DOCSLIB.ORG

Comparative Genome Assembly Algorithm, Which Can Assemble a Newly Sequenced Genome by Is a Bioinformatics Scientist at Mapping It Onto a Reference Genome

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Comparative Genome Assembly Algorithm, Which Can Assemble a Newly Sequenced Genome by Is a Bioinformatics Scientist at Mapping It Onto a Reference Genome Mihai Pop Comparative genome is a Bioinformatics Scientist at the Institute for Genomic Research. He earned his PhD in assembly Computer Science from Johns Hopkins University in 2000. His Mihai Pop, Adam Phillippy, Arthur L. Delcher and Steven L. Salzberg research interests include Date received (in revised form): 21st June 2004 genome assembly and comparative genomics. Abstract Adam Phillippy is a Bioinformatics Software One of the most complex and computationally intensive tasks of genome sequence analysis is Engineer at The Institute for genome assembly. Even today, few centres have the resources, in both software and hardware, Genomic Research. His to assemble a genome from the thousands or millions of individual sequences generated in a research interests include whole-genome shotgun sequencing project. With the rapid growth in the number of comparative genomics, whole genome alignment and sequenced genomes has come an increase in the number of organisms for which two or more sequence assembly. closely related species have been sequenced. This has created the possibility of building a Arthur L. Delcher comparative genome assembly algorithm, which can assemble a newly sequenced genome by is a Bioinformatics Scientist at mapping it onto a reference genome. We describe here a novel algorithm for comparative The Institute for Genomic genome assembly that can accurately assemble a typical bacterial genome in less than four Research and Professor minutes on a standard desktop computer. The software is available as part of the open-source Emeritus of Computer Science at Loyola College in Maryland. AMOS project. He earned his PhD in Computer Science from Johns Hopkins University in 1989 and INTRODUCTION biodefence, where multiple strains of was a member of the Most large-scale genome sequencing Bacillus anthracis are currently being Informatics Research group at Celera Genomics that projects today employ the whole-genome sequenced in order to create precise developed the human genome shotgun (WGS) sequencing strategy, in genotyping information that can be used assembly program. which a genome is shattered into for forensic purposes.1 Sequencing Steven L. Salzberg, PhD numerous small fragments, and the projects for several major human is the Senior Director of fragments are then sequenced from both pathogens, including Mycobacterium Bioinformatics at TIGR and is a ends. The resulting sequences, ranging tuberculosis, Streptococcus pneumoniae and Research Professor of Computer Science and Biology from 650 to 850 base pairs (bp) in length Staphylococcus aureus (to name but a few) at Johns Hopkins University. using the latest sequencing technology, are targeting multiple strains of these must then be assembled to reconstruct the bacteria in order to understand virulence, chromosomes of the target organism. As drug resistance and other phenotypic Keywords: assembly, genome sequencing has become more differences between strains. On a larger shotgun sequencing, efficient, the number of organisms scale, the mouse, rat and chimpanzee comparative genomics, open source sequenced by this strategy has rapidly genomes are all being sequenced and increased. In many cases, little is known mapped to the human genome to better about a genome prior to sequencing; understand human biology, and multiple sometimes even the genome size is only a Drosophila species are being sequenced rough estimate. Genome assemblers have and mapped onto one another. been relied on not only to reconstruct the DNA sequence assembly algorithms genome, but also to help answer such have generally followed an algorithmic basic questions as how many strategy known as overlap-layout-consensus.2 chromosomes an organism has. Although many distinct systems have Mihai Pop, In addition to sequencing new and been developed – among them the The Institute for Genomic completely unknown species, the popular program phrap3 – all begin by Research, scientific community has recognised in comparing all the shotgun sequences 9712 Medical Center Drive, Rockville, MD 20850, USA recent years the value of sequencing two (‘reads’) to one another and computing or more very similar species (or strains) which ones overlap each other (the overlap Tel: +1 301 795 7000 Fax: +1 301 838 0208 from the same genus. Perhaps the most step). To avoid the quadratic time E-mail: [email protected] prominent example of this is in requirement of a brute-force approach, & HENRY STEWART PUBLICATIONS 1467-5463. BRIEFINGS IN BIOINFORMATICS. VOL 5. NO 3. 