A Potential Respiratory Syncytial Virus (RSV) Infection

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Respiratory Syncytial Virus (RSV) Infection Induces Cyclooxygenase 2: A Potential Target for RSV Therapy This information is current as Joann Y. Richardson, Martin G. Ottolini, Lioubov Pletneva, of September 27, 2021. Marina Boukhvalova, Shuling Zhang, Stefanie N. Vogel, Gregory A. Prince and Jorge C. G. Blanco J Immunol 2005; 174:4356-4364; ; doi: 10.4049/jimmunol.174.7.4356 http://www.jimmunol.org/content/174/7/4356 Downloaded from References This article cites 70 articles, 27 of which you can access for free at: http://www.jimmunol.org/content/174/7/4356.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 27, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2005 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Respiratory Syncytial Virus (RSV) Infection Induces Cyclooxygenase 2: A Potential Target for RSV Therapy1 Joann Y. Richardson,* Martin G. Ottolini,* Lioubov Pletneva,§ Marina Boukhvalova,§ Shuling Zhang,† Stefanie N. Vogel,‡ Gregory A. Prince,§ and Jorge C. G. Blanco2§ Cyclooxygenases (COXs) are rate-limiting enzymes that initiate the conversion of arachidonic acid to prostanoids. COX-2 is the inducible isoform that is up-regulated by proinflammatory agents, initiating many prostanoid-mediated pathological aspects of inflammation. The roles of cyclooxygenases and their products, PGs, have not been evaluated during respiratory syncytial virus (RSV) infection. In this study we demonstrate that COX-2 is induced by RSV infection of human lung alveolar epithelial cells with the concomitant production of PGs. COX-2 induction was dependent on the dose of virus and the time postinfection. PG pro- duction was inhibited preferentially by NS-398, a COX-2-specific inhibitor, and indomethacin, a pan-COX inhibitor, but not by SC-560, a COX-1-specific inhibitor. In vivo, COX-2 mRNA expression and protein production were strongly induced in the lungs Downloaded from and cells derived from bronchioalveolar lavage of cotton rats infected with RSV. The pattern of COX-2 expression in vivo in lungs is cyclical, with a final peak on day 5 that correlates with maximal histopathology. Treatment of cotton rats with indomethacin significantly mitigated lung histopathology produced by RSV. The studies described in this study provide the first evidence that COX-2 is a potential therapeutic target in RSV-induced disease. The Journal of Immunology, 2005, 174: 4356–4364. 3 espiratory syncytial virus (RSV) is the leading viral 10). Many inflammatory mediators induced in the lung by RSV are http://www.jimmunol.org/ cause of death in children under 1 year of age and is an effective inducers of the cyclooxygenase 2 (COX-2) in lung epithelial R increasing cause of morbidity and mortality in transplant and inflammatory cells (11–15). The expressions of COX-2 and its patients and the elderly (1–3). RSV causes upper and lower respi- products, PGs and thromboxanes (TBx), have been correlated with ratory tract infections, occasionally leading to severe bronchiolitis the development of many inflammatory processes (16, 17), some of and pneumonia. In addition, RSV bronchiolitis has been associated which occur during viral infection (e.g., regulatory effects on the with the development of recurrent episodes of bronchiolar obstruc- immune response, vascular tone, platelets aggregation, airway remod- tion, specific IgE production, and establishment of asthma (4–6). eling, allergic processes, etc.). Moreover, RSV induces the production It is unclear why children, the elderly, and the immunosuppressed of PGE2 in cultures of human monocytes and dendritic cells (18). The are at much higher risk for severe disease; however, an RSV- potent physiologic effects of PGs and TBx and their possible role in by guest on September 27, 2021 induced immune pathological mechanism has long been suspected. RSV infection suggest that these mediators should be considered as Yet there is no safe and effective vaccine against RSV. Passive potential important factors in the RSV disease process. The animal anti-RSV Ab, although effective in prophylactic settings, does not model of choice for RSV studies is the cotton rat (Sigmodon hispidus), provide any clinically beneficial outcome when applied therapeu- because it most closely resembles disease in humans (19). Preclinical tically, indicating that RSV-induced pathology is primarily the re- data from cotton rats have resulted in a successful prophylactic sult of the inflammatory response to infection, rather than a direct approach in humans (20–24). viral effect. Therefore, a combined antiviral and anti-inflammatory In this work we present data demonstrating the induction of therapy might represent the most safe and efficient treatment COX-2 expression during RSV infection in vitro, in human