High Levels of Genetic Variability in West African Dwarf Crocodiles Osteolaemus Tetraspis Getraspis

High levels of genetic variability in west African Dwarf Crocodiles Osteolaemus tetraspis getraspis

DAVID A. RAY,LP. SCOTT WHITE,2 HUYEN V. DUONG,l T. CULLEN3 and LLEWELLYN D. DENSMORE1

The African Dwarf Crocodile (Osteolaemus) has been a long-standing problem for crocodilian systematists. Previously divided into separate genera, present forms are currently recognized as two subspecies within the single named species, 0. tetraspis. We sequenced a 350 bp region of mitochondrial DNA in an attempt to elucidate the relationships within one of these forms, 0. t. tetraspis. Results indicate at least two distinct and well-supported groups with nucleotide sequence divergence levels comparable to those found between species of other crocodilians. These data lay the groundwork for a comprehensive systematic and population study of the genus. Key words: Osteolaemus, Crocodylia, mtDNA, systematics.

INTRODUCTION number of Osteolaemus tetraspis populations in Liberia has dropped significantly in recent and crocodilians represent the only BIRDS years (Kofron 1992). To complicate matters, extant descendants of the ancient group the taxonomic status of forms currently placed known as Archosaurs. Modern crocodilians in the genus has been a source of dis- first appeared about 80 million years ago and agreement among crocodilian systematists radiated into over 125 genera. Of those, only since the early 20th century. eight survive in the present day. These genera are commonly grouped into three families, The genus is identified today as consisting the Alligatoridae, the Crocodylidae, and the of a single species and two subspecies - Gavialidae. The taxonomy and phylogenetics 0. t. tetraspis and 0. t. osborni (Brazaitis 1973). of many of these groups have been well Unfortunately, no unequivocal 0. t. osborni are studied (Poe 1996; Brochu 1997). However, known to exist in collections in the United with the exception of the American alligator States and, at the time samples were collected A. mississibbiensis verv little work on crocodilian for this study, permits allowing the import 11 , population genetics has been done. This of bIood were not in our possession. We deficit is currently being remedied by a number were, therefore, forced to limit this study to of surveys of several members of genus 0. t. tetraspis. However, as revealed by several Crocodylus (C. acutus, C. rhombt$e;fel; C. moreletti, previous molecular analyses also involving C. johnstoni and C. porosus). Studies of several members of this subspecies (Densmore and species of caiman have also been proposed. Owen 1989; Densmore and White 1991), substantial intraspecific genetic variation The genus Osteolaemus, to which the dwarf African crocodile belongs, is generally appears to be the ~le.In a more recent study considered the sister taxon to the genus (White and Densmore, unpubl. data) based on sequence analysis of the ND6-tRNAgIu-Cyt b Crocodylus. Dwarf crocodiles are classified as region of crocodilian mtDNA, considerable endangered and virtually nothing is known nucleotide divergence (0.098) was noted about the status of wild populations across between two individuals of 0.t. tetraspis. their range (Fig. 1) (Kofron and Steiner 1994). The animals are used for food and the As an extension to the findings of White hides utilized by native people for some and Densmore (unpubl. data), the same 350 products (Ross 1998), but the effects of base pair region of mitochondrial DNA was hunting pressure on dwarf crocodile numbers sequenced for 10 individuals of 0. t. tetraspis is unknown. Deforestation may also be taking as well as for a single individual of Crocodylus a toll. One study has suggested that the rhombifer. This region was chosen because there

'Department of Biological Sciences. Texas Tech University, Lubbock. TX 79409 USA. 'Life Sciences Division, Los Namos National Laboratory. Los Namos. NM 87545 USA. 'Cullen Vivarium. P.O. Box 878. Milwaukee. WI 52301 USA. Pages 58-69 in CROCODILIAN BIOLOGY AND EVOLUTION ed by Gordon C. Crigg. Frank Seebacher and Craig E. Franklin. Surrey Beatiy & Sons. Chipping Norton. 2000. RAY ET AL.: GENETIC VARIABILITY IN WEST AFRICAN DWARF CROCODILES 5 9