237–248. SEPTEMBER 2004 2 3 7 Pop et al. most assemblers use some form of a sequence of a closely related organism to hashing strategy (or similar indexing determine the relative placement of the technique) based on short oligomers in reads. Thus the overlap and layout stages order to identify those reads that are likely of a typical assembler are replaced with a Reference and target to overlap, and then run a more costly module performing the alignment to a genomes alignment algorithm on any pairs of reads reference genome. The remaining assembly that have a significant intersection in the stages – consensus generation and hash table. Following the overlap step, the scaffolding – remain the same as for an layout step positions the reads precisely overlap-layout-consensus algorithm. with respect to one another, producing a Throughout the remainder of this paper, multiple alignment of all reads. This the genome being sequenced is referred to multi-alignment is then used to produce as the target genome, the goal being to the consensus, ie the final DNA sequence. obtain an assembly of this genome using a Some algorithms4–6 also include an reference genome as a template. additional step in which contigs are joined The differences between the target together using the linking information genome and the reference genome, from the paired-end reads, creating larger coupled with the presence of repeats in structures known as scaffolds. This the data, create the biggest challenges for scaffolding step can also be run as a a comparative assembler. Even when the separate program after the initial two genomes belong to the same species, assembly.7 the differences between them can be AMOS Comparative In the AMOS Comparative Assembler significant. For example, Figure 1 shows Assembler (AMOS-Cmp), we take a fundamentally the alignment between two strains of different approach: the overlap step is Streptococcus agalactiae.9,10 It is immediately skipped entirely. Instead, reads are aligned clear that the strains differ by multiple to the reference genome using a modified insertions and deletions (indels, identified version of the MUMmer algorithm.8 This by breaks in the diagonal), furthermore a Alignment-layout- strategy can be called alignment-layout- cluster of repeats can be seen in the first consensus consensus, because it produces a layout 500 kilobases (Kbp) of the two genomes. directly from the alignment. In fact, The algorithm employed by AMOS- AMOS goes a step beyond many Cmp to overcome these challenges has conventional assembly algorithms, five major steps. because information is used from the Read placement with paired-end reads in the alignment step. As • Read alignment. Each shotgun read MUMmer described below, this helps in is aligned to the reference genome disambiguating the placement of reads using MUMmer.8,11,12 Repetitive that have matches to more than one place sequences and polymorphisms in the reference genome. between the target and the reference cause some reads to align in a non- METHODS contiguous fashion. A modified All assembly algorithms attempt to version of the Longest Increasing recover the information lost through the Subsequence (LIS) algorithm13 is used WGS shearing process; in particular, they in order to generate chains of mutually try to identify the original placement of consistent matches between each read the shotgun sequence fragments along the and the reference. In addition to the genome. This problem encompasses most longest consistent chain, a set of near- of the complexity of shotgun sequence optimal chains is also computed in assembly, while the remaining tasks, such order to identify reads anchored in as computing the precise multiple repeats. Those reads that are alignment of the reads or identifying ambiguously placed in the genome polymorphisms, are somewhat easier. Our (one or more chains are within 2 per comparative assembler uses the complete cent identity from the best placement) 238 & HENRY STEWART PUBLICATIONS 1467-5463. BRIEFINGS IN BIOINFORMATICS. VOL 5. NO 3. 237–248. SEPTEMBER 2004 Comparative genome assembly 2,000,000 1,500,000 NEM316 1,000,000 S. agalactiae Figure 1: Alignment 500,000 between two strains of Streptococcus agalactiae. The lines represent near-exact matches. The 0 positions of the matches 0 500,000 1,000,000 1,500,000 2,000,000 on the two genomes are S. agalactiae 2603V/R shown along the axes are classified as repetitive and resolved random. To illustrate how well these later (in some cases) by using mate- steps work, the original shotgun reads pair information. from the S. agalactiae 26039 WGS project were aligned to the final, Repeat solution • Repeat resolution. For each read finished chromosome. Out of a total that cannot be unambiguously placed of 26,099 reads, 25,310 were uniquely along the reference genome, a three- anchored, 314 were placed with the stage process is employed to help of a uniquely anchored mate, 22 disambiguate its placement. First, it is were placed by mate-pair constraints, checked to see if the paired-end and the remaining 442 had to be sequence (the ‘mate’) is uniquely placed in a randomly chosen copy of a anchored in the genome. If it is, the repeat. read is placed in the location that Layout refinement satisfies the constraints imposed by the • Layout refinement. Indels and mate-pair information. Second, if a rearrangements between the target and read and its mate are both the reference genomes complicate the ambiguously placed, an attempt is mapping of the reads to the reference.
