis was initially described in human bronchogenic carcinoma (Arenberg et al., 1996; Smith et al., 1994). Increased levels of

CXCL8 were detected in tumor tissue compared with normal lung tissue, and CXCL8 was able to induce corneal neovascularization. Further, anti-CXCL8 antibodies almost completely abrogated angiogenic activity within tumors, establishing CXCL8 as a primary mediator of angiogenesis in bronchogenic carcinoma. Similarly, anti-CXCL8 antibodies reduced human prostate tumor growth and tumor-related angiogenesis in SCID mice (Moore et al., 1999). The angiogenic effects of CCL2 and CCL5 are less well defined. These chemokines are likely indirect modulators of angiogenesis by recruiting pro-angiogenic TAMs. Several correlative studies have shown that CCL2 is co- expressed with known angiogenic factors VEGF and CXCL8 (Saji et al., 2001; Ueno et al., 2000). Additionally, CCL5 has been shown to directly up-regulate MMP-9 expression in breast cancer cells (Azenshtein et al., 2002). Given the importance of increased tumor vascularity to support tumor growth and spread, the angiogenic properties of some chemokines have implications in tumor biology.

1.4.2.4. Chemokines in Metastasis

In a seminal paper published in 2001, Muller and colleagues identified that differential chemokine and chemokine receptor expression corresponds with patterns of metastasis in breast cancer (Muller et al., 2001). Breast cancer typically metastasizes to regional lymph nodes, bone marrow, lung, and liver. Comparing the expression levels of

17 chemokine receptors in seven human breast cancer cell lines and normal primary mammary epithelial cells, their data revealed that the breast cancer cells exhibited specific patterns of receptor expression. Specifically, CXCR4 and CCR7 are highly expressed in breast cancer cells, malignant breast tumors, and metastatic cells.

Subsequent studies examined patterns of expression for the ligands CXCL12, CCL19, and CCL21, in different tissues. The highest levels of expression of CXCL12 were detected in lymph nodes, lung, liver, and bone marrow, corresponding to the typical sites of breast cancer metastasis. Low levels of CXCL12 were found in tissues that are not typically associated with breast cancer metastases, such as the skin, brain, and kidneys.

CCL19 and CCL21 expression levels were highest in lymph nodes, although CCL21 was expressed at higher levels, suggesting that this chemokine played a more prominent role in the homing of breast cancer cells to the lymph nodes via its interaction with CCR7. To determine whether the pattern of chemokine receptor expression observed was unique to breast cancer, Muller and colleagues then examined chemokine receptor expression patterns in malignant melanoma cells. Melanoma has a similar pattern of metastasis to breast cancer, but also metastasizes within the skin. Interestingly, the authors showed that melanoma cells expressed CXCR4 and CCR7, similar to breast cancer cells, but also expressed higher than normal levels of CCR10, which interacts with the skin-specific homeostatic chemokine, CCL27. Expression of CXCR4 in breast cancer cells has since been shown to be regulated by the transcription factor NF-κB, which is activated by extracellular signals (Helbig et al., 2003).

Recent studies by Karnoub and colleagues further implicate CCL5 as a potent promoter of breast cancer metastasis in vivo. These studies addressed the complicated interplay between breast tumor cells and the tumor-associated stroma (Karnoub et al.,

2007). The de novo production of CCL5 from mesenchymal stem cells acted directly on cancer cells to enhance their motility, invasion and metastasis. Such tumor cell-

mesenchymal stem cell interactions were largely dependent on CCL5-CCR5.

Interestingly, the metastatic potential of tumor cells was reversible, suggesting that

CCL5-CCR5 interactions within the tumor microenvironment had to be maintained.

Additionally, insulin-like growth factor (IGF)-1-mediated migration of breast cancer cells was dependent on CCR5 trans-activation via CCL5 expression (Mira et al., 2001). In an experimental metastasis model of melanoma, CCR5-deficient mice developed significantly fewer lung metastases than their wildtype counterparts (van Deventer et al.,

2005). Subsequent studies by the same group showed that CCR5 expression of pulmonary mesenchymal cells was responsible for lung metastases through MMP-9 expression (van Deventer et al., 2008). These data lead us to hypothesize that CCL5-

CCR5 signalling in both stromal and breast cancer cells leads to phenotypic changes that favour increased motility and invasiveness. Our data suggest that mTOR-dependent translation of motility-related proteins is partially responsible for such phenotypic changes (Murooka et al., 2008).

Other chemokine receptors have also been implicated in tumor metastasis.

CXCR1 and CXCR2 are expressed at higher levels in highly metastatic human melanoma cell lines than in non-metastatic melanoma cells (Varney et al., 2003). In the same study, neutralizing antibodies directed against these receptors were shown to inhibit both the proliferation and invasive potential of melanoma cells, regardless of whether or not the cells had been stimulated by CXCL8. In addition to its role in breast cancer metastasis,

CCR7 is associated with lymph node metastasis of esophageal squamous cell carcinoma, with high levels of CCR7 expression correlating with lymphatic permeation, lymph node

metastasis, and poor survival (Ding et al., 2003). Interesting new studies showed that

MDA-MB-231 breast cancer cells stimulated CCL2-dependent osteoclast activation and bone loss (Kinder et al., 2008; Zhu et al., 2007). Thus, localized expression of CCL2 was responsible for breast cancer metastasis to the bone, and their subsequent erosion.

1.4.3. Human Immunodeficiency Virus (HIV) Infection

The relationship between the chemokine system and invading pathogens is highly complex. While chemokines are highly expressed and are essential to coordinate the host immune response, some are exploited by viruses for their pathogenicity. Furthermore, viruses have acquired the ability to interfere with host chemokines to disrupt the immune response. Different viruses encode for proteins that exhibit high homology with chemokines or resemble chemokine receptors. Virally-encoded chemokine binding proteins bind to host chemokines and interfere with their binding to their cognate receptors. Viruses use these molecules to evade the protective mechanisms of the host for their own survival advantage (Finlay and McFadden, 2006; Murphy, 2001; Seet et al.,

2003).

Over 10 years ago several groups demonstrated that the chemokine receptors

CCR5 and CXCR4 were essential co-receptors for HIV entry into host cells (Choe et al.,

1996; Dean et al., 1996; Doranz et al., 1996; Liu et al., 1996). Initial observations revealed that the CC chemokines CCL3, CCL4 and CCL5 exerted HIV suppressive activity (Cocchi et al., 1995). The HIV-1 envelope protein gp120 forms a tri-molecular complex with host cell CD4 and either CCR5 or CXCR4. This results in the exposure of

a cryptic fusogenic peptide of gp41 from the HIV-1 envelope protein, which mediates fusion between the viral envelope and host cell membranes (Berger et al., 1999; Wyatt and Sodroski, 1998). It is now understood that CCR5 is utilized by macrophage tropic

HIV strains to infect mononuclear phagocytes, primary T cells and DCs, while CXCR4 is used by HIV strains that infect CD4+ T lymphocytes. By infecting T cells and monocytes, HIV-1 induces general immuno-suppression by crippling the CD4+ T cells that orchestrate antiviral immunity (Gerard and Rollins, 2001; Horuk, 1999). Several prominent mutations within the coding regions of CCR5 alter susceptibility of the host to

HIV-1 infection. As described earlier, individuals who are homozygous for the defective allele CCR5Δ32 are largely resistant to HIV infection (Liu et al., 1996; Samson et al.,

1996). In fact, individuals who were heterozygous for the mutant CCR5 allele progress slower towards AIDS (Dean et al., 1996). The utilization of chemokine receptors by HIV is not restricted to CCR5 and CXCR4, as CCR3, CCR2b and CCR8 are capable of mediating infection (Choe et al., 1996; Doranz et al., 1996; Horuk et al., 1998). Another non-functional polymorphic CCR5, C101X-CCR5 is unable to mediate cell entry of HIV-

1 (Blanpain et al., 2000).

Since the initial reports of the HIV suppressive properties of CCL3, CCL4 and

CCL5, subsequent studies have demonstrated their protective roles in vivo. In one study, high levels of CCL5 were found in both HIV-exposed humans and vaccinated monkeys who were resistant to HIV or SIV infection, respectively (Furci et al., 1997; Wang et al.,

1998; Zagury et al., 1998). Another study showed that the number of CCL3 gene duplications inversely predicted the risk of HIV infection and rate of disease progression

(Gonzalez et al., 2005). It is conceivable that these individuals with higher CCL3 expression limit HIV infection by CCL3 binding to and internalizing CCR5. The CCR5 antagonist AOP-CCL5 is a potent inhibitor of HIV infection, due to its ability to internalize and prevent receptor recycling to the cell surface compared to wildtype CCL5

(Mack et al., 1998; Signoret et al., 2000). Thus, cell surface CCR5 availability is a critical determinant of susceptibility to HIV infection and disease progression (Lederman et al., 2006). CXCR4 internalization is also important in CXCL12-mediated protection from HIV infection (Signoret et al., 1997). Viewed altogether, chemokines inhibit the initial stages of HIV entry by either blocking the binding of the viral envelope protein

(gp120) to co-receptors, or by inducing internalization of the receptor after binding

(Appay and Rowland-Jones, 2001; Ward et al., 1998). Small molecule inhibitors that target these chemokine receptors are currently in advanced-stage clinical trials in HIV, with the CCR5 inhibitor Maraviroc recently being approved for clinical use in the US

(MacArthur and Novak, 2008). It is important to note that high concentrations of CCL5 unexpectedly enhanced HIV infection in vitro (Gordon et al., 1999; Trkola et al., 1999).

This is due to the propensity of CCL5 to aggregate and oligomerize at these high concentrations, thereby activating T cells in an antigen-independent manner. Activated T cells exibit increased tyrosine phosphorylation signalling, rendering cells more permissive to HIV-1 infection (Trkola et al., 1999).

1.5. Hypothesis and Objectives

Hypothesis:

CCL5 exhibits dose-dependent distinct signalling events downstream of CCR5 activation.

Objectives:

Chapter 2: Characterization of CCL5-CCR5 mediated apoptosis in T cells, and the

role for glycosaminoglycan binding and CCL5 aggregation.

Chapter 3: Examine the role of mTOR and protein translation in CCL5-CCR5-mediated

T cell chemotaxis.

Chapter 4: Examine the role of mTOR in CCL5-mediated proliferation and survival of

breast cancer cells.

Chapter 2

CCL5-CCR5 Mediated Apoptosis in T cells: Requirement for Glycosaminoglycan Binding and CCL5 Aggregation

Thomas T. Murooka1, Mark M. Wong1, Ramtin Rahbar1, Beata Majchrzak-Kita1, Amanda E.I. Proudfoot2 and Eleanor N. Fish1

1Division of Cellular and Molecular Biology, Toronto General Research Institute University Health Network & Department of Immunology, University of Toronto 2Serono Pharmaceutical Research Institute, Geneva, Switzerland

Chapter 2 was published as:

Murooka, T.T., Wong, M.M., Rahbar, R., Majchrzak-Kita, B., Proudfoot, A.E., and Fish, E.N. (2006). CCL5-CCR5-mediated Apoptosis in T cells: Requirement for Glycosaminoglycan Binding and CCL5 Aggregation. J Biol Chem 281, 25184-25194.

T.T.M. performed experiments in Fig. 2.1A, 2.1E, 2.3, 2.4A, C, D, E, 2.5, 2.6, 2.8, 2.9, analyzed the data and drafted the manuscript. M.W. performed experiments in Fig 2.1B, C, D and drafted the manuscript. R.R. performed experiments in Fig. 2.7 and analyzed the data. B.M-K. performed experiments in Fig. 2.2, 2.4B A.E.I.P. provided valueable reagents. E.N.F. designed research, analyzed the data and drafted the manuscript.

2.1. Abstract

CCL5 (RANTES) and its cognate receptor, CCR5, have been implicated in T cell activation. CCL5 binding to glycosaminoglycans (GAGs) on the cell surface or in extracellular matrix sequesters CCL5, thereby immobilizing CCL5 to provide the directional signal. In two CCR5 expressing human T cell lines, PM1.CCR5 and

MOLT4.CCR5, and in human peripheral blood derived T cells, µM concentrations of

CCL5 induce apoptosis. CCL5-induced cell death involves the cytosolic release of cytochrome c, the activation of caspase-9 and caspase-3 and poly ADP ribose polymerase

(PARP) cleavage. CCL5-induced apoptosis is CCR5 dependent, as native PM1 and

MOLT4 cells lacking CCR5 expression are resistant to CCL5-induced cell death.

Furthermore, we implicate Tyrosine-339 as a critical residue involved in CCL5-induced apoptosis, as PM1 cells expressing a tyrosine mutant receptor, CCR5Y339F, do not undergo apoptosis. We show that CCL5-CCR5 mediated apoptosis is dependent on cell surface GAG binding. The addition of exogenous heparin and chondroitin sulfate, and

GAG digestion from the cell surface protects cells from apoptosis. Moreover, the non-

GAG binding variant, [44AANA47]-CCL5, fails to induce apoptosis. To address the role of aggregation in CCL5-mediated apoptosis, non-aggregating CCL5 mutant E66S, that forms dimers and E26A, that form tetramers at µM concentrations, were utilized. Unlike native CCL5, the E66S mutant fails to induce apoptosis, suggesting that tetramers are the minimal higher ordered CCL5 aggregates required for CCL5-induced apoptosis. Viewed altogether, these data suggest that CCL5-GAG binding and CCL5 aggregation are important for CCL5 activity in T cells, specifically in the context of CCR5-mediated apoptosis.

2.2. Introduction

Chemokines were originally identified for their selective chemo-attractant and pro-adhesive effects. They are responsible for directing leukocyte migration by forming chemokine gradients and triggering firm arrest by activating integrins on the leukocyte cell surface. It is now apparent that chemokines exhibit critical functions in many diverse developmental and immunological operations (Aliberti et al., 2000; Ansel et al., 2000;

Karpus et al., 1997; Makino et al., 2002; Nagasawa et al., 1996; Szekanecz and Koch,

2000). A member of the β-chemokine family, CCL5 is both a T cell chemo-attractant and an immunoregulatory molecule. Interestingly, CCL5 is preferentially chemotactic for T cells of the Th1 and memory phenotype (Schall et al., 1990; Siveke and Hamann,

1998). This may be due to CCL5 binding to CCR5, which is predominantly expressed on memory Th1 T cells (Kawai et al., 1999; Rabin et al., 1999). Given the prevalence of memory Th1 T cells in inflammatory diseases and the coincident increased expression of

CCL5 and CCR5, CCL5-CCR5 mediated events in T cells may be critical in disease pathogenesis (Gerard and Rollins, 2001; Luster, 1998).

CCL5 is a T cell co-stimulatory molecule in the context of CD3 stimulation

(Makino et al., 2002; Taub et al., 1996). Mice deficient in CCL5 demonstrate impaired T cell proliferation and cytokine production in response to antigen or anti-CD3 stimulation

(Makino et al., 2002). Anti-CD3 stimulation of T cells together with nM CCL5 treatment results in proliferation and cytokine production (Taub et al., 1996). At higher, µM concentrations, CCL5 stimulates antigen-independent activation of T cells in terms of cell proliferation, increased CD25 membrane expression and cytokine production, indicating

that high doses of CCL5 can bypass T cell receptor (TCR) recognition of antigen to activate T cells (Bacon et al., 1995; Dairaghi et al., 1998). At these µM concentrations,

CCL5 forms large oligomers with a mass greater than 100 kDa (Appay et al., 1999;

Appay et al., 2000). Mutation of the acidic amino acid residues glutamate 26 to alanine

(E26A), or glutamate 66 to serine (E66S), in CCL5, results in CCL5 variants that are unable to form higher order aggregates at µM concentrations (Appay et al., 1999;

Czaplewski et al., 1999). These mutants are unable to activate T cells, implying that the aggregating properties of CCL5 are important for T cell activation (Appay et al., 1999;

Appay et al., 2000). Notably, the non-aggregating mutants retain their ability to signal via classical G-protein dependent pathways in vitro. CCL5, as well as other chemokines, can bind to glycosaminoglycans (GAGs) on the cell surface or the extracellular matrix

(ECM) to increase relative chemokine concentrations (Ali et al., 2000; Hoogewerf et al.,

1997). The predominant GAG binding site for CCL5 has been shown to be the BBXB motif in the 40s loop (Martin et al., 2001; Proudfoot et al., 2001) and GAG binding in vivo has been shown to be critical for CCL5 function (Proudfoot et al., 2003). Residues critical for GAG binding of other chemokines including CCL3, CCL4, and MCP-1 have now been identified (Chakravarty et al., 1998; Koopmann et al., 1999; Koopmann and

Krangel, 1997; Lau et al., 2004; Laurence et al., 2001; Martin et al., 2001; Sadir et al.,

2001; Vita et al., 2002). Whether the interaction of CCL5 with GAGs induces cellular activation through a novel signaling mechanism is not clear. However, CCL5 and its interaction with GAGs facilitate oligomerization and likely contribute to efficient receptor presentation.

In this study we examined CCL5 activity in T cells in the context of GAG-binding, aggregation and apoptosis. We present evidence that CCL5 aggregates form at high ligand concentrations and that these may induce apoptosis in T cell lines and in primary human T cells in a CCR5-dependent manner. We show that CCL5-induced apoptosis involves the cytosolic release of the mitochondrial pro-apoptotic factor cytochrome c, the activation of caspases -9 and -3 and poly ADP ribose polymerase (PARP) cleavage.

Additionally, we provide evidence for the critical role of intracellular Tyrosine (Y) residue 339 of CCR5 in mediating cell death that is independent of G-protein mediated events. Finally, we show that CCL5-GAG interactions and CCL5 oligomerization are important pre-requisites to initiate a cascade of events resulting in T cell death. Taken together, our data suggests a potential novel role for CCL5 in determining T cell fate during an immunological response.

2.3. Materials and Methods

2.3.1. Cells and reagents

Human T cell lines PM1, PM1.CCR5, MOLT-4 and MOLT-4.CCR5, as well as the anti-CCR5 monoclonal antibody (2D7) were obtained from the National Institutes of

Health AIDS Research and Reference Reagent Program. All cells were maintained in culture in RPMI 1640 (Gibco-BRL) supplemented with 10% fetal calf serum (Gibco-

BRL), 100 units/ml penicillin, 100 mg/ml streptomycin (Gibco-BRL) and 25 µg/ml plasmocin (InvivoGen). Antibodies for cleaved caspase-3 (1:1000) and caspase-9

(1:1000) were purchased from Cell Signaling, anti-cytochrome c antibody (1:1000) was purchased from Santa Cruz, and anti-PARP antibody (1:2000) was purchased from BD

Pharmingen. Murine monoclonal anti-human CCL5 antibody and anti-tubulin antibody

(1:2000) were purchased from R & D Systems. Heparin sodium salt, chondroitin sulfate

A and chondroitinase ABC were from Sigma-Aldrich. JC-1 was purchased from

Molecular Probes. WT CCL5, CCL5 aggregation mutants E26A and E66S and

[44AANA47]-CCL5 were synthesized as previously reported (Proudfoot et al., 2001;

Proudfoot et al., 2003). CCL5 doses of 10 µg/ml correspond to 1.25 µM in all experiments.

2.3.2. Preparation of primary T cells

Human peripheral blood derived T cells were isolated from consenting healthy donors, as approved by the UHN research ethics committee. For activation, 106 resting T cells/ml were cultured with 1 µg/ml PHA and 2 ng/mL IL-12 for 2 days, then cultured for an additional 3 days in the presence of 100 U/ml hrIL-2. T cells were then stained with

anti human CCR5 antibody (2D7) and sorted for CCR5- and CCR5+ T cells. Sorted cells were >95% CD3 positive.

2.3.3. Chondroitinase ABC treatment

Actively growing PM1.CCR5 cells were incubated with 10 µg/ml CCL5 for 24h.

In experiments where cellular surface GAGs were enzymatically digested, cells were first resuspended at 5 x 105 cells/ml in RPMI containing 0% FCS and treated with chondroitinase ABC (1 U/ml) for 1 h at 370C and 5% CO2. Cells were then washed three times and incubated with 10 µg/ml CCL5 for 24h and analyzed by Annexin V/7-AAD analysis. For experiments where cell surface CCL5 was measured, PM1.CCR5 cells either untreated or pretreated with chondroitinase ABC were incubated with 10 µg/ml

CCL5 for 1 h on ice. Cells were collected, washed three times with ice cold PBS and stained with anti-human CCL5 antibody (R & D Systems) followed by FITC-conjugated anti-mouse IgG antibody. As isotype controls, cells were incubated with FITC labeled isotype control IgG antibody (eBioscience) and analyzed by flow cytometry.

2.3.4. MTT, Annexin V/7-AAD staining and DNA fragmentation assay

The MTT assay was performed as previously described (Uddin et al., 1997).

Annexin V-FITC and 7-AAD staining were carried out according to the manufacturer’s protocol (BD Pharmingen). Briefly, native PM1, PM1.CCR5, native MOLT-4 and

MOLT-4.CCR5 cells were incubated with 10 µg/ml CCL5 for 24h. Cells were then collected, and 1 x 105 cells were incubated in 100 µl of binding buffer together with

Annexin V-FITC and 7-AAD for 15 min. Samples were analyzed immediately by flow

cytometry (FACSCalibur, BD). DNA fragmentation was analyzed using an apoptotic

DNA ladder kit (Roche Diagnostics, Germany) according to the manufacturer’s protocol.

DNA isolated from cells was resolved in a 2% agarose gel containing ethidium bromide and visualized by a UV light source (Fluro-S MultiImager, BioRad).

2.3.5. JC-1 staining for mitochondrial membrane potential

PM1.CCR5 cells were incubated with 10 µg/ml CCL5 for the times indicated, pelleted by centrifugation, washed and resuspended in warm phosphate-buffered saline at

1 x 106 cells/ml. JC-1 was added at a final concentration of 2µM and incubated at 370C and 5% CO2 for 30 min. Cells were washed two times in PBS and resuspended in 1mL of PBS. Cells were analyzed by flow cytometry (FACSCalibur, BD).

2.3.6. Subcellular Fractionation

Cytosolic fractions were isolated using a Mitochondrial Fractionation Kit (Active

Motif #40015) according to the manufacturer’s protocol. Cell lysates were resolved by

SDS-PAGE and immunoblotted with anti-cytochrome c antibody (Santa Cruz).

2.3.7. Western Blot Analysis

Cells were incubated with 10 µg/ml CCL5 for the times indicated, pelleted by centrifugation, washed with ice-cold PBS and lysed in 100 μL of lysis buffer (1% Triton

X-100, 0.5% NP-40, 150 mM NaCl, 10 mM Tris-HCl, pH 7.4, 1 mM EDTA, 1 mM

EGTA, 0.2 mM PMSF). Protein concentration in lysates was determined using Bio-Rad

DC protein assay kit (BioRad laboratories). 40 μg of protein lysate per sample was

denatured in 5X sample buffer and resolved by SDS-PAGE gel electrophoresis. The separated proteins were transferred to a nitrocellulose membrane followed by blocking with 5% BSA (w/v) in TBS for 1hr at room temperature. Membranes were probed with the specified antibodies. Proteins were visualized using the ECL detection system

(Pierce).

2.3.8. Flow Cytometric Analysis

1 x 106 cells were incubated with anti-human CCR5, followed by FITC- conjugated anti-mouse IgG antibody. As isotype controls, cells were incubated with

FITC labeled isotype control IgG antibody (eBioscience) and analyzed using the

FACSCalibur and CellQuest software. Cells were gated based on forward and side scatter. For intracellular caspase-3 activity analysis, 1 x 106 cells were treated with CCL5 for the indicated times, fixed and permeabilized with 0.5% saponin on ice. Cells were then incubated with FITC labeled anti-active caspase-3 (Transduction Laboratories) and analyzed by flow cytometry. Notably, the anti-human CCR5 antibody recognizes ectopically expressed intact CCR5 and CCR5Y339F.

2.3.9. CCR5 site-directed mutagenesis and PM1 transfection

The pEF-BOS-CCR5 carrying the human CCR5 gene was obtained from Dr.

Martin Oppermann (University of Gottingen, Germany). Site-directed mutagenesis was performed on the pEF-BOS-CCR5 vectors. Single Y339F mutations were introduced using the QuickChange Site-Directed Mutagenesis Kit (Stratagene) using the following primers: 5’ gcgagcaagctcagttttcacccgatccactgggg 3’ (forward) 5’

cgctcgttcgagtcaaaagtgggctaggtgacccc 3’ (reverse). Mutation was confirmed by sequencing (ACGT Corporation, Toronto). Intact CCR5 and CCR5Y339F genes were then subcloned into the pUMFG retroviral vector (a gift from Dr. Jeffery Medin, Division of Experimental Therapeutics, Toronto General Research Institute). The amphotropic packaging cell line Pheonix was transfected by the calcium phosphate/chloroquine method. At 48 h post-transfection, the viral supernatant was collected and used for PM1 transfection, as described (Kinsella and Nolan, 1996). Positive transfectants were FACS sorted using anti-human CCR5 antibody and used for subsequent experiments.

2.3.10. Statistical Analysis

Paired t-test was used to determine the statistical significance of differences between groups.

2.4. Results

2.4.1. µM concentrations of CCL5 induce apoptosis in CCR5 expressing T cells

Chemokines and their receptors have been implicated in determining survival

(Boehme et al., 2000) and death (Colamussi et al., 2001; Jinquan et al., 2003; Kaul and

Lipton, 1999; Zhang et al., 2005) of various cell types. To investigate the biological consequences of CCL5-CCR5 interactions on T cell survival or death, PM1.CCR5 T cells were treated with different doses of CCL5 and the viability of cells assessed by the apoptosis marker annexin V and the permeability indicator 7-amino actinomycin D (7-

AAD). At 10 ng/ml – 1 µg/ml (nM) doses, CCL5 treatment did not affect viability, but at

10 µg/ml (µM) doses CCL5 induced apoptosis (Figure 2.1.A). Classical apoptotic cell death may be distinguished by DNA fragmentation, revealed when cells were treated with

PMA and ionomycin or 10 µg/ml of CCL5 (Figure 2.1.B). Additionally, we confirmed that 10 µg/ml of CCL5 induced apoptosis in PM1.CCR5 and another CCR5-expressing T cell line, MOLT-4.CCR5 (Figure 2.1.C). By contrast, native PM1 and MOLT-4 cells lacking CCR5 expression were not susceptible to CCL5-inducible apoptotic cell death

(Figure 2.1.D, E). Notably, the PM1 and MOLT-4 cell lines do not express CCR1, an alternate receptor for CCL5 in T cells.

2.4.2. CCL5 induced cell death is mediated by the mitochondrial/apoptosome pathway

At nM doses, CCL5 acts as a costimulatory signal for T cells. Indeed, costimulation through CD28 in the context of CD3 protects cells from AICD (Collette et al., 1998; Noel et al., 1996). Perhaps, at µM doses CCL5 bypasses the T cell receptor to

Figure 2.1. µM concentrations of CCL5 induce apoptosis in PM1.CCR5 T cells.

(A) 2 x 105 PM1.CCR5 cells/ml were treated with varying doses of CCL5 for 24 h and percent apoptotic cells were detected by staining with Annexin V-FITC and 7-AAD. Data are representative of three independent experiments (mean ± S.D.) **p<0.01. (B) 2 x 105 PM1.CCR5 cells/ml were either left untreated (control), treated with CCL5 (10 µg/ml) for either 24h or 48h. DNA fragmentation assay was performed as described in Experimental Procedures. Cells treated with PMA and ionomycin (P+I) for 24 h served as a positive control. Data are representative of two independent experiments. (C) 2 x 105 PM1.CCR5 and MOLT-4.CCR5 T cells/ml were either left untreated or treated with 10 µg/ml CCL5 for 24 h. Apoptotic cells were detected by staining with Annexin V- FITC and 7-AAD. The percentage of the cell population in each quadrant is indicated to the right of each FACS blot. Data are representative of five independent experiments. (D) Cell surface CCR5 expression was determined for native PM1, PM1.CCR5, native MOLT-4, and MOLT-4.CCR5 cells by FACS. The dotted line represents the fluorescence intensity using a FITC labeled isotype control IgG antibody. The bold solid line and the grey solid line represents the fluorescence intensity using primary anti-CCR5 antibody in conjunction with the secondary anti-mouse FITC. Data are representative of three independent experiments. (E) 2 x 105 native PM1 and native MOLT-4 cells/ml were either left untreated or treated with 10 µg/ml CCL5 for 24 h. Apoptotic cells were detected by staining with Annexin V-FITC and 7-AAD. The percentage of the cell population in each quadrant is indicated to the right of each FACS blot. Data are representative of three independent experiments.

Figure 2.1.

A B 70 ** 60

ositive p 40 30

10 V % Annexin 0 Control 10ng/mL 100ng/mL 1µg/mL 10µg/mL CCL5 concentration

C Untreated CCL5 treated

0 7 15 53

92 0 29 3

PM1.CCR5

7-AAD 7-AAD

Annexin V-FITC Annexin V-FITC

0 4 0 15

95 1 35 50

MOLT-4.CCR5 7-AAD 7-AAD 7-AAD

Annexin V-FITC Annexin V-FITC

Native PM1 Native MOLT-4 PM1.CCR5 MOLT-4.CCR5

CCR5-FITC CCR5-FITC

Untreated CCL5 treated

0.5 9 1 8 91 0 90 0.5

PM1 7-AAD 7-AAD 7-AAD

Annexin V-FITC Annexin V-FITC

0 2 0 8 97 1 92 0

MOLT-4

7-AAD 7-AAD

Annexin V-FITC Annexin V-FITC

induce apoptosis. The Fas/FasL apoptotic pathway has been studied extensively in CD4+

T cells. We did not observe any change in Fas or FasL expression following CCL5 treatment for 24 hours (Figure 2.2.). Moreover, pretreatment of cultures with the anti-

FasL monoclonal antibody, NOK1, did not prevent CCL5-mediated apoptosis (Figure

2.3.). Changes in mitochondrial membrane permeability (ΔΨ) lead to the efflux of apoptotic factors, the release of cytochrome c, apoptosome formation and finally chromatin clumping and DNA fragmentation. Accordingly, we examined CCL5- inducible changes in mitochondrial membrane potential and observed a time-dependent reduction in ΔΨm (Figure 2.4.A). Indeed, the results in Figure 2.4.B reveal a CCL5 inducible and time-dependent accumulation of cytochrome c in the cytosol in PM1.CCR5 cells, that is maximal at 12 h. We observed a concomitant cleavage of caspase-9 (37 kDa fragment) and caspase-3 (17 kDa and 19 kDa fragments) at 8 h that is sustained for 24 h

(Figure 2.4.C). The activation of caspase-3 was further confirmed by intracellular FACS analysis using the anti-active caspase-3 antibody: At 10 h post-CCL5 treatment active caspase-3 was detected (Figure 2.4.D). Finally, we examined the cleavage of the endogenous caspase-3 substrate PARP, in similar time course studies. The 85 kDa cleavage fragment of PARP was detected at 8 hours post-CCL5 treatment and to a greater extent at 16 hours (Figure 2.4.E).

Figure 2.2 CCL5 does not affect Fas/FasL expression in T cells.

2 x 105 PM1.CCR5 or MOLT-4.CCR5 cells/ml were either left untreated (control) or treated with CCL5 (10 µg/ml) for 24 hrs. Cells were then collected, washed and stained for Fas or FasL. The dotted line represents the fluorescence intensity using a PE labeled isotype control IgG antibody. The bold solid line represents the fluorescence intensity using primary anti-Fas antibody, and the grey solid line represents the fluorescence intensity using primary anti-FasL antibody.

Figure 2.2.

Untreated CCL5 treated

PM1.CCR5

IgG control Anti-FasL Anti-Fas

MOLT-4.CCR5

Figure 2.3. FasL neutralizing monoclonal antibody NOK1 does not block CCL5- mediated apoptosis in PM1.CCR5 cells.

PM1.CCR5 cells were pretreated with either IgG control or NOK1 antibody (10 µg/ml) for 30 minutes and either left untreated or treated with 10 µg/ml CCL5 for 24 h. Apoptotic cells were detected by staining with AnnexinV-FITC and 7-AAD. The percentage of the cell population in each quadrant is indicated to the right of each FACS blot. Data are representative of two independent experiments.

Figure 2.3.

Untreated CCL5 treated 1 12 1 59 86 1 34 5 IgG

0 13 2 50

85 2 42 7 NOK1

7-AAD

Annexin V-FITC

Figure 2.4. µM concentrations of CCL5 induce cytochrome c release, caspase-9 and caspase-3 activation and PARP cleavage.

(A) 1 x 106 PM1.CCR5 cells were treated with 10 µg/ml CCL5 for the indicated times. Cells were collected and stained with 2 µM JC-1, and analyzed by FACS. Mitochondrial depolarization was measured by decrease of JC-1 accumulation in the mitochondria (thus an increase in JC-1 monomers) due to loss of membrane potential. CCCP was used as positive control and gating correction (data not shown). Data are representative of two independent experiments. (mean ± S.D.) *p<0.05, **p<0.01 (B) PM1.CCR5 cells were either left untreated or treated with 10 µg/ml CCL5 for the indicated times. Cells were harvested and the cytosolic fraction isolated. The resulting lysates were resolved by SDS-PAGE and immunoblotted with anti-cytochrome c antibody. Membranes were stripped and reprobed for tubulin as loading control. The relative fold increase of cytochrome c levels is shown as signal intensity over loading control. Data are representative of two independent experiments. (C) PM1.CCR5 cells were either left untreated or treated with 10 µg/mL CCL5 for the indicated times. Cells were harvested and lysates were resolved by SDS-PAGE and immunoblotted with anti-caspase-9 or anti- cleaved caspase-3 antibody. Membranes were stripped and reprobed for tubulin as a loading control. The relative fold increase of protein level is shown as signal intensity over loading control. Data are representative of two independent experiments. (D) 1 x 106 PM1.CCR5 cells were either left untreated or treated with 10 µg/ml CCL5 for the times indicated, fixed with 2% paraformaldehyde and permeabilized with 0.5% saponin. Cells were then stained with an anti-active caspase-3-FITC antibody. Data are representative of three independent experiments. (E) PM1.CCR5 cells were either left untreated or treated with 10 µg/mL CCL5 for the indicated times and immunoblotted with anti-PARP antibody. The relative fold increase of protein level is shown as signal intensity over loading control.

Figure 2.4.

A 100

70 *

m * 60 ** 50

40 % ΔΨ

0 02481624 CCL5 treatment (hours)

B cytochrome c 3.5 CCL5 treated (time [hrs]) 3 0 2 4 12 24 2.5 2 WB: cytochrome c 1.5 WB: tubulin 1

Signal Intensity 0.5

0 0241224 CCL5 treatment (hours) CCL5 treatment (hours) C CCL5 treated (time [hrs]) 0 2 4 8 16 24 37kDa Cleaved Caspase-9

19kDa Cleaved Caspase-3 17kDa WB: tubulin

caspase-9 caspase-3 4.5 6 4 17 k D a 5 3.5 19 k D a

3 4 2.5 3 2 1.5 2 1 Signal Intensity Signal Intensity 1 0.5

0 0 0 2 4 8 16 24 0 2 4 8 16 24 CCL5 treatment (hours) CCL5CCL5 treatment treatment (hours) (hours) 90

Untreated

10h

24h Counts 48h

Active caspase-3-FITC

E CCL5 treated (time [hrs]) 0 2 4 8 16

WB: Cleaved PARP

WB: tubulin

2.5

1. 5 1 0.5

Signal Intensity 0 024816 CCL5CCL5 treatment treatment (hours) (hours)

2.4.3. µM concentrations of CCL5 induce apoptosis in CCR5 expressing primary T cells

Human primary T cells were isolated from peripheral blood from healthy donors and activated as described in Experimental Procedures. Cells were subsequently sorted based on cell surface CCR5 expression, and were >95% CD3 positive (Figure 2.5.A). To further investigate the biological consequences of CCL5-CCR5 interactions in primary T cells, CCR5+ and CCR5- primary T cells were treated with CCL5 for 24 h. Consistent with our data for PM1.CCR5 cultures, CCL5 inducible apoptosis was dependent on

CCR5 expression, did not occur at 100 ng/ml – 1 µg/ml (nM) CCL5 doses, but required

10 µg/ml (µM) doses (Figure 2.5.B). Figure 2.5.C reveals a CCL5 inducible and time- dependent cleavage of caspase-9 (37 kDa) at 2 h that is maximal at 8 h. These data confirm that CCL5 induces apoptosis in T cells in a CCR5- and mitochondrial pathway- dependent manner.