lung against RSV infection. alveolar epithelial cells and cotton rat macrophages, and in vivo, in During RSV infection, proinflammatory cytokines and chemo- the lungs of cotton rats infected with RSV. We present additional kines are detectable in isolates from bronchioalveolar lavage evidence that indicates the potential of nonsteroidal anti- (BAL) fluids of patients with lower respiratory tract infection (7– inflammatory drugs in the treatment of RSV-induced bronchiolitis. Materials and Methods Departments of *Pediatrics and †Microbiology and Immunology, Uniformed Services Animals ‡ University of the Health Sciences, Bethesda, MD 20814; Department of Microbiol- Inbred cotton rats (S. hispidus) were obtained from a colony maintained at ogy and Immunology, University of Maryland, Baltimore, MD 21201; and §Virion Systems, Rockville, MD 20850 Virion Systems. Cotton rats were housed in large polycarbonate rat cages with a bedding of pine shavings (Harlan Teklad) and were fed a diet of Received for publication October 9, 2003. Accepted for publication January 20, 2005. rodent chow and water. The cotton rat colony was monitored for Abs to The costs of publication of this article were defrayed in part by the payment of page paramyxoviruses, RSV, and rodent viruses; no such Abs were found. The charges. This article must therefore be hereby marked advertisement in accordance animals used for infection experiments were, on the average, 8–12 wk old with 18 U.S.C. Section 1734 solely to indicate this fact. and weighed 100 g at the time they were used. All animal experimentation 1 This work was supported by National Institutes of Health Grants RR13161-03 (to procedures were performed following National Institutes of Health and G.A.P.) and RO1AI057575-01 (to J.C.G.B. and S.N.V.). U.S. Department of Agriculture guidelines with institutional animal care 2 Address correspondence and reprint requests to Dr. Jorge C. G. Blanco, Virion and use committee approval. Systems, 9610 Medical Center Drive, Suite 100, Rockville, MD 20850. E-mail ad- Virus and tissue culture cells dress: [email protected] 3 Abbreviations used in this paper: RSV, respiratory syncytial virus; BAL, bronchoal- The Long strain (group A) of RSV was obtained from American Type veolar lavage; COX-2, cyclooxygenase 2; LT, leukotriene; m.o.i., multiplicity of in- Culture Collection. Virus stocks were prepared in HEp-2 cells and con- fection; rh, recombinant human; TBx, thromboxane. tained 1 ϫ 107.5 PFU/ml. Viral titers in stocks and lung homogenates were Copyright © 2005 by The American Association of Immunologists, Inc. 0022-1767/05/$02.00 The Journal of Immunology 4357 determined by plaque assay on HEp-2 cells (19). A549 cells were obtained the RSV F protein gene was amplified using the following primers: forward from American Type Culture Collection and were grown in DMEM sup- primer, AATCCTCAAAGCAAATGCAATTACC; and reverse primer, AT- plemented with 2 mM L-glutamine, 100 IU/ml penicillin, 100 ␮g/ml strep- GGCTCCTAGAGATGTGATAACGGAGC, using 32 (macrophages) or 25 tomycin, and 10% FBS in a humidified 37°C incubator with 5% CO2. For (A549 cells) amplification cycles and 55°C for the annealing temperature. The RSV infection, cells were seeded in a six-well plate at a density of 4 ϫ 105 product of the reaction (a 1.2-kb band) was visualized by direct ethidium cells/well 1 day before infection. The cells were generally 70–80% con- bromide staining of agarose gel after electrophoresis. fluent on the day after seeding. Purified stocks of RSV were diluted in DMEM to yield multiplicities of infection (m.o.i.) of 1, 0.5, and 0.1. The COX-2 Western blot and immunoprecipitation medium was removed from the cells and replaced with medium containing virus dilutions for 1 h, then replaced with complete DMEM. Uninfected A549 cells were homogenized in lysis buffer containing 20 mM Tris-HCl HEp-2 cell culture supernatant served as the control (mock inoculum). (pH 8), 100 mM NaCl, 1% Nonidet P-40, 4 mM DTT, 0.5 mM PMSF, 7.5 Cells were harvested at various times postinfection, and the supernatants mM sodium fluoride, 2 mM EDTA, and a mixture of protease inhibitors were stored at Ϫ70°C for quantification of PGE by ELISA (Cayman (Complete; Roche). Cell lysates were normalized by protein concentration, 2 ␮ Chemicals). For inhibition experiments of COX enzymes in A549 cells, and 40 g/lane was subjected to electrophoresis in 10% SDS-PAGE gels. infected cells were incubated with different concentrations of indomethacin Western blot analysis was used to detect COX-2 protein using a polyclonal (in saline), Indocin, a pan-COX inhibitor (Merck); NS-398 (in DMSO), a rabbit Ab (catalogue no.
Recommended publications
  • Fgf8b Oncogene Mediates Proliferation and Invasion of Epstein–Barr Virus-Associated Nasopharyngeal Carcinoma Cells: Implication for Viral-Mediated Fgf8b Upregulation

