Lysosomotropic Cholesterol Transport Inhibitors As Potential Chemotherapeutic Agents

The Pennsylvania State University

The Graduate School

College of Medicine

Lysosomotropic

Cholesterol Transport Inhibitors

As Potential Chemotherapeutic Agents

A Dissertation in

Genetics

Omer F. Kuzu

Submitted in Partial Fulfillment of the Requirements for the Degree of

Doctor of Philosophy December 2014 ii

The dissertation of Omer F. Kuzu was reviewed and approved* by the following:

Gavin Robertson Professor of Pharmacology, Pathology, and Dermatology Dissertation Advisor Committee Chair

Robert Levenson Professor of Pharmacology, Pathology, and Dermatology

Jin-Ming Yang Professor of Pharmacology

Sinisa Dovat Associate Professor of Pediatric Hematology and Oncology

Michael Verderame, PhD Associate Dean for Graduate Studies

*Signatures are on file at the Graduate School iii

ABSTRACT

According to American Cancer Society’s 2014 Cancer Facts report, cancer is the second leading cause of death in United States and over half million people are expected to die from this deadly disease. Until 2030, it is forecasted to be the primary cause of death with a 45 % increase in new cancer cases. Skin cancer is the most common form of cancer in the United States with more than 3 million cases is diagnosed, annually. Most skin cancers can be surgically removed when detected early. However, melanoma, the malignancy of pigment producing skin cells, is the most aggressive and dangerous of all skin cancers. It accounts for approximately 80% of skin cancer associated deaths.

Until 2013, dacarbazine (DTIC), an alkylating chemotherapeutic agent that was approved by U.S. Food and Drug Administration (FDA) in 1975, was the most common drug used for the treatment of melanoma. Recently, targeted agents such as those targeting the MAP kinase pathway have been approved by the

FDA for the treatment of melanoma. However, in nearly all cases, development of drug resistance limits the efficacy of these agents to only few months.

Therefore, there is need for development of new melanoma therapeutics that have long term efficacy.

Recently, we have identified Leelamine, a small natural compound as a potential chemotherapeutic agent against melanoma. Leelamine was 3 to 5 fold more effective at inhibiting viability of malignant melanoma cell lines compared to iv other skin cells. More importantly, leelamine showed efficacy in-vivo leading to

~60% decrease in the growth of xenografted melanoma tumors. However, very few reports were available regarding the mechanism of action of this agent.

Therefore, the primary objective of my dissertation is to identify the molecular mechanisms leading to leelamine-mediated cancer cell death. Our studies suggested that as a weakly basic amine, leelamine displayed lysosomotropism that lead to its accumulation inside the acidic organelles and consequently disrupted cholesterol egress from lysosomes. Inhibition of intracellular cholesterol transport by leelamine was the leading cause of cell death. These findings led to the development of our secondary objective, which was to explore the chemotherapeutic efficacy of other potential cholesterol transport inhibitors.

A class of weakly basic lysosomotropic compounds called Functional Inhibitors of

Acid Sphingomyelinases (FIASMA) were identified as potential cholesterol transport inhibitors and shown to be effective against melanoma cells as well as xenografted melanoma tumors.

In this dissertation, we show that as a cholesterol transport inhibitor, leelamine and several FIASMA compounds disrupt autophagic flux and inhibit receptor-mediated endocytosis resulting in the shutdown of key pathways to which melanoma cells are addicted. Inhibition of lysosomotropic accumulation of compounds by Bafilomycin-A1 co-treatment or depletion of cellular cholesterol with β-cyclodextrin co-treatment was able to attenuate the cell death mediated by these agents. This study is unique in terms of identification of FIASMA v compounds as potential chemotherapeutic agents showing efficacy through inhibiting intracellular cholesterol transport. In fact, two FIASMA compounds,

Perphenazine and Fluphenazine, that are generic antipsychotic drugs, led to 50 to 60% inhibition of xenografted melanoma tumor development. Since most of the FIASMA compounds were generic tricyclic antidepressants or antipsychotics with well-known toxicity profiles, the findings of this study could open new perspectives for repurposing these drugs for the treatment of advanced-stage cancers.

TABLE OF CONTENTS LIST OF FIGURES……………………………………………………………………..x LIST OF TABLES……………………………………………...….……………..……xiv LIST OF ABBREVIATIONS…………………………………………………..……....xv ACKNOWLEDGEMENTS …………………………………………………………..xvii

CHAPTER 1 Chemotherapeutic Potential of Lysosomotropic Compounds: A Review from Mechanism of action to signaling ...... 1 1.1 Abstract ...... 2 1.2 Introduction ...... 4 1.3 Lysosomotropism ...... 6 1.3.1 Mechanism of lysosomotropism: Cation trapping...... 6 1.3.2 Factors that influence lysosomotropism...... 7 1.3.3 The effects of lysosomotropism on cells and drug distribution .... 7 1.4 Classification of lysosomotropic compounds ...... 8 1.4.1 Class-I lysosomotropic compounds ...... 8 1.4.2 Class-II lysosomotropic compounds ...... 10 1.5 Class-II lysosomotropic compounds inhibit lysosomal cholesterol transport...... 11 1.5.1 Lysosomal cholesterol homeostasis and NPC disease ...... 11 1.5.2 Class-II lysosomotropic compounds inhibit lysosomal cholesterol egress ...... 12 1.6 The effects of inhibition of lysosomal cholesterol transport on cellular cholesterol homeostasis ...... 14 1.6.1 Intracellular cholesterol homeostasis ...... 14 1.6.2 Autophagy as a source of lysosomal cholesterol ...... 15 1.6.3 Inhibition of intracellular cholesterol transport induces autophagy ...... 17 1.6.4 Inhibition of intracellular cholesterol transport blocks autophagic flux ...... 19 1.7 The effects of class-II lysosomotropic compounds on sphingolipid metabolism ...... 19 1.7.1 Acid Sphingomyelinase Deficiency and NPC disease ...... 19 1.7.2 Class-II lysosomotropic compounds inhibit ASM activity: FIASMAs ...... 21 vii

1.8 Chemotherapeutic potential of class-II lysosomotropic compounds 22 1.9 Class-II lysosomotropic compounds increase sensitivity of multidrug resistant cell lines to chemotherapeutic agents ...... 25 1.10 Epidemiological studies ...... 27 1.11 Cell death mediated by Class-II lysosomotropic compounds: mechanisms of action ...... 31 1.11.1 Disruption of integrity of cellular membranes ...... 33 1.11.2 Induction of arachidonic acid metabolism...... 34 1.11.3 Increased oxysterol levels ...... 34 1.11.4 Disruption of mitochondrial membrane cholesterol levels ...... 35 1.11.5 BAX mediated cell death ...... 36 1.11.6 Disruption of Golgi vesiculation and caveolin transport ...... 37 1.11.7 Disruption of lipid rafts and inhibition of endocytosis ...... 37 1.11.8 Inhibition of membrane to cytosol signaling cascades ...... 38 1.11.9 Induction of endoplasmic reticulum stress ...... 40 1.11.10 Inhibition of autophagic flux ...... 44 1.12 The increased sensitivity of cancer cells to class-II lysosomotropic compounds ...... 45 1.12.1 Decreased levels of LAMP-1 and LAMP-2 proteins in cancer cells ...... 45 1.12.2 Decreased activity of ASM in cancer cells ...... 46 1.12.3 Oncogene addiction ...... 47 1.13 Conclusion ...... 48

CHAPTER 2: Leelamine mediates cancer cell death through inhibition of intracellular cholesterol transport...... 50 2.1 Abstract ...... 51 2.2 Introduction ...... 53 2.3 Materials and Methods ...... 55 2.3.1 Cell lines, culture conditions and plasmids...... 55 2.3.2 Cell viability assay and drug treatments...... 56 2.3.3 Caspase dependence, mitochondrial membrane potential and DNA fragmentation assays...... 58 2.3.4 Electron microscopy analyses...... 58 2.3.5 Kinexus and Receptor Tyrosine Kinase Protein Arrays...... 59 2.3.6 Cholesterol localization, quantitation and TLC analyses...... 59 viii

2.3.7 Evaluation of endocytosis...... 60 2.3.8 Analyses of drug uptake using 3H labeled leelamine...... 60 2.3.9 Analyses of lysosomotropism...... 60 2.3.10 Western blot analysis...... 61 2.3.11 siRNA transfections...... 62 2.3.12 Statistical analysis...... 63 2.4 Results ...... 64 2.4.1 Leelamine inhibits autophagic flux in melanoma cells...... 64 2.4.2 Leelamine has lysosomotropic property leading to accumulation in acidic organelles...... 66 2.4.3 Lysosomotropic property of leelamine mediated early caspase- independent melanoma cell death...... 68 2.4.4 Blockage of autophagic flux mediated by leelamine...... 73 2.4.5 Activity of leelamine was not mediated by PDKs or Cannabinoid receptors...... 74 2.4.6 Leelamine induced intracellular cholesterol accumulation and altered cholesterol subcellular localization...... 75 2.4.7 Leelamine inhibited cellular endocytosis...... 78 2.4.8 Leelamine inhibited signaling pathways driving melanoma cell survival...... 80 2.4.9 Leelamine disrupted receptor tyrosine kinase signaling via interference with intracellular vesicular transport systems, which was reversible by cholesterol depletion...... 83 2.5 Discussion ...... 86 2.6 Acknowledgements ...... 90

CHAPTER 3 Intracellular Cholesterol Transport Inhibitors as Potential Therapeutic Agents for Melanoma...... 91 3.1 Abstract ...... 92 3.2 Introduction ...... 94 3.3 Materials and Methods ...... 97 3.3.1 Cell lines, culture conditions and plasmids...... 97 3.3.2 Cell viability assay, drug treatments and IC50 determination. ... 97 3.3.3 Mitochondrial membrane potential, caspase and caspase- dependence assays...... 98 3.3.4 Annexin V- Propidium Iodide staining...... 99 3.3.5 Cholesterol localization assay...... 99 ix

3.3.6 Evaluation of cellular endocytosis...... 100 3.3.7 Western blot analysis...... 100 3.3.8 Immunofluorescence analyses...... 101 3.3.9 Animal studies...... 102 3.3.10 Statistical analysis...... 102 3.4 Results ...... 103 3.4.1 Identification of compounds that kill cancer cells by inhibiting lysosomal cholesterol transport...... 103 3.4.2 Certain FIASMA compounds inhibit export of late endosomal/lysosomal cholesterol by accumulating in these organelles...... 107 3.4.3 Cholesterol transport inhibitors effectively inhibit xenografted melanoma tumor growth...... 110 3.4.4 Cholesterol transport inhibitors block autophagic flux...... 112 3.4.5 CTIs inhibit cellular endocytosis and impair receptor tyrosine kinase - Akt / Stat3 signaling...... 113 3.4.6 Cholesterol transport inhibitors trigger caspase-independent cell death that involves mitochondrial localization of BAX...... 116 3.5 Discussion ...... 122 3.6 Acknowledgements ...... 128

CHAPTER 4 Conclusions and Future Directions...... 129 4.1 Conclusions ...... 130 4.2 Future Directions ...... 132

REFERENCES...... 139

LIST OF FIGURES Figure 1.1 Schematic outline of lysosomotropism...... ……..6

Figure 1.2 Classification of lysosomotropic compounds...... ……..9

Figure 1.3 Viability curves of UACC 903 cells for class-I and class-II lysosomotropic compounds...... 10

Figure 1.4 Class-II lysosomotropic compounds accumulate in luminal membranes and disrupt lysosomal homeostasis...... 11

Figure 1.5 Class-II lysosomotropic compounds inhibit lysosomal cholesterol egress...... ……..14

Figure 1.6 Lysosomal cholesterol accumulation triggers autophagy while inhibiting autophagic flux...... ……..17

Figure 1.7 Class-II lysosomotropic compounds inhibit ASM activity...... 21

Figure 1.8 Class-II lysosomotropic compounds could revert multi-drug resistance through inhibiting ABC family of proteins...... 27

Figure 1.9 Cell death pathways triggered by class-II lysosomotropic compounds...... 31

Figure 1.10 Leelamine mediated alterations in PKC singling...... 42

Figure 1.11 Baicalein, GO6976 or Staurosporine protects UACC 903 cells from leelamine mediated cell death...... 43

Figure 1.12 Cellular alterations that might be mediating sensitivity of cancer cells to class-II lysosomotropic compounds...... …..48

Figure 2.1 Vacuolization of melanoma cells following leelamine treatment...... ……..64

Figure 2.2 TEM analysis of leelamine treated UACC 903 cells………….……64

Figure 2.3 Western blot analyses of LC3B and P62 protein levels as a marker of autophagic flux …………………………………………….……..65

Figure 2.4 Light microscopic images of melanoma cells following leelamine treatment …………………………………………..………...... ….…..66

Figure 2.5 Kinetics of 3H-labeled leelamine uptake …….....…………….…....67

Figure 2.6 Viability of cells exposed to conditioned media that is collected from leelamine-treated melanoma cells..………………..….……..67

Figure 2.7 Histogram showing lysosomotropic property of leelamine, assessed by its competition with LysoTracker Red DND-99 dye..……..…....68

Figure 2.8 Viability of melanoma cells treated with leelamine in the absence or presence of V-ATPase inhibitors ..…………………………….…68

Figure 2.9 Abietic acid a structurally similar compound to leelamine without an amine group fails to induce vacuolization and death of melanoma cells ..…………………………..…………………….…..69

Figure 2.10 Caspase dependence of leelamine-mediated cell death..…….…..70

Figure 2.11 DNA laddering assay following leelamine treatment...…...…...…..70

Figure 2.12 Leelamine mediated cell death does not involve de-novo protein synthesis or leakage of proteases from lysosome...…………...….71

Figure 2.13 Histogram showing mitochondrial membrane potential following leelamine or FCCP (positive control) treatments....………..….…..72

Figure 2.14 Viability curves of wild-type or BAX-knockout HCT116 cells following leelamine treatment....………………………………..…...73

Figure 2.15 Viability of melanoma cells following cotreatment of leelamine with various apoptotic signal inhibitors....……………………..…...73

Figure 2.16 Viability curves of wild-type or atg5-knockout MEF cells following leelamine treatment....………………………………..…...74

Figure 2.17 Leelamine mediated cell death does not involve activity of the PDK isoforms....…………………………………………………..…...75

Figure 2.18 Leelamine mediated cell death does not involve activity of the cannabinoid receptors....…….…………………………………...…..75

Figure 2.19 Leelamine-mediated intracellular cholesterol accumulation...... 76

Figure 2.20 Dependence of leelamine mediated cell death to intracellular cholesterol accumulation....…….…………… …………..……...…..78

Figure 2.21 Effect of statins on melanoma cell death melanoma cells...... …...78

Figure 2.22 Inhibition of cellular endocytosis by leelamine ...... ………..…...79 xii

Figure 2.23 Schematic summary of leelamine mediated alterations in signaling pathways....…….…………………………………….…..…82

Figure 2.24 Analyses of the Kinexus protein array data with IPA software…...82

Figure 2.25 Western blot analysis of melanoma cells treated with increasing concentrations of leelamine with or without BafA1...... …...83

Figure 2.26 RTK protein array analysis of various RTKs following leelamine treatment.....………………..….…………………………………..…...83

Figure 2.27 Western blot analysis of leelamine treated cells.……………...…..84

Figure 2.28 Immunofluorescence staining of members of receptor tyrosine kinase signaling following leelamine treatment ....…..………...…..84

Figure 2.29 Western blot analysis shows restoration of leelamine mediated signaling alterations by cholesterol depletion…………….…..…....85

Figure 2.30 Schematic summary of cellular alterations mediated by leelamine....…….………………………..………………………...…..88

Figure 3.1 Distribution of IC50 values of FIASMAs for various melanoma cell lines and FF2441 fibroblasts.....…….……...……………...…..105

Figure 3.2 Histogram showing distribution of calculated pKa values of FIASMAs.....…….……...……………...... …..106

Figure 3.3 Viability curves of UACC 903 melanoma and fibroblast cells following 24 hours of treatment with various FIASMAs…...…...... 107

Figure 3.4 FIASMAs trigger melanoma cell vacuolization….…………....…..108

Figure 3.5 BafA1 protects cells from FIASMA-mediated cell death...... 108

Figure 3.6 Subcellular cholesterol accumulation following Leelamine, U18666A or FIASMA treatments.....…….……...……………...…..109

Figure 3.7 Viability of UACC 903 melanoma cells following FIASMA treatment alone or in combination with -cyclodextrin.....…...…..110

Figure 3.8 Effect of FIASMAs on xenografted melanoma tumor growth.…...111

Figure 3.9 FIASMAs inhibit autophagic flux.....…….……...….…………...…..112

xiii

Figure 3.10 FIASMAs inhibit cellular endocytosis...... ……...……………...…..114

Figure 3.11 Immunofluorescence staining of IGF1R-…...……...………...…..115

Figure 3.12 Western blot analysis of UACC 903 cells treated with various FIASMA compounds...... …….……...……………...…..116

Figure 3.13 FACs analysis showing annexin V- APC/PI staining of CTI treated UACC 903 cells...... …….……...………...... …..117

Figure 3.14 Viability of cells treated with leelamine or CTIs in the absence or presence of necrosis inhibitors IM54 and/or Necrostatin-V...... 118

Figure 3.15 Histogram showing mitochondrial membrane potential following CTI or FCCP treatments...... 118

Figure 3.16 Viability of wild-type or BAX-knockout HCT116 cells after treatment with increasing concentrations of CTIs...... 119

Figure 3.17 Viability of cells treated with leelamine or CTIs in the absence or presence of apoptosome inhibitor NS3694...... 120

Figure 3.18 Caspase-dependence of CTI mediated cell death...... 121

xiv

LIST OF TABLES Table 2.1: Compounds and sources………...... ……………………...………..57 Table 2.2: Antibodies and sources...……………...... …………………...……..62 Table 2.3: siRNA sequences and sources...…………...... …..………………..63 Table 2.4: Alterations in protein expression or activity following leelamine treatment....……………..………...... …………………….....….…..81 Table 3.1: Compounds and sources……………………………...... ………..98 Table 3.2: Antibodies and sources...…………...... …………………...……...101

Table 3.3: Biochemical properties and IC50 values of FIASMA compounds for fibroblasts and various melanoma cell lines.………… ………...... 104

LIST OF ABBREVIATIONS AA Arachidonic acid ABC ATP-binding cassette AEBSF 4-(2-Aminoethyl) benzenesulfonyl fluoride hydrochloride AKT protein kinase B ALLN Calpain Inhibitor I AO Acridine orange ASM Acid Sphingomyelinase ASMD Acid Sphingomyelinase Deficiency ATP Adenosine triphosphate BAX Bcl-2-associated X protein BBB Blood-brain-barrier BCA Bicinchoninic acid assay BRAF B-Raf proto-oncogene, serine/threonine kinase CAD Cationic amphiphilic drugs CERP Cholesterol efflux regulatory protein CNS Central Nervous System CTI Cholesterol transport inhibitor DMEM Dulbecco's Modified Eagle Medium ER Endoplasmic reticulum FACS Fluorescence-activated cell sorting FCCP Carbonyl cyanide-p-trifluoromethoxyphenylhydrazone FDA Food and Drug Administration FIASMA Functional inhibitors of acid sphingomyelinase activity GFP Green flourscent protein GPRD General Practice Research Database HGFR Hepatocyte growth factor receptor IGFIR Insulin-like growth factor type-I receptor IPA Ingenuity Pathway Analyses LDL Low-density-lipoprotein LMP Lysosomal membrane permeabilization xvi

LSD Lysosomal storage diseases MAPK Mitogen-activated protein kinase MDR Multi-drug resistant MEF Mouse embryonic fibroblast MMP Mitochondrial membrane potential MOMP Mitochondrial outer membrane permeabilization MTS 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide NPC Niemann-Pick Disease PARP Poly ADP ribose polymerase PBS Phosphate-buffered saline PDGFR Platelet-derived growth factor receptor PDK Pyruvate dehydrogenase kinases PE Phosphatidylethanolamine PI Propidium iodide PKC Protein Kinase C PTEN Phosphatase and tensin homolog PVDF Polyvinylidene fluoride QSAR Quantitative structure–activity relationship RAW Mouse leukaemic monocyte macrophage cell line RFP Red flourscent proteins RIPA Radioimmunoprecipitation assay buffer ROS Reactive oxygen species RTK Receptor tyrosine kinases SREBP Sterol regulatory element-binding protein SSRI Selective serotonin reuptake inhibitor STAT Signal Transducers and Activators of Transcription TCA Tricyclic antidepressants TLC Thin layer chromatography TMRE Tetramethylrhodamine, ethyl ester UPR Unfolded protein response WB Western blot xvii

Acknowledgements

I shall be failing in my duty if I do not mention the generous help and guidance received from following persons throughout my study. Hence, I would like to like to offer my heartfelt thanks to each of them. But first of all, cordial thanks to my supervisor Dr. Gavin P. Robertson for his continues support and mentoring. He was the person who accepted me as a Ph.D student and encouraged me to move forward in my career.

I would also like to thank previous and current members of my dissertation committee: Dr. Jin-Ming Yang, Dr. Robert Levenson, Dr. Sinisa Dovat, Dr. Philip Lazarus and Dr. Jiyue Zhu for their thoughtful guidance, comments and support.

I would like to extend my thanks to my lab seniors, who taught me all of the laboratory techniques that I performed throughout this dissertation. Before joining this lab I did not had opportunity to practice these techniques and Dr. Arati Sharma, Dr. Raghavendra Gowda and Dr. SubbaRao Madhunapantula were much more than kind to support and guide me during my studies. There is no doubt that, this dissertation would not have been possible without them.

I would like to take this opportunity to thank Gregory Kardos, Ian Huffnagle, Yu-Chi Chen and all other previous Robertson Lab members for their help, patience and their valuable advices while I worked on this project.

Finally, I would like to thank wife, Imran Kuzu who was always there to encourage me up and stood by me with her spiritual supports and best wishes.

xviii

This study is dedicated to my dear parents; Fikriye and Mehmet Kuzu. Both of them gave me unconditional love and sacrificed so much that I am the person I am today because of them. Their teachings to me are invaluable.

CHAPTER 1

Chemotherapeutic Potential of Lysosomotropic Compounds: A Review from Mechanism of Action to Signaling 2

1.1 Abstract Weak bases that readily penetrate through the lipid bilayer and accumulate inside the acidic organelles are known as lysosomotropic molecules. These molecules are protonated in low pH environments and lose lipophilicity causing entrapment in these environments. Many lysosomotropic compounds are approved as drugs and have been being used as antidepressant, antipsychotic, antihistamine, antifungal and antimalarial agents for several decades. Notably, studies have also suggested their potential as anti-cancer agents. These agents have been reported to inhibit viability of cancer cell lines in significantly lower concentrations compared to normal counterparts. Several of them were able to increase sensitivity of multidrug resistant cancer cells to certain chemotherapeutic agents. Chemotherapeutic potential of these agents was also supported by a number of epidemiological studies, while some of these agents were tested in clinical trials with promising results. Studies regarding the mechanism of these lysosomotropic compounds suggest that effects can be distinct depending on cell line and chemical structure. Therefore, understanding the common molecular alterations mediated by lysosomotropic compounds has significant importance for revealing their chemotherapeutic potential.

This review introduces the concept of lysosomotropism and separates lysosomotropic compounds into two major groups according to cytotoxicity. In this classification, in contrast to class-I, class-II lysosomotropic compounds display significant toxicity against certain cancer cells. Therefore, this review mainly focuses on class-ii lysosomotropic compounds. Briefly, the mechanism of 3 inhibition of intracellular cholesterol transport by class-II lysosomotropic compounds, its effect on intracellular cholesterol homeostasis, chemotherapeutic potential of these agents, their mechanism of action to induce cancer cell death and mediators of the increased sensitivity of cancer cells to these agents is discussed.

1.2 Introduction Weakly basic, lipophilic amine compounds that induce rapid vacuolization of cells following accumulation inside the acidic cell compartments are known as lysosomotropic molecules (1, 2). The term “lysosomotropism” was first introduced in 1974 by de Duve et al. to define compounds that accumulate to several hundred fold higher concentrations within the lysosomes compared to the cytosol (1). Lysosomotropic molecules are protonated at low pH environments

(e.g. lysosomes and endosomes) and consequently lose lipophilicity leading to entrapment inside these organelles. The degree of drug accumulation depends on pH of the cellular compartment, and physicochemical properties of the compound such as pKa and membrane permeability. Approximately 40% of a model lysosomotropic amine gets trapped inside the lysosomes following its treatment (3). Lysosomal trapping also affects distribution of compounds in body tissues. Lysosomotropic agents preferentially tend to accumulate in the liver and lungs ,as these organs have the highest abundance of lysosomes (4).

Lysosomes, endosomes and the golgi apparatus are the major acidic organelles of the cells that are found virtually in all mammalian cells. Lysosomes are the digestion and recycling centers, containing over 50 hydrolytic proteases

(such as glycosidases, sulfatases, nucleases and lipases) that have optimal activity in acidic environments (5). On the other hand, endosomes are compartments of the endocytic transport system that is primarily involved in internalization of material from the plasma membrane(6). They function as a sorting compartment of the cell where ingested material is sorted before it 5 reaches the lysosomes for degradation. During this process early endosomes bud from the plasma membrane and then mature into late endosomes before fusing with lysosomes. Both lysosomes and late endosomes are formed from a number of intraluminal membranes and a layer of external limiting membrane.

The acidic lumen of both organelles are established by the activity of the vacuolar H+ ATPase (V-ATPase) proteins that are located at the external membrane (5). These proteins hydrolyze ATP to transport protons (hydrogen ions) across the external limiting membrane.

Lysosomotropic compounds are ubiquitously found between approved therapeutic drug molecules (7). Currently, several of them are being used as antimalarial (e.g. Chloroquine, Pyrimethamine); antipsychotic (e.g.

Trifluoperazine, Fluphenazine) antidepressant (e.g. amitriptyline, Maprotiline); antihistamine (e.g. Mebhydrolin, Terfenadine); antibiotic (e.g.) or antifungal compounds. Lysosomotropic properties of these drugs contribute to therapeutic activities (8). For instance, chloroquine, the most frequently used antimalarial drug, shows its therapeutic activity partially due to its lysosomotropic property (9).

It accumulates inside the acidic food vacuoles of the malaria parasite and interferes with essential processes that are required for the parasite’s life-cycle.

Additionally, preclinical studies have suggested potential anti-cancer properties of lysosomotropic compounds. Especially tricyclic antidepressants and antipsychotic compounds exhibited anti-proliferative, anti-metastatic and pro- apoptotic effects as well as restored sensitivity of multidrug resistant cancer cells to certain chemotherapeutic agents (10-13). In this review, the concept of 6 lysosomotropism will be briefly introduced, but the primary focus will be on the molecular alterations mediated by lysosomotropic compounds and chemotherapeutic potential as anti-cancer agents.

1.3 Lysosomotropism

1.3.1 Mechanism of lysosomotropism: Cation trapping. Compounds with basic moieties Figure 1.1 tend to accumulate inside the acidic environments (7). Although they have diverse structures, many lysosomotropic compounds harbor a nitrogen atom that is responsible for weakly basic properties. With a low pH lumen, acidic organelles attract Figure 1.1 Protonation of weakly basic these basic compounds and trigger amines triggers their accumulation in acidic organelles. Lipophilic, weak bases can accumulation inside the lumen. readily diffuse through membranes in neutral form. However, upon protonation in acidic environments, these compounds lose Briefly, as described in Figure 1.1, membrane permeability becoming trapped in these organelles. weakly basic compounds can readily diffuse through the limiting membrane of the lysosomes in unionized form (B), however in acidic lumen they become protonated (HB+) and lose their membrane permeability. Due to their decreased membrane permeability, these molecules cannot cross-back to the cytosol hence become trapped in the acidic lumen.

Thus, this phenomenon has also been called as “ion trapping” (14). 7

1.3.2 Factors that influence lysosomotropism. There are many factors that influence the degree of lysosomotropism.

Among these are: pH of the environment, dissociation constant (pKa) and lipophilicity of the compound. The increase in difference between pH of the lumen and cytosol positively correlates with accumulation of protonated amine in the acidic lumen. pKa is a quantitative measure of the strength of an acid (or base) in a solution. As they are weak bases, lysosomotropic compounds tend to have a basic pKa value between 6.5 and 11 (15). Lipophilicity of a compound is an important factor that determines its passive diffusion through the lipid bilayer.

Partition-coefficient (logP) is the measure of the solubility of a compound in hydrophobic and hydrophilic environments. Hence, it is a useful quantity in estimating the distribution of drugs between hydrophobic compartments (such as lipid membranes) and hydrophilic compartments (such as cytosol).

1.3.3 The effects of lysosomotropism on cells and drug distribution Lysosomotropic compounds trigger cellular vacuolization following treatment.

Although the details of the vacuolar response were not well understood, it has been shown that both late endosomal and lysosomal proteins co-localize with amine induced vacuoles. Based on this observation, it is hypothesized that these vacuoles could be greatly expanded into hybrid organelles that were formed by fusion of lysosomes with late endosomes through trafficking in a retro-grade manner (7).

Lysosomotropism also affects drug distribution in the body. Lysosomotropic drugs can accumulate in various tissues due to uptake by acidic organelles and 8 the lipophilic character of the compound (16). Competition for acidic organelles affects their distribution thus lysosomotropic drugs such as tricyclic antidepressants, phenothiazine neuroleptics and selective serotonin reuptake inhibitors mutually decrease tissue uptake of each other when they are taken together (17, 18).

1.4 Classification of lysosomotropic compounds Lysosomotropic compounds can be classified into two major groups based on cytotoxic activities. Hydrophilic lysosomotropic molecules such as ammonium

(NH3), methylamine (CH3NH2), ethylamine (CH3CH2NH2), propylamine

(C2H5CH2NH2) can be classified as class-I compounds while lysosomotropic molecules with at least one or more hydrophobic rings and a hydrophilic tail that generally harbors polarizable amine group can be classified as class-II compounds (Fig. 1.2). Tricyclic antidepressants (Imipramine, Nortriptyline,

Amitriptyline, Trimipramine), phenothiazine antipsychotics (e.g., Promazine,

Fluphenazine, Perphenazine, Thioridazine), antihistamines (e.g., Desloratadine,

Promethazine), SSRIs,(e.g., Sertraline, Fluvoxamine, Fluoxetine) U18666A, leelamine, monodansylcadaverine (MDC), acridine orange (AO) and chloroquine are examples of class-II lysosomotropic compounds.

1.4.1 Class-I lysosomotropic compounds The members of the class-I lysosomotropic compounds are generally well tolerated by cells. Although they induce vacuolization, they do not trigger cell death up to millimolar concentrations. For instance, the viability curves for UACC

903 melanoma cells for various class-I lysosomotropic molecules are shown in 9 Figure 1.2

Figure 1.2 Classification of lysosomotropic compounds. Lysosomotropic compounds can be classified into two groups according to their cytotoxicity. Class-I lysosomotropic compounds do not induce cell death up to mililmolar concentrations. Class-II lysosomotropic compounds are more lipophilic molecules and tend to accumulate in luminal membranes of the acidic organelles.

Figure 1.3. The IC50 values for these compounds were in millimolar range.

These hydrophilic lysosomotropic compounds accumulate inside the lumen of acidic organelles in which they raise the pH and disrupt organelles homeostatic balance only at very high concentrations (19). In fact, at millimolar concentrations they block the lysosomal pathway of protein degradation and suppress new protein synthesis (20, 21).

Figure 1.3

Figure 1.3 Viability curves UACC 903 melanoma cells following 24 hour treatment with increasing concentrations of various lysosomotropic agents.