2.4.4. Expression of intact CCR5, but not CCR5Y339F, renders PM1 cells susceptible to CCL5-inducible apoptosis

CCL5 mediated CCR5 activation results in the exchange of GTP for GDP by the

Gα subunit, the dissociation of heterotrimeric G-proteins into Gα and Gβγ subunits and subsequent signal transduction. Additionally, we and others have provided evidence for the CCL5-CCR5-dependent recruitment and activation of distinct protein tyrosine kinases

[reviewed in (Wong and Fish, 2003)]. To investigate whether phosphorylation of CCR5 on intracellular Tyrosine (Y) residues influences CCR5-mediated apoptosis, the intracellular residue Y339 was mutagenized to phenylalanine (F). Vectors for intact

Figure 2.5. µM concentrations of CCL5 induce apoptosis in human primary T cells.

(A) Human peripheral T cells were isolated as described in Experimetal Procedures. FACS analysis shows cell surface CCR5 expression of pre-sorted (left side) and post- sorted (right side) T cell populations. (B) 2 x 105 CCR5- or CCR5+ T cells/ml were incubated with varying doses of CCL5 for 24 h. Percent apoptotic cells were detected by Annexin V-FITC and 7-AAD. Data are representative of three independent experiments. (mean ± S.D.) *p<0.05 (C) CCR5+ T cells were either left untreated or treated with 10 µg/mL CCL5 for the indicated times. Cells were harvested and lysates were resolved by SDS-PAGE and immunoblotted with anti-caspase-9 antibody. Membranes were stripped and reprobed for tubulin as a loading control. The relative fold increase of protein level is shown as signal intensity over loading control. Data are representative of two independent experiments.

Figure 2.5.

A Pre-sort Post-sort

IgG control Anti-CCR5 CCR5- T cells CCR5+ T cells

CCR5-FITC CCR5-FITC CCR5-FITC CCR5-FITC

B 15 CCR5+ T cells CCR5− T cells * 10

V positive % Annexin 0 Untreated 100ng/mL 1ug/mL 10ug/mL

CCL5 concentration C

CCL5 treated (time [hrs]) 0 2 4 8 16 24 WB: Cleaved Caspase-9 WB: tubulin

4 3.5

3 2.5 2 1.5

0.5 Intensity Signal 0 02481624 CCL5 treatment (hours)

CCR5 and CCR5Y339F cDNA were constructed (as described in Materials and

Methods) and introduced into native PM1 cells. Each transfectant was analyzed for cell surface CCR5 expression using an anti-human CCR5 antibody (Figure 2.7.A), which does not distinguish among the intact or mutant receptors, and clones exhibiting similar ectopic expression levels were selected for use. CCL5 binding and receptor internalization kinetics were comparable in PM1.CCR5Y339F and PM1.CCR5 cells

(Figure 2.6.A, B). In subsequent experiments we examined whether 10 µg/ml (µM) doses of CCL5 would induce apoptosis in PM1 cells expressing Tyrosine-339 deficient mutant CCR5. The data in Figure 2.7.B. show that CCL5 induced apoptosis in PM1 cells expressing intact CCR5, but not in cells expressing CCR5Y339F.

2.4.5. CCL5-induced cell death is dependent on GAG interactions

In addition to the interaction of chemokines with their cognate cell surface receptors, chemokines bind to heparin-like GAGs normally expressed on proteoglycan components of the cell surface and extracellular matrix, thereby creating a concentration gradient for cells to migrate along via a haptotactic mechanism (Amara et al., 1999;

Baltus et al., 2003; Cinamon et al., 2001; Kuschert et al., 1999; Netelenbos et al., 2002;

Pablos et al., 2003). Different studies suggest that chemokine-GAG interactions enhance the functional activities of chemokines by a mechanism that involves sequestration onto the cell surface (Ali et al., 2000; Burns et al., 1998; Hoogewerf et al., 1997). Binding studies with immobilized heparin and HUVECs revealed that the affinity interaction of

CCL5 to GAGs can be ablated by the addition of heparin, heparin sulfate, chondroitin sulfate and dermatan sulfate (Kuschert et al., 1999). Cell surface CCL5 binding was

Figure 2.6. CCL5 binding and receptor internalization of PM1.CCR5 and PM1.CCR5Y339F cells.

(A) PM1.CCR5 and PM1.CCR5Y339F cells were either left untreated or treated with 250 nM CCL5 at 37˚C for the times indicated. Cells were collected on ice, washed, and stained for cell surface CCR5 expression. % CCR5 internalization was calculated as the MFI of treated cells / MFI of untreated cells x 100% (± S.D.) (B) PM1.CCR5 and PM1.CCR5Y339F cells were either left untreated or treated with 250 nM CCL5 for 1h on ice. Cells were collected, washed, and stained for CCR5 and CCL5. The data are shown as the ratio of CCL5 MFI and CCR5 MFI (± S.D.)

Figure 2.6.

A 120 PM1.CCR5

100 PM1.CCR5Y339F

% Internalization 20

0 5 15 30 60 Time (min)

100

CCL5 MFI / CCR5 MFI Ratio 0 PM1.CCR5 PM1.CCR5Y339F

Figure 2.7. Introduction of CCR5 but not CCR5Y339F into PM1 T cells renders them susceptible to CCL5-inducible apoptosis.

(A) cDNA for intact CCR5, CCR5Y339F or vector alone was introduced by retroviral transduction into native PM1 cells. Cell surface CCR5 expression of all transfectants was examined by FACS. The dotted line represents the fluorescence intensity using FITC labeled isotype control IgG antibody. The bold solid line represents the fluorescence intensity using primary anti-CCR5 antibody in conjunction with the secondary anti- mouse FITC. (B) 2 x 105 PM1.vector, PM1.CCR5 and PM1.CCR5Y339F cells/ml were either left untreated or treated with 10 µg/ml CCL5 for 24 h. % Apoptotic cells were detected by staining with Annexin V-FITC and 7-AAD. Data are representative experiment of five independent experiments. (mean ± S.D.) **p<0.01

Figure 2.7.

PM1.vector PM1.CCR5 PM1.CCR5Y339F

CCR5-FITC CCR5-FITC CCR5-FITC

** 50

V positive % Annexin

0 PM1.vector PM1.CCR5 PM1.CCR5Y339F

observed in both native PM1 and PM1.CCR5 cells, although consistently higher CCL5 binding was seen in PM1.CCR5, presumably due to expression of its high-affinity receptor (Figure 2.8.A). The data suggest that PM1 T cells have GAGs on the cell surface that are able to bind and sequester CCL5. To address the role of GAG interactions in CCL5-induced cell death, PM1.CCR5 cells were treated with CCL5 and varying doses of heparin and chondroitin sulfate. Addition of heparin or chondroitin sulfate rescued PM1.CCR5 cells from CCL5- induced cell death: 10 µg/ml of heparin or

100 µg/ml chondroitin conferred complete protection (Figure 2.8.B). Subsequently,

PM1.CCR5 cells were treated with chondroitinase ABC to enzymatically remove the

GAGs from the cell surface. Chondroitinase treatment significantly reduced the ability of

CCL5 to bind to the cell surface (Figure 2.8.C) without altering CCR5 expression itself

(Figure 2.8.D). We show in Figure 2.8.E that chondroitinase treatment protected

PM1.CCR5 cells from CCL5-induced death. Similarly, when PM1.CCR5 cells were treated with 10 µg/ml (µM) [44AANA47]-CCL5, a non-GAG binding variant of CCL5

(Proudfoot et al., 2003) we did not observe apoptosis (Figure 2.8.F). Moreover, when

PM1.CCR5 cells were treated with a cocktail of equal concentrations of [44AANA47]-

CCL5 and intact CCL5, which had been pre-mixed for 4 h at room temperature, the resulting heterodimer did not induce apoptosis (Figure 2.8.G). The data suggest that in the absence of CCL5-GAG interactions on the cell surface, CCL5-inducible CCR5 activation that leads to apoptosis does not occur.

100

Figure 2.8. CCL5-GAG interactions are important for apoptosis.

(A) Native PM1 and PM1.CCR5 cells were either left untreated or treated with 10 µg/ml CCL5 for 1 hr on ice. CCL5 binding to the cell surface was determined by FACS analysis. The solid line represents staining with the FITC-labeled anti-CCL5 antibody and the dotted line staining with the FITC-labeled isotype control antibody. Mean fluorescence intensity is indicated in each FACS histogram. Data are representative of two independent experiments. (B) 2 x 105 PM1.CCR5 cells/ml were either left untreated or treated with 10 µg/ml CCL5, in the presence or absence of increasing doses of heparin or chondroitin sulfate A, for 24 h. Cell viability was determined using the MTT assay. Data are representative of three independent experiments. (mean ± S.D.) **p<0.01 (C) PM1.CCR5 cells were either pretreated with PBS or chondroitinase ABC prior to CCL5 treatment. CCL5 binding to the cell surface was determined by FACS analysis. Data are representative of three independent experiments. (D) PM1.CCR5 cells were either pretreated with PBS or chondroitinase ABC and cell surface CCR5 expression determined by FACS analysis. (E) PM1.CCR5 cells were either pretreated with PBS or chondroitinase ABC prior to 24 h CCL5 treatment. Apoptotic cells were detected by staining with Annexin V-FITC and 7-AAD. Data are representative of three independent experiments. (mean ± S.D.) **p<0.01 (F) PM1.CCR5 cells were either left untreated or treated with 10 µg/mL CCL5 or [44AANA47]-CCL5 for 24 h. Additionally, equal concentrations of [44AANA47]-CCL5 and wildtype CCL5 were preincubated for 4 h at room temperature, then PM1.CCR5 cells stimulated for 24 hours (1:1 [44AANA47]- CCL5:CCL5)~ heterodimer. Apoptotic cells were detected by staining with Annexin V- FITC and 7-AAD. Data are representative of three independent experiments. (mean ± S.D.) **p<0.01

101

Figure 2.8.

A Untreated CCL5 treated

Mean: 6.4 Mean: 63.3

PM1

CCL5 - FITC CCL5 - FITC Untreated CCL5 treated

Mean: 3.7 Mean: 90.9

PM1.CCR5

CCL5 - FITC CCL5 - FITC

% Viability % Viability

% Viability

CCL5 + + + + CCL5 + + + + Heparin - + + + Chondroitin µg/mL 0 1 10 100 Sulfate - + + + µg/mL 0 1 10 100

102

C D

Chondroitinase PBS alone PBS +CCL5 +CCL5 PBS alone

Chondroitinase treated

CCL5 - FITC CCL5 - FITC CCL5 - FITC CCR5-FITC

E F ** ** 50 60

50 40

40 30 30 20 20

% Annexin V positive V positive % Annexin 10 V positive % Annexin 10

0 0

CCL5 CCL5 CCL5 PBS alone alone PBS Untreated Untreated + CCL5 Heterodimer Heterodimer PBS + CCL5 CCL5 PBS + [44AANA47]- Chondroitinase Chondroitinase Chondroitinase

103

2.4.6. Aggregation of CCL5 is required for CCL5-induced cell death

At µM concentrations, CCL5 forms higher order oligomers/aggregates (Appay et al., 1999; Czaplewski et al., 1999). Certainly, CCL5 oligomerization is necessary for

CCR1-mediated arrest of leukocytes on activated epithelium during leukocyte recruitment, although subsequent CCR5-mediated transmigration does not require CCL5 aggregation (Baltus et al., 2003). To address the importance of CCL5 aggregation in

CCL5-induced PM1.CCR5 cell death, experiments were conducted using the E26A and

E66S CCL5 non-aggregating mutants. Importantly, at 10 µg/ml (µM) concentrations, where native CCL5 forms large oligomers, E26A and E66S form tetramers and dimers, respectively (Czaplewski et al., 1999). The results in Figure 2.9. show that the E66S mutant did not induce cell death even at 100 µg/ml doses, in contrast to both the intact

CCL5 and the mutant E26A. The data suggest that CCL5 tetramers are the minimal higher order aggregates required for inducing T cell death.

104

Figure 2.9. The CCL5 aggregation mutant E66S does not induce PM1.CCR5 cell death.

2 x 105 PM1.CCR5 cells/ml were either left untreated or treated with 10 µg/ml of CCL5, E26A, E66S or 100 µg/mL E66S. Apoptotic cells were detected by staining with Annexin V-FITC and 7-AAD. Data are representative of three independent experiments. (mean ± S.D.) **p<0.01

105

Figure 2.9.

70 ** 60 **

e 50

% Annexin V positiv 20

0 Untreated CCL5 E26A E66S100µg/ml E66S E66S 10µg/ml

106

2.5. Discussion

Chemokines are both chemotactic and immunoregulatory molecules. In addition to their roles in the recruitment of T cells to sites of inflammation and in triggering their adhesion and diapedesis, accumulating evidence implicates specific chemokines in antigen-independent T cell activation. Clearly, activated chemokine receptors are able to invoke many different signaling cascades that determine the functional outcome of the target cell. Herein we report on CCL5 activity in T cells in the context of GAG-binding, oligomerization and CCR5-mediated apoptosis. Certainly, CCL5-induced T cell death has been implicated as a potential immune escape mechanism in melanoma progression, associated with CCR5 mediated cytochrome c release, and caspase-9 and -3 activation

(Mellado et al., 2001a). CCL5-CCR5 mediated caspase-3 activation and cell death have been reported in neuroblastoma cells, and there is also evidence that HIV-1 virion - mediated apoptosis of bystander uninfected CD4+ T cells, which leads to T cell depletion in infected individuals, is CCR5-dependent (Cartier et al., 2003).

The cell suicide machinery can be induced by several factors, which then converge to activate caspases via two pathways: one involving caspase-8 recruitment to death receptors (TNF or CD95) and the other involving the mitochondrial/apoptosome pathway [reviewed in (Creagh et al., 2003)]. Our studies show that CCL5 induced dissipation of mitochondrial membrane potential and cytochrome c release into the cytosol in a time-dependent manner, with no involvement of CD95/CD95L. This was accompanied by increased cleavage of caspase-9, caspase-3 and PARP. Taken together,

107

the data indicated that CCL5-inducible apoptosis in CCR5-expressing T cells is mediated by activation of the mitochondrial/apoptosome pathway.

CCL5-inducible apoptosis was not sensitive to pertussis toxin (pTx) treatment, implying a Gαi-independent mechanism. Accordingly, we focused on Tyrosine (Y) residues in the intracellular portion of CCR5. CCR5 contains 3 intracellular tyrosine residues, at position 127, 307 and 339. Y127 lies in the second intracellular loop of the receptor in the DRY motif, highly conserved among CC chemokine receptors and implicated in mediating chemokine receptor signal transduction. Mutation of the DRY motif in CCR5 results in a non-functional receptor with reduced surface expression and incapable of Gα subunit binding and signaling (Huttenrauch et al., 2002a; Venkatesen et al., 2001). The other two intracellular tyrosine residues of CCR5, Y307 and Y339, reside in the C-terminal tail of the receptor. While Y307 is conserved among CC chemokine receptors, Y339 is unique to CCR5 and CCR4. In other studies, we have evidence that vaccinia virus activation of CCR5 results in tyrosine phosphorylation signaling events mediated by Y339 and not Y307 (Rahbar et al., 2006). Accordingly, we focused on

Y339, to investigate its contribution as a potential site for recruitment of signaling effectors in mediating cell death. Dong et al. reported that whether HEK293 cells express intact CCR5 or the tyrosine mutant variant, CCR5Y339F, CCL5-receptor binding is unaffected (Dong et al., 2005). In agreement, we do not observe a defect in the kinetics of CCL5 binding or internalization in PM1.CCR5Y339F cells in response to CCL5.

However, as described herein, CCL5-induced apoptosis in PM1 cells expressing intact

CCR5, but not in those expressing CCR5Y339F. The data suggest that Y339 may be a

108

critical target for effector recruitment after CCR5 dimerization, an obligatory step to trigger signaling in response to CCL5 (Hernanz-Falcon et al., 2004). Certainly, Y139 in the DRY motif of CCR2 has been identified as the primary target for Jak2 mediated

CCR2b receptor phosphorylation after MCP-1 binding (Mellado et al., 1998).

Furthermore, CCR2bY139F acts as a CCR2b dominant negative mutant, blocking chemokine responses by forming non-functional dimers with intact CCR2b.

We investigated the role of CCL5-GAG interactions in mediating T cell apoptosis.

The addition of exogenous heparin and chondroitin sulfate completely rescued

PM1.CCR5 cells from CCL5-induced cell death in a dose-dependent manner. We infer that heparin and chondroitin sulfate compete for CCL5-cell surface GAG interactions, thereby effectively blocking cell death. Apparently, heparin is more potent than chondroitin sulfate in protecting PM1.CCR5 cells from CCL5-induced cell death. This result is consistent with CCL5 exhibiting a greater affinity for heparin than chondroitin sulfate (Kuschert et al., 1999). The amino acid residues R45, K46 and R47 in CCL5 comprise a BBXB motif that is important for heparin binding (Martin et al., 2001;

Proudfoot et al., 2001). Other chemokines including CCL3, CCL4 and CXCL12 have a similar motif (Chakravarty et al., 1998; Koopmann et al., 1999; Koopmann and Krangel,

1997; Laurence et al., 2001; Martin et al., 2001; Sadir et al., 2001; Vita et al., 2002). We found that enzymatic digestion of cell surface chondroitin sulfate by chondroitinase ABC treatment protected cells from CCL5-induced death. This was consistent with a significant decrease in CCL5 binding to the cell surface after chondroitinase ABC treatment, despite no effect on CCR5 cell surface expression (Fig 5C,D), in further

109

support of a role for GAGs in sequestering chemokines and facilitating chemokine receptor binding. Proudfoot et al. have demonstrated that CCL5 GAG mutants

(designated [44AANA47]-CCL5) exhibit an 80% reduction in heparin binding capacity and no recruitment activity in vivo, although in vitro activity is retained (Proudfoot et al.,

2003). Recently, Johnson et al. reported that [44AANA47]-CCL5 functions as a dominant- negative inhibitor in a number of inflammatory models (Johnson et al., 2004). In

PM1.CCR5 cells, [44AANA47]-CCL5 was not able to induce apoptosis, even at concentrations reaching 100 µg/mL. Additionally, mixing both [44AANA47]-CCL5 and intact CCL5 results in heterodimers that are unable to recruit cells into the peritoneal cavity in vivo (Johnson et al., 2004). We observe that this heterodimeric mixture will not induce apoptosis in PM1.CCR5 cells, suggesting that [44AANA47]-CCL5 is able to disrupt CCL5 oligomerization on GAGs. Taken together, our data suggest that in the absence of CCL5-GAG interactions on the cell surface, CCL5-inducible CCR5 activation that leads to apoptosis does not occur.

CCL5 forms higher order oligomers at µM concentrations (Appay et al., 1999;

Czaplewski et al., 1999). We have provided evidence that different non-aggregating mutants variably affected cell death. Specifically, the E66S mutant did not induce cell death, even at concentrations reaching 100 µg/mL, in contrast to both the native aggregating CCL5 and the mutant E26A. The data suggest that CCL5 tetramers are the minimal higher order aggregates required for inducing T cell death, in agreement with evidence that tetramers are the minimal order aggregates required to recruit cells in vivo

(Proudfoot et al., 2003).

110

The ability of CCL5 to induce at least two distinct biological outcomes – chemotaxis and apoptosis, is an important feature of this chemokine. At nM concentrations, CCL5-CCR5 interactions induce a pertussis toxin-sensitive signaling cascade responsible for the activation of integrins and chemotaxis. CCL5 at µM concentration triggers distinct tyrosine phosphorylation signaling events, leading to prolonged calcium influx, hyperphosphorylation and generalized T cell activation (Bacon et al., 1995). The effects of µM CCL5 in T cells have been well documented, ranging from influencing proliferation, cytokine production and permissiveness for HIV-1 infection (Appay et al., 1999; Appay et al., 2000; Bacon et al., 1995; Bacon et al., 1996;

Chang et al., 2002; Dairaghi et al., 1998; Szabo et al., 1997; Turner et al., 1996). As an extension of these, the present study describes a potential novel mechanism by which high concentrations of CCL5 determine T cell fate through activation of the mitochondrial/apoptosome pathway. Because µM concentrations of CCL5 are required to invoke this outcome, the important question is whether these concentrations of CCL5 are achievable or likely in vivo. Certainly, unusually high CCL5 concentrations may be realizable at sites of acute infection or inflammation through the sequestration of CCL5 by cell surface and/or extracellular matrix GAGs. In addition, the unique ability of CCL5 to form aggregates, facilitated through GAG-binding, may also lead to an increase in local CCL5 concentration (Appay et al., 1999; Appay et al., 2000; Czaplewski et al.,

1999; Hoogewerf et al., 1997; Kuschert et al., 1999; Martin et al., 2001; Proudfoot et al.,

2001; Proudfoot et al., 2003). We, therefore, infer that the CCL5-CCR5 induced apoptosis of T cells we observe is not likely an in vitro artifact, but is attainable in vivo.

111

We argue against the possibility of CCL5 aggregates blocking the interaction of growth factors with their receptors and indirectly inducing apoptosis, as the viability of native

PM1 and MOLT-4 cells lacking CCR5 expression, yet able to sequester CCL5 aggregates by GAG binding, was not affected by µM CCL5.

This study describes a potential mechanism by which CCL5-CCR5 interactions determines T cell fate. Apoptosis of T lymphocytes is critical in maintaining both central and peripheral tolerance and homeostasis. AICD in T cells is certainly a major mechanism of clonal deletion in the immune system. Death receptors, especially

CD95/CD95L interactions have been described as an important inducer of AICD in T cells, although different effectors, including c-Myc and TRAIL, have also been identified.

Recently, Tyner et al. described an anti-apoptotic signaling pathway in macrophages mediated by nM CCL5-CCR5 interactions (Tyner et al., 2005). Although apparently contradicting our findings, the lineage of the cell type studied and the lower dose of

CCL5 employed, may explain these different observations. In the present study, we describe a potential novel mechanism by which high concentrations of the CCL5 determine T cell fate through activation of the mitochondrial/apoptosome pathway. Our results suggest that CCL5-induced cell death, in addition to CD95/CD95L mediated events, may contribute to clonal deletion of T cells during an immunological response.

The identification of specific CCR5-mediated signaling effectors critical for apoptosis is currently under investigation.

112

Chapter 3

CCL5-mediated T cell Chemotaxis Involves the Initiation of mRNA Translation through mTOR/4E-BP1

Thomas T. Murooka*, Ramtin Rahbar*, Leonidas C. Platanias# and Eleanor N. Fish*1

*Division of Cellular and Molecular Biology, Toronto General Research Institute, University Health Network & Department of Immunology, University of Toronto #Robert H. Lurie Comprehensive Cancer Center, Northwestern University Medical School, Chicago, USA

Chapter 3 was published as:

Murooka, T.T., Rahbar, R., Platanias, L.C., and Fish, E.N. (2008). CCL5-mediated T- cell chemotaxis involves the initiation of mRNA translation through mTOR/4E-BP1. Blood 111, 4892-4901.

T.T.M. performed all experiments, analyzed the data and drafted the manuscript. R.R. analyzed the data and edited the manuscript. L.C.P. designed research. E.N.F. designed research, analyzed the data and drafted the manuscript.

113

3.1. Abstract

The multi-step, coordinated process of T cell chemotaxis requires chemokines, and their chemokine receptors, to invoke signaling events to direct cell migration. Here, we examined the role for CCL5-mediated initiation of mRNA translation in CD4+ T cell chemotaxis. Using rapamycin, an inhibitor of mTOR, our data show the importance of mTOR in CCL5-mediated T cell migration. Cycloheximide, but not actinomycin D, significantly reduced chemotaxis, suggesting a possible role for mRNA translation in T cell migration. CCL5 induced phosphorylation/activation of mTOR, p70 S6K1 and ribosomal protein S6. Additionally, CCL5 induced PI-3’K-, phospholipase D- and mTOR-dependent phosphorylation and deactivation of the translational repressor 4E-BP1, which resulted in its dissociation from the eukaryotic initiation factor-4E. Subsequently, eIF4E associated with scaffold protein eIF4G, forming the eIF4F translation initiation complex. Indeed, CCL5 initiated active translation of mRNA, shown by the increased presence of high-molecular-weight polysomes which were significantly reduced by rapamycin treatment. Notably, CCL5 induced protein translation of cyclin D1 and MMP-

9, known mediators of migration. Taken together, we describe a novel mechanism by which CCL5 influences translation of rapamycin-sensitive mRNAs and “primes” CD4+ T cell for efficient chemotaxis.

114

3.2. Introduction

Directed cell migration is a tightly regulated process, critical for numerous biological processes including proper tissue development, wound healing and protection against invading pathogens. Chemokines are soluble, extracellular chemo-attractant molecules that play a vital role in many of these biological processes. The chemokines are a large family of mainly secreted, 8-10 kDa proteins subdivided into 4 families based on the relative positioning of the first two cysteine residues near the N-terminus (Luster,

1998; Stein and Nombela-Arrieta, 2005; Zlotnik et al., 1999). Chemokine ligands interact with seven transmembrane, G protein-coupled receptors (GPCRs) to induce directed cellular migration. Secreted chemokines bind to heparin-like glycosaminoglycans (GAGs) normally expressed on proteoglycan components of the cell surface and extracellular matrix, thereby creating a concentration gradient allowing immune cells to migrate via a haptotactic mechanism (Amara et al., 1999; Cinamon et al.,

2001; Kuschert et al., 1999; Netelenbos et al., 2002; Pablos et al., 2003; Proudfoot et al.,

2003). These immobilized chemokines allow leukocytes to stop rolling, promote extravasation and regulate directional migration.

T cell chemotaxis is a process that requires the activation and re-distribution of a number of signaling, adhesion and cytoskeletal molecules at the cell surface (Raftopoulou and Hall, 2004; Watanabe et al., 2005). CCL5/RANTES is a member of the β- chemokines and is chemotactic for Th1 T cells, macrophages, dendritic cells and NK cells through the expression of CCR1 and/or CCR5 (Kawai et al., 1999; Lederman et al.,

2006; Rabin et al., 1999; Schall et al., 1990; Siveke and Hamann, 1998). It is now clear

115

that signaling through CCR5 controls a multitude of cellular functions, including chemotaxis, proliferation, cytokine production, survival and apoptosis (Bacon et al.,

1995; Bacon et al., 1998; Bacon et al., 1996; Dairaghi et al., 1998; Ganju et al., 2000;

Ganju et al., 1998; Murooka et al., 2006; Rahbar et al., 2006). Through studies with PI-

3’K inhibitors wortmannin and LY294002, it is known that CCL5-mediated PI-3’K activation is critical for chemotaxis (Turner et al., 1995a; Ward, 2004; Wymann and

Marone, 2005). Chemokines activate the PI-3’Kγ isoform by the βγ subunits of trimeric

G proteins at the cell membrane, although contributions from other isoforms cannot be discounted (Curnock et al., 2003; Curnock and Ward, 2003; Sasaki et al., 2000). Studies with the mTOR inhibitor, rapamycin, have underscored the role for mTOR in fibronectin and GM-CSF induced cellular migration downstream of PI-3’K (Daniel et al., 2004;

Gomez-Cambronero, 2003; Sakakibara et al., 2005; Sun et al., 2001). mTOR possesses a carboxy-terminal region sharing significant homology with lipid kinases, especially with

PI-3’K, and has been assigned to a larger protein family termed the PIKKs

(phosphoinositide kinase-related kinase) (Gingras et al., 2004). mTOR exists in two complexes: mTOR Complex1, which is sensitive to rapamycin and phosphorylates p70

S6K1 and initiation factor 4E binding proteins (4E-BPs), and mTOR Complex2, which is rapamycin-resistant and phosphorylates PKB (Dann et al., 2007; Gingras et al., 1998;

Hay and Sonenberg, 2004). mTOR Complex1 is responsible for the phosphorylation of

S6K1 on Threonine-389 (Hay and Sonenberg, 2004; Loewith et al., 2002; Um et al.,

2006). Phosphorylation of 4E-BP1 at the priming site, Threonine-37/46, and additional sites Serine-65 and Threonine-70 are LY294002 and rapamycin sensitive (albeit in varying degrees), indicating that 4E-BP1 is regulated by both mTOR and PI-3’K (Hay

116

and Sonenberg, 2004; Proud, 2007). Another important modulator of mTOR activity is phospholipase D (PLD), for which the primary alcohol, 1-butanol, but not tert-butanol, blocks PLD-mediated S6K activation and 4E-BP1 phosphorylation in several cell types(Fang et al., 2001; Foster, 2007; Hornberger et al., 2006). Indeed, CCL5 has been shown to stimulate PLD activity in Jurkat T cells, but its role in chemotaxis has not been studied (Bacon et al., 1998). mTOR-dependent modulation of S6K1 and 4E-BP1 has been implicated in several cellular processes, including metabolism, nutrient sensing, translation and cell growth (Gingras et al., 2004; Wullschleger et al., 2006). Here, we examine for the first time the effects of CCL5 on the translation initiation of rapamycin- sensitive mRNAs, and their contribution to CD4+ T cell chemotaxis.

mRNA translation is an energy-consuming process that is highly regulated at multiple levels in mammalian cells. Changes in translation rates often correlate with changes in the level of eIF4E, and thus its availability is under tight control. Three eIF4E inhibitory proteins, the 4E-BPs (4E-BP1-3), regulate mRNA translation by sequestering eIF4E (Haghighat et al., 1995). mTOR regulates translation by modulating the availability of eIF4E through hyper-phosphorylation of 4E-BP1 (Beretta et al., 1996).

The mRNA 5’-cap structure is bound by eIF4F, a hetero-trimeric protein complex comprised of an eIF4G backbone, the cap-binding eIF4E and the RNA helicase, eIF4A.

This complex facilitates ribosome binding and passage along the 5’-UTR (untranslated region) towards the initiation codon (Richter and Sonenberg, 2005; von der Haar et al.,

2004). In addition, mTOR controls the translation of 5’-TOP (tract of oligopyrimidines) mRNAs which often encodes for cytoplasmic ribosomal proteins (Meyuhas, 2000;

117

Ruvinsky and Meyuhas, 2006). Although 5’-TOP mRNA translation is sensitive to rapamycin, the exact mechanism is unclear and recent studies have shown that S6K1 and its effector molecule rpS6 are dispensable for their translation (Ruvinsky et al., 2005).

Taken together, mTOR is a crucial regulator of the translational machinery by: (1) directly affecting eIF4F availability for 5’-capped mRNA translation initiation and (2) up-regulating ribosomal protein levels through modulation of 5’-TOP mRNA translation.

Control of translational machinery is an important contributor to the overall gene expression. Translational control allows for the rapid production of proteins without the need for mRNA transcription, processing and export into the cytoplasm. In the present study, we examined the role for CCL5-mediated initiation of mRNA translation in the context of CD4+ T cell chemotaxis. Specifically, we focused on the translation of rapamycin-sensitive mRNAs that contain significant secondary structures in their 5’-UTR.

We describe a novel mechanism by which CCL5 directly modulates protein levels to

“prime” cells for directed cellular migration, thus allowing for a more rapid and effective immune response.

118

3.3. Materials and Methods

3.3.1. Cells and reagents

Human peripheral blood-derived T cells were isolated from healthy donors as previously described (Murooka et al., 2006). Cells were maintained in RPMI 1640 supplemented with 10% fetal calf serum, 100 units/ml penicillin, 100 mg/ml streptomycin and 2 mM L-glutamine (Gibco-BRL). Briefly, CD4+ T cells were purified using the

RosetteSep T cell enrichment cocktail according to manufacturer’s specifications

(StemCell Technologies). T cells were subsequently activated in the presence of plate bound 10 µg/ml anti-CD3 antibody (eBiosciences) and 5 µg/ml anti-CD28 antibody

(eBiosciences) with soluble 5 ng/ml hrIL-12 (Bioshop, Canada) and 2.5 µg/ml anti-IL-4 antibody (eBiosciences) for 2 days, and further expanded in culture supplemented with

100 U/ml hrIL-2 (Bioshop, Canada) for 3 days. T cell purity and CCR5 expression were confirmed at day 5 by FACS analysis using anti-human CCR5 antibody (2D7) and anti- human CD3 antibody (BD Biosciences). Antibodies for phospho-eIF4E (Ser-209), eIF4E, phospho-rpS6 (Ser-235/236), rpS6, phospho-4E-BP1 (Thr-37/46), phospho-4E-BP1 (Thr-

70), 4E-BP1, phospho-p70S6K1 (Thr-389), p70S6K1, phospho-mTOR (Ser-2448) and mTOR were purchased from Cell Signaling Technology. Antibody for human cyclin D1

(DCS-6), eIF4E (P-2) and eIF4G (H-300) were purchased from Santa Cruz

Biotechnology. Murine monoclonal anti-tubulin antibody was purchased from R & D

Systems. Polyclonal rabbit antibody against human MMP-9 was purchased from

Chemicon International. Inhibitors cycloheximide, actinomycin D, rapamycin and

LY294002 were all obtained from Calbiochem. 1-butanol and tert-butanol were purchased from Sigma-Aldrich (Canada). AS-252424 was purchased from Cayman

119

Chemical Company. 2,3-diphosphoglycerate (DPG) has been shown to inhibit PLD and was purchased from Sigma-Aldrich (Canada).(Kanaho et al., 1993; Kusner et al., 1996)

CCL3 (LD78β) was purchased from Peptrotech (USA). CCL5 was a generous gift from

Dr. Amanda Proudfoot (Geneva Research Centre, Merck Serono International).

3.3.2. Immunoblotting and immunoprecipitation

T cells were serum starved in RPMI 1640/0.5% BSA overnight to reduce the effects of the various growth factors found in fetal calf serum (FCS) on mTOR and protein translation. Cells were incubated with 10 nM CCL5 for the times indicated, collected, washed two times with ice-cold PBS and lysed in 100 μl lysis buffer (1%

Triton X-100, 0.5% NP-40, 150 mM NaCl, 10 mM Tris-HCl, pH 7.4, 1 mM EDTA, 1 mM EGTA, 0.2 mM PMSF, 10 µg/ml aprotinin, 2 µg/ml leupeptin, 2 µg/ml pepstatin A).

For all experiments using inhibitors, cells were pretreated for 1 hour with the amount of inhibitor indicated prior to CCL5 treatment. Protein concentration was determined using the Bio-Rad DC protein assay kit (BioRad laboratories). 30 μg of protein lysate was denatured in sample reducing buffer and resolved by SDS-PAGE gel electrophoresis.

The separated proteins were transferred to a nitrocellulose membrane followed by blocking with 5% BSA (w/v) in TBS for 1 hour at room temperature. Membranes were probed with the specified antibodies overnight in 5% BSA (w/v) in TBST (0.1% Tween-

20) at 4°C and the respective proteins visualized using the ECL detection system (Pierce).

For immunoprecipitation assays, 2 µg of mouse anti-eIF4E monoclonal antibody (P-2) or rabbit anti-eIF4G polyclonal antibody (H-300) were added to 500 µg of protein lysates. 2

µg of appropriate whole molecule mouse or rabbit IgG antibody (Amersham Biosciences)

120

were used as controls. Antibodies were pulled down with protein A/G-sepharose beads

(Santa Cruz Biotechnology) and washed six times with lysis buffer. Beads were then denatured in 5X sample reducing buffer and resolved by SDS-PAGE gel electrophoresis.

3.3.3. Flow Cytometric Analysis

1 x 106 cells were incubated with mouse anti-human CCR5 antibody for 45 minutes on ice and washed three times with ice-cold FACS buffer (PBS/2% FCS). Cells were then incubated with FITC-conjugated anti-mouse IgG antibody (eBiosciences). As control, cells were incubated with FITC-conjugated isotype control IgG antibody

(eBioscience). Cells were analyzed using the FACSCalibur and CellQuest software (BD

Biosciences).

3.3.4. Chemotaxis Assay

T cell chemotaxis was assayed using 24-well Transwell chambers with 5µm pores

(Corning). A total of 1 x 105 cells in 100 µl chemotaxis buffer (RPMI 1640/0.5% BSA) were placed in the upper chambers. CCL5, diluted in 600 µl chemotaxis buffer, was placed in the lower wells and the chambers incubated for 2 hours at 37ºC. Migrated cells located in the bottom wells were collected, washed once with PBS and counted by FACS.

All experiments were conducted in triplicate. In experiments involving inhibitors, cells were pretreated for 1 h at the indicated inhibitor concentrations and placed in the upper chambers. Cell viability, as measured by PI staining (Figure 3.3), was not affected at any of the concentrations of inhibitors used in this study.