Total DNA was isolated from the blood samples using the SDS-Urea method of White et al. (1998). MtDNA regions including a portion of ND6, the entire tRNAg'" gene, and a portion of cyt b were amplified using two rounds of PCR. The first round yielded a product of -2000 bp. A smaller fragment, -350 bp, was then amplified in the second round using the larger fragment as a template. In either case, a master mix containing 500pl ddH20, lOOpl 10 mM dNTP mix, 90p1 10X Tag buffer (Fisher), and 100 p1 25 mM MgC12 solution (Fisher) was made. To a 0.5 mi PCR reaction tube were added 48p1 of the master mix, 4 p1 of template (7-10pM) DNA, and 3.0 pl of a 20 pM mixture of primers (Table 1). Taq polymerase (2.5 units) was added directly to the reaction vessel just before spinning down the contents in a microcentrifuge. For both first and second round ampli- Fig. I. Geographic range of Osteolaemus tetraspis (Ross fication reactions, samples were overlain with 1998). mineral oil, followed by an initial denaturation step at 94°C for three minutes. First round appears to be sufficient sequence variability amplification was performed using the follow- among crocodilian species to be sensitive ing cycle parameters: 94°C for 1 min., 50°C enough for population level studies, while the for 1 min., and 72°C for 90 sec.; 35 cycles. conserved regions are suitable for outgroup The smaller size of the second round product comparison (White and Densmore, unpubl. and a desire to decrease reaction time and data). As stated earlier, no 0. t. osborni were increase primer fidelity prompted the follow- available for analysis. However, if large ing changes to cycle parameters for the amounts of nucleotide sequence variation exist second amplification: 94°C for 15 sec., 53°C within the subspecies examined, we can likely for 30 sec., and 72°C for 50 sec.; 35 cycles. assume that larger, more significant differences A Perkin Elmer-Cetus DNA thermal cycler probably exist between the two currently (Branchburg, New Jersey) was used for both recognized forms. sets of reactions. Amplification was verified on 0.8% agarose gels, after which first and MATERIALS AND METHODS second round products were purified using the Qiagen (Santa Clarita, California) gel Blood from 10 individuals of 0. t. tetraspis was collected in acid citrate dextrose-B purification protocol. (ACD-B) (Densmore and White 1991) at the Upon isolation of the -350 bp products, Cullen Vivarium (Y4, Y 10, Y 11, Y 13, Y16, automated sequencing was performed using Y19, Y20), the St. Augustine Alligator Farm an ABI PRISM Model 310 and Amplitaq (FT), and from the collection of Bruce DNA polymerase FS (Perkin Elmer) at the Schwedick (1A and 2A). Animals Y10 and core laboratory of the Texas Tech Institute Y19 are known to have been collected in the of Biochemistry. The primary sequencing wild from Gabon. Unfortunately, the original primers were ND6L and CytB2Hint (Table 1). collection locales for the remaining Osteolaemw All sequences were aligned using ClustalW samples are not known. One blood sample (Thompson et al. 1994) with manual adjust- from C. rhombifer was obtained from the St ments. We included known DNA sequence of Augustine Alligator Farm. A. mississippiensis from White 1992; White and

Table 1. Primer sequences for first and second round amplification reactions (courtesy of White and Densmore (unpubl. data)). 1st Round Primers Primer sequence' CB2H 5'-CCCTCAGAATGATATITGTCCTCA-3' ND5L2 5'-GCCCTACTNCAYTCNAGCACAATAGT-3' 2nd Round Primers CBPHint 5'-TTTCATCATGCNGARATGTTKGATGGGGY KGRAGGTG3' NDGL 5'-TATTTRGGNGGNATGSTGGTNGTNTITG-3' ' Degenerate base codes: R = A,G; Y = C,T; S = C,G; W = A,T; K = G,T; M = A,C; H = A,C.T, B = C,G,T; V = A,C,G; D = A,G,T; N = A,C,G,T - ~- GKOCODILIAN BIOLOGY AND EVOLUTION

