DOCSLIB.ORG

Restriction of SARS-Cov-2 Replication by Targeting Programmed −1 Ribosomal Frameshifting

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Restriction of SARS-Cov-2 Replication by Targeting Programmed −1 Ribosomal Frameshifting Restriction of SARS-CoV-2 replication by targeting programmed −1 ribosomal frameshifting Yu Suna, Laura Abriolab, Rachel O. Niedererc, Savannah F. Pedersend, Mia M. Alfajaroe,f, Valter Silva Monteirof, Craig B. Wilene,f, Ya-Chi Hod, Wendy V. Gilbertc, Yulia V. Surovtsevab, Brett D. Lindenbachd,1, and Junjie U. Guoa,1 aDepartment of Neuroscience, Yale University School of Medicine, New Haven, CT 06520; bYale Center for Molecular Discovery, Yale University, West Haven, CT 06516; cDepartment of Molecular Biophysics and Biochemistry, Yale University School of Medicine, New Haven, CT 06520; dDepartment of Microbial Pathogenesis, Yale University School of Medicine, New Haven, CT 06520; eDepartment of Laboratory Medicine, Yale University School of Medicine, New Haven, CT 06520; and fDepartment of Immunobiology, Yale University School of Medicine, New Haven, CT 06520 Edited by Lynne E. Maquat, University of Rochester School of Medicine and Dentistry, Rochester, NY, and approved May 21, 2021 (received for review November 12, 2020) Translation of open reading frame 1b (ORF1b) in severe acute viral FSEs are attractive RNA targets for specific interference respiratory syndrome coronavirus 2 (SARS-CoV-2) requires a pro- with viral gene expression (11, 12). Indeed, mutations and drugs grammed −1 ribosomal frameshift (−1 PRF) promoted by an RNA that alter the efficiency of −1 PRF in HIV-1, which regulates pseudoknot. The extent to which SARS-CoV-2 replication may be Gag-Pol translation, have been shown to impede HIV-1 repli- sensitive to changes in −1 PRF efficiency is currently unknown. cation (11, 13, 14). In addition, an interferon-induced host pro- Through an unbiased, reporter-based high-throughput compound tein, Shiftless (SHFL), has been shown to interact with HIV-1 screen, we identified merafloxacin, a fluoroquinolone antibacterial, FSE, inhibit −1 PRF, and restrict HIV-1 replication (15), sug- as a −1 PRF inhibitor for SARS-CoV-2. Frameshift inhibition by mera- gesting that frameshift inhibition has become part of the host floxacin is robust to mutations within the pseudoknot region and is antiviral response. Several compounds have recently been shown similarly effective on −1 PRF of other betacoronaviruses. Consistent to modulate −1 PRF of SARS-CoV-2 to varying degrees with the essential role of −1 PRF in viral gene expression, meraflox- (16–18), although the specificity of these compounds and their acin impedes SARS-CoV-2 replication in Vero E6 cells, thereby provid- antiviral activity remain unclear. ing proof-of-principle for targeting −1PRFasaplausibleand Here, we show that merafloxacin, a fluoroquinolone com- effective antiviral strategy for SARS-CoV-2 and other coronaviruses. pound, specifically and robustly inhibits −1 PRF in betacor- BIOCHEMISTRY onaviruses including SARS-CoV-2. Inhibition of −1 PRF by translation | ribosomal frameshifting | RNA pseudoknot | coronavirus | merafloxacin impeded SARS-CoV-2 replication in Vero E6 cells, merafloxacin indicating that targeting −1 PRF represents a plausible antiviral strategy for SARS-CoV-2 and potentially other coronaviruses. evere acute respiratory syndrome coronavirus 2 (SARS-CoV- Results S2), the etiological agent of COVID-19, belongs to a family of zoonotic human coronaviruses. Upon the entry of SARS-CoV-2 A High-Throughput Screen Identifies −1 PRF Modulators for − into host cells, the first set of viral proteins are translated from SARS-CoV-2. To quantify 1 PRF efficiency in uninfected cells, B the long (>21-kb) open reading frame ORF1ab, which takes up we constructed a plasmid-based frameshifting reporter (Fig. 1 ), approximately two-thirds of the viral