121

3.3.5. Semi-quantitative RT-PCR

T cells (1 x 107) were serum starved in RPMI 1640/0.5% BSA overnight and incubated at 37°C with 10 nM CCL5 for the times indicated. Cells were collected, washed twice with ice-cold PBS and lysed with the RLT buffer (Qiagen). The resulting lysates were homogenized with a QIA shredder column and total RNA extracted using the RNeasy Mini kit (Qiagen). 2 µg of RNA was reverse transcribed using M-MLV reverse transcriptase (Invitrogen). cDNA was then serially diluted in dH20 as indicated and amplified for human cyclin D1, MMP-9 and GAPDH using the following primers and conditions: cyclin D1, FP 5’ atggaacaccagctcctgtgctgc 3’ RP 5’ tcagatgtccacgtcccgcacgt 3’ (95°C 1 min, 65.5°C 30 sec, 72°C 1 min, 35 cycles); MMP-9,

FP 5’ cgtggttccaactcggtttg 3’ RP 5’aagccccacttcttgtcgct 3’ (95°C 1 min, 58°C 30 sec,

72°C 1 min, 30 cycles); GAPDH, FP 5' aaggctgagaacgggaagcttgtcatcaat 3' RP 5' ttcccgtctagctcagggatgaccttgccc 3' (95°C 1 min, 55°C 30 sec, 72°C 1 min, 30 cycles)

3.3.6. Polysome gradients

Activated CD4+ T cells were serum-starved and treated with 10 nM CCL5 for 1 hour before lysis in ice-cold Nonidet P-40 lysis buffer (10 mM Tris-HCl (pH 8.0), 140 mM NaCl, 1.5 mM MgCl2, and 0.5% Nonidet P-40) supplemented with RNaseOut RNase inhibitor (Invitrogen) at a final concentration of 500 U/ml. Nuclei were removed by centrifugation at 3,000 x g for 2 minutes at 4 ºC. The supernatant was supplemented with

665 µg/ml heparin, 150 µg/ml cycloheximide, 20 mM DTT and 1 mM PMSF and centrifuged at 15,000 x g for 5 minutes at 4 ºC to eliminate mitochondria. The supernatant was then layered onto a 30 ml linear sucrose gradient (15-40% sucrose (w/v)

122

supplemented with 10 mM Tris-HCl (pH 7.5), 140 mM NaCl, 1.5 mM MgCl2, 10 mM

DTT, 100 µg/ml cycloheximide, and 0.5 mg/ml heparin) and centrifuged in a SW32 swing-out rotor (Beckman) at 32,000 rpm for 2 hours at 4 ºC without a brake. Fractions

(750 µl) were carefully collected from the center of the column using a pipette and digested with 100 µg of proteinase K in 1% SDS and 10 mM EDTA for 30 minutes at 37

ºC. RNAs were extracted by phenol-chloroform-isoamyl alcohol followed by ethanol precipitation and dissolved in RNase free water before being analyzed by electrophoresis on 1% denaturing formaldehyde agarose gels to examine polysome integrity. RNA from each fraction was quantified at optical density (OD) of 254 nm. OD readings for each fraction were plotted as a percentage of the total RNA of all fractions to facilitate visual comparisons, and are shown as a function of gradient depth.

3.3.7. Statistical Analysis

Two-tailed t-test was used to determine the statistical significance of differences between groups.

123

3.4. Results

3.4.1. CCL5-mediated chemotaxis of activated CD4+ T cells is mTOR-dependent

Studies were undertaken to examine the influence of mRNA translational events on CCL5-mediated chemotaxis. Ex vivo activation of peripheral blood (PB) CD4+ T cells with cytokines induced CCR5 expression (Figure 3.1.A, left panel). Notably, we observe no expression of CCR1 in our activated CD4+ T cells. T cell populations used for subsequent experiments were consistently >95% CD3 and CD4 positive. CCR5 expression on activated T cells correlated with a functional response to CCL5, as evidenced by dose-dependent migration towards CCL5 and abrogation of migration by pretreatment with anti-CCR5 antibody (5 µg/ml, 2D7) (Figure 3.1.A, right panel).

Subsequent experiments examined the effects of the PI-3’K inhibitor LY294002 or the mTOR inhibitor rapamycin on CCL5-mediated chemotaxis. As shown in Figure 3.1.B, pretreatment with either LY294002 or rapamycin significantly reduced CCL5-mediated T cell chemotaxis in a dose-dependent manner. The data suggest that both PI-3’K and mTOR play a role in CCL5-mediated T cell migration. The PI-3’Kγ-specific inhibitor,

AS-252424, also reduced CCL5-mediated T cell chemotaxis (Figure 3.1.C). Interestingly, experiments with CCL3/MIP1α, another agonist ligand of CCR5, revealed that CCL3- mediated T cell migration was insensitive to rapamycin at doses as high as 100 nM

(Figure 3.2.). Notably, we find that both CCL3/MIP1α and CCL4/MIP1β are poor effectors of CCR5-mediated T cell chemotaxis when compared with CCL5, with CCL3 exhibiting superior chemotactic activity to CCL4. Specifically, whereas 10 nM CCL5 exhibits a migration index approximately 5 fold over control (Figure 3.1.A), the migration index for 10 nM CCL3 is approximately 2 fold in identical in vitro chemotactic

124

Figure 3.1. CCL5-mediated chemotaxis of activated CD4+ T cells is dependent on PI-3’K and mTOR.

(A) Activated peripheral blood (PB) T cells were stained with anti-CCR5 and anti-CD3 antibodies (solid line) or isotype controls (dotted line) and analyzed by FACS. CCL5- mediated chemotaxis is presented as migrated cells per well. (B) Activated PB T cells were pretreated with either DMSO (carrier) or the specified inhibitors for 1hr at the concentrations indicated, and CCL5-mediated chemotaxis measured using 10 nM CCL5. The data are presented as % migration, with the number of migrated cells at 10 nM CCL5 taken as 100%. Representatives of three independent experiments are shown (± S.D.) * p<0.05 (C) Activated PB T cells were pretreated with either ethanol (carrier) or AS- 252424 for 1 hr at the concentration indicated, and CCL5-mediated chemotaxis measured using 10 nM CCL5. Data are representative of two independent experiments (± S.D.) * p<0.05 (D) Activated PB T cells pretreated with either DMSO (carrier), cycloheximide or actinomycin D for 30 min at the concentrations indicated. The data represent means ± S.D. of 3 independent experiments. * p<0.05

125

Figure 3.1.

A 30 CCR5 CD3 97% 20

10 % input cells input %

0 0 1 10 100 anti- CCR5 CCL5 (nM)

B * * C 120 * 120 * 120 * 100 100 100 80 80 80 60 60 60 40 40 40 % Migration % Migration % Migration % 20 20 20 0 0 0 0 5 10 20 0102050 012.5 LY294002 (µM) Rapamycin (nM) AS-252424 (µM) D * 120 120 *

100 100

80 80

60 60

40 40 % Migration % Migration 20 20

0 0 015 00.1110 Actinomycin D (µg/ml) Cycloheximide (µg/ml)

126

Figure 3.2. CCL3/MIP1α-dependent T cell chemotaxis is not dependent on mTOR.

(A) Activated PB T cells were pretreated with either DMSO (carrier) or rapamycin for 1 hr at the concentrations indicated, and CCL3-mediated chemotaxis measured using 10 nM CCL3 (LD78β). The data are presented as % migration, with the number of migrated cells at 10 nM CCL3 taken as 100%. Representatives of two independent experiments are shown (± S.D.). * p<0.05 (B) Activated PB T cells were either left untreated or treated with 10 nM CCL3 for the indicated times. Cells were harvested and lysates resolved by SDS-PAGE and immunoblotted with anti-phospho-4E-BP1 (Thr-37/46) antibody. Membranes were stripped and re-probed for 4E-BP1 as a loading control. The relative fold increase of 4E-BP1 phosphorylation is shown as signal intensity over loading control to the right of each blot. Representatives of two independent experiments are shown (± S.D.)

127

Figure 3.2.

A 120 100 80

60 40

% Migration 20

02050100

Rapamycin (nM)

+ CCL3 (min)

0 5 15 30 p-4E-BP1(thr 37/46)

4E-BP1 1.2 1 n 0.8

0.6 0.4 Fold Inductio 0.2

0 0 5 15 30 Time (min)

128

transwell experiments. To further investigate the involvement of mRNA translation on

CCL5-mediated T cell chemotaxis, cells were pretreated with cycloheximide or actinomycin D, inhibitors of mRNA translation and transcription, respectively. As shown in Figure 3.1.D, cycloheximide but not actinomycin D significantly reduced CCL5- mediated T cell chemotaxis in a dose-dependent manner. The reduction in CCL5- mediated T cell chemotaxis by inhibitors at the doses employed is not due their toxicity or their ability to alter cell adhesion (Figure 3.3.A, B).

3.4.2. CCL5 induces phosphorylation of mTOR, p70 S6 kinase and S6 ribosomal protein

Next, we examined CCL5-mediated phosphorylation/activation of mTOR. mTOR is phosphorylated on Serine-2448 by the PI-3’K/PKB pathway (Nave et al., 1999).

In turn, phosphorylated/activated mTOR can directly phosphorylate p70 S6K1 at

Threonine-389 in vitro (Burnett et al., 1998). In time course studies we show that T cells treated with 10 nM CCL5 induced the rapid phosphorylation/activation of mTOR on

Serine-2448 and S6K1 on Threonine-389, within 5 minutes (Figure 3.4.A, B). We also showed a CCL5-mediated phosphorylation of S6 ribosomal protein (rpS6), a known downstream effector of S6K1, on Serine-235/236 (Figure 3.4.C). Although rpS6 does not regulate translation of 5’-TOP mRNAs, phosphorylation remains an acceptable readout for S6K1 activity. Taken together, the data suggest that CCL5 is able to activate the mTOR/S6K1 pathway to potentially influence translation initiation.

129

Figure 3.3. Effect of various inhibitors on T cell viability and adhesion.

(A) Activated T cells were treated with either DMSO (carrier), ethanol (carrier) or the specified inhibitors for 3 hrs at the concentrations indicated, stained with propidium iodide and analyzed by FACS. Cells negative for PI stain were considered viable. The data represent means ± S.D. of at least 2 independent experiments. (B) 2 x 105 T cells were either left untreated, treated with DMSO (0.1% v/v) or ethanol (0.1% v/v) for 3 hrs, plated onto fibronectin-coated wells and incubated for 2 hrs at 37˚C. Cells were washed, fixed in 95% ethanol and stained with crystal violet (2% w/v). 100 µl of solubilization buffer was added and the absorbance read at 570 nm. Data are representative of two independent experiments performed in triplicate. The data show that the presence of DMSO or ethanol as a carrier did not affect T cell adhesion to fibronectin.

130

Figure 3.3.

100 100 100 80 80 80 60 60 60 40 40 40 20 20 20 % Viability % Viability % Viability 0 0 0 02050 01020 012.5

Rapamycin (nM) LY294002 (µM) AS-252424 (µM)

100 100 100 80 80 80 60 60 60 40 40 40 20 % Viability 20 20 % Viability % Viability 0 0 0 00.1110 015 0 250 500

Cycloheximide (µg/ml) Actinomycin D (µg/ml) 2,3-DPG (µM)

100 80

60 B

) 0.08

570 40 0.06 % Viability 20 0.04 0 0.02 0

(A units Arbitrary 0 Untreated DMSO ethanol

0.1% 1-butanol

0.1% tert-butanol

131

Figure 3.4. CCL5-dependent phosphorlyation of mTOR, p70 S6K1 and ribosomal protein S6 in T cells.

Activated PB T cells were either left untreated or treated with 10 nM CCL5 for the indicated times. Cells were harvested and lysates resolved by SDS-PAGE and immunoblotted with (A) anti-phospho-mTOR (Ser-2448) antibody, anti-phospho-p70 S6 kinase (Thr-389) antibody, or anti-phospho-rpS6 (Ser-235/236) antibody. Membranes were stripped and re-probed for the appropriate loading controls. (B) The relative fold increase in phosphorylation is shown as signal intensity over loading control. Data are representative of two independent experiments.

132

Figure 3.4.

A + CCL5 (min) 0 5 15 30 p-mTOR mTOR

p-p70S6K1 p70S6K1

p-rpS6 rpS6

B p-mTOR p-p70S6K1 p-rpS6 1.5 2.5 3 2.5 2 1 2 1.5 1.5 1 0.5 1 Fold Induction Fold Fold Induction Fold Induction Fold 0.5 0.5 0 0 0 0 5 15 30 0 5 15 30 0 5 15 30 Time (min) Time (min) Time (min)

133

3.4.3. CCL5-mediated 4E-BP1 phosphorylation is PI-3’K-, PLD- and mTOR-dependent

mTOR has an additional role in phosphorylating the mRNA translational

repressor 4E-BP1. Phosphorylation of 4E-BP1 is sequential, since phosphorylation of

Threonine-37/46 appears to be required for Threonine-70 and Serine-65 phosphorylation

(Hay and Sonenberg, 2004). In PB T cells, CCL5 induced a rapid phosphorylation of 4E-

BP1 on both Threonine-37/46 and Threonine-70 sites (Figure 3.5.A). The roles of PI-3’K,

PLD and mTOR in CCL5-dependent 4E-BP1 phosphorylation on Threonine-37/46 were

determined using various inhibitors. Pretreatment of PB T cells with LY294002,

rapamycin, or 1-butanol abolished 4E-BP1 phosphorylation. (Figure 3.5.B, 3.6.B).

Consistent with their inhibitory effects on 4E-BP1 phosphorylation, both PLD inhibitors

2,3-DPG and 1-butanol reduced CCL5-mediated migration of PB T cells in a dose

dependent manner (Figure 3.6.A). Notably, CCL3 did not induce phosphorylation of 4E-

BP1 on Threonine-37/46, consistent with our findings that rapamycin also does not affect

CCL3-mediated T cell migration (Figure 3.2.B).

3.4.4. CCL5 initiates protein translation through formation of the eIF4F complex

The preceding suggests that CCL5 may regulate eIF4E availability through

mTOR- dependent phosphorylation of 4E-BP1. Increased availability of eIF4E allows for

the formation of the eIF4F complex, which also includes eIF4G, a multi-domain scaffold

protein, and eIF4A, a RNA helicase that is required to unwind regions of the secondary

structure in the 5’-UTRs of mRNAs (Richter and Sonenberg, 2005; von der Haar et al.,

2004). To determine whether CCL5 mediates the formation of the eIF4F complex, cells

were treated with CCL5 for 30 minutes and cell lysates immunoprecipiated for eIF4E and

134

Figure 3.5. CCL5 phosphorylates the 4E-BP1 repressor of mRNA translation through PI-3’ kinase and mTOR.

(A) Activated PB T cells were either left untreated or treated with 10 nM CCL5 for the indicated times. Cells were harvested and lysates resolved by SDS-PAGE and immunoblotted with anti-phospho-4E-BP1 (Thr-37/46) antibody or anti-phospho-4E-BP1 (Thr-70) antibody. Membranes were stripped and re-probed for 4E-BP1 as a loading control. The relative fold increase of 4E-BP1 phosphorylation is shown as signal intensity over loading control to the right of each blot. (B) Activated PB T cells were pretreated with either DMSO (carrier), 20 µM LY294002 or 50 nM rapamycin for 1 hr prior to 15 min treatment with 10 nM CCL5. Cells were harvested and lysates resolved by SDS-PAGE and immunoblotted with anti-phospho-4E-BP1 (Thr-37/46) antibody. Membranes were stripped and re-probed for 4E-BP1 as a loading control. The relative fold increase of 4E-BP1 phosphorylation is shown as signal intensity over loading control. Data are representative of two independent experiments.

135

Figure 3.5.

Thr 37/46 3 A 2.5 2 + CCL5 (min) 1.5 1 0 5 15 30

Fold Induction 0.5 p4E-BP1 (Thr 37/46) 0 0 5 15 30 4E-BP1 Time (min)

p4E-BP1 (Thr 70) Thr 70 4E-BP1 3

1 Fold Induction B 0 0 5 15 30 LY294002 – – – + Time (min) Rapamycin – – + – CCL5 – + + + p-4E-BP1 (Thr 37/46)

4E-BP1 3.5 3 2.5 2 1.5 1

Fold Induction 0.5 0

) carrier ( LY294002 Rapamycin Rapamycin DMSO + CCL5 DMSO

136

Figure 3.6. CCL5-mediated PLD activation regulates T cell migration.

(A) Activated PB T cells were pretreated with either ethanol (carrier) or the specified inhibitors for 1hr at the concentrations indicated, and CCL5-mediated chemotaxis measured using 10 nM CCL5. The data are presented as % migration, with the number of migrated cells at 10 nM CCL5 taken as 100%. Data representative of three independent experiments are shown (± S.D.) * p<0.05 (B) T cells were pretreated with either ethanol (carrier), 500 µM 2,3-DPG or 0.1% 1-butanol for 1 hr prior to 15 min treatment with 10 nM CCL5. Cells were harvested and lysates resolved by SDS-PAGE and immunoblotted with anti-phospho-4E-BP1 (Thr-37/46) antibody. Blots were stripped and reprobed with anti-4E-BP1 antibody as a loading control. The relative fold increase of 4E-BP1 phosphorylation is shown as signal intensity over loading control. Data are representative of two independent experiments.

137

Figure 3.6.

A * * 120 120 100 100 80 80 60 60 40 40 % Migration% % Migration % 20 20

0 0

0 0 250 350 500

2,3-DPG (µM)

0.1% 1-butanol 0.1% tert-butanol B

1-butanol – – – + 2,3-DPG – – + – CCL5 – + + +

p-4E-BP1 (Thr 37/46)

4E-BP1 2.5 2

1.5 1 0.5

Fold Induction 0

)

carrier

2,3-DPG ( 1-butanol

ethanol + CCL5 + ethanol

ethanol

138

eIF4G. As shown in Figure 3.7.A, CCL5 induced an association between eIF4E and eIF4G. To examine the phosphorylation status of eIF4E, cells were treated with 10 nM

CCL5 and the cell lysates resolved by SDS-PAGE gel electrophoresis. As shown in

Figure 3.7.B, CCL5 induced phosphorylation of eIF4E on Serine-209 after 15 minutes.

In order to directly show increased mRNA translation, sucrose gradient centrifugation

was performed. Cells were treated with CCL5 for 1 hour and RNAs from each fraction

extracted and analyzed by electrophoresis on a 1% denaturing formaldehyde agarose gel

to examine polysome integrity. The distribution of 28S, 18S and 5S rRNA in untreated

cells were visualized by ethidium bromide staining (Figure 3.8, upper panel). CCL5

initiated active translation of mRNA, as shown by the increased presence of high-

molecular-weight polysomes deep in the sucrose gradient (fractions 16-20) (Figure 3.8,

lower panel). Pretreatment with rapamycin inhibited the formation of heavy polysomes.

Viewed altogether, these data show that CCL5 promotes an mTOR-dependent active

translation of mRNA by the eIF4F translation initiation complex.

139

Figure 3.7. CCL5 induces formation of the eIF4F initiation complex.

(A) Activated PB T cells were either left untreated or treated with 10 nM CCL5 for 30 min, lysed and immunoprecipitated with either anti-eIF4E or anti-eIF4G antibodies. Samples were resolved by SDS-PAGE and immunoblotted with anti-eIF4E and anti- eIF4G antibody. Whole molecule mouse or rabbit IgG was used as control. (B) Cells were either left untreated or treated with 10 nM CCL5 for the indicated times, then lysates resolved by SDS-PAGE and immunoblotted with anti-phospho-eIF4E (Ser-209) antibody. Membranes were stripped and reprobed for eIF4E as a loading control. Data are representative of two independent experiments. Values denoting the extent of phosphorylation are shown in the right hand panel.

140

Figure 3.7.

A + CCL5 (min) + CCL5 (min)

0 30 IgG IP: eIF4E 0 30 IgG IP: eIF4G

IB: eIF4E IB: eIF4G

IB: eIF4G IB: eIF4E IgG (HC)

p-eIF4E B 5 + CCL5 (min) 4 0 5 15 30 3 p-eIF4E 2 eIF4E 1 Fold Induction 0 0 5 15 30 Time (min)

141

Figure 3.8. CCL5-inducible protein translation enhances mRNA association with polyribosomes.

PB T cells were pretreated with either DMSO (carrier) or 50 nM rapamycin for 1 hr, followed by 10 nM CCL5 for 1 hr. Cells were harvested, lysed and lysates layered onto a sucrose gradient. Fractions were collected after centrifugation, RNAs extracted and quantified at optical density (OD) 254 nm. A representative gel profile of fractions from untreated cells is shown to visualize the distribution of 5S, 18S and 28S rRNAs as an indicator of the polyribosome integrity (upper panel). OD readings for each fraction were plotted as a percentage of the total RNA of all fractions and are shown as a function of gradient depth (lower panel). Actively translated mRNA is associated with high- molecular-weight polysomes deep in the gradient (shaded region). Data are representative of two independent experiments.

142

Figure 3.8.

40S 60S 80S polysome

28S 18S 5S

15% Sucrose 40%

14 Untreated CCL5 12 CCL5 + Rapamycin 10

6 % Total% RNA 4

0 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 Fraction number

143

3.4.5. CCL5-inducible protein translation of cyclin D1 and MMP-9 is mTOR- dependent

Increased eIF4E availability leads to translation initiation of a subset of mRNAs with substantial secondary structures in the 5’-UTR (De Benedetti and Graff, 2004). Among these, both MMP-9 and cyclin D1 have recently been shown to promote cellular motility

(Hu and Ivashkiv, 2006; Khandoga et al., 2006; Li et al., 2006a; Li et al., 2006b;

Neumeister et al., 2003; Xia et al., 1996). Accordingly, we conducted studies to examine whether CCL5 initiated the translation of cyclin D1 and MMP-9 levels. Serum starved T cells were pretreated with either DMSO or rapamycin for 1 hour and treated with 10 nM

CCL5 in time course experiments. CCL5 induced upregulation of both cyclin D1 and

MMP-9 protein levels within 60 minutes, whereas rapamycin completely abolished this induction (Figure 3.9.A). The observed increases in cyclin D1 and MMP-9 protein levels were not due to increased mRNA transcription, as their mRNA levels remained unchanged (Figure 3.9.B).

144

Figure 3.9. CCL5-inducible upregulation of cyclin D1 and MMP-9 protein levels is dependent on mTOR-mediated mRNA translation.

(A) Activated PB T cells were either pretreated with DMSO (carrier) or 50 nM rapamycin for 1hr prior to treatment with 10 nM CCL5 for the indicated times. Cells were harvested and lysates resolved by SDS-PAGE and immunoblotted with anti-cyclin D1 or anti-MMP-9 antibody. Membranes were stripped and reprobed for β-tubulin as loading control. The relative fold increase of cyclin D1 and MMP-9 protein level is shown as signal intensity over loading control. Data are representative of three independent experiments. (B) T cells were either left untreated or treated with 10 nM CCL5 for 1 hr and the mRNAs extracted. Semi-quantitative RT-PCRs were performed using primer sets specific for cyclin D1, MMP-9 and GAPDH, as described in Materials and Methods. Data are representative of two independent experiments.

145

Figure 3.9.

A Cyclin D1 2.5

UT + CCL5 (min) Rapamycin + CCL5 (min) n 2 0 30 60 90 0 30 60 90 1.5 cyclin D1 1 β-tubulin Fold Inductio 0.5

0 0306090 Time (min) Untreated Active MMP-9 Rapamycin 3.5 UT + CCL5 (min) Rapamycin + CCL5 (min) 3 n 0 30 60 90 0 30 60 90 2.5 pro 2 active MMP-9 1.5 β-tubulin

Fold Inductio 1 0.5 0 0306090 Time (min)

B CCL5 (min)

0 60

ctrl 1:9 1:3 -- 1:9 1:3 -- Cyclin D1 MMP-9

GAPDH

146

3.5. Discussion

Chemokines play a crucial role in directing leukocyte migration towards sites of inflammation during an immune response. Considerable advances have been made towards understanding the complex signaling cascades coordinating cell migration, which include the activation of many distinct tyrosine kinases, lipid kinases, and MAPKs.

However, the contribution of mTOR-dependent mRNA translation to chemotaxis has not been studied. Initial observations with cycloheximide and actinomycin D, inhibitors of mRNA translation and transcription, respectively, demonstrated the importance of mRNA translation for CCL5-mediated human T cell chemotaxis.

We have demonstrated that CCL5-mediated migration of activated CD4+ T cells is partially dependent on mTOR. Once activated, mTOR regulates the translational machinery by directly affecting eIF4F availability for 5’-capped mRNA translation initiation and up-regulates ribosomal protein levels through 5’-TOP mRNA translation.

Published reports suggest a role for both mTOR and p70 S6K1 in cellular migration of various cell types. GM-CSF-mediated neutrophil chemotaxis is inhibited by rapamycin, wherein phosphorylation of S6K1 is associated with migration (Gomez-Cambronero,

2003; Lehman and Gomez-Cambronero, 2002). Similarly, fibronectin-induced migration of human arterial E47 smooth muscle cells is sensitive to rapamycin (Sakakibara et al.,

2005). Several chemokines have been reported to activate S6K1, but this activation was studied in the context of cell survival and proliferation, not migration (Hwang et al.,

2003; Joo et al., 2004; Lee et al., 2002; Loberg et al., 2006). Interestingly, a G protein- coupled receptor (vGPCR), which belongs to the CXC chemokine receptor family, is

147

encoded by the Kaposi’s sarcoma-associated herpesvirus (KSHV or HHV8) and exhibits constitutive activity. Ectopic expression and activation induced the TSC2/mTOR pathway, which played a critical role in Kaposi’s sarcomagenesis by promoting cell growth (Montaner, 2007; Sodhi et al., 2006). Here, we show the importance of mTOR in

CCL5-CCR5 mediated CD4+ T cell chemotaxis. CCL5 induces rapid phosphorylation/activation of mTOR and S6K1. Several downstream effectors of S6K1 have been identified including rpS6, eIF4B and eEF2 (Proud, 2007; Ruvinsky and

Meyuhas, 2006). S6K1 activation favorably promotes translation by directly phosphorylating eIF4B to assist eIF4A helicase in unwinding RNA secondary structure

(Raught et al., 2004). The role for rpS6 is less well understood, previously believed to be associated with 5’ TOP mRNA translation. However, studies with knock-in mice in which all five regulated sites of S6 phosphorylation were altered to alanines (S6[5A]) demonstrated that rpS6 is not required for 5’TOP mRNA translation, but rather for controlling cell size (Ruvinsky et al., 2005). Nevertheless, phosphorylation of rpS6 remains an important readout for S6K1 activity.

mTOR also phosphorylates the mRNA translational repressor, 4E-BP1, in a sequential manner (Brunn et al., 1997; Burnett et al., 1998). mTOR phosphorylates

Threonine-37/46, followed by phosphorylation of Threonine-70 and Serine-65, ultimately leading to its release from eIF4E. Here we show CCL5 mediates a rapid phosphorylation of 4E-BP1 on both Threonine-37/46 and Threonine-70 sites. Phosphorylation of

Threonine-37/46 is dependent on PI-3’K, PLD and mTOR. Therefore, the data indicate that CCL5-mediated activation of the PI-3’K and PLD signaling pathways may converge

148

at the level of mTOR to modulate downstream 4E-BP1 phosphorylation. 4E-BP1 hyperphosphorylation releases eIF4E to allow for association with the scaffold protein eIF4G, which along with the RNA helicase eIF4A, forms the eIF4F hetero-trimeric initiation complex (Richter and Sonenberg, 2005; von der Haar et al., 2004). By binding to the 5’- cap structure of mRNA through eIF4E, the eIF4F initiation complex facilitates ribosome binding and its passage along the 5’-UTR towards the initiation codon. eIF4E is also directly phosphorylated on Serine-209 by Mnk1/2, although the physiological relevance is still unclear. Several reports demonstrated that phosphorylated eIF4E actually had reduced m7G cap-binding ability (McKendrick et al., 2001; Scheper et al., 2002). Proud and colleagues suggested that phosphorylation of eIF4E may allow the eIF4F complex to detach from the 5’-cap during scanning to either accelerate translation or to allow a second initiation complex to bind the mRNA (Proud, 2007). Our data support this model, as phosphorylation of eIF4E was not evident until 15 minutes post CCL5 treatment

(Figure 3.7.B). This allows time for eIF4E to bind the cap structure and recruit eIF4G/eIF4A and other associated factors such as eIF3 and the 40S subunit before the complex is released for scanning. Consistent with this, CCL5 initiated active translation of mRNA, as shown by increased presence of high-molecular-weight polysomes deep in the sucrose gradient we analyzed (fractions 16-20). The presence of polysomes was significantly reduced in the presence of rapamycin, further supporting the role for mTOR in translation initiation.

It is well known that cap structures at the 5' end of mRNA are required for efficient translation, nuclear export and protection from 5' exonucleases. Once bound by

149

eIF4F, ribosome binding and scanning can commence along the 5’-UTR towards the initiation codon. Unlike mRNAs with short 5’UTRs (e.g. β-actin), a subset of mRNAs with lengthy, highly structured 5’UTRs are poorly translated when eIF4F levels are low

(De Benedetti and Graff, 2004; Graff and Zimmer, 2003). Among these, cyclin D1 and

MMP-9 have been implicated in cellular migration of a number of cell types (Hu and

Ivashkiv, 2006; Khandoga et al., 2006; Li et al., 2006a; Li et al., 2006b; Neumeister et al.,

2003; Sun et al., 2001). Li and colleagues showed that cyclin D1-deficient mouse embryo fibroblasts (MEFs) exhibited increased adhesion and decreased motility compared to wildtype MEFs (Li et al., 2006b). Migratory defects in cyclin D1-deficient

MEFs were not a direct consequence of reduced DNA synthesis, but rather through de- repression of ROCKII and TSP-1 expression. Use of PI-3’K and mTOR inhibitors in cancer cell lines decreased cyclin D1 levels, where eIF4E over-expression led to its increased production (Gao et al., 2004; Pene et al., 2002; Rosenwald et al., 1995;

Rosenwald et al., 1993). IL-8 has been shown to up-regulate cyclin D1 at the level of translation in prostate cancer cell lines (MacManus et al., 2007). Similarly, in MMP-9 knockout mice, bone marrow-derived dendritic cell (BM-DC) migration to CCL19 was impaired, and anti-MMP-9 antibody reduced CCL5-mediated migration of IFNα DCs

(Hu and Ivashkiv, 2006). Therefore, we investigated the ability of CCL5 to initiate translation of both cyclin D1 and MMP-9 in T cells. Rapamycin-sensitive upregulation of cyclin D1 and MMP-9 protein levels occurred within 1 hour of CCL5 treatment. Up- regulation of protein levels was not due to increased transcription since we did not observe significant mRNA synthesis of these genes within this time frame. Interestingly, others have shown that CCL5-mediated increases in MMP-9 protein levels are detectable

150

early without significant upregulation of mRNA, indicating that the early effect of CCL5 on MMP-9 secretion was independent of mRNA synthesis (Chabot et al., 2006). Since T cell chemotactic migration through a model basement membrane depends on the degradation of matrix proteins by MMP-9, rapid production of the protease during the early stages of cellular migration is critical in vivo (Xia et al., 1996).

Gomez-Mouton and colleagues used real-time microscopy to elegantly demonstrate that CCR5-positive Jurkat T cells respond to CCL5 almost instantaneously, forming a leading edge and directional migration towards the source of chemokines

(Gomez-Mouton et al., 2004). In a typical chemotaxis assay, migrated cells are collected and counted after 2 hours of incubation, but as demonstrated by real-time microscopy, T cells likely do not take 2 hours to migrate through the membrane pores. We have unpublished data demonstrating that rapamycin does not affect CCL5-mediated actin polymerization, indicating that mTOR plays no role in the initial stages of migration.

Rather, CCL5-mediated translation initiation may contribute to the rapid synthesis of chemotaxis-related proteins to “prime” T cells for effective directed migration (Figure

3.10.). CCR5 is the receptor for several chemokines, specifically CCL3, CCL4, and

CCL5. We observe that CCL3 and CCL5 differentially activate mTOR signaling. mTOR and mTOR-mediated signaling seem to be dispensable for CCL3-mediated T cell chemotaxis. Notably, CCL3-CCR5 mediated chemotaxis of T cells is considerably less effective than CCL5-CCR5-mediated T cell chemotaxis. It is intriguing to speculate that

CCR5-indicible activation of mTOR signaling may contribute to this differential potency.

The identification of additional proteins that are regulated by CCL5 at the level of

151

Figure 3.10. Possible model for CCL5-mediated mRNA translation in CD4+ Tcells.

CCL5 activates the mTOR pathway and subsequent phosphorylation of p70 S6K1 and 4E-BP1. Hyper-phosphorylation of 4E-BP1 leads to its release from eIF4E where it binds to eIF4G to form the eIF4F initiation complex. Through eIF4E, eIF4F binds to the mRNA 5’-cap structure and facilitates ribosome binding and unwinding secondary structure in the 5’-UTR. Translation initiation leads to a rapid upregulation of cyclin D1 and MMP-9 protein levels to “prime” T cells for directed cell migration. S6K1 has been shown to phosphorylate eIF4B (RNA-binding protein that enhances activity of the eIF4A helicase) in response to insulin (dotted line).

152

Figure 3.10.

CCL5

CCR5

PLD PI-3’K

mTOR

S6K 4E-BP1 eIF4E

rpS6 Cyclin D1

eIF4E MMP-9 AUG ? eIF4G eIF4A

eIF4B

Cell Migration

153

translation is currently under investigation. Translational control generates a rapid production of proteins without the need for mRNA transcription, processing and export into the cytoplasm. As migratory responses must be both initiated and resolved with speed and precision, it is beneficial that chemokines can effect translation and rapidly influence the protein pool within the migrating cell. Our data describe a novel mechanism by which the chemokine CCL5 may regulate translation of mRNAs that encode proteins involved in T cell migration, such as cyclin D1 and MMP-9.

Additionally, our data suggest a mechanism for the immunosuppressive effects of rapamycin, possibly by limiting host immune cell migration.

154

Chapter 4

CCL5 Promotes Breast Cancer Progression through mTOR/4E-BP1 dependent mRNA Translation

Thomas T. Murooka*, Ramtin Rahbar* and Eleanor N. Fish*1

*Division of Cellular and Molecular Biology, Toronto General Research Institute, University Health Network & Department of Immunology, University of Toronto

Chapter 4 is a manuscript submitted as:

Murooka, T.T., Rahbar, R. and Fish, E.N. CCL5 promotes breast cancer proliferation through mTOR/4E-BP1 dependent mRNA translation.

T.T.M. performed all experiments, analyzed the data and drafted the manuscript. R.R. analyzed the data and edited the manuscript. E.N.F. designed research, analyzed the data and drafted the manuscript.

155

4.1. Abstract

The proliferative capacity of breast cancer cells is regulated by factors intrinsic to the cancer cells and by secreted factors in the microenvironment. Accumulating evidence identifies a role for chemokines and their cognate receptors in cancer progression and metastasis. Here, we investigated the proto-oncogenic potential of the chemokine receptor, CCR5, when expressed in the breast cancer cell line, MCF-7. At physiological levels, CCL5, a ligand for CCR5, enhanced MCF-7.CCR5 proliferation.

Treatment with the mTOR inhibitor, rapamycin, inhibited this CCL5-inducible proliferation. Because mTOR is known to directly modulate mRNA translation, we investigated whether CCL5 activation of CCR5 leads to increased translation. CCL5 induced the formation of the eIF4F translation initiation complex through an mTOR- dependent process. Indeed, CCL5 initiated mRNA translation, shown by an increase in high molecular-weight polysomes. Specifically, we show that CCL5 mediated a rapid up-regulation of protein expression for cyclin D1, c-Myc and Dad-1, without affecting their mRNA levels. CCL5 increased the recruitment of cyclin D1 and Dad-1 mRNAs to polysomes, indicating that their protein expression was regulated at the level of translation. Taken together, we describe a mechanism by which CCL5 influences translation of rapamycin-sensitive mRNAs, thereby providing CCR5-positive breast cancer cells with a proliferative advantage.

156

4.2. Introduction

A functional relationship exists between inflammation and tumor initiation/ progression. Different growth factors, cytokines, chemokines and angiogenic mediators are found at chronic inflammatory sites, thereby creating a micro-environment suitable for neoplastic growth (O'Hayre et al., 2008). Given that chemokines are important mediators of inflammation by actively recruiting leukocytes and regulating cytokine expression, there is considerable interest in chemokine/chemokine receptor dysregulation in tumor biology. Chemokines play a critical role in all aspects of tumorigenesis, including the control of leukocyte infiltration into tumors, initiation of primary tumor growth, survival, invasion and organ-specific metastasis (Muller et al., 2001; O'Hayre et al., 2008; Raman et al., 2007).