Densmore (submitted) for use as an additional Nei (1984) in order to allow comparisons with outgroup taxon. PAUP* v. 4.0bl (Swofford genetic distances calculated for sequence data 1998) was used to generate genetic distances from the same region from other crocodilians for phenogram construction and to perform studied by White 1992; White and Densmore parsimony analyses for estimating phylogeny. (submitted). Pairwise genetic distances from this analysis are presented in Table 2. Using RESULTS the Tajima-Nei distance matrix, a neighbour- joining analysis was performed yielding one Using the NDGL primer, we were able to tree (Fig. 2). consistently produce sequences that were clear and repeatable; other sequencing primers In addition, a maximum parsimony (phylogenetic) analysis was performed. Of the 297 proved less reliable. Aligned DNA sequences total characters, 36 were determined to be are presented in the appendix. phylogenetically informative. An exhaustive The aligned sequences were used to estimate search was performed and 17 equally several of the measures of genetic distance parsimonious trees (score = 123) resulted. A available through PAUP (Tajima-Nei, Jukes- strict consensus phylogram of these produced Cantor, Kimura 3-parameter, and Tamura- one unresolved polytomy. Bootstrap analysis Nei). All produced similar distance matrices. with 1 000 replications produced a single tree We chose to use the algorithm of Tajima and with the same topology (Fig. 3).

Table 2. Genetic distance matrix for all sequences. Distances were calculated using the algorithm of Tajima and Nei (1984). All OTU's are 0. t. tetraspis except AM (Alligator mississippiensis) and CR (Crocodyks rhombifer).

YlO Y19 FT Y13 1 A Y4 Y11 Y16 Y20 2A CR AM Y10 - Y19 0.00342 - FT 0.01039 0.00686 - Y13 0.08278 0.07779 0.07873 - 1A 0.08278 0.07779 0.07873 0 - Y4 0.09891 0.0938 0.0947 0.01389 0.01389 - Y11 0.0989 0.09385 0.09475 0.01387 0.01387 0.02097 - Y16 0.09481 0.0898 0.09067 0.01037 0.01037 0.02093 0.0209 - Y20 0.08662 0.08163 0.08255 0.00344 0.00344 0.0139 0.01389 0.0069 - 2A 0.08579 0.08184 0.08186 0.00343 0.00343 0.01734 0.01734 0.01381 0.00687 - CR 0.24245 0.23653 0.23674 0.23674 0.23674 0.24598 0.24683 0.23636 0.23182 0.23123 - AM 0.32285 0.31613 0.30214 0.30214 0.30214 0.3139 0.31028 0.30881 0.30229 0.29542 0.30297 -

Fig. 2 (below left). Neighbour-joining phylogram of relationships calculated from distance data. Branch lengths are indicative of relative amounts of evolutionary change. All terminal OTU's are 0. t. tetraspis except AM (Alligator mississippiensis) and CR (Crocodylus rhombifer). r .... IY19 Fig. 3 (right). Strict consensus dadogram of 17 equally parsimonious trees based on unweighted character analysis of 297 characters from the amplified 100 region. Numbers at nodes correspond to the percentage of 1000 bootstrap FT replicates supporting that node. All terminal OTU's are 0. t. tetraspis except AM (Alligator mississippiensis) and CR (Crocodylus rltombifcr).