    Fgf8b Oncogene Mediates Proliferation and Invasion of Epstein–Barr Virus-Associated Nasopharyngeal Carcinoma Cells: Implication for Viral-Mediated Fgf8b Upregulation

    Oncogene (2011) 30, 1518–1530 & 2011 Macmillan Publishers Limited All rights reserved 0950-9232/11 www.nature.com/onc ORIGINAL ARTICLE FGF8b oncogene mediates proliferation and invasion of Epstein–Barr virus-associated nasopharyngeal carcinoma cells: implication for viral-mediated FGF8b upregulation VWY Lui1,7, DM-S Yau1,7, CS-F Cheung1, SCC Wong1, AK-C Chan2, Q Zhou1, EY-L Wong1, CPY Lau1, EKY Lam1, EP Hui1, B Hong1, CWC Hui1, AS-K Chan1, PKS Ng3, Y-K Ng4, K-W Lo5, CM Tsang6, SKW Tsui3, S-W Tsao6 and ATC Chan1 1State Key Laboratory of Oncology in South China, Sir YK Pao Center for Cancer, Department of Clinical Oncology, Chinese University of Hong Kong, Hong Kong; 2Department of Pathology, Queen Elizabeth Hospital, Hong Kong; 3School of Biomedical Sciences, Chinese University of Hong Kong, Hong Kong; 4Department of Surgery, Chinese University of Hong Kong, Hong Kong; 5Department of Anatomical and Cellular Pathology, Chinese University of Hong Kong, Hong Kong and 6Department of Anatomy, University of Hong Kong, Hong Kong The fibroblast growth factor 8b (FGF8b) oncogene is identified LMP1 as the first viral oncogene capable of known to be primarily involved in the tumorigenesis and directly inducing FGF8b (an important cellular oncogene) progression of hormone-related cancers. Its role in other expression in human cancer cells. This novel mechanism of epithelial cancers has not been investigated, except for viral-mediated FGF8 upregulation may implicate a new esophageal cancer, in which FGF8b overexpression was role of oncoviruses in human carcinogenesis. mainly found in tumor biopsies of male patients. These Oncogene (2011) 30, 1518–1530; doi:10.1038/onc.2010.529; observations were consistent with previous findings in published online 29 November 2010 these cancer types that the male sex-hormone androgen is responsible for FGF8b expression.
  • Short-Term E Cacy Comparison Between Helical Tomotherapy and Intensity-Modulated Radiotherapy in Patients with Locally Advanced

    Short-Term E Cacy Comparison Between Helical Tomotherapy and Intensity-Modulated Radiotherapy in Patients with Locally Advanced