genome (Fig. 1A) (1, 2). replacing the stop codon of a firefly luciferase (FLuc) coding The ORF1ab-encoded polyprotein is subsequently processed into 16 individual nonstructural proteins (nsp) by two proteases, Significance PLpro/nsp3 and 3CLpro/nsp5. The 3′ half of ORF1ab, ORF1b, encodes a variety of enzymes critical for viral transcription and A large variety of RNA viruses, including the novel coronavirus replication, including an RNA-dependent RNA polymerase SARS-CoV-2, contain specific RNA structures that promote (RdRp/nsp12), an RNA helicase (Hel/nsp13), a proofreading programmed ribosomal frameshifting (PRF) to regulate viral exoribonuclease and N7-guanosine methyltransferase (ExoN/ gene expression. From a high-throughput compound screen, nsp14), an endonuclease (NendoU/nsp15), and a 2′-O-methyl- we identified a PRF inhibitor for SARS-CoV-2 and found that it transferase (nsp16). In all coronaviruses, translation of ORF1b substantially impeded viral replication in cultured cells. Inter- requires a programmed −1 ribosomal frameshift (−1 PRF) (3). estingly, the compound could target not only SARS-CoV-2 but When ribosomes arrive at the end of ORF1a, instead of con- also other coronaviruses that use similar RNA structures to tinuing elongation and soon terminating at an adjacent in-frame promote frameshifting. These results suggest targeting PRF is a stop codon, a subset of ribosomes backtrack by one nucleotide plausible, effective, and broad-spectrum antiviral strategy for and are repositioned in the −1 reading frame before continuing SARS-CoV-2 and other coronaviruses. the translation elongation cycle, thereby producing a full-length ORF1ab polyprotein. A −1 PRF region often contains two main Author contributions: Y.S., Y.V.S., B.D.L., and J.U.G. designed research; Y.S., L.A., R.O.N., components: a heptanucleotide slippery sequence (UUUAAAC S.F.P., M.M.A., and V.S.M. performed research; Y.S., L.A., R.O.N., S.F.P., M.M.A., V.S.M., in SARS-CoV-2) and a downstream stable secondary structure C.B.W., Y.-C.H., W.V.G., Y.V.S., B.D.L., and J.U.G. analyzed data; and B.D.L. and J.U.G. wrote the paper. acting as a frameshift-stimulatory element (FSE). The FSE Competing interest statement: Yale University has filed a provisional patent application secondary structures, most commonly being RNA pseudoknots related to this work titled “Compounds and Compositions for Disrupting Programmed (4, 5), are thought to facilitate −1 PRF in part by transiently Ribosomal Frameshifting.” pausing the incoming ribosome, allowing tRNAs to realign This article is a PNAS Direct Submission. within the slippery sequence. In betacoronaviruses, including This open access article is distributed under Creative Commons Attribution License 4.0 SARS-CoV-2, a three-stem pseudoknot (Fig. 1B) has been (CC BY). proposed to act as the productive conformation (3), although 1To whom correspondence may be addressed. Email: [email protected] or junjie. conformational dynamics of this region have recently been [email protected]. described (6–8). This article contains supporting information online at https://www.pnas.org/lookup/suppl/ In contrast to its wide adoption by RNA viruses, −1 PRF is doi:10.1073/pnas.2023051118/-/DCSupplemental. much less prevalent in cellular mRNAs (5, 9, 10). Therefore, Published June 14, 2021. PNAS 2021 Vol. 118 No. 26 e2023051118 https://doi.org/10.1073/pnas.2023051118 | 1of6 Downloaded by guest on September 30, 2021 A respectively. Based on a positive control construct in which FLuc ORF1a S ORF3-10 and RLuc were translated continuously without frameshifting, ORF1b we estimated the PRF efficiency to be ∼20% in HEK293T cells, FSE B consistent with previous reporter-based measurements (16, 20), FLuc RLuc(−1) C although substantially lower than ribosome footprint profiling- based measurements (21) (Discussion). Stem 1 U-G To make the PRF reporter more suited for