Load more

Recommended publications
  • Sequence Assembly Demystified
    REVIEWS COMPUTATIONAL TOOLS Sequence assembly demystified Niranjan Nagarajan1 and Mihai Pop2 Abstract | Advances in sequencing technologies and increased access to sequencing services have led to renewed interest in sequence and genome assembly. Concurrently, new applications for sequencing have emerged, including gene expression analysis, discovery of genomic variants and metagenomics, and each of these has different needs and challenges in terms of assembly. We survey the theoretical foundations that underlie modern assembly and highlight the options and practical trade-offs that need to be considered, focusing on how individual features address the needs of specific applications. We also review key software and the interplay between experimental design and efficacy of assembly. Paired-end data Previously the province of large genome centres, DNA between DNA sequences is then used to ‘stitch’ together Data from a pair of reads sequencing is now a key component of research carried the individual fragments into larger contiguous sequenced from ends of out in many laboratories. A number of new applica- sequences (contigs), thereby recovering the informa- the same DNA fragment. The tions of sequencing technologies have been spurred tion lost during the sequencing process. The assembly genomic distance between the reads is approximately by rapidly decreasing costs, including the study of process is complicated by the fact that, in many cases, known and is used to constrain microbial communities (metagenomics), the discovery this underlying assumption is incorrect. For example, assembly solutions. See also of structural variants in genomes and the analysis of genomic repeats — segments of DNA repeated in an ‘mate-pair read’. gene structure and expression.
    [Show full text]
  • DNA Sequencing
    Contig Assembly ATCGATGCGTAGCAGACTACCGTTACGATGCCTT… TAGCTACGCATCGTCTGATGGCAATGCTACGGAA.. C T AG AGCAGA TAGCTACGCATCGT GT CTACCG GC TT AT CG GTTACGATGCCTT AT David Wishart, Ath 3-41 [email protected] DNA Sequencing 1 Principles of DNA Sequencing Primer DNA fragment Amp PBR322 Tet Ori Denature with Klenow + ddNTP heat to produce + dNTP + primers ssDNA The Secret to Sanger Sequencing 2 Principles of DNA Sequencing 5’ G C A T G C 3’ Template 5’ Primer dATP dATP dATP dATP dCTP dCTP dCTP dCTP dGTP dGTP dGTP dGTP dTTP dTTP dTTP dTTP ddCTP ddATP ddTTP ddGTP GddC GCddA GCAddT ddG GCATGddC GCATddG Principles of DNA Sequencing G T _ _ short C A G C A T G C + + long 3 Capillary Electrophoresis Separation by Electro-osmotic Flow Multiplexed CE with Fluorescent detection ABI 3700 96x700 bases 4 High Throughput DNA Sequencing Large Scale Sequencing • Goal is to determine the nucleic acid sequence of molecules ranging in size from a few hundred bp to >109 bp • The methodology requires an extensive computational analysis of raw data to yield the final sequence result 5 Shotgun Sequencing • High throughput sequencing method that employs automated sequencing of random DNA fragments • Automated DNA sequencing yields sequences of 500 to 1000 bp in length • To determine longer sequences you obtain fragmentary sequences and then join them together by overlapping • Overlapping is an alignment problem, but different from those we have discussed up to now Shotgun Sequencing Isolate ShearDNA Clone into Chromosome into Fragments Seq. Vectors Sequence 6 Shotgun Sequencing Sequence Send to Computer Assembled Chromatogram Sequence Analogy • You have 10 copies of a movie • The film has been cut into short pieces with about 240 frames per piece (10 seconds of film), at random • Reconstruct the film 7 Multi-alignment & Contig Assembly ATCGATGCGTAGCAGACTACCGTTACGATGCCTT… TAGCTACGCATCGTCTGATGGCAATGCTACGGAA.
