DOCSLIB.ORG

Detection of Nocardia, Streptomyces and Rhodococcus from Broncho- Alveolar Lavage Specimens of Patients with HIV by Multiplex PC

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Detection of Nocardia, Streptomyces and Rhodococcus from Broncho- Alveolar Lavage Specimens of Patients with HIV by Multiplex PC Detection of Nocardia, Streptomyces … Rahdar HA. et al. 737 ORIGINAL ARTICLE Detection of Nocardia, Streptomyces and Rhodococcus from broncho- alveolar lavage specimens of patients with HIV by Multiplex PCR Assay Hossein Ali Rahdar1,2, Mohammad Reza Salehi3, Abass Bahador1, Seyedesomaye Jasemi1, Morteza Karami-Zarandi1, Malehe Hasan Nejad3, Shahram Shahraki- 1,6 Zahedani4, Jafar Amani5, Seifu Gizaw Feyisa , Jalil Kardan-Yamchi1, Mohammad Mehdi Feizabadi1* ABSTRACT OPEN ACCESS Citation: Hossein Ali Rahdar, Background: Nocardia, Streptomyces and Rhodococcus are life Mohammad Reza Salehi, Abass Bahador, threatening opportunistic pathogens under immunodeficiency et al. Detection of Nocardia, conditions, particularly among patients infected with HIV. Rapid Streptomyces and Rhodococcus from broncho-alveolar lavage specimens of and accurate detection of these infections can improve immune patients with HIV by multiplex PCR health quality, patient management and appropriate treatment. The assay. Ethiop J Health Sci. 2019; 29(6):737.doi:http://dx.doi.org/10.4314/ej aim of this study was to design a novel multiplex-PCR assay for hs.v29 i6.10 rapid diagnosis of these three organisms directly from broncho- Received: June 28, 2019 alveolar lavage (BAL) specimens of patients infected with HIV. Accepted: July 27, 2019 Published: November 1, 2019 Methods: The genus specific primers were designed for direct- Copyright: ©2019 Hossein Ali Rahdar, detection of Nocardia, Streptomyces and Rhodococcus in a single et al. This is an open access article tube multiplex PCR. This PCR specifically amplified the target distributed under the terms of the Creative Commons Attribution License, genes from pure cultures. It subsequently was applied on BAL which permits unrestricted use, specimens of 29 HIV positive patients that had previously been distribution, and reproduction in any medium, provided the original author and culture negative for actinomycete bacteria, of which Nocardia, source are credited. Streptomyces and Rhodococcus are members. Funding: This study was supported by Results: Of 29 respiratory clinical specimens, there were positive Tehran University of Medical Sciences (Project No,36924). for Nocardia spp. and one was positive for Streptomyces spp using Competing Interests: The authors the multiplex PCR assay. The sequencing of the PCR products declare that this manuscript was approved identified the species as Nocardia cyriacigeorgica (n=2), Nocardia by all authors in its form and that no competing interest exists. farcinica and Streptomyces albus. Affiliation and Correspondence: Conclusion: This novel multiplex PCR assay yielded reliable 1Department of Medical Microbiology, School of Medicine, Tehran University of results for accurate identification of Nocardia, Streptomyces and Medical Sciences, Tehran, Iran. Rhodococcus from BAL while the results of bacterial culture were 2Department of Microbiology, School of Medicine, Iranshahr University of Medical negative. Sciences, Iranshahr, Iran Keywords: Nocardia; Streptomyces; Rhodococcus; HIV; Infection; 3Department of Infectious and Tropical Diseases, Imam Khomeini Hospital Multiplex PCR. Complex, Tehran University of Medical Sciences, Tehran, Iran. 4Department of Medical Microbiology, INTRODUCTION School of Medicine, Zahedan University of Medical Sciences, Zahedan, Iran. In recent years, the incidence of opportunistic infections has 5Baqiyatallah University of Medical Sciences, Tehran, Iran. increased in individuals with underlying conditions, autoimmune 6Department of Biology, College of Natural diseases, cancers, HIV, organ transplantation and chemotherapy. Sciences, Jimma