high-content …UUUAAACGGGUUUGCGGUGUAAG C screening, we replaced FLuc and RLuc with mCherry and GFP •••••••••• | RLuc/FLuc ** ** ** ACG D C GAC-ACGGCGUGCCACAUUCUG-CCCGA 0.2 0.1 0 (Fig. 1 ), respectively. Consistent with the luciferase-based re- U ••• •••••• •• ••••• porter, mCherry-FSE-GFP(−1) reporter yielded reduced GFP A CUGAUGUCGU---A--U---ACAGGGCUUUU… GUA signals compared to the in-frame mCherry-GFP fusion construct Stem 3 Stem 2 without an FSE (Fig. 1 D and E). Shifting GFP back to the DEmCherry GFP No-FSE mCh-GFP fusion 0 frame after FSE [mCherry-FSE-GFP(0)] completely abolished mCh-FSE-GFP(−1) GFP signal (Fig. 1 D and E), consistent with the expectation that mCh-FSE- mCh-FSE- No-FSE mCh-FSE-GFP(0) GFP(0) GFP(−1) mCh-GFP fusion nonframeshifted ribosomes would terminate at an in-frame UAA stop codon within Stem 1 (Fig. 1B). To identify chemical modifiers of −1 PRF, we treated Percentofcells HEK293T cells in 384-well plates with each of 4,434 compounds 0 20 40 60 40 20 0 μ F A mCherry 0 0.3 0.6 0.9 1.2 at 10 M final concentration (Fig. 1 and Dataset S1 ), which GFP/mCherry ratio included 640 FDA-approved drugs, 1,600 compounds from the Pharmakon 1600 collection, and 1,872 compounds from a GFP G Tested-In-Human collection, and transfected cells with the Ivermectin mCherry-FSE-GFP(−1) reporter plasmids. Twenty-four hours F after transfection, total cell numbers, as well as mCherry and HEK293T Add Transfect Merafloxacin GFP signals in transfected (mCherry+) cells were quantified. cells compounds reporter Effect (%) Effect GFP/mCherry ratios were compared to the in-frame mCherry- Zʹ = 0.91-0.95 GFP fusion positive control as well as the mCherry-FSE-GFP(0) 24 hr 30 min 24 hr Automated imaging −60 −40 −20 0 20 negative control. Our high-content screening showed high ro- & quantification 0 2000 4000 bustness, with Z′ scores ranging between 0.91 and 0.95. Rank As expected, the vast majority of the tested compounds had Fig. 1. A high-throughput screen identifies SARS-CoV-2 PRF modulators. (A) little or no effect on the GFP/mCherry ratio (Fig. 1G). Screen Schematic illustration of the SARS-CoV-2 genome architecture, with the FSE actives were selected by using mean ± 3 SDs as cutoffs. False indicated. (B) Schematic illustration of the dual luciferase-based −1 PRF re- positives due to their intrinsic fluorescence (e.g., doxorubicin porter design.
Load more

Recommended publications
  • 1 Ribosomal Frameshift Signal of SARS-Cov-2
    bioRxiv preprint doi: https://doi.org/10.1101/2020.03.13.991083; this version posted March 15, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Structural and functional conservation of the programmed -1 ribosomal frameshift signal of SARS-CoV-2 Jamie A. Kelly and Jonathan D. Dinman* Department of Cell Biology and Molecular Genetics, University of Maryland, College Park MD 20742 *Corresponding author: Jonathan D. Dinman E-mail: [email protected] Running title: Frameshifting in SARS-CoV-2 Keywords: COVID-19, coronavirus, programmed -1 ribosomal frameshifting (-1 PRF), translation, RNA, structure, virus, (+) ssRNA 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.13.991083; this version posted March 15, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Abstract. Introduction 17 years after the SARS-CoV epidemic, the SARS-CoV2, the etiological agent of COVID- world is facing the COVID-19 pandemic. 19, is a member of the coronavirus family (1). COVID-19 is caused by a coronavirus named Coronaviruses have (+) ssRNA genomes that SARS-CoV-2. Given the most optimistic harbor two long open reading frames (ORF) projections estimating that it will take more than which occupy the 5’ ~ two-thirds of the genomic a year to develop a vaccine, our best short term RNA (ORF1 and ORF2), followed by several strategy may lie in identifying virus-specific ORFs that are expressed late in the viral targets for small molecule interventions.