    [Show full text]
  • Metagenomic Assembly Using Coverage and Evolutionary Distance (MACE)
    Metagenomic Assembly using Coverage and Evolutionary distance (MACE) Introduction Recent advances in accuracy and cost of whole-genome shotgun sequencing have opened up various fields of study for biologists. One such field is that of metagenomics – the study of the bacterial biome in a given sample. The human body, for example, has approximately 10 bacterial cells for every native cell[1], and lack of certain strains may contribute to prevalence of diseases such as obesity, Crohn’s disease, and type 2 diabetes[2,3,4]. Although the field of metagenomics is very promising, as with any new field, there are many difficulties with such analyses. Arguably, the greatest obstacle to sequencing a sample’s biome is the existence of a large number of strains of bacteria, many of which do not have an assembled genome, and an unknown prevalence of each strain. Assembly is further complicated by inherent inaccuracy in reading DNA fragments, which makes it difficult to distinguish between noise and true variants either within a strain or between strains. Additionally, in a given biotic sample, there are bound to be many clusters of closely related strains. When related bacteria coexist in a sample, any conserved regions can easily cause misassembly of the genomes. For example, two genomic sequences with a single region of homology (of length greater than the read length) will be easily distinguished from each other both before and after the homologous region. However, if given only short reads from the two genomes, it becomes impossible just based on the sequences to infer which sequence before the homologous region belongs to which sequence after the homologous region (Figure 2).
    [Show full text]
  • De Novo Genome Assembly Versus Mapping to a Reference Genome
    De novo genome assembly versus mapping to a reference genome Beat Wolf PhD. Student in Computer Science University of Würzburg, Germany University of Applied Sciences Western Switzerland [email protected] 1 Outline ● Genetic variations ● De novo sequence assembly ● Reference based mapping/alignment ● Variant calling ● Comparison ● Conclusion 2 What are variants? ● Difference between a sample (patient) DNA and a reference (another sample or a population consensus) ● Sum of all variations in a patient determine his genotype and phenotype 3 Variation types ● Small variations ( < 50bp) – SNV (Single nucleotide variation) – Indel (insertion/deletion) 4 Structural variations 5 Sequencing technologies ● Sequencing produces small overlapping sequences 6 Sequencing technologies ● Difference read lengths, 36 – 10'000bp (150-500bp is typical) ● Different sequencing technologies produce different data And different kinds of errors – Substitutions (Base replaced by other) – Homopolymers (3 or more repeated bases) ● AAAAA might be read as AAAA or AAAAAA – Insertion (Non existent base has been read) – Deletion (Base has been skipped) – Duplication (cloned sequences during PCR) – Somatic cells sequenced 7 Sequencing technologies ● Standardized output format: FASTQ – Contains the read sequence and a quality for every base http://en.wikipedia.org/wiki/FASTQ_format 8 Recreating the genome ● The problem: – Recreate the original patient genome from the sequenced reads ● For which we dont know where they came from and are noisy ● Solution: – Recreate the genome
    [Show full text]
  • Sequencing and Comparative Analysis of <I>De Novo</I> Genome
    University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Dissertations and Theses in Biological Sciences Biological Sciences, School of 7-2016 Sequencing and Comparative Analysis of de novo Genome Assemblies of Streptomyces aureofaciens ATCC 10762 Julien S. Gradnigo University of Nebraska - Lincoln, [email protected] Follow this and additional works at: http://digitalcommons.unl.edu/bioscidiss Part of the Bacteriology Commons, Bioinformatics Commons, and the Genomics Commons Gradnigo, Julien S., "Sequencing and Comparative Analysis of de novo Genome Assemblies of Streptomyces aureofaciens ATCC 10762" (2016). Dissertations and Theses in Biological Sciences. 88. http://digitalcommons.unl.edu/bioscidiss/88 This Article is brought to you for free and open access by the Biological Sciences, School of at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Dissertations and Theses in Biological Sciences by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. SEQUENCING AND COMPARATIVE ANALYSIS OF DE NOVO GENOME ASSEMBLIES OF STREPTOMYCES AUREOFACIENS ATCC 10762 by Julien S. Gradnigo A THESIS Presented to the Faculty of The Graduate College at the University of Nebraska In Partial Fulfillment of Requirements For the Degree of Master of Science Major: Biological Sciences Under the Supervision of Professor Etsuko Moriyama Lincoln, Nebraska July, 2016 SEQUENCING AND COMPARATIVE ANALYSIS OF DE NOVO GENOME ASSEMBLIES OF STREPTOMYCES AUREOFACIENS ATCC 10762 Julien S. Gradnigo, M.S. University of Nebraska, 2016 Advisor: Etsuko Moriyama Streptomyces aureofaciens is a Gram-positive Actinomycete used for commercial antibiotic production. Although it has been the subject of many biochemical studies, no public genome resource was available prior to this project.