University, Ethiopia *Email: [email protected] Among opportunistic pathogens, members of actinomycetes order such as Nocardia, Streptomyces and Rhodococcus need to be identified correctly prior to starting antibiotic therapy (1,2). DOI: http://dx.doi.org/10.4314/ejhs.v29i6.10 738 Ethiop J Health Sci. Vol. 29, No. 6 November 2019 Pulmonary nocardiosis is an invasive infection abscesses caused by actinomycetes from caused by the genus Nocardia, a partial acid-fast tuberculosis, viral, fungi infection or malignant microorganism. The common route of pulmonary tumours (3). Moreover, the sensitivity of direct infection is inhalation of contaminated aerosols smear microscopy and culture is low and from environmental sources. Therefore, the lung is controversial as it interferes with prior use of the most common organ involved in nocardiosis. antibiotics before sampling (1,13). These methods Other entry routes include direct bacterial are also time consuming, expensive and need inoculation of the skin and eyes (1,3). Nocardia technical skill. Therefore, application of rapid, species may be transmitted to inexpensive and reliable diagnostic methods is immunocompromised individuals through contact essential for diagnosis and management of these with environmental sources, leading to various infections. Previously, PCR was used in another complications, from local cutaneous lesions to study for the diagnosis of these infections in disseminated infections (3). separate single tubes (14,15). The aim of this Streptomyces spp. are gram-positive study was to design a novel multiplex-PCR assay filamentous bacteria that live in a wide range of for simultaneous identification of Nocardia and environmental sources and can produce Streptomyces and Rhodococcus genera infections antimicrobial compounds and secondary from broncho-alveolar lavage (BAL) specimens of metabolites. This group of bacteria may cause HIV-infected patients in a single tube. opportunistic infections such as pulmonary disease, tuberculosis mimicking, and mycetoma in MATERIALS AND METHODS immunocompromised patients (4). Culturing of specimens: This study was Rhodococcus spp. are saprophytic members performed between November 2018 and March of Nocardiaceae that live in environmental 2019 at the Imam Khomeini Complex Hospital sources including soil, dust, decaying plants, milk (IKH), Tehran University of Medical Sciences and animals. The first case of infection with (Tehran, Iran). Totally, 29 clinical respiratory Rhodococcus equi was reported in 1967 by Golub specimens including one lung biopsy as well as 28 et al. from lung abscess of a patient with AIDS BAL specimens were collected during routine (5,6). In addition, there are several clinical reports bronchoscopy from complicated pulmonary of human infections with R. erythropolis, R. ruber, infections of HIV patients excluding pulmonary- R. gordoniae, and R. fascians. However, R. equi tuberculosis. The specimens were sent to the has been the predominant species causing Department of Molecular Microbiology laboratory infections among rhodococci (5,7). Nowadays, the at Tehran University of Medical Sciences incidence rate of infections with Rhodococcus immediately and divided into two tubes. species are increasing due to an increasing number The specimens in the first tube were cultured of individuals with immune-disorders and the on brain-heart infusion (BHI) agar medium development of microbiology methods to detect containing polymyxin B (5 mg/liter), vancomycin these bacteria (5,8,9). (5 mg/liter) and cycloheximide (5 mg/liter) and We are at the end of the third decade of the incubated for 2 to 4 weeks at 30 and 37°C (3). acquired AIDS pandemic (10). According to the Direct smear was prepared on slides and literature, the number of opportunistic infections, specimens were stained with partially acid-fast particularly aerobic-actinomyces infection in HIV- and Gram staining using the specimens from the infected