    [Show full text]
  • Teschen Disease (Teschovirus Encephalomyelitis) Eradication in Czechoslovakia: a Historical Report
    Historical Report Veterinarni Medicina, 54, 2009 (11): 550–560 Teschen disease (Teschovirus encephalomyelitis) eradication in Czechoslovakia: a historical report V. Kouba* Prague, Czech Republic ABSTRACT: Teschen disease (previously also known as Klobouk’s disease), actually called Teschovirus encepha- lomyelitis, is a virulent fatal viral disease of swine, characterized by severe neurological disorders of encephalomy- elitis. It was initially discovered in the Teschen district of North-Eastern Moravia. During the 1940s and 1950s it caused serious losses to the pig production industry in Europe. The most critical situation at that time, however, was in the former Czechoslovakia. A nationally organized eradication programme started in 1952. That year the reported number of new cases of Teschen disease reached 137 396, i.e., an incidence rate of 2 794 per 100 000 pigs, in 14 801 villages with 65 597 affected farms, i.e., 4.43 affected farms per village and 2.10 diseased pigs per affected farm. The average territorial density of new cases was 1.07 per km2. For etiological diagnosis histological investigation of the central nervous system, isolation of virus and seroneutralization were used. Preventive meas- ures consisted in feeding pigs with sterilized waste food and in ring vaccination. Eradication measures took the form of the timely detection and reporting of new cases, isolating outbreak areas, and the slaughter of intrafocal pigs followed by sanitation measures. Diseased pigs were usually destroyed in rendering facilities. The carcasses of other intrafocal pigs were treated as conditionally comestible, i.e., only after sterilization. During the years 1952–1965 from a reported 537 480 specifically diseased pigs 36 558 died; i.e., Teschen disease mortality rate was 6.80% while other intrafocal pigs (88.12%) were urgently slaughtered.
    [Show full text]
  • Ribosomes Slide on Lysine-Encoding Homopolymeric a Stretches
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Crossref RESEARCH ARTICLE elifesciences.org Ribosomes slide on lysine-encoding homopolymeric A stretches Kristin S Koutmou1, Anthony P Schuller1, Julie L Brunelle1,2, Aditya Radhakrishnan1, Sergej Djuranovic3, Rachel Green1,2* 1Department of Molecular Biology and Genetics, Johns Hopkins School of Medicine, Baltimore, United States; 2Howard Hughes Medical Institute, Johns Hopkins School of Medicine, Baltimore, United States; 3Department of Cell Biology and Physiology, Washington University School of Medicine, St. Louis, United States Abstract Protein output from synonymous codons is thought to be equivalent if appropriate tRNAs are sufficiently abundant. Here we show that mRNAs encoding iterated lysine codons, AAA or AAG, differentially impact protein synthesis: insertion of iterated AAA codons into an ORF diminishes protein expression more than insertion of synonymous AAG codons. Kinetic studies in E. coli reveal that differential protein production results from pausing on consecutive AAA-lysines followed by ribosome sliding on homopolymeric A sequence. Translation in a cell-free expression system demonstrates that diminished output from AAA-codon-containing reporters results from premature translation termination on out of frame stop codons following ribosome sliding. In eukaryotes, these premature termination events target the mRNAs for Nonsense-Mediated-Decay (NMD). The finding that ribosomes slide on homopolymeric A sequences explains bioinformatic analyses indicating that consecutive AAA codons are under-represented in gene-coding sequences. Ribosome ‘sliding’ represents an unexpected type of ribosome movement possible during translation. DOI: 10.7554/eLife.05534.001 *For correspondence: ragreen@ Introduction jhmi.edu Messenger RNA (mRNA) transcripts can contain errors that result in the production of incorrect protein products.