1.4.2 Class-II lysosomotropic compounds On the other hand, class-II lysosomotropic compounds are significantly more toxic to the cells and they are able to induce cancer cell death in micromolar concentrations. The major difference between this group and the aforementioned one is hypothesized to be the localization of these compounds to the intralysosomal membranes. Most of these class-II agents exhibit an amphiphilic character. These agents harbor hydrophobic rings that give lipophilic character and a hydrophilic domain with an ionizable amine group that gives lysosomotropic character. Hydrophobic portion of these compounds allows their accumulation in the internal membranes of the lysosome, that perturbs activity of lysosomal membrane proteins such as acid sphingomyelinase, NPC2 (Niemann- 11

Pick disease, type C2) and phospholipases (22, 23) (Fig. 1.4). As a consequence, lysosomal lipid homeostasis becomes disrupted and lipids such as cholesterol, sphingomyelin and Figure 1.4 other phospholipids accumulate Figure 1.4 Class-II lysosomotropic compounds inside the lysosomal cell accumulate in luminal membranes and compartments, eventually leading disrupt lysosomal homeostasis. Due to to cell death (23). their hydrophobic structures, class-II lysosomotropic compounds tend to accumulate in luminal membranes where they disrupt the function of lysosomal proteins leading to lysosomal lipid accumulation.

1.5 Class-II lysosomotropic compounds inhibit lysosomal cholesterol transport

1.5.1 Lysosomal cholesterol homeostasis and NPC disease Lysosomes play crucial role in intracellular cholesterol homeostasis.

Mammalian cells acquire cholesterol as low-density-lipoprotein (LDL) bound cholesteryl esters through receptor-mediated endocytosis (24). Following uptake, LDLs are transported to the lysosomes through endosomes. In lysosomes, lysosomal acid cholesterol esterase (Lipase A, LIPA) hydrolyses cholesteryl esters to unesterified free cholesterol molecules which get rapidly distributed to endoplasmic reticulum (ER) and plasma membrane. Two lysosomal proteins, NPC1 and NPC2 play crucial roles in lysosomal cholesterol homeostasis. NPC2 is a soluble protein that is localized in the lumen of 12 lysosomes and late endosomes. It extracts and transports cholesterol from internal membranes to NPC1 protein, which is localized at the limiting membrane of the organelles. Therefore, NPC1 and NPC2 proteins cooperate to transport free cholesterol molecules to out of lysosomes.

Loss of function mutations in NPC1 (95 % of the cases) and NPC2 (5% of the cases) proteins leads to a fatal, neurodegenerative disorder called Niemann-Pick

Type C disease(25). In consistent with the function of these two proteins, the hallmark of NPC disease is elevated levels of free cholesterol in lysosomes and late endosomes. Under steady-state conditions, lysosomes of cultured human fibroblasts constitute 6% of the total cellular cholesterol. However, this pool of lysosomal cholesterol was increased up to 10-fold in NPC fibroblasts (26, 27).

1.5.2 Class-II lysosomotropic compounds inhibit lysosomal cholesterol egress A variety of class-II lysosomotropic compounds such as imipramine, stearylamine and U18666A have been reported to induce a NPC-like cellular phenotype. In fact, U18666A is a widely used agent to study NPC disease.

U18666A causes several fold increase in cholesterol levels of late endosomes and lysosomes without affecting the pH of these organelles (26, 27). Lloyd-

Evans and colleagues have published an elegant study that reveals the molecular basis of NPC1 disease (27). They identified that dysfunctional NPC1 protein initially causes a 2-fold increase in sphingosine levels in lysosomal/late endosomal cell compartments leading to calcium depletion in these organelles, followed by cholesterol and sphingomyelin accumulations. Treatment of RAW 13 macrophages with U18666A elevated the sphingosine levels within 10 minutes, which remained high for 24 hours. 30 minutes after treatment calcium levels in the acidic compartments was reduced 50% and continued to decrease up to 20% of the control within the first two hours. 2 and 8 hours after treatment, sphingolipid and cholesterol levels were elevated, respectively. Furthermore they also discovered that sphingosine was the only lipid that was capable of inducing these cellular abnormalities. Treatment of RAW macrophages with sphingosine dose-dependently decreased the lysosomal calcium levels and triggered lysosomal cholesterol accumulation. Inhibition of sphingosine synthesis through myriocin (an inhibitor of serine palmitoyl transferase 1) treatment was able to overcome all of the abnormalities that were observed in NPC1-mutant cells. The significance of sphingosine accumulation was consistent with the findings that, lysosomal sphingosine levels were increased up to 24-fold in the liver and spleen of NPC patients (28). Lloyd-Evans et al. suggested that sphingosine was an initiating factor in NPC disease; however, the link between

NPC1 protein and sphingosine has not yet been elucidated.

In lysosomes, sphingosine is a product of sphingolipid degradation by ceramidase (aCERase) enzyme. The primary amino group of the sphingosine is protonated at the acidic pH of lysosomes, hence has low permeability through the lysosomal membrane (29). Thus, sphingosine requires a transporter to aid its exit from lysosomes and NPC1 was suggested to be the key protein regulating this process. However, studies by Tomas and colleagues eliminated this possibility by showing evidence against possible involvement of NPC1 in 14 sphingosine export (30, 31). Therefore, further studies are required to clarify the significance of sphingosine accumulation, and to elucidate the link between

NPC1 protein and sphingosine in NPC disease.

1.6 Effects of inhibition of lysosomal cholesterol transport on cellular cholesterol homeostasis

1.6.1 Intracellular cholesterol homeostasis The disruption of lysosomal cholesterol transport not only alters lysosomal cholesterol levels but also disrupts cholesterol homeostasis in whole cell. In steady-state conditions, free cholesterol is transported from lysosomes to plasma membrane and then from plasma Figure 1.5 membrane to endoplasmic reticulum

(Fig. 1.5). An increase in ER cholesterol triggers a signaling cascade that induces acyl-CoA cholesterol acyltransferase (ACAT) enzyme for esterification of free cholesterol molecules to cholesterol esters. Free cholesterol molecules in ER also inhibit sterol regulatory element-binding protein (SREBP) Figure 1.5 Class-II lysosomotropic compounds inhibit lysosomal cholesterol egress. This causes a decrease in ER cleavage. When it is cleaved, cholesterol levels. Cells respond by decreasing cholesterol esterification and SREBP translocates to nucleus and inducing cholesterol synthesis and import.. triggers transcription of genes involved in cholesterol synthesis and import, such 15 as HMG-CoA reductase, and LDL receptors, respectively. Therefore, excess cholesterol not only triggers its own esterification but also inhibits new cholesterol synthesis and import. Inhibition of lysosomal cholesterol rapidly reduces ER cholesterol which in turn inhibits ACAT activity and triggers cholesterol synthesis through HMG-CoA reductase activation. In fact, 5 uM U18666A has been shown to inhibit ACAT activity by ~65% in fibroblast cells (32).

It is important to note that, exogenous LDL-cholesterol is not the only source for lysosomal cholesterol. In fact, U18666A was able to trigger lysosomal cholesterol accumulation in the absence of exogenous LDL-cholesterol (26).

There is significant evidence suggesting that cholesterol flows between different compartments (e.g. plasma membrane, lysosome, ER, Golgi, mitochondria) of the cell. It is reported that, 65 to 80% of the cellular cholesterol is located in the plasma membrane and this pool constantly moves between cell interior and surface (33). For instance, lipid rafts are important signaling domains located in plasma membrane and enriched in cholesterol levels. Inductions of the many receptors trigger their internalization to lysosomes through the endocytic pathway. Hence, during the lipid-raft-involved endocytosis significant amount of cholesterol is transported to the lysosomes.

1.6.2 Autophagy as a source of lysosomal cholesterol Autophagy is a self-digestion process that involves recycling of cellular compartments through their degradation in lysosomes and strictly regulated by multiple signaling cascades (34, 35). Autophagy has been classified in to three major groups based on the autophagic process and mechanism of delivery of 16 targeted substrates to lysosomes (36, 37). In this classification, microautophagy involves the direct uptake of cytoplasmic substrates into the lysosome through invagination of the lysosomal membrane (38, 39). Chaperone mediated autophagy involves autophagy of extremely selective protein material through recognition of hsc70 containing protein complex by lysosomal membrane proteins which is followed by unfolding and translocation of the targeted protein across the lysosomal membrane (40). On the other hand, macroautophagy is the main pathway of autophagy that is characterized by formation of double membrane structures around the targeted cytoplasmic substrates (41). The formed structure is known as an autophagosome and fuses with lysosomes for the degradation of encapsulated material. This allows recycling of unnecessary or dysfunctional cellular components that promotes cellular survival during nutrient starvation. Macroautophagy is further classified into two types as selective and nonselective autophagy. In contrast to the nonselective, selective autophagy mediates the elimination of particular damaged or excessive organelles. Therefore, these autophagic processes are also called with particular names such as ribophagy (autophagy of ribosomes), pexophagy (autophagy of peroxisomes), mitophagy (autophagy of mitochondria), reticulophagy or ER- phagy (autophagy of parts of the ER), micronucleophagy (autophagy of segments of the nucleus), lipophagy (autophagy of lipid droplets) and aggrephagy (autophagy of protein aggregates) (36).

Autophagy has been reported to be another important source for lysosomal cholesterol. Ouimet and colleagues discovered that autophagy plays essential 17 roles in delivering cholesteryl esters to lysosomes for hydrolyzation into free cholesterol molecules for their efflux (42). Cholesterol efflux from ATG5-null autophagy-deficient macrophages was significantly diminished in contrast to wild- type counterparts. These findings were consistent with previous reports that shows, ATG5-null-MEF cells accumulate less cholesterol levels following

U18666A treatment in contrast to wild-type counterparts (43). Furthermore, we have observed that ATG5-null-MEF cells were also more resistant to cell death mediated by inhibition of lysosomal cholesterol transport (44).

1.6.3 Inhibition of Figure 1.6 intracellular cholesterol transport induces autophagy While autophagy is an important source for lysosomal cholesterol, it has also been shown that lysosomal cholesterol accumulation; itself triggers autophagy (Fig. 1.6). It is suggested that the decreased levels of cholesterol in cellular organelles, such as ER, could Figure 1.6 Lysosomal cholesterol accumulation triggers autophagy while inhibiting autophagic flux. Decrease in ER cholesterol trigger autophagy as a nutritional induces autophagic pathways through Beclin-1. Induction of autophagy could enhance lysosomal deficiency response (45, 46). In cholesterol accumulation creating a viscous cycle. Disruption of lysosomal homeostasis fact, activation of Sterol inhibits autophagic flux. Inhibition of autophagy through knockdown of BECN1 or ATG5 protects cells from cell death. 18

Regulatory Element-Binding Proteins (SREBP) in NPC1-deficient cells indicates that accumulated cholesterol is invisible to the cells regulatory circuits and could trigger autophagic pathways (47). In wild-type fibroblasts, U18666A treatment induces Beclin-1 (BECN1) levels which is required for the initiation and maturation of autophagosomes (48). This induction has been reported to cause a modest increase in autophagic flux as observed through the degradation of endogenous long-lived proteins(48). It is noteworthy that, while imipramine, another class-II lysosomotropic compound, has been shown to stimulate autophagosome formation, siRNA mediated knockdown of BECN1 was able to suppress imipramine mediated cell death (49). Furthermore, autophagy in NPC disease depends on BECN1 expression and accumulation of autophagosomes was observed in the brains of NPC mice as well as in the fibroblasts of NPC patients (48). Since lysosomal cholesterol accumulation triggers autophagy and autophagy carries cholesteryl esters to the lysosomes, autophagic process creates a positive feedback loop where induction exacerbates the NPC disease via increased lipid storage (43). In fact, inhibition of autophagy decreases cholesterol in NPC1-deficient cells and restores lysosomal processes (43).

1.6.4 Inhibition of intracellular cholesterol transport blocks autophagic flux Lysosomal cholesterol accumulation not only induces autophagy but also blocks autophagic flux due to the inhibition of lysosomal protease activity by stored lipids (Fig. 1.6) (43). Accumulation of LC3B labeled autophagosomes following treatment with various lysosomotropic agents including U18666A has been reported (14). In our studies, we have also observed the accumulation of

LC3B following treatment of melanoma cells with lysosomal cholesterol transport inhibitors such as leelamine and Perphenazine (44, 50). Accumulation occurred as a result of failed fusion of autophagosomes with lysosomes. Therefore, the accumulation of LC3B is likely due to inhibition of autophagic flux, rather than induction of autophagy. Impairment of autophagic flux is potentially detrimental to the cells due to the loss of intracellular homeostasis related to accumulation of damaged intracellular components. Thus, inhibition of lysosomal cholesterol transport leads to both induction of autophagy and disruption of autophagic flux, which can induce cell death.

1.7 The effects of class-II lysosomotropic compounds on sphingolipid metabolism

1.7.1 Acid Sphingomyelinase Deficiency and NPC disease Late endosomes and lysosomes are important organelles for sphingolipid metabolism. Sphingolipids are essential components of plasma membrane and involved in various membrane functions, such as cell recognition and signaling.

Consistent with these functions, sphingomyelins (a type of sphingolipid that 20 contains phosphocholine or phosphoethanolamine polar head groups) are enriched to 50 % in lipid rafts compared to the surrounding plasma membrane

(51). Following internalization, their degradation takes place on the surface of luminal membranes of the late endosomes and lysosomes (52). Altered sphingolipid metabolism and lysosomal/late endosomal cholesterol accumulation are tightly linked to each other. In fact, types A and B form of Niemann-Pick disease are caused by deficiency of acid sphingomyelinase enzyme (ASM) and is therefore also known as Acid Sphingomyelinase Deficiency (ASMD) disorder.

Under steady-state conditions, ASM is localized to the inner membranes of late endosomes/lysosomes and hydrolyses sphingomyelin to generate phosphocholine and ceramide (5). It is a water-soluble glycoprotein and contains positively charged regions promoting its attachment to the intraluminal membranes enriched in negatively charged lipids such as BMP (bis- monoacylglycero phosphate). This attachment not only brings the enzyme to the close proximity to its substrate but also protects the enzyme from the degradation by cathepsins (53, 54).

Deficiency of ASM causes accumulation of sphingomyelin in lysosomal/late endosomal cell compartments. As discussed earlier, NPC2 protein transfers cholesterol from intraluminal membranes to NPC1 to export the cholesterol out of late endosomes. Abdul-Hammed and colleagues studied the effects of various lipid-binding proteins and late endosomal lipids on the transfer of cholesterol between liposomes (55). In this study, they discovered that, NPC2 was the only lipid-binding protein capable of transferring cholesterol between liposomes that 21 was greatly inhibited by addition of sphingomyelin. Moreover, ASM-mediated degradation of liposomal sphingomyelin was able to reverse the inhibition of cholesterol transport (56). These Figure 1.7 observations might explain the accumulation of cholesterol in type A and B forms of the NPC disease.

Cholesterol accumulation creates a vicious cycle by suppressing saposins (sphingolipid activator proteins) that are essential proteins for sphingolipid degrading enzymes

(Fig. 1.7) (57). In fact, in cultured Figure 1.7 Class-II lysosomotropic compounds and type A & B form of NPC cells cholesterol accumulation was disease inhibits ASM activity. Inhibition of ASM activity causes lysosomal sphingomyelin reported to hinder lysosomal acid accumulation. This accumulation inhibits lysosomal cholesterol egress. As a sphingomyelinase activity without consequence, lysosomal cholesterol inhibit sphingolipids activator proteins leading to further accumulation of sphingolipids. affecting total ASM protein levels

(58).

1.7.2 Class-II lysosomotropic compounds inhibit ASM activity: FIASMAs Recently, Kornhuber et al. coined the term “FIASMA” (Functional Inhibitors of

Acid Sphingomyelinase), to characterize a large group of pharmacological agents that are able to inhibit lysosomal acid sphingomyelinase activity without altering ASM protein itself (59). In the literature these compounds are also 22 referred as cationic amphiphilic drugs (CADs) (60). Since they are weakly basic lysosomotropic compounds with hydrophobic rings, they fall into class-II lysosomotropic compounds. These compounds get protonated in acidic environment decreasing membrane permeability. However, protonation of these compounds have also been suggested to trigger their interaction with negatively charged intraluminal membranes. This interaction displaces ASM by disrupting electrostatic attraction between ASM and membrane leading to its inactivity as well as degradation by cathepsins (61). As expected, the disruption of ASM activity was only observed with CAD’s and not with neutral or anionic lysosomotropic (class-I) compounds (62). As a note, class-II lysosomotropic compounds were shown to interfere not only with ASM activity but also with several other lysosomal enzymes, such as lysosomal acid ceramidase and lysosomal phospholipases (63).

1.8 Chemotherapeutic potential of class-II lysosomotropic compounds Recently, we identified leelamine, a small lysosomotropic compound that can effectively kill melanoma cells. Leelamine was able to kill melanoma cell lines at

3 to 4 fold lower concentrations compared to normal cells. More importantly, it caused a 50 to 60 % reduction in the xenografted melanoma tumor growth without any obvious systemic toxicity. We have shown that, leelamine accumulates in lysosomal/late endosomal cell compartments and induced cholesterol accumulation in these organelles. Based on its chemical and biological properties, leelamine is a class-II lysosomotropic compound. We have 23 also investigated further investigated the chemotherapeutic potential of FIASMA compounds, which are also class-II lysosomotropic compounds. We have shown that, FIASMA compounds display lysosomotropic property and inhibit lysosomal cholesterol transport. Leelamine and certain FIASMA compounds induce melanoma cell death at several fold lower concentrations compared to normal fibroblasts. Additionally, chemotherapeutic potential of the some of the FIASMA compounds were investigated in vivo. 50 to 60 % reduction in xenografted melanoma tumor development was observed following Perphenazine (50 mg/kg, every 4 day) or Fluphenazine (25 mg/kg, every 4 day) treatments. Studies related to the mechanism of action of leelamine, and screening of FIASMA compounds are presented in the second and third chapters of this dissertation, respectively.

Studies with leelamine and FIASMA compounds have indicated chemotherapeutic potential of class-II lysosomotropic compounds. Including

Perphenazine and Fluphenazine, most of the FIASMA compounds are CNS

(central nervous system) active drugs such as tricyclic antidepressants and antipsychotics. Although these drugs are prescribed to control depression or to manage psychosis, their anti-cancer potential has also been investigated in in- vitro, in-vivo and epidemiological studies. These drugs were reported to induce cancer cell death with various mechanisms in different cancer types.

Amitriptyline, a generic antidepressant that has been suggested to be used as a supportive care to decrease cancer-associated pain and has been shown to display cytotoxicity against several cancer cell lines including glioma, hepatoma, 24 multiple myeloma, lung cancer, cervical cancer, osteosarcoma and melanoma

(64, 65). In multiple myeloma tumors, amitriptyline was shown to induce p53 and activate Caspase 3 levels while decreasing Bcl-2 and Mcl-1 (two anti-apoptotic proteins) levels. Furthermore, it extended the survival of mice bearing multiple myeloma (65).

Wiklund and colleagues investigated the effect of antipsychotic agents

(reserpine, chlorpromazine, haloperidol, pimozide, risperidone and olanzapine) on the viability of lymphoblastoma, neuroblastoma, non-small cell lung cancer, breast adenocarcinoma cell lines and their normal counterpart cell lines (66).

Other than risperidone, all five antipsychotic agents selectively decreased viability of cancer cell lines in contrast to normal counterparts. Moreover, microarray and quantitative real-time polymerase chain reaction (QRT-PCR) based gene expression analysis showed upregulation of several genes that are involved in cholesterol synthesis, indicating the response of cell to inhibition of intracellular cholesterol transport. Interestingly they also demonstrated that combining these drugs with mevastatin (a cholesterol synthesis inhibitor) was able to increase general cytotoxicity.

In another study, Levkovitz et al. reported the activity of paroxetine and fluoxetine, two selective serotonin reuptake inhibitors, clomipramine, a TCA, against rat glioma and human neuroblastoma cell lines (67). A rapid increase in phosphorylated c-Jun levels and subsequent release of cytochrome C from mitochondria was observed. In contrast to primary brain tissue and neuronal cultures, cancer cells displayed increased sensitivity. These findings were later 25 confirmed by Daley and colleagues, who demonstrated that clomipramine triggers death of human glioma cells by increasing activated caspase 3 levels and inhibiting oxygen consumption (68).

Desipramine, another class-II lysosomotropic antidepressant has been reported to be effective at killing human HT29 colon carcinoma cells (69). In these cells, it disrupted mitochondrial membrane potential, triggered cytochrome

C release and induced cell cycle arrest either at G0/G1-phase or G2/M-phase in a dose-dependent manner. Nortriptyline, a second generation tricyclic antidepressant and class-II lysosomotropic agent, has been reported to kill human osteosarcoma cells by stimulating both extracellular Ca2+ influx and intracellular Ca2+ release (70).

1.9 Class-II lysosomotropic compounds increase sensitivity of multidrug resistant cell lines to chemotherapeutic agents Multidrug resistance (MDR) of cancer is an important reason for the failure of cancer chemotherapeutics. It involves development of resistance to multiple chemotherapeutic agents, even to the ones to which the cells have not been exposed to previously (71). Many class-II lysosomotropic compounds increase sensitivity of MDR cancer cell lines to chemotherapeutic agents such as doxorubicin (5, 11, 72). Thioridazine, a typical antipsychotic drug, has been reported to reverse the resistance of KB-ChR-24 (a multidrug resistant oral carcinoma cell line) cells to doxorubicin, vinblastine, dactinomycin, and daunorubicin. Trifluoperazine and chlorpromazine showed similar but somewhat weaker activity against drug resistance (11). The effect of chlorpromazine on 26

MDR cell lines was also observed in in-vivo studies, where it reversed doxorubicin-resistance in xenografted solid tumors (73).

ATP-binding cassette transporter (ABC) family of genes are known to be associated with multidrug resistance (74). Many of the proteins synthesized from these genes are called as multidrug resistance proteins (for instance ABCB1 gene encodes MDR1 protein etc.). Interestingly, some members of this gene family are also involved in intracellular cholesterol homeostasis. For instance,

ABCA1 protein is known as the cholesterol efflux regulatory protein (CERP) and functions as a cholesterol efflux pump. This relation could explain the efficacy of class-II lysosomotropic compounds on the reversal of multidrug resistance phenotype of cancer cell lines. For instance, amitriptyline was reported to reverse the multidrug resistance of MDR mouse lymphoma cells by decreasing rhodamine-123 efflux (75). The efflux of rhodamine-123 was suggested to be regulated by two members of the ABC family of proteins, ABCB1 and ABCB4

(76). Both of these proteins were associated with cholesterol homeostasis (77-

80). ABCB1 encodes for MDR1 protein and its activity was reported to be reduced by the depletion of cellular cholesterol (81). ABCB4 encodes MDR2/3 protein and mice deficient with MDR2 expression (MDR2-/-) showed a defect in biliary phospholipid and cholesterol secretion (80). In addition, in humans, mutation of this gene was associated with cholestasis, which is also transiently observed in NPC1 disease (82, 83). It was suggested that in NPC1 disease, as a response to depletion of ER cholesterol, activity and expression of cholesterol efflux proteins (ABC family of transporters) are decreased (84). Thus class-II 27 lysosomotropic compounds seem to be able to revert multidrug resistance by decreasing expression and activity of the ABC family of drug efflux proteins (Fig.

1.8).

1.10 Epidemiological studies The chemotherapeutic potential of class-II lysosomotropic compounds, such as tricyclic antidepressants, SSRIs and antihistamines have been studied in epidemiological settings. In a recent study, Walker et al. used the General

Practice Research Database (GPRD) to conduct a correlative case-control study to examine whether previous tricyclic usage was associated with reduced incidence of breast, colorectal, glioma, lung and prostate cancers (85). In this

Figure 1.8

Figure 1.8 Class-II lysosomotropic compounds could revert multi drug resistance through inhibiting ABC family of proteins. 28 study, a significant reverse association between TCA usage and glioma (odds ratio (OR) = 0.59, 95% confidence interval (95%CI) = 0.42–0.81) and colorectal cancer (OR= 0.84, 95%CI= 0.75-0.94) was observed. Importantly, these effects were reported to be dose and time dependent. However, no association was detected for lung, breast or prostate cancers.

In another case-control study, Xu and colleagues investigated whether any association existed between SSRI or TCA usage and risk of colorectal cancer

(86). Although they were unable to detect any association between TCA usage and colorectal cancer risk (OR= 0.96, 95%CI= 0.84-1.10), they detected a significant association between decreased risk of colorectal cancer and high daily

SSRI usage (OR= 0.70, 95%CI= 0.50-0.96). This data was confirmed by

Coogan et al. who reported odds ratios of 0.47 (95%CI= 0.26-0.85) and 0.77

(95%CI= 0.52-1.16) for SSRI and TCA usage, and colorectal cancer, respectively

(87). Another group reported decreased risk of colorectal cancer for persons who used antidepressants (either SSRI or TCA) (OR= 0.7, 95%CI= 0.5-0.9) (88).

However, these studies were contradicted by another study which was conducted on a larger dataset that found no association between colorectal cancer and TCA (OR= 0.94, CI= 0.84-1.05) or SSRI (OR= 0.97, CI= 0.90-1.05) usage (89).

Antidepressant treatment might promote mammary tumor growth in-vivo (90).

Therefore many case-control studies have been conducted to assess whether antidepressant or antipsychotic medication increases breast cancer risk (91-94).

Although some of these studies showed a significant association between breast 29 cancer and antidepressants, most of them contradicted these results (95-107).

Indeed, an inverse relation between Paroxetine (an SSRI type antidepressant) use and breast cancer risk (OR= 0.64, 95%CI= 0.45-0.92) was reported (91).

Linos and colleagues reported an interesting association between decreased risk of glioma and allergies (OR= 0.61, 95%CI= 0.55-0.67), asthma (OR= 0.68,

95%CI= 0.58-0.80) or eczema (OR= 0.69, 95%CI= 0.58-0.82) (108). Based on this report a potential association between glioma risk and antihistamine usage has been investigated in several studies. McCarthy et al. found an inverse association between glioma risk and antihistamine use (109). Their study was conducted on 419 glioma patients and 612 matching controls in which high (OR=

0.66, 95%CI= 0.49-0.87) and low (OR= 0.44, 95%CI= 0.25-0.76) grade glioma patients were found less likely to report any allergy in contrast to controls.

However, contradictory findings have also been reported. In one study, long term antihistamine use was associated with 3.5-fold increase in glioma risk while in another one this ratio was 2.94 fold (110, 111).

Association between prostate cancer and antidepressant or antipsychotic usage has also been investigated through several case-control studies (112,

113). Mortensen reported a decrease in prostate cancer incidence in schizophrenic patients and attributed this observation to high-dose phenothiazine

(primarily chlorpromazine) use (112, 114). However, a controversy finding was reported by Tamim and colleagues whose study suggested a positive and dose- dependent association between prostate cancer and tricyclic antidepressant use when exposure took place 2-5 years prior to cancer diagnosis (113). The odd 30 ratios were 1.31 (95%CI= 1.14- 1.51), 1.58 (95%CI= 1.29–1.93), 2.42 (95%CI=

1.87–3.12) for low, medium and high average daily dose levels, respectively.

As phenothiazine antidepressants are class-II lysosomotropic compounds, association between schizophrenia and cancer risk might indicate the chemotherapeutic potential of these agents. Mortensen investigated the incidence of cancer in 6168 schizophrenic patients and reported decreased cancer risk for respiratory system, prostate and bladder cancers (112). In female patients, uterine cervix cancer was also reduced. On the other hand, an increased risk of breast and pancreatic cancer was observed, which could be attributed to reduced exposure to common carcinogens such as cigarette smoke.

In a more recent study, this association was investigated using a nested case- control study, in more than 40.000 schizophrenia patients (115). 1.9 fold increase of colon cancer risk (OR= 2.90, 95%CI= 1.85-4.57), a slight increase in breast cancer risk (OR= 1.52, 95%CI= 1.10-2.11) and a significant decrease in respiratory cancer risk (OR= 0.53, 95%CI= 0.34-0.85) was observed. However, the claim that patients receiving antipsychotics have a higher risk of colon cancer was criticized and suggested to be related to common lifestyle risk factors observed among schizophrenia patients (116).

In conclusion, class-II lysosomotropic compounds might prevent some cancers while promoting others. Further studies are required to determine in which cancers, even in which subtypes of cancers these compounds might be helpful. Controversies in many case-control studies suggests that, more studies should be conducted on carefully curated larger datasets to identify the 31 associations between drug prescriptions and disease risks. Establishment of human curated databases might be helpful to solve these controversies in close future.

1.11 Cell death mediated by Class-II lysosomotropic compounds: mechanisms of action In the literature, many studies have investigated the mechanisms of cancer cell death mediated by various class-II lysosomotropic compounds. Although many of these studies were not conclusive, some suggested that the link between these compounds and Figure 1.9 cell death might involve multiple pathways (45). According to our studies, cell death mediated by class-II lysosomotropic compounds depends on both the lysosomotropic property of agents and inhibition of intracellular cholesterol transport

(see Chapter 3). In fact,

Bafilomycin A1 mediated inhibition of lysosomotropism or Figure 1.9 Cell death pathways triggered by class-II lysosomotropic compounds. β-cyclodextrin mediated depletion of cholesterol protected cells from death mediated by class-II compounds. 32

As discussed earlier, the lysosomotropic property of class-II compounds enable their accumulation in late endosomal/lysosomal cell compartments where they disturb intrinsic homeostasis of these organelles leading to accumulation of many lipids, but most notably cholesterol. Loss of subcellular cholesterol balance harms proper functioning of many organelles such as Golgi, ER and mitochondria (117, 118). Moreover, oxidized derivatives of cholesterol

(oxysterols) could increase lysosomal membrane permeability causing cell death through cathepsin leakage (119, 120). Disruption of subcellular vesicle transport could suppress receptor-mediated endocytosis as well as exocytosis (121).

Cholesterol depletion from the ER pool could trigger autophagy and ER stress

(122). As lysosomes and late endosomes play crucial roles in many intracellular pathways, disruption of this homeostatic balance could also disrupt mitochondria and intracellular energy balance, increase production of reactive oxygen species, cause mitotic arrest and inhibit protein synthesis (Fig. 1.9)(45).

1.11.1 Disruption of integrity of cellular membranes Cholesterol is an essential structural component of cellular membranes to maintain its integrity as well as fluidity. In cellular membranes, the cholesterol to phospholipid ratio is precisely regulated to maintain proper membrane functioning (123). Accumulation of cholesterol in lysosomal/late endosomal cell compartments could destabilize these organelles leading to an increase in permeability to lysosomal proteases and ions. As a consequence of lysosomal membrane permeabilization (LMP), cathepsins and other proteases leak in to the cytosol where they can trigger both apoptotic or non-apoptotic cell death pathways (119). Although most of the cathepsins are active only in acidic pH, some of them (such as cathepsin B, D or L) can remain active in the neutral pH of the cytoplasm. Complete disruption of lysosomal membranes can trigger necrosis while partial leakage of cathepsins can induce programmed cell death.

Sphingosine has been reported to induce cell death through lysosomal membrane permeabilization. As it was discussed earlier, in NPC disease and following treatment of class-II lysosomotropic compounds, sphingosine accumulates inside the acidic cell compartments causing increased membrane permeability. Induction of programmed cell death following treatment of jurkat T lymphocytes or J744 macrophage cells with sphingosine has been reported (29).

A decrease in mitochondrial membrane potential and activation of caspases were observed. However, a high dose of sphingosine was reported to cause necrosis without caspase activation.

1.11.2 Induction of arachidonic acid metabolism. Arachidonic acid (AA) metabolism could also induce cytotoxicity in NPC disease cells (124). Nakamura and colleagues demonstrated that, NPC1- deficient Chinese hamster ovary cells secrete increased levels of AA compared to wild-type cells. Inhibition of cytosolic phospholipase A-2 (cPLA2) or cultivation of cells in lipoprotein-deficient medium was able to suppress the AA secretion.

Moreover, U18666A treatment triggered AA secretion while inducing reactive oxygen species levels and cell death. Interestingly knockdown of cPLA2 was able to decrease U18666A mediated induction of ROS formation and cell death.

Activation of PLA2 enhanced LMP in a lymphoma cell line; and AA liberated by phospholipases could destabilize lysosomal membranes (125, 126).