patients has increased (11). Although, first tube. The specimens in the second tube were culture is a gold standard method for laboratory used for PCR assay. diagnosis of bacterial diseases, this method is not This study has been approved by the ethical robust because of the slow growing of the committee of Tehran University of Medical actinomycete bacteria and complexity of their Sciences (approval number, nutritional requirement (12). In addition, it cannot IR.TUMS.MEDICINE.REC.1397.261). differentiate between clinical symptoms of Primer design: The gyrB gene sequences were pneumonia; skin, sub-cutaneous and brain retrieved from NCBI Gene Bank for the various DOI: http://dx.doi.org/10.4314/ejhs.v29i6.10 Detection of Nocardia, Streptomyces … Rahdar HA. et al. 739 genera including Dietzia, Gordonia, A pair of primers was designed for pathogenic Mycobacterium, Nocardia, Rhodococcus, genera of Streptomyces. By modifications in Streptomyces, and Tsukamurella to design genus existing primers, pairs of specific primers were specific primers pairs. Several gyrB gene designed for Nocardia and Rhodococcus equi sequences were obtained for every genus. The (Table 1) (16,17). sequences were analysed by Oligo 5 Software and signature sequences for each genus were selected. Table 1. Primers designed for Nocardia (NR), Streptomyces (Stp) and Rhodococcus equi (R). Primer Sequence Length of product genus Stp-F GTGCTGTGCCAGAAAGGGCG 320 bp Streptomyces spp. Stp-R GCGAGGATCGTGACGTCGAT NR-F CGACCACAAGGGGGCCTA 596 bp Nocardia spp. NR-R GGTTGTAAACCTCTTTCGACAGG R-F TCCAGAAGCGGGATGAGGAT 707 bp Rhodococcus spp. R-R TGGTGTGATGGCGGAAGATC Specificity of the PCR assay: Samples used:DNA (Ampliqon Co, Denmark) that contained 1X PCR from 33 clinical isolates of Nocardia species buffer, 1.5 mM MgCl2, 1 µL template DNA (1µg), (n=10), Nocardiopsis species (n=2), Streptomyces 0.15 mMdNTP, 1.25 U Taq DNA polymerase, species (n=2), Rhodococcus
Load more

Recommended publications
  • Responses to Ecopollutants and Pathogenization Risks of Saprotrophic Rhodococcus Species
    pathogens Review Responses to Ecopollutants and Pathogenization Risks of Saprotrophic Rhodococcus Species Irina B. Ivshina 1,2,*, Maria S. Kuyukina 1,2 , Anastasiia V. Krivoruchko 1,2 and Elena A. Tyumina 1,2 1 Perm Federal Research Center UB RAS, Institute of Ecology and Genetics of Microorganisms UB RAS, 13 Golev Str., 614081 Perm, Russia; [email protected] (M.S.K.); [email protected] (A.V.K.); [email protected] (E.A.T.) 2 Department of Microbiology and Immunology, Perm State University, 15 Bukirev Str., 614990 Perm, Russia * Correspondence: [email protected]; Tel.: +7-342-280-8114 Abstract: Under conditions of increasing environmental pollution, true saprophytes are capable of changing their survival strategies and demonstrating certain pathogenicity factors. Actinobacteria of the genus Rhodococcus, typical soil and aquatic biotope inhabitants, are characterized by high ecological plasticity and a wide range of oxidized organic substrates, including hydrocarbons and their derivatives. Their cell adaptations, such as the ability of adhering and colonizing surfaces, a complex life cycle, formation of resting cells and capsule-like structures, diauxotrophy, and a rigid cell wall, developed against the negative effects of anthropogenic pollutants are discussed and the risks of possible pathogenization of free-living saprotrophic Rhodococcus species are proposed. Due to universal adaptation features, Rhodococcus species are among the candidates, if further anthropogenic pressure increases, to move into the group of potentially pathogenic organisms with “unprofessional” parasitism, and to join an expanding list of infectious agents as facultative or occasional parasites. Citation: Ivshina, I.B.; Kuyukina, Keywords: actinobacteria; Rhodococcus; pathogenicity factors; adhesion; autoaggregation; colonization; M.S.; Krivoruchko, A.V.; Tyumina, defense against phagocytosis; adaptive strategies E.A.