    [Show full text]
  • Genome Organization of Canada Goose Coronavirus, a Novel
    www.nature.com/scientificreports OPEN Genome Organization of Canada Goose Coronavirus, A Novel Species Identifed in a Mass Die-of of Received: 14 January 2019 Accepted: 25 March 2019 Canada Geese Published: xx xx xxxx Amber Papineau1,2, Yohannes Berhane1, Todd N. Wylie3,4, Kristine M. Wylie3,4, Samuel Sharpe5 & Oliver Lung 1,2 The complete genome of a novel coronavirus was sequenced directly from the cloacal swab of a Canada goose that perished in a die-of of Canada and Snow geese in Cambridge Bay, Nunavut, Canada. Comparative genomics and phylogenetic analysis indicate it is a new species of Gammacoronavirus, as it falls below the threshold of 90% amino acid similarity in the protein domains used to demarcate Coronaviridae. Additional features that distinguish the genome of Canada goose coronavirus include 6 novel ORFs, a partial duplication of the 4 gene and a presumptive change in the proteolytic processing of polyproteins 1a and 1ab. Viruses belonging to the Coronaviridae family have a single stranded positive sense RNA genome of 26–31 kb. Members of this family include both human pathogens, such as severe acute respiratory syn- drome virus (SARS-CoV)1, and animal pathogens, such as porcine epidemic diarrhea virus2. Currently, the International Committee on the Taxonomy of Viruses (ICTV) recognizes four genera in the Coronaviridae family: Alphacoronavirus, Betacoronavirus, Gammacoronavirus and Deltacoronavirus. While the reser- voirs of the Alphacoronavirus and Betacoronavirus genera are believed to be bats, the Gammacoronavirus and Deltacoronavirus genera have been shown to spread primarily through birds3. Te frst three species of the Deltacoronavirus genus were discovered in 20094 and recent work has vastly expanded the Deltacoronavirus genus, adding seven additional species3.
    [Show full text]
  • CRNKL1 Is a Highly Selective Regulator of Intron-Retaining HIV-1 and Cellular Mrnas
    bioRxiv preprint doi: https://doi.org/10.1101/2020.02.04.934927; this version posted February 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 CRNKL1 is a highly selective regulator of intron-retaining HIV-1 and cellular mRNAs 2 3 4 Han Xiao1, Emanuel Wyler2#, Miha Milek2#, Bastian Grewe3, Philipp Kirchner4, Arif Ekici4, Ana Beatriz 5 Oliveira Villela Silva1, Doris Jungnickl1, Markus Landthaler2,5, Armin Ensser1, and Klaus Überla1* 6 7 1 Institute of Clinical and Molecular Virology, University Hospital Erlangen, Friedrich-Alexander 8 Universität Erlangen-Nürnberg, Erlangen, Germany 9 2 Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine in the 10 Helmholtz Association, Robert-Rössle-Strasse 10, 13125, Berlin, Germany 11 3 Department of Molecular and Medical Virology, Ruhr-University, Bochum, Germany 12 4 Institute of Human Genetics, University Hospital Erlangen, Friedrich-Alexander Universität Erlangen- 13 Nürnberg, Erlangen, Germany 14 5 IRI Life Sciences, Institute für Biologie, Humboldt Universität zu Berlin, Philippstraße 13, 10115, Berlin, 15 Germany 16 # these two authors contributed equally 17 18 19 *Corresponding author: 20 Prof. Dr. Klaus Überla 21 Institute of Clinical and Molecular Virology, University Hospital Erlangen 22 Friedrich-Alexander Universität Erlangen-Nürnberg 23 Schlossgarten 4, 91054 Erlangen 24 Germany 25 Tel: (+49) 9131-8523563 26 e-mail: [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.04.934927; this version posted February 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder.
