NF-κB Regulates BCL3 Transcription in T Lymphocytes Through an Intronic Enhancer Baosheng Ge, Olga Li, Phillip Wilder, Angie Rizzino and Timothy W. McKeithan This information is current as of September 29, 2021. J Immunol 2003; 171:4210-4218; ; doi: 10.4049/jimmunol.171.8.4210 http://www.jimmunol.org/content/171/8/4210 Downloaded from References This article cites 36 articles, 16 of which you can access for free at: http://www.jimmunol.org/content/171/8/4210.full#ref-list-1

Why The JI? Submit online. http://www.jimmunol.org/ • Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

*average by guest on September 29, 2021 Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2003 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

NF-␬B Regulates BCL3 Transcription in T Lymphocytes Through an Intronic Enhancer1

Baosheng Ge,* Olga Li,* Phillip Wilder,† Angie Rizzino,† and Timothy W. McKeithan2

Exposure to soluble protein Ags in vivo leads to abortive proliferation of responding T cells. In the absence of a danger signal, artificially provided by adjuvants, most responding cells die, and the remainder typically become anergic. The adjuvant-derived signals provided to T cells are poorly understood, but recent work has identified BCL3 as the gene, of those tested, with the greatest differential transcriptional response to adjuvant administration in vivo. As an initial step in analyzing transcriptional responses of BCL3 in T cells, we have identified candidate regulatory regions within the locus through their evolutionary conservation and by analysis of DNase hypersensitivity. An evolutionarily conserved DNase hypersensitive site (HS3) within intron 2 was found to act as a transcriptional enhancer in response to stimuli that mimic TCR activation, namely, PHA and PMA. In luciferase reporter

gene constructs transiently transfected into the Jurkat T cell line, the HS3 enhancer can cooperate not only with the BCL3 Downloaded from promoter, but also with an exogenous promoter from herpes simplex thymidine kinase. Deletional analysis revealed that a minimal sequence of ϳ81 bp is required for full enhancer activity. At the 5؅ end of this minimal sequence is a ␬B site, as confirmed by EMSAs. Mutation of this site in the context of the full-length HS3 abolished enhancer activity. Cotransfection with NF-␬B p65 expression constructs dramatically increased luciferase activity, even without stimulation. Conversely, cotransfection with the NF-␬B inhibitor I␬B␣ reduced activation. Together, these results demonstrate a critical role for NF-␬BinBCL3 transcriptional

up-regulation by TCR-mimetic signals. The Journal of Immunology, 2003, 171: 4210–4218. http://www.jimmunol.org/

e initially cloned BCL3 (1, 2) as a candidate proto- (6). Of the 23 genes that responded to both of the tested adjuvants, oncogene located adjacent to the breakpoint junction BCL3 showed the greatest differential expression, and forced ex- W of the t(14;19) in some patients with chronic lympho- pression of BCL3-increased T cell survival in vitro or in vivo after cytic leukemia or de novo lymphoma. BCL3 is a member of the an in vivo stimulation without adjuvant. BCL3 is markedly up- I␬B family of proteins, whose primary role is to regulate the regulated by superantigen stimulation (7), but its mRNA level then NF-␬B family of transcription factors, which have important gen- declines below basal levels in the absence of adjuvant, whereas it eral roles in regulating genes involved in cell proliferation and remains highly elevated when adjuvants are present. These results by guest on September 29, 2021 apoptosis; however, their most striking roles are in inflammation suggest that BCL3, transcriptionally up-regulated initially by TCR and in innate and adaptive immune responses. This regulation oc- stimulation and later by adjuvant-derived stimuli, may be an im- curs through transcriptional activation of a wide variety of genes portant mediator of survival signals required for an effective im- that contain NF-␬B recognition elements (␬B sites). mune response. Disruption of the BCL3 locus in mice results in marked defects Dendritic cells (DCs)3 have been known for some time as the in immune function and in the microarchitecture of secondary lym- most effective APCs for activation of naive T cells, but only in phoid organs (3, 4). In BCL3-null mice, B cells largely fail to form a well-organized follicular organization in the lymph nodes and recent years has their equally important role in immune tolerance spleen, and fail to form germinal centers. Although capable of IgM become recognized. DCs that are otherwise tolerogenic can be responses, their ability to make isotype-switched responses to T- converted to fully activating DCs by adjuvants. Presumably, dif- dependent Ags is markedly impaired. In addition, Th1 and CTL ferences in signals from phenotypically different DCs are respon- responses are highly defective in BCL3-null mice. At least some of sible for the differences in transcriptional regulation of T cells in the defects in lymphocyte responses are secondary to alterations in the presence or absence of adjuvants, but the nature of the critical other cell types, including follicular dendritic cells (5). signals to T cells is poorly understood. A recent study catalogued the transcriptional response of T cells We have begun to dissect transcriptional regulation of BCL3 in in vivo to superantigen stimulation in the presence or absence of T cells because its up-regulation is a marker and a mediator of adjuvants, providing activating or tolerogenic signals, respectively adjuvant-induced survival signals in T cells (6). Using several complementary strategies, we have identified an intronic enhancer necessary for its up-regulation in response to stimuli that mimic *Department of Internal Medicine, Section of Hematology/Oncology, and †Eppley Institute for Research in Cancer and Allied Diseases, University of Nebraska Medical TCR activation. We demonstrate that this enhancer contains an Center, Omaha, NE 68132 essential cis-regulatory element that is responsive to NF-␬B. Received for publication June 17, 2003. Accepted for publication August 7, 2003. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 1 This work was supported by National Institutes of Health Grants CA55356 (to 3 Abbreviations used in this paper: DC, dendritic cell; ATF, activating transcription T.W.M.) and CA74771 (to A.R.). factor; CRE, cAMP response element; CsA, cyclosporin A; DAG, diacylglycerol; HS, 2 Address correspondence and reprint requests to Dr. Timothy McKeithan, Depart- DNase hypersensitive site; MEK, mitogen-activated protein/extracellular signal-reg- ment of Internal Medicine, University of Nebraska Medical Center, 986495 Nebraska ulated kinase kinase; PKC, protein kinase C; qPCR, quantitative real-time PCR; SR, Medical Center, Omaha, NE 68132. E-mail address: [email protected] superrepressor; TK, thymidine kinase; UTR, untranslated region; wt, wild type.

Copyright © 2003 by The American Association of Immunologists, Inc. 0022-1767/03/$02.00 The Journal of Immunology 4211