Interestingly, activation of caspases by lysosomal proteases could activate cPLA2, creating a positive feedback loop between LMP and cPLA2 activity (127).

However, further studies are required to identify the link between inhibition of cholesterol transport and arachidonic acid metabolism.

1.11.3 Increased oxysterol levels Oxysterols are also capable of inducing cell death through lysosomal membrane permeabilization (120). Roussi et al. have reported that 7β- hydroxycholesterol or 7β-hydroxysitoesterol (major oxidation products of cholesterol) induce apoptosis in Caco-2 cells, in a caspase-dependent manner

(128). Although these compounds share significant structural similarity, they display differences in the cell death mechanism induced by each compound. 7β- hydroxycholesterol induced accumulation of reactive oxygen species and caused 35 mitochondrial membrane permeabilization, whereas 7β-hydroxysitoesterol did not trigger any of these alterations. These differences in cellular responsiveness might be caused by the slight differences in the hydrophobicity of these molecules (119).

1.11.4 Disruption of mitochondrial membrane cholesterol levels Mitochondria lies at the heart of many apoptotic programs and mitochondrial membrane cholesterol is strictly regulated to ensure its proper function (118,

129). Treatment of HeLa cells with U18666A triggers mitochondrial cholesterol loading (130). Increase in mitochondrial cholesterol could disrupt ATP production (131). Yu et al. demonstrated that in NPC1 mouse neuronal cells mitochondrial membrane cholesterol levels were significantly elevated (132). As a consequence of this increase, mitochondrial membrane potential and activity of

ATP synthase was markedly reduced. Methyl-β-cyclodextrin mediated depletion of cholesterol was able to restore mitochondrial dysfunctions and ATP production. Importantly, exogenous ATP treatment was able to rescue impaired neurite outgrowth of NPC1 neurons. Many tumors display high mitochondrial cholesterol content and tricyclic antidepressants were reported to decrease the mitochondrial respiration rate, more effectively in transformed cells (130, 131,

133). These findings suggest that, class-II lysosomotropic compounds could trigger an increase in mitochondrial cholesterol content and consequently impair organelle function.

1.11.5 BAX mediated cell death As we have observed with leelamine and FIASMA compounds, class-II lysosomotropic compounds significantly hinder mitochondrial outer membrane potential. BAX is a pro-apoptotic member of Bcl-2 family of proteins and induces mitochondrial outer membrane permeabilization (MOMP) as a response to various apoptotic stimuli (134). However, BAX has also been shown to participate in lysosomal cell death pathways (119). Using immuno-electron microscopy, Kagedal and colleagues demonstrated that, Staurosporine treatment induces BAX translocation to lysosomal membranes and causes lysosomal membrane permeabilization (135). This observation was validated with purified lysosomal fractions in which they had observed release of lysosomal proteases following incubation with recombinant BAX protein. Feldstein et al. also reported similar observations with free fatty acid induced lipotoxicity (136). BAX was activated and translocated to lysosomes following exposure of liver cells to palmitate. Lysosomal membrane permeabilization was a consequence of this translocation as siRNA mediated knockdown of BAX expression was able to suppress cathepsin release. In our studies we have observed that BAX-/-

HCT116 cells were more resistant to cell death mediated by class-II lysosomotropic compounds (see Chapters II and III). However, further clarification is required to assess whether this effect was regulated by BAX translocation to mitochondria or lysosomes.

1.11.6 Disruption of Golgi vesiculation and caveolin transport Other sources of cytotoxicity mediated by inhibition of intracellular cholesterol could involve disruption of Golgi vesiculation and caveolin transport to the plasma membrane. Caveolins are integral membrane proteins that are involved in the formation of a special type of lipid rafts, called caveolae. Caveolins are upregulated in several MDR cancer cell lines and tumor specimens (137).

Caveolae membranes are enriched in cholesterol and sphingolipids as well as caveolins and perform several functions in signal transduction and endocytosis.

Reverter and colleagues demonstrated that accumulation of late endosomal cholesterol impairs cholesterol supply in Golgi and consequently decreases Golgi vesiculation and caveolin transport (121).

1.11.7 Disruption of lipid rafts and inhibition of endocytosis Cholesterol is an essential component of not only for caveolae but also other lipid rafts and clathrin-coated pits (138). Accumulation of cholesterol inside late endosomes and lysosomes may lead to alterations in the composition of lipid rafts (139). Recently, Kuech et al. analyzed the trafficking profile of dipeptidylpeptidase IV (DPPIV), a lipid raft associated membrane protein, in

NPC1 patient fibroblasts. They found that lipid raft dependent endocytosis was significantly hindered in NPC1 cells. In our studies we observed that, both leelamine and FIASMA compounds hinder endocytosis of Alexa Fluor conjugated transferrin protein (see Chapter II and III). However, many other factors might also be involved in inhibition of endocytosis. In fact, it was hypothesized that, an overall change in membrane elasticity of endosomes or defective calcium 38 homeostasis inside the acidic vesicles could prevent transportation and budding of endocytic vesicles (27, 140).

1.11.8 Inhibition of membrane to cytosol signaling cascades Endocytosis has an essential role in cellular signal transduction. It tightly controls the activity of various membrane receptors such as receptor tyrosine kinases (RTK), G-protein coupled receptors (GPCR) and ligand-gated channels

(e.g. Neurotransmitter receptors) (50, 141, 142). Therefore, inhibition of endocytosis could mediate a general jam in signal transduction pathways. We have shown that treatment of UACC 903 melanoma cells with leelamine or

FIASMA compounds, altered localization of receptor tyrosine kinases and inhibited downstream signaling such as PI3K/AKT and STAT3 cascades. Similar observations have also been reported, where exposure of U-87MG glioblastoma cell line to imipramine induced cell death through inhibiting PI3K/AKT/mTOR signaling cascade (49). Recently, impaired insulin signaling following inhibition of

NPC1 expression has also been reported (143). Both siRNA mediated knockdown of NPC1 and U18666A treatment hindered insulin mediated phosphorylation of AKT protein. The effect was mediated by the decreased levels of caveolae formation as caveolin-1 levels were diminished in plasma membrane. Consistent with this observation, the impairment of insulin signaling was also observed in NPC1 knockout mouse models (144).

Activation of RTKs leads to initiation of diverse signaling cascades such as

PI3K/AKT, MAPK, PKC and STAT. However, following receptor activation, receptors undergo endocytosis which complicates the regulation of the downstream cascades. Surface localized receptors trigger distinct signaling cascades in contrast to internalized ones (145). Some studies suggest that endosome-localized insulin receptors exert greater impact on intracellular signaling cascades in contrast to plasma membrane associated ones (146).

Inhibition of internalization of insulin-like growth factor type-I receptor (IGFIR) suppresses MAPK cascade without altering AKT activation (147). However, recycling of the IGFIR was required to sustain AKT activity (145). Moreover, it has also been reported that STAT3 co-localizes with endocytic vesicles and its activity depends on receptor-mediated endocytosis, as inhibition of endocytosis blocks its nuclear translocation and activity (148). Since malignancies are addicted to the activity of these signaling cascades, class-II lysosomotropic compounds-mediated inhibition of endocytosis could effectively induce cell death in cancer cell lines.

On the other hand, entry of many viruses into the cells depends on receptor- mediated endocytosis (149, 150). Interestingly, it was discovered that NPC1 protein was essential for the Ebola virus entry (151, 152). Primary fibroblast cells derived from NPC1 patients were resistant to infection by Ebola and Marburg viruses (151). shRNA mediated knockdown of NPC1 or treatment of cells with

U18666A or imipramine was able to prevent infection of cells with these viruses.

However, studies suggested that the decrease in infection was not related to a 40 decrease in the uptake of virus but to its transport from endocytic vesicles to cytosol (151).

1.11.9 Induction of endoplasmic reticulum stress Cytotoxicity mediated by class-II lysosomotropic compounds may also involve endoplasmic reticulum (ER) stress. ER is an important sensor for various intracellular stress factors such as accumulation of misfolded proteins and disruption of intracellular calcium homeostasis (122). ER stress is reported to be a common observation in lysosomal storage diseases (LSD) including NPC1

(153). Cholesterol depletion in ER membranes could trigger ER stress due to impaired transport of secretory proteins or due to altered calcium homeostasis

(154, 155). As discussed earlier, in their microarray study Wiklund and colleagues have identified alteration of many genes that are involved in cholesterol regulation, following treatment of cells with antipsychotic agents (66).

However, their microarray results displayed fingerprints of ER stress as evidenced by upregulation of several ER stress-related genes, such as XBP1,

GRP78 (HSPA5), HERPUD1 and C/EBP-β. XBP1 is a UPR transcription factor and regulates expression of ER resident chaperone genes such as GRP78 (156).

HERPUD1 regulates the balance between protein load vs folding capacity of the

ER and its overexpression is considered to be a hallmark of ER stress (157).

C/EBP-β is involved in transition of UPR from a protective to cell death phase

(158). It is noteworthy that, the unfolded protein response includes suppression of protein translation to block further accumulation of unfolded proteins, which 41 could explain the mitotic arrest that is commonly observed in the cells treated with weakly basic amines. (14).

In a recent study, a novel cellular stress response that causes reversible, membrane-whorls like aggregations of the ER was identified (159). This stress response was triggered by various pharmacological chemicals mostly with antipsychotics and antihistamines. Seven of the compounds (Suloctidil,

Astemizole, Chlorpromazine, Terfenadine, Trifluoperazine, Fluphenazine, and

Thioridazine) which were demonstrated to induce this type of ER stress response were FIASMA compounds acting as intracellular cholesterol transport inhibitors.

Moreover, we had observed similar membrane aggregations in leelamine treated

UACC 903 melanoma cells. Hence, this could be a general stress response triggered by class-II lysosomotropic compounds following intracellular cholesterol accumulation. In fact, it was noted that this stress response was different from classical ER stress responses and might involve altered lipid metabolism.

1.11.10 Oxidized-LDL and PKC signaling Oxidized-LDL could induce ER stress and apoptosis through protein kinase C

δ activation (PKCδ) (160). PKCδ was downregulated in transformed keratinocytes and its activation was sufficient for induction of apoptosis in these cells (161). Baicalein, an antioxidant, and an inhibitor of calcium mobilization, was shown to attenuate oxidized-LDL induced apoptosis (162, 163). This compound was also reported to protect neuronal cells against ER-stress-induced apoptosis and cardiomyocytes against the toxicity of doxorubicin through inhibition of JNK activation (164, 165). Qi et al. demonstrated that, following ER 42 stress, PKCδ translocates to the ER and forms a complex with Abl tyrosine kinase to communicate ER stress signals to mitochondria through activation of

JNK signaling (166). In fact, inhibition or knockdown of PKCδ was reported to decrease ER-stress-induced JNK activation and suppress consequent stress- related apoptosis. Formation of this complex was shown to be an essential step for ER-stress-induced apoptosis, both in-vitro and in-vivo. PKD/PKCµ, another member of PKC family of proteins, could be involved in this process as activation of PKCµ is regulated through sequential phosphorylation by PKCδ and Abl kinases (167). PKCµ has also been reported to directly regulate Figure 1.10 the JNK/c-Jun pathway following its activation (168). Consistent with these findings, we observed dose and time dependent activation of PKCδ and PKCµ following leelamine treatment

(Figure 1.10). Baicalein and two

PKC inhibitors, Gö6976 and

Staurosporine, were able to Figure 1.10 Leelamine mediated alterations in PKC singling. effectively suppress leelamine- mediated cell death (Figure 1.11). Importantly, Gö6983, (except PKCµ, inhibits same PKC isoforms with Gö6976), was not able to protect cells from leelamine- mediated cell death, suggesting that inhibition of the PKCµ was the mediator of 43

the protective effect of Figure 1.11 Gö6976 (169). Taken together, these studies demonstrate that class-II lysosomotropic compounds could trigger

ER stress associated membrane aggregations and PKCδ/PKCµ/JNK

Figure 1.11 Co-treatment of Baicalein, GO6976 or signaling could play role in Staurosporine protects UACC 903 cells from leelamine mediated cell death. the cell death process mediated by this stress.

1.11.11 Inhibition of autophagic flux In addition to these mechanisms, autophagy and inhibition of autophagic flux have also been reported to play important role in induction of cell death following inhibition of intracellular cholesterol transport (44, 49). Since the link between lysosomal cholesterol accumulation and autophagy has been discussed above, the details will not be discussed again. However briefly, inhibition of cholesterol transport could induce autophagy due to insufficient cholesterol levels in ER (45,

46). However, excess amount of cholesterol in acidic organelles impairs the fusion of autophagosomes with lysosomes leading to inhibition autophagic flux and consequently accumulation of autophagosomes (43). siRNA mediated knockdown of Beclin-1, a protein that is required for initiation and maturation of autophagosomes, was shown to protect cells from cell death initiated by cholesterol transport inhibitors (48). Consistent with this observation, autophagy- deficient ATG5 knockout MEF cells were resistant to cell death mediated by leelamine (44).

Taken together, inhibition of intracellular cholesterol transport has many impacts on cellular processes and signaling cascades. These alterations might vary between cell lines and might depend on the chemical properties of the compound that inhibits cholesterol transport. Cell death might be a consequence of a combination of multiple altered signaling events. Further investigations are warranted to identify the cause and result relationships between the altered events. 45

1.12 Increased sensitivity of cancer cells to class-II lysosomotropic compounds compared to normal cells An important aspect of class-II lysosomotropic compound mediated cell death is the increased sensitivity of cancer cell lines to these compounds in contrast to normal counterparts. This observation has been extensively reported in the literature as well as observed in our studies with leelamine and FIASMA compounds (67, 170-172). In contrast to normal cells, mutant BRAF/PTEN-/- melanoma cell lines displayed 3-5 fold increased sensitivity against leelamine.

This observation was valid for all of the FIASMA compounds that we have tested.

On average, UACC 903 cells were ~2.9 fold more sensitive to FIASMAs compared to fibroblasts. However, for wild-type BRAF or wild-type PTEN cell lines this difference was less.

1.12.1 Decreased levels of LAMP-1 and LAMP-2 proteins in cancer cells Increased sensitivity of cancer cells to cell death triggered by lysosomal pathways has been investigated (170). Transformation of cells by various oncogenes, such as Ras, Erbb2 or Src, affected maturation, size, and localization of lysosomes. In control cells lysosome-associated membrane protein-1 (LAMP-1) positive vesicles were localized to perinuclear region while they were distributed throughout the cytosol in transformed cells. Transformation of fibroblast cells reduced the levels of LAMP-1 and LAMP-2 proteins. The increased sensitivity of transformed cells was associated with this reduction since siRNA mediated knockdown of LAMP-1 and LAMP-2 was able to sensitize U-2-

OS osteosarcoma cells to cell death triggered by lysosomal pathways. MAPK 46 signaling is over-activated in many cancers including melanoma and regulates cathepsin expression (170). An increased level of cysteine cathepsins suppresses lysosome-associated membrane proteins (LAMP-1 and LAMP-2).

Both cathepsin inhibitors and ectopic expression of LAMP-1/2 proteins were shown to protect transformed cells against the lysosomal cell death pathway.

Moreover, LAMP-1/2 proteins have been reported to be involved in intracellular cholesterol transport as their knockdown results in accumulation of unesterified cholesterol in the late endosomes and lysosomes of fibroblast cells

(173). Enforced expression of LAMP-2 was able to hinder the lysosomal cholesterol accumulation induced by U18666A treatment. Taken together, in cancer cells over-activation of various oncogenes appears to trigger increased cathepsin expression which consequently decreases LAMP-1/2 levels. This decrease triggers sensitivity of transformed cells to lysosomal death pathways potentially through alterations in lysosomal cholesterol homeostasis (Figure

1.12).

1.12.2 Decreased activity of ASM in cancer cells Another factor that contributes to the increased sensitivity of cancer cells was reported to be the decreased activity of ASM in cancer cells (57). Class-II lysosomotropic compounds could be more effective in these cells through blocking the residual ASM activity. Cancer cells display higher levels of activity in membrane to cytosol signaling cascades which depends on membrane dynamics (57). Decreased activity of ASM confers high concentrations of sphingomyelin in cancer cells which could inhibit these processes while 47 enhancing the fragility of lysosomal membranes in tumor cells. Moreover, increased sphingomyelin levels also decreases cholesterol export from lysosomes and consequently inhibits saposins causing a further reduction in sphingolipid degradation (57). This vicious cycle could result further accumulation of sphingolipids up to toxic levels (Figure 1.12).

1.12.3 Oncogene addiction On the other hand, it is noteworthy that, cancer cells have increased activity of certain anti-apoptotic or mitogenic pathways that leads to several malignancies. Many of these signaling cascades are initiated from abnormally functioning proteins. Cancer cells are “addicted” to the activity of these oncogenic signaling cascades and cannot survive when they are suppressed

(174, 175). Many of the oncogenic signals are either initiated from membrane receptors or lie somewhere at the downstream of them. For instance, in melanoma ~17% of the cases involve over-activation of membrane receptors

(such as c-Kit, EGFR, EphA1), ~20% involves activation of RAS and ~60% involves activation of BRAF concurrent with PTEN deletion (176). Taken together, nearly all melanoma cases are addicted to membrane to cytosol signaling cascades and hence melanoma cell lines could have increased sensitivity to the inhibition of endocytosis caused by cholesterol transport inhibitors. In fact, in this dissertation, both leelamine and several other class-II lysosomotropic agents were shown to suppress AKT signaling in melanoma cell lines (Figure 1.12). 48 Figure 1.12 Figure 1.12 Cellular alterations that can mediate sensitivity of cancer cells to class-II lysosomotropic compounds. 1- Activation of MAPK signaling enhances Cathepsin expression which increases lysosomal cholesterol levels through inhibition of LAMP1/2 proteins. In addition, this cascade was reported to affect maturation, size and number of lysosomes which could increase their susceptibility to lysosomal membrane permeability. 2- Decreased ASM activity in cancer cells could induce lysosomal cholesterol levels through increasing sphingosine levels. Accumulated cholesterol inhibits SAPOSINS (Sphingolipid activator proteins) creating a vicious cycle between sphingosine and cholesterol accumulation . 3- Cancer cells are addicted to signaling cascades in which many are initiated from membrane receptors (e.g. AKT signaling). Inhibition of endocytosis could induce cancer cell death through suppressing these cascades.

1.13 Conclusion Selectivity of neoplastic drugs to cancer cells is a great obstacle in cancer chemotherapy. To have a decreased toxicity, cancer drugs need to pose some type of selectivity towards cancer cells. In many studies including the ones in this dissertation, it has been shown that calls-II lysosomotropic compounds tend to show several fold selectivity against various cancer cell lines in contrast to their normal counterparts (67, 68, 133, 170, 171). This selectivity has been attributed to the various metabolic differences, such as altered lysosomal membrane stability, lysosomal pH differences and activity of different signaling pathways between cancer and normal cells. Cancer cell death induced by class-

II lysosomotropic compounds was shown to be complex. Many cellular alterations such as decreased ATP production due to disruption of mitochondria, 49 increased production of reactive oxygen species, toxic molecules such as oxysterols, disruption of lysosomal membrane stability, inhibition of membrane to cytosol signaling and inhibition of autophagic flux have been reported to cause cell death following treatment with these agents. All of these could be triggered by multiple actions of these agents such as inhibition of lysosomal cholesterol egress, inhibition of ASM activity, disruption of intracellular lipid homeostasis and alteration of membrane fluidity.

In this dissertation, inhibition of lysosomal cholesterol egress by leelamine and FIASMAs was shown to impair autophagic flux and cellular endocytosis in melanoma cell lines. Inhibition of cellular endocytosis was suggested to alter localization and activity of various signaling receptors such as IGF1R and HGFR, causing suppression of key signaling cascades required for the viability of melanoma cells. More importantly these class-II lysosomotropic compounds were also effective in-vivo and reduced xenografted tumor growth up to ~60 % of the controls. Since there are many class-II lysosomotropic compounds that are generic drugs with well-established toxicity profiles, further investigations related to the chemotherapeutic potential of these agents have clinical significance and could open new perspectives for repurposing these drugs for the treatment of advanced-stage cancers.

CHAPTER 2

Leelamine mediates cancer cell death through inhibition of intracellular cholesterol transport

Kuzu OF, Gowda R, Sharma A, Robertson GP

Published in Molecular Cancer Therapeutics

2014 Jul;13(7):1690-703

2.1 Abstract Leelamine is a promising compound for the treatment of cancer; however, the molecular mechanisms leading to leelamine-mediated cell death have not been identified. This report shows that leelamine is a weakly basic amine with lysosomotropic properties, leading to its accumulation inside acidic organelles such as lysosomes. This accumulation leads to homeostatic imbalance in the lysosomal endosomal cell compartments that disrupt autophagic flux and intracellular cholesterol trafficking as well as receptor-mediated endocytosis.

Electron micrographs of leelamine-treated cancer cells displayed accumulation of autophagosomes, membrane whorls, and lipofuscin-like structures, indicating disruption of lysosomal cell compartments. Early in the process, leelamine- mediated killing was a caspase-independent event triggered by cholesterol accumulation, as depletion of cholesterol using β-cyclodextrin treatment attenuated the cell death and restored the subcellular structures identified by electron microscopy. Protein microarray–based analyses of the intracellular signaling cascades showed alterations in RTK–AKT/STAT/MAPK signaling cascades, which was subsequently confirmed by Western blotting. Inhibition of

Akt, Erk, and Stat signaling, together with abnormal deregulation of receptor tyrosine kinases, was caused by the inhibition of receptor-mediated endocytosis.

This study is the first report demonstrating that leelamine is a lysosomotropic, intracellular cholesterol transport inhibitor with potential chemotherapeutic properties leading to inhibition of autophagic flux and induction of cholesterol accumulation in lysosomal/endosomal cell compartments. Importantly, the 52 findings of this study show the potential of leelamine to disrupt cholesterol homeostasis for treatment of advanced-stage cancers.

2.2 Introduction Melanoma is the deadliest and most metastatic form of skin cancer (177). If it is detected early, surgery still is the most feasible option to cure the disease.

However, if it metastasizes to other organs, less than 36% of the patients survive for longer than one year (177). Targeted therapies such as Zelboraf and

Dabrafenib, two FDA approved mutant B-RAF inhibitors, can be used for the short-term management of melanoma. But an aggressive drug resistant disease usually develops limiting survival benefit to only a few months (178). Cancer cells were able to bypass the targeted therapies by compensating with alternative activation of the pathway, several by activating upstream receptor tyrosine kinases (179). Therefore, targeting these alternative escape routes through a combinational drug treatment approach or development of a drug that suppresses multiple disease driving pathways is indispensable for a successful treatment of melanoma or prevention of recurrent resistant disease.

Natural compounds are important sources of new drug development and represent a significant portion of the FDA-approved cancer therapeutics portfolio

(180). Through a natural compound library screen, leelamine, a tricyclic diterpene molecule that was extracted from the bark of pine trees, is reported in the article by Gowda et al. in the current issue of this journal, as a potential drug effective against advanced stage melanoma. This agent has been shown to induce death of advanced stage melanoma cell lines 3 to 5 fold more effectively than normal cells and led to a 60% decrease in tumor burden compared to control vehicle treated animals. In these studies, leelamine inhibited AKT and 54

STAT3 signaling in xenografted tumors. No obvious systemic toxicity of the compound following treatment was detected as assessed by body weights of animals or by examination of the various blood parameters that are indicative of organ distress. However, the molecular mechanisms underlying the therapeutic efficacy of leelamine are unknown; therefore, in this report, the mechanism of action of leelamine for induction of cell death in cancer cells has been identified.

Prior to this report, leelamine had been reported to be a poor agonist of cannabinoid receptors and a weak inhibitor of pyruvate dehydrogenase kinases

(181, 182). However, data presented here suggest that leelamine mediated melanoma cell death does not involve modulation of any of these reported targets, but was rather mediated by the lysosomotropic property of the compound, which triggers accumulation of compound inside the lysosomal/endosomal (LE/L) compartments. This accumulation led to disruption of cholesterol homeostasis and intracellular vesicle transport systems as well as inhibition of autophagic flux. As a consequence, a caspase-independent cell death that was separate from classical apoptotic pathways was induced.

Western blot analyses revealed inhibition of receptor tyrosine kinase (RTK), AKT,

ERK and STAT3 signaling cascades, which are reported to be important for the survival of melanoma cells. Leelamine mediated inhibition of these cascades was attributed to the inhibition of receptor mediated endocytosis of RTKs causing aberrant accumulation of these proteins in the perinuclear region of cells. 55

2.3 Materials and Methods

2.3.1 Cell lines, culture conditions and plasmids. Metastatic melanoma cell line UACC 903 was provided by Dr. Mark Nelson

(University of Arizona, Tucson, AZ) between 1995 to 1999, 1205 Lu cell line was provided by Dr. Herlyn (Wistar Institute, Philadelphia, PA) between 2003-2005, human fibroblast cell line FF2441 was provided by Dr. Craig Myers (Penn State

College of Medicine, Hershey, PA) in 2005 and these cell lines were maintained in cell culture up to 69th, 98th, 7th passages respectively. Wild-type and BAX knock-out (HCT116BAX−/−) HCT116 human colon cancer cell lines were provided by Dr. Wafik El-Deiry (Penn State College of Medicine, Hershey, PA) in 2013.

Wild-type and ATG5 knock-out (MEFATG5−/−) mouse embryonic fibroblast (MEF) cell lines were provided by Dr. Hong-Gang Wang (Penn State College of

Medicine, Hershey, PA) in 2008. All cell lines were maintained in DMEM

(Invitrogen, Carlsbad, CA) supplemented with 1% Glutamax (Invitrogen) and

10% FBS (Hyclone, Logan, UT) in a 37°C humidified 5% CO2 atmosphere incubator. Melanoma cell lines were periodically monitored for genotypic characteristics, phenotypic behavior and tumorigenic potential to confirm cell line identity. pBABE-puro mCherry-EGFP-LC3B plasmid was obtained from

Addgene and transfected to UACC 903 cells to generate GFP tagged LC3B expressing UACC 903 cell line (plasmid #22418) (183).

2.3.2 Cell viability assay and drug treatments. Viability of cells upon treatment with various compounds (see Table 2.1 for compound sources) were measured through the MTS assay (Promega,

Madison, WI) as described previously (184). For combinatorial drug treatment studies, both investigated compounds and leelamine were treated simultaneously. However, in the case of β-cyclodextrin pre-treatment, β- cyclodextrin was washed away after 60 minutes of treatment and subsequently cells were treated either with DMSO or leelamine. Twenty-four hours after treatment, MTS assay was performed.

Table 2.1: Compounds and sources

Compound Name Company Catalog # Bafilomycin A1 LC Labs, Woburn, MA B-1080 Concanamycin A Santa Cruz Biotech., Santa Cruz, CA Sc-202111 Abietic Acid Sigma-Aldrich, St. Louis, MO 10 ß-cyclodextrin Sigma-Aldrich, St. Louis, MO C4805 z-VAD-fmk Tocris, Bristol, UK 2163 Staurosporine BIOMOL, Plymouth Meeting, PA BML-EI156 TRAIL R&D Systems, Minneapolis, MN 375-TEC-010 ALLN Cayman Chem , Ann Arbor, MI 14921 ALLM Enzo Life Sciences , Farmingdale, NY BML-PI100 Pepstatin A Cayman Chem , Ann Arbor, MI 9000469 AEBSF Cayman Chem , Ann Arbor, MI 14321 Leupeptin Cayman Chem , Ann Arbor, MI 14026 BIP-V5 Calbiochem, Darmstadt, Germany 196810 NS3694 Sigma-Aldrich, St. Louis, MO N7787 BI-6C9 Santa Cruz Biotech., Santa Cruz, CA sc-210915 Simvastatin Sigma-Aldrich, St. Louis, MO S6196 Pravastatin Cayman Chem , Ann Arbor, MI 10010343 AM251 Cayman Chem , Ann Arbor, MI 71670 AM630 Cayman Chem , Ann Arbor, MI 10006974 U-18666A Cayman Chem , Ann Arbor, MI 10009085 Filipin-III Cayman Chem , Ann Arbor, MI 10009779 Dichloroacetic acid Sigma-Aldrich, St. Louis, MO D6399 Cyclohexamide Sigma-Aldrich, St. Louis, MO C7698 Leelamine Tocris, Bristol, UK 2139 Cholesterol Avanti Lipids 700000 L-alpha-PC Avanti Lipids 840051 3H Leelamine 1 million CPM/uL American Radio Chemicals, St. Louis, MO NA

2.3.3 Caspase dependence, mitochondrial membrane potential and DNA fragmentation assays. Caspase dependence of cell death was measured by growing cells in a 96- well plate and pre-incubating with pan-caspase inhibitor z-VAD-fmk (20 µmol/L) for 1 hour prior to drug treatments. TRAIL (50 ng/mL) treatment was used as a positive control for induction of caspase dependent cell death. Twenty-four hours after treatment, cell viability was measured by MTS assay as described above.

Mitochondrial membrane potential was measured via the TMRE Mitochondrial

Membrane Potential Assay Kit (Abcam, Cambridge USA) according to the kit’s protocol. For the DNA fragmentation assay, total DNA was collected using the

DNeasy (Qiagen, MA) kit according to instructions and DNA was loaded into 1% agarose gels for electrophoresis.

2.3.4 Electron microscopy analyses. UACC 903 cells growing at 70 to 80% confluency on 35 mm permanox petri dishes (Electron Microscopy Sciences, PA) were treated with leelamine (3

µmol/L) or DMSO for 3 hours, washed with PBS and then fixed with fixative

(0.5% glutaraldehyde / 4% paraformaldehyde in 0.1 M sodium cacodylate buffer, pH 7.3) for 1 hour. The cells were washed in 0.1 M sodium cacodylate and post fixed overnight in buffered 1% osmium tetroxide 1.5% potassium ferrocyanide.

After post fixation, cells were rinsed with buffer, dehydrated in a graded series of ethanol, and embedded in EMbed812 (Electron Microscopy Sciences). After sectioning, samples were stained with 2% aqueous uranyl acetate and lead citrate followed by analysis with JEOL JEM1400 Digital Capture TEM. 59

2.3.5 Kinexus and Receptor Tyrosine Kinase Protein Arrays. UACC 903 cells treated with leelamine (3 µmol/L for 3,6,12 or 24 hours) were collected with Kinexus lysis buffer according to the Kinexus protocol and shipped to Kinexus (Vancouver, Canada) for analyses with Kinexus Antibody Microarray

Chip 1.3 (812 antibodies). The array data was normalized through Z-score transformation and Z-ratios between treated samples and corresponding controls were calculated as described elsewhere (185). The data was analyzed through

Ingenuity Pathway Analyses (IPA, version 17199142) software based on the alterations with a Z ratio of ± 1.50 with the software’s default settings. Human

Phospho-Receptor Tyrosine Kinase Array Kit was obtained from R&D Systems

(Minneapolis, MN) and experiments were performed according to the manufacturer’s protocols. The blot images were quantified by using Quantity

One 1-D Software (Bio-Rad Laboratories, Hercules, CA, USA).

2.3.6 Cholesterol localization, quantitation and TLC analyses. Localization of intracellular cholesterol was detected through Cayman’s

Cholesterol Cell-Based Detection Assay Kit (Cayman Chemical, Ann Arbor, MI) according to the manufacturer’s protocol. Lipid extraction from cell cultures was achieved through the Bligh and Dyer method (186). The lipid extract was dissolved in chloroform: methanol (2:1) and stored at -20oC. TLC analyses were undertaken according to a published approach (187). High-performance thin layer chromatography (HPTLC) Silica gel 60 plates (Merck, Germany) were developed with iodine vapor. The bands were analyzed with ImageJ, image analysis software (v1.44, NIH, USA). Rf values were calculated as 0.35 for 60

Cholesterol, 0.1 for PC and 0.17 for PE. These values were consistent with the values observed in the aforementioned published study (187).