    [Show full text]
  • Structural Insights Into Mrna Reading Frame Regulation by Trna
    RESEARCH ARTICLE Structural insights into mRNA reading frame regulation by tRNA modification and slippery codon–anticodon pairing Eric D Hoffer1, Samuel Hong1, S Sunita1, Tatsuya Maehigashi1, Ruben L Gonzalez Jnr2, Paul C Whitford3, Christine M Dunham1* 1Department of Biochemistry, Emory University School of Medicine, Atlanta, United States; 2Department of Chemistry, Columbia University, New York, United States; 3Department of Physics, Northeastern University, Boston, United States Abstract Modifications in the tRNA anticodon loop, adjacent to the three-nucleotide anticodon, influence translation fidelity by stabilizing the tRNA to allow for accurate reading of the mRNA genetic code. One example is the N1-methylguanosine modification at guanine nucleotide 37 (m1G37) located in the anticodon loop andimmediately adjacent to the anticodon nucleotides 34, 35, 36. The absence of m1G37 in tRNAPro causes +1 frameshifting on polynucleotide, slippery codons. Here, we report structures of the bacterial ribosome containing tRNAPro bound to either cognate or slippery codons to determine how the m1G37 modification prevents mRNA frameshifting. The structures reveal that certain codon–anticodon contexts and the lack of m1G37 destabilize interactions of tRNAPro with the P site of the ribosome, causing large conformational changes typically only seen during EF-G-mediated translocation of the mRNA-tRNA pairs. These studies provide molecular insights into how m1G37 stabilizes the interactions of tRNAPro with the ribosome in the context of a slippery mRNA codon. *For correspondence: Introduction [email protected] Post-transcriptionally modified RNAs, including ribosomal RNA (rRNA), transfer RNA (tRNA) and messenger RNA (mRNA), stabilize RNA tertiary structures during ribonucleoprotein biogenesis, reg- Competing interests: The ulate mRNA metabolism, and influence other facets of gene expression.
    [Show full text]
  • Downloaded from the Genbank Database As of July 2020
    viruses Article Modular Evolution of Coronavirus Genomes Yulia Vakulenko 1,2 , Andrei Deviatkin 3 , Jan Felix Drexler 1,4,5 and Alexander Lukashev 1,3,* 1 Martsinovsky Institute of Medical Parasitology, Tropical and Vector Borne Diseases, Sechenov First Moscow State Medical University, 119435 Moscow, Russia; [email protected] (Y.V.); [email protected] (J.F.D.) 2 Department of Virology, Faculty of Biology, Lomonosov Moscow State University, 119234 Moscow, Russia 3 Laboratory of Molecular Biology and Biochemistry, Institute of Molecular Medicine, Sechenov First Moscow State Medical University, 119435 Moscow, Russia; [email protected] 4 Institute of Virology, Charité-Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin and Humboldt-Universität zu Berlin, 10117 Berlin, Germany 5 German Centre for Infection Research (DZIF), Associated Partner Site Charité, 10117 Berlin, Germany * Correspondence: [email protected] Abstract: The viral family Coronaviridae comprises four genera, termed Alpha-, Beta-, Gamma-, and Deltacoronavirus. Recombination events have been described in many coronaviruses infecting humans and other animals. However, formal analysis of the recombination patterns, both in terms of the involved genome regions and the extent of genetic divergence between partners, are scarce. Common methods of recombination detection based on phylogenetic incongruences (e.g., a phylogenetic com- patibility matrix) may fail in cases where too many events diminish the phylogenetic signal. Thus, an approach comparing genetic distances in distinct genome regions (pairwise distance deviation matrix) was set up. In alpha, beta, and delta-coronaviruses, a low incidence of recombination between closely related viruses was evident in all genome regions, but it was more extensive between the spike gene and other genome regions.