Materials and Methods Candidate enhancer regions were cloned indirectly into the SalI site of ϩ ϩ ϩ Cell line and drugs pGL3 derivatives. E3 4( 4642 to 6259) is derived from an Acc65I- NcoI fragment; E3 (ϩ4642 to ϩ5034) from an Acc65I-SacII fragment; and The human T cell lymphoma cell line Jurkat (clone E6-1; American Type E4 (ϩ5666 to ϩ6259) from an Ecl136II-NcoI fragment. E34 was derived Culture Collection, Manassas, VA) was grown in RPMI 1640 medium from E3 ϩ 4 by deletion of an internal SacII-Ecl136II fragment (ϩ5037 to (Cellgro, Herndon, VA) supplemented with 10% FCS (Invitrogen, Carls- ϩ5665). bad, CA), 1 mM sodium pyruvate (Cellgro), 100 U/ml penicillin, 100 ␮l/ml Deletions were prepared from an E3 construct by PCR using oligonu- streptomycin, and 25 mM HEPES, in an atmosphere of 5% CO2. For stim- cleotides containing a SalIorXhoI site (underlined below). PCR products ulation, the following concentrations were used, unless otherwise de- were digested with SalI and XhoI and cloned into the SalI site of P11. scribed: PHA (Sigma-Aldrich, Saint Louis, MO), 1 ␮g/ml; PMA, 50 ng/ml; Forward oligonucleotides are labeled from a to e, and reverse oligonucle- ionomycin, 1 ␮g/ml. For inhibitors PD98059 (LC Laboratories, Woburn, otides from 1 to 10. a, GGCGGTCGACGTCGACCTCGAGTACCTCTG; MA), 50 nM; bisindolymaleimide I, V, and IX (LC Laboratories), each at b, GGCGGTCGACTCTCCCCCAAGGCAAAC; c, GGCGGTCGACT 400 nM; cyclosporin A (CsA; Sigma-Aldrich), 100 ng/ml. TCTGCCTCAGCTGCCTG; d, GGCGGTCGACTGGGGGAAATCCCT TCCCG; e, GGCGGTCGACAAATCCCTTCCCGCAGAA; 1, GGCGC RNA isolation and Northern blotting TCGAGCTCGAGGGTGTGAAGAGGAG; 2, GGCGCTCGAGAAGAGG Total RNA was isolated from Jurkat cells using TRIzol (Life Technolo- AGCCGGTGG; 3, GGCGCTCGAGTCTCAGCCCCAGCG; 4, GGCGCT gies) and stored in formamide. A total of 10 ␮g of RNA was loaded per CGAGAAGGGGTTAAGGTTGGAG; 5, GGCGCTCGAGCGCCAGGAG lane in an agarose/formaldehyde gel and electrophoresed4hat5V/cm. GGGGGAG; 6, GGCGCTCGAGTGAGTGACGGGTGCTG; 7, GGCG After blotting to Immobilon Nyϩ membrane, hybridization with an CTCGAGACGGGTGCTGACGTGGG; 8, GGCGCTCGAGCTGACGTG [␣-32P]dCTP-labeled 1.38-kb BCL3 cDNA probe (SacI fragment) was per- GGGGAGGCA; 9, GGCGCTCGAGCTGGGTTGCGGTCAAG; 10, GGC formed in 50% deionized formamide, 0.25 M sodium phosphate (pH 7.2), GCTCGAGATTTCCCCCAGCAGGCAG. 0.25 M NaCl, and 7% SDS overnight at 42°C. Images were captured with Mutations were introduced into the plasmid P11E3 by using the Downloaded from a PhosphorImager (Molecular Dynamics, Sunnyvale, CA). QuikChange site-directed mutagenesis kit (Stratagene, Cedar Creek, TX), ac- cording to the manufacturer’s instructions. For ease of selection, in each case Real-time quantitative RT-PCR (qPCR) a novel restriction site was introduced. The following oligonucleotides and their complementary sequences were used (alterations are underlined): AP1, The expression of BCL3 and IL-2 relative to a housekeeping gene, ACTB CAAGGCAAACACTTCGAACTCAGCTGCCTGCTG; AP4-1, CAAAC ␤ ( -actin), was measured using an ABI Prism 7700 Sequence Detector (Ap- ACTTCTGCCTCAGAGTCCTGCTGGGGGAAATCCC; AP4-2, GAACT plied Biosystems, Foster City, CA). Primers and probes for BCL3, IL-2, TGACCGCAACCCATAGGCTCTGCCTCCCCCACG; ␬B, CTCAGCTG and ACTB were designed using Primer Express software (Applied Biosys- CCTGCTGTTTTAAATCCCTTCCCGCAG; Ets, GCTGGGGGAAATCCC http://www.jimmunol.org/ tems). BCL3 primers: GAAAACAACAGCCTTAGCATGGT and CTGC GGGCCGCAGAACTTGACC; cAMP response element-1 (CRE-1), GGAGTACATTTGCG; probe, CACGGCGCCAACGTGAACGC. IL-2 CTGCTCTGCCTCCCCACATGTAGCACCCGTCACTCAC; CRE-2a, CT primers: TCACCAGGATGCTCACATTTAAGT and CTGGGTCTTAA CCCCCACGTCAGCGAATTCCACTCACTCGCAGC; CRE-2b, ACGTCA GTGAAAGTTTTTGC; probe, ACATGCCCAAGAAGGCCACAGAA GCACCCGTGCATGCATCGCAGCCTCCCC; Mut4, GGAAATCCCTTC CTG. ACTB primers: TGCCGACAGGATGCAGAAG and GCCGATC CCGACTAGTGTGACCGCAACCCAG; Mut2, CTTCCCGCAGAACTTG CACACGGAGTACT; probe, ATCAAGATCATTGCTCCTCCTGAGCGC. CGGCCGCCCCAGCTGCTCTGC; Mut3, GCAACCCAGCTGCTCGCGG Ј Probes were labeled with FAM at the 5 ends as the reporter dye and TAMRA CCGCCCACGTCAGCACCC. The 2ϫCRE comprises the alterations found Ј at the 3 ends as the quencher dye. in both CRE-1 and CRE-2b. All mutations were confirmed by sequencing. All RNA samples were treated with DNase I, and then 2 ␮g RNA was transcribed into cDNA using Superscript II reverse transcriptase (Invitro- Transient transfection and luciferase analysis