100 H 0.01 RAY ET AL.: GENETIC VARIABILITY IN WE= AFRICAN DWARF CROCODILES 6 1

Osteolaemus tetraspis invariably formed a any current subspecies to species status, but monophyletic grouping. In all of the the data presented here suggest that the genus parsimony analyses and in the Neighbour- Osteolaemus requires much greater attention Joining tree, three individuals, FT, Y10 and than it has received to date. Y19, were placed on a branch together, The data presented here will serve as a separate from the other members of the basis for broadening our study of the dwarf ingroup (Figs 2 and 3). All other sequences crocodile. The goal first will be to resolve the were placed on a separate branch with several taxonomic confusion surrounding the species equally parsimonious subgroups. However, a (whether there are one, two, or three). The number of patterns are evident. taxonomy of the dwarf crocodiles has been Individuals 1A and Y 13 had .identical in flux for over 60 years. When first described sequences and therefore grouped together in by Schmidt (1919), 0. t. osborni was, in fact, all analyses. Specimens Y4 and Y11 formed placed in a separate genus, Osteoblepharon. a clade in all trees as did Y16 and Y20. This genus was discarded after examination of Individual 2A was isolated on most (12) of skulls by Werner (1933) and Mertens (1943). the trees but was joined with Y13 and 1A Both authors suggested that the two forms in the others. However, none of the above should be considered distinct species within nodes was supported by a bootstrap value the genus Osteolaemus, and this view was greater than 50%, resulting in the somewhat upheld by Inger (1948). This classification unresolved consensus tree shown (Fig. 3). remained in place until Wermuth (1953) Note, however, the sharp and strongly recognized the two forms as subspecies, supported division between the branch formed 0. t. tetraspis and 0. t. osborni. There is still by samples m, Y10, and Y19 and all other not complete agreement among crocodilian 0. t. tetraspis sequences. systematists and this group of crocodiles is in need of further study to determine the DISCUSSION taxonomic standing of its members. Nucleotide variation within Osteolaemus tetraspis Our second goal will be to gather baseline tetraspis is considerable with a tendency toward data on the population genetics of dwarf specific subgroups most likely representing crocodiles. The species and populations within different geographic localities. The individuals Osteolaemus may be the least understood of all coded as Y10 and Y 19 were collected in Gabon, the crocodilians. The most recent edition of which occupies much of the southern range of the Status Survey and Conservation Plan for 0. t. tetraspis. In all analyses, these two individ- Crocodiles published by IUCN/SSC Crocodile uals, along with FT, form a clade separate Specialist Group (Ross 1998) lists Osteolaemus from the other, presumably more northern or and C. cato$hractus (the African slender- western, forms. Bootstrap support for this snouted crocodile) as the only two crocodilians division is very strong (100%; see Fig. 3). with "extremely poor" quantitative population survey data. According to this document, there Tnbh 3. Genetic distances between selected crocodilians. Distances listed are determined by the method of is currently insufficient data to adequately Tajima and Nei (1984). Cross species comparisons determine the status of the dwarf crocodile in from White 1992; White and Densmore (submitted). any part of its range. Crocodylus acutus vs. Cz intermedius 0.074 The first step will be to survey populations ! Cr. cataphractus vs. Osteolaemus tetraspis 0.179 in an effort to determine what population Cr. johnstmi vs. Cz niloticus 0.094 Cr. substructure exists and to elucidate the proper mindoremis vs. Cr nouaeguineae 0.064 taxonomic status of the organism. *A compre- / Caiman crocodilus crocodilus vs. Ca. c. fim 0.007 1 lbmktoma schlegelii vs. Caviulis gangeticus 0.22 1 hensive population study is being initiated Average value of the two Gabon 0.087 across most of the range with blood samples individuals + FT vs. all other being collected from Senegal eastward to / 0. t. tetrasbis in study Gabon, the Congo, and the Democratic The average genetic distance between these Republic of Congo. For the first time, we will be able to include representatives of both three individuals versus the other 0. t. tetraspis currently recognized subspecies. represented in the study (0.087) is at least comparable to that found between universally Once this information has been collected, recognized species in other crocodilian genera we should have a better picture of both the (Table 3). However, based on morphology taxonomic and ecological status of these alone, all of the individuals whose DNA was animals. The effects of hunting and deforest- sequenced in this study represent members ation can be better assessed. With additional of one subspecies, 0. t. tetraspis, regardless data, the implementation of species survival of their respective origins. Further study is plans for these animals should be enhanced. clearly warranted before we consider elevating Reproductive studies of the dwarf African UL LKULUUILIAN BIOLOGY AND EVOLUTION

