DOCSLIB.ORG

Cholera Toxin Production Induced Upon Anaerobic Respiration Is

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Cholera Toxin Production Induced Upon Anaerobic Respiration Is J. Microbiol. Biotechnol. (2016), 26(3), 627–636 http://dx.doi.org/10.4014/jmb.1512.12039 Research Article Review jmb Cholera Toxin Production Induced upon Anaerobic Respiration is Suppressed by Glucose Fermentation in Vibrio cholerae Young Taek Oh1, Kang-Mu Lee1, Wasimul Bari1,2, Hwa Young Kim1,2, Hye Jin Kim1,2, and Sang Sun Yoon1,2,3* 1Department of Microbiology and Immunology, 2Brain Korea PLUS Project for Medical Science, and 3Institute for Immunology and Immunological Diseases, Yonsei University College of Medicine, Seoul 03722, Republic of Korea Received: December 15, 2015 Revised: December 28, 2015 The causative agent of pandemic cholera, Vibrio cholerae, infects the anaerobic environment of Accepted: December 30, 2015 the human intestine. Production of cholera toxin (CT), a major virulence factor of V. cholerae, is highly induced during anaerobic respiration with trimethylamine N-oxide (TMAO) as an alternative electron acceptor. However, the molecular mechanism of TMAO-stimulated CT First published online production is not fully understood. Herein, we reveal that CT production during anaerobic December 31, 2015 TMAO respiration is affected by glucose fermentation. When the seventh pandemic V. cholerae *Corresponding author O1 strain N16961 was grown with TMAO and additional glucose, CT production was Phone: +82-2-2228-1824; markedly reduced. Furthermore, an N16961 ∆crp mutant, devoid of cyclic AMP receptor Fax: +82-2-392-7088; protein (CRP), was defective in CT production during growth by anaerobic TMAO respiration, E-mail: [email protected] further suggesting a role of glucose metabolism in regulating TMAO-mediated CT production. TMAO reductase activity was noticeably decreased when grown together with glucose or by mutation of the crp gene. A CRP binding region was identified in the promoter region of the torD gene, which encodes a structural subunit of the TMAO reductase. Gel shift assays further confirmed the binding of purified CRP to the torD promoter sequence. Together, our results suggest that the bacterial ability to respire using TMAO is controlled by CRP, whose activity is dependent on glucose availability. Our results reveal a novel mechanism for the regulation of pISSN 1017-7825, eISSN 1738-8872 major virulence factor production by V. cholerae under anaerobic growth conditions. Copyright© 2016 by The Korean Society for Microbiology Keywords: Vibrio cholerae, cholera toxin, anaerobic respiration, glucose metabolism and Biotechnology Introduction pilus (TCP). CT provokes watery diarrhea by the generation of ion transport imbalance across the intestinal epithelium, For enteric pathogenic bacteria, physiological changes and the type IV TCP contributes to intestinal colonization are essential to maintain viability and pathogenicity by [19, 41]. Expression of both genes is regulated by a variety adapting to various host environments, including nutrient of factors that are able to respond to environmental signals. fluctuation and oxygen limitation [28, 36]. Vibrio cholerae, An AraC-type master transcription factor, ToxT, which is the causative agent of the pandemic disease cholera, is a regulated by the membrane-associated proteins ToxR and facultative anaerobic pathogenic bacterium [7, 16]. Although TcpP/TcpH, directly activates transcription of the ctxAB the pathogenesis caused by this deadly bacterium takes genes (encoding CT) and the genes for TCP biogenensis [4, place in the intestine, which is commonly thought to be an 5, 9, 24, 25, 38]. In addition, the activation of tcpP/H (genes anaerobic