2.3.7 Evaluation of endocytosis. Endocytic capacity of the cells was measured through evaluation of receptor- mediated endocytosis of Alexa Fluor 488 conjugated transferrin protein

(Molecular Probes, Eugene, OR). Briefly, cells were seeded into chamber slides and treated with leelamine for 2 hours. Next, transferrin protein was added at a final concentration of 5 mg/mL and incubated for 30 minutes. Cells were then washed with PBS, trypsinized and collected for flow cytometry analyses or fixed on a slide with 4% paraformaldehyde for fluorescence microscopy analysis.

2.3.8 Analyses of drug uptake using 3H labeled leelamine. To analyze the kinetics of leelamine uptake, tritium labeled leelamine was used (specific activity of 25 Ci/mmol) (American Radio Chemicals Inc, St. Louis,

MO). UACC 903 cells (70-85% confluent in a 150 mm plate) were treated with

25 mL of DMEM media containing 3 µmol/L leelamine and 5 mL of 20 mM triated leelamine (1million CPM/uL). At various time points, 20 mL of media from the plate was collected and radioactivity associated with the tritiated leelamine was measured using the LS-6500-Beckman Coulter liquid scintillation counter.

2.3.9 Analyses of lysosomotropism. UACC 903 cells were plated into 6-well plate and grown to 75-90% confluency. Cells were treated with 1 mM Lysotracker Red DND-99 (Life

Technologies, Grand Island, NY) for 15 minutes. Cells were subsequently treated 61 with leelamine or chloroquine for 45 minutes and collected for flow cytometry analyses.

2.3.10 Western blot analysis. 1-1.5 x106 melanoma cells were plated in 100 mm culture dishes and grown to 75-90% confluency. After treatments, at indicated time points cells were harvested in RIPA buffer containing protease and phosphatase inhibitors (Pierce

Biotechnology, Rockford, IL). Proteins were quantitated using the BCA Assay from Pierce (Rockford, IL). Thirty μg of protein per lane were loaded onto a

NuPage gel from Life Technologies, Inc. and electrophoresed according to the manufacturer’s instructions. Proteins were transferred to PVDF membrane and blots were probed with antibodies according to supplier’s recommendations (For detailed antibody information see Table 2.2). Immunoblots were developed using the enhanced chemiluminescence (ECL) detection system (Thermo Fisher

Scientific, Rockford, IL).

Table 2.2: Antibodies and sources

Antibody Company Catalog # Akt (Total Akt1/2/3) Cell Signaling Technology, Danvers, MA 9272 Phospho-Akt Cell Signaling Technology, Danvers, MA 9271 Phospho-4E-BP1 (S65) Cell Signaling Technology, Danvers, MA 9456 Cleaved PARP Cell Signaling Technology, Danvers, MA 9541 ERK 2 Santa Cruz Biotechnology, Santa Cruz, CA sc-1647 LC3B Cell Signaling Technology, Danvers, MA 2775 P27 (C-19) Santa Cruz Biotechnology, Santa Cruz, CA sc-528 Phospho-Stat3 (Y705) Cell Signaling Technology, Danvers, MA 9145 Stat3 Cell Signaling Technology, Danvers, MA 4904 Cyclin D1 Cell Signaling Technology, Danvers, MA 2978 Trk (pan) (C17F1) Cell Signaling Technology, Danvers, MA 4609 IGF-1RB (C-20) Santa Cruz Biotechnology, Santa Cruz, CA sc-713 HGFR (C-28) Santa Cruz Biotechnology, Santa Cruz, CA sc-161 IRS1 Cell Signaling Technology, Danvers, MA 2382 PDGFR β (28E1) Cell Signaling Technology, Danvers, MA 3169 SQSTM1/p62 Cell Signaling Technology, Danvers, MA 5114

2.3.11 siRNA transfections. 5 pmoles/well of siRNA was transfected into UACC 903 cells that were seeded into 96-well plates using Lipofectamine RNAiMAX (Life Technologies) reagent according to the manufacturer’s protocols. 48 hours after transfection, effect on cell viability was measured by MTS assays. Mutant BRAF siRNA and scrambled siRNA were used as positive and negative controls, respectively.

Viability of cells was plotted against scramble siRNA transfected cells (siRNA sequences are provided in Table 2.3).

Table 2.3: siRNA sequences and sources siRNA Sense Sequence Company Scrambled UCUCACGUGACACGUUCGGAGAAUU Invitrogen mut-Braf GGUCUAGCUACAGAGAAAUCUCGAU Invitrogen CB1 #1 UACACCAUGAUUGCAAGCAGAGGGC Invitrogen CB1 #2 UUCGUACUGAAUGUCAUUUGAGCCC Invitrogen CB2 #1 UUUGUAGGAAGGUGGAUAGCGCAGG Invitrogen CB2 #2 UGCCCAUAGGUGUAGAUGAUUCCGG Invitrogen PDK1 #1 CAGAUACUGUGAUACGGAUtt Life Sciences-Ambion PDK1 #2 GAGUCGCAUUUCAAUUAGAtt Life Sciences-Ambion PDK1 #3 CAAACUGCAAUGUACUUGAtt Life Sciences-Ambion PDK2 #1 AGAUCAACCUGCUUCCCGAtt Life Sciences-Ambion PDK2 #2 CAACCCAGCCCAUCCCAAAtt Life Sciences-Ambion PDK2 #3 CAGCAAUGCCUGUGAGAAAtt Life Sciences-Ambion PDK3 #1 GACUUAUCCAUUAAGAUCAtt Life Sciences-Ambion PDK3 #2 CCCUCGUUACUUUGGGUAAtt Life Sciences-Ambion PDK3 #3 CAUAUAUGUUUCUACGAAAtt Life Sciences-Ambion PDK4 #1 GGAUGCUCUGUGAUCAGUAtt Life Sciences-Ambion PDK4 #2 GGGCAACAGUUGAACACCAtt Life Sciences-Ambion PDK4 #3 CCGCCUCUUUAGUUAUACAtt Life Sciences-Ambion

2.3.12 Statistical analysis. The statistical analysis was performed using the unpaired Student t test. A P

< 0.05 was considered statistically significant. * indicates P < 0.05.

2.4 Results

2.4.1 Leelamine inhibits autophagic flux in melanoma cells. To dissect the mechanism by which leelamine kills cancer cells, UACC 903 melanoma cells treated with leelamine were examined by light and electron microscopy. Light microscopy showed rapid and widespread vacuolization of the cells (Fig. 2.1), followed by membrane blebbing, cell shrinkage and cell rounding.

Compared to control DMSO treated cells (Fig. 2.2 - Box a), transmission electron microscopy showed accumulation of lipofuscin-like material (Fig. 2.2 -

Box b) (undegraded lysosomal waste), formation of web-like membrane whorls

(Fig. 2.2 - Box c) and increased number of autophagosomes (Fig. 2.2 - Box d).

Figure 2.1 Figure 2.2

Figure 2.1: Light Figure 2.2: Transmission electron micrographs show microscopic images DMSO-treated control cells (a), leelamine-treated cells show vacuolization displaying formation of lipofuscin-like material (b), web-like of melanoma cells membrane whorls (c), and increased number of after treatment. autophagosomes (d). 65

TEM analysis suggested that leelamine treatment led to autophagosome accumulation; therefore, the effect of leelamine on autophagic flux was next evaluated through western blotting. Treatment with Bafilomycin A1 (BafA1), a specific inhibitor of vacuolar type H+-ATPase that blocks autophagic flux, induced accumulation of LC3B Figure 2.3 (an autophagosome marker) and p62/SQSTM1 (an autophagic flux marker) proteins indicating the inhibition of autophagosome Figure 2.3: Western blot analyses showing LC3B and P62 degradation (Fig. 2.3) protein levels as a marker of autophagic flux; Erk-2 served as a loading control. BafA1 treatment was used as a positive control for inhibition of autophagic flux. Bottom, confocal (188). Likewise, microscopy of GFP-tagged LC3B accumulation in leelamine- or BafA1-treated UACC 903 cells. leelamine treatment induced the accumulation of both proteins in a dose dependent manner suggesting inhibition of autophagic flux. Accumulation of LC3B protein was detectable via fluorescence microscopy of UACC 903 cells expressing GFP tagged LC3B protein (Fig. 2.3). Leelamine treatment also dose dependently increased the intensity ratio of LC3B-II to LC3B-I, further indicating enhanced autophagic activity (Fig. 2.3). 66

2.4.2 Leelamine has lysosomotropic property leading to accumulation in acidic organelles. Since observations such as vacuolization of cells, accumulation of lipofuscin- like material, formation of web-like membrane whorls and inhibition of autophagic flux are commonly attributed to lysosomal storage diseases and can be mimicked by some lysosomotropic compounds, the lysosomotropic potential of leelamine was next investigated (189, 190). As a weakly basic primary amine, leelamine has a pKa of 9.9 (calculated by ACD Labs Precepta software v14.0) and it was therefore predicted to be a lysosomotropic compound. Treatment with vacuolar

H+-ATPase inhibitors can suppress the activity of lysosomotropic compounds by inhibiting the acidification of cell compartments (14). Pre-treatment of UACC 903 melanoma cells with two Figure 2.4 vacuolar H+-ATPase inhibitors that target different subunits of the H+-ATPase complex, BafA1 and Concanamycin A (Conc-A), suppressed leelamine-mediated cell vacuolization (Fig. 2.4), suggesting that leelamine was a lysosomotropic compound. Figure 2.4: Light microscopic images of melanoma cells following leelamine treatment either alone or in combination with V-ATPase inhibitors Conc-A and BafA1.

Lysosomotropic compounds can be rapidly taken up by cells due to trapping inside the acidic organelles such as lysosomes and endosomes (191, 192). To measure the kinetics of leelamine uptake, UACC 903 cells were treated with tritiated leelamine and every 10 minutes Figure 2.5 media samples were collected to quantify levels of tritiated compound remaining in the media. Sixty percent of the tritiated leelamine was internalized into cells in less than 30 minutes after treatment, which supports the lysosomotropic property of the Figure 2.5: Kinetics of 3H-labeled compound (Fig. 2.5). This was further leelamine uptake. confirmed by testing the efficacy of collected samples to decrease cell viability. Figure 2.6 UACC 903 cells were treated with 3 mmol/L leelamine in a p100 plate and every 10 minutes, 300 mL of media was collected from the plate to treat UACC 903 cells that were plated in a 96 well plate

(100 mL X 3 wells/sample). Twenty-four Figure 2.6: Viability of cells exposed to conditioned media that is hours later, cell viability was assessed by collected from leelamine-treated melanoma cells at different time MTS assay. Consistent with the uptake points. kinetics of leelamine, samples collected 30 minutes after pre-incubation with cells, did not induce cell death in UACC 903 cells (Fig. 2.6). 68

To further validate the lysosomotropic property of leelamine, a modified

Lysotracker Red DND-99 competition assay was used (193). Lysosomotropic compounds typically compete with Figure 2.7 Lysotracker Red DND-99 to decrease uptake. Therefore, cells treated with a lysosomotropic compound should take up less Lysotracker Red DND-99. Flow cytometry based quantitation of the staining Figure 2.7: Histogram showing lysosomotropic property of leelamine, assessed by its competition with of cells with the Lysotracker Red DND-99 LysoTracker Red DND-99 dye, which was similar to chloroquine, a well- showed decreased uptake following known lysosomotropic compound. treatment with chloroquine (100 µmol/L), a well-known lysosomotropic compound, or leelamine (3 µmol/L), which provided further support for leelamine as a lysosomotropic compound (Fig. 2.7).

2.4.3 Lysosomotropic property of leelamine mediated early caspase- independent melanoma cell death. Figure 2.8 To determine whether the lysosomotropic property of leelamine mediated its activity, cell viability following H+-ATPase inhibition was measured. Cotreatment of 10 nmol/L of

BafA1 or Conc-A effectively protected melanoma cells from leelamine Figure 2.8: Viability of melanoma cells treated with leelamine in the absence or presence of V-ATPase inhibitors BafA1 or mediated cell death (Fig. 2.8). Conc-A. 69

Moreover, abietic acid, a structurally similar compound to leelamine that lacks the amine group, failed to induce either vacuolization or death of UACC 903 cells suggesting that, the amine group of leelamine mediated its lysosomotropic activity to subsequently trigger cell death (Fig. 2.9).

Figure 2.9

Figure 2.9: Abietic acid a structurally similar compound to leelamine without an amine group fails to induce vacuolization and death of melanoma cells. Light microscopic images of UACC 903 cells after leelamine or abietic acid treatments (left); Viability of melanoma cell lines after treatment with abietic acid (right);

Although leelamine has been reported in the current issue of this journal to induce the activation of caspases (Gowda et al.), it was not known whether the fate of leelamine treated cells is solely a result of caspase activation, or if there are other players that trigger cell death. In the case of caspase-dependent cell death, it would be expected that inhibition of caspase activation via pan-caspase inhibitor zVAD-fmk would rescue cells from leelamine mediated cell death. In the positive control, zVAD-fmk co-treatment completely restored the viability of cells, which was reduced to 58% by TNF-related apoptosis-inducing ligand (TRAIL) 70 treatment (Fig. 2.10). In contrast, zVAD-fmk had no Figure 2.10 effect on the viability of melanoma cells when cotreated with leelamine.

Furthermore, leelamine did not induce caspase-mediated DNA fragmentation up to 24 hours following treatment when Figure 2.10: Caspase dependence of leelamine- compared to Staurosporine mediated cell death measured through treatment of melanoma cells with leelamine in the absence or presence of pan-caspase inhibitor, z-VAD-fmk. treatment, an accepted apoptosis inducer (Fig. 2.11)

(194). This observation Figure 2.11 indicated that early phase of leelamine mediated cell death was triggered through a caspase independent process despite the fact that caspases are activated downstream in the cell death process.

Figure 2.11: DNA laddering assay showing Since various caspase- absence of DNA fragmentation following leelamine treatment. Staurosporine was used as a positive control for apoptosis-mediated DNA independent cell death fragmentation. programs require de-novo 71 protein synthesis, the effect of inhibition of protein synthesis on leelamine- mediated cell death was examined next (195). Co-treatment of UACC 903 melanoma cells with cycloheximide, a protein synthesis inhibitor, did not affect viability of leelamine treated cells, suggesting that de-novo protein synthesis is not required for leelamine mediated cell death (Fig. 2.12-A). Figure 2.12

Lysosomotropic compounds can induce caspase- independent cell death through lysosomal membrane permeabilization leading to leakage of cathepsins (lysosomal peptidases) into the cytosol (119,

192). To examine whether leelamine caused lysosomal membrane permeabilization, lysosomal peptidase inhibitors,

ALLN (Calpain/Cathepsin- Figure 2.12: Leelamine mediated cell death does not involve de-novo protein synthesis or leakage of proteases from lysosomes. A, Graph Inhibitor1), ALLM showing viability of UACC 903 cells upon leelamine treatment with or without increasing (Calpain/Cathepsin-Inhibitor 2), concentrations of protein syntheses inhibitor, cycloheximide; B, Viability of UACC 903 cells leupeptin (cysteine, serine and after 24 hours cotreatment of various protease inhibitors, AEBS, 100M; Pepstatin A, 50 M; Leupeptin, 50 M; ALLM, 25 M; ALLN, 10 M threonine peptidase inhibitor), with leelamine.

Pepstatin-A (aspartic proteinase inhibitor) and AEBSF (irreversible serine 72 protease inhibitor) were used. However, none of these inhibitors were able to alter leelamine mediated cell death suggesting that lysosomal membrane permeabilization is not involved in leelamine mediated cell death (Fig. 2.12-B).

Since disruption of mitochondrial function plays key roles in the execution of several cell death programs, mitochondrial membrane potential (∆Ψm) of

UACC 903 cells was measured after leelamine treatment (196). In the positive control, 20 µmol/L FCCP, a very potent un-coupler of oxidative phosphorylation in mitochondria significantly hindered ∆Ψm of treated cells. Leelamine treatment also decreased the ∆Ψm of treated melanoma cells in a time and dose dependent manner (Fig. 2.13). Mitochondrial membrane potential was found to be diminished in more than 70% Figure 2.13 of the cells when melanoma cells were treated with 3 µmol/L leelamine for 24 hours, suggesting that leelamine triggers significant perturbations in mitochondrial stability. Figure 2.13: Histogram showing m following leelamine or FCCP (positive control) treatments.

Bcl-2-associated X protein (BAX) and BH3 interacting-domain death agonist

(BID) are two well-studied apoptosis regulators that induce the opening of the mitochondrial voltage-dependent anion channels following apoptotic signals

(197). The potential involvement of BAX in leelamine mediated cell death was investigated through comparing wild-type HCT116 cells with BAX knock-out

HCT116 (HCT116 BAX−/−) cells. Interestingly, BAX knockout cells were more 73

resistant to leelamine mediated cell Figure 2.14 death in contrast to their wild type counterparts (Fig. 2.14). However, contradictorily pharmacological inhibition of Bax channels through

BAX-Inhibiting Peptide, V5; inhibition of Bid activity through BI-6C9; or inhibition of apoptosome formation Figure 2.14: Viability of wild-type or BAX- knockout HCT116 cells after 24 hours of by NS3694 were not able suppress treatment with increasing concentrations of leelamine. leelamine mediated cell death (Fig.

2.15). Figure 2.15

2.4.4 Blockage of autophagic flux mediated by leelamine. Lysosomotropic compounds can block autophagic flux through alkalinization of the lysosome to trigger caspase-independent cell Figure 2.15: Viability of UACC 903 cells after 24 hours cotreatment of leelamine with death (119, 192). To investigate various apoptotic signal inhibitors, BAX Inhibiting Peptide V5 (BIP-V5), Bid Inhibitor whether leelamine-mediated cell BI-6C9, apoptosome inhibitor NS3694. death involves inhibition of autophagic flux, autophagy deficient ATG5 knockout mouse embryonic fibroblasts (MEF) cells were compared with wild-type counterparts following leelamine treatment. ATG5 knockout MEFs showed partial resistance to leelamine mediated cell death suggesting that inhibition of 74 autophagic flux played an important role Figure 2.16 in this process (Fig. 2.16). Interestingly,

ATG5 knockout MEF cells did not undergo vacuolization upon leelamine treatment indicating a relationship between vacuolization and autophagy

(Fig. 2.16). Thus, leelamine-mediated Figure 2.16: Viability of wild-type or atg5- cell death was associated with its knockout MEF cells after 24 hours of treatment with increasing concentrations of leelamine. Images showing that lysosomotropic property and partially leelamine did not cause vacuolization of ATG5-knockout MEF cells. involved inhibition of autophagic flux.

2.4.5 Activity of leelamine was not mediated by PDKs or Cannabinoid receptors. Pyruvate dehydrogenase kinases (PDK) and cannabinoid receptors (CBR) are reported targets of leelamine (181, 182, 198). To determine whether, the lysosomotropic property of leelamine mediated cell death did not involve these proteins, pharmacological agents or RNA interference was used to inhibit these proteins. siRNA-mediated knockdown of PDK isoforms or dichloroacetate- mediated inhibition of PDKs did not affect the viability of melanoma cells suggesting that these proteins were not mediating the effect (Figs. 2.17 A and

B). Agonists of cannabinoid receptors have also been reported to promote apoptotic cell death in melanoma cells (199); however, co-treatment of neither

CB1 inverse antagonist AM251, nor CB2 inverse antagonist AM630, nor a combination of them, protected UACC 903 cells from leelamine mediated cell 75

death (Fig. 2.18-A). Figure 2.17

Consistent with these observations, siRNA- mediated knockdown of cannabinoid receptors also did not alter the activity of Figure 2.17: A and B, Graphs showing that neither siRNA mediated knockdown of PDK isoforms nor DCA treatment leelamine (Fig. 2.18-B). hinders UACC 903 cell viability indicating that leelamine mediated cell death is not tied to activity of the PDK Thus, none of the reported isoforms. targets of leelamine were found to mediate cancer cell killing.

Figure 2.18

Figure 2.18: A, Graph showing viability of UACC 903 cells following treatment with increasing concentrations of cannabinoid (CB) receptor inverse agonists (AM251 and AM630) in the presence or absence of leelamine; B, Viability of UACC 903 cells transfected with siRNA against CB receptors followed treatment with leelamine or DMSO.

2.4.6 Leelamine induced intracellular cholesterol accumulation and altered cholesterol subcellular localization. Phenotypes induced by some lysosomotropic compounds (e.g. U18666A and imipramine) resemble those occurring with Niemann Pick Type C (NPC1) disease (200, 201). NPC1 is a well-studied lysosomal storage disease, which 76 leads to neurodegeneration and cell death through lysosomal/endosomal accumulation of unesterified cholesterol due to loss-of-function mutations in NPC proteins (202). These compounds also lead to accumulation of endosomal cholesterol upon treatment (200, 201). To investigate whether leelamine triggered a phenotype similar to NPC1, cholesterol localization following leelamine treatment was analyzed via Filipin-III staining. Under steady-state conditions, UACC 903 cells stained weakly for Filipin at the periphery of the nucleus (Fig. 2.19-A). 3 mmol/L leelamine significantly altered cholesterol localization and induced a staining pattern, which was comparable to that occurring following U18666A treatment (Fig. 3A). At higher concentrations (5 mmol/L) cholesterol accumulation was more significant and observed as large

Figure 2.19

Figure 2.19: Leelamine-mediates intracellular cholesterol accumulation. A, florescence microscopy of cholesterol localization following leelamine or U18666A treatments. β- cyclodextrin–mediated depletion of cholesterol prevents leelamine-mediated intracellular cholesterol accumulation (right). B, HPTLC showing cholesterol accumulation in melanoma cells with increasing leelamine concentrations. The numbers under the cholesterol band show the quantitation of the cholesterol band with respect to the DMSO treatment; PC, phosphatidylcholine; PE, phosphatidylethanolamine. 77 droplets around the nucleus. In contrast, altered cholesterol localization was not observed in normal fibroblasts at the 3 mmol/L but was significant at 10 mmol/L.

β-cyclodextrin mediated depletion of cholesterol has been reported to decrease the toxicity of cholesterol accumulation in NPC1 disease (203). Cotreatment of

β-cyclodextrin prevented intracellular cholesterol accumulation even at high leelamine concentrations (Fig. 2.19-A). Thin layer chromatography analyses of the lipid extracts from UACC 903 cells showed an increase in intracellular cholesterol accumulation following leelamine treatment (Fig. 2.19-B).

To validate the biological significance of leelamine mediated cholesterol accumulation, β-cyclodextrin was used to deplete cellular cholesterol levels.

Depletion of cholesterol from UACC 903 or 1205 Lu melanoma cells through pre- or co-treatment with β-cyclodextrin suppressed cell death mediated by leelamine treatment (Fig. 2.20-A). In addition, electron microscopy analyses of the β- cyclodextrin co-treated UACC 903 cells showed that depletion of cholesterol prevented formation of lipofuscin-like material, membrane whorls and autophagic vesicles observed following leelamine treatment (Fig. 2.20-B). It is important to note that, it was the inhibition of cholesterol transport but not the cholesterol synthesis that lead leads to cell death since statins were not able to induce cell death in these cell lines (Fig. 2.21). 78

Figure 2.20

Figure 2.20: Leelamine-mediated cell death depends on intracellular cholesterol accumulation. A, Viability of melanoma cells following leelamine treatment alone or in combination with co- or pretreatment with β-cyclodextrin. * indicates t-test, p < 0.05 B, Transmission electron micrographs of leelamine- and β-cyclodextrin–cotreated UACC 903 cells.

2.4.7 Leelamine inhibited cellular endocytosis. Endosomes are major sorting compartments within cells functioning not only for the uptake of extracellular material but also Figure 2.21 for the maintenance of cell signaling through recycling of membrane receptors (6, 204).

Since, endosomal accumulation of cholesterol has the potential to disrupt the endocytic system, the integrity of the system was assessed by measuring endocytic uptake of Alexa Fluor- Figure 2.21: Statins as cholesterol transport inhibitors conjugated transferrin protein (205, 206). are ineffective in inducing death of UACC 903 melanoma cells. Fluorescence microscopy analyses showed robust suppression of endocytosis following leelamine treatment of both UACC

903 and 1205 Lu melanoma cells (Fig. 2.22-A). Depletion of cholesterol through

β-cyclodextrin cotreatment prevented leelamine mediated inhibition of transferrin 79

Figure 2.22

Figure 2.22: Leelamine inhibits cellular endocytosis. A, Fluorescence microscopic images showing endocytosis of Alexa Fluor–conjugated transferrin protein following DMSO control or leelamine treatment in the absence or presence of β-cyclodextrine–mediated cholesterol depletion. B, Flow cytometry–based analyses of Alexa Fluor–conjugated transferrin protein endocytosis following leelamine treatment. DAPI, 4′,6-diamidino-2- phenylindole. endocytosis. In contrast, although endocytosis of transferrin was restricted in fibroblasts cells, its inhibition was not seen until the leelamine concentration was increased to 10 mM (Fig. 2.22-A). Flow cytometry based quantitation of transferrin signal, confirmed the fluorescence microscopy analyses and displayed a dose-dependent inhibition of endocytosis (Fig. 2.22-B). 3 µmol/L leelamine treatment decreased endocytosis positive UACC 903 cells by 68% while 5

µmol/L decreased it by 88%. Collectively these data suggest that leelamine treatment inhibited cellular endocytosis in cancer cells at 3 µmol/L and required

3-fold higher levels to see a similar effect in normal cells. 80

2.4.8 Leelamine inhibited signaling pathways driving melanoma cell survival. Since leelamine disrupted cellular endocytosis, inhibition of this process was predicted to disrupt key signaling pathways important for melanoma survival.

Therefore, signaling pathways altered following leelamine treatment were assessed next. Since cycloheximide treatment suggested that protein synthesis was not involved in the activity of leelamine, the primary effect of the compound was predicted to occur at the post-translational level. Therefore, to assess these changes, high-throughput antibody microarray analysis was undertaken using

Kinexus Antibody Microarray Chip 1.3 (Kinexus Bioinformatics Corporation,

Vancouver, Canada). This analysis simultaneously assessed the expression and phosphorylation status of various cell signaling proteins. Cell lysates were collected at various time points from 3-24 hours following leelamine or control treatment and analyzed on the Kinexus arrays. Data was normalized through Z- score transformation and significant alterations were identified by calculation of

Z-ratios between treated samples and corresponding controls (Table 2.4).

Results suggested alterations in the members of receptor tyrosine kinase (RTK)

– AKT signaling pathway (e.g., IGF1R, IRS1, ALK, EPHA1, ERBB2, GSK3, and

FKHRL1) (Fig. 2.23). Analyzes of the data through Ingenuity Pathway Analyses software suggested that the insulin and PI3K-Akt pathways were the most prominent pathways that were altered following leelamine treatment (Fig. 2.24).

Table 2.4 Alterations in protein expression or activity following leelamine treatment.

Z Ratios %CFC

Target Phospho 3 hr 6 hr 12 hr 24 hr 3 hr 6 hr 12 hr 24 hr Protein Site IRS1 Y1179 1.50 2.95 2.38 1.45 113 907 406 120 IRS1 S312 1.81 1.82 1.89 2.19 142 307 324 288

IR/IGF1R Y1189/Y1190 1.21 1.83 1.81 0.17 79 328 220 8 P38A Pan-specific 1.35 5.17 1.95 0.70 90 2654 205 42 MAPK PKCL/I T564 1.82 0.55 0.80 1.66 174 84 99 163 STAT4 Pan-specific * 7.70 1.54 4.10 0.31 11598 108 1162 9 GCK Pan-specific * 1.39 * 2.23 7.44 1.68 2677 5468 38746 138

UP REGULATED TAU T548 1.73 1.50 * 2.14 -0.62 141 261 298 -27 ERK1/2 Pan-specific 0.01 2.24 0.89 1.82 -3 509 32 138 HSP90 Pan-specific * -10.8 4.99 * -0.48 1.51 -99 75219 2736 107 GFAP S8 -1.07 0.83 -1.69 -2.12 -33 168 -52 -63 LYN Y508 -0.54 -0.86 -1.56 -1.99 -18 -35 -29 -61 MAP2K4 Pan-specific -2.02 -1.54 -1.18 -0.83 -54 -71 -41 -32 BAD S75 -1.27 -2.14 -1.44 -1.63 -46 -80 -63 -64 EIF4E S209 -0.54 -1.69 -1.36 -1.74 -24 -68 -54 -62 ALK Pan-specific -1.42 -2.64 -1.75 -1.70 -50 -87 -69 -63 BCL-XS/L Pan-specific * -6.5 -6.51 -3.60 -0.34 -90 -80 -93 -22 IKBB Pan-specific * -2.33 -7.45 -2.71 -0.06 -37 -100 -56 -7 BCL2 Pan-specific -1.52 -0.54 -1.93 * -0.66 -44 -34 -53 -27 DAXX Pan-specific -1.64 -1.34 -2.17 -2.58 -49 -64 -70 -77 ERK1/2 Pan-specific -1.69 -1.04 -2.00 -1.80 -46 -47 -50 -58 GSK3AB Pan-specific -3.11 -1.35 -1.88 -1.88 -72 -59 -53 -62

DOWN REGULATED DOWN GSK3AB Pan-specific -2.07 -1.01 -1.57 -0.64 -54 -39 -43 -18 MOS Pan-specific -1.93 * -1.87 -1.60 -1.13 -52 -81 -49 -46 DFF35/45 Pan-specific -0.88 -0.86 -1.95 -2.49 -29 -47 -53 -53 DNAPK Pan-specific -0.74 -1.12 -2.36 -1.97 -25 -60 -75 -68 EPHA1 Pan-specific -1.30 -0.76 -1.65 -2.73 -42 -42 -52 -75 ERBB2 Pan-specific -1.48 -0.90 -1.98 -2.36 -46 -47 -55 -67 FKHRL1 T32 -0.99 -0.75 -3.70 -1.71 -26 -42 -64 -46 Note: Grey shadowed boxes indicates Z-Ratio > 1.5 or Z-Ratio < -1.5. Astrix (*) indicates antibody spots which were not reliable due to technical issues. %CFC: Percentage change from control treatment

Involvement of key Figure 2.23 proteins that were downstream of RTK signaling was subsequently validated by western blotting.

Significant suppression of the active AKT (pAKT) and STAT3 proteins Figure 2.23: Leelamine mediated alterations in signaling pathways. Schematic summary of signaling alterations in (pSTAT3) were identified melanoma cells occurring following leelamine treatment based on Kinexus antibody array analysis. (Fig. 2.25). Suppression of several other signaling proteins (e.g. ERK, PRAS40, CREB, p70S6K) in these pathways have been validated in the manuscript by Gowda et al. in the current issue of this journal. Phosphorylation Figure 2.24 of 4E-BP1, an important regulator of cap-dependent protein translation, was significantly decreased by leelamine suggesting that the AKT/mTOR branch of the cascade was also inhibited following leelamine treatment (207).

Most importantly, BafA1 co-treatment Figure 2.24: Ingenuity Pathway Analyses. reversed the effect of leelamine on Analyses of the Kinexus protein array data with IPA software’s default parameters these signaling cascades suggesting showing significantly altered signaling pathways. 83

that these alterations were triggered Figure 2.25 by the lysosomotropic properties of this drug (Fig. 2.25).

Figure 2.25: Western blot (WB) analysis of pAKT (S472), total AKT, 4EBP1 (T70), pSTAT3(Y705), STAT3, and ERK-2 proteins in melanoma cells treated with increasing concentrations of leelamine with or without BafA1.

2.4.9 Leelamine disrupted receptor tyrosine kinase signaling via interference with intracellular vesicular transport systems, which was reversible by cholesterol depletion. Since protein microarray analysis suggested alterations in receptor Figure 2.26 tyrosine kinase signaling, the activities of 42 different receptor tyrosine kinases were analyzed using a protein array that is specific to receptor tyrosine kinases (Fig. 2.26). Alterations in tyrosine phosphorylation of several

RTKs, such as decreases in ERBB4 and PDGFR receptors, as well as an increase in IGF1R and HGFR receptors Figure 2.26: RTK protein array analysis showing activity of various RTKs following leelamine treatment. 84

were observed. However, identified Figure 2.27 increases in HGFR and IGF1R phosphorylation were associated with intracellular accumulation of these receptors. Western blot analyses displayed a dose and time dependent accumulation of HGFR precursor protein with significant Figure 2.27: Western blot analysis of pAKT (S472), total AKT, pSTAT3 (Y705), cleaved decrease in mature forms of HGFR PARP, HGFR, IGF1R, and ERK-2 proteins post leelamine treatment of UACC 903 cells. and IGF1R receptors (Fig. 2.27).