gen), following the manufacturer’s directions. A corresponding PCR on by guest on September 29, 2021 RNA from each sample (non-RT control) was performed to verify the Jurkat cells were transfected by using DMRIE-C reagent (Invitrogen). absence of genomic DNA contamination. DNA (1 ␮g) and DMRIE-C (2 ␮l) were separately diluted in 100 ␮l each. Real-time PCR was conducted with the TaqMan Universal PCR Master The DNA and DMRIE-C samples were then combined in wells of a 24- Mix (Applied Biosystems) using 5 ␮l of cDNA with or without dilution in well plate and incubated at room temperature for 40 min; to this was added 5 a25␮l reaction mixture with a final concentration of 200 nM probe and 5 ϫ 10 cells resuspended in 100 ␮l of complete medium without serum or 400 nM primers. After incubation at 50°C for 2 min, AmpliTaq Gold was antibiotics. After incubation at 37°C and 5% CO2 for 5 h, complete me- activated by incubation at 95°C for 10 min. Forty PCR cycles were per- dium with serum and antibiotics was added to a final volume of 1 ml/well. formed with denaturation at 95°C for 15 s, and combined annealing and After 37 h, transfected Jurkat cells were stimulated with PMA, PHA, iono- extension at 60°C for 1 min. Serial dilutions of cDNA were used to con- mycin, PHA ϩ PMA, or ionomycin ϩ PMA for 6 h. Inhibitors, if used, struct standard curves for the target genes (BCL3 and IL-2) and the en- were added 15 min before stimulation, unless otherwise noted. Cells were dogenous reference gene (ACTB). For each unknown sample, the relative harvested 48 h after transfection and washed in cold PBS before lysis in 50 amount of target cDNAs and reference cDNAs applied to the PCR system ␮l passive lysis buffer (Dual Luciferase Assay Kit; Promega). Luciferase was calculated using linear regression analysis from the corresponding activity was measured with a Luminoskan luminometer, according to the standard curves. Then the normalized expression level of the target gene in manufacturer’s protocol. All transfection experiments were performed in at each sample was calculated by dividing the quantity of the target transcript least three different experiments, with similar results. with the quantity of corresponding reference transcript. The normalized values of the target transcript were used to compare its relative expression Analysis of DNase I hypersensitivity levels in different samples. HT2 cells or Jurkat cells, with or without stimulation with PHA ϩ PMA, Plasmids were washed in PBS, suspended in ice-cold buffer A (10 mM Tris-HCl (pH 7.4), 10 mM NaCl, 3 mM MgCl2, 0.5% Nonidet P-40, 0.15 mM spermine, pGL3 Basic and Control, firefly (Photinus) luciferase reporter vectors are and 0.5 mM spermidine) containing 0.5% Nonidet P-40. After 10 min to from Promega (Madison, WI), as are Renilla luciferase vectors pRL-SV40 allow lysis, the nuclei were pelleted, washed in buffer A, and then resus- ⌬ ϩ ϳ ϫ 6 and pRL-TK (thymidine kinase). IL-2pLuc BK, a luciferase reporter con- pended in buffer A Ca (buffer A containing 1 mM CaCl2)at 8 10 struct under the control of the IL-2 enhancer/promoter, was a gift of E. cells/ml. Aliquots (0.5 ml) were added to 0.1 ml of buffer A ϩ Ca con- Rothenberg (California Institute of Technology, Pasadena, CA). Making taining 0, 1.2, 3.6, 12, 36, or 72 Kunitz units of DNase I (Promega) and use of ␭ bacteriophage clones of the human BCL3 locus, various portions incubated at 37°C for 5 min. After quenching with 12 ␮l of 0.5 M EDTA of the BCL3 promoter region were cloned into the pGL3 Basic plasmid, and 60 ␮l 20% SDS, samples were digested with proteinase K and RNase either directly or indirectly. All promoter fragments described in this work A. DNA was then extracted using phenol-chloroform and ethanol precip- extend to an NcoI site (ending at ϩ212), which overlaps the translation itation. A total of ϳ8 ␮g DNA digested with either HindIII or EcoRV was initiation site. Pr11 extends from an EcoRI site (beginning at Ϫ1700); Pr21 used in each lane of a 0.8% agarose gel. Electrophoresis and Southern from a BglII site (beginning at Ϫ813); and Pr31 from a BstEII site (be- blotting were as previously described. Three HindIII fragments comprising ginning at Ϫ489). Pr41 extends from Ϫ194 and was prepared by PCR the great majority of the mouse BCL3 locus were subcloned into Bluescript using the primer GGACGGTACCAGATCTCAGCAGGGGTGGGGA KSIIϩ (Stratagene) from BAC RPCI-23 33H23. Probes for Southern blot- CAC (BCL3-derived sequences in this and later oligonucleotides are un- ting were isolated from these plasmids: probe A, a 424-bp StuI-SphI frag- derlined and shown 5Ј to 3Ј). TK luciferase constructs were prepared by ment containing exon 2; probe B, an 881-bp Bsu36I fragment from within cloning a 233-bp PvuII-HindIII promoter fragment from pRL-TK into intron 2; and probe C, a 513-bp BstEII-XmnI fragment that includes exon pGL3 Basic. 7. Human probes D and E for Southern blot hybridization are 846- and 4212 NF-␬B REGULATES BCL3

518-bp EcoRV-PstI fragments in the vicinity of the BCL3 exon 1, isolated also RasGRP, a guanine nucleotide exchange factor for Ras pro- from plasmid p␣1.4P (2). teins (8, 9). The most important PKC isoform in TCR signaling is ␪ Extraction of nuclear proteins and EMSA PKC (10), which activates several pathways, including one lead- ing to NF-␬B activation (11). Nuclear proteins were extracted from Jurkat cells, either with or without stim- We used Northern blot hybridization for initial characterization ulation with PHA ϩ PMA for 2.5 h, using NE-PER nuclear and cytoplasmic extraction reagents (Pierce, Rockford, IL), according to the manufacturer’s of the mRNA response (Fig. 1A)ofBCL3. A transcript was not protocol. The concentration of nuclear proteins was determined according to detected in the absence of stimulation, but was readily apparent the manual for the BCA Protein Assay Reagent (Pierce). The wild-type ␬B after2hofstimulation. PMA alone also induced mRNA accumu- ␬ Ј (wt- B) oligonucleotide was designed to yield a 4-nt 5 overhang. After an- lation, whereas calcium ionophore did not. At the 2-h time point, nealing of complementary strands, the resulting double-stranded oligonucleo- tide was labeled with [␣-32P]dCTP by filling in using the Klenow fragment. neither CsA nor the mitogen-activated protein/extracellular signal- Oligonucleotides used as probes and competitors in these studies are: regulated kinase kinase (MEK) inhibitor PD98059 inhibited tran- wt-␬B, CTGCTGGGGGAAATCCCTT and CGGGAAGGGATTTCCC scriptional up-regulation (but see Fig. 1C), whereas bisindolylma- ␬ CCAGCAG; Mut1- B, CTGCTGGGGGAAATAACTT and CGGGAA leimide IX, a PKC inhibitor, reduced message level by 66%, based GTTATTTCCCCCAGCAG; Mut2-␬B, CTGCTGTGTGAAATAACTTC CCG and CGGGAAGTTATTTCACACAGCAG; IGK-␬B, GAGGGG upon normalization with actin mRNA. ACTTTCCGAG and CTCGGAAAGTCCCCTC; the altered nucleotides Based on these initial Northern blot results, we used qPCR to are underlined. compare transcriptional regulation of BCL3 with that of IL-2,a ␬ ␮ For EMSA of NF- B, 15 g of nuclear extract proteins was incubated particularly thoroughly studied gene in T cells; ␤-actin RNA levels in the following binding buffer: 10 mM Tris-HCl (pH 7.5), 50 mM NaCl, ␮ ␮ were used for normalization. At 2 h stimulation, BCL3 mRNA

1 mM EDTA, 5% glycerol, 1 mM DTT, 2 g poly(dI-dC), 2 g BSA, and Downloaded from 2 ϫ 104 dpm double-stranded oligonucleotide probe for 20 min at room showed responses (data not shown) similar to those seen with temperature. The reactions were loaded onto 4% nondenaturing polyacryl- Northern blot analysis. IL-2 mRNA at this time point was too low amide gel and were electrophoresed in 25 mM Tris-HCl, 90 mM glycine, to facilitate comparisons. and 1 mM EDTA for 3.5–4 h at 150 V at 4°C. ϩ EMSA supershifts were conducted by incubating nuclear extract and Upon stimulation with PHA PMA, BCL3’s mRNA increases oligonucleotides for 20 min at room temperature after the incubation of Ab with a much shorter lag than that seen with IL-2 (Fig. 1B); this is with the nuclear extract on ice for 2 h. Control mouse IgG and Ab to consistent with the fact that BCL3, but not IL-2, is an immediate ␬ http://www.jimmunol.org/ NF- B p50 subunit (nuclear localization sequence) were from Santa Cruz early gene in response to mitogenic stimulation. BCL3 mRNA Biotechnology (Santa Cruz, CA). level peaks at 5 h with a 75-fold induction over basal levels. De- Results spite a longer lag in induction, IL-2 message peaks at the same In initially characterizing BCL3 (1), we showed that it is rapidly time point, but with a 2900-fold induction over baseline, reflecting up-regulated in human PBMC in response to the lectin PHA, a T a virtual absence without stimulation. cell mitogen that is thought to act, at least in part, through cross- To facilitate comparison with IL-2, the 5-h time point was used linking and activating the TCR. A particularly important mediator for a more extensive qPCR analysis. Calcium ionophore is not of TCR signaling is phospholipase C␥1, which hydrolyzes phos- required for BCL3 up-regulation, whereas it is required for IL-2 phatidylinositol 4,5-bisphosphate to yield two second messengers, (Fig. 1C). In TCR stimulation, a particularly important role for by guest on September 29, 2021 diacylglycerol (DAG) and inositol trisphosphate; the latter induces calcium is in activation of calcineurin, a protein phosphatase re- release of intracellular calcium stores. The combination of a cal- sponsible for activation and nuclear import of NF-AT, a family of cium ionophore, such as ionomycin, and PMA, a pharmacological transcription factors that regulates numerous genes important in T analog of DAG, can effectively mimic TCR signaling, leading to cell activation and differentiation. CsA can inhibit calcineurin in T proliferation and synthesis of cytokines, such as IL-2. In T cells, cells. Consistent with the apparent lack of requirement for calcium DAG activates not only isoforms of protein kinase C (PKC), but in BCL3 activation, CsA failed to inhibit BCL3 transcription, but