    [Show full text]
  • The Rhodococcus Equi Virulence Protein Vapa Disrupts Endolysosome Function and Stimulates Lysosome Biogenesis
    This is a repository copy of The Rhodococcus equi virulence protein VapA disrupts endolysosome function and stimulates lysosome biogenesis. White Rose Research Online URL for this paper: https://eprints.whiterose.ac.uk/104956/ Version: Accepted Version Article: Rofe, Adam P, Davis, Luther J, Whittingham, Jean L et al. (3 more authors) (2016) The Rhodococcus equi virulence protein VapA disrupts endolysosome function and stimulates lysosome biogenesis. Microbiology Open. e00416. ISSN 2045-8827 https://doi.org/10.1002/mbo3.416 Reuse This article is distributed under the terms of the Creative Commons Attribution (CC BY) licence. This licence allows you to distribute, remix, tweak, and build upon the work, even commercially, as long as you credit the authors for the original work. More information and the full terms of the licence here: https://creativecommons.org/licenses/ Takedown If you consider content in White Rose Research Online to be in breach of UK law, please notify us by emailing [email protected] including the URL of the record and the reason for the withdrawal request. [email protected] https://eprints.whiterose.ac.uk/ The Rhodococcus equi virulence protein VapA disrupts endolysosome function and stimulates lysosome biogenesis. Adam P. Rofe1, Luther J. Davis2, Jean L. Whittingham3, Elizabeth C. Latimer- Bowman2, Anthony J. Wilkinson3 and Paul R. Pryor1,4* 1 Department of Biology, Wentworth Way, University of York, York. YO10 5DD. United Kingdom; 2 Cambridge Institute for Medical Research and Department of Clinical Biochemistry, University of Cambridge, Addenbrooke’s Hospital, Hills Rd, Cambridge, CB2 0XY; 3 Structural Biology Laboratory, Department of Chemistry, University of York York.
    [Show full text]
  • Impact of Diesel and Biodiesel Contamination on Soil Microbial Community Activity and Structure Eduardo K
    www.nature.com/scientificreports OPEN Impact of diesel and biodiesel contamination on soil microbial community activity and structure Eduardo K. Mitter1*, James J. Germida2 & J. Renato de Freitas2 Soil contamination as a result of oil spills is a serious issue due to the global demand for diesel fuel. As an alternative to diesel, biodiesel has been introduced based on its high degradability rates and potential for reducing of greenhouse gases emissions. This study assessed the impacts diesel and biodiesel contamination on soil microbial community activity and structure. Our results suggest higher microbial activity in biodiesel contaminated soils and analysis of PLFA profles confrmed shifts in microbial community structure in response to contamination. High-throughput 16S rRNA amplicon sequencing also revealed a lower bacterial richness and diversity in contaminated soils when compared to control samples, supporting evidence of the detrimental efects of hydrocarbons on soil microbiota. Control samples comprised mostly of Actinobacteria, whereas Proteobacteria were predominantly observed in diesel and biodiesel contaminated soils. At genus level, diesel and biodiesel amendments highly selected for Rhodococcus and Pseudomonas spp., respectively. Moreover, predicted functional profles based on hydrocarbon-degrading enzymes revealed signifcant diferences between contaminated soils mostly due to the chemical composition of diesel and biodiesel fuel. Here, we also identifed that Burkholderiaceae, Novosphingobium, Anaeromyxobacter, Pseudomonas and Rhodococcus were the main bacterial taxa contributing to these enzymes. Together, this study supports the evidence of diesel/biodiesel adverse efects in soil microbial community structure and highlights microbial taxa that could be further investigated for their biodegradation potential. Petroleum derived diesel fuel is a major source of energy throughout the world and one of the most widespread soil contaminants1,2.