The chemokine family of chemotactic proteins contains one to three disulfide bonds and is classified as homeostatic or inflammatory. Secreted by a number of cell types, chemokines bind to glycosaminoglycans (GAGs) expressed on proteoglycan components of the cell surface and extracellular matrix, and interact with seven transmembrane G protein-coupled receptors (GPCRs). CCL5/RANTES is a member of the β-chemokines and is chemotactic for T cells, macrophages, NK cells and eosinophils through CCR1 and/or CCR5 (Kameyoshi et al., 1992; Schall et al., 1990; Taub et al.,

1995). Additionally, CCR5-mediated signaling controls cellular proliferation, cytokine production, survival and apoptosis (Bacon et al., 1995; Bacon et al., 1998; Bacon et al.,

1996; Dairaghi et al., 1998; Ganju et al., 2000; Ganju et al., 1998; Murooka et al., 2006;

Rahbar et al., 2006; Tyner et al., 2005). Several studies have demonstrated a pivotal role

157

for the CCL5/CCR5 axis in breast cancer progression. CCL5 was reported to be highly expressed in high grade tumors and was a predictor of rapid disease progression in stage

II breast cancer patients (Azenshtein et al., 2002; Luboshits et al., 1999; Niwa et al.,

2001; Yaal-Hahoshen et al., 2006). Additionally, serum CCL5 levels were elevated in patients with high grade tumors compared to low grade tumors (Niwa et al., 2001).

Breast cancer cell lines have been shown to respond to and migrate towards CCL5, as well as express physiological levels of CCL5 in culture (Azenshtein et al., 2002;

Luboshits et al., 1999; Robinson et al., 2003; Youngs et al., 1997). Finally, the CCR5 antagonist Met-CCL5 significantly reduced recruitment of macrophages and T cells into tumors, resulting in a reduction in tumor mass in mice (Robinson et al., 2003). Viewed altogether, these studies demonstrate that CCL5 can influence breast cancer progression directly by affecting tumor survival and proliferation, or indirectly by recruiting tumor- promoting inflammatory cells.

mTOR is a crucial regulator of the translational machinery by controlling S6K1 and 4E-BP1 phosphorylation/activation in multiple cellular processes, including metabolism, nutrient sensing, translation and cell growth (Gingras et al., 2004;

Wullschleger et al., 2006). We have previously shown that CCL5 initiates mRNA translation through mTOR/4E-BP1, thereby modulating CD4+ T cell chemotaxis

(Murooka et al., 2008). mTOR regulates mRNA translation by controlling the availability of eIF4E through 4E-BP1 phosphorylation (Beretta et al., 1996). The eIF4F complex, which is comprised of an eIF4G backbone, the cap-binding eIF4E and the RNA helicase eIF4A, binds the mRNA 5’-cap structure (m7GpppN). eIF4F unwinds the

158

secondary structure in the 5'-untranslated region (UTR) of mRNA and facilitates binding of the mRNA to the 40S ribosomal subunit (Richter and Sonenberg, 2005; von der Haar et al., 2004). In addition, mTOR controls the translation of 5’-TOP (tract of oligopyrimidines) mRNAs which often encode for cytoplasmic ribosomal proteins

(Meyuhas, 2000). Taken together, mTOR regulates the translation of a subset of mRNAs with lengthy, highly structured 5’-UTRs, which typically encode growth and survival proteins (Graff and Zimmer, 2003; Mamane et al., 2007).

Here, we demonstrate that the CCL5/CCR5 signaling axis can directly stimulate growth of breast cancer cells through an mTOR-dependent mechanism. We show that ectopic expression of CCR5 provides MCF-7 cells with a proliferative advantage when cultured in the presence of exogenous CCL5. Through the formation of the eIF4F translation initiation complex, CCL5 actively promotes mRNA translation, specifically of cyclin D1, c-Myc and defender against cell death-1 (Dad-1). The data illustrate the potential for breast cancer cells to exploit downstream chemokine signaling pathways for their proliferative and survival advantage through expression of appropriate chemokine receptors.

159

4.3. Materials and Methods

4.3.1. Cells and reagents

MCF-7 breast cancer cells were a generous gift from Dr. Jeffery Medin (Division of Experimental Therapeutics, Toronto General Research Institute). Cells were maintained in DMEM supplemented with 10% fetal calf serum, 100 units/ml penicillin,

100 mg/ml streptomycin and 2 mM L-glutamine (Gibco-BRL). Antibodies for eIF4E and

4E-BP1 were purchased from Cell Signaling Technology. Antibody for human cyclin D1

(DCS-6), eIF4G (H-300), phospho-Erk (E-4) and Erk1 (K-23) were purchased from Santa

Cruz Biotechnology (Santa Cruz, USA). Murine monoclonal anti-β-actin antibody was purchased from Sigma-Aldrich. Anti-Dad-1 antibody was purchased from Abcam

(Cambridge, MA). Anti-CCR5 antibody was purchased from BD Biosciences. Anti-c-

Myc antibody was a generous gift from Dr. Linda Penn (Ontario Cancer Institute,

Toronto, Canada). CCL5 was a generous gift from Dr. Amanda Proudfoot (Geneva

Research Centre, Merck Serono International). 7-methyl GTP-Sepharose beads were purchased from Amersham Biosciences. Rapamycin was obtained from Calbiochem and resuspended in DMSO.

4.3.2. Plasmid Constructs

Full-length human CCR5 cDNA was generated by PCR using the pEF.BOS-

CCR5 vector, as previously described (Rahbar et al., 2006). Specific human CCR5 forward and reverse primers containing the BamH1 and NotI restriction sites, respectively, and the FLAG epitope DYKDDDDK on the N-terminus, were used: FP 5’ ggatccatggactacaaggacgatgatgac gccgattatcaagtgtcaagtcca 3’ RP 5’

160

tgcggccgctcacaagcccacagatatttc 3’ (95°C 1 min, 64°C 30 sec, 72°C 75 sec, 30 cycles).

Human CCR5 was subcloned into pcDNA3.1+/Zeo+ vector (Invitrogen) and the orientation and integrity of the insert confirmed by DNA sequencing (ACGT Corp.,

Toronto, Canada). To establish the MCF-7.CCR5 cell line, subconfluent MCF-7 cells in

6-well tissue culture dishes were transfected with 1 µg of either pcDNA3.1 or pcDNA3.1/FLAG-CCR5 expression plasmids using Fugene-6 according to the manufacturer’s protocol (Roche). Cells were selected in 250 µg/ml zeocin for 4 weeks and FACS sorted for CCR5-positive clones. Stable CCR5 transfectant cell lines were designated MCF-7.CCR5, whereas cells transfected with vector were designated MCF-

7.vector.

4.3.3. Proliferation Assay

MCF-7.vector and MCF-7.CCR5 cells (5 x 103) were seeded into 24-well plates in

DMEM/2% fetal calf serum (FCS). Cells were incubated with either 1 or 10 nM CCL5 for the days indicated, collected and counted with a hemocytometer. Cells were fed with fresh media and CCL5 every other day. In CCR5 blocking studies, cells were pretreated with the anti-CCR5 antibody (5 µg/mL) for 1 hour prior to CCL5 stimulation. To determine the role of mTOR, cells were pretreated with rapamycin at the indicated doses for 1 hour prior to CCL5 stimulation. Cells were subsequently fed with fresh media containing rapamycin and CCL5 every other day.

4.3.4. Immunoblotting and immunoprecipitation

161

MCF-7.CCR5 cells (4 x 105) were serum starved in DMEM/0.5% BSA + 0.5% fetal calf serum (FCS) to reduce the effects of the various growth factors found in fetal calf serum on mTOR and protein translation. Cells were incubated with 10 nM CCL5 for the times indicated, collected, washed with ice-cold PBS and lysed in 200 μl lysis buffer

(1% Triton X-100, 0.5% NP-40, 150 mM NaCl, 10 mM Tris-HCl, pH 7.4, 1 mM EDTA,

1 mM EGTA, 0.2 mM PMSF, 10 µg/ml aprotinin, 2 µg/ml leupeptin, 2 µg/ml pepstatin

A). In experiments where rapamycin was used, MCF-7.CCR5 cells were pretreated for 1 hour prior to CCL5 treatment. Protein concentration was determined using the Bio-Rad

DC protein assay kit (BioRad laboratories). 30 μg of protein lysate was denatured in sample reducing buffer and resolved by SDS-PAGE gel electrophoresis. The separated proteins were transferred to a nitrocellulose membrane followed by blocking with 5%

BSA (w/v) in TBS for 1 hour at room temperature. Membranes were probed with the specified antibodies overnight in 5% BSA (w/v) in TBST (0.1% Tween-20) at 4°C and the respective proteins visualized using the ECL detection system (Pierce). For immunoprecipitations using 7-methyl GTP-sepharose beads, 30 µl of beads were added to 500 µg of protein lysates. 30 µl of unconjugated sepharose beads were used as negative control. Beads were washed three times with lysis buffer, denatured in 5X sample reducing buffer and resolved by SDS-PAGE gel electrophoresis.

4.3.5. Flow Cytometric Analysis

162

Cells incubated with FITC-conjugated anti-mouse IgG antibody alone was used as control. Cells were analyzed using the FACSCalibur and CellQuest software (BD

Biosciences).

4.3.6. Polysome gradients

MCF-7.CCR5 cells were serum-starved and treated with 10 nM CCL5 for 1 hour before lysis in ice-cold Nonidet P-40 lysis buffer (10 mM Tris-HCl (pH 8.0), 140 mM

NaCl, 1.5 mM MgCl2, and 0.5% Nonidet P-40) supplemented with RNaseOut RNase inhibitor (Invitrogen) at a final concentration of 500 U/ml. Nuclei were removed by centrifugation at 3,000 x g for 2 minutes at 4 ºC. The supernatant was supplemented with

150 µg/ml cycloheximide, 20 mM DTT and 1 mM PMSF and centrifuged at 15,000 x g for 5 minutes at 4 ºC to eliminate mitochondria. The supernatant was then layered onto a

30 ml linear sucrose gradient (15-40% sucrose (w/v) supplemented with 10 mM Tris-HCl

(pH 7.5), 140 mM NaCl, 1.5 mM MgCl2, 10 mM DTT, 100 µg/ml cycloheximide) and centrifuged in a SW32 swing-out rotor (Beckman) at 32,000 rpm for 2 hours at 4 ºC without a brake. Fractions (1 mL) were carefully collected from the center of the column using a pipette and digested with 100 µg of proteinase K in 1% SDS and 10 mM EDTA for 30 minutes at 37 ºC. RNAs were extracted by phenol-chloroform-isoamyl alcohol followed by ethanol precipitation and dissolved in 20 µl RNase free water before being analyzed by electrophoresis on 1.2% agarose gels to examine polysome integrity. RNA from each fraction was quantified at optical density (OD) of 254 nm. OD readings for each fraction were plotted as a percentage of the total RNA of all fractions to facilitate visual comparisons, and are shown as a function of gradient depth.

163

4.3.7. RT-PCR

Total RNA was isolated using the RNease Mini-Kit (Qiagen). For the reverse transcription reaction, 1 µg of total RNA or 1 µl of each polysome fraction were used.

For semi-quantitative PCR of total RNA, cDNAs were diluted 1:3 and 1:9 in water and used for subsequent amplification of human cyclin D1, c-Myc, Dad-1, PKR and β-actin using the following primers and conditions: cyclin D1, FP 5’ atggaacaccagctcctgtgctgc 3’

RP 5’ tcagatgtccacgtcccgcacgt 3’ (95°C 1 min, 65.5°C 30 sec, 72°C 1 min, 23 cycles); c-

Myc, FP 5’ cccggaattcgcccctcaacgttagcttc 3’ RP 5’ atagtttagcggccgctcacgcacaagagttccgtagctg 3’ (95°C 1 min, 58°C 30 sec, 72°C 1 min, 28 cycles); Dad-1, FP 5' agttcggttactgtctcctcg 3' RP 5' tgtgtccataagctgccatc 3' (95°C 1 min,

54°C 40 sec, 72°C 30 sec, 28 cycles); PKR, FP 5’ gccttttcatccaaatggaattc 3’ RP 5’ gaaatctgttctgggctcatg 3’ (95°C 1 min, 60°C 40 sec, 72°C 30 sec, 28 cycles); β-actin, FP

5’ tagcggggttcacccacactgtgccccatcta 3’ RP 5’ ctagaagcatttgcggtggaccgatggaggg 3’ (95°C

1 min, 58°C 40 sec, 72°C 1 min, 23 cycles). For polysomal PCR, 1 µl of cDNA from each fraction was used. Aliquots were loaded onto 1-1.2% agarose gels and visualized with ethidium bromide staining.

4.3.8. Statistical Analysis

Two-tailed t-test was used to determine the statistical significance of differences between groups.

164

4.4. Results

4.4.1. CCL5-CCR5 inducible MCF-7 proliferation is dependent on mTOR.

There is evidence that MCF-7 breast cancer cells migrate towards CCL5 in a G-protein dependent manner (Youngs et al., 1997). However, the

MCF-7 cells provided to us did not express cell surface CCR1 or CCR5, as determined by FACS analysis (Figure 4.1.A). This may reflect the heterogeneity of different MCF-7 cell lines (Prest et al., 1999). Thus, the stable sub-cell lines MCF-7.vector and MCF-7.CCR5 were created, as described in Materials &

Methods, to examine the potential proto-oncogenic role of CCR5. Cell surface CCR5 expression was confirmed in the transfected cells by FACS analysis (Figure 4.1.A). To examine their proliferative capacity, MCF-7.vector and MCF-7.CCR5 cells were cultured in the presence of 1 and 10 nM CCL5 for up to 5 days. We observed a significant increase in cell number on day 5 in MCF-7.CCR5 cells grown in the presence of 10 nM

CCL5, which was not observed in MCF-7.vector cells (Figure 4.1.B). The presence of anti-CCR5 antibody abrogated this CCL5-induced growth effect (Figure 4.1.B, right panel). Subsequent experiments examined the role of mTOR and mRNA translational events in this CCL5-CCR5 mediated proliferation. As shown in Figure 4.1.C, rapamycin significantly reduced CCL5-mediated MCF-7.CCR5 proliferation. The data suggest that

CCL5-induced proliferation may be dependent on mTOR activation. Notably, treatment of MCF-7 cells with 10 and 50 nM rapamycin resulted in growth inhibition (Figure

4.1.C), underscoring the role mTOR plays in MCF-7 breast tumor growth (Noh et al.,

2007; Noh et al., 2004).

165

Figure 4.1. CCL5-mediated MCF-7 proliferation is dependent on mTOR.

(A) MCF-7 cells were transfected with either pcDNA3 vector or pcDNA.CCR5 plasmid and selected for 4 weeks. Stable sub-cell lines were stained with anti-CCR5 (solid line) or isotype controls (dotted line) and analyzed by FACS. (B) 5 x 103 MCF-7.vector or MCF-7.CCR5 cells were seeded into 24 well plates and stimulated with CCL5. Cells were fed with fresh media containing the indicated doses of CCL5 every other day. MCF-7.CCR5 cells were pretreated with 5 µg/ml anti-CCR5 mAb (2D7) for 1 hr prior to CCL5 stimulation. Cells were trypsinized and counted with a hemocytometer. * p<0.05 (C) MCF-7.CCR5 cells were pretreated with either DMSO (carrier) or rapamycin at the indicated doses for 1 hr prior to CCL5 stimulation. Cells were fed with fresh media containing the indicated doses of rapamycin and CCL5 every other day. The data represent means ± S.D. of 3 independent experiments. * p<0.05

166

Figure 4.1.

MCF-7.vector MCF-7.CCR5

CCR5 CCR5 B MCF-7.vector MCF-7.CCR5 * * 140000 140000 120000 120000

Untreated

100000 100000 1nM CCL5

10nM CCL5 80000 80000 Anti-CCR5 mAb

60000 60000 Anti-CCR5 mAb + 10nM CCL5 Cell number 40000 Cell number 40000 20000 20000

0 0 045 045 Time (Days) Time (Days) C

MCF-7.CCR5 140000 * * 120000

Untreated

100000 10nM Rapamycin Alone

50nM Rapamycin Alone

80000 10nM CCL5

60000 10nM Rapamycin + 10nM CCL5

50nM Rapamycin + 10nM CCL5 Cell number 40000

20000 0 05 Time (Days)

167

4.4.2. CCL5 activation of CCR5 leads to the formation of the eIF4F complex through mTOR.

mTOR regulates eIF4E availability through 4E-BP1 phosphorylation (Richter and

Sonenberg, 2005). To determine whether CCL5 activation of CCR5 mediates the formation of the eIF4F complex, MCF-7.CCR5 cells were treated with CCL5 for up to 60 min in the presence or absence of 50 nM rapamycin. 7-methyl GTP conjugated sepharose beads that mimic the 5’ cap, was used to affinity pull-down eIF4E cell lysates

(Haller and Sarnow, 1997). As shown in Figure 4.2.A, treatment with 10 nM CCL5 led to the dissociation of eIF4E and 4E-BP1, which was sensitive to rapamycin treatment.

The consequent CCL5-induced association of eIF4E with eIF4G was likewise blocked by treatment with rapamycin. These findings suggest that CCL5-CCR5 interactions result in the formation of the eIF4F translation initiation complex.

In subsequent experiments, we demonstrated that CCL5 increased mRNA translation, using sucrose gradient centrifugation to isolate polysome fractions. MCF-

7.CCR5 cells were treated with 10 nM CCL5 for 1 hour, then cell extracts subjected to sucrose gradient centrifugation and serial fractions collected. RNA from each fraction extracted was analyzed by agarose gel electrophoresis to ensure polysome integrity. The distribution of 18S and 28S rRNA in fractions derived from cells either treated with

CCL5 or left untreated was visualized by ethidium bromide staining (Figure 4.2.B, upper panel). CCL5 initiated active translation of mRNA, as shown by the increased presence of high-molecular-weight polysomes deep in the sucrose gradient (fractions 17-20)

168

Figure 4.2. CCL5 induces formation of the eIF4F initiation complex and enhances mRNA association with polyribosomes.

(A) 1 x 106 MCF-7.CCR5 cells were pretreated with either DMSO (carrier) or 50 nM rapamycin for 1 hr prior to 10 nM CCL5 treatment for the indicated times. Cells were lysed and immunoprecipitated with 7-methyl GTP sepharose beads overnight. Beads were washed, resolved by SDS-PAGE and immunoblotted with anti-eIF4E, anti-eIF4G or anti-4E-BP1 antibodies. Unconjugated sepharose beads were used as negative control (neg). (B) MCF-7.CCR5 cells were pretreated with either DMSO (carrier) or 50 nM rapamycin for 1 hr, followed by 10 nM CCL5 for 1 hr. Cells were harvested, lysed and lysates layered onto a sucrose gradient. Fractions were collected after centrifugation, RNAs extracted and quantified at optical density (OD) 254 nm. Representative gel profile of fractions from untreated and CCL5-treated cells are shown to visualize the distribution of 5S, 18S and 28S rRNAs as an indicator of the polyribosome integrity (upper panel). OD readings for each fraction were plotted as a percentage of the total RNA of all fractions and are shown as a function of gradient depth (lower panel). Actively translated mRNA is associated with high-molecular-weight polysomes deep in the gradient (shaded region). Data are representative of two independent experiments.

Figure 4.2.

169

A 7-methyl GTP Sepharose neg

CCL5 (min) 0 30 60 0 30 60 Rapamycin - - - + + + eIF4E

4E-BP1

7-methyl GTP Sepharose neg

CCL5 (min) 0 30 60 0 30 60 Rapamycin - - - + + + eIF4E

eIF4G

B 15% Sucrose 40%

Untreated

CCL5

Fraction # 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20

12 Untreated

10 CCL5 CCL5 + Rapamycin 8

6 % Total RNA 4

0 12345678910111213141516171819202122 Fraction number

170

(Figure 4.2.B, lower panel). Pretreatment with rapamycin inhibited the formation of heavy polysomes. Viewed together, these data suggest that CCL5 may exert its proliferative effect by actively translating mRNAs involved in cell growth and survival.

4.4.3. CCL5 induces protein translation of proliferation and survival proteins.

Increased eIF4E availability leads to translation initiation of a subset of mRNAs with substantial secondary structures in their 5’-UTR. A large number of these mRNAs encode for proliferation and survival proteins (Graff and Zimmer, 2003; Mamane et al.,

2007). Accordingly, we conducted studies to examine whether CCL5 initiated the translation of cyclin D1, c-Myc and Dad-1, because of their well-studied roles in cell cycle progression and survival. In time course studies, MCF-7.CCR5 cells were pretreated with either DMSO (carrier) or rapamycin for 1 hour prior to treatment with 10 nM CCL5. CCL5 treatment rapidly up-regulated cyclin D1, c-Myc and Dad-1 protein levels in a time dependent manner, whereas rapamycin treatment reduced their induction

(Figure 4.3.A). Notably, rapamycin treatment did not affect CCL5-mediated Erk1/2 phosphorylation, consistent with data that mTOR is not placed upstream of Erk1/2

(Steelman et al., 2008). We provide evidence that the increases in cyclin D1, c-Myc and

Dad-1 protein levels were not due to increased gene transcription, as their mRNA levels remained unchanged after 1 hour of CCL5 treatment (Figure 4.3.B).

171

Figure 4.3. CCL5 mediates upregulation of proliferative and survival proteins through a mTOR dependent mechanism.

(A) MCF-7.CCR5 cells were either pretreated with DMSO (carrier) or 50 nM rapamycin for 1 hr prior to treatment with 10 nM CCL5 for the indicated times. Cells were harvested and lysates resolved by SDS-PAGE and immunoblotted with anti-cyclin D1, anti-Dad-1, anti-c-Myc, anti-phospho-Erk1/2, anti-Erk1/2 or β-actin. Data are representative of two independent experiments. (B) MCF-7.CCR5 cells were either pretreated with DMSO or 50 nM rapamycin for 1 hr prior to treatment with 10 nM CCL5 for 1hr and total mRNAs extracted. RT-PCR (undiluted, 1:3, 1:9) was performed using primer sets specific for cyclin D1, Dad-1, β-actin, c-Myc and PKR, as described in Materials and Methods.

172

Figure 4.3.

A CCL5 Rapamycin + CCL5 hrs: 0 0.5 1 2 0 0.5 1 2 c-Myc cyclin D1

β-actin Dad-1 p-Erk1/2 Erk1/2 β-actin

B Rapamycin UT CCL5 + CCL5

Dad-1

cyclin D1 c-Myc

β-actin PKR

173

4.4.4. CCL5 facilitates recruitment of a subset of mRNAs to polysomes.

To rule out the possibility that CCL5-mediated increases in protein expression was due to effects on protein stability, the distribution of cyclin D1 and Dad-1 mRNA along the sucrose density gradient was examined. MCF-7.CCR5 cells were pretreated with either DMSO (carrier) or 50 nM rapamycin, then treated with 10 nM CCL5 for 1 hour. Cell extracts were subjected to sucrose density centrifugation, fractions collected and RNA prepared. RT-PCR was performed on each fraction, the cDNAs analyzed by agarose gel electrophoresis, and each amplified band was quantified by densitometry.

Total RNA was designated as the sum of the band density values of all fractions. As shown in Figure 4.4., CCL5 induced the shifting of Dad-1 and cyclin D1 mRNAs to heavier polysome fractions, which was inhibited by rapamycin. CCL5 did not induce the accumulation of ß-actin mRNA to polysomes. In addition we included analysis of RNA for PKR, a protein not known to be regulated by CCL5. Both ß-actin and PKR mRNA profiles in the sucrose gradient were largely unaffected by rapamycin. The data suggest that CCL5 facilitates the recruitment of a subset of mRNAs to polysomes in a rapamycin–sensitive manner, thereby regulating their protein levels.

174

Figure 4.4. CCL5 faciliates recruitment of a subset of mRNAs to polysomes.

(A) MCF-7.CCR5 cells were either pretreated with DMSO or 50 nM rapamycin for 1 hr prior to treatment with CCL5 for 1 hr. RNA from 20 fractions was extracted and reverse transcribed into cDNA. RT-PCR was performed to assess mRNA levels of cyclin D1, Dad-1, β-actin and PKR within each fraction. Aliquots from each reaction was loaded onto an agarose gel and visualized by ethidium bromide. Amplified PCR bands from fractions were quantified by densitometry and plotted as a % of total RNA to the right of each gel. Polysomes are found in fractions 17-20 (shaded region). Data are representative of two independent experiments.

175

Figure 4.4.

12 UT 10 Dad-1 CCL5 8 Rapamycin 6 +CCL5 Fraction #: 1 3 5 7 9 11 12 13 14 15 16 17 18 19 20 4

% total RNA% total 2 polysome 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20

14 UT

cyclin D1 CCL5 9 Rapamycin +CCL5 Fraction #: 1 3 5 7 9 11 12 13 14 15 16 17 18 19 20 4 % total RNA % total polysome -1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20

UT 10 CCL5 β-actin 8 Rapamycin +CCL5 6 Fraction #: 1 3 5 7 9 11 12 13 14 15 16 17 18 19 20 4

polysome RNA% total 2 0 1 2 3 4 5 6 7 8 9 1011121314151617181920 14 12 UT 10 PKR CCL5 Rapamycin 8 +CCL5 6 Fraction #: 1 3 5 7 9 11 12 13 14 15 16 17 18 19 20 4 polysome RNA% total 2 0 1 2 3 4 5 6 7 8 9 1011121314151617181920 Fraction #

Untreated

CCL5

CCL5 + Rapamycin

176

4.5. Discussion

The tumor microenvironment comprises growth factors, cytokines, chemokines and angiogenic factors. Many of these biological response modifiers activate signaling cascades in the tumor cell leading to 4E-BP1 phosphorylation. Indeed, 4E-BP1 phosphorylation is increased in a number of cancers, and this increased phosphorylation has been shown to correlate with poor breast cancer prognosis (Armengol et al., 2007).

Similarly, eIF4E over-expression has been associated with the malignant progression of different cancers including breast, colon, lung and prostate (De Benedetti and Graff,

2004; Graff et al., 2008; Zhou et al., 2006). We have previously shown that CCL5 activation of CCR5 initiates mRNA translation through an mTOR/4E-BP1 signaling cascade, thereby modulating CD4+ T cell chemotaxis (Murooka et al., 2008). In the present study, we provide evidence that CCL5 activation of CCR5 results in signaling mediated by the mTOR/4E-BP1 pathway that offers a proliferative advantage to MCF-7 breast cancer cells.

Accumulating evidence indicates that eIF4E may act as the node of convergence for a number of upstream oncogenic signaling events. mTOR signaling is constitutively active in a number of cancers and their proliferation is strongly inhibited by rapamycin

(Noh et al., 2004; Sabatini, 2006). The two major substrates of mTOR are the serine/threonine kinase p70 S6K and the eIF4E-binding protein 4E-BP1, both shown to directly modulate protein translation (Gingras et al., 2004). 4E-BP1 hyperphosphorylation releases eIF4E, allowing it to associate with the scaffold protein eIF4G, which, along with the RNA helicase eIF4A, forms the eIF4F heterotrimeric initiation

177

complex. By binding to the 5’-cap structure of mRNAs through eIF4E, the eIF4F complex facilitates ribosome binding and its passage along the 5’-UTR towards the initiation codon. Although increased availability of eIF4F initiates the translation of all cap-dependent mRNAs, a subset of mRNAs that contain lengthy, highly structured 5’-

UTRs are the most sensitive. These mRNAs typically encode for growth and survival proteins (e.g. cyclin D1, VEGF, bcl-2), and are poorly translated when eIF4F availability is limited (De Benedetti and Graff, 2004; Graff et al., 2008). Once eIF4F complex levels are high, these mRNAs are preferentially translated and play critical roles in cell growth, proliferation and survival.

Employing microarray analyses of polysomal RNAs, Mamane and colleagues identified subsets of translationally regulated mRNAs in an inducible, eIF4E-expressing

NIH 3T3 cell line. These mRNAs encoded for a number of ribosomal proteins, anti- apoptotic proteins and cell growth-related factors (Averous et al., 2008; De Benedetti and

Graff, 2004; Mamane et al., 2007). We have extended these findings to investigate the potential for CCL5 to regulate translation of the mRNAs for cyclin D1, c-Myc and Dad-1.

The oncogenic properties of cyclin D1 during mitosis have been well characterized, and its over-expression is common in many human cancers (Knudsen et al., 2006). Similarly, the proto-oncogene c-Myc is over-expressed in many cancers, and high expression levels correlate with advanced disease stage (Pelengaris et al., 2002; Vogelstein and Kinzler,

2004). Notably, eIF4E and c-Myc synergistically have anti-apoptotic effects on cells, resulting in clonal transformation (Ruggero et al., 2004). Similarly, RNA knockdown of c-Myc decreased MCF-7 growth rate both in vitro and in vivo (Wang et al., 2005). Dad-

178

1-deficiency results in embryonic lethality in mice, associated with an increased frequency of apoptosis observed in selective tissues (Hong et al., 2000). Herein we show that CCL5 rapidly up-regulates cyclin D1, c-Myc and Dad-1 protein levels without increasing gene transcription. Furthermore, CCL5 facilitates the recruitment of Dad-1 and cyclin D1 mRNAs to polysomes in a rapamycin-sensitive manner. The specificity of these translational events is reinforced by our observation that mRNAs for β-actin and

PKR did not redistribute along the sucrose gradient following CCL5 treatment of cells.

Increased eIF4E availability does not affect all cap-dependent mRNA translation, but rather a subset of mRNAs. It is intriguing to speculate that aberrant CCR5 expression may allow breast cancer cells to take advantage of CCL5 which accumulates within the tumor microenvironment, thereby promoting protein translation associated with growth proliferation.

Previous studies have described the proto-oncogenic roles of both CCL5 and

CCR5 in several cancer types (Aldinucci et al., 2008; Azenshtein et al., 2002; Luboshits et al., 1999; Robinson et al., 2003; Sugasawa et al., 2008; Vaday et al., 2006; Youngs et al., 1997). However, there are conflicting reports regarding the direct role of CCL5 in breast tumor cell growth (Adler et al., 2003; Jayasinghe et al., 2008). Our data support the proliferative role of CCL5 in breast cancer. This is in contrast to studies showing that tumor-derived CCL5 did not contribute to breast tumor formation in vivo (Jayasinghe et al., 2008). One explanation for these discrepant results is the concentration of CCL5 in the two studies. While we observed significant CCL5-mediated proliferative effects at 10 nM, CCL5 produced by 4T1 breast cancer cells reported by Jayasinghe and colleagues

179

was approximately 100 fold less (Jayasinghe et al., 2008). We infer that a threshold level of CCL5 is required in order for CCL5 to invoke a proliferative response in breast cancer cells. The hypothesis is supported by several studies showing that CCL5 content within tumor lesions is markedly higher in more aggressive forms of breast cancer (Bieche et al.,

2004; Niwa et al., 2001). Such a threshold may be attainable through the propensity of

CCL5 to bind, oligomerize and accumulate on GAGs at their secretion site (Proudfoot et al., 2003).

Others have reported chemokine activation of mTOR signaling leading to increased proliferation and motility in cancer. The CXCR4/mTOR signaling pathway increased proliferative and migratory potential in gastric carcinoma cells (Hashimoto et al., 2008). CXCL8 has been shown to up-regulate cyclin D1 at the level of translation in prostate cancer cells (MacManus et al., 2007). Sodhi and colleagues show that endothelial-specific expression of the Karposi’s sarcoma-associated herpesvirus (KSHV)- encoded gene, v-GPCR, is sufficient to induce Kaposi-like sarcomas in mice, and is dependent on the Akt/TSC2/mTOR signaling pathway (Sodhi et al., 2006). Recently,

CCL5 was implicated in mediating pro-growth and anti-apoptotic effects of gastric cancer cells (Sugasawa et al., 2008).

Our data link CCL5-mediated proliferative effects in breast cancer with mTOR/4E-BP1/eIF4E-dependent mRNA translation. Thus, targeting intermediates of this signaling pathway may have therapeutic potential as anti-cancer drugs. Certainly, rapamycin and its derivatives are currently being evaluated in multiple cancer clinical

180

trials (Guertin and Sabatini, 2007). In addition, Graff and colleagues have successfully used eIF4E-specific anti-sense oligo-nucleotides to significantly reduce tumor growth in mice (Graff et al., 2007). Small molecule inhibitors of eIF4E-eIF4G interaction were also reported to reduce proliferation in several cancer cell lines (Moerke et al., 2007).

These initiatives have proven successful thus far, and warrant clinical investigations to evaluate their efficacy in humans.

181

Chapter 5

Discussion and Future Directions

Portion of this chapter was published as:

Murooka, T.T., Ward, S.E., and Fish, E.N. (2005). Chemokines and cancer. Cancer Treat Res 126, 15-44.

Galligan C.L., Murooka, T.T., Rahbar, R., Baig, E., Majchrzak-Kita, B., and Fish, E.N. (2006). Interferons and viruses: signalling for supremacy. Immunol Res 35, 27-40.

182

Chemokines and the Immune Response

Highly organized recruitment of effector T cells to the site of infection is imperative for an effective adaptive immune response against a foreign pathogen.

Chemokine and chemokine receptors are largely responsible for orchestrating leukocyte trafficking between infected tissues and the secondary lymphoid organs during an immunological response (Figure 5.1). Once expressed, chemokines are presented on

GAGs by endothelial cells and extracellular matrix molecules to circulating leukocytes.

Activation through chemokine receptors facilitates the transition of leukocytes from fast to slow rolling and finally, to firm adhesion. Chemokine gradients found within the tissues determine where the leukocytes ultimately localize to. Importantly, some chemokines also have immuno-modulatory roles, including their ability to regulate cytokine expression, mediate co-stimulation of T cells, and determine T cell fate. Thus, the chemokine system plays critical roles in all facets of both the innate and adaptive immune response.

During immunological insult, the innate immune response is the first line of defence against invading micro-organisms. Recognition of pathogens is mediated by germline-encoded receptors called pattern-recognition receptors (PRRs). Many Toll-like receptors (TLRs) function as PRRs and recognize conserved molecular patterns shared by pathogens (Akira et al., 2001). Resident tissue macrophages and immature dendritic cells express multiple TLRs and are the primary activators of innate immunity through the release of several inflammatory mediators, including chemokines, via NFκB activation.

183

Figure 5.1 Chemokines mediate leukocyte migration from blood to extravascular tissue

The flow of leukocytes is slowed by a rolling behaviour mediated by mucin:selectin interactions between leukocytes and the endothelial surface. Chemokines are bound to the surface of the endothelial cell and the extracellular matrix through interactions with glycosaminoglycans (GAGs). Subsequent binding of chemokines to chemokine receptors on leukocytes increases cell adhesiveness by activating integrin affinity and avidity. Extravasation through the intercellular junction is followed by migration towards subluminal chemokines tethered to GAGs within the inflamed tissues.

184

Blood vessel flow

Activation

Adherance

Rolling Extravasation

Endothelium

Inflamed tissue

Inflammatory chemokine receptor

Mucin : selectin interaction

Glycosaminoglycan

Inflammatory chemokine Integrin interaction

185

These chemokines, namely CXCL8, CCL3, CCL4, CCL5 and CXCL10, are largely responsible for the recruitment of additional immature dendritic cells, neutrophils and NK cells into infected tissues. They function to engulf or specifically kill infected cells to clear invading microbes and contain larger parasites (Akira et al., 2001). Of particular importance are immature dendritic cells, as they respond to many pathogen-associated molecular patterns, such as LPS, bacterial lipoproteins, peptidoglycan and CpG dinucleotides (Muzio et al., 2000). Immature DCs express chemokine receptors CCR1,

CCR5 and CCR6 which keep them within tissues (Sozzani et al., 2000). However, upon activation through TLRs, immature DCs down-modulate the expression of these chemokine receptors and up-regulate CCR7 expression (Dieu et al., 1998). The switch in chemokine receptor expression results in the net migration of maturing DCs from peripheral tissues to the afferent lymphatics, which express ligands for CCR7, CCL19 and CCL21 (Martin-Fontecha et al., 2003). Once in lymph nodes, CCR7 also allows mature DCs to enter the T cell areas in the deep cortex (Gunn et al., 1999). Thus, the change in the DC migratory pattern upon antigen uptake is vital for the induction of the adaptive immune response.

Naïve T cells continuously circulate the periphery, entering LNs via High

Endothelial Venules (HEVs). They express the adhesion molecule CD62L (L-selectin),

LFA-1 and α4β7, and the chemokine receptor CCR7. CD62L mediates tethering and rolling of naïve T cells on the endothelium of HEVs (Mora and von Andrian, 2006). This allows naïve T cells to home into and be retained in lymphoid tissues via their ability to respond to CCL21 synthesized in HEVs and by lymphatic endothelial cells (Gunn et al.,

186

1999). Once in the T cell zones, T cells and mature DCs continuously interact with one another until a “match” is found. The resulting activation of T cells involves alterations in cytokine production, increased proliferation and the acquisition of effector functions.

There is also a switch in chemokine receptor expression, depending on the effector function they acquire. CCR5 and CXCR3 pre-dominate on primarily cytotoxic, IFNγ- driven Th1 cells, while CCR4 and CCR8 are preferentially expressed on humoral, IL-4- dependent Th2 cells (Luther and Cyster, 2001). Some activated CD4+ T cells up- regulate CXCR5, allowing them to migrate towards the edges of B follicles to provide help to B cells (Schaerli et al., 2000). Recently activated T cells down-modulate CCR7 expression and eventually re-express the S1P receptor (also known as endothelial differentiation gene 1, EDG1), a 7 trans-membrane receptor, critical for T cell egression.