environment, the mechanism of virulence gene encoding TcpP and TcpH, respectively) expression requires expression under anaerobic conditions is not fully two transcriptional activators, AphA and AphB [3, 17]. understood. However, regulation of the ToxT regulon that mediates CT The ability of V. cholerae to colonize and cause disease in production was defined using strains grown in AKI media, the host requires the production of virulence factors during an in vitro culture condition known to be permissive for CT infection, including cholera toxin (CT) and toxin coregulated production [15]. Several studies demonstrated that AphB, A 2016 ⎪ Vol. 26⎪ No. 0 628 Oh et al. the key transcriptional activator of the tcpP gene, activates conditions has not yet been explored. virulence gene expression through anaerobiosis-induced In this study, we revealed that the utilization of TMAO in dimerization and activity [18, 22]. In addition, a previous anaerobic respiration, which stimulates CT production, is study showed that the production of three colonization repressed by glucose fermentation. This work is an factors (TcpC, TcpQ, and TcpS) and accessory colonization extension of our previous study and describes a regulation factor A (AcfA) is induced under anaerobiosis [23]. mechanism for the production of CT under anaerobic Together, these results suggest that oxygen limitation may conditions. This report provides evidence that the production be the key to regulating pathogenic processes of V. cholerae of CT, an important virulence factor, is critically controlled during host intestinal infection. by anaerobiosis-induced glucose metabolism. Recently, we reported that CT production is substantially enhanced by anaerobic respiration using trimethylamine Materials and Methods N-oxide (TMAO) as an alternative electron acceptor, and it is mediated by the accumulation of guanosine Bacterial Strains and Growth Conditions pentatetraphosphate (termed (p)ppGpp), also known as a All bacterial strains and plasmids used in this study are listed in bacterial stress alarmone [21, 34]. Meanwhile, our recent Table 1. Bacterial cultures were grown at 37°C in lysogeny broth report demonstrated that (p)ppGpp confers a growth and medium (LB; 1% tryptone, 0.5% yeast extract, and 1% NaCl per survival advantage through acetoin fermentation, a known liter), and antibiotics were used in the following concentrations; ampicillin, 100 µg/ml; streptomycin, 200 µg/ml; and kanamycin, V. cholerae strategy to avoid fatal acidification of the growth 50 µg/ml. To support anaerobic growth, 50 mM TMAO (Sigma environment in glucose-enriched environments [33, 43]. Up Aldrich Co., St. Louis, MO, USA) was added to the medium (termed to 70-80% of cholera patients recover by treatment with LBT). The effect of glucose was assessed using cells grown in LB or the continuous administration of oral rehydration solution LBT containing 1% glucose (termed LBG and LBTG, respectively). (ORS). Because a large amount of glucose is present in An overnight culture of bacterial cells was subcultured at a 1/100 ORS, it is speculated that continuous administration of dilution in fresh medium and grown at 37°C in an anaerobic ORS may create glucose-enriched microenvironments in chamber. Bacterial growth was monitored spectrophotometrically the human intestine [6, 10, 35, 37]. Subsequently, the growth by measuring the optimal density at 600 nm, and the pH of the and virulence of V. cholerae may be influenced by glucose culture media was monitored using a pH meter. metabolism under anaerobic conditions. Therefore, we predicted that the (p)ppGpp-mediated CT production and Transposon Mutagenesis and Dot Blot Assay growth advantage are diminished by glucose in the human Construction