crocodile have shown that captive breeding ACKNOWLEDGEMENTS is probably possible (Kofron and Steiner We would like to thank the following 1994). Successful programmes implemented to enhance recruitment and allow management individuals and organizations for contributing samples to this study: Bruce Schwedick, the of natural populations, such as those involving Miami Zoo, the Memphis Zoo, and the St the American alligator Uoanen and McNease 1987), often profit from molecular data. Augustine Alligator Farm. Steve Reichling from the Memphis Zoo and Bruce Schwedick In conclusion, this preliminary study of Reptile Discovery Programmes were reveals substantial levels of sequence variation extremely helpful in our attempts to collect within 0. t. tetraspis. Considering that a second locality data. Thanks also go out to Jennifer "subspecies" is recognized and has yet to Dever, Jeff Wickliffe, and Rhonda Ray for be examined, it is likely that the current their comments on earlier drafts. This work taxonomic standing is in need of revision. was partially supported by funds provided to Our proposed survey of dwarf crocodile D.A.R., P.S.W., and L.D.D. by the Depart- populations should not only aid in providing ment of Biology at Texas Tech University data to elucidate the relationships among the and by the Clark Foundation Scholarship various taxa, but should also contribute to (H.V.D). Additional support was provided by the ultimate survival of this endangered and the National Science Foundation to L.D.D poorly studied animal. (BSR-8607420). APPENDIX Aligned sequence data for 297 characters ranging from ND6L through tRNAdu to cyt b. All OTU's are 0. t. telraspis except AM (Alligator mississippiensis) and CR (Crocodylw rhombifer).

...... A ...... A ...... A..T..T...... C..... A...... A...... A..T ..T ...... C. ....A...... A...... A ..T..T...... C .....A...... A...... A..T..T...... C.. ... A...... A ...... A..T ..T...... C.. ...A...... A...... A ..T..T...... C ..... A...... A...... A ..T..T..C...... C .....A. T ..TGC...G ..A.A .....C...... G....-.CA.....G.C.....T..C..C..T.....C...C..... A...... C ...... G.A..CAACTA ...... T.....T.....GG..A...... TA-.T.AA.TTGCC...... TC.TCG...A..C.A..-..C.. A.

...... G ..G...... CC...... A...... C...... A..G...... -...... G ..G...... CC...... A...... C...... A..G ...... G ..G...... C.....CC...... A...... C.G...... A..G...... -...... G ..G...... CC...... A...... C...... A..G...... G ..G...... CC...... A...... C...... T...... A..G...... G ..G...... CC ...... A...... C...... A..G...... G ..G...... CC...... A ...... C...... A..G...... -...... G ...... G..A...... A..C.C..C....C.- ..G...... G. ...T ...... A. ..CT.T.....C...... ---...C ..CG. .AA...... A...... T....CC..C-...... A....GA..T.T-.....A...CT.T...... -......

TCAACAATTAGm-TGATCCACCAACTACT~TCCAACCCGCT-ATTAAAATTGATA~TAATTCCCTAATTGACCTCCCAACCCCATCAAA ...... A ...... G....;...... -A. ....A...... G...... T ....-A..TT.A...... G...... CA...... C...... A...... T ....-A..TT.A...... G...... CA...... C...... A...... T ....-A. .TT. A...... G...... CA...... C...... A...... G...A...... T....-A..TT.A...... T ...... G...... CA ...... C...... A...... G..A.....C...... T. ...-A ..TT. A...... G...... CA...... C...... A...... CG...... T....-A..TT.A ...... G...... CA ...... C ...... A...... C...... T.. A ..TT. A...... G...... CA...... C...... A...... -....-...A..C ..A..GC...... G...... C ....A...C...... C.AG....CC.C..TT...... CT.....CT--- ....C...... G ...... C....AA.C...... -C.C.. C CC.--...------RAY ET AL: GENETIC VARIABILITY IN WEST AFRICAN DWARF CROCODILES . 63