Thus, activated T cell egress is also an active process, responding to the S1P concentration gradient that is present between the interior of the lymphoid tissue and the adjacent blood or lymph (Cyster, 2005). The S1P receptor agonist, FTY720, displays potent immuno-suppressive properties by down-regulating and inactivating the receptor and preventing lymphocyte release from lymphoid organs (Matloubian et al., 2004).

Taken together, chemokine receptor switching ensures that only activated T cells are recruited to inflammatory sites.

Once in the circulation, activated T cell recruitment involves their rolling on the endothelial surface. This process is primarily mediated by the selectin family as well as the adhesion molecule VLA-4 (Alon et al., 1995). The inflammatory chemokine CCL5 is highly expressed at inflammatory sites, and is presented on the apical surface of

187

endothelial cells via GAGs. Rolling of T cells is gradually replaced by more firm adhesions, mediated through integrins. Chemokines can induce up-regulation of integrin affinity through conformational changes, or induce integrin clustering to increased avidity

(Johnston and Butcher, 2002). CCR5 activation on T cells leads to their firm adhesion through ICAM-1 and VCAM-1 on endothelial cells. After undergoing diapedesis, T cells ultimately localize to the focus of infection via a CCL5 concentration gradient found within the tissues.

5.1. mTOR and the Adaptive Immune Response

Efficient migration and localization of lymphocytes are essential for effective immune responses. Thus, there is much interest in elucidating the molecular mechanisms and signalling pathways that control lymphocyte trafficking. As discussed earlier, naïve

T cells express a unique array of molecules, namely CD62L, CCR7 and CXCR4, to help maintain their retention within lymphoid organs. Recent studies by Sinclair and colleagues demonstrated that the PI-3’K/mTOR pathway determines the repertoire of adhesion and chemokine receptors expressed by T cells (Sinclair et al., 2008).

Specifically, IL-2-mediated down-regulation of CD62L, CCR7 and S1P1 were all suppressed by LY294002 and rapamycin. Furthermore, adoptive transfer of rapamycin- treated CTLs led to their increased retention in both the lymph node and spleen compared to control CTLs in vivo. Interestingly, down-regulation of CD62L and CCR7 expression by PI-3’K/mTOR was dependent on the cellular abundance of KLF2, a key transcription factor for both CD62L and CCR7 (Bai et al., 2007; Carlson et al., 2006). Thus, both PI-

3’K and mTOR are responsible for regulating T cell egress in vivo by directly regulating

188

the expression of chemokine receptors and adhesion molecules. The data in Chapter 3 show that mTOR plays an important role in CCL5-mediated CD4+ T cell chemotaxis in vitro. Rapamycin-mediated reduction of T cell chemotaxis correlated with reduced protein translation, specifically cyclin D1 and MMP-9 (Figure 3.1, 3,8). The data describe a mechanism by which CCL5 directly regulates translation of chemokine-related mRNAs during T cell migration (Murooka et al., 2008). When considering the data from these two studies (Murooka et al., 2008; Sinclair et al., 2008), an intriguing story involving mTOR and lymphocyte trafficking is starting to emerge (Figure 5.2).

Prolonged antigen-bearing DC-T cell interactions lead to increased proliferation and cytokine production, including IL-2. By up-regulating CD25, the α-subunit of the IL-2 receptor, T cells display increased IL-2/IL-2R signal transduction through PI-3’Kδ and mTOR (Sinclair et al., 2008). Through an unknown mechanism, mTOR suppresses

KLF2 activity, causing down-regulation in CD62L, CCR7 and S1P1 mRNA expression.

Simultaneously, TCR-triggering in the presence of IL-12, up-regulates CCR5 expression, further promoting T cell egress. Once out in the periphery, mTOR plays a positive role in effector T cell migration towards inflamed peripheral tissue. T cells respond to a CCL5 concentration gradient, established through GAG binding on endothelial cells. There,

CCL5-mediated T cell migration is dependent on mTOR/4E-BP1 and the initiation of mRNA translation. Specifically, chemotaxis-related protein synthesis is up-regulated to possibly “prime” T cells for efficient migration. Once localized within inflammatory sites, effector T cells exert their specialized functions to control and clear pathogens. The implications are that rapamycin may exert its potent immuno-suppressive properties by

189

limiting activated effector T cell migration into inflamed tissue and simultaneously preventing their egress from secondary lymphoid organs. Whether mTOR plays a role in

190

Figure 5.2 Illustration of the role of mTOR activity in T cell migration in vivo.

Naïve T cells have high expression of KLF2. KLF2 up-regulates the expression of cell surface CD62L, CCR7 and S1P1 to ensure the normal recirculation of T cells into and out of secondary lymphoid organs. After a productive encounter with antigen-presenting cells, the IL-2/IL-2R signalling pathway suppresses KLF2 activity through PI-3’K/mTOR. Suppression of KLF2 leads to down-regulation of CD62L and CCR7 expression, promoting T cell egress from lymphoid tissue. Expression of S1P1 is similarly suppressed, although it is eventually re-expressed in activated T cells to allow their egress mediated by an alternative mechanism. Activated T cells up-regulate CCR5 and respond to the CCL5 concentration gradient in the periphery. CCL5-mediated CD4+ T cell chemotaxis is dependent on mTOR activity. Through mTOR, rapid translation of chemotaxis-related mRNAs “prime” T cells for efficient chemotaxis towards the site of inflammation.

191

Lymph node

Naïve T cells Naïve T cells HEV KLF2

CD62L CCR7 S1P1

LN homing and recirculation

Activated T cells IL-2/IL-2R complex

CCL5 mTOR concentration gradient KLF2

CD62L * CCR7 S1P1

Decreased LN homing

Activated Th1 cells CCL5/CCR5 complex * S1P1 is eventually re-expressed in activated T cells to allow their egress mediated by an mTOR alternative pathway

4E-BP1

eIF4E

Increased translation of chemotaxis-related mRNAs

192

cell migration mediated by other chemokines, namely CXCL12, CCL19 and CCL21, in T cells as well as other cell types, namely B cells and macrophages, have not been studied.

5.1.1. mTOR-mediated Nutrient Sensing and Chemotaxis

The intriguing aspect of these studies is the possible cross-talk between the control of lymphocyte migration and cellular metabolism. How do lymphocytes ensure that energy demands for the highly energy-taxing process of cell migration are met? Can chemokines play a role in regulating cellular metabolism and nutrient uptake during migration? Several studies have shown that stimulation through the TCR and costimulatory molecules triggers a switch in T cell metabolism to meet bio-energetic demands of increased cell growth, proliferation and gene transcription. In fact, T cell activation triggers a metabolic conversion from oxidative phosphorylation (OX-PHOS) to high throughput glycolysis, termed aerobic glycolysis (Fox et al., 2005; Krauss et al.,

2001). Such a switch in metabolism is important for both energy production and metabolic intermediates required for nucleotide, protein and lipid biosynthesis. Sustained

T cell activation leads to Ca2+-dependent increases in reactive oxygen species (ROS) and has implications in shaping the T cell response (Jones et al., 2007). Additionally, activated T cells display increased glucose uptake by up-regulating the glucose transporter, Glut1, through PKB (Frauwirth et al., 2002; Rathmell et al., 2003).

Altogether, the data illustrate that recently activated T cells are metabolically equipped to sustain rapid cell growth and proliferation. Once effector T cells leave lymphoid organs, do they require sustained signalling in order to maintain their anabolic metabolism and nutrient uptake? If so, can inflammatory chemokines deliver that signal, possibly through

193

mTOR activation? Since we have shown that CCL5-mediated mTOR activation leads to mRNA translation, it will be interesting to investigate whether CCL5 has other mTOR- mediated effects on T cells. Certainly, several studies demonstrated that mTOR kinase activity is required for PKB-dependent expression of the amino acid transporter- associated 4F2 heavy chain redistribution to the plasma membrane (Edinger et al., 2003b;

Edinger and Thompson, 2002). In fact, maintenance of nutrient transporters on the cell surface depends on ongoing signal transduction (Edinger et al., 2003a). When cells are deprived of IL-3, the turnover of nutrient transporters Glut1 and 4F2hc rapidly decreased the rate of nutrient uptake. Additionally, mTOR is a positive regulator of glycolysis, as rapamycin treatment decreased glycolytic rates in FL5.12 cells (Edinger et al., 2003b).

Microarray analysis of yeast and mammalian cells treated with rapamycin showed decreased levels of mRNA transcripts encoding glycolytic enzymes (Hardwick et al.,

1999; Peng et al., 2002). mTOR-dependent uptake of nutrients and glycolytic metabolism may be important to support increased protein translation and expansion in cell size, also regulated through mTOR. Further studies are required to determine whether CCL5- mediated mTOR activation affects cellular metabolism and nutrient uptake in T cells.

Specifically, whether CCL5 can regulate expression of amino acid transporter-associated proteins, such as the 4F2 heavy chain and the glucose transporter Glut1, has not been studied. Flow cytometric studies using PM1.CCR5 T cells and primary activated CD4+

T cells to determine whether CCL5 can up-regulate or sustain Glut1 and 4F2 expression can be performed. The role of CCL5-CCR5 mediated Jak/Stat, PI-3’K/PKB/mTOR and/or MAPK signalling pathways on Glut1 and 4F2 expression can be addressed using the appropriate pharmacological inhibitors. If indeed Glut1 protein and cell surface

194

expression is up-regulated or maintained by CCL5, glucose uptake and metabolism can be directly measured within cells. Glycolytic rates can be calculated by measuring the amount of lactate produced to glucose consumed. Furthermore, siRNA knockdown experiments of these nutrient receptors assessing the impact on cellular migration can provide a link between nutrient sensing and chemotaxis. Finally, translationally- regulated proteins can be identified by microarray analysis of polysomal mRNA. In these experiments, T cells are treated with CCL5 in the presence or absence of rapamycin and lysates subjected to sucrose centrifugation to isolate polysomal mRNA. These mRNAs are isolated, purified and subjected to microarray analysis, to identify a subset of mRNAs that are regulated by CCL5 at the level of translation. Specifically, proteins involved in cellular metabolism and nutrient sensing will be of interest. Taken together, it is intriguing to speculate that besides providing migrational cues, CCL5 may regulate nutrient receptor trafficking, metabolism and protein expression in order to maintain a high energy status during chemotaxis.

195

5.2. CCL5 determines T cell Fate through AICD

At the site of an infection, inflammatory chemokines are produced and secreted.

Chemokines are bound by heparin-like glycosaminoglycans, becoming immobilized and concentrated within tissue sites. Accordingly, recently activated T cells recruited from the lymphoid organs to a site of infection, are exposed to high CCL5 concentrations. The propensity of CCL5 to form higher-order aggregates at high, µM concentrations, prompted studies to investigate their effects on T cell function. It is now apparent that at these concentrations, CCL5 forms large oligomers with a mass greater than 100 kDa

(Appay et al., 1999; Appay et al., 2000). Previous studies showed that CCL5 stimulated antigen-independent activation of T cells in the context of increased proliferation, CD25 expression and cytokine production, only at these high concentrations (Bacon et al., 1995;

Dairaghi et al., 1998). This unexpected property of CCL5 demonstrated that high doses of CCL5 can bypass T cell receptor recognition of antigen to activate T cells. As an extension of these initial studies, we investigated whether CCL5-mediated T cell activation may play a role in Activation-Induced Cell Death (AICD). AICD mediates the removal of the activated and expanded T cells after an immune response (Krammer et al.,

2007). Typically, TCR re-stimulation of already expanded T cells in the absence of costimulation leads to the efficient induction of cell death, in most cases through CD95, but other mechanisms have also been described, namely TNFR1 and granzyme B (Devadas et al., 2006). Re-stimulation of T cells up-regulates the expression of CD95L, leading to induction of AICD through CD95/CD95L interactions between neighboring T cells (Li-

Weber and Krammer, 2003). Our data in Chapter 2 show that high, µM CCL5 concentrations induce T cell death (Murooka et al., 2006). Specifically, we show that

196

CCL5 aggregation at high ligand concentrations induces apoptosis in PM1, MOLT-4 and activated peripheral blood T cells in a CCR5-dependent manner (Figure 2.1, 2.5). When

T cells are subjected to µM concentration of CCL5, cells undergo apoptosis through cytosolic release of the mitochondrial pro-apoptotic factors cytochrome c, caspase-9 and caspase-3, followed by poly ADP ribose polymerase (PARP) cleavage (Figure 2.4). In both PM1.CCCR5 and MOLT-4.CCR5 cells, CCL5-mediated apoptosis was observed in approximately 60% of the cells after 24 hours, whereas ex vivo activated T cells exhibited approximately 9% apoptotic death. The data suggest that the sensitivity to CCL5- mediated apoptosis is higher in the two T cell lines. It is also possible that 24 hours is not sufficient for maximal cell death in primary T cells. Certainly, CXCL12-induced apoptosis of Jurkat T cells was not observed until after 3 days in culture. The prolonged lag period observed may reflect changes in gene expression of the death receptors

CD95/CD95L (Colamussi et al., 2001). Thus, additional time course studies with ex vivo

T cells are necessary to determine whether a similar lag period also exists in CCL5- mediate apoptosis. The result from such studies may reveal that CCL5-mediated AICD of T cells does not occur immediately, but rather is achieved over several days. This would be in agreement with the overall kinetics of the T cell immune response, where T cell function can be gradually “turned off” by prolonged exposure to high CCL5 doses.

Taken altogether, our data suggest that CCL5-induced cell death, in addition to

CD95/CD95L mediated events, may contribute to clonal deletion of T cells after an immunological response.

197

Because µM concentrations of CCL5 are required to invoke this outcome, the important question is whether these concentrations of CCL5 are achievable or likely in vivo. Certainly, unusually high CCL5 concentrations may be realizable at sites of acute infection or inflammation through the sequestration of CCL5 by cell surface and/or extracellular matrix GAGs. In addition, the unique ability of CCL5 to form aggregates, facilitated through GAG-binding, may also lead to an increase in local CCL5 concentration (Appay et al., 1999; Appay et al., 2000; Czaplewski et al., 1999;

Hoogewerf et al., 1997; Kuschert et al., 1999; Martin et al., 2001; Proudfoot et al., 2001;

Proudfoot et al., 2003). We, therefore, infer that the CCL5-CCR5 induced apoptosis of T cells we observe is not likely an in vitro artifact, but is attainable in vivo. However, this hypothesis remains an assumption, as CCL5 levels at inflammatory sites have never been measured directly. Certainly, autoimmune animal models, such as collagen-induced arthritis in mice, can be used to quantitate local CCL5 concentration in an active inflammatory site. Such studies are experimentally challenging, because of the ability of

CCL5 to bind GAGs, either expressed on the extracellular matrix or cell surfaces, and the tendency of CCL5 to form higher-order aggregates when present at high concentrations.

198

5.3. CCL5 promotes breast cancer proliferation

Many cancers are characterized by abnormal chemokine production or aberrant expression of and signalling by chemokine receptors. Tumor-associated chemokines can act directly on tumor cells to regulate proliferation and survival through an autocrine loop, or recruit tumor-promoting leukocytes to the tumor microenvironment and stimulate the release of growth factors. There is accumulating evidence for the pathogenic role of both

CCL5 and CCR5 in breast cancer. The CCL5/CCR5 axis has been associated with active recruitment of TAMs, as well as their direct proliferative role in breast cancer cells.

Robinson and colleagues showed that administration of the CCR1/CCR5 antagonist, Met-

CCL5, significantly reduced the extent of macrophage infiltration within tumors, which correlated with reduced tumor burden (Robinson et al., 2003). Breast tumor cells expressing lower levels of CCL5 exhibited decreased growth in vivo (Adler et al., 2003).

In vitro studies have shown that both CCL2 and CCL5 stimulate the release of tumor- promoting factors by macrophages, namely MMP-9 and TNFα (Azenshtein et al., 2002;

Robinson et al., 2003; Saji et al., 2001). The data indicate that inflammatory chemokines can actively recruit tumor-promoting leukocytes into the tumor microenvironment, thus establishing a continuous source of growth and angiogenic factors.

We investigated the possibility that CCL5 has direct proliferative and survival effects on breast cancer cells mediated by mTOR. The data in Chapter 4 show that exogenous CCL5 induced MCF-7 breast cancer cell proliferation (Figure 4.1.).

Specifically, CCL5 actively promoted translation of proliferative and survival proteins, namely cyclin D1, c-Myc and defender against cell death-1 (Dad-1) in a rapamycin-

199

dependent manner (Figure 4.3, 4.4.). The implications are that breast cancer cells can exploit downstream chemokine signalling pathways for their proliferative and survival advantage, by expressing the appropriate chemokine receptors. This is in contrast to studies showing that tumor-derived CCL5 did not contribute to breast tumor formation in vivo (Jayasinghe et al., 2008). One explanation for these conflicting results is the concentration of CCL5 in the two studies. While we observed significant CCL5- mediated proliferative effects at 10 nM, CCL5 produced by 4T1 breast cancer cells, reported by Jayasinghe and colleagues, was approximately 100 fold less (Jayasinghe et al.,

2008). The data suggest that a threshold level of CCL5 is required to invoke a proliferative response in breast cancer cells. This hypothesis is supported by several studies showing that CCL5 content within tumor lesions is markedly higher in the more aggressive forms of breast cancer (Bieche et al., 2004; Niwa et al., 2001). This threshold of CCL5 concentration may be attainable as a consequence of the propensity of CCL5 to bind, oligomerize and accumulate on GAGs at their secretion site (Proudfoot et al., 2003).

5.3.1. CCL5-mediated mTOR Activation and Cellular Metabolism

First described by Otto Warburg (Warburg et al., 1924), it is increasingly clear that tumor cells switch from oxidative phosphorylation to aerobic glycolysis, even when oxygen is non-limiting (Bauer et al., 2004; Elstrom et al., 2004). Glycolysis yields much less ATP per glucose molecule utilized compared to oxidative phosphorylation, but provides cells with metabolic intermediates critical for cell growth. For example, the pentose phosphate shunt converts glucose-6-phosphate to ribose-5-phosphate, a key intermediate in nucleotide biosynthesis (Jones and Thompson, 2007). Recent work by

200

Christofk and colleagues demonstrated that a switch in a splice isoform of the glycolytic enzyme pyruvate kinase is necessary for the metabolic switch to aerobic glycolysis.

RNA knockdown of the M2, but not the M1 isoform, reduced lactate production and reduced tumor formation in vivo (Christofk et al., 2008a). Furthermore, the M2 isoform binds directly and selectively to tyrosine-phosphorylated peptides (Christofk et al.,

2008b). The implications are that tyrosine phosphorylation signalling effectors can potentially regulate glycolysis through the glycolytic enzyme pyruvate kinase. This is consistent with studies showing that mammalian cells require exogenous signals to alter their cellular metabolism. For example, hyperglycemia associated with Type I diabetes remains high without insulin-mediated signal transduction to instruct cells to uptake glucose (Saltiel and Kahn, 2001). Further studies are needed to investigate the effects of

CCL5 on cellular metabolism and nutrient uptake, possibly mediated by mTOR, in breast cancer. Specifically, elucidating whether CCL5-CCR5 mediated signalling can alter glucose metabolism and nucleotide biosynthesis to sustain increased mRNA translation will be of interest. The impact of CCL5 on the expression of the glucose transporter

Glut1 and the amino acid transporter-associated protein, 4F2, can be assessed by flow cytometry. Glucose uptake and metabolism can be directly measured in MCF-7.CCR5 cells, and the role of PI-3`K and mTOR can be assessed using the appropriate pharmacological inhibitors. Glycolytic rates can be calculated by measuring the amount of lactate produced to glucose comsumed. Furthermore, siRNA knockdown experiments of these nutrient receptors to address their contributions to cell size, proliferation and survival would be of interest. Results from these studies would provide insights into the pro-tumorigenic effects of CCL5 and elucidate the contributions of altered cellular

201

metabolism, amino acid uptake and increased translation of proliferation and survival proteins.

202

5.4. Conclusions

Chemokines were originally identified for their selective chemo-attractant and pro-adhesive effects. They are responsible for directing leukocyte migration by forming chemokine gradients and triggering firm arrest by activating integrins on the leukocyte cell surface. Throughout this thesis, I have described the importance of the CCL5/CCR5 axis in the context of the immune response and cancer biology. Firstly, I showed that

CCL5-mediated effector T cell migration is regulated by mTOR-dependent mRNA translation. I demonstrated that up-regulation of chemotaxis-related proteins may

“prime” T cells for efficient migration. Secondly, I show that high concentrations of

CCL5 at the inflammatory sites can instruct effector T cells to undergo apoptosis. The data suggest that CCL5-induced cell death, in addition to CD95/CD95L mediated events, may contribute to clonal deletion of T cells after an immunological response. Finally, I demonstrate the pathological consequence of aberrant CCL5/CCR5 signalling in breast cancer. CCL5 can directly induce proliferation of MCF-7 breast cancer cells through increased translation of proliferation and survival proteins. These studies reinforce the notion that chemokines are not only potent chemotactic mediators, but are key effectors in diverse developmental, immunological and pathological processes.

203

Chapter 6

Dissemination of Work Arising from this Thesis

204

Chapter 2 was published as:

Chapter 3 was published as:

Murooka, T.T., Rahbar, R., Platanias, L.C., and Fish, E.N. (2008). CCL5-mediated T- cell chemotaxis involves the initiation of mRNA translation through mTOR/4E-BP1. Blood 111, 4892-4901.

Chapter 4 is a manuscript submitted as:

Murooka, T.T., Rahbar, R., Platanias, L.C., and Fish, E.N. CCL5 promotes breast cancer proliferation through mTOR/4E-BP1 dependent mRNA translation.

Portion of Chapter 1 and Chapter 5 are published as:

Murooka, T.T., Ward, S.E., and Fish, E.N. (2005). Chemokines and cancer. Cancer Treat Res 126, 15-44.

Galligan C.L., Murooka, T.T., Rahbar, R., Baig, E., Majchrzak-Kita, B., and Fish, E.N. (2006). Interferons and viruses: signalling for supremacy. Immunol Res 35, 27-40.

205

References

Adler, E. P., Lemken, C. A., Katchen, N. S., and Kurt, R. A. (2003). A dual role for tumor-derived chemokine RANTES (CCL5). Immunol Lett 90, 187-194.

Ajuebor, M. N., Aspinall, A. I., Zhou, F., Le, T., Yang, Y., Urbanski, S. J., Sidobre, S., Kronenberg, M., Hogaboam, C. M., and Swain, M. G. (2005). Lack of Chemokine Receptor CCR5 Promotes Murine Fulminant Liver Failure by Preventing the Apoptosis of Activated CD1d-Restricted NKT Cells. J Immunol 174, 8027-8037.

Akira, S., Takeda, K., and Kaisho, T. (2001). Toll-like receptors: critical proteins linking innate and acquired immunity. Nat Immunol 2, 675-680.

Aldinucci, D., Lorenzon, D., Cattaruzza, L., Pinto, A., Gloghini, A., Carbone, A., and Colombatti, A. (2008). Expression of CCR5 receptors on Reed-Sternberg cells and Hodgkin lymphoma cell lines: involvement of CCL5/Rantes in tumor cell growth and microenvironmental interactions. Int J Cancer 122, 769-776.

Algeciras-Schimnich, A., Vlahakis, S. R., Villasis-Keever, A., Gomez, T., Heppelmann, C. J., Bou, G., and Paya, C. V. (2002). CCR5 mediates Fas- and caspase-8 dependent apoptosis of both uninfected and HIV infected primary human CD4 T cells. Aids 16, 1467-1478.

Ali, S., Palmer, A. C., Banerjee, B., Fritchley, S. J., and Kirby, J. A. (2000). Examination of the function of RANTES, MIP-1alpha, and MIP-1beta following interaction with heparin-like glycosaminoglycans. J Biol Chem 275, 11721-11727.

Aliberti, J., Reis e Sousa, C., Schito, M., Hieny, S., Wells, T., Huffnagle, G. B., and Sher, A. (2000). CCR5 provides a signal for microbial induced production of IL-12 by CD8 alpha+ dendritic cells. Nat Immunol 1, 83-87.

206

Alon, R., Kassner, P. D., Carr, M. W., Finger, E. B., Hemler, M. E., and Springer, T. A. (1995). The integrin VLA-4 supports tethering and rolling in flow on VCAM-1. J Cell Biol 128, 1243-1253.

Amano, M., Chihara, K., Kimura, K., Fukata, Y., Nakamura, N., Matsuura, Y., and Kaibuchi, K. (1997). Formation of actin stress fibers and focal adhesions enhanced by Rho-kinase. Science 275, 1308-1311.

Amano, M., Ito, M., Kimura, K., Fukata, Y., Chihara, K., Nakano, T., Matsuura, Y., and Kaibuchi, K. (1996). Phosphorylation and activation of myosin by Rho-associated kinase (Rho-kinase). J Biol Chem 271, 20246-20249.

Amara, A., Lorthioir, O., Valenzuela, A., Magerus, A., Thelen, M., Montes, M., Virelizier, J. L., Delepierre, M., Baleux, F., Lortat-Jacob, H., and Arenzana-Seisdedos, F. (1999). Stromal cell-derived factor-1alpha associates with heparan sulfates through the first beta-strand of the chemokine. J Biol Chem 274, 23916-23925.

Angiolillo, A. L., Sgadari, C., Taub, D. D., Liao, F., Farber, J. M., Maheshwari, S., Kleinman, H. K., Reaman, G. H., and Tosato, G. (1995). Human interferon-inducible protein 10 is a potent inhibitor of angiogenesis in vivo. J Exp Med 182, 155-162.

Ansel, K. M., Ngo, V. N., Hyman, P. L., Luther, S. A., Forster, R., Sedgwick, J. D., Browning, J. L., Lipp, M., and Cyster, J. G. (2000). A chemokine-driven positive feedback loop organizes lymphoid follicles. Nature 406, 309-314.

Appay, V., Brown, A., Cribbes, S., Randle, E., and Czaplewski, L. G. (1999). Aggregation of RANTES is responsible for its inflammatory properties. Characterization of nonaggregating, noninflammatory RANTES mutants. J Biol Chem 274, 27505-27512.

207

Appay, V., Dunbar, P. R., Cerundolo, V., McMichael, A., Czaplewski, L., and Rowland- Jones, S. (2000). RANTES activates antigen-specific cytotoxic T lymphocytes in a mitogen-like manner through cell surface aggregation. Int Immunol 12, 1173-1182. Appay, V., and Rowland-Jones, S. L. (2001). RANTES: a versatile and controversial chemokine. Trends Immunol 22, 83-87.

Arenberg, D. A., Kunkel, S. L., Polverini, P. J., Glass, M., Burdick, M. D., and Strieter, R. M. (1996). Inhibition of interleukin-8 reduces tumorigenesis of human non-small cell lung cancer in SCID mice. J Clin Invest 97, 2792-2802.

Armengol, G., Rojo, F., Castellvi, J., Iglesias, C., Cuatrecasas, M., Pons, B., Baselga, J., and Ramon y Cajal, S. (2007). 4E-binding protein 1: a key molecular "funnel factor" in human cancer with clinical implications. Cancer Res 67, 7551-7555.

Arvanitakis, L., Geras-Raaka, E., Varma, A., Gershengorn, M. C., and Cesarman, E. (1997). Human herpesvirus KSHV encodes a constitutively active G-protein-coupled receptor linked to cell proliferation. Nature 385, 347-350.

Averous, J., Fonseca, B. D., and Proud, C. G. (2008). Regulation of cyclin D1 expression by mTORC1 signaling requires eukaryotic initiation factor 4E-binding protein 1. Oncogene 27, 1106-1113.

Azenshtein, E., Luboshits, G., Shina, S., Neumark, E., Shahbazian, D., Weil, M., Wigler, N., Keydar, I., and Ben-Baruch, A. (2002). The CC chemokine RANTES in breast carcinoma progression: regulation of expression and potential mechanisms of promalignant activity. Cancer Res 62, 1093-1102.

Babcock, G. J., Farzan, M., and Sodroski, J. (2003). Ligand-independent dimerization of CXCR4, a principal HIV-1 coreceptor. J Biol Chem 278, 3378-3385.

208

Bacon, K., Baggiolini, M., Broxmeyer, H., Horuk, R., Lindley, I., Mantovani, A., Maysushima, K., Murphy, P., Nomiyama, H., Oppenheim, J., et al. (2002). Chemokine/chemokine receptor nomenclature. J Interferon Cytokine Res 22, 1067-1068. Bacon, K. B., Premack, B. A., Gardner, P., and Schall, T. J. (1995). Activation of dual T cell signaling pathways by the chemokine RANTES. Science 269, 1727-1730.

Bacon, K. B., Schall, T. J., and Dairaghi, D. J. (1998). RANTES activation of phospholipase D in Jurkat T cells: requirement of GTP-binding proteins ARF and RhoA. J Immunol 160, 1894-1900.

Bacon, K. B., Szabo, M. C., Yssel, H., Bolen, J. B., and Schall, T. J. (1996). RANTES induces tyrosine kinase activity of stably complexed p125FAK and ZAP-70 in human T cells. J Exp Med 184, 873-882.

Bai, A., Hu, H., Yeung, M., and Chen, J. (2007). Kruppel-like factor 2 controls T cell trafficking by activating L-selectin (CD62L) and sphingosine-1-phosphate receptor 1 transcription. J Immunol 178, 7632-7639.

Bais, C., Santomasso, B., Coso, O., Arvanitakis, L., Raaka, E. G., Gutkind, J. S., Asch, A. S., Cesarman, E., Gershengorn, M. C., Mesri, E. A., and Gerhengorn, M. C. (1998). G- protein-coupled receptor of Kaposi's sarcoma-associated herpesvirus is a viral oncogene and angiogenesis activator. Nature 391, 86-89.

Bajetto, A., Barbero, S., Bonavia, R., Piccioli, P., Pirani, P., Florio, T., and Schettini, G. (2001). Stromal cell-derived factor-1alpha induces astrocyte proliferation through the activation of extracellular signal-regulated kinases 1/2 pathway. J Neurochem 77, 1226- 1236.

Baldwin, E. T., Weber, I. T., St Charles, R., Xuan, J. C., Appella, E., Yamada, M., Matsushima, K., Edwards, B. F., Clore, G. M., Gronenborn, A. M., and et al. (1991).

209

Crystal structure of interleukin 8: symbiosis of NMR and crystallography. Proc Natl Acad Sci U S A 88, 502-506. Baltus, T., Weber, K. S., Johnson, Z., Proudfoot, A. E., and Weber, C. (2003). Oligomerization of RANTES is required for CCR1-mediated arrest but not CCR5- mediated transmigration of leukocytes on inflamed endothelium. Blood 102, 1985-1988.

Barbero, S., Bonavia, R., Bajetto, A., Porcile, C., Pirani, P., Ravetti, J. L., Zona, G. L., Spaziante, R., Florio, T., and Schettini, G. (2003). Stromal cell-derived factor 1alpha stimulates human glioblastoma cell growth through the activation of both extracellular signal-regulated kinases 1/2 and Akt. Cancer Res 63, 1969-1974.

Barbieri, F., Bajetto, A., Porcile, C., Pattarozzi, A., Massa, A., Lunardi, G., Zona, G., Dorcaratto, A., Ravetti, J. L., Spaziante, R., et al. (2006). CXC receptor and chemokine expression in human meningioma: SDF1/CXCR4 signaling activates ERK1/2 and stimulates meningioma cell proliferation. Ann N Y Acad Sci 1090, 332-343.

Barnes, D. A., Tse, J., Kaufhold, M., Owen, M., Hesselgesser, J., Strieter, R., Horuk, R., and Perez, H. D. (1998). Polyclonal antibody directed against human RANTES ameliorates disease in the Lewis rat adjuvant-induced arthritis model. J Clin Invest 101, 2910-2919.

Barretina, J., Junca, J., Llano, A., Gutierrez, A., Flores, A., Blanco, J., Clotet, B., and Este, J. A. (2003). CXCR4 and SDF-1 expression in B-cell chronic lymphocytic leukemia and stage of the disease. Ann Hematol 82, 500-505.

Barsante, M. M., Cunha, T. M., Allegretti, M., Cattani, F., Policani, F., Bizzarri, C., Tafuri, W. L., Poole, S., Cunha, F. Q., Bertini, R., and Teixeira, M. M. (2008). Blockade of the chemokine receptor CXCR2 ameliorates adjuvant-induced arthritis in rats. Br J Pharmacol 153, 992-1002.

210

Bauer, D. E., Harris, M. H., Plas, D. R., Lum, J. J., Hammerman, P. S., Rathmell, J. C., Riley, J. L., and Thompson, C. B. (2004). Cytokine stimulation of aerobic glycolysis in hematopoietic cells exceeds proliferative demand. Faseb J 18, 1303-1305. Belperio, J. A., Keane, M. P., Arenberg, D. A., Addison, C. L., Ehlert, J. E., Burdick, M. D., and Strieter, R. M. (2000). CXC chemokines in angiogenesis. J Leukoc Biol 68, 1-8.

Beretta, L., Gingras, A. C., Svitkin, Y. V., Hall, M. N., and Sonenberg, N. (1996). Rapamycin blocks the phosphorylation of 4E-BP1 and inhibits cap-dependent initiation of translation. Embo J 15, 658-664.

Berger, E. A., Murphy, P. M., and Farber, J. M. (1999). Chemokine receptors as HIV-1 coreceptors: roles in viral entry, tropism, and disease. Annu Rev Immunol 17, 657-700.

Bieche, I., Lerebours, F., Tozlu, S., Espie, M., Marty, M., and Lidereau, R. (2004). Molecular profiling of inflammatory breast cancer: identification of a poor-prognosis gene expression signature. Clin Cancer Res 10, 6789-6795.

Blanpain, C., Doranz, B. J., Bondue, A., Govaerts, C., De Leener, A., Vassart, G., Doms, R. W., Proudfoot, A., and Parmentier, M. (2003). The core domain of chemokines binds CCR5 extracellular domains while their amino terminus interacts with the transmembrane helix bundle. J Biol Chem 278, 5179-5187.

Blanpain, C., Doranz, B. J., Vakili, J., Rucker, J., Govaerts, C., Baik, S. S., Lorthioir, O., Migeotte, I., Libert, F., Baleux, F., et al. (1999a). Multiple charged and aromatic residues in CCR5 amino-terminal domain are involved in high affinity binding of both chemokines and HIV-1 Env protein. J Biol Chem 274, 34719-34727.

Blanpain, C., Lee, B., Tackoen, M., Puffer, B., Boom, A., Libert, F., Sharron, M., Wittamer, V., Vassart, G., Doms, R. W., and Parmentier, M. (2000). Multiple nonfunctional alleles of CCR5 are frequent in various human populations. Blood 96, 1638-1645.

211

Blanpain, C., Lee, B., Vakili, J., Doranz, B. J., Govaerts, C., Migeotte, I., Sharron, M., Dupriez, V., Vassart, G., Doms, R. W., and Parmentier, M. (1999b). Extracellular cysteines of CCR5 are required for chemokine binding, but dispensable for HIV-1 coreceptor activity. J Biol Chem 274, 18902-18908.

Blanpain, C., Migeotte, I., Lee, B., Vakili, J., Doranz, B. J., Govaerts, C., Vassart, G., Doms, R. W., and Parmentier, M. (1999c). CCR5 binds multiple CC-chemokines: MCP-3 acts as a natural antagonist. Blood 94, 1899-1905.

Blanpain, C., Vanderwinden, J. M., Cihak, J., Wittamer, V., Le Poul, E., Issafras, H., Stangassinger, M., Vassart, G., Marullo, S., Schlndorff, D., et al. (2002). Multiple active states and oligomerization of CCR5 revealed by functional properties of monoclonal antibodies. Mol Biol Cell 13, 723-737.

Blanpain, C., Wittamer, V., Vanderwinden, J. M., Boom, A., Renneboog, B., Lee, B., Le Poul, E., El Asmar, L., Govaerts, C., Vassart, G., et al. (2001). Palmitoylation of CCR5 is critical for receptor trafficking and efficient activation of intracellular signaling pathways. J Biol Chem 276, 23795-23804.

Boehme, S. A., Lio, F. M., Maciejewski-Lenoir, D., Bacon, K. B., and Conlon, P. J. (2000). The chemokine fractalkine inhibits Fas-mediated cell death of brain microglia. J Immunol 165, 397-403.

Bottazzi, B., Colotta, F., Sica, A., Nobili, N., and Mantovani, A. (1990). A chemoattractant expressed in human sarcoma cells (tumor-derived chemotactic factor, TDCF) is identical to monocyte chemoattractant protein-1/monocyte chemotactic and activating factor (MCP-1/MCAF). Int J Cancer 45, 795-797.

212

Bottazzi, B., Polentarutti, N., Acero, R., Balsari, A., Boraschi, D., Ghezzi, P., Salmona, M., and Mantovani, A. (1983). Regulation of the macrophage content of neoplasms by chemoattractants. Science 220, 210-212.