FIGURE 1. Expression of the endogenous BCL3 gene. A, Northern blot analysis. This was performed with 10 ␮g of total RNA from unstimulated Jurkat cells (lane 1) or cells stimulated under various conditions, as shown, for 2 h, except for the samples in lanes 3 and 4. Iono, ionomycin; B IX, bisindoly- maleimide IX. The blot was successively hybridized with probes for BCL3 and for ACTB (␤-actin). Images were captured on a PhosphorImager (Storm; Molecular Dynamics) and analyzed using Molecular Dynamics software. B, qPCR was performed using total RNA samples isolated from Jurkat cells at various times after stimulation. BCL3, IL-2, and ACTB levels were determined; ACTB showed minimal variability and was used to normalize for minor variations in sample quantification and purity. Normalized BCL3 and IL-2 levels are expressed as a percentage of the maximal sample value. C, qPCR to illustrate transcriptional response of BCL3 and IL-2 at the 5-h time point to various stimulus conditions. Iono, ionomycin; BisI and BisIX, bisindolylmaleimide I and IX. The Journal of Immunology 4213 did almost entirely inhibit IL-2 transcription, as expected. In con- HS3, at ϳϩ5 kb; and HS4, at ϳϩ6 kb. In a previous analysis in trast, BCL3 transcription was inhibited by either PD98059, a MEK a human B cell line (H. Ohno and T. McKeithan, unpublished), inhibitor, or bisindolylmaleimide I and bisindolylmaleimide IX, four homologous HSs were similarly identified. Notably, each of PKC inhibitors. For all of the inhibitors, the extent of inhibition the four HSs corresponded to regions highly conserved among the was less than the inhibition of IL-2. Although other possibilities three species analyzed above. No evidence for HSs corresponding exist, this difference may simply be due to the lag in IL-2 tran- to more 5Ј conserved regions was seen under these conditions. scriptional response. Intracellular levels of inhibitors may initially A similar analysis was performed in Jurkat cells with or without be low and insufficient to block early BCL3 transcription, but stimulation for 2 h with PHA ϩ PMA (Fig. 3B). In both stimulated higher at later times when IL-2 transcription normally increases. and unstimulated cells, an HS was found within the second intron This interpretation is consistent with apparent lack of effect of at ϳ5 kb downstream from the beginning of exon 1. Thus, HS3, PD98059 at the 2-h time point by Northern blot and qPCR and the but not HS4, is present in Jurkat cells. A poorly defined smear reduced effectiveness of the PKC inhibitor. These results suggest corresponded to HS2, which includes the 5Ј end of exon 1 and that both the PKC and the Ras-Raf-MEK-extracellular signal-reg- sequences immediately upstream of it. Only in stimulated Jurkat ulated kinase pathways, activated by DAG, are essential for BCL3 cells was HS1 identified. As in the mouse, the predicted positions activation. of the HSs corresponded to highly conserved regions. Initial attempts to show appropriate transcriptional regulation of reporter constructs containing only the BCL3 promoter were un- successful. Consequently, to identify potential distal regulatory el- Initial characterization of luciferase reporter constructs ements, we assessed evolutionary conservation within and sur- Downloaded from Luciferase reporter gene constructs that contain these four HSs rounding the locus. As a complementary approach, we identified were prepared and analyzed in the Jurkat T cell line. For most regions of open chromatin structure by their increased sensitivity experiments, a promoter construct (P11) was used that extends to cleavage by DNase I. from Ϫ1700 to ϩ212 (the translation start site), including HS1 and Using the alignment program Vista (http://www-gsd.lbl.gov/ HS2 and the entire 5Ј untranslated region (UTR), placed immedi- vista) (12), we compared the sequences within and flanking the ately upstream of luciferase coding sequences. A 1.6-kb fragment human, mouse, and rat BCL3 loci. Fig. 2 illustrates sequence com- http://www.jimmunol.org/ parison of 30 kb encompassing the mouse locus to human and rat containing HS3 and HS4 was inserted at a distal site to generate ϩ sequences. The graph shows sequences having greater than 50% P11E3 4. conservation with human sequences. Regions of at least 75% iden- Translation of BCL3 mRNA is regulated through a pathway de- tity over 100 bp are shaded. Due to the more recent separation of pendent upon phosphatidylinositol 3-kinase and mammalian target Ј mouse and rat in evolution, their two loci are much more similar of rapamycin (13, 14). The 5 UTR of BCL3 is highly GC rich to each other than to the human sequences; thus, 90 and 95% are (91%) and may form stable secondary structures that impede ri- used as cutoffs for graphing and shading, respectively. In the bosomal scanning for the initiation codon. Thus, a potential con- mouse to human comparison, all of the exons are conserved, as cern in this analysis is the presence in the constructs of the BCL3 expected, although the small exon 3 failed to meet the shading 5Ј UTR upstream of luciferase, which may therefore impede by guest on September 29, 2021 criterion. Strikingly, however, several regions 5Ј of the gene and mRNA translation. The Jurkat cell line, however, lacks functional two regions within the second intron are also highly conserved. PTEN (15, 16), a phosphoinositide 3-phosphatase, and thus the The regions highly conserved between mouse and rat are remark- phosphatidylinositol 3-kinase pathway is constitutively active. As ably similar to those conserved between mouse and human; how- a result, the BCL3 5Ј UTR should not be expected to interfere with ever, several upstream and intronic regions are more highly con- translation in this cell line. served than many of the exons. The 5Ј untranslated region is more Little or no stimulation of luciferase activity by PHA, PMA, or conserved than the coding regions within exon 1, perhaps relating both together was found upon using the P11 construct. In contrast, to its dual role in promoter activity and in translational regulation. these treatments led to up to 11-fold stimulation with P11E3 ϩ 4. DNase hypersensitivity analysis was performed in the IL-2-de- This argues strongly that the HS3 and HS4 region contains a distal, pendent mouse cell line HT2 and in the human Jurkat cell line. In downstream enhancer. PMA was consistently more effective that HT2 cells, four DNase hypersensitive sites (HSs) were defined PHA, in marked contrast to the IL-2 response, in which PMA alone (Fig. 3A): HS1, at ϳϪ1.5 kb; HS2, corresponding to the promoter; showed little stimulation (Fig. 4A).