    [Show full text]
  • Improving Metagenomic Assemblies Through Data Partitioning: a GC Content Approach
    bioRxiv preprint doi: https://doi.org/10.1101/261784; this version posted February 8, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Improving Metagenomic Assemblies Through Data Partitioning: a GC content approach F´abioMiranda1, Cassio Batista1, Artur Silva2;3, Jefferson Morais1, Nelson Neto1, and Rommel Ramos1;2;3 1Computer Science Graduate Program { Federal University of Par´a,Bel´em,Brazil {fabiomm,cassiotb,jmorais,nelsonneto,rommelramos}@ufpa.br 2Institute of Biological Sciences { Federal University of Par´a,Bel´em,Brazil [email protected] 3Center of Genomics and Systems Biology { Federal University of Par´a,Bel´em,Brazil Abstract. Assembling metagenomic data sequenced by NGS platforms poses significant computational challenges, especially due to large vol- umes of data, sequencing errors, and variations in size, complexity, di- versity and abundance of organisms present in a given metagenome. To overcome these problems, this work proposes an open-source, bioinfor- matic tool called GCSplit, which partitions metagenomic sequences into subsets using a computationally inexpensive metric: the GC content. Ex- periments performed on real data show that preprocessing short reads with GCSplit prior to assembly reduces memory consumption and gen- erates higher quality results, such as an increase in the N50 metric and the reduction in both the L50 value and the total number of contigs produced in the assembly. GCSplit is available at https://github.com/ mirand863/gcsplit. Keywords: DNA sequencing · Metagenomics · Data partitioning · Bioin- formatic tools · Metagenomic data preprocessing 1 Introduction Metagenomics consists in determining the collective DNA of microorganisms that coexist as communities in a variety of environments, such as soil, sea and even the human body [1{3].
    [Show full text]
  • Extreme Scale De Novo Metagenome Assembly
    Extreme Scale De Novo Metagenome Assembly Evangelos Georganas∗, Rob Egany, Steven Hofmeyrz, Eugene Goltsmany, Bill Arndt{, Andrew Tritt{ Aydın Buluc¸z, Leonid Olikerz, Katherine Yelickz ∗ Parallel Computing Lab, Intel Corp. zComputational Research Division / yJoint Genome Institute, Lawrence Berkeley National Laboratory, USA { National Energy Research Scientific Computing Center, USA Abstract—Metagenome assembly is the process of transforming are not parallelized for distributed-memory systems. As a a set of short, overlapping, and potentially erroneous DNA result, they require specialized, large shared-memory machines segments from environmental samples into the accurate rep- with hundreds of GB of memory in order to deal even with resentation of the underlying microbiomes’s genomes. State-of- the-art tools require big shared memory machines and cannot modestly-sized metagenomic datasets. At the same time, the handle contemporary metagenome datasets that exceed Terabytes concurrency of these tools is limited by the core count of in size. In this paper, we introduce the MetaHipMer pipeline, a a single node (typically 10s of cores) and consequently the high-quality and high-performance metagenome assembler that execution times even for small datasets are in the order of employs an iterative de Bruijn graph approach. MetaHipMer days. The only exception among the metagenome assemblers leverages a specialized scaffolding algorithm that produces long scaffolds and accommodates the idiosyncrasies of metagenomes. is Ray Meta, which is a tool designed for distributed-memory MetaHipMer is end-to-end parallelized using the Unified Parallel systems. However, Ray Meta is not scalable to massive con- C language and therefore can run seamlessly on shared and currencies [13] and its assembly quality has been shown to be distributed-memory systems.