    Short-term ecacy comparison between helical tomotherapy and intensity-modulated radiotherapy in patients with locally advanced nasopharyngeal carcinoma Zhen Cui ( [email protected] ) Aliated Hospital of Bengbu Medical College Jia Liu Aliated Hospital of Bengbu Medical College Qiaoyu Sun Aliated hospital of Bengbu medical college Chaoge Wang Aliated Hospital of Bengbu Medical College Meifang Fang Aliated Hospital of Bengbu Medical College Zelai He Aliated Hospital of Bengbu Medical College Duojie Li Aliated Hospital of Bengbu Medical College Hao Jiang Aliated Hospital of Bengbu Medical College Research article Keywords: Nasopharyngeal carcinoma, helical tomotherapy, intensity-modulated radiotherapy, Dosimetry analysis, Adverse events Posted Date: April 9th, 2020 DOI: https://doi.org/10.21203/rs.3.rs-21288/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/14 Abstract Background: To evaluate short-term safety and ecacy of helical tomotherapy (HT) versus intensity- modulated radiotherapy (IMRT) in patients with nasopharyngeal carcinoma (NPC). Methods: Retrospective analysis of locally advanced nasopharyngeal carcinoma treated with radiotherapy and concurrent platinum based neoadjuvant chemotherapy (cisplatin 80 mg/m2 every 3 weeks for 1 cycle) in our hospital from February 2017 to October 2019, including 70 patients in HT group and 70 in IMRT group. The target area of the tumor was delineated by magnetic resonance (MRI) imaging. The prescription doses delivered to the gross tumor volume (pGTVnx) and positive lymph nodes (pGTVnd), the high risk planning target volume (PTV1), and the low risk planning target volume (PTV2), were 69.96 Gy, 66-70 Gy, 60 Gy and 50-54 Gy, in 33 fractions, respectively.
  • Primary Nasopharyngeal Kaposi Sarcoma As Index Diagnosis of AIDS in a Previously Healthy Man

    Primary Nasopharyngeal Kaposi Sarcoma As Index Diagnosis of AIDS in a Previously Healthy Man

    Head and Neck Pathology (2019) 13:664–667 https://doi.org/10.1007/s12105-018-0954-y SINE QUA NON CLINICOPATHOLOGIC CORRELATION Primary Nasopharyngeal Kaposi Sarcoma as Index Diagnosis of AIDS in a Previously Healthy Man Gwyneth S. T. Soon1 · Fredrik Petersson1 · Mark K. T. Thong2 · Char Loo Tan1,3 Received: 12 July 2018 / Accepted: 18 July 2018 / Published online: 23 July 2018 © Springer Science+Business Media, LLC, part of Springer Nature 2018 Abstract A 38-year-old, previously healthy man presented with blood-stained saliva and epistaxis. A 3 mm nasopharyngeal lesion was found. A biopsy was performed and microscopic examination revealed a Kaposi sarcoma. The patient was subsequently found to be positive for human immunodeficiency virus (HIV). The diagnosis of Kaposi sarcoma in the presence of HIV infection advanced his disease to Acquired Immunodeficiency Syndrome (AIDS). Primary manifestation of Kaposi sarcoma in the nasopharynx is extremely rare. The histologic differential diagnosis of Kaposi sarcoma in this unusual site, especially without the clinical history of immunosuppression, is broad. Awareness that nasopharynx can be a primary involvement site of Kaposi sarcoma and serves as index diagnosis of AIDS is important given its serious clinical implication. Keywords Kaposi sarcoma · Nasopharynx · Nasal cavity · AIDS · HIV · HHV8 History Diagnosis A 38-year-old Asian male with no significant medical his- Histology of the left postnasal space mass biopsy showed tory presented with episodes of blood-stained saliva and pieces of upper respiratory tract-type mucosa with a cellu- epistaxis, associated with bilateral cervical swelling of 1–2 lar tumor in the subepithelial stroma, composed of fascicles months’ duration.
  • CD4‑Positive Lymphoepithelial‑Like Carcinoma: Report of Unusual Case