    [Show full text]
  • Exposure of Humans Or Animals to Sars-Cov-2 from Wild, Livestock, Companion and Aquatic Animals Qualitative Exposure Assessment
    ISSN 0254-6019 Exposure of humans or animals to SARS-CoV-2 from wild, livestock, companion and aquatic animals Qualitative exposure assessment FAO ANIMAL PRODUCTION AND HEALTH / PAPER 181 FAO ANIMAL PRODUCTION AND HEALTH / PAPER 181 Exposure of humans or animals to SARS-CoV-2 from wild, livestock, companion and aquatic animals Qualitative exposure assessment Authors Ihab El Masry, Sophie von Dobschuetz, Ludovic Plee, Fairouz Larfaoui, Zhen Yang, Junxia Song, Wantanee Kalpravidh, Keith Sumption Food and Agriculture Organization for the United Nations (FAO), Rome, Italy Dirk Pfeiffer City University of Hong Kong, Hong Kong SAR, China Sharon Calvin Canadian Food Inspection Agency (CFIA), Science Branch, Animal Health Risk Assessment Unit, Ottawa, Canada Helen Roberts Department for Environment, Food and Rural Affairs (Defra), Equines, Pets and New and Emerging Diseases, Exotic Disease Control Team, London, United Kingdom of Great Britain and Northern Ireland Alessio Lorusso Istituto Zooprofilattico dell’Abruzzo e Molise, Teramo, Italy Casey Barton-Behravesh Centers for Disease Control and Prevention (CDC), One Health Office, National Center for Emerging and Zoonotic Infectious Diseases, Atlanta, United States of America Zengren Zheng China Animal Health and Epidemiology Centre (CAHEC), China Animal Health Risk Analysis Commission, Qingdao City, China Food and Agriculture Organization of the United Nations Rome, 2020 Required citation: El Masry, I., von Dobschuetz, S., Plee, L., Larfaoui, F., Yang, Z., Song, J., Pfeiffer, D., Calvin, S., Roberts, H., Lorusso, A., Barton-Behravesh, C., Zheng, Z., Kalpravidh, W. & Sumption, K. 2020. Exposure of humans or animals to SARS-CoV-2 from wild, livestock, companion and aquatic animals: Qualitative exposure assessment. FAO animal production and health, Paper 181.
    [Show full text]
  • 1 Ribosomal Frameshifting Stimulation
    www.nature.com/scientificreports OPEN Mechanical unfolding kinetics of the SRV-1 gag-pro mRNA pseudoknot: possible implications Received: 26 August 2016 Accepted: 24 November 2016 for −1 ribosomal frameshifting Published: 21 December 2016 stimulation Zhensheng Zhong1, Lixia Yang1, Haiping Zhang2, Jiahao Shi1, J. Jeya Vandana1, Do Thuy Uyen Ha Lam1,3, René C. L. Olsthoorn4, Lanyuan Lu2 & Gang Chen1 Minus-one ribosomal frameshifting is a translational recoding mechanism widely utilized by many RNA viruses to generate accurate ratios of structural and catalytic proteins. An RNA pseudoknot structure located in the overlapping region of the gag and pro genes of Simian Retrovirus type 1 (SRV-1) stimulates frameshifting. However, the experimental characterization of SRV-1 pseudoknot (un)folding dynamics and the effect of the base triple formation is lacking. Here, we report the results of our single- molecule nanomanipulation using optical tweezers and theoretical simulation by steered molecular dynamics. Our results directly reveal that the energetic coupling between loop 2 and stem 1 via minor- groove base triple formation enhances the mechanical stability. The terminal base pair in stem 1 (directly in contact with a translating ribosome at the slippery site) also affects the mechanical stability of the pseudoknot. The −1 frameshifting efficiency is positively correlated with the cooperative one- step unfolding force and inversely correlated with the one-step mechanical unfolding rate at zero force. A significantly improved correlation was observed between− 1 frameshifting efficiency and unfolding rate at forces of 15–35 pN, consistent with the fact that the ribosome is a force-generating molecular motor with helicase activity.
    [Show full text]
  • Polysome-Profiling in Small Tissue Samples
    bioRxiv preprint doi: https://doi.org/10.1101/104596; this version posted February 1, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Polysome-profiling in small tissue samples Shuo Liang1,#, Hermano Bellato2,#, Julie Lorent1,#, Fernanda Lupinacci2, Vincent Van Hoef1, Laia Masvidal1,*, Glaucia Hajj2,* and Ola Larsson1,* 1. Department of Oncology-Pathology, Karolinska Institutet, Stockholm, 171 77, Sweden 2. International Research Center, A.C. Camargo Cancer Center, São Paulo, Brazil # Equally contributing authors * Correspondence: Laia Masvidal ([email protected]), Glaucia Hajj ([email protected]) and Ola Larsson ([email protected]) ABSTRACT Polysome-profiling is commonly used to study genome wide patterns of translational efficiency, i.e. the translatome. The standard approach for collecting efficiently translated polysome-associated RNA results in laborious extraction of RNA from a large volume spread across multiple fractions. This property makes polysome-profiling inconvenient for larger experimental designs or samples with low RNA amounts such as primary cells or frozen tissues. To address this we optimized a non-linear sucrose gradient which reproducibly enriches for mRNAs associated with >3 ribosomes in only one or two fractions, thereby reducing sample handling 5-10 fold. The technique can be applied to cells and frozen tissue samples from biobanks, and generates RNA with a quality reflecting the starting material. When coupled with smart-seq2, a single-cell RNA sequencing technique, translatomes from small tissue samples can be obtained. Translatomes acquired using optimized non-linear gradients are very similar to those obtained when applying linear gradients.