The precursor form of IGF1R also displayed slight accumulation that was more significant after 12 hours of leelamine treatment. Accumulations of these precursor proteins were possibly related to the disruption of the endocytic system

(208). Figure 2.28 Immunofluorescence staining of various

RTKs (IGF1R,

PDGFR and TRK receptors) and IRS1, Figure 2.28: Immunofluorescence staining showing perinuclear accumulation (arrow heads) of RTK signaling members (nucleus an adaptor protein in marked with dashed circles in treated cells).

INSR/IGF1R-AKT signaling, displayed perinuclear accumulation of these proteins further supporting inhibition of the intracellular vesicular transport systems (Fig.

2.28). 85

To demonstrate that signaling alterations were induced by disrupted cholesterol homeostasis, b-cyclodextrin co-treatment was used to deplete accumulating cholesterol and effects on inhibited signaling pathways were examined by western Figure 2.29 blotting (Fig. 2.29). - cyclodextrin co-treatment restored phosphorylation of Akt and Stat3 proteins, suppressed accumulation of IGF1R and HGFR precursors, inhibited upregulation of p27 protein, reinstated Cyclin

D1 levels to control amounts, and decreased Figure 2.29: Western blot analysis shows restoration of leelamine mediated signaling alterations in pAKT PARP cleavage (Fig. (S472), total AKT, pSTAT3(Y705), STAT3, CDKN1B (P27), CCND1 (Cyclin D1), cleaved PARP, HGFR, and 2.29). Thus, these IGF1R proteins following cholesterol depletion using β- cyclodextrine (β-cyclo) treatment. ERK, extracellular signal-regulated kinase; CDK, cyclin-dependent kinase; observations suggested RB, retinoblastoma; IKK, inhibitor of IκB kinase; FGFR, fibroblast growth factor receptor. that leelamine mediated signaling alterations were initiated by disruption of cholesterol homeostasis leading to shutdown of cellular endocytosis.

2.5 Discussion In this study, leelamine has been identified as a lysosomotropic compound that disrupts intracellular cholesterol homeostasis to induce cell death more selectively in melanoma compared to normal cells. Cholesterol is an essential component of cell membranes and occupies vital roles in intracellular transport and signaling systems (209, 210). Its homeostasis is strictly regulated since proper functioning of several organelles such as golgi, endoplasmic reticulum and mitochondria rely on cholesterol abundance in the membranes of these organelles (211, 212). Late endosomes and lysosomes have an important role in maintaining this homeostasis. Cholesterol that is derived from the membranes of the endocytotic vesicles and cholesteryl esters that are derived from the imported

LDL molecules or from the autophagic flux, converge on the lysosomal cell compartments where cholesteryl esters are hydrolyzed to free cholesterol molecules (24, 42, 212). Excess free cholesterol should be either esterified in the endoplasmic reticulum or removed from the cell through the efflux pathway

(212). NPC1 and NPC2 proteins function together to export free cholesterol from the lysosomal-endosomal cell compartments and loss-of-function mutations in these genes, give rise to accumulation of free cholesterol in the lysosomal- endosomal compartments (213). Since, lysosomes are a convergent point for the endocytic and autophagic pathways, cholesterol accumulation potentially shuts down both of these pathways.

Inhibition of autophagic flux is potentially detrimental to cells due to insufficient disposal of toxic protein aggregates and inadequate recycling of unnecessary cellular components to maintain intracellular homeostasis (192).

Recent studies link autophagy to cholesterol homeostasis (42). Elrick et al.

(2012) identified autophagy as an important source of accumulated cholesterol in

NPC1 disease (43). In their study, ATG5-null-MEF cells accumulated less cholesterol in the lysosomal-endosomal compartments upon U18666A treatment.

In agreement with this observation, ATG5-null-MEF cells were more resistant to leelamine-mediated cell death compared to wild-type counterparts. These observations suggested autophagy as an important source for accumulated cholesterol in leelamine treated cells. Moreover, endosomal cholesterol accumulation not only inhibits autophagic flux but can also induce autophagy itself (214). Leelamine treatment dose dependently increased LC3BII to LC3BI ratio as well as decreased the phosphorylation of 4EBP1, suggesting the sustained inhibition of mTOR signaling and induction of autophagy. Thus, the autophagic process creates a vicious circle between cholesterol accumulation and autophagy induction in which endosomal cholesterol accumulation triggers autophagy and autophagy subsequently induces further endosomal cholesterol accumulation, which is summarized in Fig. 2.30.

In contrast to autophagy, inhibition of endocytosis disrupts intracellular signaling processes since receptor mediated signaling depends on endocytosis and endocytic recycling of internalized receptors to the cell membrane (215).

RTKs are an important family of membrane receptors that are regulated through 88

receptor-mediated endocytosis. Figure 2.30

Upon ligand binding and activation, they are internalized through endocytosis and transported to the late endosomes where they are either recycled back to the membrane or directed to the lysosomes for degradation

(215). This process is Figure 2.30: Schematic summary of cellular alterations mediated by leelamine in melanoma important for down-regulation cells. of initiated signal transduction and also required for transduction of various signals from the cell periphery to the nucleus (216).

Receptor tyrosine kinases play vital roles in the progression of several cancers including melanoma (217). Hyper-activation of several RTKs such as

PDGFR, ERBB4, AXL, IGF1R can contribute to mutant BRAF inhibitor resistance

(179). They induce PI3K/Akt, Stat and MAPK signaling cascades in response to extracellular factors. Leelamine mediated disruption of RTK signaling led to the inhibition of these three signaling cascades. Leelamine mediated inhibition of

MAPK signaling was not very prominent in contrast to Akt3 and Stat3 pathway shutdown since the constitutive activation of the MAPK cascade is triggered by mutant V600EB-Raf protein and does not require RTK activity (218). Silencing of 89

AKT activity significantly suppresses melanoma tumor growth (219). Cell lines with over-activated Akt signaling show increased sensitivity to the inhibition of

PI3K/AKT signaling pathway (220). Since leelamine inhibits AKT signaling, it is effective for killing cells in which the PI3 kinase pathway is activated. Receptor tyrosine kinases also mediate induction of Stat signaling, which is reported to be essential for the transforming activity of the various RTKs such as IGF1R (221).

Under steady state growth conditions, activity of STAT proteins is transient and tightly regulated by various signaling pathways (222). However, STATs are constitutively activated and promote tumor development in several malignancies, including melanoma (223). Niu et al. (2002) reported constitutive activation of

STAT3 in more than 80% of melanoma cell lines in which hyper-activated Stat3 inhibits apoptotic pathways through induction of BCL2L1 (BCL-XL) expression

(224). Our studies showed that leelamine significantly hinders Stat3 activity and decreases Bcl-XL protein levels as observed in Kinexus array analysis and in subsequent validation studies.

In summary, this study identifies leelamine as a lysosomotropic cholesterol transport inhibitor that triggers cell death through cholesterol accumulation in lysosomal/endosomal cell compartments. The accumulated cholesterol inhibits autophagic flux, disrupts receptor mediated endocytosis and subsequently inhibits signaling pathways that are key to melanoma development. These findings not only suggest significant potential of leelamine for the treatment of melanoma but also identify a new approach for induction of melanoma cell death and possibly that of other cancer types. 90

2.6 Acknowledgements We are thankful to Dr. Wolfgang Muss, Dr. Patrice Petit, Dr. Ken Hastings, Dr.

Goodwin Jinesh and Dr. Jayanta Debnath for their guidance in interpretation of the electronmicrographs.

CHAPTER 3

Intracellular Cholesterol Transport Inhibitors as Potential Therapeutic Agents for Melanoma

3.1 Abstract Recently, a lysosomotropic small compound, leelamine has been identified as a chemotherapeutic agent against melanoma. Leelamine was shown to act as an intracellular cholesterol transport inhibitor suggesting that cholesterol homeostasis plays a crucial role in melanoma survival. This study explores the chemotherapeutic potential of functional inhibitors of acid sphingomyelinase

(FIASMA) as cholesterol transport inhibitors. Similar to leelamine, these compounds were lysosomotropic molecules that accumulate inside the acidic organelles such as lysosomes. This accumulation inhibits cholesterol egress from late endosomal/lysosomal cell compartments leading to disrupted autophagic flux and cellular endocytosis. Inhibition of lysosomotropic accumulation of FIASMAs through Bafilomycin-A1 treatment or depletion of cholesterol through β-cyclodextrin treatment attenuated the cell death mediated by these agents. As a consequence of inhibition of cellular endocytosis, activity and localization of receptor tyrosine kinases were altered and their downstream effectors, AKT and STAT3 signaling cascades, that are two proteins required for melanoma development were inhibited. Cell death initiated by lysosomal cholesterol accumulation was suggested to be related to BAX activity and mitochondrial dysfunction as evidenced by increased resistance of BAX knockout

HCT 116 cells to FIASMAs and dose-dependent depolarization of mitochondrial membrane potential following FIASMA treatments.

In in-vivo studies, two of the FIASMAs, Perphenazine and Fluphenazine, led to an up to 60% decrease in the growth of xenografted tumors of three different 93 melanoma cell lines. Since, including these two agents, many of the FIASMA compounds are generic tricyclic antidepressants or antipsychotics with well- known toxicity profiles, the findings of this study might open new perspectives in cancer treatment through repurposing these drugs as anti-cancer agents.

3.2 Introduction Between the ages of 40 and 80, cancer is the leading cause of death in the

United States (225). In 2013, more than 1.6 million people were expected to get cancer and one third projected to die from the disease. Despite billions of dollars spent on research to identify effective cancer therapeutics, only a 1.7 % decrease in cancer related death rates reported between 2005 and 2009.

Incidence and mortality rates related to the most dangerous type of skin cancer, malignant melanoma continues to rise steadily (226). In 50 to 60% of the melanomas, BRAF is activated by a point mutation to drive melanoma development (227). In recent years, V600EBRAF targeted therapeutics have been developed with short term therapeutic efficacy due to rapid development of resistance. Consequently, there remains a need for the development of new melanoma therapeutics or approaches to overcome the development of recurrent resistant disease.

A recent report has detailed how a natural product library was screened to identify leelamine as a chemotherapeutic agent for melanoma (171). Leelamine was shown to be a lysosomotropic compound that triggered cholesterol accumulation inside acidic organelles such as lysosomes and endosomes (44).

This accumulation led to the disruption of autophagic flux and cellular endocytosis, which are crucial processes for recycling dysfunctional cellular components and for signaling pathways that are initiated from tyrosine kinase receptors, respectively (228, 229).

Cholesterol accumulation inside acidic organelles also occurs in a lysosomal storage disease called Niemann–Pick type C (NPC) (230). In this disorder, loss of functional NPC1 leads to lysosomal cholesterol accumulation. Importantly, this accumulation is accompanied by an increase in lysosomal sphingomyelin levels due to decreased acid sphingomyelinase (ASM) activity, which is a lysosomal enzyme that catalyzes the breakdown of sphingomyelin to ceramide and phosphorylcholine (231). Recently, screening of a chemical library has allowed identification of a class of compounds that are able to inhibit ASM enzyme (231, 232). These compounds were called as functional inhibitors of acid sphingomyelinase (FIASMA) since they do not inhibit the enzyme directly.

Among these are several tricyclic antidepressants such as Nortriptyline,

Amitriptyline, Desipramine and Imipramine. Interestingly, similar to leelamine,

Imipramine is also known to induce lysosomal cholesterol accumulation and trigger NPC disease phenotype (233).

Since ASM activity is inhibited in NPC disease and since imipramine is known to induce a NPC phenotype as well as inhibiting ASM; and since leelamine kills melanoma cells through inhibiting intracellular cholesterol transport, it was hypothesized that FIASMAs would kill cancer cells through inducing lysosomal cholesterol accumulation. In this study, 42 of acid sphingomyelinase inhibitors were screened for their potential activity against melanoma cell lines. They were found to trigger cell death in BRAF mutant melanoma cell lines at 2 to 5 fold lower concentrations compared to normal fibroblast cells. Similar to leelamine, cell death was initiated by inhibition of cholesterol egress from lysosomes which 96 impaired cellular endocytosis and autophagic flux. As a consequence Akt and

Stat3 signaling cascades, two important melanoma drivers that are downstream of tyrosine kinase receptors, were suppressed. More importantly, the efficacies of four acid sphingomyelinase inhibitors (Nortriptyline, Perphenazine,

Fluphenazine and Desipramine) were tested on xenografted melanoma tumor development and following oral administration found to cause up to a 60 % inhibition of tumor development.

Most of the FIASMAs were compounds approved as antidepressant, antipsychotic or antihistamine drugs. In the literature, anti-cancer activity of some of these agents have been reported and also supported by large-scale case-control studies (10-13, 85, 91). The findings of present study suggest that, mechanistically these compounds display anti-cancer activity through disrupting intracellular cholesterol transport and consequently inhibiting autophagic flux and cellular endocytosis. Eventually this leads to cancer cell death through inhibition of multiple pathways to which the cancer cells are addicted. As most of these agents are generic drugs with well-known toxicity profiles, the findings of this study could open new perspectives for repurposing these drugs as anti-cancer agents.

3.3 Materials and Methods

3.3.1 Cell lines, culture conditions and plasmids. Metastatic melanoma cell line UACC 903 was provided by Dr. Mark Nelson

(University of Arizona, Tucson, AZ), WM164M and 1205 Lu cell lines were provided by Dr. Herlyn (Wistar Institute, Philadelphia, PA), human fibroblast cell line FF2441 was provided by Dr. Craig Myers (Penn State College of Medicine,

Hershey, PA), 451Lu, 451LuR cell lines were provided by Xiaowei Xu (University of Pennsylvania, Philadelphia, PA), C8161.Cl9 cell line was provided by Danny

R. Welch (University of Kansas, Kansas City, KS). Wild-type and BAX knock-out

(HCT116BAX−/−) HCT116 human colon cancer cell lines were provided by Dr.

Wafik El-Deiry (Penn State College of Medicine, Hershey, PA). All cell lines were maintained in DMEM (Invitrogen, Carlsbad, CA) supplemented with 1%

GlutaMAX (Invitrogen) and 10% FBS (Hyclone, Logan, UT) in a 37°C humidified

5% CO2 atmosphere incubator. Melanoma cell lines were periodically monitored for genotypic characteristics, phenotypic behavior and tumorigenic potential to confirm cell line identity. Autophagosome accumulation was assessed using a

GFP-tagged LC3B expressing UACC 903 cell line that was generated using pBABE-puro mCherry-EGFP-LC3B plasmid (Addgene plasmid #22418) (183).

3.3.2 Cell viability assay, drug treatments and IC50 determination. Viability of cells following compound treatments (see Table 3.1 for compounds and their sources) was measured through the MTS assay

(Promega, Madison, WI) as described previously (184). Briefly, cells that were plated in 96-well plates and grown up to 70 to 80% confluency were treated with 98 either vehicle control or increasing concentrations of investigated compound. 24 h later MTS assay was performed and the IC50 values for each compound for respective cell lines were calculated with GraphPad Prism version 4.01

(GraphPad Software). In drug co-treatment studies, investigated compounds were treated simultaneously and 24 hours later, MTS assay was performed.

Table 3.1: Compounds and sources

Compound Name Company Catalog Number Bafilomycin A1 LC Labs, Woburn, MA B-1080 ß-cyclodextrin Sigma-Aldrich, St. Louis, MO C4805 z-VAD fmk Tocris, Bristol, UK 2163 TRAIL R&D Systems, Minneapolis, MN 375-TEC-010 ALLN (Calpain Inhibitor I) Cayman Chem , Ann Arbor, MI 14921 ALLM Enzo Life Sciences , Farmingdale, NY BML-PI100 Pepstatin A Cayman Chem , Ann Arbor, MI 9000469 AEBSF Cayman Chem , Ann Arbor, MI 14321 Leupeptin Cayman Chem , Ann Arbor, MI 14026 NS3694 Sigma-Aldrich, St. Louis, MO N7787 U-18666A Cayman Chem , Ann Arbor, MI 10009085 Filipin-III Cayman Chem , Ann Arbor, MI 10009779 / 70440 Leelamine Tocris, Bristol, UK 2139 IM-54 Necrostatin-V

3.3.3 Mitochondrial membrane potential, caspase and caspase- dependence assays. Mitochondrial membrane potential of cells was measured through the TMRE

Mitochondrial Membrane Potential Assay Kit (Abcam, Cambridge USA) according to the kit’s protocol. Caspase 3/7 activity was measured using a fluorogenic substrate Ac-DEVD-AFC (Ex. 400 nm, Em. 505 nm) according to the protocol supplied with a Caspase-3 Inhibitor Screening Assay Kit (Merck KGaA,

Darmstadt, Germany). Caspase-dependence of cell death was assessed by pre- 99 treatment of cells with pan-caspase inhibitor z-VAD-fmk (20 µmol/L) for 1 hour prior to drug treatments. TRAIL (50 ng/mL) treatment was used as a positive control to induce caspase dependent cell death. 24 hours after treatments, cell viability was measured by MTS assay as described above.

3.3.4 Annexin V- Propidium Iodide staining. To determine the effect of cholesterol transport inhibitors on apoptosis,

Annexin V-APC / Propidium Iodide staining assay kit (eBioscience, San Diego,

CA) was used. Briefly, cells were grown in 6-well plates up to 80% confluency and treated with indicated agents for 24 hours. Cells were processed according to manufacturer’s protocol and flow cytometry analysis was performed immediately on flow cytometry using a FACS Calibur (Becton Dickinson,

Mountain View, CA).

3.3.5 Cholesterol localization assay. Localization of intracellular cholesterol was detected through Filipin III staining of cells via Cayman’s Cholesterol Cell-Based Detection Assay Kit (Cayman

Chemical, Ann Arbor, MI). Lysosomal/late endosomal localization of cholesterol was detected through co-localization of LAMP1-RFP and Filipin III signals using iVision software (BioVision Technologies, Exton, PA). RFP tagged LAMP1 expressing UACC 903 cell line was generated using LAMP1-mRFP-FLAG plasmid (Addgene plasmid #34611) (234).

100

3.3.6 Evaluation of cellular endocytosis. Endocytic capacity of cells was measured through Alexa Fluor 488 conjugated transferrin protein (Molecular Probes, Eugene, OR) as described previously (44). Briefly, cells were plated in to chamber slides (or 6-well plates for flow cytometry) and treated with compounds for 3 to 4 hours. Next, cells were incubated 30 minutes with Alexa Fluor 488 conjugated transferrin protein (5

μg/mL) without changing the media. Cells were then washed with PBS and fixed with 4% paraformaldehyde for fluorescence microscopy analysis (or trypsinized, and collected for flow cytometry analysis).

3.3.7 Western blot analysis. 1-2 million melanoma cells were plated in 100 mm culture dishes and grown to 75-90% confluency. After drug treatments at indicated time points, cells were harvested in RIPA buffer containing protease and phosphatase inhibitors (Pierce

Biotechnology, Rockford, IL). BCA Assay from Pierce (Rockford, IL) was used to quantitate the amount of protein in collected cell lysates and 30 μg of protein per lane were loaded onto a NuPage gel (Life Technologies). Following electrophoresis, proteins were transferred to PVDF membrane and blots were probed with antibodies according to supplier’s recommendations (for detailed antibody information see Table 3.2). Enhanced chemiluminescence (ECL) detection system (Thermo Fisher Scientific, Rockford, IL) was used to develop immunoblots.

101

Table 3.2: Antibodies and sources

Antibody Company Catalog Number Akt (Total Akt1/2/3) Cell Signaling Technology, Danvers, MA 9272 Phospho-Akt Cell Signaling Technology, Danvers, MA 9271 ERK 2 Santa Cruz Biotechnology, Santa Cruz, CA sc-1647 Phospho-p44/42 MAPK Cell Signaling Technology, Danvers, MA 9101 BAX Cell Signaling Technology, Danvers, MA 2772 LC3B Cell Signaling Technology, Danvers, MA 2775 Phospho-STAT3 (Y705) Cell Signaling Technology, Danvers, MA 9145 STAT3 Cell Signaling Technology, Danvers, MA 4904 IGF-1RB (C-20) Santa Cruz Biotechnology, Santa Cruz, CA sc-713 HGFR (C-28) Santa Cruz Biotechnology, Santa Cruz, CA sc-161 PDGF Receptor β (28E1) Cell Signaling Technology, Danvers, MA 3169 SQSTM1/p62 Cell Signaling Technology, Danvers, MA 5114 Phospho-PRAS40 Cell Signaling Technology, Danvers, MA 2997 PRAS40 Cell Signaling Technology, Danvers, MA 2610 Cathepsin B Santa Cruz Biotechnology, Santa Cruz, CA sc-6493

3.3.8 Immunofluorescence analyses. Localization of cells IGF1R was measured through immunofluorescence staining of UACC 903 cells using IGF-IRβ Antibody (C-20) (Santa Cruz

Biotechnology, Santa Cruz, CA). Briefly, cells were plated in to chamber slides and grown up to 80 to 90% confluency, were treated with indicated compounds for 24 hours. Cells were then washed with PBS, fixed with 4% paraformaldehyde

(15 min), rinsed three times in 1X PBS (5 min each), blocked 60 minutes in

PBST with 1% BSA, incubated overnight with primary antibody (1:100 dilution in blocking buffer). Next, cells were rinsed again 3X and incubated for 1 hour with fluorochrome-conjugated secondary antibody (1:1000 in blocking buffer). Cells were then rinsed 3X, mounted on coverslips and analyzed by fluorescence microscopy. 102

3.3.9 Animal studies. All animal experiments were undertaken according to protocols approved by the Institutional Animal Care and Use Committee at The Pennsylvania State

University. Xenografted tumor formation was measured in athymic-Foxn1-/-

(nude) mice (Harlan Laboratories, Indianapolis, IN). One million cells were collected in 0.2 ml of 10% FBS supplemented DMEM to inject subcutaneously above both the left and right rib cages of 4- to 6-week-old female mice. Six days post cells injections when tumor size reached ∼100 mm3, animals were randomly separated into four groups (three experimental and control). Experimental group mice were orally administered with 50 mg/kg. Nortriptyline and Desipramine was given alternate days while Perphenazine was administered at 4 days interval due to the symptoms associated with drowsiness which is one of the common side effect of this compound. Perphenazine and Nortriptyline were dissolved in glyceryl trioctanoate, while Fluphenazine and Desipramine were dissolved in water. Drugs were administered directly into the stomach of mice via oral gavage (100 uL per treatment). Dimensions of developing tumors were measured on alternate days by using calipers.

3.3.10 Statistical analysis. The statistical analysis was performed using the unpaired Student t test. A P

< 0.05 was considered statistically significant. * P < 0.05; ** P < 0.01; *** P <

0.001. In graphs error bars represents ± SEM.

103

3.4 Results

3.4.1 Identification of compounds that kill cancer cells by inhibiting lysosomal cholesterol transport. Recently, a compound library screening has identified 72 compounds as functional inhibitors of lysosomal acid sphingomyelinase enzyme (231, 232). To test whether these compounds display similar anti-melanoma activity as leelamine, a lysosomotropic compound that induces melanoma cell death by inhibiting intracellular cholesterol transport, IC50 values for killing melanoma cells compared to normal fibroblasts was measured. Seven different melanoma cell lines harboring various combinations of V600EBRAF mutation and PTEN deletion were selected for this study as these mutations are important drivers of the melanoma development to activate the MAP and PI3 kinase pathways, respectively.

UACC 903 and 1205Lu cells harboring mutant BRAF and having PTEN deletion, had significantly lower (paired t-Test, p<0.001) IC50 values compared to wild-type PTEN (C8161 Cl.9, MelJuSO) containing melanoma cell lines or normal fibroblasts (FF2441) (Table 3.3 and Fig. 3.1). Average IC50 values for both

UACC 903 and 1205 Lu cells were three fold lower than normal fibroblasts. In contrast, wild-type BRAF/ wild-type PTEN cell line (C8161 Cl.9) or

V600EBRAF/wild-type PTEN cell lines (WM164 and 451Lu) were less sensitive to functional inhibitors of acid sphingomyelinases and IC50 values for these cell lines were not significantly different in contrast to the normal fibroblasts (FF2441).

104

TABLE 3.3

IC50 values for human cell lines PTEN WT DEL DEL WT WT WT WT Degree of Chemical

Mut. Status BRAF WT MUT MUT WT MUT MUT MUT Recovery Properties

-cyclo Baf. A1 dextrin

FF2441 903UACC 1205Lu C8161.Cl9 WM164M 451Lu 451LuR pKa logP PSA ASM ACTIVITY Leelamine 9.6 2.1 2.5 6.7 9.5 6.5 5.6 +++ ++++ 9.9 5.2 27.6 NA Amitriptyline 91.6 27.3 36.3 96.3 64.5 70.9 55.1 ++++ +++ 9.8 4.8 3.2 11.7 Amlodipine 35.2 11.9 12.8 34.3 25.8 20.8 17.7 +++ - 9.5 1.6 99.9 12.0 Astemizole 12.5 5.7 6.7 19.8 18.0 25.2 19.7 +++ +++ 8.8 5.4 42.3 14.3 AY9944 38.9 14.8 11.4 41.4 21.1 49.4 37.7 +++ - 9.1 5.8 24.1 22.1 Benztropine 78.7 53.8 70.0 72.3 75.0 76.7 43.4 + + 9.5 4.2 12.5 12.7 Chlorpromazine 34.8 16.4 15.0 38.8 22.7 23.2 22.7 ++ +++ 9.2 4.5 6.5 42.4 Chlorprothixene 48.0 15.8 8.9 17.9 17.5 34.8 28.0 + +++ 9.8 5.1 3.2 22.4 Clomiphene Citrate 27.4 13.8 16.0 24.6 21.5 22.6 12.9 + + 9.3 6.5 12.5 21.8 Clomipramine 24.6 13.2 11.6 36.5 24.1 25.3 17.3 +++ +++ 9.2 4.9 6.5 13.0 Cyclobenzaprine 68.0 22.7 34.6 84.0 53.5 66.9 52.5 ++ +++ 9.8 4.6 3.2 26.2 Cyproheptadine 92.1 37.2 39.1 >120 >120 69.2 42.2 - ++++ 8.1 4.4 3.2 22.2 Desipramine 90.4 20.6 16.8 66.4 50.1 64.1 41.8 +++ +++ 10.0 3.9 15.3 15.6 Desloratadine 44.2 21.0 19.6 55.7 37.7 34.5 29.4 +++ ++++ 9.7 4.0 24.9 21.9 Doxepin 192.5 40.3 52.6 71.7 75.0 91.8 75.2 +++ +++ 9.8 3.8 12.5 46.6 Fendiline 25.2 8.7 9.5 23.1 25.9 37.0 25.2 +++ +++ 10.1 5.8 12.0 25.2 Fluoxetine 49.7 7.6 14.5 NA NA 45.1 30.4 +++ +++ 9.8 4.2 21.3 13.0 Flupenthixol 21.7 7.1 7.7 19.4 15.2 32.6 26.1 ++++ ++++ 8.5 3.5 26.7 18.2 Fluphenazine 24.6 10.5 9.5 21.7 19.1 24.5 21.1 +++ +++ 8.2 4.0 30.0 16.5 Fluvoxamine 94.3 28.6 21.4 75.8 50.4 50.4 39.3 ++-+++ ++ 9.2 2.8 56.8 37.4 Hydroxyzin 98.6 44.8 62.7 180.0 88.4 93.3 57.2 ++ ++++ 7.8 3.4 35.9 43.0 Imipramine 184.3 41.0 42.3 95.2 86.3 79.0 67.3 +++ +++ 9.2 4.3 6.5 32.6 Maprotiline 41.9 13.0 13.4 39.6 39.0 22.3 25.3 +++ +++ 10.5 4.4 12.0 13.5 Mebhydrolin 117.3 42.1 110.4 >120 170.8 >120 144.0 + + 7.5 3.7 8.2 41.9 Mepacrine 7.4 2.6 3.8 11.3 11.0 44.2 7.5 ++ - 10.3 5.2 37.4 44.3 Mibefradil 18.1 5.2 4.9 18.1 10.0 19.2 14.5 +++ - 9.8 5.2 67.5 20.8 Norfluoxetine NA 8.9 NA NA NA NA NA ++++ ++++ 9.8 3.7 35.3 22.5 Nortriptyline 62.5 14.9 13.2 44.5 24.9 48.0 23.5 +++ +++ 10.5 4.4 12.0 13.3 Paroxetine 15.0 6.2 8.0 18.4 16.6 24.3 13.5 ++ ++ 9.8 3.2 39.7 31.7 Penfluridol 6.7 4.6 5.2 9.2 13.4 14.6 13.5 +++ - 9.0 7.3 23.5 22.0 Perphenazine 50.5 9.7 9.3 23.2 15.2 17.9 10.9 +++ +++ 8.2 3.7 30.0 20.1 Promazine 63.0 28.6 36.6 80.1 54.1 58.7 53.3 ++ ++ 9.2 3.9 6.5 33.6 Promethazin 56.7 17.4 33.5 74.3 48.4 57.9 40.2 ++ ++ 9.1 4.3 6.5 32.2 Protriptyline 41.3 10.8 18.7 48.6 35.9 50.8 31.1 +++ +++ 10.5 4.5 12.0 12.7 Sertindole 12.5 6.6 2.0 14.9 9.1 5.9 4.9 +++ +++ 8.6 3.8 40.5 12.0 Sertraline 36.4 8.5 8.4 18.7 25.4 30.0 23.6 +++ +++ 9.9 5.2 12.0 12.3 Suloctidil 8.4 6.5 5.3 12.9 13.2 14.8 14.0 ++ ++ 10.1 5.3 32.3 21.9 Tamoxifen 26.2 16.7 15.4 20.7 30.3 26.4 23.1 + + 8.8 6.4 12.5 4.1 Terfenadine 8.6 4.6 3.9 7.4 4.0 11.8 7.7 ++++ ++++ 9.0 6.5 43.7 21.8 Thioridazine 23.9 11.6 8.6 14.4 11.9 14.5 10.6 - +++ 8.9 5.5 6.5 10.4 Trifluoperazine 33.6 10.2 9.8 23.2 18.0 16.6 12.5 ++ +++ 8.4 4.7 9.7 8.3 Triflupromazine 43.2 12.4 12.2 37.7 22.3 37.4 20.8 +++ +++ 9.2 4.8 6.5 29.5 Zolantidine 40.7 33.3 28.0 71.7 46.1 50.1 33.9 + + 8.8 4.8 37.4 21.6

105

Figure 3.1

Figure 3.1: Distribution of IC50 values of FIASMAs for various melanoma cell lines th th and FF2441 fibroblasts. Box range shows 25 and 75 percentiles. Whiskers show outliers with outlier coefficient of 1.5.

To determine whether acid sphingomyelinase inhibitors trigger cell death by intracellular cholesterol transport inhibition as occurs with leelamine, the involvement of lysosomotropism and intracellular cholesterol accumulation was investigated. Since Bafilomycin A1 (BafA1) mediated inhibition of vacuolar

ATPases suppresses lysosomal accumulation of leelamine and hinders leelamine mediated cell death, the consequence of BafA1 co-treatment with functional inhibitors of acid sphingomyelinases was investigated. Cell death mediated by acid sphingomyelinase inhibitors was suppressed by inhibition of 106 vacuolar ATPases, which are listed in Table 1. This suggests that lysosomotropism plays an essential role in the cell death process. As a matter of fact, all of the Figure 3.2 FIASMAs had a calculated pKa value ranging between 7 and 11, which is a reported range for lysosomotropism (15)

(Table 3.3 and Fig. Figure 3.2: Histogram showing distribution of calculated pKa 3.2). values of FIASMAs.