    CD4‑Positive Lymphoepithelial‑Like Carcinoma: Report of Unusual Case

    Published online: 2021-08-12 CASE REPORT CD4‑positive lymphoepithelial‑like carcinoma: Report of unusual case Luaay Aziz, Raya Saab1, Toufic Eid2, Mousa A. Al‑Abbadi3 Department of Ent and Head and Neck Surgery, Healthpoint Hospital, Abu Dhabi, United Arab Emirates, Departments of 1Pediatrics and Adolescent Medicine and 2Radiation Oncology, American University of Beirut, Beirut, Lebanon, 3Department of Pathology and Laboratory Medicine, Sheikh Khalifa Medical City, Abu Dhabi, United Arab Emirates Access this article online ABSTRACT Website: www.avicennajmed.com DOI: 10.4103/ajm.AJM_135_17 We are reporting an unusual case of lymphoepithelial‑like carcinoma (LELC) in an 8‑year‑old Quick Response Code: female patient where the tumor cells showed unusual CD4 expression. The lesion was found in the left submandibular neck region, in the vicinity of the submandibular gland. The salivary gland was not infiltrated by the tumor, and the tumor exhibited a classic LELC with single and clusters of tumor cells surrounded by many hematolymphoid cells. The tumor cells revealed strong positivity for Epstein–Bar virus as confirmed by the EBER: Epstein‑Barr Virus in situ hybridization (EBER‑ISH) method of staining. Interestingly, the tumor cells expressed membranous immunostaining for the T‑helper lymphocyte antibody (CD4) in addition to pan‑cytokeratin. A brief discussion about this unusual finding is offered. The patient was treated as a case of Epstein–Bar virus‑associated nasopharyngeal carcinoma with excellent response. Key words: CD4, Epstein–Bar virus, lymphoepithelial‑like carcinoma, nasopharyngeal carcinoma INTRODUCTION After obtaining the appropriate internal review board approvals and patient family consent, we present extremely Masses and swelling in the head and neck are common unusual case of lymph node enlargement in the left side presentation in children as well as adults.
  • Oral Diseases Associated with Human Herpes Viruses: Aetiology, Clinical Features, Diagnosis and Management

    Oral Diseases Associated with Human Herpes Viruses: Aetiology, Clinical Features, Diagnosis and Management

    www.sada.co.za / SADJ Vol 71 No. 6 CLINICAL REVIEW < 253 Oral diseases associated with human herpes viruses: aetiology, clinical features, diagnosis and management SADJ July 2016, Vol 71 no 6 p253 - p259 R Ballyram1, NH Wood2, RAG Khammissa3, J Lemmer4, L Feller5 ABSTRACT Human herpesviruses (HHVs) are very prevalent DNA ACRONYMS viruses that can cause a variety of orofacial diseases. EM: erythema multiforme Typically they are highly infectious, are contracted early in HHV: human herpes virus life, and following primary infection, usually persist in a latent form. Primary oral infections are often subclinical, but may PCR: polymerase chain reaction be symptomatic as in the case of herpes simplex virus- HSV, HHV-1: herpes simplex virus induced primary herpetic gingivostomatitis. Reactivation VZV, HHV-3: varicella-zoster virus of the latent forms may result in various conditions: herpes EBV, HHV-4: Epstein-Barr virus simplex virus (HSV) can cause recurrent herpetic orolabial CMV, HHV-5: cytomegalovirus lesions; varicella zoster virus (VZV) can cause herpes zoster; Epstein-Barr virus (EBV) can cause oral hairy Key words: herpes simplex virus, human herpes virus-8, leukoplakia; and reactivation of HHV-8 can cause Kaposi varicella zoster virus, Epstein-Barr virus, recurrent herpes sarcoma. In immunocompromised subjects, infections labialis, recurrent intraoral herpetic ulcers, treatment, val- with human herpesviruses are more extensive and aciclovir, aciclovir, famcicylovir. severe than in immunocompetent subjects. HSV and VZV infections are treated with nucleoside analogues aciclovir, valaciclovir, famciclovir and penciclovir. These agents INTRODucTION have few side effects and are effective when started The human herpesvirus (HHV) family comprises a diverse early in the course of the disease.
  • Cancer Patients Have a Higher Risk Regarding COVID-19–And Vice Versa?

    Cancer Patients Have a Higher Risk Regarding COVID-19–And Vice Versa?

    pharmaceuticals Opinion Cancer Patients Have a Higher Risk Regarding COVID-19–and Vice Versa? Franz Geisslinger, Angelika M. Vollmar and Karin Bartel * Pharmaceutical Biology, Department Pharmacy, Ludwig-Maximilians-University of Munich, 81377 Munich, Germany; [email protected] (F.G.); [email protected] (A.M.V.) * Correspondence: [email protected] Received: 29 May 2020; Accepted: 3 July 2020; Published: 6 July 2020 Abstract: The world is currently suffering from a pandemic which has claimed the lives of over 230,000 people to date. The responsible virus is called severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) and causes the coronavirus disease 2019 (COVID-19), which is mainly characterized by fever, cough and shortness of breath. In severe cases, the disease can lead to respiratory distress syndrome and septic shock, which are mostly fatal for the patient. The severity of disease progression was hypothesized to be related to an overshooting immune response and was correlated with age and comorbidities, including cancer. A lot of research has lately been focused on the pathogenesis and acute consequences of COVID-19. However, the possibility of long-term consequences caused by viral infections which has been shown for other viruses are not to be neglected. In this regard, this opinion discusses the interplay of SARS-CoV-2 infection and cancer with special focus on the inflammatory immune response and tissue damage caused by infection. We summarize the available literature on COVID-19 suggesting an increased risk for severe disease progression in cancer patients, and we discuss the possibility that SARS-CoV-2 could contribute to cancer development.
  • Influence of Epstein–Barr Virus and Human Papillomavirus Infection On