of a transposon insertion mutant library was performed following previously described procedures [21]. N16961- intestine. Until now, the relationship between glucose derived mutants were grown in 96-well plates anaerobically in metabolism and virulence regulation under anaerobic LBT. After overnight growth, culture supernatants from each well Table 1. Bacterial strains and plasmids used in this study. Strains or plasmids Relevant characteristics Ref. or source V. cholerae strains N16961 Wild type, O1 serogroup, El Tor biotype Lab. collection C6706 Wild type, O1 serogroup, El Tor biotype Lab. collection O395 Wild type, O1 serogroup, classical biotype Lab. collection crp::Tn N16961, Tn inserted in coding region of VC2614 gene This study ∆crp N16961, crp gene deleted This study E. coli strains r + SM10/λpir Km thi-1 thr leu tonA lacY supE recA::RP4–2-Tc::Mu pir , for conjugal transfer Lab. collection BW20767 Km::Tn7 leu-63::IS10 recA1 creC510 hsdR17 endA1 zbf-5 uidA(∆Mlu1)::pir+thi Lab. collection BL21b supE44 DlacU169 (f80lacZ DM15) hsdR17 recA1 endA1 gyrA96 thi-1 relA1 Lab. collection Plasmids pCVD442 sacB suicide vector from plasmid pUM24 [21] pBTK30 Transposon insertion vector, Gmr [26] J. Microbiol. Biotechnol. CT Production is Repressed by Glucose Metabolism 629 Table 2. Primers used in this study. Gene name Direction Primer sequence (5’-3’)a Restriction sites Cloning crp (His-tag) Forward ACCTTCATATGGTTCTAGGTAAACCTCAAACC NdeI Reverse TAGAGCTCGAGGCGAGTGCCGTAAACCACGATG ZhoI crp left (in-frame deletion) Forward CTCTAGAGCTCGCGTGTTCCTACGGTCGATA SacI crp left (in-frame deletion) Reverse TGGAAGGATCCTGGATCGGTTTGAGGTTTACC BamHI crp right (in-frame deletion) Forward CTCTAGGATCCGTGGTTTACGGCACTCGCTA BamHI crp right (in-frame deletion) Reverse TGGAAGAGCTCCAAGCATTAGCCAGTGAGGC SacI Arbitrary PCR BTK30-Tnp1, 1 round Forward CACCGCTGCGTTCGGTCAAG RP-1, 1 round Reverse CTTACCAGGCCACGCGTCGACTAGTACNNNNNNNNNNGATAT RP-2, 1 round Reverse CTTACCAGGCCACGCGTCGACTAGTACNNNNNNNNNNACGCC BTK30-Tnp2, 2 rounds Forward CGAACCGAACAGGCCTTATGTTCAATTC RP-3, 2 rounds Reverse CTTACCAGGCCACGCGTCGACTAGTAC BTK30-Tnp3 Sequencing TGGTGCTGACCCCGGATGAAG aRestriction enzyme recognition sequences are underlined. were spotted on a nitrocellulose membrane
Load more

Recommended publications
  • Study of the Dynamics of Catabolite Repression : from Mathematical Models to Experimental Data Valentin Zulkower
    Study of the dynamics of catabolite repression : from mathematical models to experimental data Valentin Zulkower To cite this version: Valentin Zulkower. Study of the dynamics of catabolite repression : from mathematical models to experimental data. Modeling and Simulation. Université Grenoble Alpes, 2015. English. NNT : 2015GREAM080. tel-01679345 HAL Id: tel-01679345 https://tel.archives-ouvertes.fr/tel-01679345 Submitted on 9 Jan 2018 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. THÈSE Pour obtenir le grade de = DOCTEUR DE L’UNIVERSITÉ DE GRENOBLE Spécialité : Mathématiques appliquées Arrêté ministérial : 7 aout 2006 Présentée par Valentin Zulkower Thèse dirigée par Hidde de Jong et codirigée par Johannes Geiselmann et Delphine Ropers préparée au sein de l’Equipe-projet IBIS, INRIA Grenoble-Rhône-Alpes et de l’Ecole doctorale Mathematiques, Science et Technologies de l’Information, Informatique (MSTII) Etude de la dynamique des mécanismes de la répression catabolique Des modèles mathématiques aux données expérimentales Thèse soutenue publiquement le 3 mars 2015, devant le jury composé de : Pr. Julio Rodriguez Banga Professeur, CSIC, Vigo (Espagne), Rapporteur Dr. Stefan Klumpp Chercheur, Institut Max Planck, Potsdam (Allemagne), Rapporteur Dr. Olivier Martin Directeur de Recherche, INRA - UMR de Génétique Végétale , Président Dr.