Brazil, D. P., Park, J., and Hemmings, B. A. (2002). PKB binding proteins. Getting in on the Akt. Cell 111, 293-303.

Brill, A., Hershkoviz, R., Vaday, G. G., Chowers, Y., and Lider, O. (2001). Augmentation of RANTES-induced extracellular signal-regulated kinase mediated signaling and T cell adhesion by elastase-treated fibronectin. J Immunol 166, 7121-7127.

Brunn, G. J., Hudson, C. C., Sekulic, A., Williams, J. M., Hosoi, H., Houghton, P. J., Lawrence, J. C., Jr., and Abraham, R. T. (1997). Phosphorylation of the translational repressor PHAS-I by the mammalian target of rapamycin. Science 277, 99-101.

Burnett, P. E., Barrow, R. K., Cohen, N. A., Snyder, S. H., and Sabatini, D. M. (1998). RAFT1 phosphorylation of the translational regulators p70 S6 kinase and 4E-BP1. Proc Natl Acad Sci U S A 95, 1432-1437.

Burns, J. M., Gallo, R. C., DeVico, A. L., and Lewis, G. K. (1998). A new monoclonal antibody, mAb 4A12, identifies a role for the glycosaminoglycan (GAG) binding domain of RANTES in the antiviral effect against HIV-1 and intracellular Ca2+ signaling. J Exp Med 188, 1917-1927.

Campbell, D. J., Kim, C. H., and Butcher, E. C. (2003). Chemokines in the systemic organization of immunity. Immunol Rev 195, 58-71.

Carlson, C. M., Endrizzi, B. T., Wu, J., Ding, X., Weinreich, M. A., Walsh, E. R., Wani, M. A., Lingrel, J. B., Hogquist, K. A., and Jameson, S. C. (2006). Kruppel-like factor 2 regulates thymocyte and T-cell migration. Nature 442, 299-302.

213

Cartier, L., Dubois-Dauphin, M., Hartley, O., Irminger-Finger, I., and Krause, K. H. (2003). Chemokine-induced cell death in CCR5-expressing neuroblastoma cells. J Neuroimmunol 145, 27-39.

Cerdan, C., Devilard, E., Xerri, L., and Olive, D. (2001). The C-class chemokine lymphotactin costimulates the apoptosis of human CD4(+) T cells. Blood 97, 2205-2212.

Chabot, V., Reverdiau, P., Iochmann, S., Rico, A., Senecal, D., Goupille, C., Sizaret, P. Y., and Sensebe, L. (2006). CCL5-enhanced human immature dendritic cell migration through the basement membrane in vitro depends on matrix metalloproteinase-9. J Leukoc Biol 79, 767-778.

Chakravarty, L., Rogers, L., Quach, T., Breckenridge, S., and Kolattukudy, P. E. (1998). Lysine 58 and histidine 66 at the C-terminal alpha-helix of monocyte chemoattractant protein-1 are essential for glycosaminoglycan binding. J Biol Chem 273, 29641-29647.

Chan, C. C., Shen, D., Hackett, J. J., Buggage, R. R., and Tuaillon, N. (2003). Expression of chemokine receptors, CXCR4 and CXCR5, and chemokines, BLC and SDF-1, in the eyes of patients with primary intraocular lymphoma. Ophthalmology 110, 421-426.

Chang, T. L., Gordon, C. J., Roscic-Mrkic, B., Power, C., Proudfoot, A. E., Moore, J. P., and Trkola, A. (2002). Interaction of the CC-chemokine RANTES with glycosaminoglycans activates a p44/p42 mitogen-activated protein kinase-dependent signaling pathway and enhances human immunodeficiency virus type 1 infectivity. J Virol 76, 2245-2254.

Chen, C., Li, J., Bot, G., Szabo, I., Rogers, T. J., and Liu-Chen, L. Y. (2004). Heterodimerization and cross-desensitization between the mu-opioid receptor and the chemokine CCR5 receptor. Eur J Pharmacol 483, 175-186.

214

Choe, H., Farzan, M., Sun, Y., Sullivan, N., Rollins, B., Ponath, P. D., Wu, L., Mackay, C. R., LaRosa, G., Newman, W., et al. (1996). The beta-chemokine receptors CCR3 and CCR5 facilitate infection by primary HIV-1 isolates. Cell 85, 1135-1148.

Chouaib, S., Asselin-Paturel, C., Mami-Chouaib, F., Caignard, A., and Blay, J. Y. (1997). The host-tumor immune conflict: from immunosuppression to resistance and destruction. Immunol Today 18, 493-497.

Christofk, H. R., Vander Heiden, M. G., Harris, M. H., Ramanathan, A., Gerszten, R. E., Wei, R., Fleming, M. D., Schreiber, S. L., and Cantley, L. C. (2008a). The M2 splice isoform of pyruvate kinase is important for cancer metabolism and tumour growth. Nature 452, 230-233.

Christofk, H. R., Vander Heiden, M. G., Wu, N., Asara, J. M., and Cantley, L. C. (2008b). Pyruvate kinase M2 is a phosphotyrosine-binding protein. Nature 452, 181-186.

Cinamon, G., Grabovsky, V., Winter, E., Franitza, S., Feigelson, S., Shamri, R., Dwir, O., and Alon, R. (2001). Novel chemokine functions in lymphocyte migration through vascular endothelium under shear flow. J Leukoc Biol 69, 860-866.

Cocchi, F., DeVico, A. L., Garzino-Demo, A., Arya, S. K., Gallo, R. C., and Lusso, P. (1995). Identification of RANTES, MIP-1 alpha, and MIP-1 beta as the major HIV- suppressive factors produced by CD8+ T cells. Science 270, 1811-1815.

Colamussi, M. L., Secchiero, P., Gonelli, A., Marchisio, M., Zauli, G., and Capitani, S. (2001). Stromal derived factor-1 alpha (SDF-1 alpha) induces CD4+ T cell apoptosis via the functional up-regulation of the Fas (CD95)/Fas ligand (CD95L) pathway. J Leukoc Biol 69, 263-270.

215

Collette, Y., Benziane, A., Razanajaona, D., and Olive, D. (1998). Distinct regulation of T-cell death by CD28 depending on both its aggregation and T-cell receptor triggering: a role for Fas-FasL. Blood 92, 1350-1363.

Combadiere, C., Ahuja, S. K., Tiffany, H. L., and Murphy, P. M. (1996). Cloning and functional expression of CC CKR5, a human monocyte CC chemokine receptor selective for MIP-1(alpha), MIP-1(beta), and RANTES. J Leukoc Biol 60, 147-152.

Comerford, I., Litchfield, W., Harata-Lee, Y., Nibbs, R. J., and McColl, S. R. (2007). Regulation of chemotactic networks by 'atypical' receptors. Bioessays 29, 237-247.

Comerford, I., Milasta, S., Morrow, V., Milligan, G., and Nibbs, R. (2006). The chemokine receptor CCX-CKR mediates effective scavenging of CCL19 in vitro. Eur J Immunol 36, 1904-1916.

Cooke, S. P., Forrest, G., Venables, P. J., and Hajeer, A. (1998). The delta32 deletion of CCR5 receptor in rheumatoid arthritis. Arthritis Rheum 41, 1135-1136.

Cory, G. O., Cramer, R., Blanchoin, L., and Ridley, A. J. (2003). Phosphorylation of the WASP-VCA domain increases its affinity for the Arp2/3 complex and enhances actin polymerization by WASP. Mol Cell 11, 1229-1239.

Creagh, E. M., Conroy, H., and Martin, S. J. (2003). Caspase-activation pathways in apoptosis and immunity. Immunol Rev 193, 10-21.

Crump, M. P., Gong, J. H., Loetscher, P., Rajarathnam, K., Amara, A., Arenzana- Seisdedos, F., Virelizier, J. L., Baggiolini, M., Sykes, B. D., and Clark-Lewis, I. (1997). Solution structure and basis for functional activity of stromal cell-derived factor-1; dissociation of CXCR4 activation from binding and inhibition of HIV-1. Embo J 16, 6996-7007.

216

Curnock, A. P., Sotsios, Y., Wright, K. L., and Ward, S. G. (2003). Optimal chemotactic responses of leukemic T cells to stromal cell-derived factor-1 requires the activation of both class IA and IB phosphoinositide 3-kinases. J Immunol 170, 4021-4030. Curnock, A. P., and Ward, S. G. (2003). Development and characterisation of tetracycline-regulated phosphoinositide 3-kinase mutants: assessing the role of multiple phosphoinositide 3-kinases in chemokine signaling. J Immunol Methods 273, 29-41.

Cyster, J. G. (2005). Chemokines, sphingosine-1-phosphate, and cell migration in secondary lymphoid organs. Annu Rev Immunol 23, 127-159.

Czaplewski, L. G., McKeating, J., Craven, C. J., Higgins, L. D., Appay, V., Brown, A., Dudgeon, T., Howard, L. A., Meyers, T., Owen, J., et al. (1999). Identification of amino acid residues critical for aggregation of human CC chemokines macrophage inflammatory protein (MIP)-1alpha, MIP-1beta, and RANTES. Characterization of active disaggregated chemokine variants. J Biol Chem 274, 16077-16084.

Dairaghi, D. J., Soo, K. S., Oldham, E. R., Premack, B. A., Kitamura, T., Bacon, K. B., and Schall, T. J. (1998). RANTES-induced T cell activation correlates with CD3 expression. J Immunol 160, 426-433.

Daniel, C., Pippin, J., Shankland, S. J., and Hugo, C. (2004). The rapamycin derivative RAD inhibits mesangial cell migration through the CDK-inhibitor p27KIP1. Lab Invest 84, 588-596.

Dann, S. G., Selvaraj, A., and Thomas, G. (2007). mTOR Complex1-S6K1 signaling: at the crossroads of obesity, diabetes and cancer. Trends Mol Med 13, 252-259.

Darnell, J. E., Jr. (1998). Studies of IFN-induced transcriptional activation uncover the Jak-Stat pathway. J Interferon Cytokine Res 18, 549-554.

217

Dawson, T. C., Lentsch, A. B., Wang, Z., Cowhig, J. E., Rot, A., Maeda, N., and Peiper, S. C. (2000). Exaggerated response to endotoxin in mice lacking the Duffy antigen/receptor for chemokines (DARC). Blood 96, 1681-1684.

De Benedetti, A., and Graff, J. R. (2004). eIF-4E expression and its role in malignancies and metastases. Oncogene 23, 3189-3199. de Brevern, A. G., Wong, H., Tournamille, C., Colin, Y., Le Van Kim, C., and Etchebest, C. (2005). A structural model of a seven-transmembrane helix receptor: the Duffy antigen/receptor for chemokine (DARC). Biochim Biophys Acta 1724, 288-306.

Dean, M., Carrington, M., Winkler, C., Huttley, G. A., Smith, M. W., Allikmets, R., Goedert, J. J., Buchbinder, S. P., Vittinghoff, E., Gomperts, E., et al. (1996). Genetic restriction of HIV-1 infection and progression to AIDS by a deletion allele of the CKR5 structural gene. Hemophilia Growth and Development Study, Multicenter AIDS Cohort Study, Multicenter Hemophilia Cohort Study, San Francisco City Cohort, ALIVE Study. Science 273, 1856-1862.

Devadas, S., Das, J., Liu, C., Zhang, L., Roberts, A. I., Pan, Z., Moore, P. A., Das, G., and Shi, Y. (2006). Granzyme B is critical for T cell receptor-induced cell death of type 2 helper T cells. Immunity 25, 237-247.

Dieu, M. C., Vanbervliet, B., Vicari, A., Bridon, J. M., Oldham, E., Ait-Yahia, S., Briere, F., Zlotnik, A., Lebecque, S., and Caux, C. (1998). Selective recruitment of immature and mature dendritic cells by distinct chemokines expressed in different anatomic sites. J Exp Med 188, 373-386.

Ding, Y., Shimada, Y., Maeda, M., Kawabe, A., Kaganoi, J., Komoto, I., Hashimoto, Y., Miyake, M., Hashida, H., and Imamura, M. (2003). Association of CC chemokine receptor 7 with lymph node metastasis of esophageal squamous cell carcinoma. Clin Cancer Res 9, 3406-3412.

218

Dong, H. F., Wigmore, K., Carrington, M. N., Dean, M., Turpin, J. A., and Howard, O. M. (2005). Variants of CCR5, which are permissive for HIV-1 infection, show distinct functional responses to CCL3, CCL4 and CCL5. Genes Immun. Doranz, B. J., Rucker, J., Yi, Y., Smyth, R. J., Samson, M., Peiper, S. C., Parmentier, M., Collman, R. G., and Doms, R. W. (1996). A dual-tropic primary HIV-1 isolate that uses fusin and the beta-chemokine receptors CKR-5, CKR-3, and CKR-2b as fusion cofactors. Cell 85, 1149-1158.

Edinger, A. L., Cinalli, R. M., and Thompson, C. B. (2003a). Rab7 prevents growth factor-independent survival by inhibiting cell-autonomous nutrient transporter expression. Dev Cell 5, 571-582.

Edinger, A. L., Linardic, C. M., Chiang, G. G., Thompson, C. B., and Abraham, R. T. (2003b). Differential effects of rapamycin on mammalian target of rapamycin signaling functions in mammalian cells. Cancer Res 63, 8451-8460.

Edinger, A. L., and Thompson, C. B. (2002). Akt maintains cell size and survival by increasing mTOR-dependent nutrient uptake. Mol Biol Cell 13, 2276-2288.

El-Asmar, L., Springael, J. Y., Ballet, S., Andrieu, E. U., Vassart, G., and Parmentier, M. (2005). Evidence for negative binding cooperativity within CCR5-CCR2b heterodimers. Mol Pharmacol 67, 460-469.

Elstrom, R. L., Bauer, D. E., Buzzai, M., Karnauskas, R., Harris, M. H., Plas, D. R., Zhuang, H., Cinalli, R. M., Alavi, A., Rudin, C. M., and Thompson, C. B. (2004). Akt stimulates aerobic glycolysis in cancer cells. Cancer Res 64, 3892-3899.

Falasca, M., and Maffucci, T. (2007). Role of class II phosphoinositide 3-kinase in cell signalling. Biochem Soc Trans 35, 211-214.

219

Fang, Y., Vilella-Bach, M., Bachmann, R., Flanigan, A., and Chen, J. (2001). Phosphatidic acid-mediated mitogenic activation of mTOR signaling. Science 294, 1942- 1945. Feng, J., Park, J., Cron, P., Hess, D., and Hemmings, B. A. (2004). Identification of a PKB/Akt hydrophobic motif Ser-473 kinase as DNA-dependent protein kinase. J Biol Chem 279, 41189-41196.

Finlay, B. B., and McFadden, G. (2006). Anti-immunology: evasion of the host immune system by bacterial and viral pathogens. Cell 124, 767-782.

Floridi, F., Trettel, F., Di Bartolomeo, S., Ciotti, M. T., and Limatola, C. (2003). Signalling pathways involved in the chemotactic activity of CXCL12 in cultured rat cerebellar neurons and CHP100 neuroepithelioma cells. J Neuroimmunol 135, 38-46.

Florio, T., Casagrande, S., Diana, F., Bajetto, A., Porcile, C., Zona, G., Thellung, S., Arena, S., Pattarozzi, A., Corsaro, A., et al. (2006). Chemokine stromal cell-derived factor 1alpha induces proliferation and growth hormone release in GH4C1 rat pituitary adenoma cell line through multiple intracellular signals. Mol Pharmacol 69, 539-546.

Foster, D. A. (2007). Regulation of mTOR by phosphatidic acid? Cancer Res 67, 1-4.

Fox, C. J., Hammerman, P. S., and Thompson, C. B. (2005). Fuel feeds function: energy metabolism and the T-cell response. Nat Rev Immunol 5, 844-852.

Fox, J. A., Ung, K., Tanlimco, S. G., and Jirik, F. R. (2002). Disruption of a single Pten allele augments the chemotactic response of B lymphocytes to stromal cell-derived factor-1. J Immunol 169, 49-54.

Fraile-Ramos, A., Kohout, T. A., Waldhoer, M., and Marsh, M. (2003). Endocytosis of the viral chemokine receptor US28 does not require beta-arrestins but is dependent on the clathrin-mediated pathway. Traffic 4, 243-253.

220

Frauwirth, K. A., Riley, J. L., Harris, M. H., Parry, R. V., Rathmell, J. C., Plas, D. R., Elstrom, R. L., June, C. H., and Thompson, C. B. (2002). The CD28 signaling pathway regulates glucose metabolism. Immunity 16, 769-777.

Frederick, M. J., and Clayman, G. L. (2001). Chemokines in cancer. Expert Rev Mol Med 2001, 1-18.

Fu, X. Y. (1992). A transcription factor with SH2 and SH3 domains is directly activated by an interferon alpha-induced cytoplasmic protein tyrosine kinase(s). Cell 70, 323-335.

Furci, L., Scarlatti, G., Burastero, S., Tambussi, G., Colognesi, C., Quillent, C., Longhi, R., Loverro, P., Borgonovo, B., Gaffi, D., et al. (1997). Antigen-driven C-C chemokine- mediated HIV-1 suppression by CD4(+) T cells from exposed uninfected individuals expressing the wild-type CCR-5 allele. J Exp Med 186, 455-460.

Gangloff, Y. G., Mueller, M., Dann, S. G., Svoboda, P., Sticker, M., Spetz, J. F., Um, S. H., Brown, E. J., Cereghini, S., Thomas, G., and Kozma, S. C. (2004). Disruption of the mouse mTOR gene leads to early postimplantation lethality and prohibits embryonic stem cell development. Mol Cell Biol 24, 9508-9516.

Ganju, R. K., Brubaker, S. A., Chernock, R. D., Avraham, S., and Groopman, J. E. (2000). Beta-chemokine receptor CCR5 signals through SHP1, SHP2, and Syk. J Biol Chem 275, 17263-17268.

Ganju, R. K., Dutt, P., Wu, L., Newman, W., Avraham, H., Avraham, S., and Groopman, J. E. (1998). Beta-chemokine receptor CCR5 signals via the novel tyrosine kinase RAFTK. Blood 91, 791-797.

Gao, N., Flynn, D. C., Zhang, Z., Zhong, X. S., Walker, V., Liu, K. J., Shi, X., and Jiang, B. H. (2004). G1 cell cycle progression and the expression of G1 cyclins are regulated by

221

PI3K/AKT/mTOR/p70S6K1 signaling in human ovarian cancer cells. Am J Physiol Cell Physiol 287, C281-291.

Gao, X., Zhang, Y., Arrazola, P., Hino, O., Kobayashi, T., Yeung, R. S., Ru, B., and Pan, D. (2002). Tsc tumour suppressor proteins antagonize amino-acid-TOR signalling. Nat Cell Biol 4, 699-704.

Garred, P., Madsen, H. O., Petersen, J., Marquart, H., Hansen, T. M., Freiesleben Sorensen, S., Volck, B., Svejgaard, A., and Andersen, V. (1998). CC chemokine receptor 5 polymorphism in rheumatoid arthritis. J Rheumatol 25, 1462-1465.

Gerard, C., and Rollins, B. J. (2001). Chemokines and disease. Nat Immunol 2, 108-115. Giannone, G., and Sheetz, M. P. (2006). Substrate rigidity and force define form through tyrosine phosphatase and kinase pathways. Trends Cell Biol 16, 213-223.

Gingras, A. C., Kennedy, S. G., O'Leary, M. A., Sonenberg, N., and Hay, N. (1998). 4E- BP1, a repressor of mRNA translation, is phosphorylated and inactivated by the Akt(PKB) signaling pathway. Genes Dev 12, 502-513.

Gingras, A. C., Raught, B., and Sonenberg, N. (2004). mTOR signaling to translation. Curr Top Microbiol Immunol 279, 169-197.

Gomez-Cambronero, J. (2003). Rapamycin inhibits GM-CSF-induced neutrophil migration. FEBS Lett 550, 94-100.

Gomez-Mouton, C., Lacalle, R. A., Mira, E., Jimenez-Baranda, S., Barber, D. F., Carrera, A. C., Martinez, A. C., and Manes, S. (2004). Dynamic redistribution of raft domains as an organizing platform for signaling during cell chemotaxis. J Cell Biol 164, 759-768.

222

Gomez-Reino, J. J., Pablos, J. L., Carreira, P. E., Santiago, B., Serrano, L., Vicario, J. L., Balsa, A., Figueroa, M., and de Juan, M. D. (1999). Association of rheumatoid arthritis with a functional chemokine receptor, CCR5. Arthritis Rheum 42, 989-992. Gong, J. H., and Clark-Lewis, I. (1995). Antagonists of monocyte chemoattractant protein 1 identified by modification of functionally critical NH2-terminal residues. J Exp Med 181, 631-640.

Gong, J. H., Ratkay, L. G., Waterfield, J. D., and Clark-Lewis, I. (1997). An antagonist of monocyte chemoattractant protein 1 (MCP-1) inhibits arthritis in the MRL-lpr mouse model. J Exp Med 186, 131-137.

Gonzalez, E., Kulkarni, H., Bolivar, H., Mangano, A., Sanchez, R., Catano, G., Nibbs, R. J., Freedman, B. I., Quinones, M. P., Bamshad, M. J., et al. (2005). The influence of CCL3L1 gene-containing segmental duplications on HIV-1/AIDS susceptibility. Science 307, 1434-1440.

Gordon, C. J., Muesing, M. A., Proudfoot, A. E., Power, C. A., Moore, J. P., and Trkola, A. (1999). Enhancement of human immunodeficiency virus type 1 infection by the CC- chemokine RANTES is independent of the mechanism of virus-cell fusion. J Virol 73, 684-694.

Govaerts, C., Blanpain, C., Deupi, X., Ballet, S., Ballesteros, J. A., Wodak, S. J., Vassart, G., Pardo, L., and Parmentier, M. (2001). The TXP motif in the second transmembrane helix of CCR5. A structural determinant of chemokine-induced activation. J Biol Chem 276, 13217-13225.

Graff, J. R., Konicek, B. W., Carter, J. H., and Marcusson, E. G. (2008). Targeting the eukaryotic translation initiation factor 4E for cancer therapy. Cancer Res 68, 631-634.

Graff, J. R., Konicek, B. W., Vincent, T. M., Lynch, R. L., Monteith, D., Weir, S. N., Schwier, P., Capen, A., Goode, R. L., Dowless, M. S., et al. (2007). Therapeutic

223

suppression of translation initiation factor eIF4E expression reduces tumor growth without toxicity. J Clin Invest 117, 2638-2648.

Graff, J. R., and Zimmer, S. G. (2003). Translational control and metastatic progression: enhanced activity of the mRNA cap-binding protein eIF-4E selectively enhances translation of metastasis-related mRNAs. Clin Exp Metastasis 20, 265-273.

Green, D. R., Droin, N., and Pinkoski, M. (2003). Activation-induced cell death in T cells. Immunol Rev 193, 70-81.

Gross, J. D., Moerke, N. J., von der Haar, T., Lugovskoy, A. A., Sachs, A. B., McCarthy, J. E., and Wagner, G. (2003). Ribosome loading onto the mRNA cap is driven by conformational coupling between eIF4G and eIF4E. Cell 115, 739-750.

Gu, Y., Filippi, M. D., Cancelas, J. A., Siefring, J. E., Williams, E. P., Jasti, A. C., Harris, C. E., Lee, A. W., Prabhakar, R., Atkinson, S. J., et al. (2003). Hematopoietic cell regulation by Rac1 and Rac2 guanosine triphosphatases. Science 302, 445-449.

Guertin, D. A., and Sabatini, D. M. (2007). Defining the role of mTOR in cancer. Cancer Cell 12, 9-22.

Gunn, M. D., Kyuwa, S., Tam, C., Kakiuchi, T., Matsuzawa, A., Williams, L. T., and Nakano, H. (1999). Mice lacking expression of secondary lymphoid organ chemokine have defects in lymphocyte homing and dendritic cell localization. J Exp Med 189, 451- 460.

Gupta, S. K., Lysko, P. G., Pillarisetti, K., Ohlstein, E., and Stadel, J. M. (1998). Chemokine receptors in human endothelial cells. Functional expression of CXCR4 and its transcriptional regulation by inflammatory cytokines. J Biol Chem 273, 4282-4287.

224

Haghighat, A., Mader, S., Pause, A., and Sonenberg, N. (1995). Repression of cap- dependent translation by 4E-binding protein 1: competition with p220 for binding to eukaryotic initiation factor-4E. Embo J 14, 5701-5709. Haller, A. A., and Sarnow, P. (1997). In vitro selection of a 7-methyl-guanosine binding RNA that inhibits translation of capped mRNA molecules. Proc Natl Acad Sci U S A 94, 8521-8526.

Handel, T. M., and Domaille, P. J. (1996). Heteronuclear (1H, 13C, 15N) NMR assignments and solution structure of the monocyte chemoattractant protein-1 (MCP-1) dimer. Biochemistry 35, 6569-6584.

Hansell, C. A., Simpson, C. V., and Nibbs, R. J. (2006). Chemokine sequestration by atypical chemokine receptors. Biochem Soc Trans 34, 1009-1013.

Hardwick, J. S., Kuruvilla, F. G., Tong, J. K., Shamji, A. F., and Schreiber, S. L. (1999). Rapamycin-modulated transcription defines the subset of nutrient-sensitive signaling pathways directly controlled by the Tor proteins. Proc Natl Acad Sci U S A 96, 14866- 14870.

Haringman, J. J., Ludikhuize, J., and Tak, P. P. (2004). Chemokines in joint disease: the key to inflammation? Ann Rheum Dis 63, 1186-1194.

Hashimoto, I., Koizumi, K., Tatematsu, M., Minami, T., Cho, S., Takeno, N., Nakashima, A., Sakurai, H., Saito, S., Tsukada, K., and Saiki, I. (2008). Blocking on the CXCR4/mTOR signalling pathway induces the anti-metastatic properties and autophagic cell death in peritoneal disseminated gastric cancer cells. Eur J Cancer 44, 1022-1029.

Hay, N., and Sonenberg, N. (2004). Upstream and downstream of mTOR. Genes Dev 18, 1926-1945.

225

Helbig, G., Christopherson, K. W., 2nd, Bhat-Nakshatri, P., Kumar, S., Kishimoto, H., Miller, K. D., Broxmeyer, H. E., and Nakshatri, H. (2003). NF-kappaB promotes breast cancer cell migration and metastasis by inducing the expression of the chemokine receptor CXCR4. J Biol Chem 278, 21631-21638. Hereld, D., and Jin, T. (2008). Slamming the DOR on chemokine receptor signaling: heterodimerization silences ligand-occupied CXCR4 and delta-opioid receptors. Eur J Immunol 38, 334-337.

Hernanz-Falcon, P., Rodriguez-Frade, J. M., Serrano, A., Juan, D., del Sol, A., Soriano, S. F., Roncal, F., Gomez, L., Valencia, A., Martinez, A. C., and Mellado, M. (2004). Identification of amino acid residues crucial for chemokine receptor dimerization. Nat Immunol 5, 216-223.

Hileman, R. E., Fromm, J. R., Weiler, J. M., and Linhardt, R. J. (1998). Glycosaminoglycan-protein interactions: definition of consensus sites in glycosaminoglycan binding proteins. Bioessays 20, 156-167.

Hirsch, E., Katanaev, V. L., Garlanda, C., Azzolino, O., Pirola, L., Silengo, L., Sozzani, S., Mantovani, A., Altruda, F., and Wymann, M. P. (2000). Central role for G protein- coupled phosphoinositide 3-kinase gamma in inflammation. Science 287, 1049-1053.

Hong, N. A., Flannery, M., Hsieh, S. N., Cado, D., Pedersen, R., and Winoto, A. (2000). Mice lacking Dad1, the defender against apoptotic death-1, express abnormal N-linked glycoproteins and undergo increased embryonic apoptosis. Dev Biol 220, 76-84.

Honing, H., van den Berg, T. K., van der Pol, S. M., Dijkstra, C. D., van der Kammen, R. A., Collard, J. G., and de Vries, H. E. (2004). RhoA activation promotes transendothelial migration of monocytes via ROCK. J Leukoc Biol 75, 523-528.

226

Hoogewerf, A. J., Kuschert, G. S., Proudfoot, A. E., Borlat, F., Clark-Lewis, I., Power, C. A., and Wells, T. N. (1997). Glycosaminoglycans mediate cell surface oligomerization of chemokines. Biochemistry 36, 13570-13578.

Hornberger, T. A., Chu, W. K., Mak, Y. W., Hsiung, J. W., Huang, S. A., and Chien, S. (2006). The role of phospholipase D and phosphatidic acid in the mechanical activation of mTOR signaling in skeletal muscle. Proc Natl Acad Sci U S A 103, 4741-4746.

Horuk, R. (1999). Chemokine receptors and HIV-1: the fusion of two major research fields. Immunol Today 20, 89-94.

Horuk, R., Hesselgesser, J., Zhou, Y., Faulds, D., Halks-Miller, M., Harvey, S., Taub, D., Samson, M., Parmentier, M., Rucker, J., et al. (1998). The CC chemokine I-309 inhibits CCR8-dependent infection by diverse HIV-1 strains. J Biol Chem 273, 386-391.

Hosaka, S., Akahoshi, T., Wada, C., and Kondo, H. (1994). Expression of the chemokine superfamily in rheumatoid arthritis. Clin Exp Immunol 97, 451-457.

Hu, Y., and Ivashkiv, L. B. (2006). Costimulation of chemokine receptor signaling by matrix metalloproteinase-9 mediates enhanced migration of IFN-alpha dendritic cells. J Immunol 176, 6022-6033.

Huttenrauch, F., Nitzki, A., Lin, F. T., Honing, S., and Oppermann, M. (2002a). Beta- arrentin binding to CC chemokine receptor 5 requires multiple C-terminal receptor phosphorylation sites and involves a conserved Asp-Arg-Tyr sequence motif. J Biol Chem 277, 30769-30777.

Huttenrauch, F., Nitzki, A., Lin, F. T., Honing, S., and Oppermann, M. (2002b). Beta- arrestin binding to CC chemokine receptor 5 requires multiple C-terminal receptor phosphorylation sites and involves a conserved Asp-Arg-Tyr sequence motif. J Biol Chem 277, 30769-30777.

227

Hwang, J. H., Chung, H. K., Kim, D. W., Hwang, E. S., Suh, J. M., Kim, H., You, K. H., Kwon, O. Y., Ro, H. K., Jo, D. Y., and Shong, M. (2003). CXC chemokine receptor 4 expression and function in human anaplastic thyroid cancer cells. J Clin Endocrinol Metab 88, 408-416.

Hynes, R. O. (2002). Integrins: bidirectional, allosteric signaling machines. Cell 110, 673-687.

Inoki, K., Li, Y., Xu, T., and Guan, K. L. (2003). Rheb GTPase is a direct target of TSC2 GAP activity and regulates mTOR signaling. Genes Dev 17, 1829-1834.

Inoki, K., Li, Y., Zhu, T., Wu, J., and Guan, K. L. (2002). TSC2 is phosphorylated and inhibited by Akt and suppresses mTOR signalling. Nat Cell Biol 4, 648-657.

Issafras, H., Angers, S., Bulenger, S., Blanpain, C., Parmentier, M., Labbe-Jullie, C., Bouvier, M., and Marullo, S. (2002). Constitutive agonist-independent CCR5 oligomerization and antibody-mediated clustering occurring at physiological levels of receptors. J Biol Chem 277, 34666-34673.

Itoh, R. E., Kurokawa, K., Ohba, Y., Yoshizaki, H., Mochizuki, N., and Matsuda, M. (2002). Activation of rac and cdc42 video imaged by fluorescent resonance energy transfer-based single-molecule probes in the membrane of living cells. Mol Cell Biol 22, 6582-6591.

Jacinto, E., Loewith, R., Schmidt, A., Lin, S., Ruegg, M. A., Hall, A., and Hall, M. N. (2004). Mammalian TOR complex 2 controls the actin cytoskeleton and is rapamycin insensitive. Nat Cell Biol 6, 1122-1128.

Jackson, R. J. (2005). Alternative mechanisms of initiating translation of mammalian mRNAs. Biochem Soc Trans 33, 1231-1241.

228

Jamieson, T., Cook, D. N., Nibbs, R. J., Rot, A., Nixon, C., McLean, P., Alcami, A., Lira, S. A., Wiekowski, M., and Graham, G. J. (2005). The chemokine receptor D6 limits the inflammatory response in vivo. Nat Immunol 6, 403-411.

Jarnagin, K., Grunberger, D., Mulkins, M., Wong, B., Hemmerich, S., Paavola, C., Bloom, A., Bhakta, S., Diehl, F., Freedman, R., et al. (1999). Identification of surface residues of the monocyte chemotactic protein 1 that affect signaling through the receptor CCR2. Biochemistry 38, 16167-16177.

Jawaheer, D., Li, W., Graham, R. R., Chen, W., Damle, A., Xiao, X., Monteiro, J., Khalili, H., Lee, A., Lundsten, R., et al. (2002). Dissecting the genetic complexity of the association between human leukocyte antigens and rheumatoid arthritis. Am J Hum Genet 71, 585-594.

Jayasinghe, M. M., Golden, J. M., Nair, P., O'Donnell, C. M., Werner, M. T., and Kurt, R. A. (2008). Tumor-derived CCL5 does not contribute to breast cancer progression. Breast Cancer Res Treat 111, 511-521.

Jinquan, T., Jacobi, H. H., Jing, C., Millner, A., Sten, E., Hviid, L., Anting, L., Ryder, L. P., Glue, C., Skov, P. S., et al. (2003). CCR3 expression induced by IL-2 and IL-4 functioning as a death receptor for B cells. J Immunol 171, 1722-1731.

John, S., Smith, S., Morrison, J. F., Symmons, D., Worthington, J., Silman, A., and Barton, A. (2003). Genetic variation in CCR5 does not predict clinical outcome in inflammatory arthritis. Arthritis Rheum 48, 3615-3616.

Johnson, Z., Kosco-Vilbois, M. H., Herren, S., Cirillo, R., Muzio, V., Zaratin, P., Carbonatto, M., Mack, M., Smailbegovic, A., Rose, M., et al. (2004). Interference with heparin binding and oligomerization creates a novel anti-inflammatory strategy targeting the chemokine system. J Immunol 173, 5776-5785.

229

Johnston, B., and Butcher, E. C. (2002). Chemokines in rapid leukocyte adhesion triggering and migration. Semin Immunol 14, 83-92.

Jones, R. G., Bui, T., White, C., Madesh, M., Krawczyk, C. M., Lindsten, T., Hawkins, B. J., Kubek, S., Frauwirth, K. A., Wang, Y. L., et al. (2007). The proapoptotic factors Bax and Bak regulate T Cell proliferation through control of endoplasmic reticulum Ca(2+) homeostasis. Immunity 27, 268-280.

Jones, R. G., and Thompson, C. B. (2007). Revving the engine: signal transduction fuels T cell activation. Immunity 27, 173-178.

Joo, E. K., Broxmeyer, H. E., Kwon, H. J., Kang, H. B., Kim, J. S., Lim, J. S., Choe, Y. K., Choe, I. S., Myung, P. K., and Lee, Y. (2004). Enhancement of cell survival by stromal cell-derived factor-1/CXCL12 involves activation of CREB and induction of Mcl-1 and c-Fos in factor-dependent human cell line MO7e. Stem Cells Dev 13, 563-570.

Ju, S. T., Panka, D. J., Cui, H., Ettinger, R., el-Khatib, M., Sherr, D. H., Stanger, B. Z., and Marshak-Rothstein, A. (1995). Fas(CD95)/FasL interactions required for programmed cell death after T-cell activation. Nature 373, 444-448.

Kalesnikoff, J., Sly, L. M., Hughes, M. R., Buchse, T., Rauh, M. J., Cao, L. P., Lam, V., Mui, A., Huber, M., and Krystal, G. (2003). The role of SHIP in cytokine-induced signaling. Rev Physiol Biochem Pharmacol 149, 87-103.

Kameyoshi, Y., Dorschner, A., Mallet, A. I., Christophers, E., and Schroder, J. M. (1992). Cytokine RANTES released by thrombin-stimulated platelets is a potent attractant for human eosinophils. J Exp Med 176, 587-592.

230

Kanaho, Y., Nakai, Y., Katoh, M., and Nozawa, Y. (1993). The phosphatase inhibitor 2,3-diphosphoglycerate interferes with phospholipase D activation in rabbit peritoneal neutrophils. J Biol Chem 268, 12492-12497. Karnoub, A. E., Dash, A. B., Vo, A. P., Sullivan, A., Brooks, M. W., Bell, G. W., Richardson, A. L., Polyak, K., Tubo, R., and Weinberg, R. A. (2007). Mesenchymal stem cells within tumour stroma promote breast cancer metastasis. Nature 449, 557-563.