    Influence of Epstein–Barr Virus and Human Papillomavirus Infection On

    Feng et al. BMC Cancer (2021) 21:929 https://doi.org/10.1186/s12885-021-08675-x RESEARCH Open Access Influence of Epstein–Barr virus and human papillomavirus infection on macrophage migration inhibitory factor and macrophage polarization in nasopharyngeal carcinoma Guofei Feng1,2†, Yifei Xu1,2,3†, Ning Ma4, Kaoru Midorikawa1, Shinji Oikawa1, Hatasu Kobayashi1, Satoshi Nakamura2, Hajime Ishinaga2, Zhe Zhang3, Guangwu Huang5, Kazuhiko Takeuchi2* and Mariko Murata1* Abstract Background: To assess the effects of Epstein–Barr virus (EBV) and human papillomavirus (HPV) infection on the tumor microenvironment, we examined the relationship between viral infection status, macrophage migration inhibitory factor (MIF), and tumor-associated macrophages in nasopharyngeal carcinoma (NPC). Methods: A tissue microarray containing 150 cores from 90 patients with NPC and six with chronic inflammation was used. EBV and HPV status were detected using in situ hybridization with commercial EBER1 and HPV16/18 probes. Immunofluorescence double staining of MIF, pan-macrophage marker CD68, M1 macrophage marker CD11c, and M2 macrophage marker CD163 were analyzed using the same tissue microarray. The levels of these markers between NPC and inflammation cases and between tumor nests and stroma were compared. Correlations among these markers were analyzed. Results: We found EBER1(+) cases in 90% of NPC patients, including 10% EBV/HPV co-infection. M1 macrophages mainly infiltrated the tumor nest, while M2 macrophages infiltrated the tumor stroma. We found a significant positive correlation between EBER1 levels and MIF levels in tumor nests and a significant positive correlation between HPV16/18 and CD11c(+) cell levels in NPC tissues. Conclusions: It is suggested that MIF is associated with EBV, and M1 macrophage infiltration is affected by HPV status in NPC.
  • A Nasopharyngeal Carcinoma Patient with COVID-19 Infection After Immunotherapy: a Case Report and Literature Review MENGLAN ZHAI and SHENG ZHANG

    A Nasopharyngeal Carcinoma Patient with COVID-19 Infection After Immunotherapy: a Case Report and Literature Review MENGLAN ZHAI and SHENG ZHANG

    in vivo 34 : 3753-3756 (2020) doi:10.21873/invivo.12225 A Nasopharyngeal Carcinoma Patient With COVID-19 Infection After Immunotherapy: A Case Report and Literature Review MENGLAN ZHAI and SHENG ZHANG Cancer Center, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, P.R. China Abstract. Background/Aim: Novel coronavirus infection in a pathway. In addition, less well appreciated is the fact that cancer patient treated with immunotherapy, requires high immune checkpoint pathways also regulate antiviral immune attention. Case Report: Clinical and radiological data were responses and are therefore modulated by a number of obtained from the electronic medical record. Pharynx swab viruses. Up-regulation of PD-1 and its ligands PD-L1 and was tested for severe acute respiratory syndrome coronavirus PD-L2 is observed during acute virus infection. 2 (SARS-CoV-2) RNA by reverse transcription-polymerase Experimental evidence suggests that insufficient signaling chain reaction (RT-PCR). The nasopharyngeal carcinoma through the PD-1 pathway promotes immunopathology patient developed fever on the third day after chemotherapy during acute infection by exaggerating primary T cell and immunotherapy. Laboratory examination showed responses (2). Since December 2019, the novel coronavirus lymphocytopenia. On the sixth day, chest computed infection pandemic has become one of the common threats tomography (CT) images showed bilateral scattered ground- facing the world. Liang et al. (3) reported that cancer glass opacities and reticulation. Pharynx swab was positive patients might have an increased risk of COVID-19 infection for SARS-CoV-2 nucleic acid and the patient was confirmed and a poor prognosis. It was also pointed out that cancer as having Coronavirus Disease 2019 (COVID-19).
  • Cytomorphological Profile of Lymphadenopathy in HIV-Infected Persons