    [Show full text]
  • Evolutionary Transitions Between Beneficial and Phytopathogenic
    RESEARCH ARTICLE Evolutionary transitions between beneficial and phytopathogenic Rhodococcus challenge disease management Elizabeth A Savory1†, Skylar L Fuller1,2†, Alexandra J Weisberg1†, William J Thomas1, Michael I Gordon1, Danielle M Stevens1, Allison L Creason1,2‡, Michael S Belcher1, Maryna Serdani1, Michele S Wiseman1, Niklaus J Gru¨ nwald3, Melodie L Putnam1, Jeff H Chang1,2,4* 1Department of Botany and Plant Pathology, Oregon State University, Corvallis, United States; 2Molecular and Cellular Biology Program, Oregon State University, Corvallis, United States; 3Horticultural Crops Research Laboratory, United States Department of Agriculture and Agricultural Research Service, Corvallis, United States; 4Center for Genome Research, Oregon State University, Corvallis, United States Abstract Understanding how bacteria affect plant health is crucial for developing sustainable crop production systems. We coupled ecological sampling and genome sequencing to characterize *For correspondence: the population genetic history of Rhodococcus and the distribution patterns of virulence plasmids [email protected] in isolates from nurseries. Analysis of chromosome sequences shows that plants host multiple †These authors contributed lineages of Rhodococcus, and suggested that these bacteria are transmitted due to independent equally to this work introductions, reservoir populations, and point source outbreaks. We demonstrate that isolates lacking virulence genes promote beneficial plant growth, and that the acquisition of a virulence
    [Show full text]
  • Detection of Rhodococcus Fascians, the Causative Agent of Lily Fasciation in South Korea
    pathogens Article Detection of Rhodococcus fascians, the Causative Agent of Lily Fasciation in South Korea Joon Moh Park 1,†, Jachoon Koo 2,†, Se Won Kang 3, Sung Hee Jo 4 and Jeong Mee Park 4,* 1 Forest Resource Research Division, Jeollabuk-do Forest Environment Research Institute, Jinan 55454, Korea; [email protected] 2 Division of Science Education and Institute of Fusion Science, Jeonbuk National University, Jeonju 54896, Korea; [email protected] 3 Biological Resource Center, Korea Research Institute of Bioscience and Biotechnology, Jeonguep 56212, Korea; [email protected] 4 Plant Systems Engineering Research Center, Korea Research Institute of Bioscience and Biotechnology, Daejeon 34141, Korea; [email protected] * Correspondence: [email protected]; Tel.: +82-42-860-4346 † These authors contributed equally. Abstract: Rhodococcus fascians is an important pathogen that infects various herbaceous perennials and reduces their economic value. In this study, we examined R. fascians isolates carrying a virulence gene from symptomatic lily plants grown in South Korea. Phylogenetic analysis using the nucleotide sequences of 16S rRNA, vicA, and fasD led to the classification of the isolates into four different strains of R. fascians. Inoculation of Nicotiana benthamiana with these isolates slowed root growth and resulted in symptoms of leafy gall. These findings elucidate the diversification of domestic pathogenic R. fascians and may lead to an accurate causal diagnosis to help reduce economic losses in the bulb market. Citation: Park, J.M.; Koo, J.; Kang, S.W.; Jo, S.H.; Park, J.M. Detection of Keywords: fasciation; fasD; lily; Rhodococcus fascians; vicA Rhodococcus fascians, the Causative Agent of Lily Fasciation in South Korea.
    [Show full text]
  • Rhodococcus As a Versatile Biocatalyst in Organic Synthesis
    International Journal of Molecular Sciences Review Rhodococcus as a Versatile Biocatalyst in Organic Synthesis Hanna Busch, Peter-Leon Hagedoorn and Ulf Hanefeld * Department of Biotechnology, Delft University of Technology, Van der Maasweg 9, 2629 HZ Delft, The Netherlands; [email protected] (H.B.); [email protected] (P.L.H.) * Correspondence: [email protected] Received: 9 September 2019; Accepted: 24 September 2019; Published: 26 September 2019 Abstract: The application of purified enzymes as well as whole-cell biocatalysts in synthetic organic chemistry is becoming more and more popular, and both academia and industry are keen on finding and developing novel enzymes capable of performing otherwise impossible or challenging reactions. The diverse genus Rhodococcus offers a multitude of promising enzymes, which therefore makes it one of the key bacterial hosts in many areas of research. This review focused on the broad utilization potential of the genus Rhodococcus in organic chemistry, thereby particularly highlighting the specific enzyme classes exploited and the reactions they catalyze. Additionally, close attention was paid to the substrate scope that each enzyme class covers. Overall, a comprehensive overview of the applicability of the genus Rhodococcus is provided, which puts this versatile microorganism in the spotlight of further research. Keywords: Rhodococcus; biocatalysis; organic synthesis; enzyme; drugs 1. Introduction The genus Rhodococcus belongs to the phylum Actinobacteria and its members are aerobic, Gram-positive, non-motile bacteria showing high GC-contents [1]. Numerous members have been isolated from copious sources such as soil, groundwater, marine sediments, internal organs of insects, diseased and healthy animals, or plants-to name a few [2].