Karpus, W. J., Lukacs, N. W., Kennedy, K. J., Smith, W. S., Hurst, S. D., and Barrett, T. A. (1997). Differential CC chemokine-induced enhancement of T helper cell cytokine production. J Immunol 158, 4129-4136.

Kaul, M., and Lipton, S. A. (1999). Chemokines and activated macrophages in HIV gp120-induced neuronal apoptosis. Proc Natl Acad Sci U S A 96, 8212-8216.

Kawai, T., Seki, M., Hiromatsu, K., Eastcott, J. W., Watts, G. F., Sugai, M., Smith, D. J., Porcelli, S. A., and Taubman, M. A. (1999). Selective diapedesis of Th1 cells induced by endothelial cell RANTES. J Immunol 163, 3269-3278.

Khandoga, A., Kessler, J. S., Hanschen, M., Khandoga, A. G., Burggraf, D., Reichel, C., Hamann, G. F., Enders, G., and Krombach, F. (2006). Matrix metalloproteinase-9 promotes neutrophil and T cell recruitment and migration in the postischemic liver. J Leukoc Biol 79, 1295-1305.

Kim, D. H., Sarbassov, D. D., Ali, S. M., King, J. E., Latek, R. R., Erdjument-Bromage, H., Tempst, P., and Sabatini, D. M. (2002). mTOR interacts with raptor to form a nutrient-sensitive complex that signals to the cell growth machinery. Cell 110, 163-175.

Kinder, M., Chislock, E., Bussard, K. M., Shuman, L., and Mastro, A. M. (2008). Metastatic breast cancer induces an osteoblast inflammatory response. Exp Cell Res 314, 173-183.

231

Kinsella, T. M., and Nolan, G. P. (1996). Episomal vectors rapidly and stably produce high-titer recombinant retrovirus. Hum Gene Ther 7, 1405-1413.

Knudsen, K. E., Diehl, J. A., Haiman, C. A., and Knudsen, E. S. (2006). Cyclin D1: polymorphism, aberrant splicing and cancer risk. Oncogene 25, 1620-1628.

Koch, A. E., Polverini, P. J., Kunkel, S. L., Harlow, L. A., DiPietro, L. A., Elner, V. M., Elner, S. G., and Strieter, R. M. (1992). Interleukin-8 as a macrophage-derived mediator of angiogenesis. Science 258, 1798-1801.

Koopmann, W., Ediriwickrema, C., and Krangel, M. S. (1999). Structure and function of the glycosaminoglycan binding site of chemokine macrophage-inflammatory protein-1 beta. J Immunol 163, 2120-2127.

Koopmann, W., and Krangel, M. S. (1997). Identification of a glycosaminoglycan- binding site in chemokine macrophage inflammatory protein-1alpha. J Biol Chem 272, 10103-10109.

Koshiba, T., Hosotani, R., Miyamoto, Y., Ida, J., Tsuji, S., Nakajima, S., Kawaguchi, M., Kobayashi, H., Doi, R., Hori, T., et al. (2000). Expression of stromal cell-derived factor 1 and CXCR4 ligand receptor system in pancreatic cancer: a possible role for tumor progression. Clin Cancer Res 6, 3530-3535.

Kraft, K., Olbrich, H., Majoul, I., Mack, M., Proudfoot, A., and Oppermann, M. (2001). Characterization of sequence determinants within the carboxyl-terminal domain of chemokine receptor CCR5 that regulate signaling and receptor internalization. J Biol Chem 276, 34408-34418.

Krammer, P. H., Arnold, R., and Lavrik, I. N. (2007). Life and death in peripheral T cells. Nat Rev Immunol 7, 532-542.

232

Krauss, S., Brand, M. D., and Buttgereit, F. (2001). Signaling takes a breath--new quantitative perspectives on bioenergetics and signal transduction. Immunity 15, 497-502. Kraynov, V. S., Chamberlain, C., Bokoch, G. M., Schwartz, M. A., Slabaugh, S., and Hahn, K. M. (2000). Localized Rac activation dynamics visualized in living cells. Science 290, 333-337.

Kroeger, K. M., and Eidne, K. A. (2004). Study of G-protein-coupled receptor-protein interactions by bioluminescence resonance energy transfer. Methods Mol Biol 259, 323- 333.

Kumar, A., Humphreys, T. D., Kremer, K. N., Bramati, P. S., Bradfield, L., Edgar, C. E., and Hedin, K. E. (2006). CXCR4 physically associates with the T cell receptor to signal in T cells. Immunity 25, 213-224.

Kuschert, G. S., Coulin, F., Power, C. A., Proudfoot, A. E., Hubbard, R. E., Hoogewerf, A. J., and Wells, T. N. (1999). Glycosaminoglycans interact selectively with chemokines and modulate receptor binding and cellular responses. Biochemistry 38, 12959-12968.

Kusner, D. J., Hall, C. F., and Schlesinger, L. S. (1996). Activation of phospholipase D is tightly coupled to the phagocytosis of Mycobacterium tuberculosis or opsonized zymosan by human macrophages. J Exp Med 184, 585-595.

Lagane, B., Ballet, S., Planchenault, T., Balabanian, K., Le Poul, E., Blanpain, C., Percherancier, Y., Staropoli, I., Vassart, G., Oppermann, M., et al. (2005). Mutation of the DRY motif reveals different structural requirements for the CC chemokine receptor 5- mediated signaling and receptor endocytosis. Mol Pharmacol 67, 1966-1976.

Lau, E. K., Paavola, C. D., Johnson, Z., Gaudry, J. P., Geretti, E., Borlat, F., Kungl, A. J., Proudfoot, A. E., and Handel, T. M. (2004). Identification of the glycosaminoglycan binding site of the CC chemokine, MCP-1: implications for structure and function in vivo. J Biol Chem 279, 22294-22305.

233

Laurence, J. S., Blanpain, C., De Leener, A., Parmentier, M., and LiWang, P. J. (2001). Importance of basic residues and quaternary structure in the function of MIP-1 beta: CCR5 binding and cell surface sugar interactions. Biochemistry 40, 4990-4999.

Lederman, M. M., Penn-Nicholson, A., Cho, M., and Mosier, D. (2006). Biology of CCR5 and its role in HIV infection and treatment. Jama 296, 815-826.

Lee, B., Sharron, M., Blanpain, C., Doranz, B. J., Vakili, J., Setoh, P., Berg, E., Liu, G., Guy, H. R., Durell, S. R., et al. (1999). Epitope mapping of CCR5 reveals multiple conformational states and distinct but overlapping structures involved in chemokine and coreceptor function. J Biol Chem 274, 9617-9626.

Lee, J. S., Frevert, C. W., Wurfel, M. M., Peiper, S. C., Wong, V. A., Ballman, K. K., Ruzinski, J. T., Rhim, J. S., Martin, T. R., and Goodman, R. B. (2003). Duffy antigen facilitates movement of chemokine across the endothelium in vitro and promotes neutrophil transmigration in vitro and in vivo. J Immunol 170, 5244-5251.

Lee, Y., Gotoh, A., Kwon, H. J., You, M., Kohli, L., Mantel, C., Cooper, S., Hangoc, G., Miyazawa, K., Ohyashiki, K., and Broxmeyer, H. E. (2002). Enhancement of intracellular signaling associated with hematopoietic progenitor cell survival in response to SDF- 1/CXCL12 in synergy with other cytokines. Blood 99, 4307-4317.

Lefkowitz, R. J., and Shenoy, S. K. (2005). Transduction of receptor signals by beta- arrestins. Science 308, 512-517.

Lehman, J. A., and Gomez-Cambronero, J. (2002). Molecular crosstalk between p70S6k and MAPK cell signaling pathways. Biochem Biophys Res Commun 293, 463-469.

Li, Z., Jiang, H., Xie, W., Zhang, Z., Smrcka, A. V., and Wu, D. (2000). Roles of PLC- beta2 and -beta3 and PI3Kgamma in chemoattractant-mediated signal transduction. Science 287, 1046-1049.

234

Li, Z., Jiao, X., Wang, C., Ju, X., Lu, Y., Yuan, L., Lisanti, M. P., Katiyar, S., and Pestell, R. G. (2006a). Cyclin D1 induction of cellular migration requires p27(KIP1). Cancer Res 66, 9986-9994.

Li, Z., Wang, C., Jiao, X., Lu, Y., Fu, M., Quong, A. A., Dye, C., Yang, J., Dai, M., Ju, X., et al. (2006b). Cyclin D1 regulates cellular migration through the inhibition of thrombospondin 1 and ROCK signaling. Mol Cell Biol 26, 4240-4256.

Liu, R., Paxton, W. A., Choe, S., Ceradini, D., Martin, S. R., Horuk, R., MacDonald, M. E., Stuhlmann, H., Koup, R. A., and Landau, N. R. (1996). Homozygous defect in HIV-1 coreceptor accounts for resistance of some multiply-exposed individuals to HIV-1 infection. Cell 86, 367-377.

Li-Weber, M., and Krammer, P. H. (2003). Function and regulation of the CD95 (APO- 1/Fas) ligand in the immune system. Semin Immunol 15, 145-157.

Loberg, R. D., Day, L. L., Harwood, J., Ying, C., St John, L. N., Giles, R., Neeley, C. K., and Pienta, K. J. (2006). CCL2 is a potent regulator of prostate cancer cell migration and proliferation. Neoplasia 8, 578-586.

Lodi, P. J., Garrett, D. S., Kuszewski, J., Tsang, M. L., Weatherbee, J. A., Leonard, W. J., Gronenborn, A. M., and Clore, G. M. (1994). High-resolution solution structure of the beta chemokine hMIP-1 beta by multidimensional NMR. Science 263, 1762-1767.

Loetscher, P., Uguccioni, M., Bordoli, L., Baggiolini, M., Moser, B., Chizzolini, C., and Dayer, J. M. (1998). CCR5 is characteristic of Th1 lymphocytes. Nature 391, 344-345.

Loewith, R., Jacinto, E., Wullschleger, S., Lorberg, A., Crespo, J. L., Bonenfant, D., Oppliger, W., Jenoe, P., and Hall, M. N. (2002). Two TOR complexes, only one of which is rapamycin sensitive, have distinct roles in cell growth control. Mol Cell 10, 457-468.

235

Long, X., Lin, Y., Ortiz-Vega, S., Yonezawa, K., and Avruch, J. (2005). Rheb binds and regulates the mTOR kinase. Curr Biol 15, 702-713.

Louahed, J., Struyf, S., Demoulin, J. B., Parmentier, M., Van Snick, J., Van Damme, J., and Renauld, J. C. (2003). CCR8-dependent activation of the RAS/MAPK pathway mediates anti-apoptotic activity of I-309/ CCL1 and vMIP-I. Eur J Immunol 33, 494-501.

Luboshits, G., Shina, S., Kaplan, O., Engelberg, S., Nass, D., Lifshitz-Mercer, B., Chaitchik, S., Keydar, I., and Ben-Baruch, A. (1999). Elevated expression of the CC chemokine regulated on activation, normal T cell expressed and secreted (RANTES) in advanced breast carcinoma. Cancer Res 59, 4681-4687.

Luker, K. E., and Luker, G. D. (2006). Functions of CXCL12 and CXCR4 in breast cancer. Cancer Lett 238, 30-41.

Luster, A. D. (1998). Chemokines--chemotactic cytokines that mediate inflammation. N Engl J Med 338, 436-445.

Luther, S. A., and Cyster, J. G. (2001). Chemokines as regulators of T cell differentiation. Nat Immunol 2, 102-107.

MacArthur, R. D., and Novak, R. M. (2008). Reviews of anti-infective agents: maraviroc: the first of a new class of antiretroviral agents. Clin Infect Dis 47, 236-241.

Mack, M., Luckow, B., Nelson, P. J., Cihak, J., Simmons, G., Clapham, P. R., Signoret, N., Marsh, M., Stangassinger, M., Borlat, F., et al. (1998). Aminooxypentane-RANTES induces CCR5 internalization but inhibits recycling: a novel inhibitory mechanism of HIV infectivity. J Exp Med 187, 1215-1224.

MacManus, C. F., Pettigrew, J., Seaton, A., Wilson, C., Maxwell, P. J., Berlingeri, S., Purcell, C., McGurk, M., Johnston, P. G., and Waugh, D. J. J. (2007). Interleukin-8

236

Signaling Promotes Translational Regulation of Cyclin D in Androgen-Independent Prostate Cancer Cells. Mol Cancer Res 5, 737-748.

Makino, Y., Cook, D. N., Smithies, O., Hwang, O. Y., Neilson, E. G., Turka, L. A., Sato, H., Wells, A. D., and Danoff, T. M. (2002). Impaired T cell function in RANTES- deficient mice. Clin Immunol 102, 302-309.

Mamane, Y., Petroulakis, E., Martineau, Y., Sato, T. A., Larsson, O., Rajasekhar, V. K., and Sonenberg, N. (2007). Epigenetic activation of a subset of mRNAs by eIF4E explains its effects on cell proliferation. PLoS ONE 2, e242.

Manning, B. D., and Cantley, L. C. (2007). AKT/PKB signaling: navigating downstream. Cell 129, 1261-1274.

Mantovani, A., Bottazzi, B., Colotta, F., Sozzani, S., and Ruco, L. (1992). The origin and function of tumor-associated macrophages. Immunol Today 13, 265-270.

Marcotrigiano, J., Gingras, A. C., Sonenberg, N., and Burley, S. K. (1997). Cocrystal structure of the messenger RNA 5' cap-binding protein (eIF4E) bound to 7-methyl-GDP. Cell 89, 951-961.

Martin, L., Blanpain, C., Garnier, P., Wittamer, V., Parmentier, M., and Vita, C. (2001). Structural and functional analysis of the RANTES-glycosaminoglycans interactions. Biochemistry 40, 6303-6318.

Martin, P. M., and Sutherland, A. E. (2001). Exogenous amino acids regulate trophectoderm differentiation in the mouse blastocyst through an mTOR-dependent pathway. Dev Biol 240, 182-193.

MartIn-Fontecha, A., Sebastiani, S., Hopken, U. E., Uguccioni, M., Lipp, M., Lanzavecchia, A., and Sallusto, F. (2003). Regulation of dendritic cell migration to the

237

draining lymph node: impact on T lymphocyte traffic and priming. J Exp Med 198, 615- 621.

Matloubian, M., Lo, C. G., Cinamon, G., Lesneski, M. J., Xu, Y., Brinkmann, V., Allende, M. L., Proia, R. L., and Cyster, J. G. (2004). Lymphocyte egress from thymus and peripheral lymphoid organs is dependent on S1P receptor 1. Nature 427, 355-360.

Matsuo, H., Li, H., McGuire, A. M., Fletcher, C. M., Gingras, A. C., Sonenberg, N., and Wagner, G. (1997). Structure of translation factor eIF4E bound to m7GDP and interaction with 4E-binding protein. Nat Struct Biol 4, 717-724.

McKendrick, L., Morley, S. J., Pain, V. M., Jagus, R., and Joshi, B. (2001). Phosphorylation of eukaryotic initiation factor 4E (eIF4E) at Ser209 is not required for protein synthesis in vitro and in vivo. Eur J Biochem 268, 5375-5385.

Mellado, M., de Ana, A. M., Moreno, M. C., Martinez, C., and Rodriguez-Frade, J. M. (2001a). A potential immune escape mechanism by melanoma cells through the activation of chemokine-induced T cell death. Curr Biol 11, 691-696.

Mellado, M., Rodriguez-Frade, J. M., Aragay, A., del Real, G., Martin, A. M., Vila-Coro, A. J., Serrano, A., Mayor, F., Jr., and Martinez, A. C. (1998). The chemokine monocyte chemotactic protein 1 triggers Janus kinase 2 activation and tyrosine phosphorylation of the CCR2B receptor. J Immunol 161, 805-813.

Mellado, M., Rodriguez-Frade, J. M., Manes, S., and Martinez, A. C. (2001b). Chemokine signaling and functional responses: the role of receptor dimerization and TK pathway activation. Annu Rev Immunol 19, 397-421.

Mellado, M., Rodriguez-Frade, J. M., Vila-Coro, A. J., Fernandez, S., Martin de Ana, A., Jones, D. R., Toran, J. L., and Martinez, A. C. (2001c). Chemokine receptor homo- or heterodimerization activates distinct signaling pathways. Embo J 20, 2497-2507.

238

Meyuhas, O. (2000). Synthesis of the translational apparatus is regulated at the translational level. Eur J Biochem 267, 6321-6330.

Middleton, J., Neil, S., Wintle, J., Clark-Lewis, I., Moore, H., Lam, C., Auer, M., Hub, E., and Rot, A. (1997). Transcytosis and surface presentation of IL-8 by venular endothelial cells. Cell 91, 385-395.

Miki, H., Yamaguchi, H., Suetsugu, S., and Takenawa, T. (2000). IRSp53 is an essential intermediate between Rac and WAVE in the regulation of membrane ruffling. Nature 408, 732-735.

Mira, E., Lacalle, R. A., Gonzalez, M. A., Gomez-Mouton, C., Abad, J. L., Bernad, A., Martinez, A. C., and Manes, S. (2001). A role for chemokine receptor transactivation in growth factor signaling. EMBO Rep 2, 151-156.

Misse, D., Esteve, P. O., Renneboog, B., Vidal, M., Cerutti, M., St Pierre, Y., Yssel, H., Parmentier, M., and Veas, F. (2001). HIV-1 glycoprotein 120 induces the MMP-9 cytopathogenic factor production that is abolished by inhibition of the p38 mitogen- activated protein kinase signaling pathway. Blood 98, 541-547.

Misslitz, A., Pabst, O., Hintzen, G., Ohl, L., Kremmer, E., Petrie, H. T., and Forster, R. (2004). Thymic T cell development and progenitor localization depend on CCR7. J Exp Med 200, 481-491.

Mizoue, L. S., Sullivan, S. K., King, D. S., Kledal, T. N., Schwartz, T. W., Bacon, K. B., and Handel, T. M. (2001). Molecular determinants of receptor binding and signaling by the CX3C chemokine fractalkine. J Biol Chem 276, 33906-33914.

Moerke, N. J., Aktas, H., Chen, H., Cantel, S., Reibarkh, M. Y., Fahmy, A., Gross, J. D., Degterev, A., Yuan, J., Chorev, M., et al. (2007). Small-molecule inhibition of the interaction between the translation initiation factors eIF4E and eIF4G. Cell 128, 257-267.

239

Moller, C., Stromberg, T., Juremalm, M., Nilsson, K., and Nilsson, G. (2003). Expression and function of chemokine receptors in human multiple myeloma. Leukemia 17, 203-210.

Montaner, S. (2007). Akt/TSC/mTOR activation by the KSHV G protein-coupled receptor: emerging insights into the molecular oncogenesis and treatment of Kaposi's sarcoma. Cell Cycle 6, 438-443.

Moore, B. B., Arenberg, D. A., Stoy, K., Morgan, T., Addison, C. L., Morris, S. B., Glass, M., Wilke, C., Xue, Y. Y., Sitterding, S., et al. (1999). Distinct CXC chemokines mediate tumorigenicity of prostate cancer cells. Am J Pathol 154, 1503-1512.

Mora, J. R., and von Andrian, U. H. (2006). T-cell homing specificity and plasticity: new concepts and future challenges. Trends Immunol 27, 235-243.

Moriguchi, M., Hissong, B. D., Gadina, M., Yamaoka, K., Tiffany, H. L., Murphy, P. M., Candotti, F., and O'Shea, J. J. (2005). CXCL12 signaling is independent of Jak2 and Jak3. J Biol Chem 280, 17408-17414.

Moser, B., Wolf, M., Walz, A., and Loetscher, P. (2004). Chemokines: multiple levels of leukocyte migration control. Trends Immunol 25, 75-84.

Mowafi, F., Cagigi, A., Matskova, L., Bjork, O., Chiodi, F., and Nilsson, A. (2008). Chemokine CXCL12 enhances proliferation in pre-B-ALL via STAT5 activation. Pediatr Blood Cancer 50, 812-817.

Mueller, A., and Strange, P. G. (2004). Mechanisms of internalization and recycling of the chemokine receptor, CCR5. Eur J Biochem 271, 243-252.

Muller, A., Homey, B., Soto, H., Ge, N., Catron, D., Buchanan, M. E., McClanahan, T., Murphy, E., Yuan, W., Wagner, S. N., et al. (2001). Involvement of chemokine receptors in breast cancer metastasis. Nature 410, 50-56.

240

Muller, G., Reiterer, P., Hopken, U. E., Golfier, S., and Lipp, M. (2003). Role of homeostatic chemokine and sphingosine-1-phosphate receptors in the organization of lymphoid tissue. Ann N Y Acad Sci 987, 107-116.

Murooka, T. T., Rahbar, R., Platanias, L. C., and Fish, E. N. (2008). CCL5-mediated T- cell chemotaxis involves the initiation of mRNA translation through mTOR/4E-BP1. Blood 111, 4892-4901.

Murooka, T. T., Ward, S. E., and Fish, E. N. (2005). Chemokines and cancer. Cancer Treat Res 126, 15-44.

Murooka, T. T., Wong, M. M., Rahbar, R., Majchrzak-Kita, B., Proudfoot, A. E., and Fish, E. N. (2006). CCL5-CCR5-mediated Apoptosis in T Cells: REQUIREMENT FOR GLYCOSAMINOGLYCAN BINDING AND CCL5 AGGREGATION. J Biol Chem 281, 25184-25194.

Murphy, P. M. (2001). Viral exploitation and subversion of the immune system through chemokine mimicry. Nat Immunol 2, 116-122.

Murphy, P. M., Baggiolini, M., Charo, I. F., Hebert, C. A., Horuk, R., Matsushima, K., Miller, L. H., Oppenheim, J. J., and Power, C. A. (2000). International union of pharmacology. XXII. Nomenclature for chemokine receptors. Pharmacol Rev 52, 145- 176.

Muzio, M., Polentarutti, N., Bosisio, D., Manoj Kumar, P. P., and Mantovani, A. (2000). Toll-like receptor family and signalling pathway. Biochem Soc Trans 28, 563-566.

Myers, S. A., Han, J. W., Lee, Y., Firtel, R. A., and Chung, C. Y. (2005). A Dictyostelium homologue of WASP is required for polarized F-actin assembly during chemotaxis. Mol Biol Cell 16, 2191-2206.

241

Nagasawa, T., Hirota, S., Tachibana, K., Takakura, N., Nishikawa, S., Kitamura, Y., Yoshida, N., Kikutani, H., and Kishimoto, T. (1996). Defects of B-cell lymphopoiesis and bone-marrow myelopoiesis in mice lacking the CXC chemokine PBSF/SDF-1. Nature 382, 635-638.

Nakano, K., Isegawa, Y., Zou, P., Tadagaki, K., Inagi, R., and Yamanishi, K. (2003). Kaposi's sarcoma-associated herpesvirus (KSHV)-encoded vMIP-I and vMIP-II induce signal transduction and chemotaxis in monocytic cells. Arch Virol 148, 871-890.

Nanki, T., and Lipsky, P. E. (2000). Cutting edge: stromal cell-derived factor-1 is a costimulator for CD4+ T cell activation. J Immunol 164, 5010-5014.

Nanki, T., and Lipsky, P. E. (2001). Stimulation of T-Cell activation by CXCL12/stromal cell derived factor-1 involves a G-protein mediated signaling pathway. Cell Immunol 214, 145-154.

Nave, B. T., Ouwens, M., Withers, D. J., Alessi, D. R., and Shepherd, P. R. (1999). Mammalian target of rapamycin is a direct target for protein kinase B: identification of a convergence point for opposing effects of insulin and amino-acid deficiency on protein translation. Biochem J 344 Pt 2, 427-431.

Nelson, W. J., and Nusse, R. (2004). Convergence of Wnt, beta-catenin, and cadherin pathways. Science 303, 1483-1487.

Netelenbos, T., Zuijderduijn, S., Van Den Born, J., Kessler, F. L., Zweegman, S., Huijgens, P. C., and Drager, A. M. (2002). Proteoglycans guide SDF-1-induced migration of hematopoietic progenitor cells. J Leukoc Biol 72, 353-362.

Neumeister, P., Pixley, F. J., Xiong, Y., Xie, H., Wu, K., Ashton, A., Cammer, M., Chan, A., Symons, M., Stanley, E. R., and Pestell, R. G. (2003). Cyclin D1 governs adhesion and motility of macrophages. Mol Biol Cell 14, 2005-2015.

242

Niwa, Y., Akamatsu, H., Niwa, H., Sumi, H., Ozaki, Y., and Abe, A. (2001). Correlation of tissue and plasma RANTES levels with disease course in patients with breast or cervical cancer. Clin Cancer Res 7, 285-289.

Noel, P. J., Boise, L. H., Green, J. M., and Thompson, C. B. (1996). CD28 costimulation prevents cell death during primary T cell activation. J Immunol 157, 636-642.

Noh, W. C., Kim, Y. H., Kim, M. S., Koh, J. S., Kim, H. A., Moon, N. M., and Paik, N. S. (2007). Activation of the mTOR signaling pathway in breast cancer and its correlation with the clinicopathologic variables. Breast Cancer Res Treat.

Noh, W. C., Mondesire, W. H., Peng, J., Jian, W., Zhang, H., Dong, J., Mills, G. B., Hung, M. C., and Meric-Bernstam, F. (2004). Determinants of rapamycin sensitivity in breast cancer cells. Clin Cancer Res 10, 1013-1023.

Nozumi, M., Nakagawa, H., Miki, H., Takenawa, T., and Miyamoto, S. (2003). Differential localization of WAVE isoforms in filopodia and lamellipodia of the neuronal growth cone. J Cell Sci 116, 239-246.

Odorizzi, G., Babst, M., and Emr, S. D. (2000). Phosphoinositide signaling and the regulation of membrane trafficking in yeast. Trends Biochem Sci 25, 229-235.

Ogata, H., Takeya, M., Yoshimura, T., Takagi, K., and Takahashi, K. (1997). The role of monocyte chemoattractant protein-1 (MCP-1) in the pathogenesis of collagen-induced arthritis in rats. J Pathol 182, 106-114.

Ohashi, K., Nagata, K., Maekawa, M., Ishizaki, T., Narumiya, S., and Mizuno, K. (2000). Rho-associated kinase ROCK activates LIM-kinase 1 by phosphorylation at threonine 508 within the activation loop. J Biol Chem 275, 3577-3582.

243

O'Hayre, M., Salanga, C. L., Handel, T. M., and Allen, S. J. (2008). Chemokines and cancer: migration, intracellular signalling and intercellular communication in the microenvironment. Biochem J 409, 635-649.

Oppermann, M. (2004). Chemokine receptor CCR5: insights into structure, function, and regulation. Cell Signal 16, 1201-1210.

Oppermann, M., Mack, M., Proudfoot, A. E., and Olbrich, H. (1999). Differential effects of CC chemokines on CC chemokine receptor 5 (CCR5) phosphorylation and identification of phosphorylation sites on the CCR5 carboxyl terminus. J Biol Chem 274, 8875-8885.

Orimo, A., Gupta, P. B., Sgroi, D. C., Arenzana-Seisdedos, F., Delaunay, T., Naeem, R., Carey, V. J., Richardson, A. L., and Weinberg, R. A. (2005). Stromal fibroblasts present in invasive human breast carcinomas promote tumor growth and angiogenesis through elevated SDF-1/CXCL12 secretion. Cell 121, 335-348.

Paavola, C. D., Hemmerich, S., Grunberger, D., Polsky, I., Bloom, A., Freedman, R., Mulkins, M., Bhakta, S., McCarley, D., Wiesent, L., et al. (1998). Monomeric monocyte chemoattractant protein-1 (MCP-1) binds and activates the MCP-1 receptor CCR2B. J Biol Chem 273, 33157-33165.

Pablos, J. L., Santiago, B., Galindo, M., Torres, C., Brehmer, M. T., Blanco, F. J., and Garcia-Lazaro, F. J. (2003). Synoviocyte-derived CXCL12 is displayed on endothelium and induces angiogenesis in rheumatoid arthritis. J Immunol 170, 2147-2152.

Pakianathan, D. R., Kuta, E. G., Artis, D. R., Skelton, N. J., and Hebert, C. A. (1997). Distinct but overlapping epitopes for the interaction of a CC-chemokine with CCR1, CCR3 and CCR5. Biochemistry 36, 9642-9648.

244

Palazzo, A. F., Joseph, H. L., Chen, Y. J., Dujardin, D. L., Alberts, A. S., Pfister, K. K., Vallee, R. B., and Gundersen, G. G. (2001). Cdc42, dynein, and dynactin regulate MTOC reorientation independent of Rho-regulated microtubule stabilization. Curr Biol 11, 1536- 1541.

Palczewski, K., Kumasaka, T., Hori, T., Behnke, C. A., Motoshima, H., Fox, B. A., Le Trong, I., Teller, D. C., Okada, T., Stenkamp, R. E., et al. (2000). Crystal structure of rhodopsin: A G protein-coupled receptor. Science 289, 739-745.

Pause, A., Belsham, G. J., Gingras, A. C., Donze, O., Lin, T. A., Lawrence, J. C., Jr., and Sonenberg, N. (1994). Insulin-dependent stimulation of protein synthesis by phosphorylation of a regulator of 5'-cap function. Nature 371, 762-767.

Pelengaris, S., Khan, M., and Evan, G. (2002). c-MYC: more than just a matter of life and death. Nat Rev Cancer 2, 764-776.

Pello, O. M., Martinez-Munoz, L., Parrillas, V., Serrano, A., Rodriguez-Frade, J. M., Toro, M. J., Lucas, P., Monterrubio, M., Martinez, A. C., and Mellado, M. (2008). Ligand stabilization of CXCR4/delta-opioid receptor heterodimers reveals a mechanism for immune response regulation. Eur J Immunol 38, 537-549.

Pene, F., Claessens, Y. E., Muller, O., Viguie, F., Mayeux, P., Dreyfus, F., Lacombe, C., and Bouscary, D. (2002). Role of the phosphatidylinositol 3-kinase/Akt and mTOR/P70S6-kinase pathways in the proliferation and apoptosis in multiple myeloma. Oncogene 21, 6587-6597.

Peng, T., Golub, T. R., and Sabatini, D. M. (2002). The immunosuppressant rapamycin mimics a starvation-like signal distinct from amino acid and glucose deprivation. Mol Cell Biol 22, 5575-5584.

245

Percherancier, Y., Berchiche, Y. A., Slight, I., Volkmer-Engert, R., Tamamura, H., Fujii, N., Bouvier, M., and Heveker, N. (2005). Bioluminescence resonance energy transfer reveals ligand-induced conformational changes in CXCR4 homo- and heterodimers. J Biol Chem 280, 9895-9903.

Perry, S. J., and Lefkowitz, R. J. (2002). Arresting developments in heptahelical receptor signaling and regulation. Trends Cell Biol 12, 130-138.

Peterson, R. T., Beal, P. A., Comb, M. J., and Schreiber, S. L. (2000). FKBP12- rapamycin-associated protein (FRAP) autophosphorylates at Serine 2481 under translationally repressive conditions. J Biol Chem 275, 7416-7423.

Pin, J. P., Galvez, T., and Prezeau, L. (2003). Evolution, structure, and activation mechanism of family 3/C G-protein-coupled receptors. Pharmacol Ther 98, 325-354. Pinto, L. A., Williams, M. S., Dolan, M. J., Henkart, P. A., and Shearer, G. M. (2000). Beta-chemokines inhibit activation-induced death of lymphocytes from HIV-infected individuals. Eur J Immunol 30, 2048-2055.

Pogo, A. O., and Chaudhuri, A. (2000). The Duffy protein: a malarial and chemokine receptor. Semin Hematol 37, 122-129.

Pokorny, V., McQueen, F., Yeoman, S., Merriman, M., Merriman, A., Harrison, A., Highton, J., and McLean, L. (2005). Evidence for negative association of the chemokine receptor CCR5 d32 polymorphism with rheumatoid arthritis. Ann Rheum Dis 64, 487- 490.

Pollard, T. D., and Borisy, G. G. (2003). Cellular motility driven by assembly and disassembly of actin filaments. Cell 112, 453-465.

246

Pollok-Kopp, B., Schwarze, K., Baradari, V. K., and Oppermann, M. (2003). Analysis of ligand-stimulated CC chemokine receptor 5 (CCR5) phosphorylation in intact cells using phosphosite-specific antibodies. J Biol Chem 278, 2190-2198.

Prahalad, S. (2006). Negative association between the chemokine receptor CCR5-Delta32 polymorphism and rheumatoid arthritis: a meta-analysis. Genes Immun 7, 264-268.

Prest, S. J., Rees, R. C., Murdoch, C., Marshall, J. F., Cooper, P. A., Bibby, M., Li, G., and Ali, S. A. (1999). Chemokines induce the cellular migration of MCF-7 human breast carcinoma cells: subpopulations of tumour cells display positive and negative chemotaxis and differential in vivo growth potentials. Clin Exp Metastasis 17, 389-396.

Proost, P., De Meester, I., Schols, D., Struyf, S., Lambeir, A. M., Wuyts, A., Opdenakker, G., De Clercq, E., Scharpe, S., and Van Damme, J. (1998). Amino-terminal truncation of chemokines by CD26/dipeptidyl-peptidase IV. Conversion of RANTES into a potent inhibitor of monocyte chemotaxis and HIV-1-infection. J Biol Chem 273, 7222-7227.

Proost, P., Struyf, S., and Van Damme, J. (2006). Natural post-translational modifications of chemokines. Biochem Soc Trans 34, 997-1001.

Proud, C. G. (2007). Signalling to translation: how signal transduction pathways control the protein synthetic machinery. Biochem J 403, 217-234.

Proudfoot, A. E. (2006). The biological relevance of chemokine-proteoglycan interactions. Biochem Soc Trans 34, 422-426.

Proudfoot, A. E., Fritchley, S., Borlat, F., Shaw, J. P., Vilbois, F., Zwahlen, C., Trkola, A., Marchant, D., Clapham, P. R., and Wells, T. N. (2001). The BBXB motif of RANTES is the principal site for heparin binding and controls receptor selectivity. J Biol Chem 276, 10620-10626.

247

Proudfoot, A. E., Handel, T. M., Johnson, Z., Lau, E. K., LiWang, P., Clark-Lewis, I., Borlat, F., Wells, T. N., and Kosco-Vilbois, M. H. (2003). Glycosaminoglycan binding and oligomerization are essential for the in vivo activity of certain chemokines. Proc Natl Acad Sci U S A 100, 1885-1890.

Pruenster, M., and Rot, A. (2006). Throwing light on DARC. Biochem Soc Trans 34, 1005-1008.

Pullikuth, A. K., and Catling, A. D. (2007). Scaffold mediated regulation of MAPK signaling and cytoskeletal dynamics: a perspective. Cell Signal 19, 1621-1632.

Qin, S., Rottman, J. B., Myers, P., Kassam, N., Weinblatt, M., Loetscher, M., Koch, A. E., Moser, B., and Mackay, C. R. (1998). The chemokine receptors CXCR3 and CCR5 mark subsets of T cells associated with certain inflammatory reactions. J Clin Invest 101, 746- 754.

Rabin, R. L., Park, M. K., Liao, F., Swofford, R., Stephany, D., and Farber, J. M. (1999). Chemokine receptor responses on T cells are achieved through regulation of both receptor expression and signaling. J Immunol 162, 3840-3850.

Raftopoulou, M., and Hall, A. (2004). Cell migration: Rho GTPases lead the way. Dev Biol 265, 23-32.

Rahbar, R., Murooka, T. T., Hinek, A. A., Galligan, C. L., Sassano, A., Yu, C., Srivastava, K., Platanias, L. C., and Fish, E. N. (2006). Vaccinia virus activation of CCR5 invokes tyrosine phosphorylation signaling events that support virus replication. J Virol 80, 7245-7259.

Raman, D., Baugher, P. J., Thu, Y. M., and Richmond, A. (2007). Role of chemokines in tumor growth. Cancer Lett 256, 137-165.

248

Raport, C. J., Gosling, J., Schweickart, V. L., Gray, P. W., and Charo, I. F. (1996). Molecular cloning and functional characterization of a novel human CC chemokine receptor (CCR5) for RANTES, MIP-1beta, and MIP-1alpha. J Biol Chem 271, 17161- 17166.

Rathanaswami, P., Hachicha, M., Sadick, M., Schall, T. J., and McColl, S. R. (1993). Expression of the cytokine RANTES in human rheumatoid synovial fibroblasts. Differential regulation of RANTES and interleukin-8 genes by inflammatory cytokines. J Biol Chem 268, 5834-5839.

Rathmell, J. C., Elstrom, R. L., Cinalli, R. M., and Thompson, C. B. (2003). Activated Akt promotes increased resting T cell size, CD28-independent T cell growth, and development of autoimmunity and lymphoma. Eur J Immunol 33, 2223-2232.