    Cytomorphological Profile of Lymphadenopathy in HIV-Infected Persons

    Available online at www.iponlinejournal.com Journal homepage: www.innovativepublication.com/journal/ijpo Original Research Article Cytomorphological profile of lymphadenopathy in HIV-infected persons Bharat U. Patil1, Anshu2*, Nitin M. Gangane3 1Associate Professor, 2Professor, 3Director-Professor and Dean, Dept. of Pathology, Mahatma Gandhi Institute of Medical Sciences, Sevagram, Maharashtra, India Article Info Abstract Objective: To assess the role of fine needle aspiration cytology (FNAC) and to determine the Received: 16th May, 2019 cytomorphological profile in persons infected with human immunodeficiency virus presenting with lymphadenopathy. Accepted: 11th July, 2019 Materials and Methods: This was a five year (2010-2015) analysis of 54 HIV positive cases who presented with lymphadenopathy. Archival FNAC smears stained with Papanicolaou, Giemsa and Ziehl-Neelsen stains were reviewed for their cytological features. Published Online: 9th August, 2019 Results: Lymph nodes from 54 HIV-positive patients in the age range of 11-61 years were reviewed. The most common FNA diagnosis was tubercular lymphadenitis (n=24). The other Keywords: Lymphadenopathy, Fine diagnoses were: reactive lymphadenitis (n=11), suppurative lymphadenitis (n=6), lymphoma needle aspiration cytology, (n=9), metastases (n=3) and cryptococcal lymphadenitis (n=1). Of the 24 cases of tubercular Tubercular lymphadenitis, Human lymphadenitis, seven showed epithelioid granulomas with Langhan’s giant cells and caseous immunodeficiency virus, Cytology. necrosis. Numerous clusters of epithelioid cells in reactive background were noted in one case which was AFB positive. There were five cases which showed mostly caseous necrotic material with few epithelioid cells. Our study found that three cases showed only presence of acellular caseous necrosis. Caseous necrotic material with few lymphocytes and histiocytes and no epithelioid cells were reported in four cases.
  • Impact of Treatment Delay Due to the Pandemic of COVID-19 on The

    Impact of Treatment Delay Due to the Pandemic of COVID-19 on The

    Chen et al. J Hematol Oncol (2020) 13:174 https://doi.org/10.1186/s13045-020-01019-5 LETTER TO THE EDITOR Open Access Impact of treatment delay due to the pandemic of COVID-19 on the efcacy of immunotherapy in head and neck cancer patients Gaili Chen†, Qiuji Wu†, Huangang Jiang†, Zheng Li, Xinying Hua, Xiaoyan Hu, Haijun Yu, Conghua Xie and Yahua Zhong* Abstract Immunotherapy has been a new standard for recurrent/metastatic head and neck cancers (R/M HNC). One of the prominent characteristics of cancer immunotherapy is the induction of immune memory followed by endured treat- ment response. However, whether and how a treatment delay would impact on the efcacy of immunotherapy has not been well determined. During the outbreak of COVID-19, a number of cancer patients in Wuhan, the epicenter of the pandemic in China, had experienced long-lasting city lockdown and delay of immunotherapies. Here, we retrospectively analyzed 24 HNC patients treated with immune checkpoint inhibitors in our cancer institute prior to the outbreak of COVID-19 who were re-evaluated after the restoration of regular medical care. Of these 24 patients, 10 patients had achieved complete response (CR) or partial response (PR), 12 patients had achieved stable disease (SD), and 2 patients had received just one cycle treatment without efcacy evaluation before treatment delay. The median delay was 3.75 months (range 1.73–8.17 months). Re-evaluation after treatment delay revealed that ten patients (10/10) who achieved CR or PR, two patients (2/2) who received just one cycle treatment without efcacy evaluation and seven patients (7/12) who achieved SD before outbreak of COVID-19 maintained tumor response after treatment delay.
  • Nasopharyngeal Carcinoma (IJNPC) Vol