    [Show full text]
  • DNA Sequence Assembly and Genetic Algorithms New Results and Puzzling Insights
    From: ISMB-95 Proceedings. Copyright © 1995, AAAI (www.aaai.org). All rights reserved. DNA Sequence Assembly and Genetic Algorithms New Results and Puzzling Insights Rebecca Parsons Mark E. Johnson Department of Computer Science Statistics Department University of Central Florida University of Central Florida Orlando, FL USA Orlando, FL USA [email protected] [email protected] Abstract performance.Several critical issues affect the perfor- manceof a genetic algorithm: problemrepresentation, Applyinggenetic algorithmsto DNAsequence assem- operator selection, population size, and parameter se- bly is not a straightforwardprocess. Significantlyim- lection. Our previous workindicated that the perfor- provedresults in termsof performance,quality of re- manceof the genetic algorithm was sensitive to the sults, andthe scaling of applicability havebeen real- ized throughnon-standard and even counter-intuitive setting of the rate parameters. This issue seemedim- parametersettings. Specifically,the solutiontime for portant to address first. Weapplied the techniques of a 10kbdata set wasreduced by an order of magnitude, experimentaldesign and response surface analysis (Box and a 20kbdata set that waspreviously unsolved by & Draper 1987; Box, Hunter, & Hunter 1978) to the the genetic algorithmwas solved in a time that rep- rate parameterscontrolling the application of the var- resents only a linear increasefrom the 10kbdata set. ious operators in the genetic algorithm. This analysis Additionally, significant progress has been madeon promptedus to set the operator rates at significantly a 35kbdata set representingreal biological data. A different levels than those we had previously tried and single contig solution wasfound for a 752 fragment those typically used by the genetic algorithm commu- subset of the data set, and a 15 contig solution was foundfor the full data set.
    [Show full text]
  • Efficient and High Quality Hybrid De Novo Assembly of Human Genomes
    bioRxiv preprint doi: https://doi.org/10.1101/840447; this version posted November 25, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. WENGAN: Efficient and high quality hybrid de novo as- sembly of human genomes Alex Di Genova1;2;∗, Elena Buena-Atienza3;4, Stephan Ossowski3;4 and Marie-France Sagot1;2;∗ 1Inria Grenoble Rhone-Alpes,ˆ 655, Avenue de l’Europe, 38334 Montbonnot, France. 2CNRS, UMR5558, Universite´ Claude Bernard Lyon 1, 43, Boulevard du 11 Novembre 1918, 69622 Villeurbanne, France. 3Institute of Medical Genetics and Applied Genomics, University of Tubingen,¨ Tubingen,¨ Ger- many. 4NGS Competence Center Tubingen¨ (NCCT), University of Tubingen,¨ Tubingen,¨ Germany. *Correspondence should be addressed to Alex Di Genova (email: [email protected]) and Marie-France Sagot (email: [email protected]). The continuous improvement of long-read sequencing technologies along with the development of ad-doc algorithms has launched a new de novo assembly era that promises high-quality genomes. However, it has proven difficult to use only long reads to generate accurate genome assemblies of large, repeat-rich human genomes. To date, most of the human genomes assembled from long error-prone reads add accurate short reads to further polish the consensus quality. Here, we report the development of a novel algorithm for hybrid assembly, WENGAN, and the de novo assembly of four human genomes using a combination of sequencing data generated on ONT PromethION, PacBio Sequel, Illumina and MGI technology.