Raught, B., Peiretti, F., Gingras, A. C., Livingstone, M., Shahbazian, D., Mayeur, G. L., Polakiewicz, R. D., Sonenberg, N., and Hershey, J. W. (2004). Phosphorylation of eucaryotic translation initiation factor 4B Ser422 is modulated by S6 kinases. Embo J 23, 1761-1769.

Rawlings, J. S., Rosler, K. M., and Harrison, D. A. (2004). The JAK/STAT signaling pathway. J Cell Sci 117, 1281-1283.

Reif, K., Okkenhaug, K., Sasaki, T., Penninger, J. M., Vanhaesebroeck, B., and Cyster, J. G. (2004). Cutting edge: differential roles for phosphoinositide 3-kinases, p110gamma and p110delta, in lymphocyte chemotaxis and homing. J Immunol 173, 2236-2240.

Richmond, A. (2002). Nf-kappa B, chemokine gene transcription and tumour growth. Nat Rev Immunol 2, 664-674.

Richter, J. D., and Sonenberg, N. (2005). Regulation of cap-dependent translation by eIF4E inhibitory proteins. Nature 433, 477-480.

249

Rickert, P., Weiner, O. D., Wang, F., Bourne, H. R., and Servant, G. (2000). Leukocytes navigate by compass: roles of PI3Kgamma and its lipid products. Trends Cell Biol 10, 466-473.

Robinson, E., Keystone, E. C., Schall, T. J., Gillett, N., and Fish, E. N. (1995). Chemokine expression in rheumatoid arthritis (RA): evidence of RANTES and macrophage inflammatory protein (MIP)-1 beta production by synovial T cells. Clin Exp Immunol 101, 398-407.

Robinson, S. C., Scott, K. A., and Balkwill, F. R. (2002). Chemokine stimulation of monocyte matrix metalloproteinase-9 requires endogenous TNF-alpha. Eur J Immunol 32, 404-412.

Robinson, S. C., Scott, K. A., Wilson, J. L., Thompson, R. G., Proudfoot, A. E., and Balkwill, F. R. (2003). A chemokine receptor antagonist inhibits experimental breast tumor growth. Cancer Res 63, 8360-8365.

Rodriguez-Frade, J. M., Vila-Coro, A. J., Martin, A., Nieto, M., Sanchez-Madrid, F., Proudfoot, A. E., Wells, T. N., Martinez, A. C., and Mellado, M. (1999). Similarities and differences in RANTES- and (AOP)-RANTES-triggered signals: implications for chemotaxis. J Cell Biol 144, 755-765.

Rohrschneider, L. R., Fuller, J. F., Wolf, I., Liu, Y., and Lucas, D. M. (2000). Structure, function, and biology of SHIP proteins. Genes Dev 14, 505-520.

Rosenwald, I. B., Kaspar, R., Rousseau, D., Gehrke, L., Leboulch, P., Chen, J. J., Schmidt, E. V., Sonenberg, N., and London, I. M. (1995). Eukaryotic translation initiation factor 4E regulates expression of cyclin D1 at transcriptional and post- transcriptional levels. J Biol Chem 270, 21176-21180.

250

Rosenwald, I. B., Lazaris-Karatzas, A., Sonenberg, N., and Schmidt, E. V. (1993). Elevated levels of cyclin D1 protein in response to increased expression of eukaryotic initiation factor 4E. Mol Cell Biol 13, 7358-7363.

Rossi, D., and Zlotnik, A. (2000). The biology of chemokines and their receptors. Annu Rev Immunol 18, 217-242.

Ruggero, D., Montanaro, L., Ma, L., Xu, W., Londei, P., Cordon-Cardo, C., and Pandolfi, P. P. (2004). The translation factor eIF-4E promotes tumor formation and cooperates with c-Myc in lymphomagenesis. Nat Med 10, 484-486.

Ruvinsky, I., and Meyuhas, O. (2006). Ribosomal protein S6 phosphorylation: from protein synthesis to cell size. Trends Biochem Sci 31, 342-348.

Ruvinsky, I., Sharon, N., Lerer, T., Cohen, H., Stolovich-Rain, M., Nir, T., Dor, Y., Zisman, P., and Meyuhas, O. (2005). Ribosomal protein S6 phosphorylation is a determinant of cell size and glucose homeostasis. Genes Dev 19, 2199-2211.

Sabatini, D. M. (2006). mTOR and cancer: insights into a complex relationship. Nat Rev Cancer 6, 729-734.

Sabatini, D. M., Erdjument-Bromage, H., Lui, M., Tempst, P., and Snyder, S. H. (1994). RAFT1: a mammalian protein that binds to FKBP12 in a rapamycin-dependent fashion and is homologous to yeast TORs. Cell 78, 35-43.

Sabers, C. J., Martin, M. M., Brunn, G. J., Williams, J. M., Dumont, F. J., Wiederrecht, G., and Abraham, R. T. (1995). Isolation of a protein target of the FKBP12-rapamycin complex in mammalian cells. J Biol Chem 270, 815-822.

251

Sadir, R., Baleux, F., Grosdidier, A., Imberty, A., and Lortat-Jacob, H. (2001). Characterization of the stromal cell-derived factor-1alpha-heparin complex. J Biol Chem 276, 8288-8296.

Sahai, E., Olson, M. F., and Marshall, C. J. (2001). Cross-talk between Ras and Rho signalling pathways in transformation favours proliferation and increased motility. Embo J 20, 755-766.

Saji, H., Koike, M., Yamori, T., Saji, S., Seiki, M., Matsushima, K., and Toi, M. (2001). Significant correlation of monocyte chemoattractant protein-1 expression with neovascularization and progression of breast carcinoma. Cancer 92, 1085-1091.

Sakakibara, K., Liu, B., Hollenbeck, S., and Kent, K. C. (2005). Rapamycin inhibits fibronectin-induced migration of the human arterial smooth muscle line (E47) through the mammalian target of rapamycin. Am J Physiol Heart Circ Physiol 288, H2861-2868.

Sakata, D., Taniguchi, H., Yasuda, S., Adachi-Morishima, A., Hamazaki, Y., Nakayama, R., Miki, T., Minato, N., and Narumiya, S. (2007). Impaired T lymphocyte trafficking in mice deficient in an actin-nucleating protein, mDia1. J Exp Med 204, 2031-2038.

Salcedo, R., Ponce, M. L., Young, H. A., Wasserman, K., Ward, J. M., Kleinman, H. K., Oppenheim, J. J., and Murphy, W. J. (2000). Human endothelial cells express CCR2 and respond to MCP-1: direct role of MCP-1 in angiogenesis and tumor progression. Blood 96, 34-40.

Salcedo, R., Wasserman, K., Young, H. A., Grimm, M. C., Howard, O. M., Anver, M. R., Kleinman, H. K., Murphy, W. J., and Oppenheim, J. J. (1999). Vascular endothelial growth factor and basic fibroblast growth factor induce expression of CXCR4 on human endothelial cells: In vivo neovascularization induced by stromal-derived factor-1alpha. Am J Pathol 154, 1125-1135.

252

Saltiel, A. R., and Kahn, C. R. (2001). Insulin signalling and the regulation of glucose and lipid metabolism. Nature 414, 799-806.

Samson, M., Labbe, O., Mollereau, C., Vassart, G., and Parmentier, M. (1996). Molecular cloning and functional expression of a new human CC-chemokine receptor gene. Biochemistry 35, 3362-3367.

Sasaki, T., Irie-Sasaki, J., Jones, R. G., Oliveira-dos-Santos, A. J., Stanford, W. L., Bolon, B., Wakeham, A., Itie, A., Bouchard, D., Kozieradzki, I., et al. (2000). Function of PI3Kgamma in thymocyte development, T cell activation, and neutrophil migration. Science 287, 1040-1046.

Saucedo, L. J., Gao, X., Chiarelli, D. A., Li, L., Pan, D., and Edgar, B. A. (2003). Rheb promotes cell growth as a component of the insulin/TOR signalling network. Nat Cell Biol 5, 566-571.

Schaerli, P., Willimann, K., Lang, A. B., Lipp, M., Loetscher, P., and Moser, B. (2000). CXC chemokine receptor 5 expression defines follicular homing T cells with B cell helper function. J Exp Med 192, 1553-1562.

Schall, T. J., Bacon, K., Toy, K. J., and Goeddel, D. V. (1990). Selective attraction of monocytes and T lymphocytes of the memory phenotype by cytokine RANTES. Nature 347, 669-671.

Scheper, G. C., van Kollenburg, B., Hu, J., Luo, Y., Goss, D. J., and Proud, C. G. (2002). Phosphorylation of eukaryotic initiation factor 4E markedly reduces its affinity for capped mRNA. J Biol Chem 277, 3303-3309.

Seet, B. T., McCaughan, C. A., Handel, T. M., Mercer, A., Brunetti, C., McFadden, G., and Fleming, S. B. (2003). Analysis of an orf virus chemokine-binding protein: Shifting

253

ligand specificities among a family of poxvirus viroceptors. Proc Natl Acad Sci U S A 100, 15137-15142.

Sehgal, A., Keener, C., Boynton, A. L., Warrick, J., and Murphy, G. P. (1998a). CXCR-4, a chemokine receptor, is overexpressed in and required for proliferation of glioblastoma tumor cells. J Surg Oncol 69, 99-104.

Sehgal, A., Ricks, S., Boynton, A. L., Warrick, J., and Murphy, G. P. (1998b). Molecular characterization of CXCR-4: a potential brain tumor-associated gene. J Surg Oncol 69, 239-248.

Servant, G., Weiner, O. D., Herzmark, P., Balla, T., Sedat, J. W., and Bourne, H. R. (2000). Polarization of chemoattractant receptor signaling during neutrophil chemotaxis. Science 287, 1037-1040.

Sgadari, C., Angiolillo, A. L., Cherney, B. W., Pike, S. E., Farber, J. M., Koniaris, L. G., Vanguri, P., Burd, P. R., Sheikh, N., Gupta, G., et al. (1996). Interferon-inducible protein-10 identified as a mediator of tumor necrosis in vivo. Proc Natl Acad Sci U S A 93, 13791-13796.

Shahrara, S., Amin, M. A., Woods, J. M., Haines, G. K., and Koch, A. E. (2003). Chemokine receptor expression and in vivo signaling pathways in the joints of rats with adjuvant-induced arthritis. Arthritis Rheum 48, 3568-3583.

Shaw, J. P., Johnson, Z., Borlat, F., Zwahlen, C., Kungl, A., Roulin, K., Harrenga, A., Wells, T. N., and Proudfoot, A. E. (2004). The X-ray structure of RANTES: heparin- derived disaccharides allows the rational design of chemokine inhibitors. Structure (Camb) 12, 2081-2093.

254

Shenoy, S. K., and Lefkowitz, R. J. (2003). Trafficking patterns of beta-arrestin and G protein-coupled receptors determined by the kinetics of beta-arrestin deubiquitination. J Biol Chem 278, 14498-14506.

Signoret, N., Oldridge, J., Pelchen-Matthews, A., Klasse, P. J., Tran, T., Brass, L. F., Rosenkilde, M. M., Schwartz, T. W., Holmes, W., Dallas, W., et al. (1997). Phorbol esters and SDF-1 induce rapid endocytosis and down modulation of the chemokine receptor CXCR4. J Cell Biol 139, 651-664.

Signoret, N., Pelchen-Matthews, A., Mack, M., Proudfoot, A. E., and Marsh, M. (2000). Endocytosis and recycling of the HIV coreceptor CCR5. J Cell Biol 151, 1281-1294. Silzle, T., Kreutz, M., Dobler, M. A., Brockhoff, G., Knuechel, R., and Kunz-Schughart, L. A. (2003). Tumor-associated fibroblasts recruit blood monocytes into tumor tissue. Eur J Immunol 33, 1311-1320.

Simmons, G., Clapham, P. R., Picard, L., Offord, R. E., Rosenkilde, M. M., Schwartz, T. W., Buser, R., Wells, T. N., and Proudfoot, A. E. (1997). Potent inhibition of HIV-1 infectivity in macrophages and lymphocytes by a novel CCR5 antagonist. Science 276, 276-279.

Sinclair, L. V., Finlay, D., Feijoo, C., Cornish, G. H., Gray, A., Ager, A., Okkenhaug, K., Hagenbeek, T. J., Spits, H., and Cantrell, D. A. (2008). Phosphatidylinositol-3-OH kinase and nutrient-sensing mTOR pathways control T lymphocyte trafficking. Nat Immunol 9, 513-521.

Siveke, J. T., and Hamann, A. (1998). T helper 1 and T helper 2 cells respond differentially to chemokines. J Immunol 160, 550-554.

Smith, D. R., Polverini, P. J., Kunkel, S. L., Orringer, M. B., Whyte, R. I., Burdick, M. D., Wilke, C. A., and Strieter, R. M. (1994). Inhibition of interleukin 8 attenuates angiogenesis in bronchogenic carcinoma. J Exp Med 179, 1409-1415.

255

Sodhi, A., Chaisuparat, R., Hu, J., Ramsdell, A. K., Manning, B. D., Sausville, E. A., Sawai, E. T., Molinolo, A., Gutkind, J. S., and Montaner, S. (2006). The TSC2/mTOR pathway drives endothelial cell transformation induced by the Kaposi's sarcoma- associated herpesvirus G protein-coupled receptor. Cancer Cell 10, 133-143.

Soriano, S. F., Serrano, A., Hernanz-Falcon, P., Martin de Ana, A., Monterrubio, M., Martinez, C., Rodriguez-Frade, J. M., and Mellado, M. (2003). Chemokines integrate JAK/STAT and G-protein pathways during chemotaxis and calcium flux responses. Eur J Immunol 33, 1328-1333.

Sotsios, Y., Whittaker, G. C., Westwick, J., and Ward, S. G. (1999). The CXC chemokine stromal cell-derived factor activates a Gi-coupled phosphoinositide 3-kinase in T lymphocytes. J Immunol 163, 5954-5963.

Sozzani, S., Allavena, P., Vecchi, A., and Mantovani, A. (2000). Chemokines and dendritic cell traffic. J Clin Immunol 20, 151-160.

Spinetti, G., Bernardini, G., Camarda, G., Mangoni, A., Santoni, A., Capogrossi, M. C., and Napolitano, M. (2003). The chemokine receptor CCR8 mediates rescue from dexamethasone-induced apoptosis via an ERK-dependent pathway. J Leukoc Biol 73, 201-207.

Springael, J. Y., de Poorter, C., Deupi, X., Van Durme, J., Pardo, L., and Parmentier, M. (2007). The activation mechanism of chemokine receptor CCR5 involves common structural changes but a different network of interhelical interactions relative to rhodopsin. Cell Signal 19, 1446-1456.

Springael, J. Y., Urizar, E., and Parmentier, M. (2005). Dimerization of chemokine receptors and its functional consequences. Cytokine Growth Factor Rev 16, 611-623.

256

Srinivasan, S., Wang, F., Glavas, S., Ott, A., Hofmann, F., Aktories, K., Kalman, D., and Bourne, H. R. (2003). Rac and Cdc42 play distinct roles in regulating PI(3,4,5)P3 and polarity during neutrophil chemotaxis. J Cell Biol 160, 375-385.

Stambolic, V., Suzuki, A., de la Pompa, J. L., Brothers, G. M., Mirtsos, C., Sasaki, T., Ruland, J., Penninger, J. M., Siderovski, D. P., and Mak, T. W. (1998). Negative regulation of PKB/Akt-dependent cell survival by the tumor suppressor PTEN. Cell 95, 29-39.

Steelman, L. S., Abrams, S. L., Whelan, J., Bertrand, F. E., Ludwig, D. E., Basecke, J., Libra, M., Stivala, F., Milella, M., Tafuri, A., et al. (2008). Contributions of the Raf/MEK/ERK, PI3K/PTEN/Akt/mTOR and Jak/STAT pathways to leukemia. Leukemia 22, 686-707.

Stein, J. V., and Nombela-Arrieta, C. (2005). Chemokine control of lymphocyte trafficking: a general overview. Immunology 116, 1-12.

Strieter, R. M., Kunkel, S. L., Elner, V. M., Martonyi, C. L., Koch, A. E., Polverini, P. J., and Elner, S. G. (1992). Interleukin-8. A corneal factor that induces neovascularization. Am J Pathol 141, 1279-1284.

Strieter, R. M., Polverini, P. J., Kunkel, S. L., Arenberg, D. A., Burdick, M. D., Kasper, J., Dzuiba, J., Van Damme, J., Walz, A., Marriott, D., and et al. (1995). The functional role of the ELR motif in CXC chemokine-mediated angiogenesis. J Biol Chem 270, 27348- 27357.

Struyf, S., De Meester, I., Scharpe, S., Lenaerts, J. P., Menten, P., Wang, J. M., Proost, P., and Van Damme, J. (1998). Natural truncation of RANTES abolishes signaling through the CC chemokine receptors CCR1 and CCR3, impairs its chemotactic potency and generates a CC chemokine inhibitor. Eur J Immunol 28, 1262-1271.

257

Suetsugu, S., Miki, H., and Takenawa, T. (1998). The essential role of profilin in the assembly of actin for microspike formation. Embo J 17, 6516-6526.

Suetsugu, S., Murayama, K., Sakamoto, A., Hanawa-Suetsugu, K., Seto, A., Oikawa, T., Mishima, C., Shirouzu, M., Takenawa, T., and Yokoyama, S. (2006). The RAC binding domain/IRSp53-MIM homology domain of IRSp53 induces RAC-dependent membrane deformation. J Biol Chem 281, 35347-35358.

Sugasawa, H., Ichikura, T., Kinoshita, M., Ono, S., Majima, T., Tsujimoto, H., Chochi, K., Hiroi, S., Takayama, E., Saitoh, D., et al. (2008). Gastric cancer cells exploit CD4+ cell-derived CCL5 for their growth and prevention of CD8+ cell-involved tumor elimination. Int J Cancer 122, 2535-2541.

Sukumvanich, P., DesMarais, V., Sarmiento, C. V., Wang, Y., Ichetovkin, I., Mouneimne, G., Almo, S., and Condeelis, J. (2004). Cellular localization of activated N-WASP using a conformation-sensitive antibody. Cell Motil Cytoskeleton 59, 141-152.

Sumi, T., Matsumoto, K., and Nakamura, T. (2001). Specific activation of LIM kinase 2 via phosphorylation of threonine 505 by ROCK, a Rho-dependent protein kinase. J Biol Chem 276, 670-676.

Sun, J., Marx, S. O., Chen, H. J., Poon, M., Marks, A. R., and Rabbani, L. E. (2001). Role for p27(Kip1) in Vascular Smooth Muscle Cell Migration. Circulation 103, 2967- 2972.

Sun, Y. X., Wang, J., Shelburne, C. E., Lopatin, D. E., Chinnaiyan, A. M., Rubin, M. A., Pienta, K. J., and Taichman, R. S. (2003). Expression of CXCR4 and CXCL12 (SDF-1) in human prostate cancers (PCa) in vivo. J Cell Biochem 89, 462-473.

258

Suzuki, N., Nakajima, A., Yoshino, S., Matsushima, K., Yagita, H., and Okumura, K. (1999). Selective accumulation of CCR5+ T lymphocytes into inflamed joints of rheumatoid arthritis. Int Immunol 11, 553-559.

Suzuki, S., Chuang, L. F., Yau, P., Doi, R. H., and Chuang, R. Y. (2002). Interactions of opioid and chemokine receptors: oligomerization of mu, kappa, and delta with CCR5 on immune cells. Exp Cell Res 280, 192-200.

Szabo, M. C., Butcher, E. C., McIntyre, B. W., Schall, T. J., and Bacon, K. B. (1997). RANTES stimulation of T lymphocyte adhesion and activation: role for LFA-1 and ICAM-3. Eur J Immunol 27, 1061-1068.

Szekanecz, Z., and Koch, A. E. (2000). Cell-cell interactions in synovitis. Endothelial cells and immune cell migration. Arthritis Res 2, 368-373.

Taub, D. D., Sayers, T. J., Carter, C. R., and Ortaldo, J. R. (1995). Alpha and beta chemokines induce NK cell migration and enhance NK-mediated cytolysis. J Immunol 155, 3877-3888.

Taub, D. D., Turcovski-Corrales, S. M., Key, M. L., Longo, D. L., and Murphy, W. J. (1996). Chemokines and T lymphocyte activation: I. Beta chemokines costimulate human T lymphocyte activation in vitro. J Immunol 156, 2095-2103.

Thornton, S., Duwel, L. E., Boivin, G. P., Ma, Y., and Hirsch, R. (1999). Association of the course of collagen-induced arthritis with distinct patterns of cytokine and chemokine messenger RNA expression. Arthritis Rheum 42, 1109-1118.

Trkola, A., Gordon, C., Matthews, J., Maxwell, E., Ketas, T., Czaplewski, L., Proudfoot, A. E., and Moore, J. P. (1999). The CC-chemokine RANTES increases the attachment of human immunodeficiency virus type 1 to target cells via glycosaminoglycans and also

259

activates a signal transduction pathway that enhances viral infectivity. J Virol 73, 6370- 6379.

Turner, L., Ward, S. G., Sansom, D., and Westwick, J. (1996). A role for RANTES in T lymphocyte proliferation. Biochem Soc Trans 24, 93S.

Turner, L., Ward, S. G., and Westwick, J. (1995a). RANTES-activated human T lymphocytes. A role for phosphoinositide 3-kinase. J Immunol 155, 2437-2444.

Turner, L., Ward, S. G., and Westwick, J. (1995b). A role for phosphoinositide 3--kinase in RANTES induced chemotaxis of T lymphocytes. Biochem Soc Trans 23, 283S.

Turner, S. J., Domin, J., Waterfield, M. D., Ward, S. G., and Westwick, J. (1998). The CC chemokine monocyte chemotactic peptide-1 activates both the class I p85/p110 phosphatidylinositol 3-kinase and the class II PI3K-C2alpha. J Biol Chem 273, 25987- 25995.

Tyner, J. W., Uchida, O., Kajiwara, N., Kim, E. Y., Patel, A. C., O'Sullivan, M. P., Walter, M. J., Schwendener, R. A., Cook, D. N., Danoff, T. M., and Holtzman, M. J. (2005). CCL5-CCR5 interaction provides antiapoptotic signals for macrophage survival during viral infection. Nat Med 11, 1180-1187.

Uchida, D., Begum, N. M., Almofti, A., Nakashiro, K., Kawamata, H., Tateishi, Y., Hamakawa, H., Yoshida, H., and Sato, M. (2003). Possible role of stromal-cell-derived factor-1/CXCR4 signaling on lymph node metastasis of oral squamous cell carcinoma. Exp Cell Res 290, 289-302.

Uddin, S., Fish, E. N., Sher, D., Gardziola, C., Colamonici, O. R., Kellum, M., Pitha, P. M., White, M. F., and Platanias, L. C. (1997). The IRS-pathway operates distinctively from the Stat-pathway in hematopoietic cells and transduces common and distinct signals during engagement of the insulin or interferon-alpha receptors. Blood 90, 2574-2582.

260

Ueda, Y., Neel, N. F., Schutyser, E., Raman, D., and Richmond, A. (2006). Deletion of the COOH-terminal domain of CXC chemokine receptor 4 leads to the down-regulation of cell-to-cell contact, enhanced motility and proliferation in breast carcinoma cells. Cancer Res 66, 5665-5675.

Uehara, S., Grinberg, A., Farber, J. M., and Love, P. E. (2002). A role for CCR9 in T lymphocyte development and migration. J Immunol 168, 2811-2819.

Ueno, T., Saito, F., Gray, D. H., Kuse, S., Hieshima, K., Nakano, H., Kakiuchi, T., Lipp, M., Boyd, R. L., and Takahama, Y. (2004). CCR7 signals are essential for cortex-medulla migration of developing thymocytes. J Exp Med 200, 493-505.

Ueno, T., Toi, M., Saji, H., Muta, M., Bando, H., Kuroi, K., Koike, M., Inadera, H., and Matsushima, K. (2000). Significance of macrophage chemoattractant protein-1 in macrophage recruitment, angiogenesis, and survival in human breast cancer. Clin Cancer Res 6, 3282-3289.

Um, S. H., D'Alessio, D., and Thomas, G. (2006). Nutrient overload, insulin resistance, and ribosomal protein S6 kinase 1, S6K1. Cell Metab 3, 393-402.

Vaday, G. G., Peehl, D. M., Kadam, P. A., and Lawrence, D. M. (2006). Expression of CCL5 (RANTES) and CCR5 in prostate cancer. Prostate 66, 124-134. van Deventer, H. W., O'Connor, W., Jr., Brickey, W. J., Aris, R. M., Ting, J. P., and Serody, J. S. (2005). C-C chemokine receptor 5 on stromal cells promotes pulmonary metastasis. Cancer Res 65, 3374-3379. van Deventer, H. W., Wu, Q. P., Bergstralh, D. T., Davis, B. K., O'Connor, B. P., Ting, J. P., and Serody, J. S. (2008). C-C chemokine receptor 5 on pulmonary fibrocytes facilitates migration and promotes metastasis via matrix metalloproteinase 9. Am J Pathol 173, 253-264.

261

Vanhaesebroeck, B., Leevers, S. J., Ahmadi, K., Timms, J., Katso, R., Driscoll, P. C., Woscholski, R., Parker, P. J., and Waterfield, M. D. (2001). Synthesis and function of 3- phosphorylated inositol lipids. Annu Rev Biochem 70, 535-602.

Varney, M. L., Li, A., Dave, B. J., Bucana, C. D., Johansson, S. L., and Singh, R. K. (2003). Expression of CXCR1 and CXCR2 receptors in malignant melanoma with different metastatic potential and their role in interleukin-8 (CXCL-8)-mediated modulation of metastatic phenotype. Clin Exp Metastasis 20, 723-731.

Venkatesen, S., Petrovic, A., Locati, M., Kim, Y. O., Weissman, D., and Murphy, P. M. (2001). A membrane-proximal basic domain and cysteine cluster in the C-terminal tail of CCR5 contribute a bipartite motif critical for cell surface expression. J Biol Chem 276, 40133-40145.

Vicente-Manzanares, M., Rey, M., Jones, D. R., Sancho, D., Mellado, M., Rodriguez- Frade, J. M., del Pozo, M. A., Yanez-Mo, M., de Ana, A. M., Martinez, A. C., et al. (1999). Involvement of phosphatidylinositol 3-kinase in stromal cell-derived factor-1 alpha-induced lymphocyte polarization and chemotaxis. J Immunol 163, 4001-4012.

Vila-Coro, A. J., Mellado, M., Martin de Ana, A., Martinez, A. C., and Rodriguez-Frade, J. M. (1999a). Characterization of RANTES- and aminooxypentane-RANTES-triggered desensitization signals reveals differences in recruitment of the G protein-coupled receptor complex. J Immunol 163, 3037-3044.

Vila-Coro, A. J., Rodriguez-Frade, J. M., Martin De Ana, A., Moreno-Ortiz, M. C., Martinez, A. C., and Mellado, M. (1999b). The chemokine SDF-1alpha triggers CXCR4 receptor dimerization and activates the JAK/STAT pathway. Faseb J 13, 1699-1710.

Vita, C., Drakopoulou, E., Ylisastigui, L., Bakri, Y., Vizzavona, J., Martin, L., Parmentier, M., Gluckman, J. C., and Benjouad, A. (2002). Synthesis and

262

characterization of biologically functional biotinylated RANTES. J Immunol Methods 266, 53-65.

Vogelstein, B., and Kinzler, K. W. (2004). Cancer genes and the pathways they control. Nat Med 10, 789-799.

Volin, M. V., Shah, M. R., Tokuhira, M., Haines, G. K., Woods, J. M., and Koch, A. E. (1998). RANTES expression and contribution to monocyte chemotaxis in arthritis. Clin Immunol Immunopathol 89, 44-53. von der Haar, T., Gross, J. D., Wagner, G., and McCarthy, J. E. (2004). The mRNA cap- binding protein eIF4E in post-transcriptional gene expression. Nat Struct Mol Biol 11, 503-511.

Vroon, A., Heijnen, C. J., Lombardi, M. S., Cobelens, P. M., Mayor, F., Jr., Caron, M. G., and Kavelaars, A. (2004). Reduced GRK2 level in T cells potentiates chemotaxis and signaling in response to CCL4. J Leukoc Biol 75, 901-909.

Wang, F., Herzmark, P., Weiner, O. D., Srinivasan, S., Servant, G., and Bourne, H. R. (2002). Lipid products of PI(3)Ks maintain persistent cell polarity and directed motility in neutrophils. Nat Cell Biol 4, 513-518.

Wang, Y., Tao, L., Mitchell, E., Bogers, W. M., Doyle, C., Bravery, C. A., Bergmeier, L. A., Kelly, C. G., Heeney, J. L., and Lehner, T. (1998). Generation of CD8 suppressor factor and beta chemokines, induced by xenogeneic immunization, in the prevention of simian immunodeficiency virus infection in macaques. Proc Natl Acad Sci U S A 95, 5223-5228.

Wang, Y. H., Liu, S., Zhang, G., Zhou, C. Q., Zhu, H. X., Zhou, X. B., Quan, L. P., Bai, J. F., and Xu, N. Z. (2005). Knockdown of c-Myc expression by RNAi inhibits MCF-7 breast tumor cells growth in vitro and in vivo. Breast Cancer Res 7, R220-228.

263

Warburg, O., Posener, K., and Negelein, E. (1924). Biochem Z., clii, 309.

Ward, S. G. (2004). Do phosphoinositide 3-kinases direct lymphocyte navigation? Trends Immunol 25, 67-74.

Ward, S. G., Bacon, K., and Westwick, J. (1998). Chemokines and T lymphocytes: more than an attraction. Immunity 9, 1-11.

Watanabe, T., Noritake, J., and Kaibuchi, K. (2005). Regulation of microtubules in cell migration. Trends Cell Biol 15, 76-83.

Webb, D. J., Donais, K., Whitmore, L. A., Thomas, S. M., Turner, C. E., Parsons, J. T., and Horwitz, A. F. (2004). FAK-Src signalling through paxillin, ERK and MLCK regulates adhesion disassembly. Nat Cell Biol 6, 154-161.

Weber, M., Blair, E., Simpson, C. V., O'Hara, M., Blackburn, P. E., Rot, A., Graham, G. J., and Nibbs, R. J. (2004). The chemokine receptor D6 constitutively traffics to and from the cell surface to internalize and degrade chemokines. Mol Biol Cell 15, 2492-2508.

Wong, M., and Fish, E. N. (1998). RANTES and MIP-1alpha activate stats in T cells. J Biol Chem 273, 309-314.

Wong, M., Uddin, S., Majchrzak, B., Huynh, T., Proudfoot, A. E., Platanias, L. C., and Fish, E. N. (2001). Rantes activates Jak2 and Jak3 to regulate engagement of multiple signaling pathways in T cells. J Biol Chem 276, 11427-11431.

Wong, M. M., and Fish, E. N. (2003). Chemokines: attractive mediators of the immune response. Semin Immunol 15, 5-14.

264

Wong, T., Majchrzak, B., Bogoch, E., Keystone, E. C., and Fish, E. N. (2003). Therapeutic implications for interferon-alpha in arthritis: a pilot study. J Rheumatol 30, 934-940.

Wu, L., LaRosa, G., Kassam, N., Gordon, C. J., Heath, H., Ruffing, N., Chen, H., Humblias, J., Samson, M., Parmentier, M., et al. (1997). Interaction of chemokine receptor CCR5 with its ligands: multiple domains for HIV-1 gp120 binding and a single domain for chemokine binding. J Exp Med 186, 1373-1381.

Wullschleger, S., Loewith, R., and Hall, M. N. (2006). TOR signaling in growth and metabolism. Cell 124, 471-484.

Wyatt, R., and Sodroski, J. (1998). The HIV-1 envelope glycoproteins: fusogens, antigens, and immunogens. Science 280, 1884-1888.

Wymann, M. P., and Marone, R. (2005). Phosphoinositide 3-kinase in disease: timing, location, and scaffolding. Curr Opin Cell Biol 17, 141-149.

Xia, M., Gaufo, G. O., Wang, Q., Sreedharan, S. P., and Goetzl, E. J. (1996). Transduction of specific inhibition of HuT 78 human T cell chemotaxis by type I vasoactive intestinal peptide receptors. J Immunol 157, 1132-1138.

Xiao, X., Wu, L., Stantchev, T. S., Feng, Y. R., Ugolini, S., Chen, H., Shen, Z., Riley, J. L., Broder, C. C., Sattentau, Q. J., and Dimitrov, D. S. (1999). Constitutive cell surface association between CD4 and CCR5. Proc Natl Acad Sci U S A 96, 7496-7501.

Yaal-Hahoshen, N., Shina, S., Leider-Trejo, L., Barnea, I., Shabtai, E. L., Azenshtein, E., Greenberg, I., Keydar, I., and Ben-Baruch, A. (2006). The chemokine CCL5 as a potential prognostic factor predicting disease progression in stage II breast cancer patients. Clin Cancer Res 12, 4474-4480.

265

Yang, Q., and Guan, K. L. (2007). Expanding mTOR signaling. Cell Res 17, 666-681. Yang, Y. F., Mukai, T., Gao, P., Yamaguchi, N., Ono, S., Iwaki, H., Obika, S., Imanishi, T., Tsujimura, T., Hamaoka, T., and Fujiwara, H. (2002). A non-peptide CCR5 antagonist inhibits collagen-induced arthritis by modulating T cell migration without affecting anti- collagen T cell responses. Eur J Immunol 32, 2124-2132.

Yao, Q., Compans, R. W., and Chen, C. (2001). HIV envelope proteins differentially utilize CXCR4 and CCR5 coreceptors for induction of apoptosis. Virology 285, 128-137.

Youngs, S. J., Ali, S. A., Taub, D. D., and Rees, R. C. (1997). Chemokines induce migrational responses in human breast carcinoma cell lines. Int J Cancer 71, 257-266.

Zagury, D., Lachgar, A., Chams, V., Fall, L. S., Bernard, J., Zagury, J. F., Bizzini, B., Gringeri, A., Santagostino, E., Rappaport, J., et al. (1998). C-C chemokines, pivotal in protection against HIV type 1 infection. Proc Natl Acad Sci U S A 95, 3857-3861.

Zapico, I., Coto, E., Rodriguez, A., Alvarez, C., Torre, J. C., and Alvarez, V. (2000). CCR5 (chemokine receptor-5) DNA-polymorphism influences the severity of rheumatoid arthritis. Genes Immun 1, 288-289.

Zeelenberg, I. S., Ruuls-Van Stalle, L., and Roos, E. (2003). The chemokine receptor CXCR4 is required for outgrowth of colon carcinoma micrometastases. Cancer Res 63, 3833-3839.

Zhang, H. M., Yuan, J., Cheung, P., Chau, D., Wong, B. W., McManus, B. M., and Yang, D. (2005). Gamma interferon-inducible protein 10 induces HeLa cell apoptosis through a p53-dependent pathway initiated by suppression of human papillomavirus type 18 E6 and E7 expression. Mol Cell Biol 25, 6247-6258.

Zhang, X. F., Wang, J. F., Matczak, E., Proper, J. A., and Groopman, J. E. (2001). Janus kinase 2 is involved in stromal cell-derived factor-1alpha-induced tyrosine

266

phosphorylation of focal adhesion proteins and migration of hematopoietic progenitor cells. Blood 97, 3342-3348.

Zhou, S., Wang, G. P., Liu, C., and Zhou, M. (2006). Eukaryotic initiation factor 4E (eIF4E) and angiogenesis: prognostic markers for breast cancer. BMC Cancer 6, 231.

Zhou, Y., Kurihara, T., Ryseck, R. P., Yang, Y., Ryan, C., Loy, J., Warr, G., and Bravo, R. (1998). Impaired macrophage function and enhanced T cell-dependent immune response in mice lacking CCR5, the mouse homologue of the major HIV-1 coreceptor. J Immunol 160, 4018-4025.

Zhu, J., Jia, X., Xiao, G., Kang, Y., Partridge, N. C., and Qin, L. (2007). EGF-like ligands stimulate osteoclastogenesis by regulating expression of osteoclast regulatory factors by osteoblasts: implications for osteolytic bone metastases. J Biol Chem 282, 26656-26664.

Zlotnik, A., Morales, J., and Hedrick, J. A. (1999). Recent advances in chemokines and chemokine receptors. Crit Rev Immunol 19, 1-47.

Zlotnik, A., and Yoshie, O. (2000). Chemokines: a new classification system and their role in immunity. Immunity 12, 121-127.

Zuniga, J. A., Villarreal-Garza, C., Flores, E., Barquera, R., Perez-Hernandez, N., Montes de Oca, J. V., Cardiel, M. H., Vargas-Alarcon, G., and Granados, J. (2003). Biological relevance of the polymorphism in the CCR5 gene in refractory and non-refractory rheumatoid arthritis in Mexicans. Clin Exp Rheumatol 21, 351-354.

267