    [Show full text]
  • Fatty Acids As a Tool to Understand Microbial Diversity and Their Role in Food Webs of Mediterranean Temporary Ponds
    Molecules 2014, 19, 5570-5598; doi:10.3390/molecules19055570 OPEN ACCESS molecules ISSN 1420-3049 www.mdpi.com/journal/molecules Article Fatty Acids as a Tool to Understand Microbial Diversity and Their Role in Food Webs of Mediterranean Temporary Ponds Carla C.C.R. de Carvalho 1,* and Maria-José Caramujo 2,† 1 IBB-Institute for Biotechnology and Bioengineering, Centre for Biological and Chemical Engineering, Department of Bioengineering, Instituto Superior Técnico, Universidade de Lisboa, Av. Rovisco Pais, Lisbon 1049-001, Portugal 2 Centre for Environmental Biology, Faculty of Sciences, Universidade de Lisboa, Campo Grande C2, Lisbon 1749-016, Portugal; E-Mail: [email protected] † Current address: Department of Cell Biology and Neurosciences, Istituto Superiore di Sanità, Viale Regina Elena 299, Roma 00161, Italy. * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +351-218-419-594; Fax: +351-218-419-062. Received: 6 February 2014; in revised form: 27 April 2014 / Accepted: 28 April 2014 / Published: 30 April 2014 Abstract: Temporary Mediterranean ponds are complex ecosystems which support a high diversity of organisms that include heterotrophic microorganisms, algae, crustaceans, amphibians and higher plants, and have the potential to supply food and a resting place to migratory birds. The role of heterotrophs at the base of the food web in providing energy to the higher trophic levels was studied in temporary ponds in Central and Southern Portugal. The relative quantification of the hetero and autotrophic biomass at the base of the food web in each pond was derived from the polar fatty acid (PLFA) composition of seston through the application of the matrix factorization program CHEMTAX that used specific PLFA and their relative proportion as markers for e.g., classes of bacteria, algae and fungi.
    [Show full text]
  • Adaptive Response of Rhodococcus Opacus PWD4 to Salt and Phenolic Stress on the Level of Mycolic Acids Carla C
    de Carvalho et al. AMB Expr (2016) 6:66 DOI 10.1186/s13568-016-0241-9 ORIGINAL ARTICLE Open Access Adaptive response of Rhodococcus opacus PWD4 to salt and phenolic stress on the level of mycolic acids Carla C. C. R. de Carvalho1, Martin A. Fischer2, Sandra Kirsten2, Birgit Würz3, Lukas Y. Wick3 and Hermann J. Heipieper2* Abstract Mycolata form a group of Gram-positive bacteria with unique cell envelope structures that are known for their high tolerance against antibiotics and both aromatic and aliphatic hydrocarbons. An important part of the unique surface structure of the mycolata is the presence of long chain α-alkyl-β-hydroxy fatty acids, the mycolic acids. In order to investigate the adaptive changes in the mycolic acid composition, we investigated the composition of mycolic acids during the response both to osmotic stress caused by NaCl and to 4-chlorophenol in Rhodococcus opacus PWD4. This bacterium was chosen as it is known to adapt to different kinds of stresses. In addition, it is a potential biocatalyst in bioremediation as well as for biotechnological applications. In the present study, cells of R. opacus PWD4, grown in liquid cultures, responded to toxic concentrations of NaCl by increasing the ratio between mycolic acids and mem- brane phospholipid fatty acids (MA/PLFA-ratio). Cells reacted to both NaCl and 4-chlorophenol by decreasing both the average chain length and the unsaturation index of their mycolic acids. These changes in mycolic acid composi- tion correlated with increases in cell surface hydrophobicity and saturation of membrane fatty acids, demonstrating the relation between mycolic acid and phospholipid synthesis and their contribution to cell surface properties of R.