FIGURE 2. Sequence conservation. The Web-based alignment program Vista (http://www-gsd.lbl.gov/vista) was used to determine the sequence con- servation of 30 kb of mouse sequences, beginning Ϫ10 kb upstream of the first exon, to human and rat sequences. These sequences were obtained from the National Center for Biotechnology Information database. Numbering corresponds to the second of three identified transcription start sites (36), and the homologous ϩ1 position is used throughout for human sequences. In the upper half of each graph is shown the percentage of identity between mouse and human with a 50% cutoff. Regions of Ն100 bp with Ն75% identity are shaded in gray if within exons (darker for coding regions) and otherwise in black. Sequences of 50–75% identity are left unshaded. The positions of exons are shown above each graph. Similarly, the percentage of identity of rat to mouse is shown in the lower half of each graph, but with a 90% cutoff and a criterion of 95% for shading. 4214 NF-␬B REGULATES BCL3 Downloaded from http://www.jimmunol.org/

FIGURE 4. Initial analysis of luciferase reporter constructs. Relative light units of firefly luciferase activity are shown, after normalization for Renilla luciferase activity on the basis of average activity within each treat- ment group. A, Stimulation by PHA and PMA. Luciferase activity without stimulation, with PHA, with PMA, or with both. No stimulation is seen

with the vector control (pGL3 Basic) or with the P11 promoter alone, but by guest on September 29, 2021 both PHA and PMA stimulate P11E3 ϩ 4, which contains the putative FIGURE 3. DNase hypersensitivity in mouse and human T cells. A, enhancer region. In contrast, the IL-2 promoter/enhancer construct shows Nuclei were isolated from the IL-2-dependent murine T cell line HT2 and little response to PMA alone. B, Stimulation by PMA and ionomycin subjected to digestion with varying quantities of DNase I. DNA was ex- (Iono). No stimulation is seen with the vector control (pGL3 Basic) or with tracted, digested with HindIII, and used for Southern blotting, with suc- the P11 promoter alone, but PMA or PMA ϩ ionomycin stimulates P11E3 cessive hybridizations with probes A, B, and C. The map of the murine ϩ 4. Ionomycin alone has no effect. In contrast, the IL-2 promoter/en- BCL3 locus is shown below, indicating exon positions, the location of the hancer construct requires both PMA and ionomycin. The lower two groups three probes used, and HindIII sites. Lanes from left to right were prepared demonstrate that the E3 ϩ 4 enhancer is active with an exogenous pro- with DNA isolated with nuclei digested with increasing quantities of moter, from herpes simplex TK. Note that a separate scale for luciferase DNase I. The positions of size markers in kb are shown at the left. In each activity is used, reflecting an at least 10-fold greater activity of this pro- hybridization, the largest band corresponds to the intact HindIII fragment, moter than that of the BCL3 promoter. C, Comparison of the enhancer and additional smaller bands seen with probes A and B indicate HSs. B, activity of the HS3 and HS4 regions in the context of the TK promoter. The Similarly, Southern blots were prepared from EcoRV-digested DNA iso- constructs contained HS3 (TKE3), HS4 (TKE4), both (TKE34), or both lated from DNase I-treated nuclei isolated from Jurkat cells or from cells with the intervening sequences (TKE3 ϩ 4). Only HS3 is required for full stimulated for 2 h with PHA ϩ PMA. Two blots were hybridized to probes enhancer activity. D, Effect of CsA. Whereas neither the vector control nor D and E, whose location within the human BCL3 locus are indicated P11 responds to PHA ϩ PMA, both the P11E3 ϩ 4 construct and the IL-2 below. control are stimulated. Only the activity of the IL-2 construct, however, is inhibited by CsA. E, Analysis of 5Ј promoter deletions. Four constructs are compared, having promoters successively shorter at the 5Ј end. All pro- To determine whether the promoter/enhancer luciferase con- moters are active and respond to the enhancer, including the shortest, P41. struct responds to stimuli and inhibitors similarly to the endoge- Note that the HS1 region does not contribute to luciferase activity. nous gene, we treated transfected Jurkat cells with conditions cor- responding to those in Fig. 1. As with the endogenous gene, calcium ionophore had no effect on BCL3 up-regulation, in con- greater basal activity than that seen with the BCL3 promoter, but trast to a IL-2 reporter construct, in which both PMA and iono- showed minimal stimulation with PMA ϩ PHA. In contrast, the mycin were required for optimal activation (Fig. 4B). The results TK construct containing E3 ϩ 4 was markedly stimulated. As with were compatible with the possibility that BCL3 promoter se- P11E3 ϩ 4, only PMA was required for activation. These results quences provide at least part of the specificity responsible for up- suggest that the intronic enhancer is largely responsible for the regulation by PMA ϩ ionomycin. We prepared additional con- response to TCR-mimetic stimuli. structs using an exogenous promoter from herpes simplex TK with CsA, which blocks calcium-dependent calcineurin signaling, or without the BCL3 HS3 and HS4 region (E3 ϩ 4). The TK was used to further assess whether a calcium signal is required for promoter construct lacking an enhancer showed a considerably BCL3 activation. Whereas it inhibited IL-2 reporter activity, it did not The Journal of Immunology 4215 block luciferase activity from the BCL3 reporter P11E3 ϩ 4 (Fig. 4C), number of candidate sites in the HS3 region were found that are corresponding to what was found with the endogenous gene. conserved between mouse and human (Fig. 5, lower panel). These Additional constructs were prepared to assess the relative im- include possible sites for AP1, NF-␬B, Ets, CREB/ATF, and portance of the HS3 and HS4 regions, in the context of both P11 STATs, as well as two potential sites for AP4. In the human, but and TK promoters. Equivalent results were found with the two not the mouse, a second slightly more divergent potential CREB/ promoters, but only the latter is shown in Fig. 4D. Luciferase ac- ATF site (CRE) is found immediately 3Ј of the first site. tivity of a construct containing HS4 (TKE4) was not consistently A large number of deletions and site-directed mutations were different from the TK promoter alone, whereas constructs containing prepared within HS3 (Fig. 5). Deletions from the 5Ј end, up to the HS3 (TKE3) or HS3 and HS4 without the sequences between them ␬B site, did not decrease enhancer activity; rather, they increased (TKE34) were similar to TKE3 ϩ 4 (Fig. 4A). These results demon- it, suggesting that a negative regulatory element may be present. strated that HS3 is responsible for enhancer activity in Jurkat cells in Deletions that extend into the ␬B greatly reduce enhancer activity. response to PHA ϩ PMA. The absence of an effect from HS4 is Deletions from the 3Ј end do not decrease activity unless they consistent with the absence of an HS at this site in Jurkat cells. impinge upon the two potential CRE sites. A region as small as 81 Given the apparent dominant role of the enhancer in transcrip- bp suffices for full enhancer activity. tional activation, only limited analysis of the promoter was per- Site-directed mutagenesis (Fig. 5B) within the full-length HS3 pro- formed in this study. The DNase hypersensitivity at HS1 in stim- vides results consistent with these deletions. Corresponding mutations ulated Jurkat cells suggested that this region might be involved in were also made in the minimal 81-bp region (results not shown). No activation. Thus, we compared a small series of constructs with 5Ј obvious effects are seen for two mutations at sites outside the minimal deletions of the promoter region, all extending to the translation region, whereas a mutation within the ␬B site virtually eliminates Downloaded from initiation codon. P41E3 ϩ 4, the shortest construct (Ϫ195/ϩ212), enhancer activity (Fig. 5B). Notably, the effect on activity is actually is truncated at the immediate 5Ј end of the CpG island that over- greater than the deletion extending partially into the site, which, how- laps the promoter and first exon. All showed full activity despite ever, may not entirely abolish binding by NF-␬B (see below, Fig. 6). the fact that only the longest, P11E3 ϩ 4, contains the HS1 region Mutation of the 5Ј, evolutionarily conserved putative CRE site caused (Fig. 4E). These results imply that HS1 is not required for tran- a smaller, but still marked reduction in enhancer activity, which was scriptional up-regulation of BCL3 under these conditions. further increased by additional mutation of the second putative CRE http://www.jimmunol.org/ site. Equal or greater effects of these mutations were seen in the con- Enhancer analysis text of the minimal promoter (results not shown). Mutations in a num- Using a web-based program (17, 18) to identify potential transcrip- ber of other locations yielded small decreases in enhancer activity, but tion factor binding sites (MatInspector; http://genomatix.de), a with variability among experiments. by guest on September 29, 2021