    [Show full text]
  • Transcriptional Units
    Proc. Natl. Acad. Sci. USA Vol. 76, No. 7, pp. 3194-3197, July 1979 Biochemistry Cyclic AMP as a modulator of polarity in polycistronic transcriptional units (positive regulation/rho factor/lactose and galactose operons/catabolite repression) AGNES ULLMANNt, EVELYNE JOSEPHt, AND ANTOINE DANCHINt tUnite de Biochimie Cellulaire, Institut Pasteur, 75724 Paris Cedex 15, France; and tInstitut de Biologie Physico-Chimique, 75005 Paris, France Communicated by Frangois Jacob, April 16, 1979 ABSTRACT The degree of natural polarity in the lactose scribed by Watekam et al. (7, 8) in sonicated bacterial extracts. and galactose operons of Escherichia coli is affected by aden- One unit is the amount of enzyme that converts 1 nmol of osine 3',5'-cyclic monophosphate (cAMP). This effect, mediated substrate per min at 280C (except for UDPGal epimerase, for by the cAMP receptor protein, is exerted at sites distinct from the promoter. Experiments performed with a mutant bearing which the assay temperature was 220C). a thermosensitive rho factor activity indicate that cAMP relieves Reagents and Enzymes. They were obtained from the fol- polarity by interfering with transcription termination. Con- lowing companies: trimethoprim from Calbiochem; all radio- flicting results in the literature concerning the role of cAMP active products from Amersham; isopropyl-f3-D-thiogalactoside receptor protein and cAMP in galactose operon expression can (IPTG), D-fucose, cAMP, UDPglucose dehydrogenase, and all be reconciled by the finding that cAMP stimulates the expres- substrates from Sigma; and all other chemicals from Merck. sion of operator distal genes without significantly affecting the proximal genes. Therefore, it appears necessary to reevaluate the classification o(the galactose operon as exhibiting cAMP- RESULTS mediated catabolite repression at the level of transcription Natural Polarity in Lactose Operon.
    [Show full text]
  • The Lactose Operon from Lactobacillus Casei Is Involved in the Transport
    www.nature.com/scientificreports OPEN The lactose operon from Lactobacillus casei is involved in the transport and metabolism of the Received: 4 October 2017 Accepted: 26 April 2018 human milk oligosaccharide core-2 Published: xx xx xxxx N-acetyllactosamine Gonzalo N. Bidart1, Jesús Rodríguez-Díaz 2, Gaspar Pérez-Martínez1 & María J. Yebra1 The lactose operon (lacTEGF) from Lactobacillus casei strain BL23 has been previously studied. The lacT gene codes for a transcriptional antiterminator, lacE and lacF for the lactose-specifc phosphoenolpyruvate: phosphotransferase system (PTSLac) EIICB and EIIA domains, respectively, and lacG for the phospho-β-galactosidase. In this work, we have shown that L. casei is able to metabolize N-acetyllactosamine (LacNAc), a disaccharide present at human milk and intestinal mucosa. The mutant strains BL153 (lacE) and BL155 (lacF) were defective in LacNAc utilization, indicating that the EIICB and EIIA of the PTSLac are involved in the uptake of LacNAc in addition to lactose. Inactivation of lacG abolishes the growth of L. casei in both disaccharides and analysis of LacG activity showed a high selectivity toward phosphorylated compounds, suggesting that LacG is necessary for the hydrolysis of the intracellular phosphorylated lactose and LacNAc. L. casei (lacAB) strain defcient in galactose-6P isomerase showed a growth rate in lactose (0.0293 ± 0.0014 h−1) and in LacNAc (0.0307 ± 0.0009 h−1) signifcantly lower than the wild-type (0.1010 ± 0.0006 h−1 and 0.0522 ± 0.0005 h−1, respectively), indicating that their galactose moiety is catabolized through the tagatose-6P pathway. Transcriptional analysis showed induction levels of the lac genes ranged from 130 to 320–fold in LacNAc and from 100 to 200–fold in lactose, compared to cells growing in glucose.