Lysosomal/late endosomal accumulation of leelamine disrupts intracellular cholesterol homeostasis to trigger cholesterol accumulation in these organelles.

Leelamine mediated cell death is mediated by cholesterol accumulation since depletion of cholesterol using β-cyclodextrin treatment suppresses cell death. To determine whether cholesterol depletion using β-cyclodextrin would prevent killing mediated by acid sphingomyelinase inhibitors, cells were co-treated with both agents. Similar to leelamine-mediated cell death, depletion of cholesterol suppressed the cell death mediated by acid sphingomyelinase inhibitors, suggesting these compounds disrupt intracellular cholesterol homeostasis (Table

3.3).

107

3.4.2 Certain functional inhibitors of acid sphingomyelinase disrupt egress of cholesterol from late endosomal/lysosomal cell compartments. To further characterize the Figure 3.3 activity of acid sphingomyelinase inhibitors on melanoma cells, five compounds (Desipramine,

Flupentixol, Fluphenazine,

Nortriptyline and

Perphenazine), with low IC50 values, were selected from

Table 1. Effect on viability of melanoma cell line, UACC 903 and normal human fibroblast Figure 3.3: Viability of UACC 903 melanoma and fibroblast cells after 24 hours of treatment with were compared through MTS increasing concentrations of various FIASMA compounds. Viability graphs are built based on the B-spline curves for the increasing concentrations of assays. UACC 903 cells were drug treatments. Error bars represents ± SEM. killed at 4 – 6 fold lower concentrations of these compounds than normal fibroblasts (Fig. 3.3).

Compounds were lysosomotropic and induced vacuolization of cells following their treatment (Fig. 3.4). Bafilomycin A1 co-treatment at 50 nM suppressed cell death mediated by these agents suggesting that lysosomotropic property of the compounds play essential role in the induction of cell death (Fig. 3.5). Through these experiments, Leelamine was used as a positive control; where it was able 108 to induce 70% cell death and Figure 3.4 that was reduced to ~25% with

Bafilomycin A1 co-treatment.

Next, the effect of these five compounds on intracellular cholesterol localization was assessed through Filipin III staining. U18666A, a well- studied cholesterol transport inhibitor, and leelamine served as positive controls. Post six Figure 3.4: FIASMA compounds display lysosomotropic property hence induce hour treatment, all five vacuolization of cells following their treatment. compounds promoted Figure 3.5 intracellular cholesterol accumulation in contrast to DMSO control treatment similar to that observed with leelamine and U18666A a well- studied cholesterol transport inhibitor. (Fig. Figure 3.5: Viability of melanoma cells treated with 3.6-A). Cholesterol various FIASMA compounds in the absence or presence of V-ATPase inhibitor Bafilomycin A1. Error bars represents ± SEM. accumulation was 109 observed in late endosomal/ lysosomal cell compartments as shown by co- localization of RFP tagged LAMP1 (lysosome-associated membrane glycoprotein-1) with cholesterol (Filipin III) (Fig. 3.6-B).

Figure 3.6

A B

Figure 3.6: A, Fluorescence microscopy of subcellular cholesterol localization following Leelamine, U18666A or FIASMA treatments. B, co-localization of RFP tagged LAMP1 protein with accumulated cholesterol following Fluphenazine (10M, 6hr) treatment. Scatterplot of Filipin-III and LAMP1-RFP pixel intensities of the cells shown in B.

To determine whether cholesterol depletion could prevent melanoma cell death that is triggered by acid sphingomyelinase inhibitors, cells were cotreated with these agents and beta-cyclodextrin. 1 mM beta-cyclodextrin retarded

UACC 903 cell death mediated by all five compounds similar to that when leelamine and beta-cyclodextrin are combined (Fig. 3.7). Since FIASMA compounds mediated cell death through lysosomal/endosomal accumulation of cholesterol hereafter FIASMA compounds will be referred as intracellular cholesterol transport inhibitors (CTI) throughout the manuscript. 110

3.4.3 Intracellular cholesterol transport inhibitors effectively supress xenografted melanoma tumor growth.

To measure the Figure 3.7 chemotherapeutic efficacy of Perphenazine,

Nortriptyline and

Desipramine were tested on xenografted melanoma mouse models. Perphenazine was the most effective at Figure 3.7: Viability of UACC 903 melanoma cells following FIASMA treatment alone or in combination with - reducing tumor growth cyclodextrin. Error bars represents ± SEM. by ~60 % compared to vehicle control whereas Nortriptyline and Desipramine led to 50% and 30% decrease, respectively (Fig. 3.8-A).

Since, Perphenazine, an antipsychotic agent, was the most promising at reducing tumor growth, this agent and another more potent antipsychotic CTI,

Fluphenazine, was further investigated for efficacy against UACC 903, 1205Lu and A2058 (IC50 values for both Perphenazine and Fluphenazine ~10 uM) melanoma xenografts. In all three cell lines, oral administration of 50 mg/Kg

Perphenazine or 25 mg/Kg Fluphenazine at 4 day intervals led to 40 to 60 % decrease in tumor development (Figs. 3.8-B, D and E). Weight of tumors harvested from animals treated with CTIs was significantly lower than control groups and correlated with the tumor volume measurements (Figs. 3.8-C and F). 111

Figure 3.8

Figure 3.8: A, Bar graph representing the effect of oral administration of Desipramine, Nortriptyline and Perphenazine on xenografted UACC 903 melanoma tumor growth at day 22. B, D and E, growth kinetics of UACC 903, 1205 Lu and A2058 xenografted tumors following oral administration of Fluphenazine (25 mg/kg) and Perphenazine (50 mg/kg). Image (insert) depicting UACC 903 tumors harvested at the end of experiment. C and F, bar graphs showing percentage of tumor weights in contrast to control treated animals, harvested from UACC 903 and A2058 xenografted animals, respectively. Error bars represents ± SEM. NS: Not significant. * p<0.05; ** p<0.01

112

3.4.4 Intracellular cholesterol transport inhibitors block autophagic flux. Leelamine mediated Figure 3.9 disruption of intracellular cholesterol leads to inhibition of both autophagic flux and cellular endocytosis. To investigate whether CTIs also inhibit autophagic flux, levels of an autophagosome marker,

LC3B and an autophagic Figure 3.9: A, Western blot analyses showing LC3B and flux marker, P62 protein levels as a marker of autophagic flux in CTI treated UACC 903 cells; Erk-2 served as a loading control. p62/SQSTM1 were B, fluorescence microscopy of GFP-tagged LC3B suggesting autophagosome accumulation in CTI- or BafA1- treated UACC 903 cells. examined. Western blotting of cell lysates harvested from Nortriptyline, Perphenazine or

Fluphenazine treated UACC 903 cells, showed dose dependent accumulation of

LC3B and p62 proteins (Fig. 3.9-A). The accumulation of LC3B was also noticed through fluorescence microscopy of GFP-tagged LC3B expressing UACC 903 cells (Fig. 3.9-B). These results suggests that, similar to leelamine, CTIs inhibit autophagic flux and causes aggregation of autophagosomes. 113

3.4.5 Inhibition of intracellular cholesterol transport suppresses cellular endocytosis and retard receptor tyrosine kinase - Akt / Stat3 signaling. The effect of cholesterol transport inhibitors on cellular endocytosis was investigated through cellular uptake of Alexa Fluor conjugated transferrin protein.

Transferrin is internalized into early endosomes through clathrin-mediated endocytosis which serves as the major pathway for uptake of receptor–ligand complexes (235). Uptake of Alexa Fluor conjugated transferrin protein enables evaluation of endocytic activity through fluorescence microscopy or flow cytometry. Cholesterol transport inhibitors significantly suppressed the uptake of transferrin protein similar to that occurring with leelamine suggesting that lysosomal/endosomal accumulation of cholesterol halts cellular endocytosis (Fig.

3.10-A). In contrast DMSO treated control cells internalized Alexa Fluor conjugated transferrin protein. This observation was further confirmed by flow cytometry based quantitation of transferrin signal which revealed a dose- dependent inhibition of endocytosis following cholesterol transport inhibitor treatment (Fig. 3.10-B). 114

Figure 3.10

Figure 3.10: A, fluorescence microscopy images showing endocytosis of Alexa Fluor– conjugated transferrin protein following DMSO control or CTI treatments. B, flow cytometry–based quantification of Alexa Fluor–conjugated transferrin protein endocytosis following CTI treatments.

Inhibition of cellular endocytosis is expected to suppress signaling cascades that are regulated by receptor tyrosine kinases, since activity of these receptors depend on functional endocytosis (236). Leelamine has been shown to alter localization of several receptor tyrosine kinases and inhibit downstream cascades of the PI3K/AKT, MAPK and STAT3 signaling pathways. The localization of various receptor tyrosine kinases and activity of these signaling cascades were investigated through immunofluorescence staining and western blotting. Treatment of UACC 903 cells with CTIs altered localization of IGF1R receptors to perinuclear region (Fig. 3.11). Western blotting data also confirmed 115

alterations in receptor Figure 3.11 tyrosine kinases. For example, Nortriptyline,

Perphenazine or

Fluphenazine treatments caused dose-dependent accumulation of pro HGFR and pro-IGFIR proteins (Fig.

Figure 3.11: 3.12). Furthermore, Immunofluorescence staining of IGF1R- downstream effectors of showing perinuclear accumulation (arrow receptor tyrosine kinases, heads) following CTI treatment. phospho AKT and phospho

STAT3 levels were also downregulated (Fig. 3.12). Interestingly, phospho

ERK1/2 levels were up-regulated with CTI treatments. Additionally, lysosomal

Cathepsin B levels, which has been reported to be an important protease for cancer metastases, was also investigated through western blotting (237).

Cathepsin B is a cysteinyl protease that resides inside the lysosomes as an inactive pro-enzyme until its secretion to the extracellular space where in melanoma cells it facilitates cell invasiveness and migration (238). Robust decreases in active Cathepsin B levels with concomitant increase in inactive pro-

Cathepsin B levels were observed (Fig. 3.12).

116

Figure 3.12

Figure 3.12: Western blot analysis of UACC 903 cells treated with increasing concentrations of Nortriptyline, Perphenazine or Fluphenazine.

3.4.6 Cholesterol transport inhibitors trigger caspase-independent cell death that involves mitochondrial localization of BAX. To characterize the downstream signaling cascades that mediate cell death triggered by CTIs, alterations in various apoptotic signals were examined. First, to differentiate between viable, early and late apoptotic cells, UACC 903 cells were treated with CTIs for 24 hours and stained with propidium iodide (PI) in tandem with APC-conjugated Annexin V. All of the tested CTIs led to a significant increase in the percentage of early apoptotic cells (Annexin V +, PI -)

(Fig. 3.13). In DMSO treated control cells only ~1 % of the cells were undergoing apoptosis. However, in the treated cells this percentage was 117 increased to 4-8 %. The increase in the Figure 3.13 percentage of apoptotic cells was dose- dependent. Furthermore, a dramatic increase (0.5 % vs 10 - 37 %) was noticed in late apoptotic/necrotic cells

(Annexin V +, PI +).

In order to eliminate the possibility of cell death through necrosis, Necrostatin-

V and IM-54, two necrosis inhibitors were used. This approach has been recommended by nomenclature committee on cell death to identify the cause of cell accumulation in late Figure 3.13: FACs analysis showing apoptotic/necrotic quadrant (239). annexin V- APC/PI staining of CTI treated UACC 903 cells. Cells, in the Neither IM-54 nor Necrostatin-5 lower right quadrant show early apoptotic cells; in the upper right quadrant show late apoptotic dead cells. cotreatment was able to protect cells from leelamine mediated cell death (Fig. 3.14; Left Panel). In addition, their combination was also not able to protect cells from any of the tested CTIs ruling out the possibility of involvement of necrosis in the cell death process (Fig. 3.14;

Right Panel).

Loss of transmembrane potential of mitochondria (∆ψmt) plays a central role in many apoptotic processes (240). As leelamine has been shown to decrease mitochondrial membrane potential (MMP), the effect of CTIs on MMP was 118 measured through flow cytometry of Tetramethylrhodamine, Ethyl Ester (TMRE)

Figure 3.14

Figure 3.14: Viability of cells treated with leelamine or CTIs in the absence or presence of necrosis inhibitors IM54 and/or Neecrostatin-V. Error bars represents ± SEM. stained UACC 903 cells. Positive control, FCCP (an oxidative phosphorylation uncoupler) treatment diminished the MMP in 100% of the cells. 13% to 15% of the cells lost their MMP, post 3 hours of Figure 3.15 10 uM Nortriptyline or Perphenazine treatments (Fig. 3.15). The decrease in

MMP was dose and time dependent as evidenced by 19% and 28% decrease after 6 hour of 10 and 15 uM

Perphenazine treatments respectively.

As a pro-apoptotic member of the

Bcl-2 protein family, BAX is an important regulator of the apoptotic process and known to translocate to Figure 3.15: Histogram showing mitochondrial membrane potential following CTI or FCCP (positive control) treatments. 119 mitochondrial membrane and subsequently induce a rapid loss of MMP (241).

To assess the involvement of BAX in CTI mediated cell death, the sensitivity of wild-type and BAX-knockout HCT116 cells to CTIs were compared. BAX- knockout cells were more resistant to increasing concentrations of Perphenazine treatment (Fig. 3.16; Left Panel). In fact, including Leelamine, all other tested

CTIs were also more effective towards wild-type HCT116 cells in contrast to BAX knockouts (Fig. 3.16; Right Panel).

Figure 3.16

Figure 3.16: Viability of wild-type or BAX-knockout HCT116 cells after 24 hours of treatment with increasing concentrations of Perphenazine (left panel) or other CTIs (right panel). Error bars represents ± SEM.

It is known that following its mitochondrial localization, BAX mediates

Cytochrome C release from mitochondria which leads to assembly of apoptosome and consequently activation of caspases (242). To investigate whether activity of apoptosome is involved in CTI mediated cell death, NS-3694, an inhibitor of apoptosome formation was used. Interestingly, the response of

CTIs to apoptosome inhibition was variable. 50 M NS-3694 was partially able to 120 protect cells from cell death mediated by Perphenazine, Fluphenazine or

Flupentixol treatment, while it was ineffective against Desipramine, Nortriptyline or leelamine treatments (Fig. 3.17).

Since, activation of caspase

proteases plays a central role in

several apoptotic programs;

caspase-dependence of CTI

mediated cell death was

examined through pan-caspase

inhibitor z-VAD-fmk co-treatment.

TRAIL treatment was used as a

positive control for this

experiment. 50 ng/mL TRAIL decreased the viability of UACC 903 cells to 34% of the DMSO treated controls whereas, co-treatment of 20 mMol/L z-VAD-fmk was able to totally protect cells from TRAIL (Fig. 3.18). However, inhibition of caspases was unable to protect cells from any of the fıve CTIs or leelamine suggesting that disruption of cholesterol transport triggers caspase-independent cell death (Fig.3.18).

It is known that, lysosomal membrane permeabilization can lead to leakage of lysosomal proteases to cytosol and trigger caspase-independent cell death (119,

243). Although Z-VAD-fmk has repeatedly been shown to inhibit lysosomal proteases, such as calpains and cathepsins, the involvement of lysosomal leakage was further studied through various protease inhibitors (239). Co- 121

Figure 3.18

Figure 3.18: Right Panel : Caspase-dependence of CTI mediated cell death measured through treatment of UACC 903 cells with CTIs in the absence or presence of pan-caspase inhibitor, z-VAD-fmk (20M). Left panel is a positive control for zVADfmk co-treatment. It effectively suppresses TRAIL (50ng/mL) mediated caspase activation. Error bars represents ± SEM. ** p<0.01. treatment of ALLN (Calpain/Cathepsin Inhibitor-1), leupeptin (cysteine, serine and threonine protease inhibitor), Pepstatin-A (aspartic proteinase inhibitor) or

AEBSF (serine peptidase inhibitor) were not able to protect cells from the tested

CTIs suggesting that lysosomal proteases are not involved in cell death process.

122

3.5 Discussion Recently Leelamine, a lysosomotropic compound, was identified as a chemotherapeutic agent against melanoma (171). Findings related to the mechanism of action of leelamine suggested a crucial interaction between lysosomal accumulation of the compound and its activity. Following lysosomal accumulation, leelamine disrupts intracellular cholesterol transport and induces a phenotype that mimics type C form of Niemann Pick disease (NPC) (44). NPC is an autosomal recessively inherited lysosomal storage disease that causes neuronal cell death through intracellular accumulation of sphingolipids and cholesterol (244). It is genetically and clinically distinct from type A and B forms in which loss of function mutations in the acid sphingomyelinase gene renders lysosomal sphingomyelin accretion and consequently leads to defective lysosomal/endosomal cholesterol trafficking (245). However, in the type C form, mutation of NPC1 protein disrupts cholesterol efflux from lysosomes leading to its build up in lysosomal/late endosomal cell compartments (246).

In two consecutive studies, Kornhuber et al. identified a class of compounds that were able to inhibit lysosomal acid sphingomyelinase enzyme activity and hence named them as functional inhibitors of acid sphingomyelinase activity (

FIASMA’s) (231, 232). Most of the functional inhibitors of acid sphingomyelinase were tricyclic antidepressants, antipsychotics or antihistamines. In their study, a tricyclic antidepressant, imipramine, was identified as a functional inhibitor of acid sphingomyelinase (231). Imipramine is one of the few compounds that are also used to study the NPC disease (247). Similar to leelamine, imipramine disrupts 123 intracellular cholesterol transport and triggers a phenotype that resembles the

NPC disease (247). Considering the facts that: i) Type A and B form of Niemann

Pick disease is triggered by inhibition of the ASM activity; ii) Type C form of the disease is triggered by disruption of intracellular cholesterol transport; iii)

Imipramine was identified as a functional inhibitor of acid sphingomyelinase and known to mimic NPC disease; iv) Leelamine mediates melanoma cell death through induction of intracellular cholesterol accumulation; our study suggest that

FIASMA compounds might function as intracellular cholesterol transport inhibitors and might have the potential to induce melanoma cell death. In fact, in this study it was shown that melanoma cells were ~3 times more sensitive to

FIASMA compounds in contrast to normal fibroblasts. Moreover, a slight but significant correlation between IC50 values and reported residual acid sphingomyelinase activity of the FIASMA compounds was observed. Thus, the results of the present study clearly suggest that FIASMA compounds have the potential to show chemotherapeutic activity through the mechanisms similar to those that are mediated by leelamine.

Studies carried out by Kornhuber et al. also have suggested that pKa

(dissociation constant) and LogP (partition coefficient) values are detrimental factors for the structure-property activity relationship of the FIASMA compounds.

The pKa value is the predominant factor that determines the accumulation of the lysosomotropic compounds in acidic organelles (14). As shown in the current study, FIASMA compounds tend to have a calculated pKa value around 9.5. On the other hand, the LogP value represents hydrophobicity (or lipophilicity) of a 124 compound which is an important factor for drug-likeness as it affects drug absorption and solubility (248). In fact, Lipinski and his colleagues had analyzed the physicochemical properties of over 2,000 drugs and set the maximum logP value to 5 as a guideline to drug-likeness (249). FIASMA compounds had a

LogP value around 5 and were expected to diffuse easily through blood-brain barrier due to their lipophilicity (231). Indeed, most of the FIASMA’s were tricyclic lysosomotropic antidepressants or antipsychotics Central Nervous

System (CNS) related drugs.

In the literature there is a significant amount of data suggesting that tricyclic lysosomotropic antidepressant compounds display activity against several malignancies (67, 69, 250, 251). Many of these antidepressants were reported to trigger cancer cell death besides restoring sensitivity of multidrug resistant

(MDR) cancer cell lines to various chemotherapeutic agents (10-13). For instance, Perphenazine has been reported to induce mitochondria-mediated cell death in human neuroblastoma cells and trigger apoptosis in both wild-type and

MDR B16 melanoma cells (252, 253). Fluphenazine was also effective against this multi-drug resistant cell line (253). Flupentixol was reported to enhance sensitivity of murine fibrosarcoma cells to anticancer drugs such as Adriamycin,

Actinomycin D and Vinblastine (254). Also, another antidepressant Desipramine was shown to trigger apoptotic cell death of colon carcinoma cells through both mitochondria dependent and independent pathways (255).

Results of the present study suggest that lysosomotropic cholesterol transport inhibitors mediate melanoma cell death through inhibition of autophagic flux and 125 cellular endocytosis. As a consequence, they inhibit RTK-AKT/STAT3 signaling cascades that are known to be highly activated in the significant portion of melanomas (256-258). Melanoma cell lines which harbor PTEN deletion tends to have high AKT activity which may explain their increased sensitivity to the cholesterol transport inhibitors. As a master regulator of apoptosis, AKT activation suppresses many apoptotic stimuli through inhibition of BAX localization to the mitochondrial membrane (259). In fact, in this study it was shown that FIASMA compounds suppressed AKT signaling and BAX knock-out cells were resistant to cell death mediated by these agents. When BAX localizes to mitochondria, it triggers mitochondrial membrane depolarization and cytochrome C release (260). Consequently this induces apoptosome formation and caspase activation. Investigated CTIs also diminished the mitochondrial membrane potential and activated the caspases. Apoptosome inhibitor NS-3694 was able to partially suppress the cell death whereas pan-caspase inhibitor, zVAD-fmk, failed to rescue cells from cell death. This controversy findings suggests that an unusual caspase 3/7 independent but apoptosome dependent cell death process was triggered by CTIs. One possible pathway might involve caspase-9 activity since NS-3694 is known to disrupt apoptosome/caspase-9 interaction and zVAD-fmk is reported to be able to enhance caspase 9 activity

(261, 262). A similar kind of cell death process which involves caspase 9 but not

3 has been previously reported (263). However, further studies are warranted to identify the details of this unusual cell death process. 126

Interestingly, in a case-control study that involves follow up of a cohort of

6168 chronic schizophrenic patients for 27 years, a significant association between reduced risk of prostate cancer and use of high-dose tricyclic antidepressants was discovered (114). In another case-control study, association between previous tricyclic antidepressant usage and cancer incidence was investigated (85). After adjusting for other possible influences, such as age, gender, smoking, alcohol usage, etc., a statistically significant inverse association between previous tricyclic antidepressant usage and incidence of glioma as well as colorectal cancers was detected. Notably, these associations were reported to be dose- and time-dependent suggesting that tricyclic antidepressants may have potential as chemotherapeutic agents.

Many of the agents that were identified as FIASMA compounds are currently being tested in clinical trials for their efficacy against various cancers including leukemia, myeloma, lung, prostate and colorectal cancers (264-268). The chemotherapeutic potential of Quinacrine (Mepacrine), an antimalarial basic tricyclic amine, on prostate cancer was assessed in a phase 2 trial (265). The trial was conducted in patients who did not responded to previous chemotherapies and no drug-related serious adverse effects were observed.

Although only one of the 31 patients showed partial response to the treatment,

50% of the patients showed stabilization or decrease in the rate of disease progression. More recently, Sage et al. reported the activity of tricyclic antidepressants against small cell lung cancers and carried out a phase-IIa clinical study with Desipramine (266, 269). Although their plan was starting 127 patients on doses of 75 mg/day and increasing this up to 450 mg/day, all patients but one were not able to tolerate a dosage above 150 mg/day (personal communication). This intolerability coupled with lack of efficacy led to the early termination of the study suggesting that alternative approaches in the administration of these drugs may be required.

In this report, in vivo studies exhibited significant anti-melanoma potential of

Perphenazine and Fluphenazine, two CNS active compounds. Both agents led to a 50 to 60 % decrease in the growth of xenografted melanoma tumors.

However, drowsiness was a prevalent complication in these studies and external heat support was applied in order to reverse the effects of lowered blood pressure. As an antipsychotic drug, the suggested dosage of Perphenazine for humans is 0.2 to 0.4 mg/kg (12 to 24 mg/day) for a 60 kg human but in rare conditions, such as hospitalized patients with schizophrenia, this dosage can be increased up to ~1 mg/kg (64 mg/day). According to the FDA guidelines this dosage range corresponds to 2.5 to 5 mg/kg and can go up to 12.5 mg/kg in mice. For Fluphenazine the suggested dosage in humans is generally less than

0.33 mg/kg (20 mg/day) for a 60 kg human which corresponds to 4.1 mg/kg in mice. In this study, however, the doses given were 4 to 10 times greater than the standard dosage range in mice in order to induce chemotherapeutic activity.

Although these dosages are currently impractical in humans, decreasing the blood-brain-barrier permeability of these compounds could make these high doses a viable option. Liposomal formulation could represent a potential approach for decreasing the blood-brain-barrier permeability and allow clinical 128 trials such as that conducted by Sage et al to reach doses required for chemotherapeutic efficacy.

Antidepressants have multifaceted value in cancer therapeutics and hence have been proposed by World Health Organization as a supportive care for cancer patients (65, 270). They can reduce severity of cancer-associated pain, anxiety, depression as well as adverse effects of chemotherapy such as vomiting

(251). As it was reported in this manuscript, many correlative studies suggested that tricyclic antidepressants have potential chemotherapeutic anti-cancer activities. However, further studies and clinical trials are required to determine which antidepressants (or cholesterol transport inhibitors or FIASMA`s) are effective, and whether or when they can be combined with other chemotherapeutic agents.

3.6 Acknowledgements We are thankful to Dr. Sabatini DM for providing LAMP1-mRFP-FLAG plasmid, Dr. Jin-Ming Yang, Dr. Robert Levenson, Dr. Sinisa Dovat, Dr. Rogerio

Neves, and Dr. Raghavendra Gowda for their guidance throughout the experiments.

129

CHAPTER 4

Conclusions and Future Directions

130

4.1 Conclusions The study presented in this dissertation details the mechanism of action of hydrophobic lysosomotropic compounds to induce cell death in melanoma cells.

This study was initiated with the aim of identifying the mechanism of chemotherapeutic action of a naturally derived small molecule, leelamine. It was discovered that, leelamine mediates cancer cell death through inhibiting intracellular cholesterol transport. The findings of the leelamine study formed the basis for the identification and characterization of class-II lysosomotropic compounds as intracellular cholesterol transport inhibitors.

In these studies we have identified that, hydrophobic lysosomotropic compounds (e.g., leelamine, Perphenazine, Fluphenazine) accumulate in acidic organelles due to their lysosomotropic property leading to disruption of lipid homeostasis and accumulation of cholesterol in these organelles. As a consequence, autophagic flux and cellular endocytosis were inhibited resulting in suppression of multiple oncogenic signaling pathways, such as AKT and STAT3.

In vitro, these compounds were able to kill mutant BRAF/ PTEN-/- melanoma cells in 3 to 5 fold less concentrations compared to normal skin cells. The cancer cell death was dependent on both lysosomotropic property of the compounds and intracellular cholesterol accumulation since inhibition of v-ATPases or depletion of cholesterol was able to suppress cell death. Cholesterol transport inhibitors were able to inhibit xenografted melanoma tumor growth development, in vivo. It was demonstrated that, oral administration of Perphenazine (50 mg/kg) or 131

Fluphenazine (25 mg/kg) was able to decrease tumor growth up to 50-60 % of the controls.

Incidence and mortality rates for malignant melanoma continue to rise annually. It is estimated that there will be approximately 76,000 new cases of melanoma and over 9,000 deaths this year. Advanced-stage metastatic melanoma carries a poor prognosis, with an overall median survival of ~2–8 months, and with only 5% of patients surviving beyond 5 years. For last few decades systemic treatment options for melanoma were ineffective for the long- term treatment of the disease. Therefore; new and novel approaches are needed to augment existing ones that could enhance melanoma treatment options. The research presented in this dissertation demonstrated that class-II lysosomotropic compounds exhibit anti-melanoma potential through inhibiting lysosomal egress of cholesterol. Since many of these agents are therapeutic drugs approved by

FDA for their antidepressant, antipsychotic or antihistamine activities, the results of these studies would be unique in terms of repurposing these generic drugs as anti-cancer agents. Since these drugs have well-known toxicity profiles, the transition to clinic for the treatment would be rapid.

132

4.2 Future Directions Following studies are suggested to extend the observations made in this dissertation by further assessing the chemotherapeutic activity of class-II lysosomotropic compounds as inhibitors of intracellular cholesterol transport.

● In this dissertation, including leelamine we have tested 43 compounds for

their activity against melanoma cell lines as well as normal fibroblasts.

Although all of these, compounds were able to trigger cell death in several

fold lower concentrations in melanoma cells compared to normal

fibroblasts, the range of IC50 values was very wide. This suggests that

some of the compounds could be more effective due to their

physicochemical properties. Therefore, to identify the “best” cholesterol

transport inhibitor (CTI) a QSAR study can be conducted. Development of

a good QSAR model might allow modification of these existing

compounds to enhance anti-cancer activity.

● Since drugs are extensively metabolized in vivo, efficacies and toxicities

could show great variability in contrast to their in vitro effects. Therefore, a

full range of drug metabolism and pharmacokinetic studies can be

conducted to identify the most potent CTI as an anti-cancer candidate. A

variety of in-silico tools can be used to predict the enzymes that are likely

to metabolize a compound as well as the metabolites of the compound

(271).

133

● Although many of the class-II lysosomotropic compounds are generic

drugs with well-known toxicity profiles and regime, their application as a

chemotherapeutic agent would further require dose and time interval

related studies. In our studies we have observed that Perphenazine which

has an IC50 value of ~10 µM for UACC 903 cells in-vitro, was able to

decrease xenografted tumor size ~50% when administered 50 mg/Kg

once in every four day. According to FDAs human equivalent dosage

calculation guidelines this dosage corresponds to 3 mg/Kg for humans.

Whereas, for hospitalized schizophrenia patients, the highest dosage

suggested for this drug is 1 mg/kg per day. Therefore, it would be

pertinent to do dose escalation studies for establishing a tolerable and

efficacious dosage regime.

● Another important concern related to the in-vivo applicability of cholesterol

transport inhibitors involves the potential adverse effects of these

compounds. Treatment of rats with high doses of U18666A was reported

to cause cataracts, especially when treatment was initiated immediately

after birth (45). It was hypothesized that alteration of the cholesterol

content of the lens fiber cell plasma membrane could be the basis of lens

opacification caused by U18666A treatment. Interestingly in many case-

control studies, a significant risk of development of cataract has been

linked with antidepressant or antipsychotic usage (272-274). Moreover,

since many of the class-II lysosomotropic compounds are CNS active 134

drugs (e.g., antidepressants, antipsychotics), their application at high-

doses might cause severe adverse effects. In fact, symptoms associated

with drowsiness-sleepiness were observed with Perphenazine (50 mg/kg)

or Fluphenazine (25 mg/kg) treated animals, which persisted as long as

48 hours for some of these animals. As a consequence, this caused

dehydration as well as decrease in body temperature requiring external

heat support for the recovery. Therefore, alternative treatment

approaches can be required to prevent toxicity issues.

● The CNS activity of class-II lysosomotropic compounds is associated with

high blood-brain-barrier (BBB) permeability due to high lipophilicity of

these compounds. Therefore, decreasing the BBB permeability could

overcome the CNS associated side effects of these agents. Since

liposomes have low BBB permeability, intravenous administration of these

agents in liposome encapsulated formulations could be a potential

approach to overcome CNS related side effects. Therefore, development

of nanoparticles containing cholesterol transport inhibitors and evaluating

therapeutic potential following intravenous delivery is warranted. The

ideal agent is predicted to kill the melanoma cells by inhibiting the key

pathways to which the cancer cell has become addicted during its

evolution and have a minimal effect on the CNS by not passing the blood-

brain barrier.

135

● In this dissertation, the efficacy of leelamine and several class-II

lysosomotropic compounds on melanoma cell lines and xenografted

tumors were investigated. In-vitro studies suggested that, these agents

were more effective on BRAF mutant / PTEN-/- melanoma cell lines in

contrast to other melanoma cells. The possible mechanisms leading to

increased sensitivity of these compounds were discussed in the last part

of the chapter one of this dissertation. However, these mechanisms might

require further studies to identify which cancers would respond better to

CTI treatment. Moreover, the efficacy of the class-II lysosomotropic

compounds on some other cancer types has been reported previously.