FIGURE 5. Analysis of enhancer deletions and mutations. A, The luciferase activities derived from 15 constructs containing the P11 promoter and deletions within the HS3 enhancer were compared. The 5Ј deletions are denoted a through d, and 3Ј deletions 1 through 10. The end points of the deletions are shown to scale in relation to the putative transcription factor binding sites; they are also shown more precisely in C. The results are grouped into a series of 5Ј deletions, a series of 3Ј deletions, and a second set of 3Ј deletions containing the optimal 5Ј deletion. B, Analysis of point mutations. The bars show the results of a typical experiment testing luciferase activity of mutants of P11E3. The position of the mutations is shown to scale below, in relation to putative transcription factor binding sites. C, The sequence of the HS3 region is shown, with potential sites for transcription factor binding in boxes. All sites shown are completely conserved between mouse and human with the exception of CRE-2. The end points of 5Ј and 3Ј deletions described in A are also illustrated. 4216 NF-␬B REGULATES BCL3

FIGURE 7. Effects of manipulating NF-␬B activity on luciferase activ- ity. A, Pr11E3 ϩ 4 was cotransfected with 0, 50, 100, 200, or 500 ng of a construct expressing I␬B␣-SR. Luciferase activity is shown. B, Pr11, Pr11E3, or Pr11E3⌬␬B was cotransfected with 0, 50, or 100 ng each of MT2T-p50 and MT2T-p65, which express the p50 and p65 subunits of NF-␬B. Luciferase activity is shown in the same scale as in A. Downloaded from

typically the most abundant forms of NF-␬B. Thus, we also per- formed EMSA in the presence of an Ab to p50. As expected, this led

to supershifted complexes, which were not seen with control Ab. http://www.jimmunol.org/ FIGURE 6. Analysis of NF-␬B activity of nuclear extracts from Jurkat We sought to determine whether luciferase expression driven by cells with or without stimulation. Lanes 2–6 and 12 were loaded with the BCL3 enhancer is affected by cotransfection of constructs that nuclear extract from unstimulated cells; lanes 7–11, 13, and 14, from stim- either enhance or inhibit NF-␬B activity. We cotransfected the ulated cells. No extract was included in lane 1. Note from lanes 2 and 7 the P11E3 ϩ 4 reporter with an expression construct (20) for a form ␬ marked induction of NF- B binding (large filled arrowhead). In lanes 3–6 of I␬B␣ with mutations in the two N-terminal serine residues and 8–11, unlabeled double-stranded oligonucleotides were also included whose phosphorylation is required for stimulation-induced degra- at 100-fold excess: lanes 3 and 8, wt-␬B; 4 and 9, mut1 (2 bp changed from dation. Cotransfection with this superrepressor (SR) led to a dose- wt-␬B); 5 and 10, mut2 (4 bp changed from wt-␬B); 6 and 11, IGK (pro- totypical ␬B site from the intronic enhancer of the Ig ␬ L chain locus). dependent decrease in both basal and stimulated levels of lucif- by guest on September 29, 2021 wt-␬B and IGK effectively compete for the NF-␬B band. A second band erase activity (Fig. 7A). Conversely, cotransfection with increasing (small filled arrowhead) presumably results from binding of a separate NF quantities of expression constructs for the p50 and the p65 (RelA) whose recognition sequence is absent in the IGK oligonucleotide. mut1 subunits of NF-␬B led to a dose-dependent increase in both basal and, more so, mut2 oligonucleotides are poor competitors for binding. In and stimulated levels of luciferase (Fig. 7B). Unexpectedly, an lanes 12 and 13, an Ab to the p50 subunit of NF-␬B was preincubated with increase in basal activity was also seen with the constructs con- nuclear extracts. Supershifted bands (open arrowheads) are found in both taining the BCL3 promoter alone or with an enhancer mutated in stimulated and unstimulated samples. No supershift is seen with a control its ␬B site; these values were not consistently further increased by rabbit antiserum (lane 14). stimulation with PHA ϩ PMA. These results are discussed further below.

The putative ␬B site (GGGAAATCCC) within the enhancer is Discussion an exact match for the ␬B consensus (GGGRNNYYCC, in which Our analysis of sequence conservation among human, mouse, and R ϭ A, G, and Y ϭ C, T), and is predicted to be a high affinity site rat revealed several highly conserved regions within the second (19) that binds NF-␬B p50 homodimers or p50-p65 heterodimers intron and upstream of the gene. In addition to the promoter, three with higher affinity than the prototypical IGK ␬B site. We per- of these conserved regions correspond to HSs in a mouse T cell formed EMSAs using oligonucleotides from this site to determine line and are therefore good candidates for regulatory regions. One whether it can in fact bind NF-␬B. Shifted complexes are seen of these, HS3, was also constitutively hypersensitive in the human using nuclear extracts from stimulated and, to a much lesser extent, T cell line Jurkat, whereas HS1 was seen only in stimulated Jurkat from unstimulated cells. The complexes can be effectively com- cells. Analysis of luciferase reporter constructs in Jurkat cells led peted with the identical (wt) oligonucleotide at 100-fold excess or to the identification of HS3 as a potent distal, downstream en- with the prototypical ␬B site from the intronic enhancer of the Ig hancer, responsible for the stimulatory effect of TCR-mimetic sig- L chain ␬ locus. In contrast, much less competition was provided nals. The enhancer functions not only with the BCL3 promoter, but by a mutant oligonucleotide (mut1) corresponding to the intro- also with the heterologous TK promoter. duced site-directed mutation. The residual competition implies that Analysis of deletions narrowed the core enhancer activity to the mutant oligonucleotides retain a weak affinity for NF-␬B. It is ϳ81 bp, extending from a 5Ј ␬B site to two putative 3Ј CRE sites. notable that 5Ј deletion e (see E3e2, Fig. 5) leads to a residual site Mutation of individual sites within HS3 identified one of these changed to a similar extent as in mut1. This may be responsible for putative CRE sites, which is evolutionarily conserved, as impor- the small remaining enhancer activity seen with this deletion. A tant in enhancer activity. The most dramatic of the site-directed second oligonucleotide (mut2) with additional alterations within mutations was elimination of the ␬B site, which virtually abolished the site showed almost no competition. In T cells, as in most other enhancer activity. Cotransfection of the reporter construct contain- cell types, homo- and heterodimers that include the p50 subunit are ing the enhancer with an I␬B␣-SR expression construct led to a The Journal of Immunology 4217