    [Show full text]
  • Phenotypic Characterization of Rhodococcus Equi Biofilm Grown In
    pathogens Article Phenotypic Characterization of Rhodococcus equi Biofilm Grown In Vitro and Inhibiting and Dissolving Activity of Azithromycin/Rifampicin Treatment Elisa Rampacci 1,* , Maria Luisa Marenzoni 1, Stefano Giovagnoli 2 , Fabrizio Passamonti 1 , Mauro Coletti 1 and Donatella Pietrella 3 1 Department of Veterinary Medicine, University of Perugia, Via San Costanzo 4, 06126 Perugia, Italy; [email protected] (M.L.M.); [email protected] (F.P.); [email protected] (M.C.) 2 Department of Pharmaceutical Sciences, University of Perugia, Via del Liceo 1, 06123 Perugia, Italy; [email protected] 3 Department of Pharmaceutical Sciences, Biochemical Sciences and Health Section, University of Perugia, Via del Giochetto, 06122 Perugia, Italy; [email protected] * Correspondence: [email protected] Received: 8 November 2019; Accepted: 3 December 2019; Published: 4 December 2019 Abstract: Microbial biofilm has been implicated in a wide range of chronic infections. In spite of the fact that Rhodococcus equi is a recognized cause of chronic disease in animals and humans, few studies have focused on the sessile phenotype of R. equi. The aim of this research was to phenotypically characterize the biofilm development of R. equi and its answerability for hypo-responsiveness to macrolides and rifampicin. Biofilm formation is initiated by bacterial adhesion to the surface. In this work, the ability of R. equi to adhere to the surface of human lung epithelial cells was detected by a fluorometric adhesion test performed on 40 clinical isolates. Subsequently, the capability of R. equi to produce biofilm was investigated by colorimetric, fluorescence and scanning electron microscopy analysis, revealing a general slow growth of rhodococcal biofilm and different sessile phenotypes among field isolates, some also including filamented bacteria.
    [Show full text]
  • Rhodococcus Opacus PD630 Genetic Tool Development to Enable the Conversion of Biomass
    Washington University in St. Louis Washington University Open Scholarship Engineering and Applied Science Theses & Dissertations McKelvey School of Engineering Winter 12-15-2019 Rhodococcus opacus PD630 Genetic Tool Development to Enable the Conversion of Biomass Drew Michael Delorenzo Washington University in St. Louis Follow this and additional works at: https://openscholarship.wustl.edu/eng_etds Part of the Biomedical Engineering and Bioengineering Commons, and the Microbiology Commons Recommended Citation Delorenzo, Drew Michael, "Rhodococcus opacus PD630 Genetic Tool Development to Enable the Conversion of Biomass" (2019). Engineering and Applied Science Theses & Dissertations. 492. https://openscholarship.wustl.edu/eng_etds/492 This Dissertation is brought to you for free and open access by the McKelvey School of Engineering at Washington University Open Scholarship. It has been accepted for inclusion in Engineering and Applied Science Theses & Dissertations by an authorized administrator of Washington University Open Scholarship. For more information, please contact [email protected]. WASHINGTON UNIVERSITY IN ST. LOUIS McKelvey School of Engineering Department of Energy, Environmental, and Chemical Engineering Dissertation Examination Committee: Dr. Tae Seok Moon (chair) Dr. Gautam Dantas Dr. Marcus Foston Dr. Himadri Pakrasi Dr. Fuzhong Zhang Rhodococcus opacus PD630 Genetic Tool Development to Enable the Conversion of Biomass by Drew Michael DeLorenzo A dissertation presented to The Graduate School of Washington University
    [Show full text]
  • Rhodococcus As Biofactories for Microbial Oil Production