Therefore, it is worthwhile to conduct a screen on various cancer cell lines

in order to explore the chemotherapeutic potential of these agents on

other cancer types.

● Another important subject that requires further investigation is related to

the effect of class-II lysosomotropic compounds on drug resistance.

Currently, targeted therapies such as Zelboraf and Dabrafenib, two FDA

approved mutant B-RAF inhibitors, are being used for the short-term

management of melanomas. However, an aggressive and drug resistant

disease usually develops just after few months of treatment. As discussed

in the first chapter, class-II lysosomotropic compounds have been

reported to induce sensitivity of multidrug resistant cell lines to various

chemotherapeutic agents. Therefore, it would be interesting to assess 136

whether combinatorial treatment of BRAF targeted agents with class-II

lysosomotropic compounds would increase the efficacy of treatment while

preventing drug resistance.

● It has been determined in this dissertation that lysosomal/late endosomal

accumulation of cholesterol has an essential role in induction of cell death

in melanoma cell lines. However, it is presently unclear whether in-vivo

efficacy of these agents also depends on intracellular cholesterol

accumulation in tumors. Hence, it would be important to determine,

whether class-II lysosomotropic compounds could induce same alterations

in tumor tissues compared to what was observed in in-vitro studies. In

addition, as it was discussed in the last section of chapter one, the

increased levels of cholesterol in cancer cells may contribute to their

sensitivity to CTIs. The validity of this hypothesis can be checked by

assessing the cholesterol levels in various cell lines as well as tumors.

● Further investigation related to the identification of link between

cholesterol accumulation and cell death is required. As discussed in the

first chapter, lysosomal sphingosine accumulation is a hallmark of NPC1

disease and has also been observed following U18666A treatment. In

fact, U18666A treatment has been demonstrated to elevate sphingosine

levels prior to cholesterol accumulation and treatment of cells with

sphingosine was able to trigger lysosomal cholesterol accumulation. 137

Although this suggests that increased sphingosine levels could be the

initiator of cholesterol accumulation; currently the source of elevated

sphingosine is unknown. It was hypothesized that, NPC1 could also be a

transporter for sphingosine. This hypothesis was supported and

contradicted by the findings of various studies. Hence further studies are

required to understand how class-II lysosomotropic compounds elevate

sphingosine levels and inhibit cholesterol egress from acidic cell

compartments.

● Although several studies have been conducted to identify any association

between the risk of cancer development and usage of antidepressants,

antipsychotics or antihistamines, contradictory results were obtained.

Many factors, such as size and quality of analyzed data, might have

contributed to these contradictions. However, as discussed earlier, class-

II lysosomotropic compounds are more effective in cancers with unique

mutations. Therefore, conducting case-control studies in subtypes of

cancers could identify better associations between decreased risk of

cancers and cholesterol transport inhibitors. In addition, it would be

interesting to conduct an epidemiological study to identify whether there is

a decreased risk of cancer development in NPC patients, since their cells

already have decreased levels of intracellular cholesterol transport.

138

● During our studies we have identified four compounds, -cyclodextrin,

baicalein, staurosporine and Go6976, that were able to suppress

leelamine mediated cell death. As leelamine resembles Niemann Pick

Type C disease these compounds might also show protective activity

against this neurodegenerative disease. In fact, on May 2010, -

cyclodextrin has gained orphan drug status and designated as a promising

agent for the treatment of NPC disease. However very high concentrations

of -cyclodextrin is required for the treatment. In vitro, 1 mM -cyclodextrin

was able to suppress leelamine mediated cell death while in clinical trials

-cyclodextrin was administered at 2500 mg/kg as an eight-hour infusion,

twice weekly (203). However, any of the other compounds that are

identified in this study, were studied for the treatment of NPC. Since these

agents were also able to suppress leelamine mediated cell death at very

low concentrations (Go6976, 500nM; Staurosporine, 5nM; and Baicalein,

35 uM) assessment of their efficacy for the therapeutics of NPC disease

could raise a potential hope for NPC patients.

139

References 1. de Duve C, de Barsy T, Poole B, Trouet A, Tulkens P, Van Hoof F. Commentary. Lysosomotropic agents. Biochemical pharmacology. 1974;23:2495-531. 2. Oblak E, Krasowska A. [The biological activity of lysosomotropic agents]. Postepy higieny i medycyny doswiadczalnej. 2010;64:459-65. 3. Duvvuri M, Krise JP. A novel assay reveals that weakly basic model compounds concentrate in lysosomes to an extent greater than pH-partitioning theory would predict. Molecular pharmaceutics. 2005;2:440-8. 4. Kaufmann AM, Krise JP. Lysosomal sequestration of amine-containing drugs: analysis and therapeutic implications. Journal of pharmaceutical sciences. 2007;96:729-46. 5. Kallunki T, Olsen OD, Jaattela M. Cancer-associated lysosomal changes: friends or foes? Oncogene. 2013;32:1995-2004. 6. Mellman I. Endocytosis and molecular sorting. Annual review of cell and developmental biology. 1996;12:575-625. 7. Goldman SD, Funk RS, Rajewski RA, Krise JP. Mechanisms of amine accumulation in, and egress from, lysosomes. Bioanalysis. 2009;1:1445-59. 8. Kornhuber J, Retz W, Riederer P. Slow accumulation of psychotropic substances in the human brain. Relationship to therapeutic latency of neuroleptic and antidepressant drugs? Journal of neural transmission Supplementum. 1995;46:315-23. 9. Homewood CA, Warhurst DC, Peters W, Baggaley VC. Lysosomes, pH and the anti-malarial action of chloroquine. Nature. 1972;235:50-2. 10. Hait WN, Gesmonde JF, Murren JR, Yang JM, Chen HX, Reiss M. Terfenadine (Seldane): a new drug for restoring sensitivity to multidrug resistant cancer cells. Biochemical pharmacology. 1993;45:401-6. 11. Akiyama S, Shiraishi N, Kuratomi Y, Nakagawa M, Kuwano M. Circumvention of multiple-drug resistance in human cancer cells by thioridazine, trifluoperazine, and chlorpromazine. Journal of the National Cancer Institute. 1986;76:839-44. 12. Peer D, Margalit R. Fluoxetine and reversal of multidrug resistance. Cancer letters. 2006;237:180-7. 13. Zhou T, Duan J, Wang Y, Chen X, Zhou G, Wang R, et al. Fluoxetine synergys with anticancer drugs to overcome multidrug resistance in breast cancer cells. Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine. 2012;33:1299-306. 14. Marceau F, Bawolak MT, Lodge R, Bouthillier J, Gagne-Henley A, Gaudreault RC, et al. Cation trapping by cellular acidic compartments: beyond the concept of lysosomotropic drugs. Toxicology and applied pharmacology. 2012;259:1-12. 15. Nadanaciva S, Lu S, Gebhard DF, Jessen BA, Pennie WD, Will Y. A high content screening assay for identifying lysosomotropic compounds. Toxicology in vitro : an international journal published in association with BIBRA. 2011;25:715- 23. 140

16. Daniel WA. Mechanisms of cellular distribution of psychotropic drugs. Significance for drug action and interactions. Progress in neuropsychopharmacology & biological psychiatry. 2003;27:65-73. 17. Daniel WA, Wojcikowski J. Contribution of lysosomal trapping to the total tissue uptake of psychotropic drugs. Pharmacology & toxicology. 1997;80:62-8. 18. Daniel WA, Wojcikowski J. Lysosomal trapping as an important mechanism involved in the cellular distribution of perazine and in pharmacokinetic interaction with antidepressants. European neuropsychopharmacology : the journal of the European College of Neuropsychopharmacology. 1999;9:483-91. 19. Miller DK, Griffiths E, Lenard J, Firestone RA. Cell killing by lysosomotropic detergents. The Journal of cell biology. 1983;97:1841-51. 20. Seglen PO, Grinde B, Solheim AE. Inhibition of the lysosomal pathway of protein degradation in isolated rat hepatocytes by ammonia, methylamine, chloroquine and leupeptin. European journal of biochemistry / FEBS. 1979;95:215-25. 21. Seglen PO, Gordon PB. Effects of lysosomotropic monoamines, diamines, amino alcohols, and other amino compounds on protein degradation and protein synthesis in isolated rat hepatocytes. Molecular pharmacology. 1980;18:468-75. 22. Kubo M, Hostetler KY. Mechanism of cationic amphiphilic drug inhibition of purified lysosomal phospholipase A1. Biochemistry. 1985;24:6515-20. 23. Abe A, Hiraoka M, Shayman JA. A role for lysosomal phospholipase A2 in drug induced phospholipidosis. Drug metabolism letters. 2007;1:49-53. 24. Liscum L, Faust JR. The intracellular transport of low density lipoprotein- derived cholesterol is inhibited in Chinese hamster ovary cells cultured with 3- beta-[2-(diethylamino)ethoxy]androst-5-en-17-one. The Journal of biological chemistry. 1989;264:11796-806. 25. Mellon SH, Gong W, Schonemann MD. Endogenous and synthetic neurosteroids in treatment of Niemann-Pick Type C disease. Brain research reviews. 2008;57:410-20. 26. Lange Y, Ye J, Steck TL. Circulation of cholesterol between lysosomes and the plasma membrane. The Journal of biological chemistry. 1998;273:18915- 22. 27. Lloyd-Evans E, Morgan AJ, He X, Smith DA, Elliot-Smith E, Sillence DJ, et al. Niemann-Pick disease type C1 is a sphingosine storage disease that causes deregulation of lysosomal calcium. Nature medicine. 2008;14:1247-55. 28. Rodriguez-Lafrasse C, Rousson R, Pentchev PG, Louisot P, Vanier MT. Free sphingoid bases in tissues from patients with type C Niemann-Pick disease and other lysosomal storage disorders. Biochimica et biophysica acta. 1994;1226:138-44. 29. Kagedal K, Zhao M, Svensson I, Brunk UT. Sphingosine-induced apoptosis is dependent on lysosomal proteases. The Biochemical journal. 2001;359:335-43. 30. Lloyd-Evans E, Platt FM. Lipids on trial: the search for the offending metabolite in Niemann-Pick type C disease. Traffic. 2010;11:419-28. 141

31. Blom T, Li Z, Bittman R, Somerharju P, Ikonen E. Tracking sphingosine metabolism and transport in sphingolipidoses: NPC1 deficiency as a test case. Traffic. 2012;13:1234-43. 32. Subbaiah PV, Sowa JM, Singh DK. Sphingolipids and cellular cholesterol homeostasis. Effect of ceramide on cholesterol trafficking and HMG CoA reductase activity. Archives of biochemistry and biophysics. 2008;474:32-8. 33. Underwood KW, Jacobs NL, Howley A, Liscum L. Evidence for a cholesterol transport pathway from lysosomes to endoplasmic reticulum that is independent of the plasma membrane. The Journal of biological chemistry. 1998;273:4266-74. 34. Ravikumar B, Sarkar S, Davies JE, Futter M, Garcia-Arencibia M, Green- Thompson ZW, et al. Regulation of mammalian autophagy in physiology and pathophysiology. Physiological reviews. 2010;90:1383-435. 35. Pietrocola F, Izzo V, Niso-Santano M, Vacchelli E, Galluzzi L, Maiuri MC, et al. Regulation of autophagy by stress-responsive transcription factors. Seminars in cancer biology. 2013;23:310-22. 36. Cheng Y, Ren X, Hait WN, Yang JM. Therapeutic targeting of autophagy in disease: biology and pharmacology. Pharmacological reviews. 2013;65:1162- 97. 37. Weidberg H, Shvets E, Elazar Z. Biogenesis and cargo selectivity of autophagosomes. Annual review of biochemistry. 2011;80:125-56. 38. Sahu R, Kaushik S, Clement CC, Cannizzo ES, Scharf B, Follenzi A, et al. Microautophagy of cytosolic proteins by late endosomes. Developmental cell. 2011;20:131-9. 39. Li WW, Li J, Bao JK. Microautophagy: lesser-known self-eating. Cellular and molecular life sciences : CMLS. 2012;69:1125-36. 40. Kaushik S, Cuervo AM. Chaperone-mediated autophagy: a unique way to enter the lysosome world. Trends in cell biology. 2012;22:407-17. 41. Eskelinen EL. New insights into the mechanisms of macroautophagy in mammalian cells. International review of cell and molecular biology. 2008;266:207-47. 42. Ouimet M, Franklin V, Mak E, Liao X, Tabas I, Marcel YL. Autophagy regulates cholesterol efflux from macrophage foam cells via lysosomal acid lipase. Cell metabolism. 2011;13:655-67. 43. Elrick MJ, Yu T, Chung C, Lieberman AP. Impaired proteolysis underlies autophagic dysfunction in Niemann-Pick type C disease. Human molecular genetics. 2012;21:4876-87. 44. Kuzu OF, Gowda R, Sharma A, Robertson GP. Leelamine mediates cancer cell death through inhibition of intracellular cholesterol transport. Molecular cancer therapeutics. 2014;13:1690-703. 45. Cenedella RJ. Cholesterol synthesis inhibitor U18666A and the role of sterol metabolism and trafficking in numerous pathophysiological processes. Lipids. 2009;44:477-87. 46. Cheng J, Ohsaki Y, Tauchi-Sato K, Fujita A, Fujimoto T. Cholesterol depletion induces autophagy. Biochemical and biophysical research communications. 2006;351:246-52. 142

47. Huang X, Suyama K, Buchanan J, Zhu AJ, Scott MP. A Drosophila model of the Niemann-Pick type C lysosome storage disease: dnpc1a is required for molting and sterol homeostasis. Development. 2005;132:5115-24. 48. Lieberman AP, Puertollano R, Raben N, Slaugenhaupt S, Walkley SU, Ballabio A. Autophagy in lysosomal storage disorders. Autophagy. 2012;8:719- 30. 49. Jeon SH, Kim SH, Kim Y, Kim YS, Lim Y, Lee YH, et al. The tricyclic antidepressant imipramine induces autophagic cell death in U-87MG glioma cells. Biochemical and biophysical research communications. 2011;413:311-7. 50. Hanyaloglu AC, von Zastrow M. Regulation of GPCRs by endocytic membrane trafficking and its potential implications. Annual review of pharmacology and toxicology. 2008;48:537-68. 51. Pike LJ. The challenge of lipid rafts. Journal of lipid research. 2009;50 Suppl:S323-8. 52. Kolter T, Sandhoff K. Principles of lysosomal membrane digestion: stimulation of sphingolipid degradation by sphingolipid activator proteins and anionic lysosomal lipids. Annual review of cell and developmental biology. 2005;21:81-103. 53. Linke T, Wilkening G, Lansmann S, Moczall H, Bartelsen O, Weisgerber J, et al. Stimulation of acid sphingomyelinase activity by lysosomal lipids and sphingolipid activator proteins. Biological chemistry. 2001;382:283-90. 54. Kornhuber J, Tripal P, Reichel M, Muhle C, Rhein C, Muehlbacher M, et al. Functional Inhibitors of Acid Sphingomyelinase (FIASMAs): a novel pharmacological group of drugs with broad clinical applications. Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology. 2010;26:9-20. 55. Abdul-Hammed M, Breiden B, Adebayo MA, Babalola JO, Schwarzmann G, Sandhoff K. Role of endosomal membrane lipids and NPC2 in cholesterol transfer and membrane fusion. Journal of lipid research. 2010;51:1747-60. 56. Schulze H, Sandhoff K. Sphingolipids and lysosomal pathologies. Biochimica et biophysica acta. 2014;1841:799-810. 57. Saftig P, Sandhoff K. Cancer: Killing from the inside. Nature. 2013;502:312-3. 58. Reagan JW, Jr., Hubbert ML, Shelness GS. Posttranslational regulation of acid sphingomyelinase in niemann-pick type C1 fibroblasts and free cholesterol- enriched chinese hamster ovary cells. The Journal of biological chemistry. 2000;275:38104-10. 59. Kornhuber J, Tripal P, Gulbins E, Muehlbacher M. Functional inhibitors of acid sphingomyelinase (FIASMAs). Handbook of experimental pharmacology. 2013:169-86. 60. Yoshida Y, Arimoto K, Sato M, Sakuragawa N, Arima M, Satoyoshi E. Reduction of acid sphingomyelinase activity in human fibroblasts induced by AY- 9944 and other cationic amphiphilic drugs. Journal of biochemistry. 1985;98:1669-79. 143

61. Schulze H, Kolter T, Sandhoff K. Principles of lysosomal membrane degradation: Cellular topology and biochemistry of lysosomal lipid degradation. Biochimica et biophysica acta. 2009;1793:674-83. 62. Elojeimy S, Holman DH, Liu X, El-Zawahry A, Villani M, Cheng JC, et al. New insights on the use of desipramine as an inhibitor for acid ceramidase. FEBS letters. 2006;580:4751-6. 63. Canals D, Perry DM, Jenkins RW, Hannun YA. Drug targeting of sphingolipid metabolism: sphingomyelinases and ceramidases. British journal of pharmacology. 2011;163:694-712. 64. Mao X, Hou T, Cao B, Wang W, Li Z, Chen S, et al. The tricyclic antidepressant amitriptyline inhibits D-cyclin transactivation and induces myeloma cell apoptosis by inhibiting histone deacetylases: in vitro and in silico evidence. Molecular pharmacology. 2011;79:672-80. 65. Zhang Z, Du X, Zhao C, Cao B, Zhao Y, Mao X. The antidepressant amitriptyline shows potent therapeutic activity against multiple myeloma. Anti- cancer drugs. 2013;24:792-8. 66. Wiklund ED, Catts VS, Catts SV, Ng TF, Whitaker NJ, Brown AJ, et al. Cytotoxic effects of antipsychotic drugs implicate cholesterol homeostasis as a novel chemotherapeutic target. International journal of cancer Journal international du cancer. 2010;126:28-40. 67. Levkovitz Y, Gil-Ad I, Zeldich E, Dayag M, Weizman A. Differential induction of apoptosis by antidepressants in glioma and neuroblastoma cell lines: evidence for p-c-Jun, cytochrome c, and caspase-3 involvement. Journal of molecular neuroscience : MN. 2005;27:29-42. 68. Daley E, Wilkie D, Loesch A, Hargreaves IP, Kendall DA, Pilkington GJ, et al. Chlorimipramine: a novel anticancer agent with a mitochondrial target. Biochemical and biophysical research communications. 2005;328:623-32. 69. Arimochi H, Morita K. Characterization of cytotoxic actions of tricyclic antidepressants on human HT29 colon carcinoma cells. European journal of pharmacology. 2006;541:17-23. 70. Hsu SS, Huang CJ, Chen JS, Cheng HH, Chang HT, Jiann BP, et al. Effect of nortriptyline on intracellular Ca2+ handling and proliferation in human osteosarcoma cells. Basic & clinical pharmacology & toxicology. 2004;95:124-30. 71. Wu Q, Yang Z, Nie Y, Shi Y, Fan D. Multi-drug resistance in cancer chemotherapeutics: mechanisms and lab approaches. Cancer letters. 2014;347:159-66. 72. Shiraishi N, Akiyama S, Kobayashi M, Kuwano M. Lysosomotropic agents reverse multiple drug resistance in human cancer cells. Cancer letters. 1986;30:251-9. 73. Pommerenke EW, Volm M. Reversal of doxorubicin-resistance in solid tumors by clomipramine. In vivo. 1995;9:99-101. 74. Ioannou YA. Multidrug permeases and subcellular cholesterol transport. Nature reviews Molecular cell biology. 2001;2:657-68. 75. Varga A, Nugel H, Baehr R, Marx U, Hever A, Nacsa J, et al. Reversal of multidrug resistance by amitriptyline in vitro. Anticancer research. 1996;16:209- 11. 144

76. Morita SY, Tsuda T, Horikami M, Teraoka R, Kitagawa S, Terada T. Bile salt-stimulated phospholipid efflux mediated by ABCB4 localized in nonraft membranes. Journal of lipid research. 2013;54:1221-30. 77. Le May C, Berger JM, Lespine A, Pillot B, Prieur X, Letessier E, et al. Transintestinal cholesterol excretion is an active metabolic process modulated by PCSK9 and statin involving ABCB1. Arteriosclerosis, thrombosis, and vascular biology. 2013;33:1484-93. 78. Pal A, Mehn D, Molnar E, Gedey S, Meszaros P, Nagy T, et al. Cholesterol potentiates ABCG2 activity in a heterologous expression system: improved in vitro model to study function of human ABCG2. The Journal of pharmacology and experimental therapeutics. 2007;321:1085-94. 79. Jeannesson E, Siest G, Bastien B, Albertini L, Aslanidis C, Schmitz G, et al. Association of ABCB1 gene polymorphisms with plasma lipid and apolipoprotein concentrations in the STANISLAS cohort. Clinica chimica acta; international journal of clinical chemistry. 2009;403:198-202. 80. van Nieuwerk CM, Groen AK, Ottenhoff R, van Wijland M, van den Bergh Weerman MA, Tytgat GN, et al. The role of bile salt composition in liver pathology of mdr2 (-/-) mice: differences between males and females. Journal of hepatology. 1997;26:138-45. 81. Kimura Y, Morita SY, Matsuo M, Ueda K. Mechanism of multidrug recognition by MDR1/ABCB1. Cancer science. 2007;98:1303-10. 82. de Vree JM, Jacquemin E, Sturm E, Cresteil D, Bosma PJ, Aten J, et al. Mutations in the MDR3 gene cause progressive familial intrahepatic cholestasis. Proceedings of the National Academy of Sciences of the United States of America. 1998;95:282-7. 83. Fraile PQ, Hernandez EM, Martinez de Aragon A, Macias-Vidal J, Coll MJ, Espert AN, et al. [Niemann-Pick type C disease: From neonatal cholestasis to neurological degeneration. Different phenotypes]. Anales de pediatria. 2010;73:257-63. 84. Choi HY, Karten B, Chan T, Vance JE, Greer WL, Heidenreich RA, et al. Impaired ABCA1-dependent lipid efflux and hypoalphalipoproteinemia in human Niemann-Pick type C disease. The Journal of biological chemistry. 2003;278:32569-77. 85. Walker AJ, Card T, Bates TE, Muir K. Tricyclic antidepressants and the incidence of certain cancers: a study using the GPRD. British journal of cancer. 2011;104:193-7. 86. Xu W, Tamim H, Shapiro S, Stang MR, Collet JP. Use of antidepressants and risk of colorectal cancer: a nested case-control study. The Lancet Oncology. 2006;7:301-8. 87. Coogan PF, Strom BL, Rosenberg L. Antidepressant use and colorectal cancer risk. Pharmacoepidemiology and drug safety. 2009;18:1111-4. 88. Chubak J, Boudreau DM, Rulyak SJ, Mandelson MT. Colorectal cancer risk in relation to antidepressant medication use. International journal of cancer Journal international du cancer. 2011;128:227-32. 145

89. Cronin-Fenton DP, Riis AH, Lash TL, Dalton SO, Friis S, Robertson D, et al. Antidepressant use and colorectal cancer risk: a Danish population-based case-control study. British journal of cancer. 2011;104:188-92. 90. Hilakivi-Clarke L, Wright A, Lippman ME. DMBA-induced mammary tumor growth in rats exhibiting increased or decreased ability to cope with stress due to early postnatal handling or antidepressant treatment. Physiology & behavior. 1993;54:229-36. 91. Wernli KJ, Hampton JM, Trentham-Dietz A, Newcomb PA. Antidepressant medication use and breast cancer risk. Pharmacoepidemiology and drug safety. 2009;18:284-90. 92. Cotterchio M, Kreiger N, Darlington G, Steingart A. Antidepressant medication use and breast cancer risk. American journal of epidemiology. 2000;151:951-7. 93. Halbreich U, Shen J, Panaro V. Are chronic psychiatric patients at increased risk for developing breast cancer? The American journal of psychiatry. 1996;153:559-60. 94. Sharpe CR, Collet JP, Belzile E, Hanley JA, Boivin JF. The effects of tricyclic antidepressants on breast cancer risk. British journal of cancer. 2002;86:92-7. 95. Kelly JP, Rosenberg L, Palmer JR, Rao RS, Strom BL, Stolley PD, et al. Risk of breast cancer according to use of antidepressants, phenothiazines, and antihistamines. American journal of epidemiology. 1999;150:861-8. 96. Lawlor DA. Re: "antidepressant medication use and breast cancer risk". American journal of epidemiology. 2000;152:1104; author reply 5. 97. Fulton-Kehoe D, Rossing MA, Rutter C, Mandelson MT, Weiss NS. Use of antidepressant medications in relation to the incidence of breast cancer. British journal of cancer. 2006;94:1071-8. 98. Tamim H, Boivin JF, Hanley J, Stang M, Collet JP. Risk of breast cancer in association with exposure to two different groups of tricyclic antidepressants. Pharmacoepidemiology and drug safety. 2006;15:689-97. 99. Chien C, Li CI, Heckbert SR, Malone KE, Boudreau DM, Daling JR. Antidepressant use and breast cancer risk. Breast cancer research and treatment. 2006;95:131-40. 100. Coogan PF, Palmer JR, Strom BL, Rosenberg L. Use of selective serotonin reuptake inhibitors and the risk of breast cancer. American journal of epidemiology. 2005;162:835-8. 101. Gonzalez-Perez A, Garcia Rodriguez LA. Breast cancer risk among users of antidepressant medications. Epidemiology. 2005;16:101-5. 102. Steingart A, Cotterchio M, Kreiger N, Sloan M. Antidepressant medication use and breast cancer risk: a case-control study. International journal of epidemiology. 2003;32:961-6. 103. Moorman PG, Grubber JM, Millikan RC, Newman B. Antidepressant medications and their association with invasive breast cancer and carcinoma in situ of the breast. Epidemiology. 2003;14:307-14. 146

104. Nadalin V, Cotterchio M, Kreiger N. Antihistamine use and breast cancer risk. International journal of cancer Journal international du cancer. 2003;106:566-8. 105. Lawlor DA, Juni P, Ebrahim S, Egger M. Systematic review of the epidemiologic and trial evidence of an association between antidepressant medication and breast cancer. Journal of clinical epidemiology. 2003;56:155-63. 106. Weiss SR, McFarland BH, Burkhart GA, Ho PT. Cancer recurrences and secondary primary cancers after use of antihistamines or antidepressants. Clinical pharmacology and therapeutics. 1998;63:594-9. 107. Azoulay L, Yin H, Renoux C, Suissa S. The use of atypical antipsychotics and the risk of breast cancer. Breast cancer research and treatment. 2011;129:541-8. 108. Linos E, Raine T, Alonso A, Michaud D. Atopy and risk of brain tumors: a meta-analysis. Journal of the National Cancer Institute. 2007;99:1544-50. 109. McCarthy BJ, Rankin K, Il'yasova D, Erdal S, Vick N, Ali-Osman F, et al. Assessment of type of allergy and antihistamine use in the development of glioma. Cancer epidemiology, biomarkers & prevention : a publication of the American Association for Cancer Research, cosponsored by the American Society of Preventive Oncology. 2011;20:370-8. 110. Scheurer ME, El-Zein R, Thompson PA, Aldape KD, Levin VA, Gilbert MR, et al. Long-term anti-inflammatory and antihistamine medication use and adult glioma risk. Cancer epidemiology, biomarkers & prevention : a publication of the American Association for Cancer Research, cosponsored by the American Society of Preventive Oncology. 2008;17:1277-81. 111. Amirian ES, Marquez-Do D, Bondy ML, Scheurer ME. Antihistamine use and immunoglobulin E levels in glioma risk and prognosis. Cancer epidemiology. 2013;37:908-12. 112. Mortensen PB. The incidence of cancer in schizophrenic patients. Journal of epidemiology and community health. 1989;43:43-7. 113. Tamim HM, Mahmud S, Hanley JA, Boivin JF, Stang MR, Collet JP. Antidepressants and risk of prostate cancer: a nested case-control study. Prostate cancer and prostatic diseases. 2008;11:53-60. 114. Mortensen PB. Neuroleptic medication and reduced risk of prostate cancer in schizophrenic patients. Acta psychiatrica Scandinavica. 1992;85:390-3. 115. Hippisley-Cox J, Vinogradova Y, Coupland C, Parker C. Risk of malignancy in patients with schizophrenia or bipolar disorder: nested case- control study. Archives of general psychiatry. 2007;64:1368-76. 116. Guo JJ. Schizophrenia associated with increased risk of colon cancer but reduced risk of respiratory cancer. Evidence-based mental health. 2008;11:93. 117. Maxfield FR, van Meer G. Cholesterol, the central lipid of mammalian cells. Current opinion in cell biology. 2010;22:422-9. 118. Kennedy BE, Charman M, Karten B. Niemann-Pick Type C2 protein contributes to the transport of endosomal cholesterol to mitochondria without interacting with NPC1. Journal of lipid research. 2012;53:2632-42. 119. Boya P, Kroemer G. Lysosomal membrane permeabilization in cell death. Oncogene. 2008;27:6434-51. 147

120. Yuan XM, Li W, Brunk UT, Dalen H, Chang YH, Sevanian A. Lysosomal destabilization during macrophage damage induced by cholesterol oxidation products. Free radical biology & medicine. 2000;28:208-18. 121. Reverter M, Rentero C, de Muga SV, Alvarez-Guaita A, Mulay V, Cairns R, et al. Cholesterol transport from late endosomes to the Golgi regulates t- SNARE trafficking, assembly, and function. Molecular biology of the cell. 2011;22:4108-23. 122. Jaattela M, Tschopp J. Caspase-independent cell death in T lymphocytes. Nature immunology. 2003;4:416-23. 123. Tabas I. Consequences of cellular cholesterol accumulation: basic concepts and physiological implications. The Journal of clinical investigation. 2002;110:905-11. 124. Nakamura H, Yasufuku K, Makiyama T, Matsumoto I, Fujino H, Murayama T. Arachidonic acid metabolism via cytosolic phospholipase A2 alpha induces cytotoxicity in niemann-pick disease type C cells. Journal of cellular physiology. 2012;227:2847-55. 125. Zhao M, Brunk UT, Eaton JW. Delayed oxidant-induced cell death involves activation of phospholipase A2. FEBS letters. 2001;509:399-404. 126. Zhang G, Yi YP, Zhang GJ. Effects of arachidonic acid on the lysosomal ion permeability and osmotic stability. Journal of bioenergetics and biomembranes. 2006;38:75-82. 127. Wissing D, Mouritzen H, Egeblad M, Poirier GG, Jaattela M. Involvement of caspase-dependent activation of cytosolic phospholipase A2 in tumor necrosis factor-induced apoptosis. Proceedings of the National Academy of Sciences of the United States of America. 1997;94:5073-7. 128. Roussi S, Gosse F, Aoude-Werner D, Zhang X, Marchioni E, Geoffroy P, et al. Mitochondrial perturbation, oxidative stress and lysosomal destabilization are involved in 7beta-hydroxysitosterol and 7beta-hydroxycholesterol triggered apoptosis in human colon cancer cells. Apoptosis : an international journal on programmed cell death. 2007;12:87-96. 129. Wang C, Youle RJ. The role of mitochondria in apoptosis*. Annual review of genetics. 2009;43:95-118. 130. Lucken-Ardjomande S, Montessuit S, Martinou JC. Bax activation and stress-induced apoptosis delayed by the accumulation of cholesterol in mitochondrial membranes. Cell death and differentiation. 2008;15:484-93. 131. Baggetto LG, Clottes E, Vial C. Low mitochondrial proton leak due to high membrane cholesterol content and cytosolic creatine kinase as two features of the deviant bioenergetics of Ehrlich and AS30-D tumor cells. Cancer research. 1992;52:4935-41. 132. Yu W, Gong JS, Ko M, Garver WS, Yanagisawa K, Michikawa M. Altered cholesterol metabolism in Niemann-Pick type C1 mouse brains affects mitochondrial function. The Journal of biological chemistry. 2005;280:11731-9. 133. Higgins SC, Pilkington GJ. The in vitro effects of tricyclic drugs and dexamethasone on cellular respiration of malignant glioma. Anticancer research. 2010;30:391-7. 148