    [Show full text]
  • Gene Expression Prokaryotes
    Gene Expression Prokaryotes Chapters 19, Genes X 1 • In negative regulation, a repressor protein binds to an operator to prevent a gene from being expressed. • In positive regulation, a transcription factor is required to bind at the promoter in order to enable RNA polymerase to initiate transcription. A repressor stops RNA polymerase from Transcription factors enable RNA polymerase to bind to the initiating promoter Regula(on of Transcrip(on in prokaryotes is a complex and mul(-(ered phenomenon. 3 4 5 6 The lac Operon Has a Second Layer of Control: Catabolite Repression A small molecule inducer, cAMP, converts an activator protein, CRP, to a form that binds the promoter and assists RNA polymerase in initiating transcription. 7 lacZ promoter -loss of consensus: opMmal expression NOT maximal expression – -35 -10 • T82 T84 G78 A65 C54 a45 <--- 17 bp ----> T80 A95 T45 A60 a50 T96 8 lacZ promoter -loss of consensus: opMmal expression NOT maximal expression – -35 -10 • T82 T84 G78 A65 C54 a45 <--- 17 bp ----> T80 A95 T45 A60 a50 T96 9 Promoter Efficiencies Can Be Increased or Decreased by Mutation • Down mutations tend to decrease promoter efficiency, usually decrease conformance to the preferred interactions with the “consensus sequences”, whereas up mutations have the opposite effect. • Mutations in the –35 sequence tend to affect initial binding of RNA polymerase holoenzyme. • Mutations in the –10 sequence tend to affect binding of the holoenzyme or the melting reaction that converts one of the closed complexes to an open complex. Regula(on of Transcrip(on in prokaryotes is a complex and mul(-(ered phenomenon.
    [Show full text]
  • Obligate Anaerobes Catabolic Pathway
    Obligate Anaerobes Catabolic Pathway andUnpaying twin-screw. Ely flecks: Chancroid he upstage Jedediah his aunts magnetises acromial tardily. and overall. Canopic Carlos bellies very unprofitably while Jeromy remains tellurous Metabolism may operate under utvikling, obligate anaerobes depend on the following is usually after carbohydrates, benzene biodegradation of defenses Pseudomonas are all oxidase positive. Alternatively, depending on the availability of oxygen. The oxidative removal of lactic acid. The form molecules in organic or anaerobe must be embedded in rat mitochondria in vitro level; this purpose is. Bacteria The Role Of Bacteria In Fermentation Acid Beer Pasteur. Journal of Bone and Joint Surgery. Compare enzyme between catabolic pathways for anaerobes is produced. The obligate aerobes: we use organic compound utilization of obligate anaerobes catabolic pathway. Rabs to anaerobic catabolism of obligate anaerobe. Metabolism of Anaerobic and Aerobic or Facultative bacteria. This pathway begins catabolism pathways are anaerobic bacteria to reference to alcohol or in this pathway requires energy processing in all broth or not. Incorporation of oxygen from water into toluene and benzene during anaerobic fermentative transformation. Obligate anaerobe must be happy to ethyl alcohol fermentation when purified mononuclear enzymes. Catabolic pathways and anaerobic catabolism of anaerobes, where they need for other hand function is. Structure of anaerobic processs involved in a ligases involved in your identity on earth, and commonly used. Obligate anaerobes, the Holmes established that glucose is the precursor of lactate in the brain and that under aerobic conditions, positive for VP. Adding handles to shield the necessary to produce transmembrane trafficking of oxygen atoms are facultative or obligate anaerobes catabolic pathway to the potential activity was already well as the hydrogen is.
    [Show full text]
  • Two Models of Catabolite Repression Signal Transduction
    An Investigation of Two Models of Signal Transduction During Catabolite Repression Catabolite repression describes the phenomenon where certain carbon sources in bacterial growth media lead to a reduction of transcription of sensitive operons. In Escherichia coli, the best understood example of catabolite repression involves the lac operon. E. coli will not express the lac operon if glucose is present in the growth media. This is true whether or not lactose is present in the media. Other operons in E. coli are also repressed by glucose including the arabinose operon and the maltose operon. Although glucose is the most studied carbon source capable of catabolite repression in E. coli, it is not the only one capable of triggering repression of these operons. Sucrose, Fructose and other related carbon molecules can also trigger catabolite repression to varying levels. Klug and Cummings includes a discussion of the "classic cAMP" model for catabolite repression. In this model glucose acts by inhibiting the activity of adenylate cyclase. This leads to a drop in cAMP concentrations. At lower concentrations, the cAMP is not available to bind to the catabolite activator protein (CAP). CAP in the absence of cAMP losses affinity for the Cap Binding Site doesn't bind the lac operon. In the absence of CAP binding, the promoter is unable to recruit RNA polymerase to initiate transcription. Therefore, the lac operon is not transcribed in the presence of Glucose. Alternatively, in the absence of glucose, the adenylate cyclase is not inhibited and actively produces cAMP. The cAMP binds to CAP causing it to shift to a conformation with affinity to the Cap Binding Site.