    [Show full text]
  • Using Ribosome Profiling to Quantify Differences in Protein Expression
    bioRxiv preprint doi: https://doi.org/10.1101/501478; this version posted December 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 Using ribosome profiling to quantify differences in protein expression: 2 a case study in Saccharomyces cerevisiae oxidative stress conditions 3 4 5 William R. Blevins1,#, Teresa Tavella1,#, Simone G. Moro1, Bernat Blasco-Moreno2, 6 Adrià Closa-Mosquera2, Juana Díez2, Lucas B. Carey2, M. Mar Albà1,2,3,* 7 8 1Evolutionary Genomics Groups, Research Programme on Biomedical Informatics (GRIB), Hospital del 9 Mar Research Institute (IMIM), Barcelona, Spain 10 2Health and Experimental Sciences Department, Universitat Pompeu Fabra(UPF), Barcelona, Spain 11 3Catalan Institution for Research and Advanced Studies (ICREA), Barcelona, Spain. 12 #Shared first co-authorship 13 *To whom correspondence should be addressed. 14 Running title: differential gene translation 15 Keywords: differential gene expression, ribosome profiling, RNA-Seq, translation, oxidative stress 1 bioRxiv preprint doi: https://doi.org/10.1101/501478; this version posted December 19, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 16 Abstract 17 18 Cells respond to changes in the environment by modifying the concentration of specific 19 proteins. Paradoxically, the cellular response is usually examined by measuring variations 20 in transcript abundance by high throughput RNA sequencing (RNA-Seq), instead of 21 directly measuring protein concentrations.
    [Show full text]
  • Mechanisms of Mrna Frame Maintenance and Its Subversion During Translation of the Genetic Code
    Biochimie xxx (2015) 1e7 Contents lists available at ScienceDirect Biochimie journal homepage: www.elsevier.com/locate/biochi Mini-review Mechanisms of mRNA frame maintenance and its subversion during translation of the genetic code * Jack A. Dunkle, Christine M. Dunham Emory University School of Medicine, Department of Biochemistry, 1510 Clifton Road NE, Suite G223, Atlanta, GA 30322, USA article info abstract Article history: Important viral and cellular gene products are regulated by stop codon readthrough and mRNA frame- Received 11 December 2014 shifting, processes whereby the ribosome detours from the reading frame defined by three nucleotide Accepted 11 February 2015 codons after initiation of translation. In the last few years, rapid progress has been made in mechanis- Available online xxx tically characterizing both processes and also revealing that trans-acting factors play important regu- latory roles in frameshifting. Here, we review recent biophysical studies that bring new molecular Keywords: insights to stop codon readthrough and frameshifting. Lastly, we consider whether there may be com- Ribosome mon mechanistic themes in À1 and þ1 frameshifting based on recent X-ray crystal structures of þ1 Protein synthesis Frameshifting frameshift-prone tRNAs bound to the ribosome. © RNA structure 2015 Elsevier B.V. and Societe française de biochimie et biologie Moleculaire (SFBBM). All rights Translocation reserved. The ribosome is a macromolecular machine that performs incorporated, at least for the most error-prone codoneanticodon protein synthesis, one of the most conserved cellular functions in pairs [5e7]. The most common translational errors are missense or all organisms. Translating the information encoded on the tRNA miscoding errors but non-initiation, stop codon readthrough messenger RNA (mRNA) template into amino acids is a highly and mRNA reading frame errors do occur, although at lower fre- complex but coordinated process with four defined stages - initi- quencies [8].
    [Show full text]