134. Youle RJ, Strasser A. The BCL-2 protein family: opposing activities that mediate cell death. Nature reviews Molecular cell biology. 2008;9:47-59. 135. Kagedal K, Johansson AC, Johansson U, Heimlich G, Roberg K, Wang NS, et al. Lysosomal membrane permeabilization during apoptosis--involvement of Bax? International journal of experimental pathology. 2005;86:309-21. 136. Feldstein AE, Werneburg NW, Li Z, Bronk SF, Gores GJ. Bax inhibition protects against free fatty acid-induced lysosomal permeabilization. American journal of physiology Gastrointestinal and liver physiology. 2006;290:G1339-46. 137. Shatz M, Liscovitch M. Caveolin-1: a tumor-promoting role in human cancer. International journal of radiation biology. 2008;84:177-89. 138. Subtil A, Gaidarov I, Kobylarz K, Lampson MA, Keen JH, McGraw TE. Acute cholesterol depletion inhibits clathrin-coated pit budding. Proceedings of the National Academy of Sciences of the United States of America. 1999;96:6775-80. 139. Kuech E-M, Shammas H, Maalouf KE, von Koeckritz-Blickwede M, Das AM, Naim HY. Lipid raft abnormalities and subsequent protein trafficking effects in Niemann-Pick type C1 (LB158). The FASEB Journal. 2014;28:LB158. 140. Mukherjee S, Maxfield FR. Cholesterol: stuck in traffic. Nature cell biology. 1999;1:E37-8. 141. Goh LK, Sorkin A. Endocytosis of receptor tyrosine kinases. Cold Spring Harbor perspectives in biology. 2013;5:a017459. 142. Puthenveedu MA, Yudowski GA, von Zastrow M. Endocytosis of neurotransmitter receptors: location matters. Cell. 2007;130:988-9. 143. Fletcher R, Gribben C, Ma X, Burchfield JG, Thomas KC, Krycer JR, et al. The role of the niemann-pick disease, type c1 protein in adipocyte insulin action. PloS one. 2014;9:e95598. 144. Ong QR, Lim ML, Chua CC, Cheung NS, Wong BS. Impaired insulin signaling in an animal model of Niemann-Pick Type C disease. Biochemical and biophysical research communications. 2012;424:482-7. 145. Romanelli RJ, LeBeau AP, Fulmer CG, Lazzarino DA, Hochberg A, Wood TL. Insulin-like growth factor type-I receptor internalization and recycling mediate the sustained phosphorylation of Akt. The Journal of biological chemistry. 2007;282:22513-24. 146. Ceresa BP, Kao AW, Santeler SR, Pessin JE. Inhibition of clathrin- mediated endocytosis selectively attenuates specific insulin receptor signal transduction pathways. Molecular and cellular biology. 1998;18:3862-70. 147. Chow JC, Condorelli G, Smith RJ. Insulin-like growth factor-I receptor internalization regulates signaling via the Shc/mitogen-activated protein kinase pathway, but not the insulin receptor substrate-1 pathway. The Journal of biological chemistry. 1998;273:4672-80. 148. Shah M, Patel K, Mukhopadhyay S, Xu F, Guo G, Sehgal PB. Membrane- associated STAT3 and PY-STAT3 in the cytoplasm. The Journal of biological chemistry. 2006;281:7302-8. 149. Yamashiro DJ, Maxfield FR. Acidification of endocytic compartments and the intracellular pathways of ligands and receptors. Journal of cellular biochemistry. 1984;26:231-46. 149

150. Mercer J, Schelhaas M, Helenius A. Virus entry by endocytosis. Annual review of biochemistry. 2010;79:803-33. 151. Carette JE, Raaben M, Wong AC, Herbert AS, Obernosterer G, Mulherkar N, et al. Ebola virus entry requires the cholesterol transporter Niemann-Pick C1. Nature. 2011;477:340-3. 152. Cote M, Misasi J, Ren T, Bruchez A, Lee K, Filone CM, et al. Small molecule inhibitors reveal Niemann-Pick C1 is essential for Ebola virus infection. Nature. 2011;477:344-8. 153. Wei H, Kim SJ, Zhang Z, Tsai PC, Wisniewski KE, Mukherjee AB. ER and oxidative stresses are common mediators of apoptosis in both neurodegenerative and non-neurodegenerative lysosomal storage disorders and are alleviated by chemical chaperones. Human molecular genetics. 2008;17:469- 77. 154. Ridsdale A, Denis M, Gougeon PY, Ngsee JK, Presley JF, Zha X. Cholesterol is required for efficient endoplasmic reticulum-to-Golgi transport of secretory membrane proteins. Molecular biology of the cell. 2006;17:1593-605. 155. Vitner EB, Platt FM, Futerman AH. Common and uncommon pathogenic cascades in lysosomal storage diseases. The Journal of biological chemistry. 2010;285:20423-7. 156. Lee AH, Iwakoshi NN, Glimcher LH. XBP-1 regulates a subset of endoplasmic reticulum resident chaperone genes in the unfolded protein response. Molecular and cellular biology. 2003;23:7448-59. 157. Hori O, Ichinoda F, Yamaguchi A, Tamatani T, Taniguchi M, Koyama Y, et al. Role of Herp in the endoplasmic reticulum stress response. Genes to cells : devoted to molecular & cellular mechanisms. 2004;9:457-69. 158. Meir O, Dvash E, Werman A, Rubinstein M. C/EBP-beta regulates endoplasmic reticulum stress-triggered cell death in mouse and human models. PloS one. 2010;5:e9516. 159. Varadarajan S, Bampton ET, Smalley JL, Tanaka K, Caves RE, Butterworth M, et al. A novel cellular stress response characterised by a rapid reorganisation of membranes of the endoplasmic reticulum. Cell death and differentiation. 2012;19:1896-907. 160. Larroque-Cardoso P, Swiader A, Ingueneau C, Negre-Salvayre A, Elbaz M, Reyland ME, et al. Role of protein kinase C delta in ER stress and apoptosis induced by oxidized LDL in human vascular smooth muscle cells. Cell death & disease. 2013;4:e520. 161. Yadav V, Yanez NC, Fenton SE, Denning MF. Loss of protein kinase C delta gene expression in human squamous cell carcinomas: a laser capture microdissection study. The American journal of pathology. 2010;176:1091-6. 162. Lin C-C, Ou H-C, Pi I, You Y-C. Baicalein attenuates oxLDL-induced oxidative functional damages in endothelial cells. The FASEB Journal. 2010. 163. Kyo R, Nakahata N, Sakakibara I, Kubo M, Ohizumi Y. Baicalin and baicalein, constituents of an important medicinal plant, inhibit intracellular Ca2+ elevation by reducing phospholipase C activity in C6 rat glioma cells. The Journal of pharmacy and pharmacology. 1998;50:1179-82. 150

164. Choi JH, Choi AY, Yoon H, Choe W, Yoon KS, Ha J, et al. Baicalein protects HT22 murine hippocampal neuronal cells against endoplasmic reticulum stress-induced apoptosis through inhibition of reactive oxygen species production and CHOP induction. Experimental & molecular medicine. 2010;42:811-22. 165. Chang WT, Li J, Haung HH, Liu H, Han M, Ramachandran S, et al. Baicalein protects against doxorubicin-induced cardiotoxicity by attenuation of mitochondrial oxidant injury and JNK activation. Journal of cellular biochemistry. 2011;112:2873-81. 166. Qi X, Mochly-Rosen D. The PKCdelta -Abl complex communicates ER stress to the mitochondria - an essential step in subsequent apoptosis. Journal of cell science. 2008;121:804-13. 167. Storz P, Doppler H, Toker A. Protein kinase Cdelta selectively regulates protein kinase D-dependent activation of NF-kappaB in oxidative stress signaling. Molecular and cellular biology. 2004;24:2614-26. 168. Hurd C, Waldron RT, Rozengurt E. Protein kinase D complexes with C- Jun N-terminal kinase via activation loop phosphorylation and phosphorylates the C-Jun N-terminus. Oncogene. 2002;21:2154-60. 169. Gschwendt M, Dieterich S, Rennecke J, Kittstein W, Mueller HJ, Johannes FJ. Inhibition of protein kinase C mu by various inhibitors. Differentiation from protein kinase c isoenzymes. FEBS letters. 1996;392:77-80. 170. Fehrenbacher N, Bastholm L, Kirkegaard-Sorensen T, Rafn B, Bottzauw T, Nielsen C, et al. Sensitization to the lysosomal cell death pathway by oncogene-induced down-regulation of lysosome-associated membrane proteins 1 and 2. Cancer research. 2008;68:6623-33. 171. Gowda R, Madhunapantula SV, Kuzu OF, Sharma A, Robertson GP. Targeting multiple key signaling pathways in melanoma using leelamine. Molecular cancer therapeutics. 2014;13:1679-89. 172. Petersen NH, Olsen OD, Groth-Pedersen L, Ellegaard AM, Bilgin M, Redmer S, et al. Transformation-associated changes in sphingolipid metabolism sensitize cells to lysosomal cell death induced by inhibitors of acid sphingomyelinase. Cancer cell. 2013;24:379-93. 173. Schneede A, Schmidt CK, Holtta-Vuori M, Heeren J, Willenborg M, Blanz J, et al. Role for LAMP-2 in endosomal cholesterol transport. Journal of cellular and molecular medicine. 2011;15:280-95. 174. Weinstein IB, Joe A. Oncogene addiction. Cancer research. 2008;68:3077-80; discussion 80. 175. Yan R, Hallam A, Stockley PG, Boyes J. Oncogene dependency and the potential of targeted RNAi-based anti-cancer therapy. The Biochemical journal. 2014;461:1-13. 176. Arkenau HT, Kefford R, Long GV. Targeting BRAF for patients with melanoma. British journal of cancer. 2011;104:392-8. 177. Tas F. Metastatic behavior in melanoma: timing, pattern, survival, and influencing factors. Journal of oncology. 2012;2012:647684. 178. Wang AX, Qi XY. Targeting RAS/RAF/MEK/ERK signaling in metastatic melanoma. IUBMB life. 2013;65:748-58. 151

179. Finn L, Markovic SN, Joseph RW. Therapy for metastatic melanoma: the past, present, and future. BMC medicine. 2012;10:23. 180. Newman DJ, Cragg GM. Natural products as sources of new drugs over the last 25 years. Journal of natural products. 2007;70:461-77. 181. Aicher TD, Damon RE, Koletar J, Vinluan CC, Brand LJ, Gao J, et al. Triterpene and diterpene inhibitors of pyruvate dehydrogenase kinase (PDK). Bioorganic & medicinal chemistry letters. 1999;9:2223-8. 182. Lovinger DM. Presynaptic modulation by endocannabinoids. Handbook of experimental pharmacology. 2008:435-77. 183. N'Diaye EN, Kajihara KK, Hsieh I, Morisaki H, Debnath J, Brown EJ. PLIC proteins or ubiquilins regulate autophagy-dependent cell survival during nutrient starvation. EMBO reports. 2009;10:173-9. 184. Gowda R, Madhunapantula SV, Desai D, Amin S, Robertson GP. Selenium-containing histone deacetylase inhibitors for melanoma management. Cancer biology & therapy. 2012;13:756-65. 185. Cheadle C, Vawter MP, Freed WJ, Becker KG. Analysis of microarray data using Z score transformation. The Journal of molecular diagnostics : JMD. 2003;5:73-81. 186. Bligh EG, Dyer WJ. A rapid method of total lipid extraction and purification. Canadian journal of biochemistry and physiology. 1959;37:911-7. 187. Kupke IR, Zeugner S. Quantitative high-performance thin-layer chromatography of lipids in plasma and liver homogenates after direct application of 0.5-microliter samples to the silica-gel layer. Journal of chromatography. 1978;146:261-71. 188. Klionsky DJ, Abeliovich H, Agostinis P, Agrawal DK, Aliev G, Askew DS, et al. Guidelines for the use and interpretation of assays for monitoring autophagy in higher eukaryotes. Autophagy. 2008;4:151-75. 189. Settembre C, Fraldi A, Jahreiss L, Spampanato C, Venturi C, Medina D, et al. A block of autophagy in lysosomal storage disorders. Human molecular genetics. 2008;17:119-29. 190. Futerman AH, van Meer G. The cell biology of lysosomal storage disorders. Nature reviews Molecular cell biology. 2004;5:554-65. 191. Ishizaki J, Yokogawa K, Ichimura F, Ohkuma S. Uptake of imipramine in rat liver lysosomes in vitro and its inhibition by basic drugs. The Journal of pharmacology and experimental therapeutics. 2000;294:1088-98. 192. Geng Y, Kohli L, Klocke BJ, Roth KA. Chloroquine-induced autophagic vacuole accumulation and cell death in glioma cells is p53 independent. Neuro- oncology. 2010;12:473-81. 193. Lemieux B, Percival MD, Falgueyret JP. Quantitation of the lysosomotropic character of cationic amphiphilic drugs using the fluorescent basic amine Red DND-99. Analytical biochemistry. 2004;327:247-51. 194. Belmokhtar CA, Hillion J, Segal-Bendirdjian E. Staurosporine induces apoptosis through both caspase-dependent and caspase-independent mechanisms. Oncogene. 2001;20:3354-62. 152

195. Liu CY, Takemasa A, Liles WC, Goodman RB, Jonas M, Rosen H, et al. Broad-spectrum caspase inhibition paradoxically augments cell death in TNF- alpha -stimulated neutrophils. Blood. 2003;101:295-304. 196. Chen LB. Mitochondrial membrane potential in living cells. Annual review of cell biology. 1988;4:155-81. 197. Shimizu S, Narita M, Tsujimoto Y. Bcl-2 family proteins regulate the release of apoptogenic cytochrome c by the mitochondrial channel VDAC. Nature. 1999;399:483-7. 198. Cadoudal T, Distel E, Durant S, Fouque F, Blouin JM, Collinet M, et al. Pyruvate dehydrogenase kinase 4: regulation by thiazolidinediones and implication in glyceroneogenesis in adipose tissue. Diabetes. 2008;57:2272-9. 199. Blazquez C, Carracedo A, Barrado L, Real PJ, Fernandez-Luna JL, Velasco G, et al. Cannabinoid receptors as novel targets for the treatment of melanoma. FASEB journal : official publication of the Federation of American Societies for Experimental Biology. 2006;20:2633-5. 200. Kobayashi T, Beuchat MH, Lindsay M, Frias S, Palmiter RD, Sakuraba H, et al. Late endosomal membranes rich in lysobisphosphatidic acid regulate cholesterol transport. Nature cell biology. 1999;1:113-8. 201. Lange Y, Ye J, Rigney M, Steck T. Cholesterol movement in Niemann- Pick type C cells and in cells treated with amphiphiles. The Journal of biological chemistry. 2000;275:17468-75. 202. Schneider P, Korolenko TA, Busch U. A review of drug-induced lysosomal disorders of the liver in man and laboratory animals. Microscopy research and technique. 1997;36:253-75. 203. Matsuo M, Togawa M, Hirabaru K, Mochinaga S, Narita A, Adachi M, et al. Effects of cyclodextrin in two patients with Niemann-Pick Type C disease. Molecular genetics and metabolism. 2013;108:76-81. 204. Maxfield FR, McGraw TE. Endocytic recycling. Nature reviews Molecular cell biology. 2004;5:121-32. 205. Sobo K, Le Blanc I, Luyet PP, Fivaz M, Ferguson C, Parton RG, et al. Late endosomal cholesterol accumulation leads to impaired intra-endosomal trafficking. PloS one. 2007;2:e851. 206. Zhang M, Dwyer NK, Love DC, Cooney A, Comly M, Neufeld E, et al. Cessation of rapid late endosomal tubulovesicular trafficking in Niemann-Pick type C1 disease. Proceedings of the National Academy of Sciences of the United States of America. 2001;98:4466-71. 207. Pause A, Belsham GJ, Gingras AC, Donze O, Lin TA, Lawrence JC, Jr., et al. Insulin-dependent stimulation of protein synthesis by phosphorylation of a regulator of 5'-cap function. Nature. 1994;371:762-7. 208. Basque J, Martel M, Leduc R, Cantin AM. Lysosomotropic drugs inhibit maturation of transforming growth factor-beta. Canadian journal of physiology and pharmacology. 2008;86:606-12. 209. Incardona JP, Eaton S. Cholesterol in signal transduction. Current opinion in cell biology. 2000;12:193-203. 153

210. Wang Y, Thiele C, Huttner WB. Cholesterol is required for the formation of regulated and constitutive secretory vesicles from the trans-Golgi network. Traffic. 2000;1:952-62. 211. Bastiaanse EM, Hold KM, Van der Laarse A. The effect of membrane cholesterol content on ion transport processes in plasma membranes. Cardiovascular research. 1997;33:272-83. 212. Simons K, Ikonen E. How cells handle cholesterol. Science. 2000;290:1721-6. 213. Sztolsztener ME, Dobrzyn A, Pikula S, Tylki-Szymanska A, Bandorowicz- Pikula J. Impaired dynamics of the late endosome/lysosome compartment in human Niemann-Pick type C skin fibroblasts carrying mutation in NPC1 gene. Molecular bioSystems. 2012;8:1197-205. 214. Pacheco CD, Kunkel R, Lieberman AP. Autophagy in Niemann-Pick C disease is dependent upon Beclin-1 and responsive to lipid trafficking defects. Human molecular genetics. 2007;16:1495-503. 215. Sorkin A, von Zastrow M. Endocytosis and signalling: intertwining molecular networks. Nature reviews Molecular cell biology. 2009;10:609-22. 216. Kholodenko BN. Four-dimensional organization of protein kinase signaling cascades: the roles of diffusion, endocytosis and molecular motors. The Journal of experimental biology. 2003;206:2073-82. 217. Gschwind A, Fischer OM, Ullrich A. The discovery of receptor tyrosine kinases: targets for cancer therapy. Nature reviews Cancer. 2004;4:361-70. 218. Davies H, Bignell GR, Cox C, Stephens P, Edkins S, Clegg S, et al. Mutations of the BRAF gene in human cancer. Nature. 2002;417:949-54. 219. Stahl JM, Sharma A, Cheung M, Zimmerman M, Cheng JQ, Bosenberg MW, et al. Deregulated Akt3 activity promotes development of malignant melanoma. Cancer research. 2004;64:7002-10. 220. Sangai T, Akcakanat A, Chen H, Tarco E, Wu Y, Do KA, et al. Biomarkers of response to Akt inhibitor MK-2206 in breast cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 2012;18:5816-28. 221. Zhang W, Zong CS, Hermanto U, Lopez-Bergami P, Ronai Z, Wang LH. RACK1 recruits STAT3 specifically to insulin and insulin-like growth factor 1 receptors for activation, which is important for regulating anchorage-independent growth. Molecular and cellular biology. 2006;26:413-24. 222. Bromberg J, Darnell JE, Jr. The role of STATs in transcriptional control and their impact on cellular function. Oncogene. 2000;19:2468-73. 223. Frank DA. STAT signaling in the pathogenesis and treatment of cancer. Molecular medicine. 1999;5:432-56. 224. Niu G, Bowman T, Huang M, Shivers S, Reintgen D, Daud A, et al. Roles of activated Src and Stat3 signaling in melanoma tumor cell growth. Oncogene. 2002;21:7001-10. 225. Siegel R, Naishadham D, Jemal A. Cancer statistics, 2013. CA: a cancer journal for clinicians. 2013;63:11-30. 226. Rahib L, Smith BD, Aizenberg R, Rosenzweig AB, Fleshman JM, Matrisian LM. Projecting cancer incidence and deaths to 2030: the unexpected 154 burden of thyroid, liver, and pancreas cancers in the United States. Cancer research. 2014;74:2913-21. 227. Settleman J. Optimizing the treatment of BRAF mutant melanoma. Genome medicine. 2014;6:30. 228. Wiley HS, Burke PM. Regulation of receptor tyrosine kinase signaling by endocytic trafficking. Traffic. 2001;2:12-8. 229. Chen N, Karantza V. Autophagy as a therapeutic target in cancer. Cancer biology & therapy. 2011;11:157-68. 230. Vanier MT. Niemann-Pick disease type C. Orphanet journal of rare diseases. 2010;5:16. 231. Kornhuber J, Muehlbacher M, Trapp S, Pechmann S, Friedl A, Reichel M, et al. Identification of novel functional inhibitors of acid sphingomyelinase. PloS one. 2011;6:e23852. 232. Kornhuber J, Tripal P, Reichel M, Terfloth L, Bleich S, Wiltfang J, et al. Identification of new functional inhibitors of acid sphingomyelinase using a structure-property-activity relation model. Journal of medicinal chemistry. 2008;51:219-37. 233. Kaufmann AM, Krise JP. Niemann-Pick C1 functions in regulating lysosomal amine content. The Journal of biological chemistry. 2008;283:24584- 93. 234. Zoncu R, Bar-Peled L, Efeyan A, Wang S, Sancak Y, Sabatini DM. mTORC1 senses lysosomal amino acids through an inside-out mechanism that requires the vacuolar H(+)-ATPase. Science. 2011;334:678-83. 235. Liu AP, Aguet F, Danuser G, Schmid SL. Local clustering of transferrin receptors promotes clathrin-coated pit initiation. The Journal of cell biology. 2010;191:1381-93. 236. Sorkin A, Von Zastrow M. Signal transduction and endocytosis: close encounters of many kinds. Nature reviews Molecular cell biology. 2002;3:600-14. 237. Sloane BF, Honn KV, Sadler JG, Turner WA, Kimpson JJ, Taylor JD. Cathepsin B activity in B16 melanoma cells: a possible marker for metastatic potential. Cancer research. 1982;42:980-6. 238. Matarrese P, Ascione B, Ciarlo L, Vona R, Leonetti C, Scarsella M, et al. Cathepsin B inhibition interferes with metastatic potential of human melanoma: an in vitro and in vivo study. Molecular cancer. 2010;9:207. 239. Galluzzi L, Vitale I, Abrams JM, Alnemri ES, Baehrecke EH, Blagosklonny MV, et al. Molecular definitions of cell death subroutines: recommendations of the Nomenclature Committee on Cell Death 2012. Cell death and differentiation. 2012;19:107-20. 240. Ly JD, Grubb DR, Lawen A. The mitochondrial membrane potential (deltapsi(m)) in apoptosis; an update. Apoptosis : an international journal on programmed cell death. 2003;8:115-28. 241. Smaili SS, Hsu YT, Sanders KM, Russell JT, Youle RJ. Bax translocation to mitochondria subsequent to a rapid loss of mitochondrial membrane potential. Cell death and differentiation. 2001;8:909-20. 242. Gomez-Crisostomo NP, Lopez-Marure R, Zapata E, Zazueta C, Martinez- Abundis E. Bax induces cytochrome c release by multiple mechanisms in 155 mitochondria from MCF7 cells. Journal of bioenergetics and biomembranes. 2013;45:441-8. 243. Kroemer G, Galluzzi L, Vandenabeele P, Abrams J, Alnemri ES, Baehrecke EH, et al. Classification of cell death: recommendations of the Nomenclature Committee on Cell Death 2009. Cell death and differentiation. 2009;16:3-11. 244. Vanier MT. Niemann-Pick diseases. Handbook of clinical neurology. 2013;113:1717-21. 245. Leventhal AR, Chen W, Tall AR, Tabas I. Acid sphingomyelinase-deficient macrophages have defective cholesterol trafficking and efflux. The Journal of biological chemistry. 2001;276:44976-83. 246. Chang TY, Reid PC, Sugii S, Ohgami N, Cruz JC, Chang CC. Niemann- Pick type C disease and intracellular cholesterol trafficking. The Journal of biological chemistry. 2005;280:20917-20. 247. Roff CF, Goldin E, Comly ME, Cooney A, Brown A, Vanier MT, et al. Type C Niemann-Pick disease: use of hydrophobic amines to study defective cholesterol transport. Developmental neuroscience. 1991;13:315-9. 248. Mannhold R, Kubinyi H, Timmerman H, Pliska V, Testa B, Waterbeemd H. Lipophilicity in drug action and toxicology: John Wiley & Sons; 2008. 249. Lipinski CA, Lombardo F, Dominy BW, Feeney PJ. Experimental and computational approaches to estimate solubility and permeability in drug discovery and development settings. Advanced drug delivery reviews. 2001;46:3- 26. 250. Lieb J. Defeating cancer with antidepressants. Ecancermedicalscience. 2008;2:88. 251. Lieb J. The multifaceted value of antidepressants in cancer therapeutics. European journal of cancer. 2008;44:172-4. 252. Perez-Alvarez S, Iglesias-Guimarais V, Solesio ME, Melero-Fernandez de Mera RM, Yuste VJ, Galindo MF, et al. Methadone induces CAD degradation and AIF-mediated necrotic-like cell death in neuroblastoma cells. Pharmacological research : the official journal of the Italian Pharmacological Society. 2011;63:352-60. 253. Gil-Ad I, Shtaif B, Levkovitz Y, Nordenberg J, Taler M, Korov I, et al. Phenothiazines induce apoptosis in a B16 mouse melanoma cell line and attenuate in vivo melanoma tumor growth. Oncology reports. 2006;15:107-12. 254. Fan D, Poste G, Seid C, Earnest LE, Bull T, Clyne RK, et al. Reversal of multidrug resistance in murine fibrosarcoma cells by thioxanthene flupentixol. Investigational new drugs. 1994;12:185-95. 255. Arimochi H, Morita K. Desipramine induces apoptotic cell death through nonmitochondrial and mitochondrial pathways in different types of human colon carcinoma cells. Pharmacology. 2008;81:164-72. 256. Davies MA. The role of the PI3K-AKT pathway in melanoma. Cancer journal. 2012;18:142-7. 257. Kortylewski M, Jove R, Yu H. Targeting STAT3 affects melanoma on multiple fronts. Cancer metastasis reviews. 2005;24:315-27. 156

258. Xie TX, Huang FJ, Aldape KD, Kang SH, Liu M, Gershenwald JE, et al. Activation of stat3 in human melanoma promotes brain metastasis. Cancer research. 2006;66:3188-96. 259. Tsuruta F, Masuyama N, Gotoh Y. The phosphatidylinositol 3-kinase (PI3K)-Akt pathway suppresses Bax translocation to mitochondria. The Journal of biological chemistry. 2002;277:14040-7. 260. Boya P, Gonzalez-Polo RA, Poncet D, Andreau K, Vieira HL, Roumier T, et al. Mitochondrial membrane permeabilization is a critical step of lysosome- initiated apoptosis induced by hydroxychloroquine. Oncogene. 2003;22:3927-36. 261. Rodriguez-Enfedaque A, Delmas E, Guillaume A, Gaumer S, Mignotte B, Vayssiere JL, et al. zVAD-fmk upregulates caspase-9 cleavage and activity in etoposide-induced cell death of mouse embryonic fibroblasts. Biochimica et biophysica acta. 2012;1823:1343-52. 262. Lademann U, Cain K, Gyrd-Hansen M, Brown D, Peters D, Jaattela M. Diarylurea compounds inhibit caspase activation by preventing the formation of the active 700-kilodalton apoptosome complex. Molecular and cellular biology. 2003;23:7829-37. 263. Cui Q, Yu JH, Wu JN, Tashiro S, Onodera S, Minami M, et al. P53- mediated cell cycle arrest and apoptosis through a caspase-3- independent, but caspase-9-dependent pathway in oridonin-treated MCF-7 human breast cancer cells. Acta pharmacologica Sinica. 2007;28:1057-66. 264. Ontario Clinical Oncology G, Hamilton Health Sciences C, Juravinski Cancer Centre F. Safety Study of Thioridazine in Combination With Cytarabine to Treat Relapsed or Refractory Acute Myeloid Leukemia. 2015. 265. Cleveland B. Quinacrine Treatment in Patients With Androgen- Independent Prostate Cancer. 2008. 266. Joel N, Stanford U. Phase IIa Desipramine in Small Cell Lung Cancer and Other High-Grade Neuroendocrine Tumors. 2014. 267. Immune C. Study of Fluphenazine in Relapsed or Relapsed-and- Refractory Multiple Myeloma. 2010. 268. Sidney Kimmel Comprehensive Cancer C, National Cancer I, Tau Therapeutics LLC. Mibefradil Dihydrochloride and Temozolomide in Treating Patients With Recurrent Glioma. 2015. 269. Jahchan NS, Dudley JT, Mazur PK, Flores N, Yang D, Palmerton A, et al. A drug repositioning approach identifies tricyclic antidepressants as inhibitors of small cell lung cancer and other neuroendocrine tumors. Cancer discovery. 2013;3:1364-77. 270. Laird B, Colvin L, Fallon M. Management of cancer pain: basic principles and neuropathic cancer pain. European journal of cancer. 2008;44:1078-82. 271. Dimelow RJ, Metcalfe PD, Thomas S. In Silico Models of Drug Metabolism and Drug Interactions. Encyclopedia of Drug Metabolism and Interactions. 2012. 272. Souza VB, Moura Filho FJ, Souza FG, Rocha CF, Furtado FA, Goncalves TB, et al. Cataract occurrence in patients treated with antipsychotic drugs. Revista brasileira de psiquiatria. 2008;30:222-6. 157

273. Smith D, Pantelis C, McGrath J, Tangas C, Copolov D. Ocular abnormalities in chronic schizophrenia: clinical implications. The Australian and New Zealand journal of psychiatry. 1997;31:252-6. 274. Etminan M, Mikelberg FS, Brophy JM. Selective serotonin reuptake inhibitors and the risk of cataracts: a nested case-control study. Ophthalmology. 2010;117:1251-5.

Curriculum Vitae Ömer Faruk KUZU EDUCATION: 2011- to present Ph.D., Genetics Department, Penn State University, College of Medicine 2009-2011 Master of Science, Genetics Department, Penn State University, College of Medicine 2003-2008: Bachelors of Science, Molecular Biology and Genetics Department, Bilkent University, Turkey PUBLICATIONS: Kuzu OF, Gowda R, Sharma A, Robertson GP. Leelamine mediates cancer cell death through inhibition of intracellular cholesterol transport, Mol Cancer Ther. 2014 Jul;13(7):1690-703. Gowda R, Madhunapantula SV, Kuzu OF, Sharma A, Robertson GP. Targeting multiple key signaling pathways in melanoma using leelamine, Mol Cancer Ther. 2014 Jul;13(7):1679-89. Gowda R, Madhunapantula SV, Sharma A, Kuzu OF, Robertson GP Nanolipolee- 007, a novel nanoparticle based drug containing leelamine for the treatment of melanoma, Mol Cancer Ther. 2014 Jul 31 AWARDS: 2011 Student Award for Excellence in Innovation, Penn State University, College of Medicine PROVISIONAL PATENTS/PATENTS/LICENSING OF PATENTS 1. Composition and methods relating to proliferative diseases. Inventors: Robertson GP., Gowda R, Subbarao Madhunapantula, Kuzu OF, Gajanan Inamdar. 2013/10/16. WO Patent publication number: EP2648706 A2.

PRESENTATIONS AND PUBLISHED ABSTRACTS Gowda R, Madhunapantula SV, Kuzu OF, Sharma A and Robertson GP. Naturally occurring leelamine inhibits melanoma development by targeting multiple. AACR- 104 th Annual meeting, Washington, DC, April 6-10th, 2013. (Poster Presentation) Kuzu OF, Raghavendra Gowda, Arati Sharma, G. P. Robertson. Leelamine targets the sucide bags of the cells. 25 th Annual Graduate Student Research Forum, Penn State College of Medicine, Penn State University, Hershey, PA 17033 held on March 1, 2013. (Oral Presentation) Kuzu OF, Gowda R, Madhunapantula SV, Sharma A, Robertson GP. Using protein arrays and system biology to identify targets of leelamine. International Melanoma Congress, Tampa, USA, 2011. (Poster Presentation)