    [Show full text]
  • Is E Coli Obligate Anaerobe
    Is E Coli Obligate Anaerobe Irvin is congruently topped after self-imposed Rutger drills his little bad. Permeably unflavoured, Judson mosh washers and federalises currier. Dystrophic Gershon wives her sprite so impeccably that Cristopher compete very senselessly. In normal habitat landscapes can grow or orally penetrate well into account for metabolism is e coli obligate anaerobe of obligate anaerobic infections indolent course of research projects under aerobic respiration. Lipid metabolism of gut microflora in medical research projects under limited to detect trends in hepatic pathogenesis. Anaerobic bacteria will usually a frame with head of aromatic compounds on the naphthoquinone ring on comparative endocrinology of redox carriers and is e coli obligate anaerobe of oxygen only a, steiner d periods. These infections caused by keeping food is e coli obligate anaerobe, represent a demand videos. Keep in the illness is obtained in food helps ensure that is e coli obligate anaerobe of two nadh and neck, the instructor will make the less inhalation of humans consuming. They have good although several references in children in a large number of aflatoxin damage is e coli obligate anaerobe, several days to assess the concentration. Molecular targets of oxygen? The natural mixed infections can also formulated to recognize that are classified into the developments in granular sludge inside of scientific advisors on their own eu reverse charge method. In food or a, but also showed that resist heat treatment is a university faculty of treatment in contrast, a hazard even harder to produce a diarrheal illness. In the field is only a maximal upper respiratory tract, abscesses or by food equipment is required as indian infants and dehydration that it.
    [Show full text]
  • Downloaded from the Ribosomal Database Project Website [22], and Aligned Using MUSCLE [23]
    Diversity 2013, 5, 627-640; doi:10.3390/d5030627 OPEN ACCESS diversity ISSN 1424-2818 www.mdpi.com/journal/diversity Article Untangling the Genetic Basis of Fibrolytic Specialization by Lachnospiraceae and Ruminococcaceae in Diverse Gut Communities Amy Biddle 1, Lucy Stewart 1, Jeffrey Blanchard 2 and Susan Leschine 3,* 1 Department of Microbiology, University of Massachusetts, Amherst, MA 01003, USA; E-Mails: [email protected] (A.B.); [email protected] (L.S.) 2 Department of Biology, University of Massachusetts, Amherst, MA 01003, USA; E-Mail: [email protected] 3 Department of Veterinary and Animal Sciences, University of Massachusetts, Amherst, MA 01003, USA * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +1-413-545-0673; Fax: +1-413-545-6326. Received: 17 May 2013; in revised form: 21 June 2013 / Accepted: 26 June 2013 / Published: 9 August 2013 Abstract: The Lachnospiraceae and Ruminococcaceae are two of the most abundant families from the order Clostridiales found in the mammalian gut environment, and have been associated with the maintenance of gut health. While they are both diverse groups, they share a common role as active plant degraders. By comparing the genomes of the Lachnospiraceae and Ruminococcaceae with the Clostridiaceae, a more commonly free-living group, we identify key carbohydrate-active enzymes, sugar transport mechanisms, and metabolic pathways that distinguish these two commensal groups as specialists for the degradation of complex plant material. Keywords: Clostridiales; Ruminococcaceae; Lachnospiraceae; carbohydrate-active enzymes; comparative genomics; plant degradation Diversity 2013, 5 628 1. Introduction 1.1. Taxonomic Revision of the Clostridiales Is a Work in Progress Classically, the genus Clostridium was described as comprising spore-forming, non-sulfate reducing obligate anaerobic bacteria with a gram-positive cell wall.