marked, dose-dependent decrease in transcription, whereas co- Another member of the I␬B family, I␬B␣, is also positively transfection with expression constructs for the p50 and p65 sub- regulated by NF-␬B, in this case through ␬B sites in the promoter units of NF-␬B considerably increased expression. These results (29). Its activation is part of a negative autoregulatory loop, are consistent with an essential role for the ␬B site in enhancer whereby NF-␬B activation leads to increased synthesis of an function. Surprisingly, cotransfection with expression constructs NF-␬B inhibitor. Such autoinhibitory loops are common, espe- for the p50 and p65 subunits of NF-␬B also increased expression cially in the case of transcription factors that are tightly regulated of a BCL3 promoter construct either lacking an enhancer or con- (30). NFKB1, NFKB2, and RELB, which encode three of the five taining the HS3 enhancer mutated at the ␬B site. These results NF-␬B subunits, are also regulated in part through NF-␬B itself suggest that the promoter itself, which contains two evolutionarily (31–34). Because the p105 and p100 proteins synthesized from the conserved putative ␬B sites, can respond to NF-␬B, at least under NFKB1 and NFKB2 genes can heterodimerize with other NF-␬B experimental conditions. Up-regulation of BCL3 in hepatocytes in subunits and sequester them in the cytoplasm, their transcriptional response to TNF-␣ has been ascribed to one of these sites (21); regulation by NF-␬B can also be considered a negative autoregu- however, it should be noted that the study did not assess the po- latory circuit. In contrast, the RELB NF-␬B subunit is a transcrip- tential contribution by distal enhancers. tional activator of a subset of ␬B-regulated genes that, when in a Among its other effects, TCR activation, through a very com- heterodimer with NFKB2 p52, is resistant to inhibition by I␬B␣ ␬ plex series of steps, leads to membrane recruitment and activation (35). Thus, transient activation of the classic NF- B p50-p65 het- ␬ of phospholipase C␥1, which hydrolyzes phosphatidylinositol 4,5- erodimer can lead to sustained NF- B activity through induction ␬ bisphosphate to yield two second messengers, DAG and inositol of the RELB subunit. NF- B-induced synthesis of BCL3 protein,

␬ Downloaded from trisphosphate. The latter induces release of cytoplasmic calcium which has an antiapoptotic role, as does classic NF- B, shows stores, whereas DAG activates at least two pathways. DAG bind- similarities to induction of RELB, and in fact the two genes are ing to RasGRP leads to activation of Ras and its downstream sig- induced in many of the same contexts. naling cascade, whereas its binding to PKC activates several other Work in the Marrack laboratory has identified BCL3 as the best pathways, including one leading to NF-␬B activation. In T cells, known marker, at the mRNA level, for the adjuvant-dependent the most important PKC isoform in TCR signaling is the calcium- survival signal to T cells (6). Thus, understanding its transcrip- independent novel isoform PKC␪ (10). Treatment with ionomycin, tional regulation in T cells can potentially aid in dissecting these http://www.jimmunol.org/ signals, which to date poorly are understood. BCL3 is markedly a calcium ionophore, and with PMA, a DAG analog, can mimic up-regulated by superantigen stimulation (7), but its mRNA level many aspects of TCR signaling, including stimulation of IL-2 syn- then declines below basal levels in the absence of adjuvant, thesis, which requires both second messengers. whereas it remains highly elevated when adjuvants are present. It is intriguing that, in contrast to IL-2 and several other genes, The work presented in this study analyzes the first, Ag-dependent a calcium signal is not required for transcriptional activation of phase of this biphasic response. Considerable evidence supports BCL3, which promotes active immunity. Conditions inducing a the notion that T cell proliferation, survival, and differentiation are more prominent calcium signal than DAG-dependent signals tend ␪ ␬ actually programmed at the time of initial Ag engagement both in to promote T cell anergy (22). PKC is required for NF- B acti- by guest on September 29, 2021 vitro and in vivo. It remains to be determined whether the later vation by the TCR (11). The current results imply that NF-␬B phase of BCL3 expression is dependent upon a previous Ag-de- binding to the HS3 enhancer element partially mediates the TCR pendent activation, whether autocrine or paracrine signals are re- stimulation of BCL3 transcription. TCR activation is also known to quired for the later phase, and whether it also is dependent upon result in phosphorylation of members of the CREB/ATF family the HS3 enhancer. through successive activation of RasGRP, Ras, Raf, MEK, extra- cellular signal-regulated kinase 1 or 2, and Rsk2 (23, 24). The presence of two potential CRE sites at the 3Ј end of the minimal Acknowledgments enhancer raises the possibility that phosphorylation of CREB/ATF We thank Xiaoyan Feng for excellent technical assistance; the University transcription factors bound to these sites may play an important of Nebraska Medical Center Eppley Molecular Biology Core Laboratory role in enhancer function. Notably, some members of this family for oligonucleotide synthesis and DNA sequencing; and Drs. Gail Bishop, Ellen Rothenberg, and Ulrich Siebenlist for the I␬B␣-SR, IL-2pLuc⌬BK, of transcription factors can bind to NF-␬B proteins (25), and and MT2T-p50 and -p65 expression constructs, respectively. NF-␬B p65 and phosphorylated CREB/ATF can interact with the important, closely related coactivators p300 and CBP through in- dependent sites (26). Further analysis will be required to determine References 1. Ohno, H., G. Takimoto, and T. W. McKeithan. 1990. The candidate proto-on- whether synergistic recruitment of coactivators by these transcrip- cogene bcl-3 is related to genes implicated in cell lineage determination and cell tion factors plays an essential role in the function of the BCL3 HS3 cycle control. Cell 60:991. enhancer, and to determine the mechanism by which the intronic 2. McKeithan, T. W., H. Ohno, and M. O. Diaz. 1990. Identification of a transcrip- tional unit adjacent to the breakpoint in the 14;19 translocation of chronic lym- enhancer activates the promoter. Additional experiments in cell phocytic leukemia. Genes Chromosomes Cancer 1:247. lines and in normal T cells will also be required to confirm the 3. Schwarz, E. M., P. Krimpenfort, A. Berns, and I. M. Verma. 1997. Immunolog- roles of the cis elements that we have identified in BCL3 regulation ical defects in mice with a targeted disruption in Bcl-3. Genes Dev. 11:187. 4. Franzoso, G., L. Carlson, T. Scharton-Kersten, E. W. Shores, S. Epstein, after physiological activation of the TCR and costimulatory A. Grinberg, T. Tran, E. Shacter, A. Leonardi, M. Anver, et al. 1997. Critical molecules. roles for the Bcl-3 oncoprotein in T cell-mediated immunity, splenic microarchi- In other cell types, a variety of stimuli that function, at least in tecture, and germinal center reactions. Immunity 6:479. 5. Poljak, L., L. Carlson, K. Cunningham, M. H. Kosco-Vilbois, and U. Siebenlist. part, through NF-␬B also increases transcription of BCL3. Thus, 1999. Distinct activities of p52/NF-␬B required for proper secondary lymphoid LPS up-regulates it in B cells (27), TNF-␣ in hepatocytes (21), and organ microarchitecture: functions enhanced by Bcl-3. J. Immunol. 163:6581. IL-1 in chondrocytes and synovial cells (28). Further evidence will 6. Mitchell, T. C., D. Hildeman, R. M. Kedl, T. K. Teague, B. C. Schaefer, J. White, Y. Zhu, J. Kappler, and P. Marrack. 2001. Immunological adjuvants promote be required to determine whether these stimuli act through the ␬B activated T cell survival via induction of Bcl-3. Nat. Immun. 2:397. site in HS3. In fact, as noted above, there is evidence that TNF-␣ 7. Teague, T. K., D. Hildeman, R. M. Kedl, T. Mitchell, W. Rees, B. C. Schaefer, J. Bender, J. Kappler, and P. Marrack. 1999. Activation changes the spectrum but up-regulates BCL3 in hepatocytes through a conserved, atypical not the diversity of genes expressed by T cells. Proc. Natl. Acad. Sci. USA ␬B site present in the promoter. 96:12691. 4218 NF-␬B REGULATES BCL3