    molecules Review Rhodococcus as Biofactories for Microbial Oil Production Héctor M. Alvarez * , Martín A. Hernández, Mariana P. Lanfranconi, Roxana A. Silva and María S. Villalba INBIOP (Instituto de Biociencias de la Patagonia), Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET), Facultad de Ciencias Naturales y Ciencias de la Salud, Universidad Nacional de la Patagonia San Juan Bosco, Ruta Provincial N◦ 1, Km 4-Ciudad Universitaria, Comodoro Rivadavia 9000, Chubut, Argentina; [email protected] (M.A.H.); [email protected] (M.P.L.); [email protected] (R.A.S.); [email protected] (M.S.V.) * Correspondence: [email protected]; Tel.: +54-297-488-6168 Abstract: Bacteria belonging to the Rhodococcus genus are frequent components of microbial commu- nities in diverse natural environments. Some rhodococcal species exhibit the outstanding ability to produce significant amounts of triacylglycerols (TAG) (>20% of cellular dry weight) in the presence of an excess of the carbon source and limitation of the nitrogen source. For this reason, they can be considered as oleaginous microorganisms. As occurs as well in eukaryotic single-cell oil (SCO) producers, these bacteria possess specific physiological properties and molecular mechanisms that differentiate them from other microorganisms unable to synthesize TAG. In this review, we summa- rized several of the well-characterized molecular mechanisms that enable oleaginous rhodococci to produce significant amounts of SCO. Furthermore, we highlighted the ability of these microorganisms to degrade a wide range of carbon sources coupled to lipogenesis. The qualitative and quantitative oil production by rhodococci from diverse industrial wastes has also been included. Finally, we summarized the genetic and metabolic approaches applied to oleaginous rhodococci to improve SCO production.
    [Show full text]
  • Rhizosphere Bacterium Rhodococcus Sp. P1Y Metabolizes Abscisic Acid to Form Dehydrovomifoliol
    biomolecules Article Rhizosphere Bacterium Rhodococcus sp. P1Y Metabolizes Abscisic Acid to Form Dehydrovomifoliol Oleg S. Yuzikhin 1,2 , Natalia E. Gogoleva 3,4, Alexander I. Shaposhnikov 1 , Tatyana A. Konnova 5, Elena V. Osipova 3, Darya S. Syrova 1, Elena A. Ermakova 3, Valerii P. Shevchenko 6, Igor Yu. Nagaev 6, Konstantin V. Shevchenko 6, Nikolay F. Myasoedov 6, Vera I. Safronova 1, Alexey L. Shavarda 7, Anton A. Nizhnikov 1,7 , Andrey A. Belimov 1 and Yuri V. Gogolev 3,4,* 1 All-Russia Research Institute for Agricultural Microbiology, Podbelskogo sh. 3, Pushkin, 196608 Saint-Petersburg, Russia; [email protected] (O.S.Y.); [email protected] (A.I.S.); [email protected] (D.S.S.); [email protected] (V.I.S.); [email protected] (A.A.N.); [email protected] (A.A.B.) 2 All-Russian Research Institute of Plant Protection, Podbelskogo sh. 3, Pushkin, 196608 Saint-Petersburg, Russia 3 Kazan Institute of Biochemistry and Biophysics, Federal Research Center “Kazan Scientific Center of the RAS”, Lobachevsky Street, 2/31, 420111 Kazan, Tatarstan Republic, Russia; [email protected] (N.E.G.); [email protected] (E.V.O.); [email protected] (E.A.E.) 4 Kazan Federal University Institute of Fundamental Medicine and Biology, K.Marx, 76, 420012 Kazan, Russia 5 Laboratory of Plant Infectious Diseases, FRC Kazan Scientific Center of RAS, 420111 Kazan, Tatarstan Republic, Russia; [email protected] 6 Institute of Molecular Genetics, Russian Academy of Sciences, Akademika Kurchatova Square, 2, 123182 Moscow, Russia; [email protected] (V.P.S.); [email protected] (I.Y.N.); [email protected] (K.V.S.); Citation: Yuzikhin, O.S.; Gogoleva, [email protected] (N.F.M.) 7 Department of Genetics and Biotechnology, Saint-Petersburg State University, University Embankment, N.E.; Shaposhnikov, A.I.; Konnova, 199034 Saint-Petersburg, Russia; [email protected] T.A.; Osipova, E.V.; Syrova, D.S.; * Correspondence: [email protected]; Tel.: +7-917-916-8381 Ermakova, E.A.; Shevchenko, V.P.; Nagaev, I.Y..; Shevchenko, K.V.; et al.
    [Show full text]