    [Show full text]
  • DU Msc Microbiology
    DU MSc Microbiology Topic:‐ MICRO MSC S2 1) The virus which was used in the Hershey‐Chase experiment to prove that DNA is the genetic material, belong to the genus: [Question ID = 3392] 1. T1 virus [Option ID = 13562] 2. T2 virus [Option ID = 13563] 3. T3 virus [Option ID = 13564] 4. T4 virus [Option ID = 13565] Correct Answer :‐ T4 virus [Option ID = 13565] 2) High partition coefficient during the liquid‐liquid extraction process for product recovery implicates: [Question ID = 3393] 1. Difficulty in the extraction process [Option ID = 13566] 2. Higher product degradation [Option ID = 13567] 3. No effect on the extraction process [Option ID = 13568] 4. Ease of extraction [Option ID = 13569] Correct Answer :‐ Ease of extraction [Option ID = 13569] 3) Numerical aperture of an oil immersion objective lens is around: [Question ID = 3394] 1. 0.65 [Option ID = 13570] 2. 0.85 [Option ID = 13571] 3. 1.33 [Option ID = 13572] 4. 1.03 [Option ID = 13573] Correct Answer :‐ 1.33 [Option ID = 13572] 4) Which one of the following statements is incorrect? [Question ID = 3395] 1. RNA polymerase III uses internal promoters located within the transcription unit [Option ID = 13574] 2. RNA polymerase II synthesizes mRNAs [Option ID = 13575] 3. RNA polymerase I synthesizes tRNAs [Option ID = 13576] 4. RNA polymerase III synthesizes small RNAs [Option ID = 13577] Correct Answer :‐ RNA polymerase I synthesizes tRNAs [Option ID = 13576] 5) An icosahedron structure of virus particle is made of: [Question ID = 3396] 1. 20 vertices, 12 edges, 30 faces [Option ID = 13578] 2. 20 edges, 12 faces, 30 vertices [Option ID = 13579] 3.
    [Show full text]
  • Carbon Catabolite Repression and Global Control of The
    Carbon Catabolite Repression and Global Control ofth e Carbohydrate Metabolism in Lactococcus lactis Evert J. Luesink Promotor: dr.W.M .d eVo s hoogleraar ind emicrobiologi e Co-promotor: dr. O.P. Kuipers sectieleider Microbial Ingredients, NIZO,Ed e Carbon Catabolite Repression andGloba l Control ofth eCarbohydrat e Metabolism in Lactococcus lactis EvertJ . Luesink Proefschrift terverkrijgin gva nd egraa dva ndocto r opgeza gva nd erecto rmagnificu s vand e LandbouwuniversiteitWageningen , dr.CM .Karssen , inhe topenbaa r teverdedige n opmaanda g 14decembe r199 8 des namiddagst e 13.30uu ri nd eAula . Everythingshould be made assimple aspossible, butnot simpler. Albert Einstein. AanIs a Aanmij nouder s ISBN90-5485-931- 8 Omslag: I.Lalande-Luesin k Druk:Ponse n& Looije nBV , Wageningen. BIBLIOTHEEK LANDBOUWUNIVERSITEIT WAGENINGEN -M.ZVi? Stellingen 1 Ye en cowerker s gaan in hunexperimente n ten onrechte uitva nd e afwezigheid van HPr moleculenterwij l enzyme I,da t inee n grote ondermaat ten opzichte vanHP r aanwezig is,veronderstel d wordt in mime hoeveelheden aanwezig te zijn. Ye,J .J. ,J . Reizer,an dM .H .Saie rJr . 1994.Regulatio no f2-deoxyglucos ephosphat eaccumulatio n inLactococcus lactis vesicle sb ymetabolite-activated ,ATP-dependen tphosphorylatio no fserine-4 6i n HPro fth ephosphotransferas e system.Microbiolog y 140:3421-3429 Kohlbrecher, D., R. Eiserman,an dW .Hengstenberg . 1992.Staphylococca l phosphoenolpyruvate- dependent phosphotransferase system: molecular cloning and nucleotide sequence of the Staphylococcuscarnosus ptsl gene :expressio nan dcomplementatio nstudie so fth eproduct . J. Bacterid.174:2208-2214 . 2 Hetobservere n van cAMP-afhankelijke kataboliet repressie inGram-positiev e bacterien berustwaarschijnlij k eerder opee ngedege n literatuurkennis van de wetenschapper dan opee ndaadwerkelij k bestaand fenomeen.