8. Dower, N. A., S. L. Stang, D. A. Bottorff, J. O. Ebinu, P. Dickie, 23. Muthusamy, N., and J. M. Leiden. 1998. A protein kinase C-, Ras-, and RSK2- H. L. Ostergaard, and J. C. Stone. 2000. RasGRP is essential for mouse thymo- dependent signal transduction pathway activates the cAMP-responsive element- cyte differentiation and TCR signaling. Nat. Immun. 1:317. binding protein transcription factor following T cell receptor engagement. J. Biol. 9. Ebinu, J. O., S. L. Stang, C. Teixeira, D. A. Bottorff, J. Hooton, P. M. Blumberg, Chem. 273:22841. M. Barry, R. C. Bleakley, H. L. Ostergaard, and J. C. Stone. 2000. RasGRP links 24. Xing, J., D. D. Ginty, and M. E. Greenberg. 1996. Coupling of the RAS-MAPK T-cell receptor signaling to Ras. Blood 95:3199. pathway to gene activation by RSK2, a growth factor-regulated CREB kinase. 10. Isakov, N., and A. Altman. 2002. Protein kinase C␪ in T cell activation. Annu. Science 273:959. Rev. Immunol. 20:761. 25. Du, W., D. Thanos, and T. Maniatis. 1993. Mechanisms of transcriptional syn- 11. Sun, Z., C. W. Arendt, W. Ellmeier, E. M. Schaeffer, M. J. Sunshine, L. Gandhi, ergism between distinct virus-inducible enhancer elements. Cell 74:887. J. Annes, D. Petrzilka, A. Kupfer, P. L. Schwartzberg, and D. R. Littman. 2000. PKC-␪ is required for TCR-induced NF-␬B activation in mature but not immature 26. Goodman, R. H., and S. Smolik. 2000. CBP/p300 in cell growth, transformation, T lymphocytes. Nature 404:402. and development. Genes Dev. 14:1553. 12. Mayor, C., M. Brudno, J. R. Schwartz, A. Poliakov, E. M. Rubin, K. A. Frazer, 27. Bhatia, K., K. Huppi, T. McKeithan, D. Siwarski, J. F. Mushinski, and L. S. Pachter, and I. Dubchak. 2000. VISTA: visualizing global DNA sequence I. Magrath. 1991. Mouse bcl-3: cDNA structure, mapping and stage-dependent alignments of arbitrary length. Bioinformatics 16:1046. expression in B lymphocytes. Oncogene 6:1569. 13. Kraiss, L. W., A. S. Weyrich, N. M. Alto, D. A. Dixon, T. M. Ennis, V. Modur, 28. Elliott, S. F., C. I. Coon, E. Hays, T. A. Stadheim, and M. P. Vincenti. 2002. T. M. McIntyre, S. M. Prescott, and G. A. Zimmerman. 2000. Fluid flow activates Bcl-3 is an interleukin-1-responsive gene in chondrocytes and synovial fibro- a regulator of translation, p70/p85 S6 kinase, in human endothelial cells. blasts that activates transcription of the matrix metalloproteinase 1 gene. Arthritis Am. J. Physiol. Heart Circ. Physiol. 278:H1537. Rheum. 46:3230. 14. Weyrich, A. S., D. A. Dixon, R. Pabla, M. R. Elstad, T. M. McIntyre, 29. Ito, C. Y., A. G. Kazantsev, and A. S. Baldwin, Jr. 1994. Three NF-␬B sites in S. M. Prescott, and G. A. Zimmerman. 1998. Signal-dependent translation of a the I␬B␣ promoter are required for induction of gene expression by TNF␣. Nu- regulatory protein, Bcl-3, in activated human platelets. Proc. Natl. Acad. Sci. cleic Acids Res. 22:3787. USA 95:5556. 15. Shan, X., M. J. Czar, S. C. Bunnell, P. Liu, Y. Liu, P. L. Schwartzberg, and 30. Becskei, A., and L. Serrano. 2000. Engineering stability in gene networks by R. L. Wange. 2000. Deficiency of PTEN in Jurkat T cells causes constitutive autoregulation. Nature 405:590. localization of Itk to the plasma membrane and hyperresponsiveness to CD3 31. Bren, G. D., N. J. Solan, H. Miyoshi, K. N. Pennington, L. J. Pobst, and Downloaded from stimulation. Mol. Cell. Biol. 20:6945. C. V. Paya. 2001. Transcription of the RelB gene is regulated by NF-␬B. On- 16. Xu, Z., D. Stokoe, L. P. Kane, and A. Weiss. 2002. The inducible expression of cogene 20:7722. the tumor suppressor gene PTEN promotes apoptosis and decreases cell size by 32. Cogswell, P. C., R. I. Scheinman, and A. S. Baldwin, Jr. 1993. Promoter of the inhibiting the PI3K/Akt pathway in Jurkat T cells. Cell Growth Differ. 13:285. human NF-␬B p50/p105 gene: regulation by NF-␬B subunits and by c-REL. 17. Werner, T. 2000. Computer-assisted analysis of transcription control regions: J. Immunol. 150:2794. Matinspector and other programs. Methods Mol. Biol. 132:337. 33. Ten, R. M., C. V. Paya, N. Israel, O. Le Bail, M. G. Mattei, J. L. Virelizier, 18. Quandt, K., K. Frech, H. Karas, E. Wingender, and T. Werner. 1995. MatInd and P. Kourilsky, and A. Israel. 1992. The characterization of the promoter of the

MatInspector: new fast and versatile tools for detection of consensus matches in gene encoding the p50 subunit of NF-␬B indicates that it participates in its own http://www.jimmunol.org/ nucleotide sequence data. Nucleic Acids Res. 23:4878. regulation. EMBO J. 11:195. 19. Udalova, I. A., R. Mott, D. Field, and D. Kwiatkowski. 2002. Quantitative pre- 34. Liptay, S., R. M. Schmid, E. G. Nabel, and G. J. Nabel. 1994. Transcriptional diction of NF-␬B DNA-protein interactions. Proc. Natl. Acad. Sci. USA 99:8167. regulation of NF-␬B2: evidence for ␬B-mediated positive and negative autoreg- 20. Hsing, Y., and G. A. Bishop. 1999. Requirement for nuclear factor-␬B activation ulation. Mol. Cell. Biol. 14:7695. by a distinct subset of CD40-mediated effector functions in B lymphocytes. J. Im- munol. 162:2804. 35. Dobrzanski, P., R. P. Ryseck, and R. Bravo. 1994. Differential interactions of 21. Brasier, A. R., M. Lu, T. Hai, Y. Lu, and I. Boldogh. 2001. NF-␬B-inducible Rel-NF-␬B complexes with I␬B␣ determine pools of constitutive and inducible BCL-3 expression is an autoregulatory loop controlling nuclear p50/NF-␬B1 res- NF-␬B activity. EMBO J. 13:4608. idence. J. Biol. Chem. 276:32080. 36. Rebollo, A., L. Dumoutier, J. C. Renauld, A. Zaballos, V. Ayllon, and 22. Macian, F., F. Garcia-Cozar, S. H. Im, H. F. Horton, M. C. Byrne, and A. Rao. A. C. Martinez. 2000. Bcl-3 expression promotes cell survival following inter- 2002. Transcriptional mechanisms underlying lymphocyte tolerance. Cell leukin-4 deprivation and is controlled by AP1 and AP1-like transcription factors.

109:719. Mol. Cell. Biol. 20:3407. by guest on September 29, 2021