    Nasopharyngeal Carcinoma (IJNPC) Vol

    International Journal of Nasopharyngeal Carcinoma (IJNPC) Vol. 03, No. 02, June 2021 | 51-53 International Journal of NASOPHARYNGEAL CARCINOMA Journal homepage: https://talenta.usu.ac.id/IJNPC New Role Management Nasopharyngeal Carcinoma Patient in General Hospital Haji Adam Malik Medan during COVID-19 Pandemic Sholahuddin Adlan Simatupang1*, Farhat Farhat1, Elvita Rahmi Daulay2 1Departement of Otorhinolaryngology Head and Neck Surgery, Faculty of Medicine, Universitas Sumatera Utara, Medan, Indonesia 2Departement of Radiology, Faculty of Medicine, Universitas Sumatera Utara, Medan, Indonesia Abstract Article Info Introduction: Nasopharyngeal carcinoma (NPC) is a type of squamous cell carcinoma that develops Article history: from the nasopharyngeal epithelial cells and has become one among the most popular frequent Received: 7th June 2021 malignancy in the head and neck. When patients with cancer are diagnosed with COVID-19, more Received in revised form: 17th June 2021 intense surveillance or treatment should be considered. Accepted: 17th June 2021 Discussion: In the COVID 19 pandemic, Personal protection provisions should be strengthened. created for cancer patients and cancer survivors. To avoid the spread of COVID-19, many improvements have Keywords: been made in the treatment of NPC patients at the Haji Adam Malik General Hospital in Medan. Nasopharyngeal carcinoma, management, Conclusion: The management carried out on NPC patients, there are several examinations that the COVID-19, Adam malik patient needs to do first in the COVID 19 pandemic at the General Hospital Haji Adam Malik Medan. *Corresponding author: Address: Jl. Dr. Mansyur No.5, Padang Bulan, Kec. Medan Baru, Kota Medan, Sumatera Utara 20155, Indonesia e-mail: [email protected] 1. INTRODUCTION The treatment parameters were abstracted and summarized consisting Nasopharyngeal carcinoma (NPC) is a malignancy neoplasm that of use of the rescue operation and the type of surgical approach, the method, occurs in the epithelial layer of the Nasopharynx [1].
  • The Screening of Viral Risk Factors in Tongue and Pharyngolaryngeal Squamous Carcinoma

    The Screening of Viral Risk Factors in Tongue and Pharyngolaryngeal Squamous Carcinoma

    ANTICANCER RESEARCH 30: 1233-1238 (2010) The Screening of Viral Risk Factors in Tongue and Pharyngolaryngeal Squamous Carcinoma YANG ZHENG1, PU XIA2, HUA-CHUAN ZHENG1,2, HIROYUKI TAKAHASHI1, SHINJI MASUDA3 and YASUO TAKANO1 1Department of Diagnostic Pathology, Graduate School of Medicine and Pharmaceutical Science, University of Toyama, Toyama, Japan; 2Department of Biochemistry and Molecular Biology, College of Basic Medicine, China Medical University, Shenyang, P.R. China; 3Division of Pathology, Kouseiren Takaoka Hospital, Takaoka, Japan Abstract. Background: The oral cavity and pharyngolarynx here might play an important role in the carcinogenesis of is readily open to the environment, which provides a good tongue and pharyngolaryngeal squamous carcinomas. atmosphere to viral infection and subsequently links to the local carcinogenesis. The aim of this study is to clarify the The oral cavity and pharyngolarynx is a door for the human viral risk factors for tongue and pharyngolaryngeal squamous body open to the environment. Tonsil is near to these carcinomas and the oncogenic role of DNA viruses. Materials anatomical sites, where lymph nodes are rich. Both provide and Methods: Tongue, pharyngeal and laryngeal carcinomas, a favorable atmosphere for viral infection, which is closely and corresponding non-neoplastic mucosa (NNM) were linked to the local carcinogenesis (1-3). Here, we targeted collected and subjected to microdissection and DNA the viral risk factors of tongue and pharyngolaryngeal extraction with integrity detected by beta-globin polymerase squamous carcinomas, including Epstein-Barr virus (EBV), chain reaction(PCR). Additionally, we examined genomic human papilloma virus (HPV) and John Cunningham virus DNA copies of Epstein-Barr virus (EBV), human papilloma (JCV).