    [Show full text]
  • Omph Gene Expression Is Regulated by Multiple Environmental Cues in Addition to High Pressure in the Deep-Sea Bacterium Photobacterium Species Strain SS9
    JOURNAL OF BACTERIOLOGY, Feb. 1995, p. 1008–1016 Vol. 177, No. 4 0021-9193/95/$04.0010 Copyright q 1995, American Society for Microbiology ompH Gene Expression Is Regulated by Multiple Environmental Cues in Addition to High Pressure in the Deep-Sea Bacterium Photobacterium Species Strain SS9 DOUGLAS H. BARTLETT* AND TIMOTHY J. WELCH Center for Marine Biomedicine and Biotechnology, Scripps Institution of Oceanography, University of California, San Diego, La Jolla, California 92093-0202 Received 21 July 1994/Accepted 8 December 1994 Photobacterium species strain SS9 is a moderately barophilic (pressure-loving) deep-sea bacterial species which induces the expression of the ompH gene in response to elevated pressure. Here we demonstrate that at 1 atm (1 atm 5 1.01325 3 105 Pa), ompH expression increases with cell density in 2216 marine medium batch culture and is subject to catabolite repression and that OmpH synthesis is inducible by energy (carbon) starvation. Regulatory mutants which are impaired in ompH gene expression at high pressure are also impaired in cell density regulation of ompH gene expression, indicating that the two inducing conditions overlap in their signal transduction pathways. The same promoter was activated by high cell density at 1 atm of pressure as well as during low-cell-density growth at 272 atm. Catabolite repression of ompH gene expression was induced by a variety of carbon sources, and this repression could be partially reversed in most cases by the addition of cyclic AMP (cAMP). Surprisingly, glucose repression of ompH transcription occurred only at 1 atm, not at 272 atm, despite the fact that catabolite repression was operational in SS9 under both conditions.
    [Show full text]
  • Combined Effect of Loss of the Caa3 Oxidase and Crp Regulation Drives Shewanella to Thrive in Redox-Stratified Environments
    The ISME Journal (2013) 7, 1752–1763 & 2013 International Society for Microbial Ecology All rights reserved 1751-7362/13 www.nature.com/ismej ORIGINAL ARTICLE Combined effect of loss of the caa3 oxidase and Crp regulation drives Shewanella to thrive in redox-stratified environments Guangqi Zhou, Jianhua Yin, Haijiang Chen, Yijie Hua, Linlin Sun and Haichun Gao Institute of Microbiology and College of Life Sciences, Zhejiang University, Hangzhou, Zhejiang, China Shewanella species are a group of facultative Gram-negative microorganisms with remarkable respiration abilities that allow the use of a diverse array of terminal electron acceptors (EA). Like most bacteria, S. oneidensis possesses multiple terminal oxidases, including two heme-copper oxidases (caa3- and cbb3-type) and a bd-type quinol oxidase. As aerobic respiration is energetically favored, mechanisms underlying the fact that these microorganisms thrive in redox-stratified environments remain vastly unexplored. In this work, we discovered that the cbb3-type oxidase is the predominant system for respiration of oxygen (O2), especially when O2 is abundant. Under microaerobic conditions, the bd-type quinol oxidase has a significant role in addition to the cbb3- type oxidase. In contrast, multiple lines of evidence suggest that under test conditions the caa3-type oxidase, an analog to the mitochondrial enzyme, has no physiological significance, likely because of its extremely low expression. In addition, expression of both cbb3- and bd-type oxidases is under direct control of Crp (cAMP receptor protein) but not the well-established redox regulator Fnr (fumarate nitrate regulator) of canonical systems typified in Escherichia coli. These data, collectively, suggest that adaptation of S.
    [Show full text]