REFERENCES Poe, S., 1996. Data set incongruence and the phylogeny of the crocodilians. Syst. Biol. 45: 393-414. Brazaitis, P., 1973. The identification of living ng Crocodilians. Zoologica 59: 59-88. Ross, J. P. (ed), 1998. Crocodiles. Status Survey and ng Conservation Action Plan. 2nd Edition. IUCNISSC he Brochu, C. A., 1997. Morphology, fossils, divergence Crocodile Specialist Group. IUCN: Gland, St timing and the phylogenetic relationships of Switzerland and Cambridge, UK. viii+96 Pp. Gavialis. Syst. Biol. 46(3): 479-52 1. "g Schmidt, K. P., 1919. Contributions to the herpetology .ck Densmore, L. D. and Owen, R. D., 1989. Molecular of the Belgian Congo based on the collection of the :re systematics of the Order Crocodilia. Arne?: Zool. American Museum Congo Expedition, 1905-1915. 29: 831-41. :ct Part I. Turtles, crocodiles, lizards and chameleons. ;er Densmore, L. D. and White, P. S., 1991. The systematics Bull. Amex Mus. Nut. Hist. 39: 385-624. :or and evolution of the Crocodylia as suggested by Swofford, D. L., 1998. PAUP (Phylogenetic Analysis restriction endonuclease anaylsis of mitochondria1 Using Parsimony), version 4.01b. ~rk and nuclear ribosomal DNA. Copeia 1991(3): to 602-15. Tajima, F. and Nei, M., 1984. Estimation of evolutionary rt- distances between nucleotide sequences. Mol. Biol. Hurchzermeyer, F. and Penrith, M., 1995. Geographical Evol. 1: 269-85. ity races of the Dwarf Crocodile? CTOC.Special. Group lip News1 12(2): 4. Thompson, J. D., Higgins, D. G. and Gibson, T. J., 1994. ClustalW: improving the sensitivity of progressive by Inger, R. F., 1948. The systematic status of Osteoblepharon 1.D multiple sequence alignment through sequence osborni. Copeia 1948(1): 15-19. weighting, positions-specific gap penalties and Joanen, T. and McNease. L., 1987. The management weight matrix choice. Nucl. Acids Res. 22: 4673480. of alligators in Louisiana. Pp. 33-42 in Wildlife Management: Crocodiles and Alligators ed by G. J. Wermuth, H., 1953. Systematik der Rezenten Krokodile. Mitteil. Zoo1.-Mus. Berlin 28(2): 375-5 14. W. Webb, S. C. Manolis and P. J. Whitehead. Surrey Beatty & Sons: Chipping Norton. White, P. S., 1992. Relationships of Extant Crocodylia as Kofron, C. P., 1992. Status and habitats of the Inferred by Sequence Analysis of Mitochondria1 three African crocodiles in Liberia. J. Trop. Ecol. DNA. Ph.D. diss. Texas Tech University, Lubbock, 8: 265-73. TX, USA (Diss. Abstra. 93-12533). White. P. S., Tatum. 0. L., Tegelstrom. H. and Densmore, ~~f~~,P. and steiner, c., 1994. observations on the African Dwarf Crocodile, Osseolaemw letraspis. Cop& L. D. 111. 1998. Mitochondria1 DNA Isolation, 1994(2): 533-35. separation, and detection of fragments. Pp. 65-102 in Molecular Genetic Analysis of Populations: A Mertens, R., 1943. Die rezenten Krokodile des Natur- Practical Approach ed by A. R. Hoelzel. Oxford Museums Senkenberg. Senkenbergiana 26: 252-3 12. University Press: New York.