    [Show full text]
  • Cancer Whole-Genome Sequencing: Present and Future
    Oncogene (2015) 34, 5943–5950 © 2015 Macmillan Publishers Limited All rights reserved 0950-9232/15 www.nature.com/onc REVIEW Cancer whole-genome sequencing: present and future H Nakagawa, CP Wardell, M Furuta, H Taniguchi and A Fujimoto Recent explosive advances in next-generation sequencing technology and computational approaches to massive data enable us to analyze a number of cancer genome profiles by whole-genome sequencing (WGS). To explore cancer genomic alterations and their diversity comprehensively, global and local cancer genome-sequencing projects, including ICGC and TCGA, have been analyzing many types of cancer genomes mainly by exome sequencing. However, there is limited information on somatic mutations in non- coding regions including untranslated regions, introns, regulatory elements and non-coding RNAs, and rearrangements, sometimes producing fusion genes, and pathogen detection in cancer genomes remain widely unexplored. WGS approaches can detect these unexplored mutations, as well as coding mutations and somatic copy number alterations, and help us to better understand the whole landscape of cancer genomes and elucidate functions of these unexplored genomic regions. Analysis of cancer genomes using the present WGS platforms is still primitive and there are substantial improvements to be made in sequencing technologies, informatics and computer resources. Taking account of the extreme diversity of cancer genomes and phenotype, it is also required to analyze much more WGS data and integrate these with multi-omics data,
    [Show full text]
  • Basics on Molecular Biology ‡Ŷ
    BASICS ON MOLECULAR BIOLOGY Ŷ Ŷ Cell – DNA – RNA – protein Ŷ Sequencing methods Ŷ arising questions for handling the data, making sense of it Ŷ next two week lectures: sequence alignment and genome assembly Cells • Fundamental working units of every living system. • Every organism is composed of one of two radically different types of cells: – prokaryotic cells – eukaryotic cells which have DNA inside a nucleus. • Prokaryotes and Eukaryotes are descended from primitive cells and the results of 3.5 billion years of evolution. 2 Prokaryotes and Eukaryotes • According to the most recent evidence, there are three main branches to the tree of life • Prokaryotes include Archaea (“ancient ones”) and bacteria • Eukaryotes are kingdom Eukarya and includes plants, animals, fungi and certain algae Lecture: Phylogenetic trees, this topic in more detail 3 All Cells have common Cycles • Born, eat, replicate, and die 4 Common features of organisms • Chemical energy is stored in ATP • Genetic information is encoded by DNA • Information is transcribed into RNA • There is a common triplet genetic code – some variations are known, however • Translation into proteins involves ribosomes • Shared metabolic pathways • Similar proteins among diverse groups of organisms 5 All Life depends on 3 critical molecules • DNAs (Deoxyribonucleic acid) – Hold information on how cell works • RNAs (Ribonucleic acid) – Act to transfer short pieces of information to different parts of cell – Provide templates to synthesize into protein • Proteins – Form enzymes that send signals
    [Show full text]
  • Information Theory of DNA Shotgun Sequencing Abolfazl S
    IEEE TRANSACTIONS ON INFORMATION THEORY, VOL. 59, NO. 10, OCTOBER 2013 6273 Information Theory of DNA Shotgun Sequencing Abolfazl S. Motahari, Guy Bresler, Student Member, IEEE, and David N. C. Tse, Fellow, IEEE Abstract—DNA sequencing is the basic workhorse of modern day biology and medicine. Shotgun sequencing is the dominant technique used: many randomly located short fragments called reads are extracted from the DNA sequence, and these reads are assembled to reconstruct the original sequence. A basic question is: given a sequencing technology and the statistics of the DNA sequence, what is the minimum number of reads required for reliable reconstruction? This number provides a fundamental Fig. 1. Schematic for shotgun sequencing. limit to the performance of any assembly algorithm. For a simple statistical model of the DNA sequence and the read process, we show that the answer admits a critical phenomenon in the asymp- totic limit of long DNA sequences: if the read length is below Shotgun sequencing is the dominant method currently used a threshold, reconstruction is impossible no matter how many to sequence long strands of DNA, including entire genomes. reads are observed, and if the read length is above the threshold, The basic shotgun DNA sequencing setup is shown in Fig. 1. having enough reads to cover the DNA sequence is sufficient to Starting with a DNA molecule, the goal is to obtain the sequence reconstruct. The threshold is computed in terms of the Renyi entropy rate of the DNA sequence. We also study the impact of of nucleotides ( , , ,or ) comprising it. (For humans, the noise in the read process on the performance.
    [Show full text]